Datasets:

ewhfef

/

mix_cpt

like 1

supraclavicular brachial plexus block is a common regional anesthetic technique used to provide anesthesia and analgesia for upper extremity surgery at our institution . -2 adrenoreceptor agonists have been the focus of interest for their sedative , analgesic , and perioperative sympatholytic and cardiovascular stabilizing effects with reduced anesthetic requirements . clonidine , an imidazoline , -2 adrenoreceptor agonist , has been extensively studied as an adjuvant to local anesthetic in peripheral nerve blocks . dexmedetomidine is also -2 adrenoreceptor agonist and its selectivity to -2 adrenoreceptor is 8 times greater than clonidine . the anesthetic and analgesic requirements get reduced to a huge extent by the use of these two adjuvants because of their analgesic properties and augmentation of local anesthetic effects . the present study was undertaken to compare the efficacy of clonidine and dexmedetomidine as an adjunct to bupivacaine in supraclavicular brachial plexus block in upper extremity surgery for the onset and duration of sensory and motor block and duration of analgesia . after the institutional ethics committee 's approval and written informed consent , this prospective randomized , double - blind study was conducted on sixty patients of american society of anesthesiologists grade i and ii of either sex , aged 2160 years who were scheduled for moderate orthopedic surgeries on the upper limb under supraclavicular brachial plexus block . patients with history of cardiac , respiratory , hepatic and/or renal disorders , and pregnant women were excluded from the study . patients known to be sensitive or allergic to study medications were also excluded from the study . patients not included in the study were those with usual contraindication to brachial plexus block such as clotting disorders , local infections , and patient refusal . details of anesthetic procedure and study protocols were fully explained to patient during preoperative visit . patients in group c ( n = 30 ) received 39 ml of bupivacaine 0.25% with 1 ml ( 1 g / kg ) clonidine and those in group d ( n = 30 ) received 39 ml of bupivacaine 0.25% with 1 ml ( 1 g / kg ) dexmedetomidine in a double - blinded manner . identical syringes containing 1 ml of either clonidine or dexmedetomidine and labeled only with study number were prepared by an investigator neither involved in the administration of block nor following up of patients . all patients fasted for 68 h before surgery . on arrival in the anesthetic room , intravenous access secured with 18 g cannula in the nonoperated arm and infusion of lactated ringer started . baseline measurement of heart rate ( hr ) , noninvasive blood pressure , and spo2 were recorded before the block was performed . under all aseptic precautions , neural localization was achieved using a nerve stimulator ( stimuplex ; b. braun melsungen , melsungen , germany ) connected to 22 g , 55 mm long stimulating needle ( stimuplex d ; b. braun melsungen , melsungen , germany ) . the position of the needle was judged adequate when an output current 0.5 ma elicited a slight distal motor response . sensory and motor blocks were evaluated every 3 min within first 30 min following completion of drug administration . vital parameters ( pulse , arterial pressures , and spo2 ) were recorded every 5 min for first 30 min and thereafter every 10 min till the end of surgery . postoperatively , sensory and motor blockade and vitals parameters were noted at 10 min , 30 min and 1 , 2 , 4 , 6 , and 12 h after the end of surgery . sensory block was assessed by pinprick test and graded as grade 0 = no sensation felt , grade 1 = dull sensation felt , grade 2 = sharp pain felt . motor block was assessed using a modified bromage scale(3 = extension of elbow against gravity , 2 = flexion of wrist against gravity , 1 = finger movement , and 0 = no movement ) . the onset of sensory block was defined as the time from injection of local anesthetic till no response to pinprick test whereas onset time of motor block was defined as the time between injection and motor paralysis . the duration of sensory block was considered as the time interval from complete sensory block till first postoperative pain , and the duration motor block was defined as the time interval between the complete paralysis and complete recovery of motor function . postoperative pain levels were assessed by 10 cm visual analog scale ( vas ) from 0 ( no pain ) to 10 ( severe pain ) . injection diclofenac 75 mg administered intramuscularly , as rescue analgesic , when vas reached > 4 . the time to first analgesic the time between the end of local anesthetic administered and the first analgesic request was recorded as the duration of analgesia . adverse events comprised hypotension ( a 20% decrease from baseline value ) , bradycardia ( hr < 50 beats / min ) , hypoxemia ( spo2<90% ) , or nausea and vomiting . at the end of surgery , the quality of anesthesia was assessed according to a numeric scale;4 = excellent : no complaint from patient , 3 = good : minor complaint with no need for supplemental analgesia , 2 = moderate : complaint which required supplemental analgesics , and 1 = unsuccessful : patient was given general anesthesia . the data were analyzed by student 's t - test and chi - square test . the demographic data were similar in each group [ table 1 ] . although sensory and motor block onset times were shorter in group d than in group c , the difference was statistically insignificant [ table 2 ] . block characteristics sensory and motor block durations were significantly prolonged in group d compared to group c ( p < 0.001 ) . the duration of analgesia was significantly longer in dexmedetomidine group than in clonidine group ( p < 0.001 ) [ table 2 ] . the baseline hemodynamic parameters were comparable in both groups [ figures 1 and 2 ] . although there was significant fall in mean pulse rate and blood pressure in dexmedetomidine group as compared to clonidine group up to 90 min , no treatment was required . thereafter , pulse rate and arterial pressure were comparable during the study period in both groups . the quality of anesthesia was found significantly better in patients who received dexmedetomidine compared to those who received clonidine ( p < 0.05 ) [ table 3 ] . bb : before block ; ab : after block ; sbp : systolic blood pressure ; dbp : diastolic blood pressure quality of anesthesia none of the patients experienced an episode of hypotension , bradycardia , or hypoxemia that required treatment during either intraoperative or postoperative period . side effects such as drowsiness , nausea , and vomiting were not seen in any patient in the two groups . in our study , we compared the addition of clonidine ( 1 g / kg ) and dexmedetomidine ( 1 g / kg ) to bupivacaine in supraclavicular brachial plexus block . the results of our study revealed that the onset time for both sensory and motor blocks after the supraclavicular brachial plexus block using either clonidine or dexmedetomidine in bupivacaine were similar . however , dexmedetomidine provided longer duration of both motor and sensory blocks and prolonged duration of analgesia . moreover , dexmedetomidine group had better quality of anesthesia . there has been increasing use of some adjuncts , e.g. , opioids , epinephrine , -2 adrenoreceptor agonists to local anesthetic agents to improve the block quality in peripheral nerve blocks . it was reported in various studies that the addition of -2 adrenoreceptor agonists to local anesthetic agents in peripheral nerve blocks improved the quality the anesthesia and prolonged the duration of analgesia . several animal studies have investigated the analgesic effects of -2 adrenoreceptor agonists as an adjuvant to local anesthetic agents . yoshitomi et al . found that addition of clonidine or dexmedetomidine to lignocaine enhances local analgesic effect . they postulated that improved analgesic effect of clonidine and dexmedetomidine was mediated through -2 adrenoreceptors . in another animal study , dexmedetomidine has been shown to increase the duration of bupivacaine anesthesia and analgesia of sciatic nerve block in rats . in two different sciatic nerve rat models , brummett et al . found that dexmedetomidine added to ropivacaine significantly prolonged the duration of analgesia . moreover , in humans , various studies have found clonidine and dexmedetomidine to be safe and effective in various neuraxial and regional anesthesia including intrathecal and intravenous regional anesthesia . abosedira compared the effect of adding either clonidine or dexmedetomidine to lidocaine during bier 's block and reported that adding dexmedetomidine to lignocaine during bier 's block is superior in quality of anesthesia , tourniquet tolerance , and intraoperative and postoperative analgesia than is the addition of clonidine . found the improved quality of anesthesia and tourniquet pain and reduced postoperative analgesic requirement when they used dexmedetomidine lignocaine mixture during bier 's block . had compared the dexmedetomidine and clonidine in epidural anesthesia and concluded that dexmedetomidine is a better neuraxial adjuvant compared with clonidine for providing an early onset of sensory analgesia and prolonged postoperative analgesia . however , el - hennawy et al . found no difference in duration of analgesia between either dexmedetomidine or clonidine when added to bupivacaine during pediatric caudal anesthesia . till date , several studies investigated that effects of clonidine or dexmedetomidine in axillary brachial plexus block and found that these drugs had an improving effect on quality and duration of anesthesia . during our literature search , we did not find any study comparing dexmedetomidine and clonidine as an adjuvant to bupivacaine in supraclavicular brachial plexus block . therefore , we assumed that dexmedetomidine may be more effective in supraclavicular brachial plexus block . there is no study which has compared the dose equivalence of these drugs in peripheral nerve block . the dose of studied drugs was selected on the basis of study by abosedira , in which he / she used dexmedetomidine 1 g / kg and clonidine 1 g / kg in lidocaine during bier 's block . the mechanism by which -2 adrenoreceptor agonist produces analgesia and sedation is not fully understood and likely to be multifactorial . peripherally -2 adrenoreceptor agonists produce analgesia by reducing release of norepinephrine and causing -2 receptor - independent inhibitory effect on nerve action potentials . centrally , -2 adrenoreceptor agonists produce analgesia and sedation by inhibition of substance p release in the nociceptive pathway at the level of the dorsal root neuron and by activation of -2 adrenoreceptors in locus coeruleus.-2 adrenoreceptors are coupled via a pertussis toxin - sensitive g protein to potassium ion channel . the results of our study showed stable perioperative hemodynamics , also drowsiness , which often associated with the use of clonidine , was not noted in our patients . no other side effects were noted in any of the patients in the present study . we had taken a volume of 40 ml of local anesthetic agent because this volume was associated with a more complete spread for brachial plexus block as found by winnie et al . thus , our study demonstrated that addition of dexmedetomidine to bupivacaine in supraclavicular brachial plexus block prolonged the duration of analgesia and improved the quality of anesthesia as compared to clonidine with hemodynamic stability and lack of side effects , thus making dexmedetomidine an attractive choice as an adjuvant to bupivacaine for supraclavicular brachial plexus block .

this article describes the curation workflow for xenbase ( www.xenbase.org ) ( 1,2 ) and was presented as part of the biocreative workshop 2012 track ii . xenbase is a large - scale model organism database ( mod ) and community resource for researchers working with the frog species , xenopus tropicalis and xenopus laevis . it is a central source for genomic , gene expression , literature and other experimental data on xenopus and also acts as a clearinghouse for xenopus gene nomenclature . developmental biologists use xenopus embryos to study gene function during development and to model gene action in human congenital diseases , while cell biologists use xenopus eggs and oocytes for exploring the mechanistic basis of central processes such as cell division . xenbase also makes xenopus data accessible to researchers using other model organisms by using gene symbols based on the symbols for human orthologues and by providing links to orthologous genes in humans and similar major vertebrate model organisms ( e.g. mouse and zebrafish ) . our curation workflow focuses on associating papers with authors , genes and anatomy terms and extracting gene expression patterns . the xenopus literature corpus contains > 42 000 papers with 1500 new papers added per year . gene expression data are often presented in papers in the form of image evidence typically images of embryos stained to display the distribution of an mrna in the various tissues of the organism . ( the following 17 steps correspond to the numbered items in figure 1 . ) 1.every week an automatic process searches for new or updated papers in pubmed whose abstract , title or metadata contains the keyword xenopus. every week an automatic process searches for new or updated papers in pubmed the first stream consists of a series of manual and automated steps that are used to annotate gene expression patterns in papers . the second stream describes the automated processes of capturing , transforming , inputting , and indexing papers into the textpresso search engine . the first stream consists of a series of manual and automated steps that are used to annotate gene expression patterns in papers . the second stream describes the automated processes of capturing , transforming , inputting , and indexing papers into the textpresso search engine . the primary process , focussing on annotation of gene expressions and image data , is as follows : 2.each paper s title , abstract and metadata are imported into xenbase s db2 relational database through which they are made available on xenbase ( www.xenbase.org/literature/literature.do ) and to the literature curation pipeline . 3.an automatic process identifies mentions of genes and anatomy terms in the abstract and title based on gene symbols and anatomy terms as well as synonyms ( see data and controlled vocabularies section ) . 4.curators select papers for curation based on the presence of gene expression evidence and whether xenbase may reproduce images either through open - access licensing or special permissions . at this stage , papers irrelevant to current curation processes , such as those using xenopus oocytes for cellular biology experiments , are excluded . 6.curators choose which images have relevant information ( e.g. gene expression ) and import those images and their corresponding captions . 7.captions for imported images are automatically annotated with controlled vocabularies to identify genes and anatomy terms . . this may be types of content we currently curate ( e.g. gene expression ) or content types we plan to curate in the future once support is added to xenbase ( e.g. phenotypes , antibodies and morpholinos ) . 9.the curator annotates image captions for gene expression patterns via a custom web - based curation system ( figure 2 ) . in the future , this curation is likely to be expanded to include additional data types such as phenotypes , gene regulation , transgenics and protein localization.10.the curator updates the status to indicate whether or not curation is complete.11.if there are insufficient data in the image captions to complete the annotation , the curator will proceed to the full paper text to obtain the required information ( see curation bottlenecks section).12.if the curator is still missing information , they may contact the author ( see curation bottlenecks section ) . for example , curators often need to contact authors to determine which cdna clone and , in the case of x. laevis , which alloallele was used in the experiment . each paper s title , abstract and metadata are imported into xenbase s db2 relational database through which they are made available on xenbase ( www.xenbase.org/literature/literature.do ) and to the literature curation pipeline . an automatic process identifies mentions of genes and anatomy terms in the abstract and title based on gene symbols and anatomy terms as well as synonyms ( see data and controlled vocabularies section ) . curators select papers for curation based on the presence of gene expression evidence and whether xenbase may reproduce images either through open - access licensing or special permissions . at this stage , papers irrelevant to current curation processes , such as those using xenopus oocytes for cellular biology experiments , are excluded . curators choose which images have relevant information ( e.g. gene expression ) and import those images and their corresponding captions . captions for imported images are automatically annotated with controlled vocabularies to identify genes and anatomy terms . . this may be types of content we currently curate ( e.g. gene expression ) or content types we plan to curate in the future once support is added to xenbase ( e.g. phenotypes , antibodies and morpholinos ) . the curator annotates image captions for gene expression patterns via a custom web - based curation system ( figure 2 ) . in the future , this curation is likely to be expanded to include additional data types such as phenotypes , gene regulation , transgenics and protein localization . the curator updates the status to indicate whether or not curation is complete . if there are insufficient data in the image captions to complete the annotation , the curator will proceed to the full paper text to obtain the required information ( see curation bottlenecks section ) . if the curator is still missing information , they may contact the author ( see curation bottlenecks section ) . for example , curators often need to contact authors to determine which cdna clone and , in the case of x. laevis , which alloallele was used in the experiment . in the second process , the full texts of papers are imported into xenbase s textpresso ( 3 ) text mining and search tool ( see use of text mining tools section ) . textpresso is currently independent of our curation process but we hope to integrate it into a semi - automated full - text curation process in the future ( see use of text mining tools section ) . 13.if the paper is in pubmed central , its full text is downloaded from pubmed central.14.if the paper is not in pubmed central , the pdf for the journal is imported from the journal website.15.pdf documents are converted to xml using the open - source pdftohtml utility ( pdftohtml.sourceforge.net).16.documents are processed into textpresso ( see use of text mining tools section).17.documents are indexed using textpresso - controlled vocabularies . if the paper is in pubmed central , its full text is downloaded from pubmed central . if the paper is not in pubmed central , the pdf for the journal is imported from the journal website . pdf documents are converted to xml using the open - source pdftohtml utility ( pdftohtml.sourceforge.net ) . documents are processed into textpresso ( see use of text mining tools section ) . documents are indexed using textpresso - controlled vocabularies . to our knowledge , the xenbase curation process , among mods , is novel in a number of respects . second , using html scrapers , we have semi - automated the task of extracting images from papers and uploading them to xenbase . the left panel shows the image , caption and a tables of existing annotations made to that image . the right side of the panel contains a form used for editing existing or new annotations . it starts with a series of fields to specify species , gene name , clone names or accessions . next the curator can specify a range of development stages when a particular expression pattern occurs . finally , anatomy terms describing where expression occurs can be chosen from checkbox lists of commonly uses anatomy terms or a suggestion box . anatomy terms are restricted to those that exist during the stage range previously entered by the curator . finally , there is a section for updating the curation status of the item and entering curation notes . the left panel shows the image , caption and a tables of existing annotations made to that image . the right side of the panel contains a form used for editing existing or new annotations . it starts with a series of fields to specify species , gene name , clone names or accessions . next the curator can specify a range of development stages when a particular expression pattern occurs . finally , anatomy terms describing where expression occurs can be chosen from checkbox lists of commonly uses anatomy terms or a suggestion box . anatomy terms are restricted to those that exist during the stage range previously entered by the curator . finally , there is a section for updating the curation status of the item and entering curation notes . xenbase started with very limited resources for human curators . while more established mods had teams of curators read papers and annotate them with genes and anatomy items described therein , xenbase made use automated text mining methods for matching gene and anatomy term mentions in paper . evidence of gene expression data from in situ hybridization and immunohistochemistry experiments is most often presented as images . hence , it was desirable to include these images drawn from literature into xenbase . to eliminate the repetitive task of having curators extract images from papers and import them into xenbase , we developed tools to scrape journal websites for images and upload those chosen by the curators into xenbase . the more difficult work of extracting gene expression patterns from texts has been left to human curators . however standard mod operating procedure for curators to extract facts , such as gene expression patterns , from papers would be to have a curator read the paper and extract those facts . realizing the evidence for gene expression is almost always illustrated in images and described in those image captions , we created a curation process centred on images and their captions . they only proceed to read the full paper if important information is missing from the captions . even when information is missing from captions , it can often be searched from the paper without reading the entire paper . in conclusion , this process has been very successful at leveraging the use of human curator time . finally , the image - centric curation process can be expanded to other forms of data that commonly used image - based evidence such as phenotypes . first pass extraction of gene expression facts based on cooccurrences of anatomy terms and genes in captions proved too inaccurate . image scrapers save curator time but frequently need to be fixed when publishers change the structure of their journal websites . the image - centric curation process is not really applicable to problems such as identifying antibody , morpholinos or gene ontology terms . thus , xenbase is exploring the idea of creating semi - automated curation processes of the full text of papers , using textpresso . the primary process , focussing on annotation of gene expressions and image data , is as follows : 2.each paper s title , abstract and metadata are imported into xenbase s db2 relational database through which they are made available on xenbase ( www.xenbase.org/literature/literature.do ) and to the literature curation pipeline . 3.an automatic process identifies mentions of genes and anatomy terms in the abstract and title based on gene symbols and anatomy terms as well as synonyms ( see data and controlled vocabularies section ) . 4.curators select papers for curation based on the presence of gene expression evidence and whether xenbase may reproduce images either through open - access licensing or special permissions . at this stage , papers irrelevant to current curation processes , such as those using xenopus oocytes for cellular biology experiments , are excluded . 6.curators choose which images have relevant information ( e.g. gene expression ) and import those images and their corresponding captions . 7.captions for imported images are automatically annotated with controlled vocabularies to identify genes and anatomy terms . . this may be types of content we currently curate ( e.g. gene expression ) or content types we plan to curate in the future once support is added to xenbase ( e.g. phenotypes , antibodies and morpholinos ) . 9.the curator annotates image captions for gene expression patterns via a custom web - based curation system ( figure 2 ) . in the future , this curation is likely to be expanded to include additional data types such as phenotypes , gene regulation , transgenics and protein localization.10.the curator updates the status to indicate whether or not curation is complete.11.if there are insufficient data in the image captions to complete the annotation , the curator will proceed to the full paper text to obtain the required information ( see curation bottlenecks section).12.if the curator is still missing information , they may contact the author ( see curation bottlenecks section ) . for example , curators often need to contact authors to determine which cdna clone and , in the case of x. laevis , which alloallele was used in the experiment . each paper s title , abstract and metadata are imported into xenbase s db2 relational database through which they are made available on xenbase ( www.xenbase.org/literature/literature.do ) and to the literature curation pipeline . an automatic process identifies mentions of genes and anatomy terms in the abstract and title based on gene symbols and anatomy terms as well as synonyms ( see data and controlled vocabularies section ) . curators select papers for curation based on the presence of gene expression evidence and whether xenbase may reproduce images either through open - access licensing or special permissions . at this stage , papers irrelevant to current curation processes , such as those using xenopus oocytes for cellular biology experiments , are excluded . curators choose which images have relevant information ( e.g. gene expression ) and import those images and their corresponding captions . captions for imported images are automatically annotated with controlled vocabularies to identify genes and anatomy terms . this may be types of content we currently curate ( e.g. gene expression ) or content types we plan to curate in the future once support is added to xenbase ( e.g. phenotypes , antibodies and morpholinos ) . the curator annotates image captions for gene expression patterns via a custom web - based curation system ( figure 2 ) . in the future , this curation is likely to be expanded to include additional data types such as phenotypes , gene regulation , transgenics and protein localization . the curator updates the status to indicate whether or not curation is complete . if there are insufficient data in the image captions to complete the annotation , the curator will proceed to the full paper text to obtain the required information ( see curation bottlenecks section ) . if the curator is still missing information , they may contact the author ( see curation bottlenecks section ) . for example , curators often need to contact authors to determine which cdna clone and , in the case of x. laevis , which alloallele was used in the experiment . in the second process , the full texts of papers are imported into xenbase s textpresso ( 3 ) text mining and search tool ( see use of text mining tools section ) . textpresso is currently independent of our curation process but we hope to integrate it into a semi - automated full - text curation process in the future ( see use of text mining tools section ) . 13.if the paper is in pubmed central , its full text is downloaded from pubmed central.14.if the paper is not in pubmed central , the pdf for the journal is imported from the journal website.15.pdf documents are converted to xml using the open - source pdftohtml utility ( pdftohtml.sourceforge.net).16.documents are processed into textpresso ( see use of text mining tools section).17.documents are indexed using textpresso - controlled vocabularies . if the paper is in pubmed central , its full text is downloaded from pubmed central . if the paper is not in pubmed central , the pdf for the journal is imported from the journal website . pdf documents are converted to xml using the open - source pdftohtml utility ( pdftohtml.sourceforge.net ) . documents are processed into textpresso ( see use of text mining tools section ) . the xenbase curation process , among mods , is novel in a number of respects . second , using html scrapers , we have semi - automated the task of extracting images from papers and uploading them to xenbase . the left panel shows the image , caption and a tables of existing annotations made to that image . the right side of the panel contains a form used for editing existing or new annotations . it starts with a series of fields to specify species , gene name , clone names or accessions . next the curator can specify a range of development stages when a particular expression pattern occurs . finally , anatomy terms describing where expression occurs can be chosen from checkbox lists of commonly uses anatomy terms or a suggestion box . anatomy terms are restricted to those that exist during the stage range previously entered by the curator . finally , there is a section for updating the curation status of the item and entering curation notes . the left panel shows the image , caption and a tables of existing annotations made to that image . the right side of the panel contains a form used for editing existing or new annotations . it starts with a series of fields to specify species , gene name , clone names or accessions . next the curator can specify a range of development stages when a particular expression pattern occurs . finally , anatomy terms describing where expression occurs can be chosen from checkbox lists of commonly uses anatomy terms or a suggestion box . anatomy terms are restricted to those that exist during the stage range previously entered by the curator . finally , there is a section for updating the curation status of the item and entering curation notes . xenbase started with very limited resources for human curators . while more established mods had teams of curators read papers and annotate them with genes and anatomy items described therein , xenbase made use automated text mining methods for matching gene and anatomy term mentions in paper . evidence of gene expression data from in situ hybridization and immunohistochemistry experiments is most often presented as images . hence , it was desirable to include these images drawn from literature into xenbase . to eliminate the repetitive task of having curators extract images from papers and import them into xenbase , we developed tools to scrape journal websites for images and upload those chosen by the curators into xenbase . the more difficult work of extracting gene expression patterns from texts has been left to human curators . however standard mod operating procedure for curators to extract facts , such as gene expression patterns , from papers would be to have a curator read the paper and extract those facts . realizing the evidence for gene expression is almost always illustrated in images and described in those image captions , we created a curation process centred on images and their captions . they only proceed to read the full paper if important information is missing from the captions . even when information is missing from captions , it can often be searched from the paper without reading the entire paper . in conclusion , this process has been very successful at leveraging the use of human curator time . finally , the image - centric curation process can be expanded to other forms of data that commonly used image - based evidence such as phenotypes . first pass extraction of gene expression facts based on cooccurrences of anatomy terms and genes in captions proved too inaccurate . image scrapers save curator time but frequently need to be fixed when publishers change the structure of their journal websites . the image - centric curation process is not really applicable to problems such as identifying antibody , morpholinos or gene ontology terms . thus , xenbase is exploring the idea of creating semi - automated curation processes of the full text of papers , using textpresso . xenbase uses various different controlled vocabularies to capture the what , where and when of gene expression . further metadata on these experiments such as specific clone or antibody used are also captured . a controlled vocabulary of gene symbols and synonyms drawn from the xenbase gene catalogue describe what is expressed . xenbase gene symbols are used by ncbi gene for xenopus gene naming and are based on the names of human orthologues . synonyms this is especially important as the same gene is often referred to by more than one name in archival literature . xenbase allows any user to enter synonyms for genes , helping ensure synonym lists are comprehensive and up to date . because x. laevis is pseudotetraploid , having two versions of each gene ( alloallele - a and alloallele - b ) , we also must consider which version of each gene was expressed . where genes are expressed , are represented using the xenopus anatomy ontology ( xao ) ( 4 ) . the xao is structured as a directed acyclic graph { dag [ a dag is a directional data structure similar to a tree or hierarchy except that nodes may have more than one parent and cycles are not allowed . for example , in the xao , a dag represents the part - of relationship between anatomy items . for example , the brain is part of the nervous system and the head ( two ) parents . the brain has the parts ( children ) hindbrain and forebrain . ] } and the xao is constructed using best practices outlined by the obo foundry ( the obo foundry is a repository of biomedical ontologies and a source of best practices in constructing those ontologies . ) ( 5 ) allowing it to be interrelated to anatomy ontologies from other model organisms . nieuwkoop and faber ( nf ) development stages , defined in ( 6 ) , have long been the accepted standard for delineating periods of development in xenopus and are used to describe when expression occurs . additional metadata on experiments such as clones or antibodies used to test for gene expression and the species used in the experiment are also captured . various data on antibodies used in immunohistochemistry experiments are captured from the literature by curators . finally , the species , laevis or tropicalis , used in the experiment must be determined . additionally , xenbase uses a small ontology structured as a dag to describe different content types of papers . these are all structured as single - level - controlled vocabularies with synonyms , described in ( 3 ) . to get a better feel for the data elements captured in xenbase , we recommend the reader to view some sample pages in xenbase : www.xenbase.org/literature/article.do?method=display&articleid=39749 provides an example of a curated article . note that names of genes and anatomy items are hyperlinked in the abstract and image captions . ( to view captions click show captions. ) clicking on an image will open a box showing the image , caption and a table of curator - entered annotations . click an image under the summary or literature images section to see sample annotations . xenbase curators experience a number of obstacles such as missing information and anatomy terms that are not in the xao . for example , the authors may not have specified which species of xenopus was used , which x. laevis gene alloallele was tested or the genbank accession number of the clone used in the experiment . in the case of antibodies , there may be information missing on its construction . this requires first searching the entire text of the paper , literature search of secondary references describing the missing data and then , if necessary , contacting the author . another problem is that the controlled vocabularies xenbase uses are not yet comprehensive enough to capture all the terminology used in literature . there are cases where the author has described expression in a tissue that is not currently represented in the xao . this requires the curator to research the tissue , determine whether the term is a synonym of an existing xao term or whether it is a valid term missing from the xao . xenbase curators are continually expanding the xao and keeping it synchronized with other model organism ontologies . curators will define new terms and integrate them into the xao in relation to existing terms . this may involve examining anatomy ontologies for other vertebrates such as mouse or zebrafish or through consultation with other ontology development teams such as national center for biomedical ontology ( www.bioontology.org ) , uberon ( www.uberon.org ) , the common amphibian anatomical ontology ( www.amphibanat.org ) or phenoscape ( www.phenoscape.org ) . xenbase currently successfully makes use of its built - in link matching tool for text mining . our link matching tool identifies gene and anatomy term mentions in titles , abstracts and captions . this uses a combination of inverted indices and regular expressions to match gene symbols , anatomy terms and their synonyms . in the case of genes terms with common homonyms can be entered into a table of exclusions that are ignored by the matching process , to reduce false positives . this tool comes into play at both steps 3 and 7 in our curation workflow diagram . although this is a fairly basic approach , the identification of synonyms is a particularly important step allowing this tool to associate genes and anatomy terms from different papers , despite the plethora of alternative gene names and variant anatomical descriptions used in the scientific literature . textpresso is used to index the full text of documents , and in particular , index the corpus by controlled vocabularies . textpresso also segments the paper into sections such as abstract , body , discussion , materials , results and citations . currently , textpresso is used as an advanced query tool ( www.xenbase.org/cgi-bin/textpresso/xenopus/home ) that allows users to return documents or sentences matching particular criteria . users can pose questions such as return sentences with two genes and a regulation term [ by selecting three categories : gene ( xenopus) twice and regulation or return sentences containing a gene mention and a morpholino from the materials section [ by turning advanced search on , unselecting all fields but materials and entering the categories : gene ( xenopus) and morpholino. in the near future , we plan to expand textpresso s application to identify papers that contain information on antibodies and/or morpholinos for particular genes . we have had success with text mining ; we believe its potential to improve curation has barely been tapped . there are many places in the curation process where text mining could be applied to further improve our curation workflow . at steps 3 and 7 , our current technology does an effective job of finding gene and anatomy term mentions , especially by taking advantage of synonyms . however , we are aware that more effective text mining methods for capturing this information exist . furthermore , because of numerous ways used to describe a range of development stages ( e.g. stages 1 , 2 , 3 and 4 ; 15 ; st . 1 to 5 ) , our current methods do not capture this information . furthermore , it would be useful to capture other entities such as gene ontology terms or ncbi accession numbers . at step 4 of the process , classifiers that could identify the content of papers using our content type ontology could help in triaging papers for curation . much more ambitiously , at step 7 , actual gene expression relationships could potentially be captured from captions . if false positives were kept to a reasonable level , extracted relationships could be approved or edited by curators , increasing the efficiency of the process . if this was made possible , extracting other relations such as gene regulations ( i.e. gene a regulates gene b ) or phenotypes ( e.g. knocking out gene a results in phenotypes 1 , 2 and 3 ) would also be valuable . at step 16 , textpresso attempts to segment papers into sections . however , textpresso does this poorly because it is difficult to automatically recognize the many different ways to title and delineate sections of a paper . for example , we have found that associating papers with gene mentions produces many false positives as paper titles in the paper s references mention genes that are unrelated to the work described in the paper . being able to properly distinguish between the references section and other sections of a paper would allow us to more accurately associate papers with genes by excluding genes referenced in the citations section . extending the markup of papers to identify paragraphs and part - of - speech tagging would also be extremely useful . as current curation in xenbase is very image and caption centric , it may miss information found only in the full body text of papers . beyond gene expression , other types of curatable information may not be presented via images ( e.g. gene regulation ) . while limited curation resources still preclude examining every paper , we have considered developing a pipeline that would use textpresso to extract sentences from papers that may contain useful biological information ( gene expression , antibodies , phenotypes , morpholinos , etc . ) . the interface would be designed to allow curators to approve , reject or edit extracted facts and zoom out from sentences to surrounding text to further assess facts in the data . the eunice kennedy shriver national institute of child health and human development ( nichd ) at the national institutes of health ( 5p41hd064556 ) and an nserc discovery grant .

neuropathic pain is an umbrella term that has recently been redefined by the international association for the study of pain as pain caused by a lesion or disease of the somatosensory system,1 thereby encompassing a number of diverse conditions and body sites . although largely underappreciated , the vulva is a particularly common locus of chronic pain with neuropathic characteristics in women of any age . in the largest community - based study conducted thus far , chronic unexplained vulvar pain , defined as burning or sharp knife - like pain or pain on contact , that lasted for at least 3 months or longer was reported by nearly 7% of women aged 1864 years in a us urban area.2 in spite of this high prevalence , it was also revealed in the latter study that no proper diagnosis was provided to a majority of women suffering from chronic vulvar pain even following multiple physician visits,2 a finding that has been corroborated by several recent us population - based studies.3,4 here , we report on a case of a middle - aged woman with chronic vulvar neuropathic pain that , although unique from a clinical perspective , exemplifies the burden of unrecognized chronic vulvar pain from a public health view , as discussed further . a 45-year - old woman was referred to the vulvovaginal disease clinic with debilitating vulvar burning and itching over the right labium majus , also causing severely disturbed sleep . careful history taking revealed that she had two vaginal deliveries and was known to suffer from crohn s disease involving the right hemicolon , terminal ileum , and rectum , for which she was treated with azathioprine orally and rectally applied mesalazine . finally , she had a history of atopy , and reported occasional seasonal allergic rhinitis symptoms . a blind biopsy was taken from the right labial skin in a dermatology practice ; it showed no epidermal or dermal anomalies . several topical treatments were initiated empirically , including vaginal antibiotic and fungistatic agents and various corticoid ointments , without providing relief . during a surgical consult , a nodule was detected in the right labium majus and was the presumed cause of the chronic pain . it was removed under general anesthesia , and had histological features indicative of a ruptured hair follicle . as no diagnosis was obtained , the patient was also asked to discontinue all medications , including those for treatment of crohn s disease . the patient was eventually referred to our hospital , which is a tertiary referral center . careful examination of the vulva and vagina revealed neither visible anomalies nor any other findings indicative of vulvar inflammatory , infectious , or neoplastic mucocutaneous disease . during the clinical exam , the patient was asked to point out the pain area , showing the right labiocrural fold , the anterior surface of the right labium majus , and right medial upper thigh , though burning sensation of the right labium majus was the most prominent complaint and was initially mentioned by the patient as the only complaint . tactile sense assessment was performed with a piece of cotton wool , a cotton - tip swab , and a sharp wooden stick over these areas and further compared with the contralateral sites . while varied dysesthetic tactile responses were obtained , the overall pattern was hypoesthesia upon soft touch and pronounced hyperesthesia and allodynia upon sharp touch . though often difficult to differentiate from ilioinguinal neuralgia , this particular pattern was highly suggestive of genitofemoral neuralgia , involving both the genital and femoral branches of the genitofemoral nerve ( figure 1 ) . maximal passive hip flexion further provoked burning over the right labium majus , though not the thigh . subsequently , electrophysiological examination through somatosensory evoked potentials ( ssep ) assessment of the labia majora was performed . the labia majora were stimulated with bipolar surface electrodes ( cathode proximally ) at an intensity of two times the sensory threshold , with stimulus duration of 0.2 ms and a frequency of 2 hz . recording was done using needle electrodes , with the active electrode placed 2 cm behind the cz position of the international 1 020 system and the reference electrode at the fpz position . recordings were performed with the medelec sapphire device ( vickers healthcare co , woking , uk ) . ssep responses over the right compared to the left labium majus showed a prolonged latency ( 32.2 versus 29.1 ms corresponding to ~10% prolongation ) and considerably decreased amplitude ( 0.50 versus 1.58 v corresponding to ~70% lower amplitude ) . additionally , imaging of the pelvis was conducted through magnetic resonance imaging ( mri ) , whereby t1- , t2- and proton density - weighted sequences were obtained , though no anomalies could be documented . initial pain relief was procured through application of a 5% lidocaine patch fit to the right labium majus and left in place during daytime for 12 hours a day . while providing some attenuation of pain during the day nortriptyline at a daily dose of 25 mg was ill - tolerated without any effect on vulvar pain . venlafaxine was slowly titrated , starting with a dose of 37.5 mg and adding up in increments of 37.5 mg per day at intervals of 7 days , until a daily dose of 150 mg was reached . while reporting mild side effects of vivid dreaming and increased transpiration , the patient experienced rapid improvement of vulvar pain , which allowed her to resume normal sleep at night , after 2 years of sleep deprivation . she gradually tapered off use of the lidocaine patch and reported that she no longer experienced vulvar discomfort during activities of daily life . in view of the side effects under venlafaxine , the treatment regimen was changed to duloxetine 60 mg a day , resulting in disappearance of the side effects , while maintaining optimal pain relief of the vulva . discomfort over the right thigh , primarily described as itching rather than burning , did persist however , for which we initiated a compounded topical gabapentin cream in a 6% concentration formulated in a nonionic cream , resulting in significant relief of discomfort over the right thigh . at some point in time during follow - up , the patient reported a slight but hindering exacerbation of vulvar pain under duloxetine . careful history taking revealed that the pain reoccurred following a bicycle day trip , and the patient was therefore instructed on vulvar care with emphasis on limiting vulvar mechanical strain as a known aggravating factor . one year after initial assessment , the patient remains pain free under continued treatment with duloxetine orally 60 mg a day and 6% gabapentin cream applied twice daily . for this kind of approach or publication , ghent university hospital institutional review board approval was not deemed necessary by our institution . written informed consent from the patient was obtained . according to the international society for the study of vulvovaginal disease , vulvar pain can broadly be classified as pain related to a specific disorder , either as pain occurring in the absence of relevant visible findings or a specific clinically identifiable , neurologic disorder.5 vulvar pain attributable to a specific disorder basically encompasses pain resulting from infectious disease ( eg , herpes genitalis ) , inflammatory mucocutaneous disease ( eg , lichen planus ) , neoplastic disease ( eg , squamous cell carcinoma ) , and neurological disease ( eg , postherpetic neuralgia).5 in the event that no such underlying disease to vulvar pain can be identified , the term vulvodynia has been adopted,5 though etymologically referring to vulvar pain as such . vulvodynia involves in the vast majority of patients mechanical allodynia and hyperalgesia of the vaginal vestibular area , thought to relate at least in part to marked regional c - fiber hyperinnervation and possibly neuroinflammation.6 while the nosology of vulvodynia has been a long - standing matter of debate,5,7,8 clearly , the signs and symptoms in vulvodynia show considerable overlap with neuropathic pain,9 as assessed by available screening tools.10 women presenting with chronic nociceptive vulvar pain typically elicit visible epithelial alterations ( eg , lichen planus , vulvar intraepithelial neoplasia , and genitourinary syndrome of menopause ) prompting clinical diagnosis , though histopathological confirmation following biopsy might be sought , and hence most of these , often older patients , will eventually be managed accordingly . paradoxically , women presenting with the more common neuropathic type of chronic vulvar pain , resulting from vulvodynia or specific neuropathic pain syndromes , usually do not show visible anomalies , and either do not seek medical attention or remain undiagnosed even following multiple physician visits.3,4,11 a recent population - based study revealed , for instance , that merely 3% of women meeting vulvodynia criteria were actually diagnosed with vulvodynia.3 illustrating this point is the significant diagnostic delay observed in the case we presented , as well as the strong physician tendency to attribute the pain reported by the patient to visible or demonstrable tissue alterations , prompting biopsy and surgery , as well as the number of treatments directed toward infectious and inflammatory conditions , even though no such diagnosis was obtained . while chronic unexplained vulvar pain is a debilitating condition affecting a vast number of women of all ages,2 this has been mostly attributed to vulvodynia epidemiology , and hence it has not been established how often chronic vulvar pain is associated with specific neuropathic pain syndromes related to neuralgia of the genitofemoral , ilioinguinal , and pudendal nerves ( figure 1 ) , though not a rarity at a vulvar disease clinic in our experience . genitofemoral neuralgia was first described by magee12 as genitofemoral causalgia , and subsequently redefined by lyon,13 where the current nomenclature was introduced.14 genitofemoral neuralgia in women is almost exclusively known as an iatrogenic pain disorder , complicating common lower abdominal and pelvic surgical procedures such as inguinal herniorrhaphy , cesarean section , hysterectomy , and lymph node biopsy , as recently and comprehensively reviewed by cesmebasi et al.14 in the original case series by magee,12 there is also mention of an 11-year - old girl who developed genitofemoral neuralgia after falling while bicycling , presumably involving direct trauma to the groin by the handle bar.13 murovic et al,15 in their series of ten patients , also reported on four patients who developed genitofemoral neuralgia after blunt abdominal trauma . we identified only one case report on spontaneous - onset genitofemoral neuralgia , not related to surgery or blunt trauma , involving a 20-year - old woman , in which nerve compression was suspected to result from tight - fitting clothing.16 interestingly , also with regard to the case presented by us , bicycle riding has also been reported as a possible factor evoking genitofemoral neuralgia.14 tight - fitting clothing and bicycling are often reported as aggravating or evoking factors in patients with vulvodynia or neuropathic pain attending our vulvar disease clinic , pointing at vulvar mechanical strain through pressure and friction as an important aggravating and possibly initiating factor to chronic vulvar disease , though this is poorly addressed in the medical literature . we can not explain how the patient presented developed genitofemoral neuralgia , though possibly resulting from a tubal ligation procedure . a relationship with crohn s disease could not be established . the mainstay to the diagnosis of genitofemoral neuralgia has been the use of selective nerve blocks , as originally proposed by lichtenstein et al.17 historically , this technique involved an essentially blind block near the pubic tubercle , distal to the presumed site of injury following most types of surgery , and with a considerable potential for injury to the surrounding structures at the injection site . due to the retroperitoneal location dorsal to the psoas muscle , the genitofemoral nerve has been notoriously difficult to target more proximally . recently , several medical imaging - guided transpsoas techniques have been described by use of computed tomography and ultrasound;1821 magnetic resonance neurography - guided nerve blocks are likely to serve as another excellent diagnostic tool.22 in case of clinical suspicion of genitofemoral , ilioinguinal , or pudendal neuralgia , we initially obtain electrophysiological assessment through ssep , an approach that has not been reported in this context in the literature before . we identified one case report in which ilioinguinal nerve entrapment was suspected through electromyography in a 35-year - old man with acute scrotal pain.23 clearly , the sensitivity of electrophysiological approaches needs to be validated in sufficiently large patient series ; however , it has proven a useful noninvasive first - line diagnostic assessment in our experience . a myriad of therapeutic approaches for genitofemoral neuralgia have been described as comprehensively reviewed by cesmebasi et al,14 including ultrasound - guided nerve block injections,20,21 various ablative techniques for neurolysis,24 and genitofemoral neurectomy , recently described through a minimally invasive endoscopic retroperitoneal approach.2527 it may be acknowledged that neurolysis or neurectomy of the genitofemoral nerve may be accompanied by hypoesthesia over the labium majus,15 possibly impairing sexual function28 . noninvasive , pharmacotherapeutic approaches may provide proper pain relief in a substantial proportion of patients . a recent systematic review by the special interest group on neuropathic pain of the international association for the study of pain found sufficient evidence to strongly recommend tricyclic antidepressants , serotonin noradrenaline reuptake inhibitors , pregabalin , and gabapentin as first - line treatments in neuropathic pain.29 in the patient presented here , as with many other patients presenting with chronic vulvar pain , satisfactory pain relief was obtained with serotonin noradrenaline reuptake inhibitors and topical gabapentin . in summary , it is widely observed that although many women of all ages suffer from chronic neuropathic type vulvar pain , most of these will remain undiagnosed even following multiple physician visits . a majority of these patients presumably have vulvodynia , while an unknown number of women suffer from a specific neuropathic vulvar pain condition . although physicians such as dermatologists , urologists , and gynecologists are largely unfamiliar with these conditions , several clues to the diagnosis of genitofemoral , ilioinguinal , or pudendal neuralgia may be particularly useful in the first- or second - line assessment when confronted with the chronic vulvar pain patient ( table 1 ) : 1 ) careful history taking reveals continuous vulvar pain , often reported as a burning sensation ( though possibly also involving itch , tingling , or sharp pain ) ; 2 ) pain or discomfort is typically unilateral ; 3 ) vulvar pain or discomfort may be most pronounced while sitting , and least prominent when lying ; 4 ) clinical and microbiological analysis does not reveal anomalies , and even if anomalies are observed , these do not necessarily correlate with subjective symptoms , especially since symptoms are unilateral ; 5 ) vulvar pain may be provoked by maximal hip flexion ; and 6 ) tactile sense anomalies may be demonstrated by the use of ordinary disposables available in most physician offices . finally , first - line treatment may be initiated according to current evidence with tricyclic antidepressants , serotonin noradrenaline reuptake inhibitors , pregabalin , and gabapentin , whereby it is crucial to inform the patient on the treatment rationale , expected treatment success , and possible side effects .

although the basic structure of the spindle is similar in all cell types of higher eukaryotes , spindle assembly can occur through different pathways . in most animal somatic cells , spindle formation is mediated by a pair of microtubule ( mt ) * organizing centers , called the centrosomes . during prophase , the separating centrosomes nucleate astral arrays of mts that are captured and stabilized by the chromosomes , allowing the formation of a bipolar spindle ( for review see compton , 2000 ) . in contrast , meiotic cells of females of several animal species and mitotic cells of higher plants assemble their spindles via an acentrosomal pathway . in these cells , which do not possess centrosomes , mts grow from multiple sites around the chromosomes and progressively self - organize into a bipolar spindle through the action of both plus - end and minus - end directed motor proteins ( compton , 2000 ) . growing evidence indicates that chromosomes play a key role in the formation of these acentrosomal spindles ( for review see karsenti and vernos , 2001 ) . recent studies have suggested that this role reflects the ability of chromosomes to generate ran - gtp , a ras - like gtpase that promotes mt growth and stability . the chromatin - bound ran - gef , rcc1 , is thought to catalyze the ran - gdp / ran - gtp transition , generating a high local concentration of ran - gtp that stimulates mt nucleation ( carazo - salas et al . , 1999 , 2001 ) . a large body of work indicates that chromosomes also play an essential role in the formation of centrosome - containing spindles . when the nucleus of grasshopper spermatocytes is removed by micromanipulation before nuclear envelope breakdown , astral mts disassemble and the spindle fails to form ( zhang and nicklas , 1995 ) . studies performed in echinoderm , drosophila , and xenopus early embryos have shown that centrosomes can duplicate and form robust asters in the absence of chromosomes , but these asters fail to evolve into real spindles and do not undergo the ana - telophase morphological transformations that characterize chromosome - containing spindles ( sluder et al . , 1986 ; picard et al . , 1988 ; raff and glover , 1989 ; sawin and mitchison , 1991 ) . similar results have been recently obtained using ptk homokaryons , where centrosomes lacking associated chromosomes give rise to metaphase - like spindles that fail to turn into normal ana - telophase spindles ( faruki et al . , 2002 ) . interestingly , also in acentrosomal systems , such as mouse meiosis , chromatin - free bipolar spindles do not have the ability to evolve into ana - telophase like configurations ( brunet et al . , 1998 ) . together , these results have led to the view that chromosomes play an essential role in spindle formation and dynamics both in acentrosomal and centrosome - containing systems ( waters and salmon , 1997 ; karsenti and vernos , 2001 ) . here , we show that drosophila secondary spermatocytes devoid of chromosomes assemble metaphase - like spindles that evolve into telophase spindles these results indicate that in drosophila spermatocytes , spindle formation and dynamics are controlled by chromosome - independent factors . in the course of an extensive screen for mutations affecting drosophila male meiosis ( see materials and methods ) , we isolated four mutants with severe defects in chromosome segregation . two of these mutants map to the second and two to the third chromosome ; complementation tests revealed that they identify two genes we call fusolo ( fsl ) and solofuso ( suo ) . deficiency mapping experiments showed that fsl and suo are uncovered by df(3l)bk10 ( 71c3 ; 71e5 ) and df(2l)va17 ( 37c ; 37f5 ) , respectively . fsl / fsl , fsl / fsl , fsl / df , and fsl / df flies are viable but sterile in both sexes ; suo / suo , suo / suo homozygotes , and suo / df hemizygotes are viable and also sterile in both sexes , whereas suo / df hemizygotes are late lethals . to characterize the meiotic phenotype of fsl and suo , we made larval and adult testis preparations that were simultaneously stained for tubulin , centrin , and dna . the anti human centrin ( hscen1p ) antibody ( paoletti et al . , 1996 ) decorates drosophila centrioles ( riparbelli et al . , 2002 ) , facilitating distinction between first and second meiotic divisions , which display two and one centriole at each pole , respectively . the analysis of fsl / df , fsl / fsl , fsl / df , and fsl / fsl testes showed that these mutant combinations do not substantially differ in terms of severity of the phenotype , displaying a common defect in chromosome segregation . thus , we focused on fsl / fsl and fsl / df for detailed characterization of the meiotic phenotype . in fsl / fsl and fsl / df , however , in most ana - telophases , chromosome segregation is disrupted ( fig . 1 , d and e ; table i ) . in approximately half of mutant ana - telophase i cells , all chromosomes segregate to one pole only ( fig . 1 e and table i ) , leading to the formation of secondary spermatocytes that are completely devoid of chromosomes ( fig . chromosome - containing fsl secondary spermatocytes form a regular spindle and exhibit the same aberrant chromosome behavior seen in the first meiotic division ( unpublished data ; see fig . 5 a ) . in fsl secondary spermatocytes without chromosomes , centrosomes nucleate robust astral arrays of mts that move to the opposite cell poles ( fig . 2 a ) . these asters give rise to metaphase - like spindles devoid of chromosomes that differ from their wild - type counterparts only for the absence of kinetochore fibers ( fig . it should be noted that in these chromosome - free spindles , there is limited overlapping between the antiparallel mts emanating from the opposite poles ( fig however , little or no overlapping of these mts is also seen in wild - type metaphase spindles ( fig . 2 a ; cenci et al . , 1994 ) . chromosome - free spindles evolve into an anaphase a - like configuration , which again displays little or no mt overlapping at the center of the cell , as occurs in wild - type anaphases ( fig . 2 , c and c ) , assemble a morphologically normal central spindle , and elongate to form telophase figures that are indistinguishable from their wild - type counterparts ( fig . it should be noted that in fsl mutants , the frequency of chromosome - free metaphase / early anaphase ii figures and the frequency of chromosome - free telophase ii figures are comparable ( table i ) . this indicates that most ( if not all ) metaphase - like spindles without chromosomes have the ability to form a central spindle and to proceed to telophase . cells were stained for tubulin ( green ) , centrin ( orange ) , and dna ( blue ) . ( a and b ) meiotic division in wild - type males . ( a ) metaphase i ; ( b ) late telophase i ; ( c e ) meiotic division in fsl males . ( c ) metaphase i ; ( d ) late telophase i with nonsegregating chromosomes at the center of the cell ; ( e ) late telophase i with all chromosomes segregating to only one of the two presumptive daughter cells . meiotic defects observed in fsl mutant males a , number of cells scored ; b , percentage of cells devoid of chromosomes ; c , percentage of telophases with nonsegregating chromosomes at the center of the cell ( see fig . 1 d ) ; d , percentage of telophases with chromosomes segregating to one daughter cell only ( see fig cells were stained for tubulin ( green ) , centrin ( orange ) , and dna ( blue ) . ( a e ) second meiotic division in wild type males . ( a ) metaphase ; ( b ) early anaphase , ( c ) late anaphase ; ( d ) early telophase ; ( e ) late telophase . ( a ) metaphase - like ; ( b ) early anaphase - like ; ( c ) late anaphase - like ; ( d ) early telophase - like ; ( e ) late telophase - like . the cytological characterization of suo mutants showed that they exhibit common alterations in chromosome segregation , which are more pronounced in suo than in suo mutant combinations . the chromosome segregation defect in suo spermatocytes is different from that observed in fsl mutants . suo prometaphase and metaphase i figures are normal , as observed in fsl mutants , but anaphases and telophases are characterized by the presence of chromatin bridges that are usually not seen in fsl mutants . as a result of these bridges , in a fraction of suo ana - telophase i cells , all the chromosomes segregate to one pole only , giving rise to chromosome - free secondary spermatocytes [ 25% in suo / suo ( n = 97 ) and 29% in suo / df ( n = 61 ) ] . the suo secondary spermatocytes devoid of chromosomes behave like those of fsl mutants ; they form a bipolar spindle that undergoes the same dynamic transformations seen in chromosome - containing spindles ( unpublished data ) . together , these results indicate that the ability to form a spindle in the absence of chromosomes does not depend on a specific mutant background , but is an intrinsic characteristic of drosophila spermatocytes . in contrast to drosophila spermatocytes , chromosome - free metaphase - like spindles of ptk homokaryons are unable to evolve into a typical telophase structure . in these peculiar spindles , the antiparallel mts emanating from the centrosomes give rise to a compact mt bundle that fails to bind the mklp ( cho1 ) kinesin , which accumulates at the central spindle midzone in chromosome - containing cells ( faruki et al . , 2002 ) . thus , we asked whether the central spindles of chromosome - free telophases have the ability to bind pavarotti ( pav ) , the drosophila orthologue of mklp ( adams et al . , 1998 ) . cells were stained for tubulin ( green ) , pav ( orange ) , and dna ( blue ) . bar , 10 m . to further characterize the central spindles of chromosome - free spermatocytes , we asked whether they have the ability to bind aurora b. aurora b is in an evolutionary conserved macromolecular complex that contains the inner centromere protein and survivin ( for review see adams et al . , 2001 ) . the proteins of this complex are called chromosome passengers ( earnshaw and bernat , 1991 ) because they accumulate at centromeres in metaphase , but move to the central spindle midzone in telophase . given that both aurora b and the inner centromere protein are essential for cell cleavage , it has been suggested that these proteins may help to integrate chromosomal events with cytokinesis ( adams et al . , 2001 ) . immunostaining of wild - type spermatocytes for aurora b showed that this protein is concentrated at metaphase kinetochores ( fig . as spermatocytes progress through cell division , aurora b accumulates in the central spindle midzone ( fig . 4 c ) . in chromosome - containing cells of fsl and suo mutants , aurora b behavior is identical to wild type ( fig . 4 b and d ; unpublished data ) . in chromosome - free metaphase - like figures from both fsl and suo mutants , aurora however , as these cells move toward telophase , aurora b accumulates in the central spindle midzone , as occurs in wild type ( fig . , these results clearly show that aurora b concentration in the central spindle does not require its previous localization at kinetochores . in addition , they strongly suggest that the role played by aurora b during cytokinesis is independent of that played in chromosome structure and segregation . cells were stained for tubulin ( green ) , aurora b ( orange ) , and dna ( blue ) . ( a ) wild - type metaphase i ; ( b ) fsl metaphase i ; ( c ) wild - type telophase i ; ( d ) fsl telophase i ; ( e ) chromosome - free fsl early telophase ii ; ( f ) chromosome - free fsl late telophase ii . note that aurora b concentrates in the central spindle midzone in the absence of chromosomes . the findings that chromosome - free spermatocytes normally accumulate both pav and aurora b at their central spindle midzones suggest ( but do not prove ) that these cells have the ability to undergo cytokinesis . thus , we stained both fsl and suo mutant testes for components of the cytokinetic apparatus such as f actin , myosin ii , and anillin . f actin and myosin ii are well - known components of the contractile ring that mediates cytokinesis in animal cells ( for review see glotzer , 2001 ) . anillin is a 190-kd protein that concentrates in the cleavage furrow of a variety of drosophila cells , where it is thought to mediate membrane ring interactions during cytokinesis ( field and alberts , 1995 ; giansanti et al . , 1999 ; the analysis of fsl ( fig . 5 ) and suo preparations ( unpublished data ) revealed that secondary spermatocytes without chromosomes form morphologically regular cytokinetic structures across the central spindle midzone . in addition , we observed that these structures and those of their wild - type counterparts constrict to the same extent ( fig . ( a c ) telophase ii figures stained for tubulin ( green ) , dna ( blue ) , and either actin ( a , orange ) , myosin ii ( b , orange ) , or anillin ( c , orange ) . note that the cytokinetic structures of chromosome - free cells are comparable to those of chromosome - containing cells . ( d and e ) live spermatids from wild - type ( d ) and fsl ( e ) males . note that in fsl mutants , some nebenkern ( arrowheads ) are not associated with nuclei . bars , 10 m . to confirm that fsl and suo secondary spermatocytes can undergo cytokinesis in the absence of chromosomes we analyzed spermatid morphology in larval testes of both mutants . in wild type spermatocytes , mitochondria are equally partitioned between the two daughter cells at each meiotic division . at the end of meiosis ii the mitochondria received by each spermatid fuse to form a spherical structure called the nebenkern . as a result , each wild type spermatid comprises two spherical structures of similar size : a phase - light nucleus and a phase - dark nebenkern ( fig . 5 d ) . if cytokinesis fails , abnormal spermatids are formed , containing a large nebenkern associated with either two or four normal - sized nuclei ( fuller , 1993 ) . an examination of fsl and suo live spermatids revealed that in both mutants there are no large nebenkern resulting from failure in cytokinesis . instead , both mutants display many regular - sized nebenkern that are not associated with nuclei ( fig . 5 e ) ; these nebenkern are likely to originate from secondary spermatocytes without chromosomes that have successfully undergone the cytokinetic process . we have shown that chromosome - free spermatocytes assemble regular cytokinetic structures and cleave normally , indicating that chromosomes are not the source of signals that stimulate cytokinesis . these findings are consistent with the micromanipulation experiments on grasshopper spermatocytes , showing that elimination of chromosomes from metaphase cells does not prevent them to proceed through anaphase and telophase and undergo cytokinesis ( zhang and nicklas , 1996 ) . they also agree with the classic rappaport 's experiments on echinoderm eggs ( rappaport , 1986 ) , and with more recent experiments on vertebrate cells , showing that ectopic cytokinesis can occur between adjacent asters of different chromosome - containing spindles placed in the same cytoplasm ( eckley et al . , 1997 ; rieder et al . , 1997 ; savoian et al . , 1999 ) . previously , we have shown that in drosophila spermatocytes the signals for cytokinesis are not generated by the asters . asterless spermatocytes , which are devoid of asters due to a primary defect in centrosome assembly , form poorly focused anastral spindles . however , these spindles eventually organize morphologically normal central spindles that are fully able to support cytokinesis ( bonaccorsi et al . , 1998 ) . thus , the results on asterless , fsl , and suo indicate that neither the asters nor the chromosomes are required for signaling cytokinesis in drosophila spermatocytes . this suggests that in this system , the central spindle is both necessary and sufficient to stimulate cytokinesis . our results indicate that drosophila secondary spermatocytes can form a morphologically normal spindle in the absence of chromosomes , and thus , in the absence of a high concentration of ran - gtp in the center of the cell . the assembly of a metaphase - like bipolar spindle in the absence of chromosomes has been observed in several systems ( see introduction ) , including mouse oocytes ( brunet et al . , 1998 ) and ptk homokaryons ( faruki et al . , 2002 ) . however , all these metaphase - like mt arrays are unstable and fail to proceed through ana - telophase . thus , it has been suggested that in most centrosome - containing animal cells , chromosomes are not required for initial spindle morphogenesis , but for the stabilization of the structure and its evolution toward an ana - telophase configuration ( faruki et al . , 2002 ) . in contrast with these systems , the metaphase - like chromosome - free spindles of drosophila spermatocytes are sufficiently stable to undergo anaphase and telophase . we would like to point out that drosophila spermatocytes behave differently from those of grasshopper , where enucleation of late prophase spermatocytes inhibits spindle assembly ( zhang and nicklas , 1995 ) . yet , elimination of chromosomes from grasshopper metaphase spermatocytes does not affect the ability of the spindle to proceed through ana - telophase ( zhang and nicklas , 1996 ) . however , the latter finding may reflect incomplete elimination of a critical chromosome - associated factor ( e.g. , ran - gtp ) from the micromanipulated cell . regardless the interpretation of these grasshopper experiments , it is clear that in drosophila spermatocytes , chromosome - independent factors control spindle formation and dynamics . however , both the nature of these factors and the mechanisms underlying progression of chromosome - free spindles from a metaphase - like to a telophase - like structure remain to be determined . fsl , fsl , suo , and suo have been isolated by a cytological screen of a collection of male sterile mutants . these mutants were selected by b. wakimoto ( washington university , seattle , wa ) and d.l . lindsley ( university of california , san diego , san diego , ca ) from 12,000 viable lines , generated by e. koundakjian and c. zuker ( university of california , san diego , san diego , ca ) , each homozygous for either a second or a third ems - mutagenized chromosome . we named our mutants fusolo and solofuso , two italian terms that mean only spindle , after the cytological phenotype described here . to map suo and fsl , we used the second and third chromosome deficiency kits ( provided by the bloomington stock center , indiana university , bloomington , in ; http://flystocks.bio.indiana.edu/ ) , respectively . each of these kits includes a set of selected deficiencies that uncover about two thirds of the chromosome . fsl / tm6c and suo / cyo females were crossed to males from each pertinent deficiency stock , and the mutant / df males from each cross were tested for fertility . the double - staining techniques for actin / tubulin , myosin ii / tubulin , and anillin / tubulin ( the anti - myosin and -anillin antibodies were provided by c. field , harvard medical school , boston , ma ) were described previously ( giansanti et al . , 1999 ) . for double immunostaining of centrin / tubulin and aurora b / tubulin , testes were fixed according to protocol 3 of giansanti et al . they were then incubated overnight with both a monoclonal anti - tubulin antibody ( amersham biosciences ) diluted 1:100 in pbs and either a rabbit anti - hscen1p antibody ( provided by m. bornens , institut curie , paris , france ; paoletti et al . , 1996 ) or a rabbit anti - aurora b antibody ( provided by d. glover , university of cambridge , cambridge , uk ; giet and glover , 2001 ) diluted 1:500 and 1:200 in pbs , respectively . mouse ( diluted 1:20 ; jackson immunoresearch laboratories ) and a cy3-conjugated anti rabbit ( diluted 1:100 ; jackson immunoresearch laboratories ) secondary antibodies . after two washes ( 5 min each ) in pbs , slides were mounted in vectashield plus dapi ( vector laboratories ) to stain dna . ( 1994 ) , and were analyzed by phase contrast optics . immunostained and live preparations were examined using a microscope ( axioplan ; carl zeiss microimaging , inc . ) equipped with an hbo 50-w mercury lamp for epifluorescence and with a cooled charge - coupled device ( ccd ; photometrics ) , as described by bonaccorsi et al . they were then converted into photoshop 5.5 and used as such , or merged in pseudocolors . fsl , fsl , suo , and suo have been isolated by a cytological screen of a collection of male sterile mutants . these mutants were selected by b. wakimoto ( washington university , seattle , wa ) and d.l . lindsley ( university of california , san diego , san diego , ca ) from 12,000 viable lines , generated by e. koundakjian and c. zuker ( university of california , san diego , san diego , ca ) , each homozygous for either a second or a third ems - mutagenized chromosome . we named our mutants fusolo and solofuso , two italian terms that mean only spindle , after the cytological phenotype described here . to map suo and fsl , we used the second and third chromosome deficiency kits ( provided by the bloomington stock center , indiana university , bloomington , in ; http://flystocks.bio.indiana.edu/ ) , respectively . each of these kits includes a set of selected deficiencies that uncover about two thirds of the chromosome . fsl / tm6c and suo / cyo females were crossed to males from each pertinent deficiency stock , and the mutant / df males from each cross were tested for fertility . the double - staining techniques for actin / tubulin , myosin ii / tubulin , and anillin / tubulin ( the anti - myosin and -anillin antibodies were provided by c. field , harvard medical school , boston , ma ) were described previously ( giansanti et al . , 1999 ) . for double immunostaining of centrin / tubulin and aurora b / tubulin , testes were fixed according to protocol 3 of giansanti et al . they were then incubated overnight with both a monoclonal anti - tubulin antibody ( amersham biosciences ) diluted 1:100 in pbs and either a rabbit anti - hscen1p antibody ( provided by m. bornens , institut curie , paris , france ; paoletti et al . , 1996 ) or a rabbit anti - aurora b antibody ( provided by d. glover , university of cambridge , cambridge , uk ; giet and glover , 2001 ) diluted 1:500 and 1:200 in pbs , respectively . mouse ( diluted 1:20 ; jackson immunoresearch laboratories ) and a cy3-conjugated anti rabbit ( diluted 1:100 ; jackson immunoresearch laboratories ) secondary antibodies . after two washes ( 5 min each ) in pbs , slides were mounted in vectashield plus dapi ( vector laboratories ) to stain dna . ( 1994 ) , and were analyzed by phase contrast optics . immunostained and live preparations were examined using a microscope ( axioplan ; carl zeiss microimaging , inc . ) equipped with an hbo 50-w mercury lamp for epifluorescence and with a cooled charge - coupled device ( ccd ; photometrics ) , as described by bonaccorsi et al . they were then converted into photoshop 5.5 and used as such , or merged in pseudocolors .

a 61-year - old male patient presented to our institution with a complaint of pain in the right knee that had aggravated for the last three days . on the same knee , he underwent posterior cruciate ligament ( pcl ) reconstruction surgery due to trauma seven years prior and tka due to rheumatoid arthritis four years previously . although the patient suffered no difficulties with walking and performing daily living activities , he was admitted for three months in the recent year due to the worsening of the arthritis . he had been on methotrexate , one of the disease modifying antirheumatic drugs ( dmard ) for one year . pain , swelling , burning sensation , and limited range of motion were observed in the right knee during physical examination . the leukocyte count was 6,770/mm , erythrocyte sedimentation rate was 46 mm / hr , and c - reactive protein was 44.55 1 ) , which led us to perform joint aspiration with a suspicion of deep infection . about 50 ml of purulent exudate was aspirated and sdsd was isolated from the culture , so surgical intervention was conducted . we did not remove the interference screws inserted in the previous pcl reconstruction because the insertion site in the medial femoral condyle was not affected by the infection . in addition , the screws were so firmly fixated that removal appeared impossible without special techniques and bone loss . infiltration of more than ten multinuclear leukocytes per high power field was observed in the frozen biopsy samples . accordingly , we performed a thorough debridement of the synovial sheath and inserted a block type cement spacer impregnated with a combination of three antibiotics ( gentamycin 1 g , third generation cephalosporin 4 g , and vancomycin 4 g ) to improve infection management ( fig . the sdsd cultured before and during surgery was resistant to oxacillin in the antibiotic sensitivity test . accordingly , under the diagnosis of deep infection caused by sdsd resistant to oxacillin , vancomycin ( 2 g / day ) was administered . in addition , third generation cephalosporin ( 2 g / day , ceftriaxone sodium ) was used as a prophylactic agent to prevent other infections in the immunocompromised patient with an opportunistic infection . at seven weeks after surgery , the antibiotic treatment was discontinued because the leukocyte count , erythrocyte sedimentation rate , and c - reactive protein levels were normal and the swelling , burning sensation , and flare improved . the infection did not recur in the following two weeks , so revision tka was performed . synovial exudate was not noted during surgery and infiltration of one multinuclear leukocyte in the high power field was observed in the frozen biopsy samples ( fig . postoperatively , the burning sensation and flare continued and the c - reactive protein level increased to 53.09 mg / l . to prevent the recurrence of the sdsd infection and other infections that may be caused by the long - term hospitalization , vancomycin ( 2 g / day ) and third generation cephalosporin ( 2 g / day , ceftriaxone sodium ) were injected at the same time . the c - reactive protein was 23.88 mg / l at two weeks after surgery and 10.12 mg / l at four weeks after surgery and the symptoms improved . therefore , the antibiotic treatment was replaced with oral administration of third generation cephalosporin ( cefcapene pivoxil hydrochloride 300 mg / day ) for the following six weeks . currently , at six months after surgery , no pain , burning sensation , and swelling have been observed . from four months after surgery , heterotopic ossification in the anterior aspect of the distal femur however , magnetic resonance imaging has not revealed abnormal findings such as soft tissue inflammation ( fig . 5 ) and the range of motion has improved to 10 in flexion contracture and 75 in further flexion . coagulase - negative staphylococcus and staphylococcus aureus have been known as the most common causative organisms of deep infection after tja , followed by gram - negative bacteria , fungi , and mycobacterium tuberculosis . streptococci are mostly alpha or beta hemolytic and may become pathogenic in patients with immunological failure or malignant tumors . of these , s. pyogens ( lancefield group a ) and s. agalactiae ( lancefield group b ) have been frequently involved in infections in humans including pharyngitis , septic arthritis , and sepsis and recognized as an important pathogen of infections after tja . on the other hand , lancefield group c streptococci that may exist among the normal flora have rarely been described as a causative pathogen of infections after tja . in 2000 , kleshinski et al.4 ) first reported a case of prosthetic joint infection caused by a lancefield group c streptococcus , but it was not identified clearly whether sd was responsible for the infection because blood cultures were negative . in 1996 , vandamme et al.5 ) subdivided sd into sdse ( a human pathogen ) and sdsd ( an animal pathogen ) and reported that sd does not cause infection in humans because sdse is a part of the normal human flora and sdsd is zoonotic6 ) . however , sdse has recently been identified as a beta hemolytic pathogen that can cause laryngopharyngitis and pneumonia in immunocompromised individuals and the elderly7 ) . fernandez - martinez et al.8 ) reported a case of septic arthritis in the knee suggesting that sd can cause harm to humans . takahashi et al.9 ) emphasized the risk of sdse in the aging society where infections caused by sdse are increasingly encountered in elderly patients . in the study by koh et al.2 ) , upper limb cellulitis was caused by sdsd in a patient who was injured while cleaning a fish and was treated successfully with antibiotics . they concluded that sdsd can cause human infections especially for individuals handling livestock and seafood . our patient had no history of exposure to fish or animals , but he had been on a dmard for a continuous period due to rheumatoid arthritis . rheumatoid arthritis patients are 2.5 times more likely to have infections after tka than other patients and the use of immunosuppressive agents such as dmards increases the risk of infection10 ) . therefore , we believe that sdsd caused an opportunistic infection in our patient whose immune system was suppressed by rheumatoid arthritis medication . regarding the sd infection management , human infections caused by sdsd have not been documented in the literature . however , we believe the same treatment modalities for sdse - caused infections can also be effective for sdsd - caused infections considering that there are no differences in the phenotypic characteristics between the sdse strains and sdsd strains9 ) . lancefield group c streptococci are normally treated with penicillin and sdse frequently develops resistance to macrolide and quinolone , not to penicillin and cephalosporin9 ) . we used vancomycin in our patient based on the culture tests in which sdsd was identified as the causative pathogen and the antibiotic sensitivity test . in addition , third generation cephalosporin was injected at the same time to prevent other infections in the immunocompromised patient with an opportunistic infection . after revision arthroplasty , antibiotics were administered continuously until symptoms were improved to prevent the recurrence of the sdsd infection because of the development of postoperative symptoms and blood test results and a second infection that may be caused by the long hospitalization . sdsd can cause cross infection from animals to humans , especially in immnocompromised patients and individuals in the fishing or animal industry . human infection by sdsd after tka is very rare and can be treated with two - stage re - implantation .

severe coronary artery calcifications ( cacs ) present an ongoing treatment challenge despite the advent of various technologies for plaque debulking and reducing atherosclerotic burden prior to stent implantation . the diamondback 360 coronary orbital atherectomy ( oa ) system ( cardiovascular systems inc . , st . paul , mn , usa ) has demonstrated both safety and efficacy by facilitating stent delivery in patients with severely calcified coronary artery plaque . in addition , the device is compatible with smaller sized guide catheters and its use has been shown to be safe and feasible via the transradial approach . patients with acute coronary syndrome ( acs ) , however , have been excluded from these studies , and the utility of oa is yet to be shown in this group of acutely ill patients with a high potential for thrombus load . we present a case in which oa was used to facilitate stent implantation in a patient with acute st - elevation myocardial infarction ( stemi ) evaluated with emergent transradial coronary angiography . to the best of our knowledge , this is the first reported case of successful use of oa via the transradial approach in the setting of acute stemi . a 65-year - old female presented to the emergency room with a 3-day history of intermittent chest pain that acutely worsened . the patient was a daily smoker and was known to have type 2 diabetes mellitus . emergent transradial coronary angiography was performed via a hydrophilic coated 25 cm 6 fr right radial sheath . angiography showed a mid - left anterior descending ( lad ) , 80% stenosis but the culprit lesion was identified as a heavily calcified , 99% stenosis in the mid - segment of the right coronary artery ( rca ) ( fig . the decision was made to proceed with percutaneous coronary intervention ( pci ) and the rca lesion was crossed using a whisper guide wire . balloon angioplasty was attempted with a mini trek ii otw balloon ( 2.00 15 mm ) without adequate lesion dilatation ; there was no angiographic evidence of dissection ( fig . therefore , the diamondback 360 coronary oa system was used to facilitate lesion preparation prior to stent deployment . a temporary transvenous pacing wire was placed via the right femoral vein due to the risk of developing high - grade atrioventricular block during rca atherectomy . oa was then performed using multiple slow passes of a 1.25 mm crown both at low and high rotational speeds , achieving improved angiographic appearance ( fig . the diseased segment was then successfully pre - dilated with a 3.0 15 mm euphora balloon and a xience alpine rx drug - eluting stent ( 3.25 33 mm ) was deployed . post - dilatation was then accomplished with non - compliant euphora rx ( 3.25 12 mm ) and non - compliant emerge mr ( 3.5 8.0 mm ) balloons . thrombolysis in myocardial infarction ( timi ) 3 flow was achieved at the end of the procedure ( fig . the patient returned electively a month later and underwent successful transradial optical coherence tomography ( oct)-guided pci of the mid - lad stenosis . ( a ) coronary angiography showing a heavily calcified , 99% stenosis of the mid rca ( arrow ) . ( b ) inadequate lesion dilatation ( arrow ) following balloon angioplasty . ( c ) improved angiographic appearance of lesion ( arrow ) following orbital atherectomy . the present case illustrates the successful use of oa for the preparation of a heavily calcified lesion prior to stent implantation in the setting of acute stemi via the transradial approach . advanced age , diabetes mellitus , and renal failure are well - known risk factors for cac . treatment of coronary artery lesions where significant calcifications are present is associated with a higher incidence of non - q - wave myocardial infarction . furthermore , pci in such lesions is also associated with higher rates of restenosis and target lesion revascularization , partly due to the increased likelihood of incomplete stent apposition to the vessel wall and suboptimal stent expansion . rotational atherectomy ( ra ) has been adopted as a tool for preparation of heavily calcified coronary lesions prior to stent implantation . prior studies have shown that ra improves procedural success , although without reduction in rates of restenosis . the diamondback 360 coronary oa system has emerged as an alternative to ra and is currently approved for the treatment of severely calcified coronary lesions by the u.s . food and drug administration based on the outcomes of clinical trials [ 1 , 9 , 10 ] . the oa system uses an eccentrically mounted , diamond - coated crown that rotates over an atherectomy guide wire such that centrifugal forces lead to an orbital intracoronary motion with a luminal gain diameter proportional to the rotational speed . consequently , the 1.25 mm crown can be used to treat calcified vessels with a diameter of up to 4.0 mm while maintaining compatibility with a 6 fr guide catheter and allowing for radial access intervention even in larger coronary vessels . the feasibility of the oa system via the transradial approach is demonstrated both in our patient as well as in a previously reported case series by ruisi et al . . although ra is relatively contraindicated in the setting of acute stemi due to the concern of triggering platelet activation or causing distal embolization in the presence of thrombus , its successful use has been reported previously [ 1214 ] . similarly , the use of oa is contraindicated when angiographic evidence of thrombus is present . nonetheless , recent studies of morphological coronary characterization in patients with acs using oct have increased awareness of the fact that in addition to plaque rupture and erosion , calcified nodules are associated with a previously underestimated proportion of acs presentations . the calcified nodule lesions are associated with diameter stenoses similar to plaque rupture lesions but a higher proportion of white thrombus rather than the heavy burden of red thrombus associated with plaque rupture . to our knowledge , there have been no prior reported cases of transradial oa being used in the setting of acute stemi . in our patient , adequate lesion dilatation could not be achieved with balloon angioplasty ( fig . successful lesion debulking was achieved with the use of oa that facilitated subsequent implantation of a drug - eluting stent . this case demonstrates the safe transradial use of oa for treatment of a heavily calcified lesion in the setting of acute stemi with the use of modern oral antiplatelet therapy . although oa should be considered as contraindicated for the management of soft - ruptured plaque , which accounts for the majority of stemi presentations , its use should be considered in patients with acute myocardial infarction due to calcified lesions with low thrombotic burden to facilitate optimal treatment .

isolated subcutaneous preadipocytes from lean ( bmi < 25 ) and obese ( bmi > 30 ) subjects ( zen - bio , research triangle park , nc ) were plated on t-75 cell culture flasks and cultured at 37c and 5% co2 in dulbecco 's modified eagle 's medium ( dmem)/nutrient mix f-12 medium ( 1:1 , v / v ) supplemented with 10u / ml p / s , fbs 10% , hepes 1% and glutamine 1% ( all from gibco , invitrogen s.a , barcelona , spain ) . one week later , the isolated and expanded human subcutaneous preadipocytes were cultured ( 40.000 cells / cm ) in 12-well plates with preadipocytes medium ( zen - bio ) composed of dmem / nutrient mix f-12 medium ( 1:1 , v / v ) , hepes , fbs , penicillin and streptomycin in a humidified 37c incubator with 5% co2 . twenty - four hours after plating , cells were checked for complete confluence ( day 0 ) and differentiation was induced using differentiation medium ( dm , zen - bio ) composed of preadipocytes medium , human insulin , dexamethasone , isobutylmethylxanthine and peroxisome proliferator activated receptor ( ppar) agonists ( rosiglitazone ) . after 7 days ( day 7 ) , dm was replaced with fresh adipocyte medium ( am , zen - bio ) composed of dmem / nutrient mix f-12 medium ( 1:1 , v / v ) , hepes , fbs , biotin , panthothenate , human insulin , dexamethasone , penicillin , streptomycin and amphotericin . negative control ( nondifferentiated cell ) was performed with preadipocyte medium during all differentiation process . fourteen days after the initiation of differentiation , cells appeared rounded with large lipid droplets apparent in the cytoplasm . cells were then considered mature adipocytes , harvested , and stored at 80c for rna extraction to study oct1 and oct2 gene expression levels after human adipocyte differentiation . mmol / l ) , cimetidine ( sigma , barcelona , spain ) ( 0.5 mmol / l and 5 mmol / l ) and metformin and cimetidine coincubations were performed with differentiation medium along 14 days . the differentiation was monitored with the fatty acid synthase ( fasn , hs00188012_m1 , applied biosystems , madrid , spain ) , adiponectin ( adipoq , hs00605917_m1 , applied biosystems ) , acetyl - coa carboxylase ( acc1 , hs00167385_m1 , applied biosystems ) , peroxisome proliferator - activated receptor ( ppar , hs00234592_m1 , applied biosystems ) , fatty acid binding protein 4(fabp4 , hs00609791_m1 , applied biosystems ) , interleukin 6 ( il6 , hs00985639_m1 , applied biosystems ) , and monocyte chemoattractant protein-1 ( mcp1 , hs00234140_m1 , applied biosystems ) expression . subcutaneous adipose tissue was obtained from six obese subjects undergoing open abdominal surgery ( gastrointestinal bypass ) under anesthesia after an overnight fast . the mean age was 46 6.4 years ( range , 3958 years ) and the bmi 44.9 12.4 kg / m . medical histories , physical examinations , electrocardiogram , and blood screening showed that all patients were in good health . the study had the approval of the ethics committee and all patients gave informed written consent . samples of subcutaneous adipose tissue were immediately transported to the laboratory ( 510 min ) . the tissue was cut with scissors into small pieces ( 510 mg ) , and incubated in buffer plus albumin ( 3 ml / g of tissue ) for 530 min . after incubation , the tissue explants were centrifuged for 30 s at 400 g. then 100 mg of minced tissue was placed into 1-ml m199 ( gibco , invitrogen ) containing 10% fbs ( hyclone , thermo fisher scientific ) , 100 unit / ml penicillin ( gibco , invitrogen ) , 100 g / ml streptomycin ( gibco , invitrogen ) , and incubated for 48 h in suspension culture under aseptic conditions ( 15 ) . control treatment ( m199 ) and metformin ( sigma , barcelona , spain ) ( 0.1 and 1 mmol / l ) were compared . after 48 h , all samples were immediately flash - frozen in liquid nitrogen before being stored at 80c . to evaluate cell integrity , lactate dehydrogenase activity released from damaged cells was analyzed by cytotoxicity detection kit ( lactate dehydrogenase [ ldh ] ; roche diagnostics , mannheim , germany ) according to the manufacturer 's instructions in all treatments . oct1 , acc1 , fasn , adipoq , ppar , il-6 , and mcp-1 relative gene expression were analyzed using taqman technology suitable for relative genetic expression quantification ( described below ) . a group of 118 adipose tissue samples ( 57 visceral and 61 subcutaneous depots ) , from participants with a bmi within 20 and 68 kg / m , who were recruited at the endocrinology service of the hospital universitari dr . all subjects were of caucasian origin and reported that their body weight had been stable for at least 3 months before the study . all subjects gave written informed consent after the purpose of the study was explained to them . adipose tissue samples were obtained from subcutaneous and visceral depots during elective surgical procedures ( cholecystectomy , abdominal hernia surgery , and gastric by - pass surgery ) . all samples were washed , fragmented , and immediately flash - frozen in liquid nitrogen before stored at 80c . to perform the isolation of adipocyte and stromo - vascular fraction , tissues were washed three to four times with pbs and suspended in an equal volume of pbs supplemented with 1% bovine serum and 0.1% collagenase type i prewarmed to 37c . the tissue was placed in a shaking water bath at 37c with continuous agitation for 60 min , and centrifuged for 5 min at 300 to 500 g at room temperature . the adipose tissue fractionation was performed from eight subcutaneous fat depots . to study gene expressions , rna was prepared from these samples using rneasy lipid tissue mini kit ( qiagen , izasa sa , barcelona , spain ) . the integrity of each rna sample was checked by agilent bioanalyzer ( agilent technologies , palo alto , ca ) . total rna was quantified by means of spectrophotometer ( genequant , ge health care , piscataway nj ) reverse transcribed to cdna using a high capacity cdna archive kit ( applied biosystems ) according to the manufacturer 's protocol . gene expression was assessed by real time pcr using an abi prism 7,000 sequence detection system ( applied biosystems , madrid , spain ) , using taqman technology suitable for relative genetic expression quantification . the commercially available and prevalidated taqman primer / probe sets used were as follows : endogenous control ppia ( 4333763 , cyclophilin a , applied biosystems , madrid , spain ) and target gene human organic cation transporter 1 and human organic cation transporter 2 ( oct1 , hs00427552_m1 ; and oct2 , hs00161893_m1 , applied biosystems ) . the rt - pcr taqman reaction was performed in a final volume of 25 l . the cycle program consisted of an initial denaturing of 10 min at 95c , and then 40 cycles of 15-s denaturizing phase at 95c and 1 min annealing and extension phase at 60c . a threshold cycle ( ct value ) was obtained for each amplification curve , and a ct value was first calculated by subtracting the ct value for human cyclophilin a ( ppia ) rna from the ct value for each sample . fold changes compared with the endogenous control were then determined by calculating 2 , so gene expression results are expressed as expression ratios relative to ppia gene expression according to manufacturers ' guidelines . adipose tissue lysates ( from eight subcutaneous fat depots ) were washed in ice - cold pbs followed by homogenization assay using ripa lysis buffer ( millipore , madrid , spain ) supplemented with a protease inhibitor cocktail ( sigma - aldrich , madrid , spain ) at 4c for 30 min . cellular debris were eliminated by centrifugation of the diluted samples at 14,000 g for 30 min ( 4c ) . ripa protein extracts ( 50 g ) were separated by sds - page and transferred to nitrocellulose membranes by conventional procedures . membranes were immunoblotted with oct1 , fasn , and -actin antibodies ( santa cruz biotechnology , ca ) . anti - rabbit igg and anti - mouse igg coupled to horseradish peroxidase was used as a secondary antibody . horseradish peroxidase activity was detected by chemiluminescence , and quantification of protein expression was performed using scion image software . amp - activated protein kinase ( ampk ) activity was determined measuring pthr172ampk by elisa ( kho0651 , invitrogen , barcelona , spain ) . the analytical sensitivity of this assay is < 1 unit / ml of ampk [ pt172 ] . the average recovery was 90% the specificity of this assay for phosphorylated ampk ( pt172 ) was confirmed by peptide competition . intra- and interassay coefficients of variation for all these determinations were between 5 and 10% . acetyl - coa carboxylase- ( acc ) activity was calculated measuring pser79acc1 and acc1 ( total ) by elisa ( kho1061 and kho1071 , respectively ; invitrogen , barcelona , spain ) . the analytical sensitivity of these assays are < 0.5 units / ml of human acc1 [ ps79 ] and human acc1 , respectively . the specificity of this assay for phosphorylated acc1 [ ps79 ] was confirmed by peptide competition . intra- and interassay coefficients of variation for all these determinations were between 5 and 10% . differentiation was monitored by morphologic assessment and oil red o staining . for oil red staining , cells were washed twice with pbs , fixed in 4% formaldehyde for 1 h , and stained for 30 min with 0.2% oil red o solution in 60% isopropanol . cells were then washed several times with water , and excess water was evaporated by placing the stained cultures at 32c . to determine the extent of adipose conversion , 0.2 ml of isopropanol was added to the stained culture dish . the extracted dye was immediately removed by gentle pipeting and its optical density was monitored spectrophotometrically at 500 nm using a multiwell plate reader ( model anthos labtec 2010 1.7 reader ) . cell counting was assessed by trypan blue dye exclusion using a neubauer hemacytometer , after 14 days differentiation of human subcutaneous preadipocytes , in triplicate . to evaluate cell integrity , ldh activity released from damaged cells was analyzed by cytotoxicity detection kit ( ldh ; roche diagnostics , mannheim , germany ) according to the manufacturer 's instructions . unless otherwise stated , descriptive results of continuous variables are expressed as mean and sd for gaussian variables , or median and interquartile range . parameters that did not fulfill normal distribution were mathematically transformed to improve symmetry for subsequent analyses . unpaired and paired t tests were used to compare clinical variables and oct-1 and 2 gene expressions according to obesity status . nonparametric tests , mann whitney u and wilcoxon 's tests , were used to evaluate the effects of metformin and cimetidine treatments in vitro and ex vivo . isolated subcutaneous preadipocytes from lean ( bmi < 25 ) and obese ( bmi > 30 ) subjects ( zen - bio , research triangle park , nc ) were plated on t-75 cell culture flasks and cultured at 37c and 5% co2 in dulbecco 's modified eagle 's medium ( dmem)/nutrient mix f-12 medium ( 1:1 , v / v ) supplemented with 10u / ml p / s , fbs 10% , hepes 1% and glutamine 1% ( all from gibco , invitrogen s.a , barcelona , spain ) . one week later , the isolated and expanded human subcutaneous preadipocytes were cultured ( 40.000 cells / cm ) in 12-well plates with preadipocytes medium ( zen - bio ) composed of dmem / nutrient mix f-12 medium ( 1:1 , v / v ) , hepes , fbs , penicillin and streptomycin in a humidified 37c incubator with 5% co2 . twenty - four hours after plating , cells were checked for complete confluence ( day 0 ) and differentiation was induced using differentiation medium ( dm , zen - bio ) composed of preadipocytes medium , human insulin , dexamethasone , isobutylmethylxanthine and peroxisome proliferator activated receptor ( ppar) agonists ( rosiglitazone ) . after 7 days ( day 7 ) , dm was replaced with fresh adipocyte medium ( am , zen - bio ) composed of dmem / nutrient mix f-12 medium ( 1:1 , v / v ) , hepes , fbs , biotin , panthothenate , human insulin , dexamethasone , penicillin , streptomycin and amphotericin . negative control ( nondifferentiated cell ) was performed with preadipocyte medium during all differentiation process . fourteen days after the initiation of differentiation , cells appeared rounded with large lipid droplets apparent in the cytoplasm . cells were then considered mature adipocytes , harvested , and stored at 80c for rna extraction to study oct1 and oct2 gene expression levels after human adipocyte differentiation . mmol / l ) , cimetidine ( sigma , barcelona , spain ) ( 0.5 mmol / l and 5 mmol / l ) and metformin and cimetidine coincubations were performed with differentiation medium along 14 days . the differentiation was monitored with the fatty acid synthase ( fasn , hs00188012_m1 , applied biosystems , madrid , spain ) , adiponectin ( adipoq , hs00605917_m1 , applied biosystems ) , acetyl - coa carboxylase ( acc1 , hs00167385_m1 , applied biosystems ) , peroxisome proliferator - activated receptor ( ppar , hs00234592_m1 , applied biosystems ) , fatty acid binding protein 4(fabp4 , hs00609791_m1 , applied biosystems ) , interleukin 6 ( il6 , hs00985639_m1 , applied biosystems ) , and monocyte chemoattractant protein-1 ( mcp1 , hs00234140_m1 , applied biosystems ) expression . subcutaneous adipose tissue was obtained from six obese subjects undergoing open abdominal surgery ( gastrointestinal bypass ) under anesthesia after an overnight fast . the mean age was 46 6.4 years ( range , 3958 years ) and the bmi 44.9 12.4 kg / m . medical histories , physical examinations , electrocardiogram , and blood screening showed that all patients were in good health . the study had the approval of the ethics committee and all patients gave informed written consent . samples of subcutaneous adipose tissue were immediately transported to the laboratory ( 510 min ) . the tissue was cut with scissors into small pieces ( 510 mg ) , and incubated in buffer plus albumin ( 3 ml / g of tissue ) for 530 min . after incubation , the tissue explants were centrifuged for 30 s at 400 g. then 100 mg of minced tissue was placed into 1-ml m199 ( gibco , invitrogen ) containing 10% fbs ( hyclone , thermo fisher scientific ) , 100 unit / ml penicillin ( gibco , invitrogen ) , 100 g / ml streptomycin ( gibco , invitrogen ) , and incubated for 48 h in suspension culture under aseptic conditions ( 15 ) . control treatment ( m199 ) and metformin ( sigma , barcelona , spain ) ( 0.1 and 1 mmol / l ) were compared . after 48 h , all samples were immediately flash - frozen in liquid nitrogen before being stored at 80c . to evaluate cell integrity , lactate dehydrogenase activity released from damaged cells was analyzed by cytotoxicity detection kit ( lactate dehydrogenase [ ldh ] ; roche diagnostics , mannheim , germany ) according to the manufacturer 's instructions in all treatments . oct1 , acc1 , fasn , adipoq , ppar , il-6 , and mcp-1 relative gene expression were analyzed using taqman technology suitable for relative genetic expression quantification ( described below ) . a group of 118 adipose tissue samples ( 57 visceral and 61 subcutaneous depots ) , from participants with a bmi within 20 and 68 kg / m , who were recruited at the endocrinology service of the hospital universitari dr . all subjects were of caucasian origin and reported that their body weight had been stable for at least 3 months before the study . all subjects gave written informed consent after the purpose of the study was explained to them . adipose tissue samples were obtained from subcutaneous and visceral depots during elective surgical procedures ( cholecystectomy , abdominal hernia surgery , and gastric by - pass surgery ) . all samples were washed , fragmented , and immediately flash - frozen in liquid nitrogen before stored at 80c . to perform the isolation of adipocyte and stromo - vascular fraction , tissues were washed three to four times with pbs and suspended in an equal volume of pbs supplemented with 1% bovine serum and 0.1% collagenase type i prewarmed to 37c . the tissue was placed in a shaking water bath at 37c with continuous agitation for 60 min , and centrifuged for 5 min at 300 to 500 g at room temperature . to study gene expressions , rna was prepared from these samples using rneasy lipid tissue mini kit ( qiagen , izasa sa , barcelona , spain ) . the integrity of each rna sample was checked by agilent bioanalyzer ( agilent technologies , palo alto , ca ) . total rna was quantified by means of spectrophotometer ( genequant , ge health care , piscataway nj ) reverse transcribed to cdna using a high capacity cdna archive kit ( applied biosystems ) according to the manufacturer 's protocol . gene expression was assessed by real time pcr using an abi prism 7,000 sequence detection system ( applied biosystems , madrid , spain ) , using taqman technology suitable for relative genetic expression quantification . the commercially available and prevalidated taqman primer / probe sets used were as follows : endogenous control ppia ( 4333763 , cyclophilin a , applied biosystems , madrid , spain ) and target gene human organic cation transporter 1 and human organic cation transporter 2 ( oct1 , hs00427552_m1 ; and oct2 , hs00161893_m1 , applied biosystems ) . the rt - pcr taqman reaction was performed in a final volume of 25 l . the cycle program consisted of an initial denaturing of 10 min at 95c , and then 40 cycles of 15-s denaturizing phase at 95c and 1 min annealing and extension phase at 60c . a threshold cycle ( ct value ) was obtained for each amplification curve , and a ct value was first calculated by subtracting the ct value for human cyclophilin a ( ppia ) rna from the ct value for each sample . fold changes compared with the endogenous control were then determined by calculating 2 , so gene expression results are expressed as expression ratios relative to ppia gene expression according to manufacturers ' guidelines . adipose tissue lysates ( from eight subcutaneous fat depots ) were washed in ice - cold pbs followed by homogenization assay using ripa lysis buffer ( millipore , madrid , spain ) supplemented with a protease inhibitor cocktail ( sigma - aldrich , madrid , spain ) at 4c for 30 min . cellular debris were eliminated by centrifugation of the diluted samples at 14,000 g for 30 min ( 4c ) . ripa protein extracts ( 50 g ) were separated by sds - page and transferred to nitrocellulose membranes by conventional procedures . membranes were immunoblotted with oct1 , fasn , and -actin antibodies ( santa cruz biotechnology , ca ) . anti - rabbit igg and anti - mouse igg coupled to horseradish peroxidase was used as a secondary antibody . horseradish peroxidase activity was detected by chemiluminescence , and quantification of protein expression was performed using scion image software . amp - activated protein kinase ( ampk ) activity was determined measuring pthr172ampk by elisa ( kho0651 , invitrogen , barcelona , spain ) . the analytical sensitivity of this assay is < 1 unit / ml of ampk [ pt172 ] . the average recovery was 90% the specificity of this assay for phosphorylated ampk ( pt172 ) was confirmed by peptide competition . intra- and interassay coefficients of variation for all these determinations were between 5 and 10% . acetyl - coa carboxylase- ( acc ) activity was calculated measuring pser79acc1 and acc1 ( total ) by elisa ( kho1061 and kho1071 , respectively ; invitrogen , barcelona , spain ) . the analytical sensitivity of these assays are < 0.5 units / ml of human acc1 [ ps79 ] and human acc1 , respectively . the specificity of this assay for phosphorylated acc1 [ ps79 ] was confirmed by peptide competition . intra- and interassay coefficients of variation for all these determinations were between 5 and 10% . red staining , cells were washed twice with pbs , fixed in 4% formaldehyde for 1 h , and stained for 30 min with 0.2% oil red o solution in 60% isopropanol . cells were then washed several times with water , and excess water was evaporated by placing the stained cultures at 32c . to determine the extent of adipose conversion the extracted dye was immediately removed by gentle pipeting and its optical density was monitored spectrophotometrically at 500 nm using a multiwell plate reader ( model anthos labtec 2010 1.7 reader ) . cell counting was assessed by trypan blue dye exclusion using a neubauer hemacytometer , after 14 days differentiation of human subcutaneous preadipocytes , in triplicate . to evaluate cell integrity , ldh activity released from damaged cells was analyzed by cytotoxicity detection kit ( ldh ; roche diagnostics , mannheim , germany ) according to the manufacturer 's instructions . statistical analyses were performed using spss 12.0 software . unless otherwise stated , descriptive results of continuous variables are expressed as mean and sd for gaussian variables , or median and interquartile range . parameters that did not fulfill normal distribution were mathematically transformed to improve symmetry for subsequent analyses . unpaired and paired t tests were used to compare clinical variables and oct-1 and 2 gene expressions according to obesity status . nonparametric tests , mann whitney u and wilcoxon 's tests , were used to evaluate the effects of metformin and cimetidine treatments in vitro and ex vivo . the differentiation process was monitored through fasn , acc1 , ppar , and adipoq gene expression ( fig . oct1 , fasn , acc1 , ppar and adiponectin gene expression during differentiation of human preadipocytes from obese ( a ) and lean subjects ( b ) . * p < 0.05 vs. day 0 . in isolated preadipocytes from lean and obese subjects , oct1 gene expression was significantly increased during the differentiation process in parallel to adipogenic genes ( fig . oct1 gene expression was positively associated with fasn ( r = 0.8 , p < 0.001 ) , acc1 ( r = 0.66 , p = 0.003 ) , ppar ( r = 0.65 , p = 0.004 ) and adipoq ( r = 0.73 , p = 0.001 ) gene expressions and negatively with il-6 gene expression ( r = 0.7 , p = 0.002 ) . metformin ( 5 mmol / l ) decreased the expression of lipogenic genes ( fig . 4 ) , leading to impaired differentiation of human preadipocytes . cotreatment with cimetidine restored adipogenesis ( fig . fasn , acc1 , ppar , adiponectin , oct1 , fabp4 , il-6 , mcp-1 gene expressions after metformin ( 5 mmol / l ) cotreatments in differentiated human adipocytes . * p < 0.05 vs. differentiated adipocytes ; + p < 0.05 vs. metformin ( 5 mmol / l ) treatment . oil red o staining and ldh activity in differentiated human adipocytes , and after metformin ( 5 mmol / l ) and cimetidine ( 0.5 and 5 mmol / l ) cotreatment . * p < 0.05 vs. differentiated adipocytes ; + p < 0.05 vs. metformin ( 5 mmol / l ) treatment . ( a high - quality color representation of this figure is available in the online issue . ) however , metformin administration did not increase il-6 and mcp-1 gene expression in comparison with differentiated adipocytes . high doses of cimetidine ( 5 mmol / l ) significantly decreased adiponectin gene expression ( fig . 3 ) . oct1 gene expression did not change significantly after metformin or cimetidine treatments ( fig . 3 ) . metformin treatment increased significantly ampk activity , increasing ampk and consequently acc1 . in cimetidine * p < 0.05 vs. differentiated adipocytes ; + p < 0.05 vs. metformin ( 5 mmol / l ) treatment . ldh activity was measured to evaluate the cytotoxicity in each of the treatments . no significant difference was found comparing undifferenciated and differenciated adipocytes , whether treated or untreated with cimetidine ( 0.5 mmol / l and 5 mmol / l ) . after metformin ( 5 mmol / l ) treatment , ldh activity tended to be higher compared with differentiated adipocytes ( fig . 4 ) . metformin ( 0.1 and 1 mmol / l ) led to decreased adipogenic and inflammatory gene expression ( fig . fasn , acc1 , ppar , adiponectin , oct1 , il-6 , mcp-1 gene expressions after metformin ( 0.1 and 1 mmol / l ) in subcutaneous adipose tissue explants . * p < 0.05 vs. control ( vehicle ) treatment . in addition , baseline oct1 gene expression was associated with the metformin - induced adipogenic gene expression reduction ( acc1 , adipoq , fasn , and ppar ) , suggesting that the higher the oct-1 gene expression , the higher the effects of metformin ( for 0.1 mmol / l , r = 0.81 , p = 0.04 , r = 0.94 , p = 0.004 , r = 0.96 , p = 0.002 and r = 0.68 , p = 0.1 , respectively ; and for 1 mmol / l , r = 0.76 , p = 0.07 , r = 0.94 , p = 0.004 , r = 0.88 , p = 0.02 , and r = 0.64 , p = 0.17 , respectively ) . treatment of adipose tissue with metformin ( 0.1 and 1 mmol / l ) did not change lactate dehydrogenase activity ( cell integrity ) in comparison with control treatment ( fig . the oct1 gene was similarly expressed in subcutaneous and visceral adipose tissue [ 0.002 ( 0.00050.0034 ) versus 0.0015 ( 0.00040.003 ) r.u . , p = 0.4 , n = 31 ] . in fact , the expression of oct1 in both fat depots correlated significantly ( r = 0.54 , p < 0.001 ) . the relative oct1 gene expression was lower compared with lipogenic genes ( 100- and 10-fold decrease in comparison with fasn and acc1 gene expression ) . in both subcutaneous and visceral fat depots , oct1 gene expression correlated significantly with bmi ( r = 0.46 , p < 0.001 and r = 0.47 , p < 0.001 , respectively ) and percent fat mass ( r = 0.36 , p = 0.005 , and r = 0.49 , p < 0.001 , respectively ) ( fig in addition , oct1 gene expression correlated significantly with diastolic blood pressure ( r = 0.35 , p = 0.04 ) in visceral adipose tissue . no associations were detected with other metabolic parameters ( age , systolic blood pressure , fasting glucose , fasting triglycerides , hdl cholesterol , and ldl cholesterol ) . anthropometrical and biochemical variables of study participants values are mean sd . * comparing obese subjects vs. nonobese . oct1 relative gene expression in both visceral and subcutaneous adipose tissue according to obesity status . there is evidence indicating that mrna levels may not necessarily predict the translated protein levels . in this regard , we measured oct1 protein in adipose tissue by western blot . a : oct1 protein levels in subcutaneous adipose tissue according to obesity status . non - normalized oct1 protein and normalized for -actin values ( relative levels ) are shown . b : oct1 gene expression in stromovascular cells and mature adipocytes from subcutaneous adipose tissue . to gain insight about the type of cells from adipose tissue that expressed oct1 , we analyzed oct1 gene expression in stromo - vascular cells and mature adipocytes from subcutaneous adipose tissue . in stromo - vascular cells oct1 gene expression was significantly higher than in mature adipocytes ( 1.8-fold increase , p = 0.01 ; fig . the differentiation process was monitored through fasn , acc1 , ppar , and adipoq gene expression ( fig . oct1 , fasn , acc1 , ppar and adiponectin gene expression during differentiation of human preadipocytes from obese ( a ) and lean subjects ( b ) . * p < 0.05 vs. day 0 . in isolated preadipocytes from lean and obese subjects , oct1 gene expression was significantly increased during the differentiation process in parallel to adipogenic genes ( fig . oct1 gene expression was positively associated with fasn ( r = 0.8 , p < 0.001 ) , acc1 ( r = 0.66 , p = 0.003 ) , ppar ( r = 0.65 , p = 0.004 ) and adipoq ( r = 0.73 , p = 0.001 ) gene expressions and negatively with il-6 gene expression ( r = 0.7 , p = 0.002 ) . metformin ( 5 mmol / l ) decreased the expression of lipogenic genes ( fig . 4 ) , leading to impaired differentiation of human preadipocytes . cotreatment with cimetidine restored adipogenesis ( fig . fasn , acc1 , ppar , adiponectin , oct1 , fabp4 , il-6 , mcp-1 gene expressions after metformin ( 5 mmol / l ) and cimetidine ( 0.5 and 5 mmol / l ) cotreatments in differentiated human adipocytes . * p < 0.05 vs. differentiated adipocytes ; + p < 0.05 vs. metformin ( 5 mmol / l ) treatment . oil red o staining and ldh activity in differentiated human adipocytes , and after metformin ( 5 mmol / l ) and cimetidine ( 0.5 and 5 mmol / l ) cotreatment . * p < 0.05 vs. differentiated adipocytes ; + p < 0.05 vs. metformin ( 5 mmol / l ) treatment . ( a high - quality color representation of this figure is available in the online issue . ) however , metformin administration did not increase il-6 and mcp-1 gene expression in comparison with differentiated adipocytes . high doses of cimetidine ( 5 mmol / l ) significantly decreased adiponectin gene expression ( fig . 3 ) . oct1 gene expression did not change significantly after metformin or cimetidine treatments ( fig . 3 ) . metformin treatment increased significantly ampk activity , increasing ampk and consequently acc1 . in cimetidine mmol / l ) cotreatment on ampk , acc1 , and acc1 concentrations . * p < 0.05 vs. differentiated adipocytes ; + p < 0.05 vs. metformin ( 5 mmol / l ) treatment . no significant difference was found comparing undifferenciated and differenciated adipocytes , whether treated or untreated with cimetidine ( 0.5 mmol / l and 5 mmol / l ) . after metformin ( 5 mmol / l ) treatment , ldh activity tended to be higher compared with differentiated adipocytes ( fig . metformin ( 0.1 and 1 mmol / l ) led to decreased adipogenic and inflammatory gene expression ( fig . fasn , acc1 , ppar , adiponectin , oct1 , il-6 , mcp-1 gene expressions after metformin ( 0.1 and 1 mmol / l ) in subcutaneous adipose tissue explants . * p < 0.05 vs. control ( vehicle ) treatment . in addition , baseline oct1 gene expression was associated with the metformin - induced adipogenic gene expression reduction ( acc1 , adipoq , fasn , and ppar ) , suggesting that the higher the oct-1 gene expression , the higher the effects of metformin ( for 0.1 mmol / l , r = 0.81 , p = 0.04 , r = 0.94 , p = 0.004 , r = 0.96 , p = 0.002 and r = 0.68 , p = 0.1 , respectively ; and for 1 mmol / l , r = 0.76 , p = 0.07 , r = 0.94 , p = 0.004 , r = 0.88 , p = 0.02 , and r = 0.64 , p = 0.17 , respectively ) . treatment of adipose tissue with metformin ( 0.1 and 1 mmol / l ) did not change lactate dehydrogenase activity ( cell integrity ) in comparison with control treatment ( fig . 6 ) . the oct1 gene was similarly expressed in subcutaneous and visceral adipose tissue [ 0.002 ( 0.00050.0034 ) versus 0.0015 ( 0.00040.003 ) r.u . in fact , the expression of oct1 in both fat depots correlated significantly ( r = 0.54 , p < 0.001 ) . the relative oct1 gene expression was lower compared with lipogenic genes ( 100- and 10-fold decrease in comparison with fasn and acc1 gene expression ) . in both subcutaneous and visceral fat depots , oct1 gene expression correlated significantly with bmi ( r = 0.46 , p < 0.001 and r = 0.47 , p < 0.001 , respectively ) and percent fat mass ( r = 0.36 , p = 0.005 , and r = 0.49 , p < 0.001 , respectively ) ( fig . 7 ) . in addition , oct1 gene expression correlated significantly with diastolic blood pressure ( r = 0.35 , p = 0.04 ) in visceral adipose tissue . no associations were detected with other metabolic parameters ( age , systolic blood pressure , fasting glucose , fasting triglycerides , hdl cholesterol , and ldl cholesterol ) . oct1 relative gene expression in both visceral and subcutaneous adipose tissue according to obesity status . there is evidence indicating that mrna levels may not necessarily predict the translated protein levels . in this regard , we measured oct1 protein in adipose tissue by western blot . non - normalized oct1 protein and normalized for -actin values ( relative levels ) are shown . b : oct1 gene expression in stromovascular cells and mature adipocytes from subcutaneous adipose tissue . to gain insight about the type of cells from adipose tissue that expressed oct1 , we analyzed oct1 gene expression in stromo - vascular cells and mature adipocytes from subcutaneous adipose tissue . in stromo - vascular cells oct1 gene expression was significantly higher than in mature adipocytes ( 1.8-fold increase , p = 0.01 ; fig . the oct1 gene was similarly expressed in subcutaneous and visceral adipose tissue [ 0.002 ( 0.00050.0034 ) versus 0.0015 ( 0.00040.003 ) r.u . , p = 0.4 , n = 31 ] . in fact , the expression of oct1 in both fat depots correlated significantly ( r = 0.54 , p < 0.001 ) . the relative oct1 gene expression was lower compared with lipogenic genes ( 100- and 10-fold decrease in comparison with fasn and acc1 gene expression ) . in both subcutaneous and visceral fat depots , oct1 gene expression correlated significantly with bmi ( r = 0.46 , p < 0.001 and r = 0.47 , p < 0.001 , respectively ) and percent fat mass ( r = 0.36 , p = 0.005 , and r = 0.49 , p < 0.001 , respectively ) ( fig . in addition , oct1 gene expression correlated significantly with diastolic blood pressure ( r = 0.35 , p = 0.04 ) in visceral adipose tissue . no associations were detected with other metabolic parameters ( age , systolic blood pressure , fasting glucose , fasting triglycerides , hdl cholesterol , and ldl cholesterol ) . anthropometrical and biochemical variables of study participants values are mean sd . * comparing obese subjects vs. nonobese . oct1 relative gene expression in both visceral and subcutaneous adipose tissue according to obesity status . there is evidence indicating that mrna levels may not necessarily predict the translated protein levels . in this regard , we measured oct1 protein in adipose tissue by western blot . 8a ) . a : oct1 protein levels in subcutaneous adipose tissue according to obesity status . non - normalized oct1 protein and normalized for -actin values ( relative levels ) are shown . b : oct1 gene expression in stromovascular cells and mature adipocytes from subcutaneous adipose tissue . to gain insight about the type of cells from adipose tissue that expressed oct1 , we analyzed oct1 gene expression in stromo - vascular cells and mature adipocytes from subcutaneous adipose tissue . in stromo - vascular cells oct1 gene expression was significantly higher than in mature adipocytes ( 1.8-fold increase , p = 0.01 ; fig . metformin has been described to be more effective in obese subjects , and the degree of obesity has been found to constitute a strong predictor of metformin effects ( 3,4 ) . the main findings of this study are : 1 ) oct1 gene expression was detectable in whole adipose tissue ( similarly in the subcutaneous and visceral fat depots ) and in isolated adipocytes ; 2 ) this expression increased significantly with adipocyte differentiation in association with lipogenic ( fasn , acc , pparg ) and adipogenic ( adipoq ) genes ; 3 ) metformin ( 5 mmol / l ) blunted the adipocyte differentiation of human preadipocytes in parallel to decreasing significantly the expression of proinflammatory mediators ; 4 ) blocking metformin action using cimetidine reversed these effects ; and 5 ) in ex - vivo experiments , metformin led to decreased adipogenic and proinflammatory gene expression . to the best of our knowledge , this is the first study evaluating metformin effects and oct1 gene expression in human adipocytes . the increased oct1 gene expression in stromo - vascular cells compared with adipocytes suggests that metformin action on stromo - vascular cells might contribute to systemic effects . considering the importance of oct1 in the metformin response ( 9 ) , we suggest that the higher oct1 gene expression in obese subjects is behind the increased metformin effects in these subjects . interestingly we found that baseline oct1 gene expression was associated with the metformin - induced adipogenic gene expression reduction ( acc1 , adipoq , fasn and ppar ) , suggesting that the higher the oct-1 gene expression , the higher the effects of metformin . the inhibitory effects of metformin on adipogenesis have been previously shown in the 3t3-l1 cell line ( 1113 ) via ampk activation . however , to our knowledge , these actions have not been explored in human preadipocytes . in the current study , metformin ( 5 mmol / l ) significantly decreased the expression of adipogenic ( fasn , acc , pparg , adipoq ) genes and the formation of lipid droplets , increasing ampk activity ( ampk and consequently acc1 ) . the adipocyte differentiation ( increasing lipogenic gene expression and decreasing ampk activity ) was restored dose - dependently when the oct1 blocker agent cimetidine was used as a cotreatment . in agreement with our data , the response to metformin was inhibited in mice models in which the oct1 gene was deleted ( oct1 ) . subjects carrying a single nucleotid polymorphism associated with a decrease in oct1 gene expression also showed decreased metformin effects ( 4,10,16 ) . importantly , metformin administration significantly decreased il-6 and mcp-1 gene expression in adipocytes and in adipose tissue explants . recently , metformin has been shown to display anti - inflammatory effects in endothelial cells by inhibiting tnf-induced ikk/ phosphorylation , ikappab- degradation , and il-6 production ( 17,18 ) . the mode of action of metformin has yet to be fully established . in muscle , liver , and endothelial cells , the metabolic changes induced by metformin appear to be mediated by the amp - activated protein kinase ( ampk ) . ampk acts as a sensor of the cellular energy status , being switched on by an increased atp demand or by processes that interfere with atp production such as ischemia . the activated form of ampk switches on catabolic pathways while switching off atp - consuming processes ( 19 ) . it has been reported that metformin binds to complex i of the mitochondrial respiratory chain , and this could in part explain how this drug acts ( 20 ) . the inhibition of complex i would cause a decrease in energy supply that would in turn lead to a higher amp / atp ratio , and the concomitant activation of ampk . however , although metformin has been associated with weight loss , glitazones lead to increased adipocyte differentiation and weight gain . metformin stimulates catabolic pathways in white adipose tissue through the activation of ampk , reducing the triglyceride stores as reflected by the smaller size of the adipocytes ( 13,21 ) . these effects are achieved through an increase in lipolysis and -oxidation , which would imply that there is no release of fatty acids and that they are oxidized within the adipocyte . other authors have described that metformin inhibited adipocyte differentiation ( using rat mesenchymal stem cells ) ( 22 ) . we propose here that oct1 density in adipose tissue is a factor that can significantly influence all these effects of metformin . furthermore , fisher et al . ( 14 ) have shown that metformin induces glucose uptake independent of insulin in subcutaneous and visceral human adipocytes . in conclusion , oct1 gene expression and protein levels the increased oct1 gene expression in adipose tissue of obese subjects might contribute to increased metformin action in these subjects .

patients were recruited as part of the cdc emerging infections program s unex study and met all project inclusion criteria , including absence of important preexisting medical conditions , development of an illness with defined features suggestive of infectious etiology , severity leading to admission to an intensive care unit or to death , and failure of cultivation and routinely available serologic tests to provide a microbiologic diagnosis ( 1 ) . of specimens available from more than 139 cases fulfilling these criteria , only those from anatomic sites that are usually culture negative in healthy persons and those from patients with syndromes of suspected bacterial etiology were selected for broad - range bacterial pcr analysis . the median age of the 46 patients ( 21 female , 25 male ) was 18.5 years ( range 1 to 47 years ) . the patients resided in new haven county ( ct ) ( n=5 ) , minnesota ( n=6 ) , oregon ( n=20 ) , or three counties in the san francisco bay area ( n=15 ) . partial 16s rdna sequences were determined from three streptococcus pneumoniae clinical isolates obtained from patients in the san francisco bay area during 1997 and 1998 ( strains sf10014 , sf10175 , and sf10314 ; california department of health services , berkeley , ca ) . louis , mo ) was used as a positive control and as template for measurement of pcr assay sensitivity in reactions with primers fd1mod and 16s1rr - b ( see below ) . dna was extracted from serum ( n=4 ) , blood ( n=25 ) , blood culture ( n=9 ) , and bone marrow ( n=2 ) specimens by using the chaotropic properties of guanidine isothiocyanate , followed by dna extraction and purification by alcohol precipitation with the isoquick nucleic acid extraction kit ( orca research , bothell , wa ) . pleural fluid ( n=3 ) was digested with proteinase k ( sigma ) and non - ionic detergent , essentially as described ( 12 ) . all specimens were analyzed with pcr methods using at least one of the following four bacterial broad - range 16s rdna primer pairs : fd1mod ( 5-agagtttgatcytggytyag-3 , corresponding to positions 8 - 27 in the e. coli 16s rrna gene ) ( 4 ) and 16s1rr - b ( 5-ctttacgcccartrawtccg-3 , 575 - 556 ) ( 6 ) ; 63f ( 5-caggcctaacacatgcaagtc-3 ) ( 13 ) and 16s1rr - b ; 8f2 ( 5-tggagagtttgatcctggctcag-3 , 5 - 27 ) and 806r ( 5-ggactaccagggtatctaat-3 , 806 - 787 ) ( 3 ) ; and 515f ( 5-gtgccagcagccgcggtaa-3 , 515 - 533 ) ( 3 ) and 13r ( 5-aggcccgggaacgtattcac-3 , 1390 - 1371 ) ( 3 ) . the presence of amplifiable dna and pcr inhibitors was assessed with human beta - globin gene pcrs and primers pco4 and gh20 ( 3 ) . forty - three specimens from 34 patients were analyzed with primer pair fd1mod/16s1rr - b . reactions based on these primers contained 10 mm tris - hcl ph 8.3 , 50 mm kcl , 1.5 mm mgcl2 , 200 m each deoxynucleoside triphosphates , 2.5 u amplitaq ld dna polymerase ( pe biosystems , foster city , ca ) , and 5-l template , as well as 20 pmol of each primer in a total volume of 50 l . after a denaturation step of 3 min at 94c , pcr steps at 94c for 30 sec , 56c for 30 sec , and 72c for 30 sec were repeated 30 to 36 times , followed by an elongation step at 72c for 7 min in a geneamp pcr system 2400 thermal cycler ( pe biosystems ) . products were detected by agarose gel electrophoresis and dna staining with ethidium bromide . in most cases , the presence of product was also assessed by attempting to generate recombinant plasmid clones ( see below ) . pcr amplification conditions used with some other bacterial broad - range primer pairs included 100-l reaction volumes and a 4-min initial denaturation step . reactions with all reagents necessary for pcr , including water processed in parallel with clinical specimens , were performed as negative controls . pcr products were sequenced directly , as well as after cloning , by using the ta or topo cloning systems ( invitrogen , carlsbad , ca ) . automated abi prism 373 or 377 dna sequencers ( pe biosystems ) and bigdye terminator cycle sequencing chemistry were used for determining dna sequences . both dna strands were analyzed , and base - editing was performed together with manual review of the electropherograms , using autoassembler ( pe biosystems ) . the 16s rdna sequences were compared with those in the genbank database by using the blast search tool ( 14 ) . in addition , the automated 16s rrna sequence alignment tool and phylogenetic algorithms from the arb software package ( technical university of munich , germany ) were used ( 15 ) . complete sequences of the four rrna operons of a s. pneumoniae serotype 4 strain were obtained from the institute for genomic research , rockville , md ( 16 ) . unpublished sequence data from the rrna operons of a different s. pneumoniae strain were obtained from smithkline beecham , philadelphia , pa . patients were recruited as part of the cdc emerging infections program s unex study and met all project inclusion criteria , including absence of important preexisting medical conditions , development of an illness with defined features suggestive of infectious etiology , severity leading to admission to an intensive care unit or to death , and failure of cultivation and routinely available serologic tests to provide a microbiologic diagnosis ( 1 ) . of specimens available from more than 139 cases fulfilling these criteria , only those from anatomic sites that are usually culture negative in healthy persons and those from patients with syndromes of suspected bacterial etiology were selected for broad - range bacterial pcr analysis . the median age of the 46 patients ( 21 female , 25 male ) was 18.5 years ( range 1 to 47 years ) . the patients resided in new haven county ( ct ) ( n=5 ) , minnesota ( n=6 ) , oregon ( n=20 ) , or three counties in the san francisco bay area ( n=15 ) . partial 16s rdna sequences were determined from three streptococcus pneumoniae clinical isolates obtained from patients in the san francisco bay area during 1997 and 1998 ( strains sf10014 , sf10175 , and sf10314 ; california department of health services , berkeley , ca ) . louis , mo ) was used as a positive control and as template for measurement of pcr assay sensitivity in reactions with primers fd1mod and 16s1rr - b ( see below ) . dna was extracted from serum ( n=4 ) , blood ( n=25 ) , blood culture ( n=9 ) , and bone marrow ( n=2 ) specimens by using the chaotropic properties of guanidine isothiocyanate , followed by dna extraction and purification by alcohol precipitation with the isoquick nucleic acid extraction kit ( orca research , bothell , wa ) . pleural fluid ( n=3 ) was digested with proteinase k ( sigma ) and non - ionic detergent , essentially as described ( 12 ) . all specimens were analyzed with pcr methods using at least one of the following four bacterial broad - range 16s rdna primer pairs : fd1mod ( 5-agagtttgatcytggytyag-3 , corresponding to positions 8 - 27 in the e. coli 16s rrna gene ) ( 4 ) and 16s1rr - b ( 5-ctttacgcccartrawtccg-3 , 575 - 556 ) ( 6 ) ; 63f ( 5-caggcctaacacatgcaagtc-3 ) ( 13 ) and 16s1rr - b ; 8f2 ( 5-tggagagtttgatcctggctcag-3 , 5 - 27 ) and 806r ( 5-ggactaccagggtatctaat-3 , 806 - 787 ) ( 3 ) ; and 515f ( 5-gtgccagcagccgcggtaa-3 , 515 - 533 ) ( 3 ) and 13r ( 5-aggcccgggaacgtattcac-3 , 1390 - 1371 ) ( 3 ) . the presence of amplifiable dna and pcr inhibitors was assessed with human beta - globin gene pcrs and primers pco4 and gh20 ( 3 ) . forty - three specimens from 34 patients were analyzed with primer pair fd1mod/16s1rr - b . reactions based on these primers contained 10 mm tris - hcl ph 8.3 , 50 mm kcl , 1.5 mm mgcl2 , 200 m each deoxynucleoside triphosphates , 2.5 u amplitaq ld dna polymerase ( pe biosystems , foster city , ca ) , and 5-l template , as well as 20 pmol of each primer in a total volume of 50 l . after a denaturation step of 3 min at 94c , pcr steps at 94c for 30 sec , 56c for 30 sec , and 72c for 30 sec were repeated 30 to 36 times , followed by an elongation step at 72c for 7 min in a geneamp pcr system 2400 thermal cycler ( pe biosystems ) . products were detected by agarose gel electrophoresis and dna staining with ethidium bromide . in most cases , the presence of product was also assessed by attempting to generate recombinant plasmid clones ( see below ) . pcr amplification conditions used with some other bacterial broad - range primer pairs included 100-l reaction volumes and a 4-min initial denaturation step . reactions with all reagents necessary for pcr , including water processed in parallel with clinical specimens , were performed as negative controls . pcr products were sequenced directly , as well as after cloning , by using the ta or topo cloning systems ( invitrogen , carlsbad , ca ) . automated abi prism 373 or 377 dna sequencers ( pe biosystems ) and bigdye terminator cycle sequencing chemistry were used for determining dna sequences . both dna strands were analyzed , and base - editing was performed together with manual review of the electropherograms , using autoassembler ( pe biosystems ) . the 16s rdna sequences were compared with those in the genbank database by using the blast search tool ( 14 ) . in addition , the automated 16s rrna sequence alignment tool and phylogenetic algorithms from the arb software package ( technical university of munich , germany ) were used ( 15 ) . complete sequences of the four rrna operons of a s. pneumoniae serotype 4 strain were obtained from the institute for genomic research , rockville , md ( 16 ) . unpublished sequence data from the rrna operons of a different s. pneumoniae strain were obtained from smithkline beecham , philadelphia , pa . bacterial 16s rdna sequences were detected in specimens from 8 of the 46 patients . when the same pcr conditions were used , negative control reactions failed to yield a visible product of the expected size . the absence of large amounts of inhibitors of the pcr reaction in specimens from the remaining 38 patients was demonstrated by the ability to amplify human beta - globin sequences from those specimens . the specimen types with positive bacterial 16s rdna pcr results were csf ( three patients ) , pleural fluid ( two patients ) , bone marrow aspirate ( one patient ) , and blood culture bottle material ( two patients ) ( table 1 ) . the sensitivity of this pcr assay with primers fd1mod/16s1rr - b was 5 - 50 e. coli 16s rdna gene copies , as assessed by using purified e. coli dna as template . a second cerebrospinal ( csf ) sample obtained 5 days later also contained s. pneumoniae rdna . specimens from five subjects were analyzed with broad - range bacterial rdna primer pairs 8f2/806r and 515f/13r . pcr products of approximately the anticipated size ( 804 and 876 bp , respectively ) were generated from specimens from cases xor34 and xor06 . from case xor34 , this sequence shared 99.3% similarity ( 1332/1342 nucleotide positions ) with the four identical 16s rrna gene sequences from each of the recently published complete n. meningitidis serogroup a and b genomes ( genbank accession numbers al162758 and ae002551 ) ; these genbank sequences were the closest match to the xor34 case sequence . direct sequencing of pcr products from case xor06 generated 654 bp of sequence homologous to the n. meningitidis serogroup a and b 16s rrna genes . limited csf from this case prevented a more complete sequence analysis of the bacterial rdna in this specimen . two csf specimens drawn on different days from case xca73 each generated pcr products whose directly determined sequences were identical ( 526/526 bp ) to the published 16s rdna sequence from a s. pneumoniae reference strain ( nctc 7465 t , aj001246 ) and with the 16s rdna sequences from three s. pneumoniae strains isolated from patients in the same region and from the same time period ( sf10014 , sf10175 and sf10314 ) ; these reference sequences were determined as part of this study ( figure ) . the sequences of two clones from each of the amplified xca73 products were identical to the sequences obtained directly from the pcr products . the csf specimens from cases xor06 , xor34 , and xca73 had been collected after empiric antibiotic therapy had begun . the tree was rooted with staphylococcus aureus and escherichia coli as outgroups and constructed with a maximum - likelihood algorithm using 468 homologous sequence positions that were selected from a sequence dataset of 497 total positions . streptococcus pneumoniae clinical isolates sequenced for this study are marked as sf10175 , sf10314 , and sf10014 . all six sequences from the case xca73 cerebrospinal fluid were identical to those of the s. pneumoniae reference strain ( accession no . aj001246 ) . pcr = polymerase chain reaction . from two of the three culture - negative pleural fluid specimens ( cases xeb44 and xmn22 ) dna products of the expected size ( ~568 bp ) were amplified with bacterial broad range primers fd1mod/16s1rr - b . in addition to analysis of cloned molecules from these products , the pcr product from case xeb44 was sequenced directly ; insufficient product was obtained from the pleural fluid of case xmn22 for direct sequencing . from the xeb44 pleural fluid specimen , three recombinant plasmid clones from this product were characterized by dna sequencing ( table 2 ) . one clone sequence from each of the pleural fluid specimens ( clones c and g in table 2 ) was identical ( 497/497 and 509/509 bp ) to an s. pneumoniae rdna sequence deposited in genbank ( reference strain nctc 7465 , # aj001246)(figure ) . however , four other clones from xeb44 ( clones a , b , d , and e ) and one from xmn22 ( clone f ) contained one or two positions with variant nucleotides . this variability was confirmed in case xeb44 by examining the sequence obtained directly from the pcr product ( table 2 , original pcr product ) . in contrast , ambiguities were not seen in directly sequenced pcr products from the three clinical isolates ( sf10014 , sf10175 , sf10314 ) , nor in the sequences obtained from case xca73 csf . anucleotides in bold type differ with the reference strain sequence at the indicated rdna position . the variation observed in these pneumococcal sequences , a model of the secondary structure of the s. pneumoniae 16s rrna was constructed , based on the published secondary structure of the bacillus subtilis homologue ( 17 ) ( supplemental data available at http://relman.stanford.edu ) . two of the five polymorphic positions are predicted to participate in a stem structure and can therefore be assessed for compensatory changes at the paired position . of the two , only the polymorphism at position 442 creates a noncanonical pairing , thereby suggesting a possible taq polymerase incorporation error . intrachromosomal allelic variability was another possible explanation for the observed polymorphisms in these pleural fluid s. pneumoniae 16s rdna sequences . however , the complete genome sequence of each of two s. pneumoniae strains contains four identical copies of the 16s rrna operon ( 16 ) ( unpub . therefore , our data are consistent with the hypothesis that patient xeb44 was infected in the pleural space by at least two different s. pneumoniae strains . insufficient amounts of data from the patient xmn22 specimen hamper speculation of a similar nature for this case . pcr analysis of a bone marrow aspirate from a case of fatal respiratory disease ( xor63 ) showed a 16s rdna sequence that was 99.8% ( 527/528 bp ) similar to 16s rdna sequences from stenotrophomonas maltophilia ( strain atcc 13637 , # ab008509 ) . this sequence was obtained directly from the pcr product as well as from two recombinant clones ; all were identical . a bone marrow aspirate from another patient in our study did not reveal bacterial 16s rdna sequences . two blood culture bottle specimens ( from cases xor56 and xct29 ) of nine that were studied gave positive results for bacterial rdna using pcr primer pair fd1mod/16s1rr - b . all these specimens had been collected from inoculated culture bottles that had failed to exhibit signs of bacterial growth during routine incubation . from one of the two positive specimens ( case xor56 ) , sequences obtained directly from the pcr product and from two recombinant clones were identical ( at 535 positions ) to the 16s rdna sequence of a staphylococcus epidermidis type strain ( atcc 14990 t , # d83363 ) . from the other pcr - positive blood culture specimen ( case xct29 ) , direct sequencing of the pcr products indicated the presence of multiple , different dna molecules . two clones were 99.8% ( 545/546 bp ) similar to 16s rdna sequences from enterococcus faecium ( strain dsm20477 , # aj276355 ) and e. durans ( strain dsm20633 , # aj276354 ) . one clone was 99.8% similar to a sequence from bacillus stearothermophilus ( strain if012550 , # ab021196 ) , one was 98.6% similar ( 509/516 ) to a sequence from a halomonas sp . ( strain ml-028 , # af139994 ) , and one clone with a truncated sequence was 96.4% similar ( 323/335 bp ) to several bacillus species . the clinical relevance of the rdna findings in the etiology of these two cases remains uncertain . in this study , we applied a molecular diagnostic method , broad - range bacterial rdna pcr to 59 specimens from 46 unex cases . positive findings were obtained for eight of the cases . in six of these cases , the organism detected in the specimens is a known cause of the type of syndrome the patient had . the diagnosis of infectious diseases with molecular data , rather than from cultivation or serology , requires a careful examination of criteria for causation ( 18 ) and may require new molecular surveys of host microbial ecology . streptococcus pneumoniae and n. meningitidis are common causes of bacterial meningitis in the united states ( 19 ) , and s. pneumoniae is a well - known cause of pneumonia and empyema . despite some unconfirmed reports of s. pneumoniae dna in the serum of healthy persons ( 2022 ) , our failure to find other bacterial sequences in the two pleural fluid specimens with broad - range primers leads us to conclude that s. pneumoniae was the cause of these two cases of respiratory tract disease . in csf , dna from these organisms has been detected only in meningitis cases . similarly , s. maltophilia was the only bacterial species detected in a privileged anatomic site ( bone marrow ) in case xor63 . the known association of this organism with lower respiratory tract disease and septicemia strongly suggests that it caused at least some of this patient s respiratory disease . however , additional specimens were not available for confirmation ; in addition , s. maltophilia is ubiquitous in nature and , despite our negative controls , may in theory contaminate laboratory reagents . we speculate that it may have been acquired after the patient 's admission to the hospital and contributed to the late stages of the patient s illness . in the cases of multisystem failure ( xor56 ) and cardiac disease ( myocarditis , xct29 ) , the role played by the organisms detected in the blood culture specimens in causing disease is much less clear . although s. epidermidis was also cultivated from the blood of case xor56 by local physicians , it is a well - recognized blood culture contaminant . are also occasional blood culture contaminants , and their dna may contaminate blood culture media ( 23 ) . is the most likely disease - causing agent among those detected in case xct29 . in general , with reliance on molecular methods , conclusions about causation are most reliably drawn after 1 ) repeated detection of the same organism in separate specimens from the same patient collected only at clinically relevant time points ; 2 ) direct detection of the organism in situ in areas of pathology ( 24 ) ; 3 ) documentation of response to appropriate therapy ; and 4 ) assessment of specific immune responses . many of the same concerns and goals are applicable to cultivation - based diagnosis . in practice , especially when case investigation occurs after resolution of illness or death , as in this project , the preferred type and amount of specimens are not always available . our findings from these unexplained cases raise several important questions . why were nt these well - known bacterial pathogens detected during the routine care of these patients ? specimens are not always collected from the appropriate anatomic site , at the appropriate time , in a sufficient amount , nor processed in an optimal fashion . in addition , the sensitivity of cultivation and serology is imperfect , even for organisms amenable to these approaches . most of the project patients had received broad - range antibiotics before specimens were collected for this study . [ in applying broad - range rdna pcr to clinical specimens , one confronts the problem of 16s rdna sequence microheterogeneity . small discrepancies between directly amplified sequences and reference sequences in public databases pose difficulties for the definition of taxon boundaries , and complicate clinical interpretation of laboratory data ( 25,26 ) . in our investigation , the finding of streptococcus pneumoniae 16s rdna sequence microheterogeneity in the pleural fluid of a patient with culture - negative empyema suggests that some cases of pneumococcal disease , and perhaps other bacterial disease , may be caused by multiple concurrent strains of the same species . why have we failed to explain most of these project cases ? are some unexplained cases caused by novel or previously unrecognized pathogens ? our experiments addressed only the possibility of a bacterial cause with bacterial domain - specific broad - range pcr primers ; current efforts include broad - range primers for various families of viruses , and for fungi and the archaea . multiple broad - range primer pairs may be necessary for each group ( as we describe for the bacteria ) to detect unrecognized organisms with polymorphisms in conserved primer recognition sites . in addition to the specimen problems listed above , pcr inhibitors may cause some false - negative results . the timing of specimen acquisition may also be relevant , since the average delay between onset of illness and specimen collection was 9 days for our pcr - positive cases versus 16 days for all cases studied with broad - range pcr . although bacterial dna persists longer than cultivatable organisms after therapy is initiated ( 27 ) , the former still has a limited half - life . finally , it must be kept in mind that some of these cases may not have a microbial cause . applying broad - range bacterial pcr to this set of difficult clinical cases raised several important points about the future use of this diagnostic approach . first , certain specimen types , such as csf ( 3/16 specimens positive ) , pleural fluid ( 2/3 positive ) , and bone marrow ( 1/2 positive ) , may provide higher diagnostic yield in bacterial disease than other types , such as serum and blood . second , the microbial sequence background in clinical specimens from healthy persons ( e.g. , blood ) must be better characterized before findings from ill persons can be reliably interpreted . third , sequence microheterogeneity in anatomically isolated sites of microbial disease may be more common than previously assumed . there are several possible explanations for the s. pneumoniae 16s rdna heterogeneity in this specimen ( see above ) ; however , we believe that at least some of the heterogeneity is best explained by the presence of two ( or more ) s. pneumoniae strains . to our knowledge this is the first case of invasive disease associated with multiple s. pneumoniae strains , although dual infections with other pathogens have been described ( 28,29 ) . in fact , carriage of multiple strains of haemophilus influenzae was recently shown to correlate with an increased risk for otitis media in children ( 30 ) , and mixed - strain infections with mycobacterium tuberculosis have also been reported ( 31 ) . multiple - strain infections with s. pneumoniae may have been previously missed with culture - based methods because of the common laboratory practice of subculturing a single representative when there is only one apparent colony morphotype . the search for microbial causes of unexplained illnesses and deaths must continue to integrate traditional and molecular methods and will inevitably challenge assumptions about the mechanisms of microbial disease causation . refined techniques , novel approaches , and study of other populations such as immunocompromised or impaired hosts are likely to provide new insights into the spectrum of infectious diseases .

this work was supported by the national 863 project ( no : 2002aa302608 ) , from the ministry of science and technology , china .

eating disorders have been defined as characterized by persistence disturbance of eating or eating - related behavior that results in the altered consumption or absorption of food and that significantly impairs health or psychosocial functioning.1 the last version of the diagnostic and statistical manual of mental disorders , fifth edition ( dsm-5),1 places eating disorders in the feeding and eating disorders chapter , featuring several modifications of dsm - iv - tr . these changes include the inclusion of three disorders avoidant / restrictive food intake disorder ( arfid ) , rumination disorder , and pica previously described in the feeding and eating disorder of infancy or early childhood chapter and subsequently removed with the aim to produce a single chapter for eating disorders in childhood and adulthood . it includes anorexia nervosa ( an ) , bulimia nervosa ( bn ) , binge eating disorder ( bed ) , arfid , rumination disorder , pica , other specified feeding or eating disorder , and unspecified feeding or eating disorder.1 the modifications of the diagnostic criteria appearing in the dsm-5 are relatively few , although significant , and involve clarifications to language and adjustments to existing diagnoses.2 in an , the amenorrhea criterion was removed , and in bn , the threshold frequency of binge episodes and compensatory behaviors were decreased as the two subtypes ( purging type and non - purging type ) were deleted . moreover , the dsm-5 officially recognized bed as a formal diagnosis.1 in reviewing and revising these disorders , the dsm-5 eating disorders work group had two objectives : clarify the existing diagnostic criteria , and decrease the frequency with which individuals , presenting for eating disorder treatment , were assigned to the heterogeneous category residual category , other specified feeding or eating disorder ( or , in dsm - iv , eating disorders not otherwise specified [ ednos ] ) , reassigning someone to a specific diagnosis . le grange et al,3 in a nationwide study in the us , reported that 80.97% of adolescents and 75.38% of adults with an eating disorder were classified as having ednos , making it the most common eating disorder diagnosis . conversely , by using dsm-5 criteria , many of these individuals will be returned to a diagnosis with a greater clinical utility . the national comorbidity survey replication estimates the lifetime prevalence of an , bn , and bed at 0.9% , 1.5% , and 3.5% in women and 0.3% , 0.5% , and 2.0% in men , respectively.4 the new criteria adopted in the last edition of the dsm included in the main diagnoses the majority of patients who were classified as ednos , maintaining this category as a residual condition . however , several data seem to indicate that the new dsm-5 criteria determine mainly quantitative changes , and some issues related to the dsm categorization of eating disorders were not solved with the new edition . for example , it is noteworthy that the majority of the diagnoses change across time and a considerable number of an patients develop bn , and vice versa.5,6 the dsm categories can only represent a temporary condition that would eventually changes with time . indeed , several psychopathological dimensions , such as body image disorder or emotion dysregulation , represent stable markers associated with eating disorders . in this regard , dsm-5 modifications seem to represent quantitative rather than qualitative changes to the previous criteria.7 moreover , the relationship of eating disorder psychopathology with other conditions outside the dsm categories , such as obsessive compulsive and autism spectrum , is still far from clarified . indeed , the psychopathology of eating disorders changes across time under the influence of environmental factors , determining the emergence of new phenotypes . these conditions are still less investigated and are not clearly identified in a diagnostic category . in the light of these considerations , this review took into consideration the historic evolution of the eating disorder concept up to the last version of the dsm , to the latest proposal for a new conceptualization of the eating disorder spectrum , and the new emergent eating disorders and behaviors . in particular , we focused on what is known about the symptoms , epidemiology , assessment , and diagnostic boundaries of a new problematic eating pattern called orthorexia nervosa ( on ) that could be accepted as a new psychological syndrome , as emphasized by an increasing number of scientific articles in the last few years.811 although the symptomatology of an shows an evolution related to environmental factors across history , it is important not to consider it as a contemporary disorder ( table 1 ) . the first examples of self - starvation in western countries have been reported as starting from the widespread diffusion of gnostic philosophy and christianity , both of which promoted a dichotomy between the evil , material world , and the holiness of souls.12 christian hermits researched purification through self - starvation,13 and it seems that saint jerome professed the ascetic regime benefits to roman women , to the extent that a roman girl died of self - starvation following his precepts.1214 during the middle age , and in particular from the 13th to the 16th century , it is possible to collect various evidence of extreme , self - induced fasting , often leading to premature death by starvation , such as catherina from siena.15 the characteristic sex difference was already evident , with fasting reported as a peculiar trait of feminine approach to medieval asceticism16 and female sainthood ideals were often related to self - sacrifice practices . deprivation of food , except for the ritual of eucharist , was an element of spirituality along with reclusion , self - flagellation , humble dressing , and other practices.17 a close relationship between inanition and spirituality in the middle age was described , although most of the cases of self - starvation were ascribed to demonic possessions.12,18 all fasting women were believed suspicious ( even in the case of st caterina ) and only highborn charismatic ladies could convince men of the holy nature of their habits.15,18 some authors named the common fasting habits reported in holy women as holy anorexia ( also known as anorexia mirabilis).6,15,16,19 this condition differs from an in focusing on spiritual purity instead of drive for thinness and overevaluation of body shape and body weight , and it is also associated with other penitential practices , as seen earlier.19 during the renaissance period , religious context became less associated with extreme fasting , and new patterns of food deprivation appeared . starving abilities were often explained with a mix of spiritual and material beliefs , but the trend toward medical explanations progressively increased , especially in the 18th century . in 1770 , morton published the seminal monography the author stated that this kind of fasting was caused by an ill and morbid state of the spirits , supposing a psychological etiology.20 finally , it is important to consider the evolution of the meaning of self - starvation during the last 3 centuries . food restriction was progressively distanced from the religious connotation and was deeply interconnected with the body image self - representation . indeed , since the mid-18th century , the ideal of feminine beauty slowly switched from a rounded figure to a slim and slender appearance . industrialization led more women ( in particular from lower classes ) to work , and an ethereal and frail beauty became instead an upper - class statement , a demonstration of efficiency , prosperity , and delicacy of mind.21 an example was provided by the poet lord byron who promoted the new ideal of beauty as pale , languid body , anguished and surrounded by a melancholic aura.18,22 a similar ideal of feminine allure is also observable in pre - raphaelites art , popular in the 19th century.18,22,23 in this framework , the case of the empress elizabeth of austria , also known as sissy , who followed strict diets and practiced strenuous physical activity , is remarkable . with her tall and very thin figure , during the second half of the 19th century , she embodied the modern ideal of beauty , based upon thinness , which progressively gained popularity until the 20th century.18 the ideal body shape for woman changes over time to suit the cultural and social norms . at one time , women were expected to aspire to a curvaceous , ample figure . over the past 30 years the ever - growing fitness industry has carried the popular misconception that health equals thinness . miller and pumariega,24 from a sociological perspective , ascribed these changes in eating disorders to the increasingly globalized , interconnected world that exposes more people to the societal pressures common to the western culture emphasizing female body image and thinness . moreover , foreign exchange programs and immigration can also predispose individuals , especially adolescents and young adults , to an eating disorder that contains features of the native culture blended with this pressure to conform . authors considered the example of the middle east , where vomiting rather than restriction were more frequent symptoms of an , likely reflecting cultural values or traditions that make the act of vomiting more feasibly acceptable than restriction.24 to date , in the western world , the sharp contrast between the wide availability of cheap , calorific , and highly palatable foods and the excessive value placed on slimness and dietary restraint , along with the daily bombardment with images of emaciated supermodels and other media images of thin role models , has meant that weight and shape concerns and dieting are the norm among young women.25 the recent increase of eating disorders may reflect a true increase in the incidence of these disorders , greater recognition by clinicians , and enhanced awareness of sufferers as a result of mass - media coverage.26 the evolution of the empirical method and positivism led to new approaches in the field of medicine , psychiatry , and in particular also in the way eating disorders were conceptualized . for example , the first complete pathological nosography was proposed by erasmus darwin in 1794 . later , darwin categorized a voluntary fasting practice that would eventually lead to death , caused in young women by the obsessive idea of being too fat.27 the french physician luis victor marc author of trait de la folie des femmes enceintes , des nouvelles accouches et de nourices , published in 1858 , and of trait pratique des maladies mentales published in 1862 wrote a paper in 1860 that could be recognized as one of the first attempts to describe , from a proper psychiatric point of view , the nosography of what is currently defined as an.28 in this work , he reported two clinical cases , outlining the delusional beliefs which led to food - refusal . in the second half of the 19th century , food - refusal was progressively described from a clinical point of view . lasegue29 and gull30 presented a complete medical description of anorexia , considered the first true clinical recognition of the disorder . gull coined the term anorexia nervosa to distinguish the disorder from the term hysteria , resulting in anorexia being considered a psychological disorder . after its acceptance as a psychogenic disorder in the late 1800s , an was the first eating disorder placed in the diagnostic and statistical manual of mental disorder ( dsm ) in its first edition ( dsm - i),31 being considered a psychophysiological reaction ( a neurotic illness ) . the second publication of the dsm - ii,32 placed an under special symptoms feeding disturbances , which also included pica and rumination . later on , in the dsm - iii33 and in its revised version ( dsm - iii - r),34 eating disorders were classified under disorders of childhood or adolescence , perhaps in part , contributing to previous underdiagnosis of later - onset cases . the american psychiatric association ( apa ) created two specific categories that formally recognized the diagnosis of eating disorders : an and binge eating ( called bulimia in dsm - iii and bn in dsm - iii - r and dsm - iv).34,35 in the dsm - iv , all other clinically significant eating disorder symptoms were absorbed by the residual categories of ednos and bed , included under disorders for further research . subsequently , in the dsm - iv - tr , eating disorders moved to an independent section.36 the dsm-5 chapter for eating disorder in addition to pica , an , bn , bed , and arfid provides a section named other specified feeding or eating disorder , in which are included some other peculiar pathological eating patterns , like atypical an ( all other criteria for an are met , but weight is in the normal range ) , and bn or bed with lower episode frequency and/or lasting <3 months . this section includes purging disorder ( recurrent purging behavior to influence weight or shape , without binge eating ) and night eating syndrome , characterized by recurrent episodes of night eating , as manifested by eating after awakening from sleep or excessive food consumption after the evening meal.1 the first attempt to understand the causes of self - starvation encompasses biological as well as psychological interpretations . for example , some clinicians first hypothesized hormonal etiology,37 while others doubted a hormonal etiology . indeed , sheehan and summers38 documented significant clinical differences between anorexia and pituitary atrophy and proposed a psychological etiology . on a different perspective , according to a psychoanalytic interpretation , the refusal to eat should be considered as a manifestation of a defense against a dreaded unconscious wish for oral impregnation.39 during the 1960s and 1970s , a crucial role of family environment was postulated , and an anorexogenic family was associated with the development of an.40 this model stressed the anorexic s confusion between her own body and the internalized maternal bad object , and suggests that exercise and starvation could allow better control over the body itself.41 bruch42 gained long - standing experience in treating patients with eating disorders and singled out the disturbed perception of the body as a significant feature of an . the author describes the anorexic as lacking an autonomous sense of self and a continued obedience to parental figures , leading to an inability to master the psychological tasks of adolescence such as individuation and separation from the family . the anorexic turns to extreme control over her body because everything else in her life appears out of control . thereafter , palazzoli41,43 confirmed these theories adding the notion of lack of differentiation between one s own body and the maternal object . bemporad12 suggested that control over the body via starvation , exercise , and , at times , self - punishment , has provided a vehicle for psychopathology in females since the middle ages and that this form of behavior flourished in certain periods of history and receded in others . those historical epochs in which females , in contemporary nonindustrialized , non - westernized societies , have a role limited to nurturing and procreation , were dominated by its male citizens , and suffered economic hardship , do not seem to have experienced frequent episodes of female self - starvation . in contrast , those periods that offered substantial opportunities for women beyond a basic biological role , such as the renaissance and late victorian eras which were more egalitarian and more affluent , seemed to have witnessed spiraling rates of self - starvation . this finding is exemplified in some modern muslim societies , and where , despite very high per capita income , females social roles continue to be determined by male dictates and eating disorders are not reported . moreover , it should be underlined that not all the historical settings are equally favorable for the development of an . as palazzoli pointed out,43 lack of food and/or economic depression this hypothesis could explain the observed reduction of self - starvation cases in the early middle ages or during the second world war , and its gradual increase in step with the postwar economic recovery.43 with the advent of new biotechnologies ( molecular biology , neuroimaging ) , the current scientific approach to the etiology of eating disorders is multifactorial , including sociocultural factors , underlying personality and behavioral traits , and neurobiological basis , in particular genetic factors and heritability . social and cultural context could promote peculiar kinds of food intake management and control above others , also influencing the subjective and semantic aspects of pathological manifestations in patients with a genetic vulnerability to develop this disorder.19 as is the case for other psychiatric disorders , the psychopathology of eating disorders is thought to arise from the interplay of multiple risk and protective factors , despite the fact that the challenge for the future is to understand better the relative importance of neurobiological and psychosocial risk factors and how these elements interact.40 as previously reported , the new edition of the dsm represents a relevant step toward the nosography of eating disorders , including the majority of clinical phenotypes into the main diagnostic categories . however , patients who seek for a treatment represent only the tip of an iceberg , encompassing subthreshold conditions , as well as high - risk population according to a continuum of common psychopathological features . moreover , other features typically associated with clinical presentation of eating disorders challenged the actual nosological system based on the categorical approach . for example , there is a substantial fluidity between diagnoses across time,5,44 and a relevant overlap with other psychiatric and medical conditions such as obsessive compulsive disorder ( ocd ) , obesity , and atypical manifestations . for this reason , researchers began focusing on attitudinal and behavioral traits rather than full syndromes.40 in line with this perspective , the spectrum approach may represent a valid tool to overcome the actual limitation of the eating disorder diagnoses . the term spectrum has been used frequently in psychiatry to refer to putative etiologically related clinical features.4547 eating disorders spectrum involves core , atypical and subclinical symptoms and signs , temperament and personality traits , and behavioral patterns that , as a whole , represent a range of psychiatric symptomatology linked to eating disorders . spectrum symptoms may develop as prodromes to a full - blown disorder , or occur as vulnerability factors for the development of a not - yet - fully expressed disorder , or as sequelae of a previous disorder.48,49 the eating disorders spectrum concept , as for the other psychiatric disorders , was created by clinical experience of the pisa and pittsburgh groups , with the aim of defining whether atypical , mild , and subthreshold symptomatology ( usually considered soft and irrelevant ) , are effectively associated with a significant impact on everyday life with special regard to social impairment and to discriminate between different phenotypes of patients.26 the concept of a spectrum could represent a new instrument to better describe the complex pattern of the psycho - pathological features and behaviors of eating disorders , which have been recently found to be widespread across the general population , overcoming the boundaries of dsm categories . indeed , new eating habits , with possible pathological implications , come to the observation of clinicians . for example , researchers identified a maladaptive behavior peculiar to males , among which eating disorders seem to be increasingly prevalent;50 muscle dysmorphia a possible lack of muscularity could be perceived as a malformation . considering that this particular phenotype seems not to share the psychopathological core of eating disorders , leone et al51 suggested that muscle dysmorphia should be eventually categorized as a subtype of body dysmorphic disorder . another emerging phenomenon is diabulimia , which refers to people with type 1 diabetes intentionally avoiding taking insulin for the purpose of causing weight loss.52 in drunkorexia , the food intake is restricted before drinking alcohol : this behavior has been highlighted in particular among college students.53 an alarming restrictive eating pattern which can involve women during or after pregnancy is pregorexia . in this framework , women try to reduce caloric intake , or excessively intensify physical exercise due to the desire to avoid or control pregnancy weight gain.54 although attention to food selection is not pathological itself , and considering the emphasis given by media on proper nutrition , the emergence of on as a new eating behavior has been emphasized by an increasing public interest . , is characterized by highly sensitive cognitions and worries about healthy nutrition leading to such an accurate food selection that a correct diet becomes the most important part of life.55 the term orthorexia nervosa , derived from the greek words orthos ( correct ) and orexis ( appetite ) . dunn and bratman summarized in more detail the clinical picture of this condition in a recent review.56 individuals with higher tendency to on are primarily characterized by nutritional beliefs leading to a greater importance given to the perceived healthiness and nutritional properties rather than to taste and enjoyment of the foods.9,57 in some cases , there is a strict focus on biological nondairy vegetarianism , veganism , or raw food . the food quality , source , packaging , and processing are carefully checked daily , due to pervasive preoccupations with health - from - food and the desire to improve one s own physical health and well - being . apart from meals , a great amount of time is consumed by intrusive , food - related thoughts , with chronic worrying about food flaws and health threats , resulting in a severe distress or impairment of relationships , school , and work domains.10,5860 as with the other conditions mentioned , on is not formally present in dsm-5,1 neither in the section on disorders requiring more scientific research , nor in icd-10.61 considering the heterogeneity of features described earlier , it is still the object of debate whether on can be considered a single , defined syndrome , a variance of other syndromes , or merely a behavioral and culturally influenced attitude.62,63 moroze et al10 proposed four diagnostic criteria for on , based on the review of literature,56,59,64 underscoring the fact that these criteria will have to be corroborated from validation studies along the lines of other dsm-5 diagnostic entities before they could be accepted into a future version of the dsm . in particular , moroze et als10 criterion b refers to impairment , caused by obsessional preoccupation of physical health due to an unbalanced diet and specify the severe distress or impairment of social , academic , or vocational functioning owing to obsessional thoughts and behaviors focusing on patient s beliefs about healthy eating . as far as the diagnostic boundaries are concerned , it is of note that this condition shows similarities and differences with an and ocd , which are themselves often comorbid.65,66 even if on and an share abnormal eating attitudes and behaviors , and on and an patients both have a poor insight about the consequences of their disorders,67,68 the core beliefs of the two syndromes are different in nature.8,11 as a matter of fact , an patients are mainly worried about body image , the quantity of food consumed , and gaining weight . in these individuals , the eating pattern is the consequence of the need to lose weight , and self - esteem depends on the weight lost . however , it is of note that severe orthorexic attitude toward food can be a risk factor to evolve to an.67 on the other hand , considering ocd , both syndromes share high anxiety traits , a need to exert control , perfectionism , and concerns about contamination , whereas the most significant difference is the ego - syntonic content of obsessions characterizing individuals with higher tendency to on with a limited insight.56 at present , using the dsm classification system , disordered eating driven by the need to follow an obsessively rigid diet designed to promote good health would likely be best classified as arfid . in fact , individuals with a tendency to on choose to restrict their intake because of a pathological drive to be as healthy as possible . however , limited epidemiological information regarding on and some methodological problems in available studies ( eg , small sample size , no data on representative community samples , assessment in high - risk groups ) do not allow generalization of the results.9 the average prevalence rate of orthorexic symptoms has been found to be 6.9% for the general population and 35%57.8% for high - risk groups ( eg , dieticians , nutrition students , and other health care professionals including medical students , artists , fitness participants , and performance artists).9 to date , there are interesting hypotheses on the neurobiological , genetic , neuroanatomical , neurochemical , or psychophysiological correlates of the orthorexic condition.11 the theoretical overlap with anorexia and ocd , and maybe with autism spectrum disorders ( asds ) , suggests that the neuropathophysiology of asds may represent the starting points for this kind of research . in the light of the spectrum disorder approach , it is important to consider the relevant overlap between the clinical characteristics of specific an phenotypes and some conditions included in asds . this diagnostic category included autistic disorder , asperger s disorder , and pervasive developmental disorder , according to the neurodevelopmental disorders work group position for the dsm-5.1 symptoms of these disorders represent a single continuum of mild to severe disorders , and the triad of impairments spanning social interaction , communicative behavior , and repetitive and restricted behaviors , distinctive of dsm-5 , was collapsed into two domains , preserving restricted and repetitive behaviors but converging social and communicative difficulties into a single domain.1 research on the link between asds and eating disorders has evolved since conceptualization by gillberg.69,70 the author identified some similarities between an and asd and proposed that an should be conceptualized as an empathy disorder on the same spectrum as autism.69 this hypothesis was enlightened by longitudinal studies indicating that asd , recently subsume by dsm-5 criteria under asd , was overrepresented in the an population.70 in other samples , 16% of teenagers with an had a premorbid diagnosis of autism spectrum condition71 and 23% of adults with an met the clinical criteria for autism spectrum condition.72,73 tchanturia et al74 observed that in spite of differences in presentation , such as a later age of onset in an , a biased sex ratio toward females in an and on the contrary toward males with asd , and higher than average intelligence quotient in an vs more heterogeneous intelligence quotient levels for asd , empirical studies from the last decade corroborated an overlap in behavioral and cognitive features between an and asd . rigid attitudes and behaviors are typical features of an , which can be seen as resembling the unusually narrow interests and rigid and repetitive behavior in asd , albeit in an these are focused on food or weight . both asd and an show social anhedonia,74,75 deficits in emotional intelligence,76,77 difficulties on advanced theory of mind tests ( such as the reading the mind in the eyes test),78 rigidity on tests of set - shifting,7982 excellent performance on tests of attention to detail , such as the embedded figures test,78 and alexithymia . finally regions , including the superior temporal sulcus , fusiform face area , amygdala , and orbitofrontal cortex.83,84 for these reasons , gillberg et al s initial assumption has gathered evidence with reports of the possibility that autism and an share common underlying cognitive and neural phenotypes.70,83,85,86 currently , research confirms important point of symptom overlap between on , an , ocd , and obsessive compulsive personality disorder ( ocpd).87 in particular , the resemblance with an is prompting debate as to whether on is a unique disorder or a subset of an or ocd . on and an share common traits of perfectionism , high traits of anxiety , and a high need to exert control , in addition to the potential for significant weight loss . both have limited insight into their condition and often refuse the consequent functional impairments . concerning the relationship between on and obsessive compulsive spectrum disorders , there is some evidence that ocpd , rather than ocd , has a close link with eating disorders,66 in particular with an.88 these similarities with on include perfectionism , rigid thinking , and preoccupation with details and perceived rules . anderluh et al89 have shown that the presence of ocpd traits positively predicts development of pathological eating habits . in summary , we hypothesize that individuals with higher tendency to orthorexia symptoms could share some traits of both asd and ocd ; the obsession for proper nutrition , ritualized patterns of food preparation and eating , spending time in researching , cataloging and measuring food , planning future meals , and the presence of additional and intrusive food - related thoughts characterize this condition.87 furthermore , these individuals are at risk for social isolation due to their stance of moral superiority and intolerance to others food beliefs . these disturbing features and behaviors could resemble deficits in social - emotional reciprocity , restricted and repetitive patterns of behavior and interests , inflexible adherence to routines , and the resulting impairment in social and occupational areas typical of patients with low levels of autistic spectrum . on the other hand , eating problems are frequently present in subjects with asds : these atypical eating behaviors and habits occur in childhood , and food selectivity is the most frequent of these problems.90,91 the tendency to be overly selective or have an aversion to specific texture , colors , smells , and temperatures and to show rigidity to the brands of particular foods , endure up to adulthood associated with an increased risk for underweight.92,93 further and prospective studies are needed to clarify shared features and boundaries between on , eating spectrum disorders and asd . this review considered the historic evolution of the concept of an up to the last version of the dsm , and described some relevant psychopathological data able to support a new conceptualization of the eating disorder spectrum . the relationships between eating disorders , autism , and obsessive compulsive spectrum seem to be of great interest in order to achieve a better understanding of different eating attitudes and behaviors , and deserve more effort in terms of large , accurate psychopathological investigations .

a recent survey from the centers for disease control and prevention indicates that diabetes affects 25.8 million people in the united states which is 8.3% of the u.s . most diabetic patients will ultimately develop kidney failure , hypertension , and/or suffer stroke . in addition , about two - thirds of diabetic patients will develop peripheral neuropathy . people suffering from diabetic neuropathic pain experience spontaneous pain ( pain sensation in the absence of stimulation ) , hyperalgesia ( increased pain sensation to painful stimuli ) , and allodynia ( pain sensation to innocuous stimuli ) , which greatly affect their quality of life . hyperglycemia has been suggested to be the initiating cause of peripheral nerve fiber degeneration , which results in pain . however , aggressive glycemic control can only control the progression of neuronal degeneration but not reverse the neuropathy . current treatments of diabetic neuropathy include tricyclic antidepressants , anticonvulsants , selective serotonin reuptake inhibitors , and opioids , however they often have side effects that limit their use . therefore , an alternative therapy with no or greatly reduced side effects is still imperative for these patients often suffering multiple comorbid conditions . epoxy fatty acids ( epfas ) , formed by cytochrome p450 ( cyp450 ) from polyunsaturated fatty acids , are important lipid mediators . epoxy - eicosatrienoic acids ( eets ) , epoxy - eicosatetraenoic acids ( epetes ) , and epoxy - docosapentaenoic acids ( epdpes ) , from arachidonic acid , eicosapentaenoic acid , and docosahexaenoic acid , respectively , have analgesic properties in inflammatory pain models . although these epfas are very potent lipid mediators , they are rapidly metabolized by soluble epoxide hydrolase ( seh ec 3.3.2.10 ) to their corresponding 1,2-diols and to a lesser extent by other enzymes in vivo . the in vivo biological activities of these natural chemical mediators appear limited by their rapid degradation . stabilization of epfas through inhibition of seh has shown anti - inflammatory , antihypertensive , and analgesic effects . recent studies also indicate that seh inhibition is analgesic in chronic diabetic neuropathic pain in animal models . in fact , it is more efficacious than gabapentin , a clinically approved drug for this condition . in nonmodel species , seh inhibitors have reduced the inflammatory and devastating neuropathic pain in laminitis horses , reduced blood pressure in forearm blood flow studies in man , and reduced neuropathic pain in human diabetics ( www.sphaerapharma.com ) . , several groups have reported the synthesis and evaluation of seh inhibitors with different central pharmacophores with potency varying from micromolar to nanomolar ranges . the 1,3-disubstituted urea is one of the more potent central pharmacophores being used to inhibit seh because the urea forms tight hydrogen bonds with the active residue asp335 and the chemistry is easily accessible . the physical properties of many of the most potent compounds are generally poor . efforts to improve physical properties including water solubility , hydrophilicity , decreased clogp , and lowered melting point of seh inhibitors have generally resulted in a decrease in potency and less desirable pharmacokinetics . these physical properties can also result in poor absorption and inferior pharmacokinetic properties and can demand heroic formulation . therefore , it is necessary to further optimize the structures of the inhibitors and improve the oral bioavailability of the seh inhibitors carrying a 1,3-disubstituted urea as a central pharmacophores . recent reports in drug discovery suggest that the residence time of a drug in its target is an important parameter to predict in vivo drug efficacy . residence time is defined as the duration of time which the target , either enzyme or receptor , is occupied by the ligand . the traditional ic50 and ki or kd is determined in a closed in vitro system in which the concentrations of the ligand and the target are constant . however , an in vivo system is an open system , thus the target is exposed to a varying concentration of ligand after dosing because of circulation , metabolism , and excretion . therefore , drug efficacy is no longer correlated with the in vitro potency ( ic50 or ki ) that is determined in a closed system but rather depends on the duration the target is occupied by the ligand . this residence time can be calculated from the reciprocal of the dissociation rate constant ( koff ) of the target , inhibitors with improved potency have been designed and synthesized based on the holo - structure of the recombinant human seh with published seh inhibitor : tppu ( uc1770 ) ( figure 1b ) . their residence times have been determined and their in vivo efficacies have been tested in a diabetic neuropathic pain model . ( a ) the general scaffold of seh inhibitors used in this report . piperidyl - urea inhibitors of seh were first described in 2006 and have the general scaffold shown in figure 1a . it has been demonstrated that large amide substituents at r2 improve the potency of the seh inhibitors ( figure 1a ) . however , seh inhibitors with large amide substituents at r2 ( figure 1a ) exhibit poor pharmacokinetic profiles in dogs . to further improve both the potency and pharmacokinetic profiles of the seh inhibitors , we started with a published inhibitor having a small substituent at r2 : tppu ( inhibitor 18 ) ( figure 1b ) , which resulted in good potency and a good pharmacokinetic profile . because of the favorable properties of inhibitor 18 , an x - ray structure of human seh with inhibitor 18 was obtained and used to predict structural modifications of inhibitors leading to improved potency and properties . the x - ray structure indicates that there is a small secondary binding site ( valley ) next to the -carbon of the amide of inhibitor 18 ( figure 2a , b ) , which can provide additional binding possibilities . we therefore hypothesized that the potency of the inhibitors could be significantly improved by incorporating a small hydrophobic substituent at the -carbon of the amide ( figure 2b ) . in addition , the 4-trifluoromethoxyphenyl group on the urea of inhibitor 18 fits closely to the right side of the binding pocket with only a little room for additional binding ( figure 2c , d ) . thus , only substituents which are similar to the size of the 4-trifluoromethoxyphenyl group were used for inhibitor optimization . on the basis of these findings , a series of 30 piperidyl - ureas was made using four different methods described previously . these methods with slight modifications are summarized in scheme 1 ( detailed synthetic procedures are provided in the supporting information ) . ( a ) holo - crystal structure of human seh ( green ) with inhibitor 18 ( tppu ) ( cyan ) ( pdb code : 4od0 ) . ( b ) the left side of the tunnel of human seh with inhibitor 18 ( cyan ) . the arrow indicated the valley of the left side of the tunnel for potential additional binding for new inhibitors . ( c , d ) the right binding pocket of human seh with uc1770 from the view of the front and back ( cyan ) . the graphics were prepared by the pymol molecular graphics system , version 1.3 edu , schrodinger , lcc . a new series of seh inhibitors was synthesized with various substituents at r2 on the amide ( table 1 ) while maintaining r1 as a 4-trifluoromethylphenyl group . in general , as the size of the substituent increases , the potency of the inhibitors against human seh increases . as we hypothesized , addition of a methyl group on the -carbon of the amide ( figure 1a ) greatly improves the potency by almost 5-fold ( inhibitors 2 vs 4 and inhibitors 3 vs 6 ) . interestingly , replacing the isopropyl ( 4 ) with cyclopropyl group ( 5 ) also results in a slight increase in potency , an increase in water solubility , and a decrease in melting point . the elongation of the aliphatic chain by one carbon ( inhibitors 2 vs 3 ) slightly enhances ( 30% ) the potency ( table 1 ) . to investigate whether the enhanced potency of inhibitor 6 is stereospecific , we tested the corresponding s - isomer ( inhibitor 7 ) , which is 2-fold more potent than its racemic mixture ( table 1 ) , suggesting that the r - isomer is less active . the related inhibitor 8 is less potent than inhibitors 6 and 7 , which indicates that the addition of methyl group not only is stereospecific but is also regiospecific . an x - ray structure of human seh with inhibitor 4 shows that the methyl group on the -carbon of the amide of inhibitor 4 effectively fits into the additional binding site on the right side of the binding pocket ( figure 3 ) . this additional binding site was predicted from the crystal structure of human seh with inhibitor 18 ( figure 2b ) . overlay structures of human seh with inhibitor 18 ( cyan ) and inhibitor 4 ( orange ) . this figure suggests that the design principle is valid and the methyl group at -position of the amide provides extra binding toward the valley of the left binding pocket . the graphics were prepared by the pymol molecular graphics system , version 1.3 edu , schrodinger , lcc . solubility was measured with sodium phosphate buffer ( 0.1 m , ph 7.4 ) according to the method described by tsai et al . and described in detail in supporting information . n.d . elogp was determined by hplc method calibrated with elogp of six selected inhibitors determined by the shake - flask method ( supporting information , figure s3 ) . ki was determined by fret - based displacement assay described by lee et al . abbreviation : elogp stands for experimental log p. although the addition of an alkyl group enhances the potency of this series of seh inhibitors , their metabolic stability will likely decrease because the added alkyl group at the -position is expected to be metabolized faster . this also increases the lipophilicity of the inhibitors , which may increase their affinity to cyp450 enzymes that are responsible for drug oxidation . because fluoride replacement is known to decrease metabolism , we synthesized inhibitor 9 , and it shows potency similar to inhibitor 8 . the size of the cf3 group is similar to the size of the isopropyl , group and the potency of inhibitor 9 is maintained . this could provide an approach to increase the stability of the inhibitors without hampering the potency of the inhibitors . we then further optimized the potency of seh inhibitors by modifying the substituent at r1 while maintaining the 2-methyl butanoyl group at r2 ( table 2 ) . the binding pocket is very hydrophobic ( supporting information , figure s2 ) with limited space ( figure 2c , d ) . therefore , the size of r1 was modified slightly in order to test if increasing the hydrophobic surface of the inhibitors could enhance their potency . the result indicates that there is steric hindrance within the right binding pocket ( figure 2c , d ) . thus , the potency of the inhibitor dropped when the size of the substituent at r1 ( figure 1a ) was increased from a 4-iso - propylphenyl group to a 4-tert - butylphenyl- group ( inhibitors 11 and 12 ) ( table 2 ) . it is interesting that the inhibitor 6 , which has cf3 group in place of an iso - propyl and tert - butyl group , is more potent as an inhibitor when compared to inhibitors 11 and 12 . to investigate whether the enhanced potency of inhibitor 6 is due to fluorine induced interactions or better occupancy of the binding pocket , the 4-t - butylphenyl group of inhibitor 12 was replaced by its isostere : a 4-heptafluoro - iso - propyl - phenyl group at r1 of inhibitor 13 . this compound is 20-fold more potent than inhibitor 6 , which indicates that the fluorine induced interactions in the left binding pocket are very strong ( table 2 ) . these data suggest that the left side of the binding pocket is likely fluorophilic . interestingly , replacement of the 4-trifluoromethylphenyl at r1 of inhibitor 6 by a 4-trifluoromethoxyphenyl group ( inhibitor 14 ) did not alter potency , but the replacement improved solubility by 10-fold ( table 1 ) . furthermore , inhibitors with a cycloalkyl group at r1 were synthesized , and the addition of carbon atoms ( inhibitor 15 to 17 ) enhances the binding toward human seh by more than 4 times ( table 2 ) and placement of cycloalkyl group at r1 greatly enhances their solubility . solubility was measured with sodium phosphate buffer ( 0.1 m , ph 7.4 ) according to the method described by tsai et al . and described in detail in supporting information . n.d . elogp was determined by hplc method calibrated with elogp of six selected inhibitors determined by the shake - flask method ( supporting information , figure s3 ) . ki was determined by fret - based displacement assay described by lee et al . the results are the average of duplicates with sem . abbreviation : elogp stands for experimental log p. it has been reported that inhibitors with 4-trifluoromethoxyphenyl at r1 are more potent than inhibitors with 4-trifluoromethylphenyl at r1 and have better physical properties . to investigate whether such substitution could enhance the potency of the inhibitors and improve physical properties in general , a series of inhibitors with 4-trifluoromethylphenyl group at r1 the results suggest that substitution of 4-trifluoromethylphenyl with 4-trifluoromethoxyphenyl enhances the potency of certain inhibitors ( 2 vs 18 and 4 vs 19 in tables 1 and 3 ) , but there is no substantial improvement with inhibitors with the 2-methyl butanoyl group at r2 ( 6 vs 14 and 7 vs 21 in table 13 ) or the cyclopropyl group at r2 ( 5 vs 20 ) . this may be due to the possibility of different binding orientations than the one shown in figure 2a and in previous crystallography . therefore , two inhibitors which are structurally similar to 21 but with urea substituted by the amide ( 22 and 23 ) were synthesized . in general , structure activity relationships developed with the urea central pharmacophore are predictive of enzyme inhibition with amide and carbamate . both inhibitors 22 and 23 are less potent than their corresponding urea ( 21 ) ( table 3 ) . compound 22 , which has amide nitrogen ( nh ) on the piperidine side ( figure 1a ) , is far less potent than the amide 23 , which has an amide nitrogen ( nh ) on the r1 side ( figure 1a ) ( table 2 ) . it indicates that the urea nh asp(o ) interaction is stronger than the urea nh asp(o ) interaction by 5.7 kj mol , calculated based on the ki of both inhibitors . this result is consistent with the crystal structure where the distance between urea nh and asp(o ) is shorter than the distance between urea nh and asp(o ) hydrogen bonding ( figure 2a ) . in some cases , the placement of 4-trifluoromethoxyphenyl at r1 ( figure 1a ) enhances the potency of seh inhibitors , but in all cases , this substitution decreases the melting point and improves the solubility of the inhibitors ( tables 13 ) . solubility was measured with sodium phosphate buffer ( 0.1 m , ph 7.4 ) according to the method described by tsai et al . and described in detail in supporting information . n.d . elogp was determined by hplc method calibrated with elogp of six selected inhibitors determined by the shake - flask method ( supporting information , figure s3 ) . ki was determined by fret - based displacement assay described by lee et al . abbreviation : elogp stands for experimental log p. it was reported that replacement of amide with sulfonamide at r2 was shown to enhance the potency of the inhibitors . however therefore , a new series of inhibitors with a different sulfonamide at r2 was synthesized for a more detailed study ( table 4 ) . in general , the potency of the inhibitors increases with the size of r2 ( 7-fold better potency from a methyl 25 to a butyl 31 ) . however , unlike the inhibitor with an amide at r2 ( table 1 ) , the placement of an iso - propylsulfonamide at r2 ( 29 vs 26 ) does not significantly enhance the potency against human seh . this is probably because the sulfonamide exists as a tetrahedron while amide is trigonal planar and the s(o)2c bond is at least 0.28 longer than the c(o)c bond . these data further indicate that the enhanced potency of the methyl substitution at the -position of the amide is structurally specific . overall , unlike previously reported , the inhibitors with a sulfonamide at r2 are less potent than the inhibitors with amides at r2 . in addition , the physical properties ( solubility and melting point ) of inhibitors with a sulfonamide at r2 are generally poor as compared to inhibitors with amides at r2 . solubility was measured with sodium phosphate buffer ( 0.1 m , ph 7.4 ) according to the method described by tsai et al . and described in detail in supporting information . n.d . elogp was determined by hplc method calibrated with elogp of six selected inhibitors determined by the shake - flask method ( supporting information , figure s3 ) . ki was determined by fret - based displacement assay described by lee et al . stands for solubility ; elogp stands for experimental log p. here , we have identified several structural changes that can significant enhance the potency and improve the physical properties of the inhibitors . we have also demonstrated that the sulfonamide at r2 is less attractive than the corresponding amide . recent studies have suggested that koff , a kinetic parameter on enzyme inhibition , from the enzyme is a better indicator for in vivo potency than ki . this is because inhibitors are only effective in blocking catalysis when the target proteins are occupied by the inhibitors . the koff can provide more detailed information , about the duration of time the inhibitors are bound to the target enzyme ( target occupancy ) than the ki , an equilibrium parameter on enzyme inhibition , and ultimately this translates into in vivo efficacy . therefore , a small set of new potent inhibitors together with several potent published inhibitors ( figure 1c ) were selected to determine their koff against seh using a recently developed fret - based assay . the result indicates that the koff of inhibitors decreases with the size of r2 increased ( table 5 and figure 1c , inhibitor 4 < 7 ; tpau < 18 ( tppu ) . however , the koff does not substantially change when the r1 was varied among a 4-trifluoromethylphenyl group ( inhibitor 6 ) , a 4-trifluoromethoxyphenyl group ( inhibitor 14 ) , and a 4-isopropylphenyl group ( inhibitor 11 ) ( table 5 ) . the 4-heptafluoroisopropylphenyl group at r1 ( inhibitor 13 and inhibitor 24 ) significantly decreased the koff of the inhibitors . this further supports our hypothesis that the pocket is fluorophilic and the added fluorines can induce several interactions with the nearby residues within the binding pocket . the koffs of new inhibitors are slower overall , indicating a longer residence time in the target and have at least a 2-fold slower off rate than any of the previously published inhibitors ( table 5 and figure 1c , apau , tpau , 18 ( tppu ) , tups , t - tucb ) . koff was determined by fret - based displacement assay described by lee et al . and described in detail in supporting information . inhibitor complex ( 8 m ) was diluted by 40 times by fluorescent reporter the fluorescent enhancement ( excit = 280 nm , emit = 450 ) was measured over time ( 5100 s ) . the results are the average of triplicates with sd t1/2 = ln(2)/koff , which describes the half - life of enzyme inhibitor complex . to investigate relationship of koff with ki and other physical properties of the inhibitors , correlation graphs of koff with these parameters were plotted ( supporting information , figure s1a ) . the results show no correlation ( r = 0.21 ) between the number of non - hydrogen atoms and koff . however , there is a trend showing ( r = 0.52 ) that an increase in elogp results in a decrease of koff ( supporting information , figure s1b ) . this may due to the fact that the binding pocket of the human seh is hydrophobic ( supporting information , figure s2 ) . an increase of hydrophobicity of the ligand increases the lipophilic interactions with the binding pocket . therefore , it requires higher activation energy to break up the interactions between protein and the bound inhibitors . in addition , a correlation between ki and koff was plotted ( supporting information , figures s1c , s1d ) . the plot indicates that there is a good correlation between ki and koff ( r = 0.88 ) over a wide range of potencies ( from 0 to 20 nm ) . however , when we focused on a narrower range of potencies ( from 0 to 1.4 nm ) , the correlation is moderate ( r = 0.44 ) . because ki is a ratio of koff over kon therefore , the poor correlation over a moderate range ki values suggests that the differences are due to the kon . these results indicate that it is possible to specifically modulate koff without greatly affecting ki . to investigate the oral bioavailability of seh inhibitors , we determined the pharmacokinetic profiles post oral administration . cassette dosing was used as a screening tool to select the compounds for more detailed study to allocate limited resources to the most promising compounds . there are cautions with cassette dosing including changes in pharmacokinetic behavior due to competition for xenobiotic metabolism . the high potency and thus low doses used in this study make this artifact less likely . a comparison of pharmacokinetic profiles of seh inhibitors between the cassette dose and single dose carried out in nonhuman primate . the results show that there was no statistically significant difference in the pharmacokinetic behaviors between cassette and individual dosing of seh inhibitors ; therefore , cassette dosing was predictive for the compounds reported here . the pharmacokinetic profiles of this series of selected potent compounds also determined the effect of the position or addition of aliphatic carbons on the inhibitors . in general , the results indicate that the seh inhibitors with a 4-trifluoromethylphenyl group or a 4-trifluoromethoxyphenyl group at r1 ( figure 1a ) have good drug exposure levels based on the area under the curve of the pharmacokinetic kinetic profile ( pk - auc ) after oral administration ( table 6 ) . as we replaced the 4-trifluoromethylphenyl group or 4-trifluoromethoxyphenyl group at r1 with a 4-isopropylphenyl group ( inhibitors 6 or 14 vs 11 ) , the potency of inhibitor 14 decreases ( table 2 ) . as we anticipated , the pharmacokinetic t1/2 ( pk - t1/2 ) and oral drug exposure level estimated by pk - auc also decreases ( table 6 ) . further replacement of the phenyl group at r1 with a cycloalkyl group ( inhibitors 16 and 17 ) greatly decreases the oral drug exposure level ( table 6 , supporting information , figures s6 , s8 , and s9 ) . it is likely that each addition of an aliphatic carbon renders the molecule more susceptible to metabolism by cyp450 enzymes . such a phenomenon was also observed as the alkyl chain length varied at r2 . as we hypothesized , the pk - t1/2 of the inhibitors also decrease when the alkyl chain length at r2 of the amide and sulfonamide series increases ( table 6 for amide inhibitors , 18 , 19 , and 21 ; for sulfonamide inhibitors , 25 and tups ( figure 1c ) vs 31 and 32 ) . the result also show that the pk - auc estimated drug exposure levels of the sulfonamide inhibitors 31 and 32 are , in general , worse than the amide inhibitors ( table 6 ) . the mice ( n = 4 ) were treated by oral dosing with a cassette of 3 to 5 compounds ( 0.3 mg / kg per each compounds dissolved in 20% peg400 in oleic acid rich triglycerides ) . the pharmacokinetic profiles of the inhibitors were calculated by winonlin based on the model of one compartmental analysis . the pharmacokinetic profiles of the inhibitors were calculated by winonlin based on the model of noncompartmental analysis . we then synthesized inhibitors 9 and 24 in order to study whether the addition of fluorine could enhance the stability of our inhibitors as has been previously suggested . the replacement of a terminal methyl group with a cf3 group at the r2 of the amide inhibitors ( inhibitors 9 vs tppu and 24 vs 13 ) not only improves the pk - t1/2 of the inhibitors but also increases their oral drug exposure levels ( table 6 ) . inhibitor 30 shows at least a 20-fold better bioavailability based on oral pk - auc with a substantially longer pk - t1/2 as compared to inhibitors 31 and 32 ( table 6 ) . however , addition of fluorine to the fluorinated substituents could not further enhance the stability of the inhibitors . when the inhibitors with 4-trifluoromethyl groups at r1 were substituted by a heptafluoro - isopropyl group ( inhibitor 6 vs 13 ) , both the pk - t1/2 and bioavailability decreased ( table 6 ) . this is probably due to the fact that the increase of elogp enhances the affinity toward xenobiotic metabolizing enzymes and cell membranes . these results suggest that in order to enhance the stability of the inhibitors , addition of fluorine should be carefully positioned . in general , inhibitors with 4-trifluoromethylphenyl , 4-trifluoromethoxyphenyl , and 4-(heptafluoro - iso - propyl)phenyl groups at r1 with amide substituents at r2 showed good pharmacokinetic profiles . inhibitors 16 , 17 , 31 , and 32 , although very potent , are not optimal candidates for testing in animal chronic disease models because of poor oral drug exposure levels . our data also suggest that these inhibitors ( 16 , 17 , 31 , and 32 ) may not be top candidates to be optimized for human drugs . the inhibitors with a piperidyl moiety attached at n of the urea show greatly improved oral pharmacokinetic profiles compared to inhibitors with a cyclohexyl moiety attached at n of the urea also ( supporting information , figure s6 ) . overall , our data suggested that several newly synthesized seh inhibitors have an improved and optimized pharmacokinetic profile for diseases requiring chronic treatment . several of the newly synthesized seh inhibitors selected for potency and good oral drug exposure levels were tested against a set of proteins to evaluate potential off - target side effects and nonspecific binding . inhibitor 24 was excluded because of its relatively high elogp ( table 3 ) , which was suspected to lead to high nonspecific binding . high lipophilicity is avoided when possible in medicinal chemistry because it is associated with poor pharmacokinetic behavior and nontargeted related side effects . although not conclusive , the pharmacokinetic studies indicated that the 4-(heptafluoro - iso - propyl-)phenyl group likely enhances the affinity of inhibitors toward xenobiotic metabolizing enzymes and cell membranes , potentially leading to the poor oral drug exposure of inhibitor 13 ( table 6 ) . it was reported that very high plasma protein binding can not only hamper the efficacy of drugs or signaling molecules but also can alter their pharmacokinetic profile . therefore , the plasma protein binding of the selected inhibitors were measured with an assay carried out with a rapid equilibrium dialysis device based on manufacturer s protocol ( table 7 ) . these new inhibitors demonstrated a moderate level of plasma protein binding ranging from 85 to 96% . this level of plasma protein binding is unlikely to alter their bioavailability . given the inhibitors had kis approaching the subnanomolar range , the plasma proteins could be considered as carrier proteins that facilitate the their distribution . previously , seh inhibitors with similar structures failed to show significant inhibition of the cyp450s which are highly involved in xenobiotic metabolism . in this study , we examined the inhibition of cyp2c and cyp2j2 because cyp2c is an important drug metabolizing enzyme but principally because both enzymes are implicated in the synthesis of epoxy fatty acids . the results indicated that only minor inhibition of both cyp450 enzymes is observed at 10 m of the seh inhibitors ( table 7 ) . these data suggested that the seh inhibitors do not affect the biosynthesis of epfas by inhibition of cyp2c and cyp2j2 . this in turn suggests that the in vivo efficacy of the inhibitors is not due to inhibition upstream in the cyp450 pathway . inhibition of the herg channel is a very important toxicology screen due to demonstrated association with cardiotoxicity . most of the tested inhibitors show very minor inhibition on herg at 50 m except for inhibitors 5 and 19 ( table 7 ) . however , even inhibitors 5 and 19 , which have 0.49 and 0.31 nm ki against recombinant human seh , have more than an 10000-fold selectivity over the herg channel . therefore , these selected inhibitors are considered not to present a risk with herg inhibition . in summary , we have demonstrated that our seh inhibitors having ki value in the lower subnanomolar are unlikely to induce unanticipated side effects due to nonspecific binding to other pharmacologically important proteins . several new potent seh inhibitors with good pharmacokinetic profiles and no significant nonspecific binding on human proteins and enzymes were selected for further in vitro testing prior to in vivo studies . because the in vivo studies were to be conducted in rat , we determined the potency ( ki and koff ) against the recombinant rat seh ( table 8) . the data suggest that the inhibitors have a slightly different structure activity relationship ( sar ) on the recombinant rat seh compared to human seh . the inhibitors with a 4-trifluoromethoxyphenyl group at r1 are less potent than the inhibitors with a 4-trifluoromethylphenyl group at r1 by at least 10-fold ( table 8) . these results are opposite to the sar obtained from the human recombinant seh ( table 1 and 3 ) . in addition , there is not a clear sar based on the koff of the inhibitors ( table 8) . however , the results indicate that the new inhibitors are more potent , both in ic50 and koff , than the previously published inhibitors 18 ( tppu ) and tpau ( figure 1c and table 8) . additionally , the pharmacokinetic profiles in rat were obtained for this new set of inhibitors ( supporting information , figure s11 ) . all of the selected inhibitors show good oral bioavailability ( pk - auc ) except inhibitor 21 , which demonstrated at least 2 lower blood concentration than the other inhibitors ( table 9 ) . elimination is an important parameter of overall pharmacokinetics , and it has been previously reported that inhibitors with short elimination pk - t1/2 are not well suited to use for chronic treatment . several of the new inhibitors demonstrate good pharmacokinetic profiles with moderate elimination pk - t1/2 ( 5 h ) in both mice and rats . therefore , these inhibitors were selected for further in vivo efficacy test on rat . the result is the average of triplicates with standard derivation ( sd ) shown . ic50 is determined by radiometric assay using [ h]-t - dppo ( 50 m ) as a substrate and rat seh ( 2.5 nm ) incubated at 30 c for 10 min koff was determined by fret - based displacement assay described by lee et al . briefly , a preincubated rat seh inhibitor complex ( 8 m ) was diluted by 40 times by fluorescent reporter apcu ( 2 m , 0.1 m sodium phosphate , ph 7.4 ) . the fluorescent enhancement ( excit = 280 nm , emit = 450 ) was measured over time ( 5100 s ) . t1/2 = ln(2)/koff , which describes the half - life of enzyme inhibitor complex . the rat ( n = 3 or 4 ) were treated by oral dosing with a cassette of four compounds ( 0.3 mg / kg per each compound dissolved in 20% peg400 in oleic acid rich triglycerides ) . the pharmacokinetic profiles of the inhibitors were calculated by winonlin based on the best fit model of one compartmental analysis . because inhibitor 7 has the best in vitro potency ( ic50 and koff ) against rat seh with a good pharmacokinetic profile ( table 8 and 9 ) , it was tested in a model of type 1 diabetic neuropathic pain . at as low as 0.1 mg / kg , inhibitor 7 effectively increases mechanical withdrawal thresholds ( reduces pain ) in neuropathic rats ( figure 4a ) . importantly , this reduction in pain behavior increases dose dependently from 0.1 to 0.3 mg / kg ( figure 4a , b , p < 0.05 ) . in addition , there is a good correlation between the blood concentration of inhibitor 7 and increased withdrawal thresholds ( figure 4c , d ) . ( a ) inhibitor 7 ( ic50 rat seh = < 1.25 nm ) improves mechanical withdrawal thresholds in a model of diabetic neuropathy . oral dosing of 0.1 and 0.3 mg / kg dose dependently increased mwt , indicating pain relief ( n = 5 , mean sem ) . the neuropathic baseline is normalized to 100% to show the response to a single dose of seh inhibitor over the time course . the response to treatments depended on the time , but when the treatments were compared , there was a statistically significant increase from the 0.1 to the 0.3 mg / kg dose ( mann whitney rank sum test , u = 454.5 , n1 = n2 = 45 , p = < 0.001 ) . auc describes an area under the curve of the mwt post - oral dosing of the inhibitor vs time . the bar chart depicts the auc of mwts after oral dosing of inhibitor 7 . an increased in auc of mwt is interpreted as an increase in pain relief . when the auc for these doses were compared , this relationship maintained statistical significance ( mann whitney rank sum test , u = 2.00 , n1 = n2 = 5 , p = 0.032 ) . a plot of the nociceptive responses ( n = 5 , mean sem ) vs blood concentration ( n = 4 , mean sem ) reveals increasing efficacy with increasing blood concentration . ( d ) the efficacy of inhibitor 7 is dependent on blood concentration . when compared , the nociceptive responses ( n = 5 , mean sem ) and the pharmacokinetic profile after oral dosing ( n = 4 , mean sem ) of 7 follow the same trend while revealing a slight delay to in the behavioral assay . the graphics and statistics were prepared by kaleidagraph version 4.1 ( synergy software , reading , pa ) . our data indicate that inhibitor 7 shows better in vitro efficacy in terms of both ic50 and koff than the previously published inhibitor tpau ( figure 1c ) as well as having good pharmacokinetic profiles in both mouse and rat ( table 6 and 9 ) . therefore , we compared the in vivo efficacy of inhibitor 7 as previously reported results for tpau in the same model . our results indicate that using a 10-fold lower dose of inhibitor 7 is as efficacious as tpau in the nociceptive bioassay ( figure 5 ) . it is also reassuring that the relative in vivo potency of these two seh inhibitors in the nociceptive assays correlates with their relative in vitro potency on the target enzyme . these pain assays in the rat appear valuable for broad ranking of the analgesic activity of seh inhibitors . however , the differences in pharmacokinetic and target site affinities caution against extrapolating these data to predict the fine ranking of the potency of different seh inhibitors in man . auc describes an area under the curve of the withdrawal threshold post - oral dosing of the diabetic rat with seh inhibitors vs time . a comparison of the newly synthesized seh inhibitor 7 ( ic50 rat seh = < 1.25 nm , t1/2 = 21.6 min ) to previously published analogue tpau ( ic50 rat seh = 79 nm , t1/2 = 11.9 min ) showed a significantly higher response of inhibitor 7 at 0.3 mg / kg compared to the same 0.3 mg / kg dose of tpau in a model of diabetic neuropathy ( t test , t = 2.31 with 9 degrees of freedom , p = 0.046 , * shows significant difference to 0.3 mpk of inhibitor 7 ) . however , there was no significant difference between the 10-fold lower dose of inhibitor 7 at 0.3 mg / kg and tpau at 3 mg / kg ( mann whitney rank sum test , u = 14.00 , n1 = 5 n2 = 6 , ns p = 0.931 ) . the graphic and statistics were prepared by sigmaplot ( systat software , san jose , ca ) . overall , our data show that the new inhibitor 7 exhibits a strong correlation between in vivo efficacy with dose and drug level in blood , is more efficacious than the previously reported tpau , and has promise as a therapy for use in treating chronic pain conditions . here , a new series of 1,3-disubstituentd urea seh inhibitors was synthesized with the design based on the recently obtained holo - structure of human seh with inhibitor 18 ( tppu ) . the sar of this new series indicates that the right side binding pocket of the seh enzyme has limited space for optimization and is fluorophilic ( figures 1a , 2a , b ) , with an additional binding site identified in the left side binding pocket ( figures 1a , 2d ) . the newly synthesized inhibitors are at least 10 times more potent against human seh than a previously published inhibitor ( tpau , figure 1c , ki(human seh ) = 9.4 0.3 nm ) with a minimum 2-fold longer residence time on the human seh . these new inhibitors have been demonstrated selective for seh with no significant specific binding toward several other human proteins ( plasma protein , cyp450 enzymes , and herg channel protein ) . the poor physical properties limit the oral bioavailability of inhibitors with a 1,3-disubstituted urea . this new series of inhibitors has improved physical properties translating into good pharmacokinetic profiles in the rat and mouse ( supporting information , figure s5s11 ) increases their druglikeness compared to previous seh inhibitors . inhibiting seh has been demonstrated to be more efficacious than gabapentin and celecoxib in alleviating modeled diabetic neuropathic pain in rat with no apparent side effect such as impaired mobility , cognition , or motor skill . however , the seh inhibitors reported in those studies had either poor physical properties ( poor water solubility and high melting point ) or poor in vivo stability . in this report , the new more potent seh inhibitors are close to 10 times more efficacious than tpau in a diabetic neuropathic pain model . in addition , the selected inhibitor 7 demonstrated strong correlation between drug level in blood and dose with in vivo efficacy . this new series of inhibitors has demonstrated enhanced potency with slow koff , improved pharmacokinetic profiles ( moderate to long elimination t1/2 and high auc ) , and more importantly , improved efficacy against diabetic neuropathic pain in a rat model . with increased potency and bioavailability , there are decreases in the required effective dose and greatly simplified formulation . the new seh inhibitors are good candidates for chronic treatment of diabetic neuropathic pain . all reagents and solvent were purchased from commercial suppliers and were used directly without further purifications . reactions were monitored by thin - layer chromatography ( tlc ) on merck f254 silica gel 60 aluminum sheets , and spots were either visible under light or uv light ( 254 mm ) or stained with an oxidizing solution ( kmno4 stain ) . the same tlc system was used to test purity , and all final products showed a single spot on tlc . h nmr spectra were recorded on a varian qe-300 spectrometer with deuterated chloroform ( cdcl3 ; = 7.24 ppm ) or deuterated dimethyl sulfoxide ( dmso - d6 ) containing tms an internal standard . the purity of the inhibitors reported in this manuscript was determined either by ( 1 ) hplc - uv using agilent 1200 series hplc series equipped with phenomenex luna2 c18 reverse phase column ( c18 , 4.6 mm 150 mm , 5 m ) coupled with agilent g1314 uv vis detector ( detection at 230 nm ) with isocratic flow at methanol : water ( 2:1 by volume ) for 90 min , or by ( 2 ) h nmr . the inhibitor was dissolved in etoh at 100 m and 10 l was injected on hplc . purity was based on the percent of total peak area at 230 nm using hplc - uv . the presence of anilines in the final product was estimated from h nmr . the lowest obtained purity was reported . the purity was also further supported as described in the supporting information by lc / ms with monitoring of total ion current , tlc in several systems , a sharp melting point , and occasional other technique . the synthesis of tert - butyl 4-(3-(4-(trifluoromethyl)phenyl)ureido)piperidine-1-carboxylate , 1-(piperidin-4-yl)-3-(4-(trifluoromethyl)phenyl)urea , 1-(piperidin-4-yl)-3-(4-(trifluoromethoxy)phenyl)urea and tert - butyl 4-(3-(4-(trifluoromethoxy)phenyl)ureido)piperidine-1-carboxylate have been reported elsewhere . the synthesis of inhibitors 1,2,3,6,apau , tpau,18 ( tppu),20 ( tpcu ) , and t - tucb were reported elsewhere . the experimental procedures of enzyme preparation , ic50 determination for seh inhibitors , and ki determination for seh inhibitors followed the published procedures and are described in detail in supporting information . corresponding isocyanate ( 1 equiv ) and 4-amino-1-boc - piperidine ( 1.1 equiv ) were dissolved in ch2cl2 ( 50 mm , corresponding to isocyanate ) and stirred at rt for 12 h. the reaction was quenched by addition of water . the organic layer was isolated , and the aqueous layer was extracted with etoac ( etoac : aqueous layer/1:1 ) four times . the combined organic layer was dried over anhydrous magnesium sulfate and was concentrated under vacuo and was further purified by flash chromatography , yielding corresponding boc - protected urea . the boc protected urea from the step 1 was dissolved in hcl solution ( 2 m , meoh ) to make reaction mixture ( 186 mm , boc protected urea ) . the resulting solution was refluxed for 2 h. the solvent was removed in vacuo , and the crude reaction product was adjusted to ph 12 with naoh solution ( 6n ) . the precipitates were filtered and dried under high vacuum . the final product unprotected urea was served as a scaffold for the next step of synthesis . unless specified , the unprotected urea ( 1 equiv ) from step 2 , edci ( 1.5 equiv ) , dmap ( 1.5 equiv ) , and corresponding carboxylic acid ( 1.5 equiv ) were dissolved in ch2cl2 ( 8.3 mm , unprotected urea ) and stirred overnight ( 12 h ) at rt . the organic layer was collected , and the aqueous layer was extracted with etoac ( etoac : aqueous layer/1:1 ) four times . the combined organic layer was dried over anhydrous magnesium sulfate and was concentrated in vacuo and further purified by flash chromatography . the corresponding isocyanate ( 1 equiv ) was added to a suspension of targeted piperidine ( 1.1 equiv ) in ch2cl2 ( 20 mm , corresponding isocyanate ) . the reaction was quenched with the addition of hcl solution ( 2 m ) . the organic layer was collected , and the aqueous layer was further extracted with etoac ( etoac : aqueous layer/1:1 ) three times . the organic layer was dried over anhydrous magnesium sulfate and was concentrated in vacuo . corresponding amine ( 1 equiv ) and triethylamine ( 1.2 equiv ) was dissolved in ch2cl2 ( 54 mm corresponding to amine ) and stirred at 78 c . triphosgene ( 0.37 equiv ) dissolved in ch2cl2 ( 20 mm , corresponding triphosgene ) was added dropwise at 78 c . corresponding piperidine ( 1.1 equiv ) dissolved in ch2cl2 ( 54 mm , corresponding piperidine ) was added slowly , and the reaction was further stirred at rt for 12 h. the reaction was quenched with the addition of hcl solution ( 2 m ) . the organic layer was collected , and the aqueous layer was further extracted with etoac ( etoac : aqueous layer/1:1 ) three times . the organic layer was dried over anhydrous magnesium sulfate and was concentrated in vacuo . the first two steps are the same as synthetic method 1 , steps 1 and 2 , unless specified . the unprotected urea ( 1 equiv ) and triethylamine ( 1.2 equiv ) was dissolved in ch2cl2 ( 8.3 mm , corresponding unprotected urea ) , and corresponding sulfonyl chloride was added dropwise at 0 c and the reaction was stirred overnight ( 12 h ) at rt . the organic layer was collected , and the aqueous layer was extracted with etoac ( etoac : aqueous layer/1:1 ) four times . the combined organic layer was dried over anhydrous magnesium sulfate and was concentrated in vacuo and further purified by flash chromatography . crystals of the enzyme were obtained using the hanging drop vapor - diffusion method by mixing equal volumes of protein ( 812 mg / ml concentration in 100 mm sodium phosphate ph 7.4 , 3 mm dtt ) and the reservoir solution ( 30% peg 3350 , 010% sucrose ) at 4 c . the crystals grew in approximately 1 week and belonged to the hexagonal space group p6522 . complexes of seh with inhibitors 8/uc1770 or 4 have been obtained by soaking seh crystals grown as described above in modified mother liquor ( 35% peg 3350 , 50 mm sodium phosphate ph 7.4 ) supplemented with 1 mm solution of inhibitor for 17 days prior to the data collection , a suitable crystal was dipped for 30 s in a modified mother liquor solution ( 35% peg 3350 ) with the addition of 10% glycerol as a cryoprotectant . diffraction data were collected at 100 k at the xp station at the center for advance microstructures and devices at louisiana state university with a mar charge - coupled device camera ( structure tppu / uc1770 ) or the ne - cat beamline 24-id - c at the advanced photon source equipped with the pilatus 6 m detector ( structure 4 ) . the images were processed and scaled using the hkl2000 ( structure tppu / uc1770 ) or xia2 program suit ( structure 4 ) . data collection and data processing statistics are given in table 1 . the molecular replacement procedure was applied to locate a solution using the program molrep . a monomer of human seh ( pdb accession code 1s8o ) was used as a search model . the positioned mr model was refined using the maximum likelihood refinement in refmac with the tls parameters generated by the tlsmd server . hek-293 cells stably expressing hkv11.1 ( herg ) under g418 selection were a generous gift from craig january ( university of wisconsin , madison ) . cells were cultured in dmem containing 10% fetal bovine serum , 2 mm glutamine , 1 mm na pyruvate , 100 u / ml penicillin and 100 g / ml streptomycin , and 500 mg / ml g418 . before electrophysiological experiments , cells were grown to 60% confluency and 10 mm astemizole was added to the culture for 24 h to increase kv11.1 surface expression . all experiments were conducted with an epc-10 amplifier ( heka , lambrecht / pfalz , germany ) in the whole - cell configuration of the patch - clamp technique with a holding potential of 80 mv . pipette resistances averaged 2.0 m. compound solutions in na+-ringer were freshly prepared during the experiments from 10 mm stock solutions in dmso . the external solution contained in mm : 160 nacl , 4.5 kcl , 2 cacl2 , 1 mgcl2 , and 10 hepes , ph 7.4 , osmolality 300 mmol / kg . the internal pipet solution contained in mm : 120 kcl , 10 hepes , 4 na2atp , 10 egta , 5.374 cacl2 , 1,75 mgcl2 , ph 7.2 , osmolality 295 mmol / kg ( free ca concentration 150 nm calculated with maxchelator assuming a temperature of 25 c , a ph of 7.2 , and an ionic strength of 160 mm ) . herg ( kv11.1 ) currents were elicited with a two - step pulse ( applied every 10 s ) from 80 mv first to 20 mv for 1 s and then to 50 mv for 2 s , and the percent reduction of both peak and tail current by the drug were determined . all the animal experiments were performed according to the protocols approved by the animal use and care committee of university of california davis . male swiss webster mice ( 8 week old , 2430 g ) purchased from charles river laboratories were used for pk studies . inhibitors for oral administration were dissolved in oleic acid - rich triglyceride containing 20% peg400 ( v / v ) to give a clear solution . blood ( 10 l ) was collected from the tail vein using a pipet tip rinsed with 7.5% edta(k3 ) at 0 , 0.5 , 1 , 1.5 , 2 , 4 , 6 , 8 , 24 , and 48 h after administration of the inhibitor in a cassette of 35 compounds ( supporting information , table s1 ) ( 0.3 mg / kg per compounds , 100110 ul ) . each blood sample was immediately transferred to a tube containing 50 l of water containing 0.1% edta . after being mixed strongly on a vortex for 1 min , the blood samples were prepared for the measurement of seh inhibitors according to the previously reported method by liu et al . the details lc / ms ms methods are described in detail in the supporting information . all the animal experiments were performed according to the protocols approved by the animal use and care committee of university of california davis . male sprague dawley rats ( n = 4 , 8 week old , 250300 g ) were used for pharmacokinetic study for seh inhibitors . a cassette of four inhibitors ( inhibitors 4 , 7 , 19 , and 21 , 0.3 mg / kg per inhibitors , 0.91.2 ml ) was given by oral administration . inhibitor was dissolved in oleic oil containing 5% polyethylene glycol 400 to form a clear solution . blood ( 10 l ) was collected from the tail vein by using a pipet tip rinsed with 7.5% edta(k3 ) at 0 , 0.5 , 1 , 1.5 , 2 , 4 , 6 , 8 , and 24 h after oral dosing with the inhibitor . each blood sample was immediately transferred to a tube containing 50 l of water and mixed by vortex for 1 min , and all samples were stored at 80 c until analysis . the blood samples were prepared for the measurement of seh inhibitors according to the previously reported method by liu et al . the details lc / ms ms methods are described in detail in the supporting information . a diabetic neuropathic pain modeled was generated using streptozocin which targets and kills the pancreatic beta islet cells , rendering the animals with type i diabetes . the rats were acclimated for 1 h and tested for baseline thresholds before inducing diabetes . the baseline mechanical withdrawal thresholds were established using the von frey mechanical nociceptive test with an electronic anesthesiometer ( iitc , woodland hills , ca ) . subsequently , streptozocin ( 55 mg / kg ) in saline was injected via tail vein per previously reported methods . after 5 days , the allodynia of diabetic rats was confirmed with the von frey nociceptive assay . the hind paw of the rat was probed through the mesh with a rigid tip probe connected to the electronic readout pressure meter set to the maximum hold setting . the withdrawal thresholds per rat were measured 35 times at 1 min intervals for each time point . the baseline diabetic allodynia was quantified again at the beginning of all test days . the rats were then administered vehicle or seh inhibitor via oral gavage and tested at 30 min , 1 , 2 , 3 , 4 , 5 , 6 , and 8 h for mechanical withdrawal thresholds . the reported scores are the grams of force required to elicit a hind paw withdrawal averaged with standard error of the mean ( sem ) per a group of rats ( n = 5 ) . the baseline diabetic neuropathic scores were normalized to 100% to reflect the response to treatments which are reported as % of post diabetic neuropathic baseline .

the nature of the effects of higher - order corneal aberrations on lower - order corneal astigmatism has until now been poorly understood . if the corneal astigmatism differed from the manifest astigmatism , it was usually diagnosed as lenticular astigmatism through a process of exclusion . some authors have also performed studies to show that the posterior surface of the cornea can also cause astigmatism , but the amount of induction of astigmatism has been relatively small ( on the order of a fraction of a diopter).13 topography - guided ablation , market name contoura on the wavelight excimer lasers ( wavelight , erlangen , germany ) , has added yet another element of uncertainty . often the manifest refraction ( cyclopleged or not ) and the autorefraction do not correspond with the astigmatism that contoura processing results in . in parts 2 and 3 of this series , the author has shown that correcting with contoura processing through the lyra ( layer yolked reduction of astigmatism ) protocol results in correction of astigmatism in virtually all cases , and has also demonstrated that treatment on the wrong manifest astigmatism axis can result in loss of effectiveness of astigmatism correction and also induction of a whole new astigmatism on an oblique axis.4,5 we examined patients who had a significant difference between manifest refraction and contoura measured astigmatism in an effort to delineate the reasons for induction , modification , and reduction of astigmatism by the corneal aberrations . our hypothesis was that the higher - order aberrations ( hoas ) were directly modifying the lower - order astigmatism in such a way as the combination of the distortion of the two necessitated the cortical processing to pick a point of least confusion , resulting in a manifest refraction that was often significantly different from the contoura measured astigmatism / axis . figure 1 shows how with - the - rule and against - the - rule create an oval - shaped central cornea . this demonstrates the ovalization caused by these two types of lower - order astigmatism . an analysis was performed by the author in patients who had full contoura measured correction performed as per the lyra protocol , which allows for contoura processing to determine the linkage in between the aberration correction layer and the refraction correction layer . the lyra protocol is as follows : enter the manifest / cycloplegic refraction into contoura during presurgical planning.zero out the astigmatism and sphere to see ablation pattern for the aberration correction layer.enter contoura measured astigmatism and axis for the final correction . the ablation map at this point should be similar to the pentacam anterior elevation map . this will assist understanding the ablation when there is a significant discrepancy between manifest versus measured astigmatic power and axis.the sphere is now entered after adjustment for the spherical equivalent of the change in astigmatism . zero out the astigmatism and sphere to see ablation pattern for the aberration correction layer . the ablation map at this point should be similar to the pentacam anterior elevation map . this will assist understanding the ablation when there is a significant discrepancy between manifest versus measured astigmatic power and axis . the sphere is now entered after adjustment for the spherical equivalent of the change in astigmatism . aberration correction was visualized on the treatment planning page of contoura by zeroing out the refraction , and displaying contoura correction of the aberration . the change of shape to the central cornea was determined using this method , and comparison against the manifest refraction astigmatism and axis was performed . the examination of a large number of eyes resulted in six categories where manifest astigmatism was different from corneal astigmatism . all patients were analyzed using the topolyzer vario , and all patients had correction by one surgeon ( mm ) at one center using the wavelight ex500 system with contoura and the wavenet server . as part of this analysis , patients had cyclopleged manifest refractions performed to rule out the existence of lenticular accommodation of astigmatism . for purposes of this paper , a manifest refraction will be a cyclopleged one , essentially the refraction that we obtain using the phoropter with patient subjective input . all cases below each have a preoperative topography , postoperative topography , and aberration ablation pattern to determine the type of aberration . case 1 : corneal aberration induction of manifest astigmatism ( figure 2 ) preoperative manifest refraction : 1.00 , 2.758 with best - corrected visual acuity ( bcva ) of 20/20preoperative autorefraction : 0.50 , 2.50171measured contoura correction : 1.40 , 2.001postoperative refraction and vision at 3 months : plano ; 20/15 . preoperative manifest refraction : 1.00 , 2.758 with best - corrected visual acuity ( bcva ) of 20/20 preoperative autorefraction : 0.50 , 2.50171 measured contoura correction : 1.40 , 2.001 postoperative refraction and vision at 3 months : plano ; 20/15 . in this case , the hoa creates an oval that adds to the lower - order astigmatism oval , increasing the manifest astigmatism . when the hoa is treated , the amount of astigmatism correct is decreased as demonstrated by the contoura measured correction and postoperative result . case 2 : corneal aberration cancellation of manifest astigmatism ( figure 3 ) preoperative manifest refraction : 1.50 with bcva of 20/20preoperative autorefraction : 2.00measured contoura correction : 1.12 , 0.77121postoperative refraction and vision at 1 week : plano ; 20/15 . preoperative manifest refraction : 1.50 with bcva of 20/20 preoperative autorefraction : 2.00 measured contoura correction : 1.12 , 0.77121 postoperative refraction and vision at 1 week : plano ; 20/15 . this particular patient had his entire lower - order astigmatism completely cancelled out by the hoa , resulting in a manifest refraction with no astigmatism ( no astigmatism on the autorefraction also ) . the oval caused by the lower - order astigmatism is oblique ( oblique astigmatism has only been seen rarely by us ) , as is the ovalization created by the hoas , and the two ovals completely cancel each other out during manifest refraction . removing the hoa reveals the lower - order astigmatism underneath , which can be recognized as bowtie case 3 : corneal aberration cancellation via oblique aberration and cerebral processing ( figure 4 ) preoperative manifest refraction : 2.75 with bcva of 20/20preoperative autorefraction : 3.75 , 0.25150measured contoura correction : 2.40 , 0.771postoperative refraction and vision at 1 month : 0.25 ; 20/15 . preoperative manifest refraction : 2.75 with bcva of 20/20 preoperative autorefraction : 3.75 , 0.25150 measured contoura correction : 2.40 , 0.771 postoperative refraction and vision at 1 month : 0.25 ; 20/15 . this patient shows with - the - rule astigmatism on topography , but has a manifest refraction and autorefraction that essentially shows no astigmatism . the ablation pattern shows correction of trefoil , but the oval created is not along the axis expected to cancel out the corneal lower - order astigmatism . the other eye of this patient had a similar with - the - rule astigmatism on topography , similar lack of astigmatism of manifest and autorefraction , but the aberration oval was perpendicular to the lower - order astigmatism and clearly cancelled it out . this one is at an oblique angle , so it appears that somehow the patient s cerebral processing is working similar to the other eye , but somehow still cancelling out the astigmatism with an oblique aberration . it is difficult to see how even examining this aberration in three dimensions would somehow create an ovalization that was directly perpendicular to the oval created by the lower - order bowtie astigmatism . the result of contoura measured correction resulted in 20/15 vision with all astigmatism removed in both eyes . case 4 : aberration induction of astigmatism with dilation of the pupil ( figure 5 ) preoperative manifest refraction : 7.75 , 1.0075 with bcva of 20/20preoperative autorefraction : 8.00 , 0.7575measured contoura correction : 8.00 , 0.07121postoperative refraction and vision at 1 month : plano ; 20/15 . preoperative manifest refraction : 7.75 , 1.0075 with bcva of 20/20 preoperative autorefraction : 8.00 , 0.7575 measured contoura correction : 8.00 , 0.07121 postoperative refraction and vision at 1 month : plano ; 20/15 . this patient has coma directly adjacent to the pupil , causing manifest refraction and autorefraction of astigmatism . case 5 : oblique manifest astigmatism induced by corneal aberration ( figure 6 ) preoperative manifest refraction : 2.50 , 0.50155 with bcva of 20/20preoperative autorefraction : 2.75 , 0.50142measured contoura correction : 2.00 , 1.501postoperative refraction and vision at 1 month : plano ; 20/15 . preoperative manifest refraction : 2.50 , 0.50155 with bcva of 20/20 preoperative autorefraction : 2.75 , 0.50142 measured contoura correction : 2.00 , 1.501 postoperative refraction and vision at 1 month : plano ; 20/15 . bowtie astigmatism , yet both manifest and autorefraction show an oblique astigmatism of a much smaller magnitude . in this particular case the trefoil is creating an oval that is at an oblique angle cancelling out the with - the - rule astigmatism and also creating an oblique astigmatism . removing the aberration results in 1.50 d of with - the - rule astigmatism . the topography shows signs of the epithelium still becoming uniform from epithelial molding to the aberration . case 6 : pure lenticular astigmatism ( figure 7a c ) this case has a wavefront measured astigmatism of 3.5 d at 84 degrees , a manifest astigmatism of 1.75 d at 90 degrees , and a contoura measured astigmatism of 1.49 d at 81 degrees . the contoura measured astigmatism is very close to the manifest astigmatism , while the wavefront shows a much higher amount of measured astigmatism . in this case , the corneal aberration is cancelling out astigmatism that can only be coming from the lens , and treating the contoura measured will reveal astigmatism from the lens . the diagnosis of such a case is best done with wavefront measurement , and treatment of residual astigmatism can either be done with wavefront - guided or likely even wavefront - optimized correction . if the surgeon elects to treat , they must inform the patient of the need for re - treatment if cataract surgery is ever necessary . this understanding of how hoas affect lower - order astigmatism came about as an attempt to understand why the lyra protocol using the measured contoura astigmatism is effective . different theories were examined , but the underlying fact was that using the lyra protocol eliminated astigmatism , and resulted in good vision even when the manifest astigmatism / axis differed markedly from the contoura measured astigmatism / axis . over time , examining the hoa pattern of patients in relation to their lower - order astigmatism , and the changes from manifest refraction to contoura measured led to an understanding of how the hoas were interacting with the lower - order astigmatism . essentially , this understanding was reverse - engineered from the realization that the lyra protocol works and creates more uniform corneas . the author initially considered the theory that lenticular accommodation of the cornea may exist to explain some of the differences between manifest and measured refraction . this would be where the lens is capable of accommodating in such a way as to correct or even cause astigmatism . this has never been proven to exist , but was a theory that was considered . cycloplegia would actually provide a different astigmatism refraction that would be closer to or equivalent to the contoura measured astigmatism if lenticular accommodation of astigmatism was present . unfortunately , in no cases that the author examined was this demonstrated , and all patients considered for this analysis had cyclopleged refractions to rule out any accommodative aspect . what we have theorized is that peripheral or central hoas create an ovalization in the central cornea ( within the mesopic pupil ) , resulting in a deformed central ray of light forming a lower - order astigmatism . therefore , the manifest refraction is a result of the oval shapes created by lower - order and higher - order astigmatism and its resulting central ray of light interaction . corneal lower - order astigmatism essentially creates an oval shape in the center of the cornea , as shown in the figures . corneal aberrations such as trefoil and quadrafoil can also create an oval shape to the central cornea , and depending on how the two ovals of higher - order and lower - order aberration line up , it will either increase or decrease the manifest measurement of astigmatism . the author further theorizes that the central ray of light forms the main part of vision , and the refraction requested by the patient achieves the best possible correction that minimizes cerebral confusion via the addition of spherical or astigmatism glass correction . this visual impression of the patient is widely determined by the shape formed by low- and high - order aberrations that pass the central portion of the cornea and form the related focusing at the retinal level . it adds or reduces the amount of refraction ( depending on the orientation of the spherical aberration ) when the pupil widens . the dilated pupil allows the pre - existent hoa to become dominant and change the focus quality at the retinal level . this paper in contrast seeks to demonstrate that hoas can also affect the visual impression of the patient . furthermore , the autorefractometer might not be able to detect the difference between hoa and lower - order aberration , because it measures only the central 2 mm of the cornea and , therefore , the ray of light deformed by the lower - order aberrations and hoas . what we have observed across the examination of many patients is that the majority of hoas are trefoil , with a lesser amount of quadrafoil , and coma . when the aberration is examined using the treatment planning page , it was possible in some cases to see the oval created by the aberration and how it impacted the actual corneal astigmatism . unfortunately , aberrations are not two dimensional , they are three dimensional and the ovals simply do not line up in all two - dimensional ablation maps . contoura with lyra protocol results in many cases with a completely different measured astigmatism and axis versus the manifest . in the author s experience , performing this procedure has not worsened patients vision , which would occur if the hypotheses presented here were incorrect . the author surmises that it is cerebral processing that compensates for the distortion caused by hoas . the cerebral cortex must interpolate information where it becomes distorted by an hoa , and removal of that hoa would remove the need for that interpolation . although there has been some conjecture in the past that some aberrations may be good , that is , as in fighter pilots that have 20/10 vision and hoas , the author believes that the high resolution for the 20/10 vision comes from a high density of photoreceptors in the retina in these individuals , and a fighter pilot s or baseball player s high capabilities in dynamic vision testing are due to rapid cerebral interpolation to compensate for distortion created by hoas . if this is the case , then removal of the hoas on a person who is already 20/10 would result not in better snellen visual acuity ( which would be limited by retinal photoreceptor density in the macula ) , but in faster response times as cerebral processing / interpolation would no longer be necessary . furthermore , the ability to clearly see the edges of objects would allow for faster locking in by the brain for dynamic motion , likely resulting in better response time to a 95 mile per hour fastball or a fast flying opposing fighter that require responses in the milliseconds . the author now postulates that there is no such thing as a good aberration , but essentially all aberrations are bad and require cerebral processing to compensate for them . treating these hoas to make a more uniform cornea will simply allow a clear path of light that will not need to be compensated for . at this point , it should be mentioned that too much emphasis can be placed on the snellen visual acuity . we have all seen 20/15 patients who are not happy , and we have treated patients for halos who are clearly 20/15 but have 0.5 d of astigmatism and complain about their night vision . treating that residual astigmatism significantly improves the night time vision and decreases halos . in our experience , a patient who is 20/20 without halos is happier than a 20/15 with halos . an eye with 20/15 or 20/10 vision after laser correction means that the treatment allowed the retina to more fully achieve its resolution , but it does not guarantee that aberrations or incomplete treatment of the cornea will not result in a patient who is not completely happy . for purposes of visualization , with - the - rule astigmatism if the aberration also creates an oval that is horizontal , the manifest astigmatism will be greater than the corneal astigmatism . if the aberration creates a vertical oval on the same type of cornea , the manifest astigmatism will be cancelled out or less than the corneal astigmatism . depending on the axes of the two ovals the manifest and measured axis may be significantly different also . with further refinement of the contoura software , we would be able to specifically quantify the axis of the oval created by the aberration , as we can quantify the axis created by lower - order corneal astigmatism , and with that create a vector diagram that can accurately predict the axis . this would be interesting for demonstrative purposes , but in essence contoura does it for us by giving us the final result of astigmatism and axis by calculating this interaction . the author understands that separating these interactions as has been done in this paper is artificially attempting to break down complex three - dimensional interactions between the hoa and the lower - order astigmatism into a two - dimensional image for illustration purposes . we do not expect to find these interactions in every single case , but in many cases this interaction can be visualized . the main takeaway from these cases is that the interactions are mainly corneal in nature , and rarely involve the lens as has been postulated for many years via data from wavefront maps . cases 1 and 2 essentially demonstrate either cancellation or induction of astigmatism with ovalization created by the hoas that is either on the same axis or perpendicular to the oval created by the lower - order astigmatism . case number 3 demonstrated a different sort of issue , where the oval shape created by the aberration was oblique to the axis of the corneal astigmatism , yet seemed to fully cancel it out . although it is possible that the oval created centrally is not as oblique as the overall shape of the trefoil aberration in his cornea , we think just as likely it may be that cerebral processing is involved . this patient s other eye had a textbook cancellation of with - the - rule astigmatism by corneal aberration . it may very well be that there was partial compensation of the astigmatism in case 3 by the aberration , and partial compensation of the corneal astigmatism via cerebral processing . we know that manifest refraction is based simply on the point of least confusion of vision , and we know that what we see is actually subject to cerebral processing . this particular case was an anomaly , and the only one that the author has seen like this , where it seems cerebral processing somehow allowed an oblique aberration to cancel out a regular with - the - rule astigmatism . in this case , it is difficult to see even how examining this aberration in three dimensions would somehow create an ovalization that was directly perpendicular to the oval created by the lower - order bowtie astigmatism . in case 5 , we also demonstrate a case where an oblique aberration appears to cancel out a with - the - rule lower - order astigmatism . in that case , an oblique astigmatism is created on manifest refraction . in this case , there is no oblique astigmatism on manifest refraction , just a complete cancellation of with - the - rule astigmatism . cerebral processing is responsible for figure 5 , where the lines do not look parallel but actually are . this type of simple drawing is an example of how cerebral processing can be used to alter how we see things . case 4 demonstrates how coma peripheral to the pupil can result in incorrect measurement of astigmatism in a dark room with a mydriatic pupil , or during cyclopleged refraction . correction of this astigmatism results would lead to an incorrect result , as there is no actual astigmatism , but a localized distortion created by the high spot of the peripupillary coma . such a patient may have decreased or no manifest astigmatism with a meiotic pupil , as the pupil may close enough to decrease or eliminate the distortion created by the coma . removal of the coma results in a cornea that has no astigmatism on either manifest or cyclopleged refraction . not only can the coma cause a manifest astigmatism , but it can also change the axis of astigmatism of an actual lower - order corneal astigmatism , resulting in an incorrect treatment . this particular patient had astigmatism at an oblique axis on manifest , cyclopleged manifest , and also autorefraction . contoura measured showed no astigmatism at all , supported by the fact that no lower - order astigmatism is noted on the preoperative topography . similar examples can be demonstrated with corneal keratoconus patients where the predominating aberration is coma ( except in the case of central keratoconus ) . case 5 demonstrates how an oblique aberration oval changes the with - the - rule astigmatism noted on topography to an oblique manifest astigmatism . this case shows how the interaction between lower- and higher - order astigmatism can also end up with an oblique axis of astigmatism being created . in this particular case not only does the oblique oval created by the trefoil cancel out the with - the - rule astigmatism , but it also creates a tangential astigmatism at an oblique axis . after observing the interactions between higher- and lower - order astigmatism over many contoura with lyra protocol corrections , the vast majority of lower - order astigmatism is actually either with- or against - the - rule , with an axis of astigmatism usually within 15 degrees of the 90 degree and 180 degree axes . it appears that oblique manifest astigmatism seems to be mainly caused by either an oblique oval created by an aberration , or by peripupillary coma that affects the mydriatic and cyclopleged manifest measurements . this patient has minimal lower- or higher - order corneal astigmatism , but has a manifest refraction showing astigmatism . pure lenticular astigmatism appears to be more uncommon than originally thought . in the analysis of author mm s patients , since performing contoura with lyra protocol corrections , no patients had demonstrated lenticular astigmatism . contributor sl has seen 45 eyes with lenticular astigmatism several years and thousands , of eyes examined . in all cases of lenticular astigmatism there was little to no corneal aberration or corneal astigmatism present , with significant astigmatism on manifest refraction . such a case is presented here as case 6 , and the author believes that such a case should be carefully approached as the center of lenticular astigmatism may be different than the center for wavefront - optimized or wavefront - guided treatment . although theoretically a patient may exist with corneal aberration , corneal astigmatism , and lenticular astigmatism , neither the author nor the contributors have seen such a patient to this point . such a patient would have residual astigmatism after all corneal aberrations and astigmatism were eliminated . enhancement of such a patient could likely be done through wavefront - guided ablation , or even perhaps by wavefront - optimized ablation to eliminate residual astigmatism . the takeaway message , though , is that lenticular astigmatism is much less common than has been estimated . this has been a diagnosis of exclusion , as there was incomplete understanding of the nature of how hoas interact with lower - order astigmatism . while conducting literature searches for this paper , the author could not find a single study or paper proving lenticular astigmatism s existence except for the report of an unusual patient . finally , studies that analyzed posterior corneal astigmatism demonstrated only very small amounts of astigmatism , on the order of small fractions of a diopter.13 finally , it is important to note that contoura is able to calculate the linkage between the hoas and lower - order astigmatism . we do not regularly spend time finding the ovalization interactions between the hoas and lower - order astigmatism .

d - myo - inositol 1,4,5-trisphosphate receptors ( ip3rs ) are ca channels located on the endoplasmic reticulum . ip3 [ ins(1,4,5)p3 , 1 ] is a second messenger produced by the action of phospholipase c on phosphatidylinositol 4,5-bisphosphate in response to various extracellular signals . ip3 binds to its receptor and opens its intrinsic ca channel , allowing ca to leak into the cytosol and so cause the increase in cytosolic [ ca ] that regulates many cellular events . to study the interaction of 1 with its receptor and to understand structure activity relationships ( sars ) , many synthetic analogues of ip3 these studies revealed that the 4,5-bisphosphate functionality and 6-oh group are apparently crucial for activity , while the 1-phosphate has a supplementary role , and the 2-oh and 3-oh groups are much less important . although the relative importance of all of the hydroxyl and phosphate groups has been established , none of the synthetic analogues has proven to be more potent than the natural ligand . in 1993 , two potent agonists of ip3 receptors , adenophostin a ( 3a , figure 1 ) and adenophostin b ( 3b ) , were isolated from culture broths of penicillium brevicompactum . both 3a and 3b bind to ip3 receptors with much greater affinity than ip3 and are 10100 times more potent than ip3 in evoking ca release . this finding has stimulated many syntheses of various analogues of the adenophostins and studies of their sars . structures of ip3 ( 1 ) , ins(4,5)p2 ( 2 ) , and adenophostins ( 3a and 3b ) . sar studies with synthetic analogues of adenophostin a ( ada ) with and without a purine ring established that the presence of the adenine ring ( or an aromatic surrogate ) is crucial for enhanced affinity . this suggests that the adenosine moiety either disposes the 2-phosphate in a special spatial arrangement to strengthen its interactions with the receptor ( indirect role ) or that the adenine moiety itself is involved in supplementary binding interactions with a nearby region of the binding site ( direct role ) . it has been shown that the glucose 2-oh group ( analogous to 6-oh in ip3 ) is important , while the glucose 5-ch2oh ( analogous to the 3-oh in ip3 ) and ribose 4-ch2oh are less important for ada activity . the roles of the phosphate groups of ip3 seem to be established , but their relative importance in the adenophostins has not been examined systematically using synthetic chemistry . we have proposed a model for ada binding to the ip3-binding core ( ibc ) of the receptor in which the glucose 2-oh and 3,4-bisphosphate triad mimic the 6-oh and 4,5-bisphosphate triad of ip3 , while the adenine engages in a cation- interaction with arg504 adjacent to the binding site . in this model we recently reviewed aspects of the chemistry and biology of ada in its interaction with ip3r and examined the thermodynamics of both ip3 and ada binding to both the n terminus and ibc of the ip3r . bisphosphate 6 ( figure 2 ) was previously made by enzymatic hydrolysis of ada using alkaline phosphatase and was reported to be 1800 times weaker than ada . this implied a critical role for the 2-phosphate group and led some workers to conclude that the adenine had only an indirect role , by enhancing the positioning of the 2-phosphate group . however , this finding seems incompatible with our suggestion based on detailed sar and molecular modeling that the adenine may form its own interactions with the ip3r . furthermore , inframolecular protonation studies of ada suggest that , at least in solution , the 2-p is close to the glucose ring and the three phosphate groups behave similarly to those in ip3 . hence , we were curious to re - examine the biological activity of 6 with a chemically synthesized sample and to compare its activity with a minimal motif of ada , glucose 3,4-bisphosphate [ gluc(3,4)p2,7 ] . quantitative insight into the contribution of the adenosine moiety might be obtained by comparison of the activities of 6 and 7 , which differ only by the presence of the adenosine moiety . thus , to explore our model further and to investigate whether the extra binding motif of ada as compared to ip3 might compensate for removal of a phosphate interaction , we report the synthesis and biological evaluation of all three possible bisphosphates of ada . a preliminary communication on this work has appeared , and we recently reported the ability of 6 to evoke ca release via recombinant and mutant ip3rs . for the synthesis of adenophostin analogues , an ideal and economical strategy would be the vorbrggen condensation of a silylated purine with an appropriately protected disaccharide , followed by deprotection of hydroxyl groups ( to be later phosphorylated ) , phosphorylation , and final deprotection . it is a prerequisite to have ester functionalities at 1-o- and 2-o - positions of the disaccharide for the vorbrggen condensation . other hydroxyl groups on the disaccharide have to be protected with orthogonal protecting groups , such that the hydroxyls to be phosphorylated are protected with an easily removable temporary protecting group and the other hydroxyls are protected with a stable protecting group that can be cleaved at the final step . because the nucleoside after vorbrggen condensation will have an ester protecting group at the 2-o - position ( which has to be phosphorylated in 4 and 5 ) and the fact that this ester can be removed under milder conditions , it is ideal to protect the other hydroxyl to be phosphorylated as a similar ester . benzyl is the protecting group of choice for all other hydroxyl groups as it is stable to various conditions and also due to the convenience in its deprotection along with other benzyl protecting groups on phosphate triesters in a single final step . the synthesis of 4 started from the cheaply available penta - o - acetyl--d - glucose ( 8 , scheme 1 ) . the glycosyl donor 15 was prepared from 8 by a series of protecting group manipulations . the butane 2,3-diacetal ( bda ) derivative 9 was obtained from 8 as reported previously . the acid - labile bda protecting group was removed by hydrolysis with 80% acetic acid . stannylene - mediated benzylation was sluggish and gave a 1:1 mixture of isomeric tribenzyl ethers 12 ( 27% ) and 13 ( 23% ) along with unreacted 11 ( 36% ) . sodium hydride - mediated benzylation also gave a 1:1 mixture of tribenzyl ethers 12 ( 18% ) and 13 ( 16% ) in very low yield along with fully benzylated 14 ( 32% ) and starting material 11 ( 24% ) . fortunately , benzylation under biphasic conditions with tetrabutylammonium hydrogen sulfate as phase transfer catalyst gave predominantly the tribenzyl ether 12 ( 74% ) along with minor amounts of 13 ( 8% ) and 14 ( 10% ) . n - iodosuccinimide ( nis)-mediated glycosylation of 5-o - benzyl-1,2-o - isopropylidene--d - ribofuranose ( 16 ) , which was prepared from 1,2-o - isopropylidene--d - xylofuranose by a known procedure with glycosyl donor 15 , gave the -glycoside 17 selectively . such a high degree of selectivity has been observed before when structurally similar compounds were used . to make the disaccharide donor for vorbrggen glycosylation , the isopropylidene group in 17 was hydrolyzed with 90% trifluoroacetic acid ( tfa ) , and the resulting mixture of diols ( anomeric mixture ) was acetylated under standard conditions to produce a chromatographically inseparable / mixture of triacetates 18 . vorbrggen condensation of 18 with silylated 6-chloropurine gave the -nucleoside 19 as the exclusive product . the yield of the condensation depended on the nature of the silylating agents used for the persilylation of purine . among the various silylating agents used , n , o - bis - trimethylsilyl - acetamide ( bsa ) gave a very good yield for the subsequent same pot glycosylation . removal of the acetate protecting groups in nucleoside 19 and substitution of chlorine with an amino group were achieved concomitantly by ammonolysis . the diol 20 was then selectively phosphitylated with dibenzyl n , n - diisopropyl phosphoramidite in the presence of imidazolium triflate as catalyst , and the resulting bisphosphite was oxidized in situ to bisphosphate 21 . finally , all of the benzyl protecting groups ( on both the phosphate and the sugar ) were removed by transfer hydrogenolysis to provide the bisphosphate 4 , which was purified by ion exchange chromatography . reagents and conditions : ( a ) bnbr , nah , dmf , 0 c room temperature , 2 h. ( b ) 80% aqueous hoac , reflux , 1 h. ( c ) bu2sno , bnbr , bu4nbr , mecn , 3 molecular sieves , reflux , 24 h. ( d ) bu4nhso4 , bnbr , dcm : 5% aqueous naoh ( 1:1 ) , room temperature . ( e ) ac2o , pyr , room temperature , 12 h. ( f ) compound 16 , nis , tmsotf , dioxane : toluene ( 3:1 v / v ) , 3 molecular sieves , room temperature , 30 min . ( h ) ac2o , pyr , room temperature , 3 h. ( i ) 6-chloropurine , bsa , tmsotf , mecn , 70 c , overnight . ( k ) ( 1 ) ( bno)2pn(ipr)2 , imotf , dcm , room temperature , 30 min ; ( 2 ) mcpba , 78 c room temperature , 1 h. ( l ) cyclohexene , pd(oh)2 , meoh , h2o , 80 c , overnight . synthesis of bisphosphate 5 started with commercially available tetra - acetate 22 ( scheme 2 ) . the acetate protecting groups on 22 were removed by methanolysis with a catalytic amount of sodium methoxide in methanol , and the resulting crude tetrol was converted into diol 23 by benzylidenation using benzaldehyde dimethyl acetal and camphorsulphonic acid ( csa ) . crude 23 was then benzylated with an excess of benzyl bromide and sodium hydride to afford the dibenzyl ether 24 . reductive opening of the benzylidene acetal by following a known procedure gave the tribenzyl ether 25(32 ) selectively . glycosylation of ribose derivative 16 with the glycosyl donor 26 , obtained by acetylation of the tribenzyl ether 25 , gave -glycoside 27 selectively . as in the previous case , disaccharide 27 was converted into the triacetate 28 ( - and -anomer ) in a one pot reaction of hydrolysis of acetonide with tfa followed by acetylation . vorbrggen condensation with 6-chloropurine gave the nucleoside 29 , which on ammonolysis provided the diol 30 . transfer hydrogenolysis removed all of the benzyl protecting groups to provide the bisphosphate 5 , which was purified by ion exchange chromatography . reagents and conditions : ( a ) meoh , naome , room temperature , 30 min . ( d ) bnbr , nah , dmf , room temperature , 2 h. ( e ) tfa , et3sih , dcm , 0 c . ( f ) ac2o , pyr , room temperature , 3 h. ( g ) compound 16 , nis , tmsotf , dioxane : toluene , 3 molecular sieves , room temperature , 30 min . ( i ) 6-chloropurine , bsa , tmsotf , mecn , 70 c , overnight . ( k ) ( 1 ) ( bno)2pn(ipr)2 , imotf , dcm , room temperature , 30 min ; ( 2 ) mcpba , 78 c room temperature , 1 h. ( l ) cyclohexene , pd(oh)2 , meoh , h2o , 80 c , overnight . the requirement that the 1-o- and 2-o - positions of the disaccharide should be protected as esters for vorbrggen condensation leaves an ester group at the 2-o - position of nucleosides 19 and 29 . with the next step being the substitution of 6-cl with nh2 and deprotection of the hydroxyl groups to be phosphorylated , the ester functionality at 2-o- position is advantageous , as treatment with nh3 effects both of the transformations . the other hydroxyl group to be phosphorylated ( 3 in 18 and 4 in 28 ) was also protected as its acetate for convenient one - step deprotection . however , it can not be applied to the synthesis of bisphosphate 6 as there is no phosphate at the 2-o - position . this prompted us to explore other possibilities . during our synthesis of the ada analogue , guanophostin , several attempts to substitute the chlorine in the intermediate 32 with different oxygen nucleophiles under basic conditions [ 4 m naoh , dioxane ; 3-hydroxypropiononitrile , 1,8-diaza - bicycloundec-7-ene ( dbu ) , dichloromethane ( dcm ) ; 3-hydroxypropiononitrile , nah , tetrahydrofuran ( thf ) ; bnoh , k2co3 ] were marred by accompanied dephosphorylation . for instance , when 3-hydroxypropiononitrile in the presence of a base ( dbu or nah ) was used , it was observed that at first all of the benzyl groups were displaced by the 2-cyanoethoxy group , which underwent -elimination to give water - soluble phosphate monoesters . o sugar cleavage , also giving all of the possible mono- , bis- , and tris - phosphates . possible transesterification pathways for a protected sugar phosphate are shown in figure 4 . because the p o sugar also underwent cleavage , we were curious to investigate the possible selective dephosphorylation at the 2-position from a protected trisphosphate such as 33 ( scheme 3 ) via transesterification with an alcohol . we envisioned that if we used the incoming nucleophile ( ro ) , the same as the protecting group on the phosphorus ( benzyl ) , the unwanted loss of protecting group on phosphorus can be prevented . various possible transesterification mechanisms for phosphate triesters . only the first step is shown . reagents and conditions : ( a ) bnoh , nah , room temperature , 30 min . ( c ) pd(oh)2 , cyclohexene , meoh , h2o , 80 c , overnight . ( d ) r nh2 ( r = h , bu , pr ) , etoh , room temperature . trisphosphate 33 on treatment with in situ - generated sodium benzoxide [ benzyl alcohol ( 5 equiv ) and nah ( 2 equiv ) ] in n , n - dimethylformamide ( dmf ) at room temperature for 30 min gave a bisphosphate as major product with minor amounts of other byproducts . fortunately , the use of the milder base potassium carbonate and bnoh as solvent resulted in the exclusive formation of this bisphosphate in excellent yield . the fact that the 2-phosphate is comparatively less crowded and hence more prone to nucleophilic attack than those in the 3,4 vicinal bisphosphate functionality could be the reason for this high selectivity . this assumption is supported by the fact that triacetate 35 on aminolysis with various amines gives the 2-o - deacetylated derivative 36 exclusively . finally , the benzyl protecting groups on both sugar and phosphorus were removed by transfer hydrogenolysis and purification of the product by ion exchange column chromatography provided bisphosphate 6 quantitatively . for biological comparison with 6 , the previously unknown glucose 3,4-bisphosphate 7 was synthesized from allyl glycoside 37 ( scheme 4 ) . phosphorylation of 37 using standard phosphoramidite methodologygave the fully protected bisphosphate 38 , and the allyl protecting group was removed using pdcl2 in methanol to give bisphosphate 39 as a mixture of - and -anomers . hydrogenolysis of 39 then provided the bisphosphate 7 , and h nmr and p nmr spectroscopy showed this to exist as a mixture of - and -anomers in aqueous or methanolic solution . the relative proportions of the two anomers were dependent on salt form and ph . reagents and conditions : ( a ) ( 1 ) ( bno)2pn(ipr)2 , 1h - tetrazole , dcm , room temperature , 1 h ; ( 2 ) mcpba , 78 c , 10 min , 92% . ( c ) h2 , pd(oh)2 , meoh , h2o , 85% . the ability of bisphosphates 47 , ip3 ( 1 ) , ada ( 3a ) , and d - myo - inositol 4,5-bisphosphate [ ins(4,5)p2 ( 2 ) ] to stimulate the ip3r of intracellular ca stores was measured using a low - affinity ca indicator trapped within the intracellular stores of permeabilized dt40 cells expressing only recombinant rat ip3r1 , as previously reported . the amount of ca released by each of these compounds was expressed as a fraction of the total ca content of the endoplasmic reticulum ( er ) as assessed by the addition of ionomycin . results show the half - maximal effective concentration of each ligand ( ec50 ) , the hill coefficient ( nhill ) , and the percentage of the intracellular stores released by a maximal concentration of each ligand . the ec50 for 5 , where even the maximal practicable concentration ( 50 m ) failed fully to release the ip3-sensitive ca stores , was calculated by assuming that it was a full agonist capable of releasing the entire ip3-sensitive ca store . among the bisphosphates , 6 is the most potent ; it releases the same fraction of the ca stores as other full agonists , and it is only 40 times less potent than ada and only four times less potent than ip3 . this contradicts an earlier report where 6 was found to be 1800-fold less potent than ada , although this is now thought to be in error ( see ref ( 19 ) for discussion ) . bisphosphate 4 released only 8% of the ca stores at a concentration of 50 m . it was impracticable to assess the activity at higher concentrations and so impossible to resolve whether 4 is a full agonist with very low affinity or a partial agonist . bisphosphate 5 had some activity , but even at 50 m , it released only 53% of the intracellular stores . again , it was impracticable to increase the concentration of 5 sufficiently to assess whether it is a full agonist , capable at a high enough concentration , of mimicking the response to a maximal concentration of ada or ip3 . assuming 5 to be a full agonist , then it is 2300 times less potent than ip3 . this is broadly in agreement with an earlier report , where ins(4,5)p2 was 460-fold less potent than ip3 in evoking ca release from rat brain microsomes . when compared in permeabilized dt40 cells ( table 1 ) , synthetic ins(4,5)p2 from the present study is ca . the marginally weaker activity of 7 as compared to ins(4,5)p2 is not surprising , given the existence of 7 as a mixture of anomers . the 7- isomer mimics four of the ip3 carbon centers retaining the important triad binding motif ( 4,5-bisphosphate and 6-oh ) ; hence , 7- might be more or less active as ip2 ( figure 5 ) . however , 7- can orient in two different ways ( a and b ; figure 5 ) , mimicking the orientation of ip3 . although orientation a has the binding motif in full , it mimics only three carbons of ip3 , while orientation b mimics four centers of ip3 but lacks the 6-oh mimic of the binding motif . while it is reasonable to expect that the mode with maximum resemblance to ip3 ( b ) would be the preferred fit , the association constant could be less due to the lack of 6-oh interaction with the receptor . competition between these two orientations ( a and b ) for receptor binding could reduce the overall potency . ada binds to a site that at least substantially overlaps the ip3-binding site and in a manner that is thought to be broadly similar to ip3 . the crystal structure of ip3 bound to the ibc ( residues 224604 ) of ip3r1 and our model for ada binding together allow a rationalization of the biological activities of the bisphosphates of adenophostin a. the ibc comprises an -domain and -domain , with ip3 sandwiched between the two domains ( figure 6 ) . possible hydrogen bonds between ip3 and ip3r in the crystal structure ( pdb : 1n4k ) of the ibc of ip3r1 . the 4,5-bisphosphate motif of ip3 makes more contacts with the receptor than the more exposed 1-phosphate . the 1-phosphate interacts only with r568 and the backbone nh of k569 in the -domain , while the 4-phosphate interacts mainly with residues in the -domain ( r265 , r269 , and t267 ) , and the 5-phosphate interacts predominantly with amino acids in the -domain ( r504 , k508 , r511 , and y567 ) . we and others have speculated that binding of ip3 pulls the domains together and closes the clam - like binding core , in a manner similar to glutamate binding to ionotropic glutamate receptors . ip3 ( 1 ) and ins(4,5)p2 ( 2 ) activate ip3r by engaging residues in the - ( green ) and - ( pink ) domains of the ibc , stabilizing a closed conformation that favors opening of the c - terminal ca channel . phosphate groups may have strong ( dark green ) or weaker ( light green ) interactions with the -domain . molecular modeling suggests that ada ( 3a ) has additional interactions ( light green ) with the -domain of the ibc , accounting for the greater potency of ada . 4-dephospho - ada ( 4 ) is essentially inactive because it can not form effective -domain interactions . however , 3-dephospho - ada ( 5 ) and 2-dephospho - ada ( 6 ) retain activity because they can effectively engage both domains , even though 5 does not contain a vicinal bisphosphate pair . the previously unexplained and relatively potent activity of ada regiosomer 40 can now be explained by analogy with 5 . recently published x - ray structures of the n - terminal ligand - binding domain ( lbd ) and the n - terminal domain of rat ip3r1 ( residues 1604 ) with and without ip3 bound support the idea that ip3 causes domain closure within the ibc . as ip3 binds , side chains of nine residues within the - and -domains of the ibc become organized around ip3 , causing the clam - like structure to partially close , reducing the angle between the two domains by 8. unfortunately , the resolution of these structures is not sufficient to provide further clues about how ada and its analogues might bind . the 4,5-bisphosphate of ip3 clearly plays a major role in cross - linking the two domains of the ibc , and the 1-phosphate exerts its enhancing effect by providing an additional , weaker interaction with the -domain , accounting for the greater potency of ip3 relative to ins(4,5)p2 ( figure 7 ) . the known inactivity of d - myo - inositol 1,4-bisphosphate [ ins(1,4)p2 ] suggests that the 1-p alone can not interact strongly enough with the -domain to pull the two domains together . our model for ada binding shows how the 3,4-bisphosphate of ada can mimic the 4,5-bisphosphate of ip3 , while both its 2-phosphate group and adenine moiety have additional interactions with the ibc ( figures 7 and 8a ) . specifically , we have proposed that while the 2-phosphate of ada essentially mimics the 1-phosphate of ip3 , the adenine can engage in a cation- interaction with the guanidinium side chain of r504 in the -domain . interactions of ada ( a ) , compound 5 ( b ) , and compound 6 ( c ) with the ibc of ip3r as predicted by molecular docking experiments . the present study shows that bisphosphate analogues of ada lacking the 3- or 4-phosphate ( 4 and 5 ) are very weak agonists , confirming the important role for the 3,4-vicinal bisphosphate in ada . however , our finding that 4 and 5 differ in their potency suggests unequal contributions from the two phosphates ( 4-p and 3-p ) . while bisphosphate 4 is almost inactive , 5 is a weak agonist of ip3r , being some 2300-fold weaker than ip3 . this shows that between the vicinal bisphosphates , the 3-phosphate in ada is less important than the 4-phosphate . loss of activity after deletion of the 4-phosphate from ada is consistent with it providing the major contact with the -domain , which may be essential for clam closure . thus , 4 and 5 can be considered as analogues of d - myo - inositol 1,5-bisphosphate [ ins(1,5)p2 ] and ins(1,4)p2 , respectively , and the fact that 5 is a weak agonist while its inositol equivalent ins(1,4)p2 is inactive can be explained in terms of our model by the enhancing role of the adenine in 5 , strengthening its -domain interactions ( figures 7 and 8b ) . 2-dephospho - ada ( 6 ) differs from gluc(3,4)p2 ( 7 ) only in having an adenosine moiety ; yet , it is 200-fold more potent than 7 ( table 1 ) . this 200-fold enhancement of activity by the adenosine moiety in the absence of a 2-phosphate establishes unequivocally that the adenosine moiety contributes directly to enhanced activity independent of any effect on positioning of that phosphate . in a recent report , we demonstrated , in a study linking chemical modification with receptor mutagenesis , that removal of the 2-phosphate from ada to give 6 has significantly lesser effects on affinity for the ibc than did removal of the 1-phosphate from ip3 to give ins(4,5)p2 . a cell line was established that expresses only ip3r1 , and mutation of r504 more profoundly reduces the affinity of ip3r for ada ( 353-fold ) than for ip3 ( 13-fold ) . the activities of other adenophostin analogues and the corresponding ip3 analogues were also comparable . thus , when an amino acid thought to be responsible for engaging the adenine unit ( r504 ) is mutated , the enhanced activity of adenophostin ligands disappears . bisphosphate 6 is the most potent known agonist of the ip3r with only two phosphates , suggesting that it may be possible to develop high - affinity ligands with fewer phosphates or even nonphosphate moieties . the possibility to develop less charged agonists or antagonists would be particularly attractive for cellular or in vivo chemical biological studies . even though 5 is a weak agonist , its measurable activity suggests that a vicinal bisphosphate is not absolutely required for a ligand to activate ip3r . the regioisomeric ada analogue 2-phospho-3-dephospho - ada 40 ( figure 9 ) with the 3-phosphate group of ada transposed to the 2-position was previously shown to possess surprisingly potent activity that did not fit established sar considerations . compound 40 , although lacking the vicinal 3,4-bisphosphate , is only 1220 times less potent than ip3 in liver flux and binding assays , respectively . interestingly , d - myo - inositol 1,4,6-trisphosphate ( 41 ) , which may be pictured as having a similar arrangement of phosphate groups to 40 ( figure 9 ) , is also an agonist , only 23 times weaker than ip3 . however , 41 may be able to present an ip3-like arrangement of phosphate groups to the ibc simply by binding in an alternative orientation ( 41b , figure 9 ) . similar reasoning was used to explain the unexpected activity of 40 in the original study , where it was suggested that it too may be able to adopt an inverted binding orientation . this may seem improbable given the size and complexity of 40 as compared to 41 , but the alternative explanation , namely , that a vicinal bisphosphate is not required , would have been totally unprecedented . given the new finding of activity for 5 , which can not present a vicinal bisphosphate in any binding orientation , we can now suggest a simpler explanation for the activity of both 5 and 40 that is also consistent with more recent information on the structure of the ibc and with the concept of a direct role for the adenine . we propose that , contrary to previous assumptions , a vicinal bisphosphate motif is not absolutely essential for activation of ip3r , given sufficiently strong compensating contributions from other components of the ligand . thus , we suggest that for bisphosphate 5 , interactions of the adenine with the -domain partially compensate the loss of one phosphate group in the vicinal pair , while in 40 , these interactions are supplemented by additional contributions from the 2-phosphate , presumably also with the -domain , strengthening binding still further ( figure 7 ) . thus , it appears that two or more weak interactions with the -domain can , to some extent , compensate for the loss of a strong interaction . in summary , as a continuation of our efforts to understand sars of adenophostins at the ip3 receptor and to gain further insight into the molecular mechanism of ip3-mediated signal transduction pathways in general , we have synthesized all of the bisphosphate analogues of ada , excising one of its three phosphates at a time . bisphosphates 4 and 5 were prepared in a series of reactions involving -selective glycosylation of an appropriately protected glucose ( glycosyl donor ) and protected ribose acceptor , vorbrggen condensation of an appropriately protected disaccharide with 6-chloropurine , followed by further manipulation and chemoselective phosphitylation . a novel strategy for regioselective dephosphorylation by transesterification has been introduced for the efficient synthesis of 6 . the ability of these novel bisphosphates to stimulate ip3r - mediated ca release was measured using rat type i ip3r expressed in chicken dt40 cells and compared to that of glucose 3,4-bisphosphate ( 7 ) and ins(4,5)p2 . this study reveals that although the 3,4-bisphosphate functionality is important for high affinity binding and channel opening , it is still possible for molecules lacking this feature to stimulate the ip3r , albeit to a lesser extent . p-4 of ip3 , which contacts the -domain of the ibc , is required , but p-5 , which contacts the -domain , can be replaced by a cation- interaction between the adenine of ada and r504 in the -domain . the same interaction can substantially compensate the loss of p-1 to provide the potent agonist 6 with only two phosphate groups . inositol polyphosphates often bind to sites rich in arg and lys residues , and replacing such interactions with a polar phosphate by a cation- motif could have more general applications in the chemical biology of inositol phosphate signaling and probably also in other fields . a 200-fold enhancement in activity is found in going from the simple glucose bisphosphate 7 to the related 6 bearing an adenosyl moiety , establishing a direct role for the adenosine of ada in increasing affinity for the receptor . compound 6 , the most potent among the bisphosphates synthesized , approaches the potency of ip3 . this is the first report of a relatively potent agonist of ip3r devoid of one phosphate group from the natural ligand and suggests the possibility to develop other ligands having a fewer number of phosphates . such ligands , with less charge , could be useful for pharmacological intervention in this cellular signaling system and , at their simplest , might comprise two motifs that interact with the ibc domains linked by a suitable spacer . the reappraisal here of the relatively potent activity and surprising activity of 40 , published earlier , in the light of these new results and particularly the activity of 5 , begins to demonstrate the potential of this approach , suggesting that it should be possible in principle to develop ip3r ligands without a vicinal bisphosphate moiety . tlc was performed on precoated plates ( merck aluminum sheets silica 60 f254 , art no . chromatograms were visualized under uv light and by dipping plates into either phosphomolybdic acid in meoh or anisaldehyde in ethanol , followed by heating . ion exchange chromatography was performed on an lkb - pharmacia gradifrac medium pressure ion - exchange chromatograph using mp1 ag ion - exchange resin and a gradient of 0100% 150 mm tfa as eluent or q sepharose fast flow resin and a gradient of 0100% 1.0 m triethylammonium bicarbonate ( teab ) . h nmr , cosy , noesy , hmbc , and hmqc spectra were recorded on varian ex-400 ( 400 mhz ) and bruker avance iii ( 400 and 500 mhz ) spectrometers . proton chemical shifts are reported in ppm ( ) relative to internal tetramethylsilane ( tms , 0.0 ppm ) or with the solvent reference relative to tms employed as the internal standard ( cdcl3 , 7.26 ppm ; d2o , 4.79 ppm ) . data are reported as follows : chemical shift ( multiplicity [ singlet ( s ) , doublet ( d ) , triplet ( t ) , quartet ( q ) , and multiplet ( m ) ] , integration , coupling constants [ hz ] , annotation ) . c and dept spectra were recorded on varian ex-400 ( 100 mhz ) and bruker avance iii ( 100 and 126 mhz ) spectrometers with complete proton decoupling . carbon chemical shifts are reported in ppm ( ) relative to tms with the respective solvent resonance as the internal standard ( cdcl3 , 77.0 ppm ) . p nmr spectra were recorded on varian ex-400 ( 162 mhz ) or bruker avance iii ( 162 mhz ) spectrometers with complete proton decoupling . phosphorus chemical shifts are reported in ppm ( ) relative to an 85% h3po4 external standard ( h3po4 , 0.0 ppm ) . melting points were determined using a reichert - jung thermo galen kofler block and are uncorrected . mass spectra were recorded at the serc mass spectrometry service centre , swansea , and at the university of bath on vg autospec or microtof instruments . polarimeter in a cell volume of 5 cm , and specific rotation is given in 10 deg cm g. uv spectra were recorded using a perkin - elmer lambda ez201 spectrometer . the purities of final compounds were determined to be greater than 98% by hplc analysis . hplc analysis was carried out on a hewlett - packard series chromatograph with a strong anion - exchange resin ( mp1 ag , column size 3 mm 150 mm ) . a linear gradient of 050% 150 mm tfa was used as eluent at 1 cm / min over 60 min , with the uv detector set at 254 nm . synthetic phosphates were assayed using an adaptation of the modified brigg 's phosphate assay and/or ames phosphate assay . flash column chromatography was performed using silica gel 60 a ( 3263 m ) . all reactions were carried out under argon or nitrogen atmosphere employing oven - dried glassware unless stated otherwise . usual work up refers to taking up the crude material in an organic solvent ( ethyl acetate , dcm , or chcl3 ) followed by washing successively with water , cold diluted hcl , saturated nahco3 solution , and brine and drying over anhydrous mgso4 . both donor 15 ( 1.925 g , 3.587 mmol ) and acceptor 16 ( 981 mg , 3.5 mmol ) were dissolved in toluene dioxane ( 10 ml : 30 ml ) , and the mixture was stirred with powdered 3 molecular sieves for 15 min . nis ( 866 mg , 3.85 mmol ) was then added , and when it had dissolved , tmsotf ( 100 l , 0.55 mmol ) was added dropwise , and the mixture was stirred at room temperature . nahco3 solution was added to quench the acidic residue , and the mixture was diluted with ethyl acetate and washed with saturated na2s2o3 solution and then with brine . hexane to afford the -glycoside 17 ( 2 g , 76% ) as a colorless crystalline solid ; mp 112 c ; [ ]d + 120.8 ( c 1 , chcl3 ) . h nmr ( 400 mhz , cdcl3 ) : 1.35 ( s , 3h , ch3 isopropylidene ) , 1.50 ( s , 3h , ch3 isopropylidene ) , 1.96 ( s , 3h , coch3 ) , 3.46 ( dd , 1h , 10.87 hz , 1.00 hz , h-6a ) , 3.51 ( dd , 1h , 9.88 hz , 3.95 hz , h-2 ) , 3.59 ( dd , 1h , 10.87 hz , 2.47 hz , h-6b ) , 3.67 ( dd , 1h , 8.40 hz , 2.97 hz , h-5a ) , 3.673.74 ( m , 2h , h-4 and h-5 ) , 3.79 ( dd , 1h , 11.61 hz , 1.73 hz , h-5b ) , 4.15 ( dd , 1h , 9.14 hz , 3.95 hz , h-3 ) , 4.29 ( ddd , 1h , 9.14 hz , 3.21 hz , 1.73 hz , h-4 ) , 4.44 ( ab q , 2h , 25.69 hz , 11.36 hz , ch2ph ) , 4.47 ( ab q , 2h , 82.02 hz , 11.86 hz , ch2ph ) , 4.53 ( ab q , 2h , 46.44 hz , 11.86 hz , ch2ph ) , 4.64 ( ab q , 2h , 50.89 hz , 12.35 hz , ch2ph ) , 4.71 ( t , 1h , 3.95 hz , h-2 ) , 5.23 ( d , 1h , 3.95 hz , h-1 ) , 5.45 ( t , 1h , 9.39 hz , h-3 ) , 5.83 ( d , 1h , 3.95 hz , h-1 ) , 7.117.35 ( m , 20 h , 4 c6h5 ) . elemental analysis calcd for c44h50o11 : c , 70.01 ; h , 6.68 . found : c , 69.8 ; h , 6.69 . m / z ( es+ ) = 777.4 [ ( m + na ) , 100% ] . hrms : mass calcd for c44h54o11n1 [ m + nh4 ] , 772.3691 ; found , 772.3691 . disaccharide 17 ( 128 mg , 0.17 mmol ) was stirred with 90% tfa ( 0.5 ml ) for 1015 min at room temperature . the tfa was then evaporated off , and the residue was coevaporated several times with toluene to remove traces of water . the residue was then dissolved in pyridine ( 2 ml ) , ac2o ( 0.5 ml , 5.3 mmol ) was then added , and the mixture was stirred for 4 h at room temperature . work up was as usual , and the crude product was chromatographed to afford an inseparable mixture of the - and -triacetates 18 ( 120.6 mg , 89% ) . a suspension of triacetate 18 ( 120 mg , 0.15 mmol ) , 6-chloropurine ( 46 mg , 0.3 mmol ) , and bsa ( 182 l , 0.74 mmol ) in mecn ( 5 ml ) was refluxed until the solution became clear . the mixture was cooled to room temperature , and then , tmsotf ( 60 l , 0.33 mmol ) was added , and the solution was stirred at 70 c overnight . workup was in ethyl acetate , and the crude product was chromatographed to afford the nucleoside 19 ( 103 mg , 77% ) as a colorless gum . h nmr ( 400 mhz , cdcl3 ) : 1.84 ( s , 3h , coch3 ) , 1.86 ( s , 3h , coch3 ) , 3.41 ( dd , 1h , 10.14 hz , 3.48 hz , h-2 ) , 3.44 ( dd , 1h , 8.99 hz , 1.74 hz , ha-6 ) , 3.56 ( dd , 1h , 10.72 hz , 3.19 hz , hb-6 ) , 3.563.61 ( m , 1h , ha-5 ) , 3.60 ( t , 1h , 9.27 hz , h-4 ) , 3.703.80 ( m , 2h , h-5 , hb-5 ) , 4.40 ( ab q , 2h , 33.62 hz , 11.01 hz , phch2 ) , 4.41 ( ab q , 2h , 78.84 hz , 11.88 hz , phch2 ) , 4.424.46 ( m , 1h , h-4 ) , 4.47 ( ab q , 2h , 14.49 hz , 11.59 hz , phch2 ) , 4.49 ( ab q , 2h , 64.92 hz , 12.17 hz , phch2 ) , 4.68 ( t , 4.93 hz , h-3 ) , 4.95 ( d , 1h , 3.48 hz , h-1 ) , 5.45 ( dd , 1h , 10.14 hz , 9.28 hz , h-3 ) , 5.68 ( dd , 1h , 5.22 hz , 4.64 hz , h-2 ) , 6.30 ( d , 1h , 4.64 hz , h-1 ) , 7.007.30 ( m , 20h , 4 ph ) , 8.45 ( s , 1h , h-8 ) , 8.66 ( s , 1h , h-2 ) . m / z ( es+ ) = 915.44 [ ( m + na ) , 100% ] . hrms : mass calcd for c48h50cln4o11 [ m + h ] , 893.3159 ; found , 893.3160 . a solution of chloro - nucleoside 19 ( 100 mg , 0.112 mmol ) in ethanol ( 10 ml ) in a pressure tube was saturated with nh3 ( bubbled at 0 c for 1015 min ) . the tube was then closed tightly and was heated at 74 c for 5 days . solvents were evaporated off in vacuo , and the crude product was chromatographed with 4% meoh chcl3 to afford the diol 20 ( 86 mg , 97% ) as a colorless gum . h nmr ( 400 mhz , cdcl3 ) : 3.51 ( dd , 1h , 9.78 hz , 3.52 hz , h-2 ) , 3.56 ( dd , 1h , 10.17 hz , 9.39 hz , h-4 ) , 3.553.61 ( m , 2h , ha-5 and ha-6 ) , 3.66 ( dd , 2h , 10.57 hz , 3.52 hz , hb-5 and hb-6 ) , 3.82 ( ddd , 1h , 10.17 hz , 3.13 hz , 1.96 hz , h-5 ) , 4.04 ( br , 1h , oh ) , 4.20 ( dd , 1h , 9.39 hz , 9.78 hz , h-3 ) , 4.28 ( dd , 1h , 6.26 hz , 3.13 hz , h-4 ) , 4.41 ( dd , 1h , 5.87 hz , 3.52 hz , h-3 ) , 4.484.52 ( br , 1h , oh ) , 4.48 ( s , 2h , phch2 ) , 4.51 ( ab q , 2h , 43.82 hz , 12.13 hz , phch2 ) , 4.67 ( dd , 11.74 hz , 5.87 hz , h-2 ) , 4.69 ( ab q , 2h , 116.21 hz , 11.35 hz , phch2 ) , 4.80 ( ab q , 2h , 17.61 hz , 11.74 hz , phch2 ) , 4.96 ( d , 1h , 3.91 hz , h-1 ) , 5.98 ( d , 1h , 5.87 hz , h-1 ) , 6.05 ( br s , 2h , nh2 ) , 7.157.35 ( m , 20h , 4 ph ) , 7.98 ( s , 1h , h-8 ) , 8.39 ( s , 1h , h-2 ) . m / z ( es+ ) = 812.48 [ ( m + na ) , 100% ] . hrms : mass calcd for c44h48o9n5 [ m + h ] , 790.3447 ; found , 790.3449 . to a solution of diol 20 ( 123 mg , 0.156 mmol ) and dibenzyl - n , n - di - isopropyl phosphoramidite ( 113 mg , 0.327 mmol ) in dcm ( 5 ml ) was added imidazolium triflate ( 75 mg , 0.343 mmol ) , and the solution was stirred at room temperature for 30 min . when tlc showed the disappearance of diol 20 , the temperature was reduced to 78 c , and then , mcpba ( 170 mg , 6070% ) was added , and the solution was stirred for 1 h , gradually allowing the temperature to attain room temperature . workup was in ethyl acetate , and the crude product was chromatographed with ethyl acetate : hexane : et3n , 77:20:3 ( v / v / v ) , to get pure bisphosphate 21 ( 165 mg , 81% ) as a colorless oil . h nmr ( 400 mhz , cdcl3 ) : 3.46 ( dd , 1h , h-6a ) , 3.56 ( dd , 1h , h-6b ) , 3.583.64 ( m , 2h , h-2 , h-5a ) , 3.673.76 ( m , 3h , h-4 , h-5 , h-5b ) , 4.354.54 ( m , 7h , h-4 , 3 ch2ph ) , 4.624.77 ( m , 5h , h-3 , 2 ch2ph ) , 4.794.98 ( m , 7h , h-3 , 3 ch2ph ) , 5.40 ( d , 1h , 3.52 hz , h-1 ) , 5.66 ( ddd , 1h , 8.22 hz , 5.48 hz , 4.90 hz , h-2 ) , 5.706.00 ( br , 2h , nh2 ) , 6.34 ( d , 1h , 5.48 hz , h-1 ) , 7.007.42 ( m , 40h , 8 ph ) , 7.93 ( s , 1h , h-8 ) , 8.27 ( s , 1h , h-2 ) . elemental analysis calcd for c72h73n5o15p2 c , 66.00 ; h , 5.62 ; n , 5.34 . m / z ( es+ ) = 1334.29 [ ( m + na ) , 100% ] , 1311.38 [ ( m + 1 ) , 100% ] . hrms ( fab , csi / glycerol ) : mass calcd for c72h73o15n5p2 [ m ] , 1309.4573 ; found , 1309.4585 . a suspension of bisphosphate 21 ( 130 mg , 0.1 mmol ) and 20% pd(oh)2 on carbon ( 300 mg ) in a mixture of cyclohexene ( 4 ml ) , meoh ( 10.5 ml ) , and h2o ( 0.75 ml ) was refluxed at 80 c overnight . after filtration through a membrane filter , the filtrate was concentrated in vacuo . purification by an ag column with 0100% gradient elution using 150 mm tfa as an eluent gave pure bisphosphate 4 ( 53 mg , 91% ) . h nmr ( 400 mhz , d2o ) : 3.58 ( t , 1h , 8.5 hz , h-4 ) , 3.663.76 ( m , 3h , h-2 , h-5 , h-6a ) , 3.803.90 ( m , 3h , h-5a , h-5b , h-6b ) , 4.34 ( ddd , 1h , 9.45 hz , 8.50 hz , 8.50 hz , h-3 ) , 4.43 ( dd , 1h , 7.09 hz , 3.78 hz , h-4 ) , 4.63 ( dd , 1h , 5.20 hz , 3.31 hz , h-3 ) , 5.245.29 ( m , 1h , h-2 ) , 5.27 ( d , 1h , 3.78 hz , h-1 ) , 6.35 ( d , 1h , 5.61 hz , h-1 ) , 8.40 ( s , 1h , h-2 ) , 8.50 ( s , 1h , h-8 ) . p nmr ( 161.94 mhz , d2o with excess of tea ) : 4.25 , 3.35 . m / z ( es+ ) = 590.1 [ ( m + h ) , 90% ] ; 612.1 [ ( m + na ) , 100% ] . m / z ( es ) 588.2 [ ( m h ) , 100% ] . hrms : mass calcd for c16h26o15n5p2 [ m + h ] , 590.0895 ; found , 590.0895 . to a solution of donor acetate 26 ( prepared from the known dibenzyl ether 24(50 ) ) ( 1.007 g , 1.876 mmol ) , acceptor 16 ( 527 mg , 1.88 mmol ) , and n - iodosuccinimide ( 640 mg , 2.845 mmol ) in a mixture of toluene ( 14 ml ) and dioxane ( 19 ml ) were added powdered 3 molecular sieves , and the mixture was stirred for 15 min under argon atmosphere . tmsotf ( 100 l , 0.55 mmol ) was then added dropwise , and the mixture was stirred at room temperature for 30 min . when tlc showed disappearance of the starting material , the reaction mixture was filtered through a small pad of celite , and the filtrate was diluted with ethyl acetate and washed successively with saturated na2s2o3 solution , nahco3 solution , and brine . after it was dried over mgso4 , chromatography using ethyl acetate hexane gave pure -disaccharide 27 ( 1 g , 71% ) as a colorless gum . h nmr ( 400 mhz , cdcl3 ) : 1.38 ( s , 3h , ch3 isopropylidene ) , 1.60 ( s , 3h , ch3 isopropylidene ) , 1.85 ( s , 3h , coch3 ) , 3.33 ( dd , 1h , 10.59 hz , 4.33 hz , h-6a ) , 3.39 ( dd , 1h , 10.59 hz , 2.89 hz , h-6b ) , 3.65 ( dd , 1h , 9.63 hz , 3.85 hz , h-2 ) , 3.69 ( dd , 1h , 11.55 hz , 3.85 hz , h-5a ) , 3.77 ( ddd , 1h , 10.11 hz , 3.85 hz , 3.85 hz , h-5 ) , 3.80 ( dd , 1h , 11.55 hz , 1.93 hz , h-5b ) , 3.88 ( t , 1h , 9.63 hz , h-3 ) , 4.15 ( dd , 1h , 9.63 hz , 4.33 hz , h-3 ) , 4.324.38 ( m , 1h , h-4 ) , 4.43 ( ab q , 2h , 47.18 hz , 12.04 hz , ch2ph ) , 4.57 ( ab q , 2h , 47.66 hz , 12.04 hz , ch2ph ) , 4.72 ( ab q , 2h , 32.98 hz , 11.80 hz , ch2ph ) , 4.73 ( dd , 1h , 4.70 hz , 1.17 hz , h-2 ) , 4.75 ( ab q , 2h , 119.15 hz , 11.31 hz , ch2ph ) , 5.09 ( dd , 1h , 10.11 hz , 9.63 hz , h-4 ) , 5.21 ( d , 1h , 3.37 hz , h-1 ) , 5.83 ( d , 1h , 3.85 hz , h-1 ) , 7.207.40 ( m , 20 h , 4 c6h5 ) . elemental analysis calcd for c44h50o11 : c , 70.00 ; h , 6.68 . found : c , 69.79 ; h , 6.69 . m / z ( es+ ) = 777.47 [ ( m + na ) , 100% ] . hrms : mass calcd for c44h54o11n [ m + nh4 ] , 772.3691 ; found , 772.3694 . disaccharide 27 ( 270 mg , 0.358 mmol ) was treated with 90% tfa ( 2 ml ) at room temperature for 15 min . tfa was evaporated off , and the residue was coevaporated with toluene several times . the residue thus obtained was dissolved in pyridine ( 5 ml ) , added ac2o ( 2 ml , 21.2 mmol ) , and stirred at room temperature for 3 h. workup was as usual , and the product was crystallized from ethyl acetate hexane to give an inseparable / mixture of the triacetate 28 ( 149 mg , total yield = 249 mg , 87% ) . data for 28- : mp 127128 c ; [ ]d + 46 ( c 1 , chcl3 ) . h nmr ( 400 mhz , cdcl3 ) : 1.80 ( s , 3h , ch3 ) , 1.89 ( s , 3h , ch3 ) , 1.93 ( s , 3h , ch3 ) , 3.31 ( dd , 1h , 10.77 hz , 4.72 hz , h-6a ) , 3.38 ( dd , 1h , 10.77 hz , 2.94 hz , h-6b ) , 3.55 ( dd , 1h , 9.78 hz , 3.52 hz , h-2 ) , 3.60 ( dd , 1h , 11.16 hz , 4.11 hz , h-5a ) , 3.69 ( dd , 1h , 11.35 hz , 3.13 hz , h-5b ) , 3.81 ( ddd , 1h , 10.17 hz , 4.70 hz , 2.94 hz , h-5 ) , 3.89 ( t , 1h , 9.78 hz , h-3 ) , 4.39 ( ab q , 2h , 41.87 hz , 11.74 hz , ch2ph ) , 4.40 ( t , 1h , 3.52 hz , h-4 ) , 4.50 ( ab q , 2h , 14.87 hz , 11.74 hz , ch2ph ) , 4.60 ( t , 1h , 5.87 hz , h-3 ) , 4.65 ( s , 2h , ch2ph ) , 4.73 ( ab q , 2h , 94.68 hz , 11.74 hz , ch2ph ) , 4.95 ( d , 1h , 3.52 hz , h-1 ) , 5.02 ( dd , 1h , 10.17 hz , 9.40 hz , h-4 ) , 5.31 ( dd , 1h , 4.70 hz , 1.17 hz , h-2 ) , 6.12 ( d , 1h , 1.17 hz , h-1 ) , 7.227.33 ( m , 20 h , 4 c6h5 ) . elemental analysis calcd for c45h50o13 : c , 67.66 ; h , 6.31 . found : c , 67.5 ; h , 6.34 . m / z ( es+ ) = 821.73 [ ( m + na ) , 100% ] . hrms : mass calcd for c45h54o13n [ m + nh4 ] , 816.3590 ; found , 816.3592 . a suspension of triacetate 28 ( 234 mg , 0.293 mmol ) , 6-chloropurine ( 91 mg , 0.589 mmol ) , and bsa ( 356 l , 1.46 mmol ) in acetonitrile ( 9 ml ) was refluxed until the solution became clear . after it was cooled and the addition of tmsotf ( 115 l , 0.635 mmol ) , the solution was heated to 70 c , stirred overnight , and quenched with a saturated solution of nahco3 , and the mixture worked up in ethyl acetate . hexane to yield the chloronucleoside 29 ( 241 mg , 92% ) as a colorless gum . h nmr ( 400 mhz , cdcl3 ) : 2.16 ( s , 3h , coch3 ) , 2.20 ( s , 3h , coch3 ) , 3.673.75 ( m , 2h , ha-6 and hb-6 ) , 3.803.92 ( m , 3h , h-2 , ha-5 , hb-5 ) , 4.01 ( m , 1h , h-5 ) , 4.27 ( t , 1h , 9.50 hz , h-3 ) , 4.72 ( ab q , 2h , 29.72 hz , 11.64 hz , phch2 ) , 4.80 ( ab q , 2h , phch2 ) , 4.91 ( q , 1h , h-4 ) , 4.935.00 ( m , 3h , h-3 , phch2 ) , 5.10 ( ab q , 2h , 87.33 hz , 11.34 hz , phch2 ) , 5.23 ( d , 1h , 3.68 hz , h-1 ) , 5.29 ( dd , 1h , 10.11 hz , 9.50 hz , h-4 ) , 5.95 ( dd , 1h , 6.44 hz , 5.52 hz , h-2 ) , 6.79 ( d , 1h , 6.44 hz , h-1 ) , 7.507.70 ( m , 20h , 4 ph ) , 8.79 ( s , 1h , h-8 ) , 9.06 ( s , 1h , h-2 ) . m / z ( es+ ) = 915.4 [ ( m + na ) , 100% ] . hrms : mass calcd for c48h49o11n4cl1na1 [ m + na ] , 915.2979 ; found , 915.2984 . a solution of chloronucleoside 29 ( 360 mg , 0.403 mmol ) in ethanol was saturated with ammonia and heated at 74 c in a sealed pressure tube for 5 days . the solvents were evaporated off , and the residue was dissolved in dcm and washed with water and then with brine . the organic layer was dried over mgso4 , and the solvents were evaporated under reduced pressure to afford the pure diol 30 ( 318 mg , 100% ) as a colorless gum . h nmr ( 400 mhz , cdcl3 ) : 3.54 ( dd , 1h , 9.39 hz , 3.91 hz , h-2 ) , 3.573.68 ( m , 5h , h-4 , h-5a , h-5b , h-6a and h-6b ) , 3.763.90 ( m , 2h , h-3 , h-5 ) , 4.284.38 ( m , 1h , h-4 ) , 4.384.52 ( m , 5h , h-3 , 2 ch2ph ) , 4.644.72 ( m , 1h , h-2 ) , 4.72 ( abq , 2h , 46.17 hz , 11.74 hz , ch2ph ) , 4.86 ( d , 3.52 hz , h-1 ) , 4.89 ( abq , 2h , 66.52 hz , 11.35 hz , ch2ph ) , 5.745.90 ( br , 2h , nh2 ) , 6.03 ( d , 1h , 5.48 hz , h-1 ) , 7.207.38 ( m , 20 h , 4 c6h5 ) , 7.98 ( s , 1h , h-8 ) , 8.30 ( s , 1h , h-2 ) . m / z ( es+ ) = 812.70 [ ( m + na ) , 100% ] . hrms : mass calcd for c28h42o7ns [ m + h ] , 790.3447 ; found , 790.3454 . to a solution of 30 ( 165.5 mg , 0.21 mmol ) and dibenzyl - n , n - di - isopropyl phosphoramidite ( 152 mg , 0.44 mmol ) in dcm ( 5 ml ) was added imidazolium triflate ( 102 mg , 0.468 mmol ) , and the solution was stirred at room temperature for 30 min . when tlc showed disappearance of the starting material , the temperature was reduced to 78 c , mcpba ( 170 mg ) was added , and the mixture was stirred for 30 min , allowing the temperature to attain room temperature . the mixture was taken up in ethyl acetate , and the solution was washed successively with na2so3 solution , water , and brine . the solution was dried over mgso4 , and the residue after evaporation was chromatographed to yield bisphosphate 31 ( 233 mg , 85% ) as a colorless oil . a suspension of bisphosphate 31 ( 155 mg , 0.118 mmol ) and 20% pd(oh)2 on carbon ( 400 mg ) in a mixture of cyclohexene ( 5.5 ml ) , meoh ( 10.5 ml ) , and h2o ( 0.75 ml ) was heated at 80 c overnight . after filtration through a membrane filter , the evaporated filtrate was purified on an ag column using 0100% gradient elution using 150 mm tfa as eluent to give pure bisphosphate 5 ( 62 mg , 89% ) . h nmr ( 400 mhz , d2o ) : 3.52 ( dd , 1h , 9.78 hz , 3.91 hz , h-2 ) , 3.603.79 ( m , 5h , h-5 , h-5a , h-5b h-6a , h-6b ) , 3.82 ( dd , like a t , 9.29 hz , 8.80 hz , h-3 ) , 3.89 ( ddd , like a q , 1h , 9.29 hz , 8.80 hz , 8.80 hz , h-4 ) , 4.31 ( dd , 1h , 6.85 hz , 3.42 hz , h-4 ) , 4.52 ( dd , 1h , 4.89 hz , 3.42 hz , h-3 ) , 5.11 ( d , 1h , 3.91 hz , h-1 ) , 5.18 ( ddd , 1h , 9.78 hz , 5.87 hz , 5.38 hz , h-2 ) , 6.23 ( d , 1h , 6.36 hz , h-1 ) , 8.28 ( s , 1h , h-2 ) , 8.39 ( s , 1h , h-8 ) . p nmr ( 161.94 mhz , d2o with excess of tea ) : 4.22 , 3.13 . m / z ( es ) = 588.1 [ ( m h ) , 50% ] . hrms ( es ) : mass calcd for c16h24o15n5p2 [ m h ] , 588.0750 ; found , 588.0751 . to a solution of trisphosphate 33 ( 60 mg , 0.0405 mmol ) in bnoh ( 2 ml ) was added anhydrous k2co3 ( 25 mg , 0.18 mmol ) , and the mixture was stirred at 70 c overnight . chcl3 gave the bisphosphate 34 ( 46 mg , 93% ) as a colorless gum . h nmr ( 400 mhz , cdcl3 ) : 3.46 ( dd , 1h , 10.70 hz , 3.30 hz , h-5a ) , 3.50 ( dd , 1h , 9.78 hz , 3.70 hz , h-2 ) , 3.54 ( dd , 1h , 10.84 hz , 2.38 hz , h-5b ) , 3.543.62 ( m , 2h , h-6a and h-6b ) , 3.88 ( ddd , 1h , 10.04 hz , 3.83 hz , 2.78 hz , h-5 ) , 4.244.30 ( m , 2h , h-3 and h-4 ) , 4.27 ( ab q , 2h , 47.56 hz , 11.63 hz , c o ch2ph ) , 4.35 ( s , 2h , c o ch2ph ) , 4.49 ( ddd , like a q , 9.78 hz , 9.51 hz , 9.51 hz , h-4 ) , 4.51 ( ab q , 2h , 40.83 hz , 12.03 hz , c o ch2ph ) , 4.584.66 ( m , 1h , h-2 ) , 4.72 ( d , 1h , 3.44 hz , h-1 ) , 4.825.06 ( m , 9h , 4 p o - ch2ph , h-3 ) , 5.81 ( br , 2h , nh2 ) , 5.99 ( d , 1h , 5.02 hz , h-1 ) , 7.107.26 ( m , 35 h , 7 ph ) , 7.91 ( s , 1h , h-8 ) , 8.17 ( s , 1h , h-2 ) . m / z ( es+ ) = 1243.16 [ ( m + na ) , 100% ] , ( es ) 1218.64 [ ( m h ) , 100% ] . hrms ( fab , csi / glycerol ) : mass calcd for c65h67o15n5p2 [ m ] , 1219.4103 ; found , 1219.4096 . a suspension of bisphosphate 34 ( 45 mg , 0.037 mmol ) and 20% pd(oh)2 on carbon ( 120 mg ) in a mixture of cyclohexene ( 1.6 ml ) , meoh ( 3 ml ) , and h2o ( 0.22 ml ) was heated at 80 c overnight . after filtration through a membrane filter , the evaporated filtrate was purified on an ag column using 0100% gradient elution using 150 mm tfa as eluent to give pure bisphosphate 6 ( 20 mg , 92% ) . h nmr ( 400 mhz , d2o ) : 3.743.90 ( m , 6h , h-2 , h-5 , h-5a , h-5b h-6a , h-6b ) , 4.10 ( ddd , like a q , 1h , 9.66 hz , 9.66 hz , 9.66 hz , h-4 ) , 4.42 ( dd , 1h , 7.24 hz , 3.86 hz , h-4 ) , 4.474.55 ( m , 2h , h-3 , h-3 ) , 4.87 ( dd , like a t , 1h , 5.80 hz , 5.31 hz , h-2 ) , 5.19 ( d , 1h , 3.38 hz , h-1 ) , 6.19 ( d , 1h , 5.80 hz , h-1 ) , 8.40 ( s , 1h , h-2 ) , 8.50 ( s , 1h , h-8 ) . p nmr ( 161.94 mhz , d2o with excess of tea ) : 4.50 , 3.62 . m / z ( es+ ) = 590.2 [ ( m + h ) , 100% ] ; 612.1 [ ( m + na ) , 100% ] ; m / z ( es ) 588.2 [ ( m h ) , 100% ] . hrms : mass calcd for c16h26o15n5p2 [ m + h ] , 590.0895 ; found , 590.0895 . to a stirred solution of allyl 2,6-di - o - benzyl--d - glucopyranoside ( 37 ) ( 400 mg , 1.00 mmol ) and 1h - tetrazole ( 280 mg , 4.00 mmol ) in dry ch2cl2 ( 5 ml ) at room temperature was added dibenzyl - n , n - diisopropylphosphoramidite ( 1.0 ml , 3.0 mmol ) . c , and mcpba ( 1.0 g , 57% , 3.3 mmol ) was added in portions over 1 min . after a further 10 min at 78 c , a solution of na2so3 ( 50 ml , 10% w / v ) was added , and the mixture was stirred vigorously for 23 min , until the mixture began to freeze . the cooling bath was then removed , and the mixture was allowed to reach room temperature and diluted with ch2cl2 ( 50 ml ) . the organic layer was separated , washed with a saturated solution of nahco3 ( 50 ml ) , dried over mgso4 , and concentrated . purification of the residue by flash chromatography ( etoac / hexane 1:2 then 1:1 ) gave 38 as a colorless oil ( 846 mg , 0.919 mmol , 92% ) ; [ ]d + 15.9 ( c 2.3 , chcl3 ) . h nmr ( 400 mhz , cdcl3 ) : 3.57 ( dd , 1h , 9.7 hz , 3.6 hz , h-2 ) , 3.72 ( dd , 1h , 10.9 hz , 2.1 hz , h-6a ) , 3.76 ( dd , 1h . 10.9 hz , 4.4 hz , h-6b ) , 3.843.90 ( m , 2h , h-5 and och2ch = ch2 ) , 4.074.12 ( m , 1h , one proton of och2ch = ch2 ) , 4.38 , 4.51 ( abq , 2h , jab = 12.1 hz , och2ph ) , 4.47 , 4.72 ( abq , 2h , jab = 12.1 hz , och2ph ) , 4.61 ( ddd , 1h , 9.8 hz , 9.4 hz , 9.4 hz , h-4 ) , 4.72 ( d , 1h , 3.6 hz , h-1 ) , 4.905.08 ( m , 9h , 4 poch2ph and h-3 ) , 5.165.21 ( m , 1h , och2ch = chh cis ) , 5.265.32 ( m , 1h , och2ch = chh trans ) , 5.825.93 ( m , 1h , och2ch = ch2 ) , 7.157.30 ( m , 28h , ph ) , 7.317.35 ( m , 2h , ph ) . ms m / z ( es ) ; 919 [ ( m h ) , 45% ] , 829 [ ( m c7h7 ) , 100% ] . hrms : mass calcd for c51h54o12p2 , 943.2983 [ m + na ] ; found , 943.2954 . elemental analysis calcd for c51h54o12p2 ( 920.91 ) : c , 66.51 ; h , 5.91 . found : c , 66.6 ; h , 5.97 . to a solution of 38 ( 400 mg , 0.434 mmol ) in dry methanol ( 5 ml ) was added pdcl2 ( 20 mg , 0.11 mmol ) . the mixture was stirred vigorously in a flask fitted with a drying tube ( air is required for the reaction ) for 3 h , after which time tlc ( ethyl acetate / hexane 1:1 ) showed the reaction to be essentially complete , with conversion of 38 ( rf 0.36 ) into two products ( rf 0.10 and 0.16 ) . the acidic solution was neutralized by stirring with excess nahco3 for 5 min , then filtered through celite , and concentrated . purification by flash chromatography ( etoac / hexane 2:3 , then etoac ) gave 39 ( mixture of and anomers ) as a colorless oil ( 311 mg , 0.353 mmol , 81% ) ; [ ]d + 6.4 ( c 1.1 , chcl3 ) . h nmr ( 400 mhz , cdcl3 ) : 3.46 ( dd , 0.25h * , 8.9 hz , 7.7 hz , h-2 in -anomer ) , 3.54 , ( dd , 0.75h , 9.5 hz , 3.4 hz , h-2 in -anomer ) , 3.56 ( m , 0.25h , buried , h-5 in -anomer ) , 3.643.79 ( m , 2h , ch2 - 6 in - and -anomers ) , 4.094.14 ( m , 1.5h , oh-1 and h-5 in -anomer ) , 4.324.66 ( m , 5.25h , h-4 and 2 och2ph in - and -anomers , h-3 in -anomer ) , 4.694.76 ( m , 0.75h , h-1 and poch2ph in -anomer ) , 4.875.07 ( m , 8.25h , h-3 and 4 poch2ph in -anomer , 3 poch2ph in -anomer ) , 5.13 ( dd , 0.75h , 3.2 hz , 3.2 hz , h-1 in -anomer ) , 7.027.35 ( m , 30h , ph ) . p nmr ( 162 mhz , cdcl3 ) : 2.27 ( 0.75p ) , 2.24 ( 0.25p ) , 1.99 ( 0.25p ) , 1.72 ( 0.75p ) . m / z ( fab ) 881 [ ( m + h ) , 90% ] , 91 [ c7h7 , 100% ] . hrms : mass calcd for c48h50o12p2 , 903.2670 [ m + na ] . found , 903.2649 . elemental analysis calcd for c48h50o12p2 ( 880.85 ) : c , 65.45 ; h , 5.72 . found c , 65.4 ; h , 5.70 . * approximately 3:1 mixture of - and -anomers ; integrals are therefore approximate . to a solution of 39 ( 225 mg , 0.255 mmol ) in meoh ( 20 ml ) and water ( 5 ml ) was added pd(oh)2c ( 20% , 50% water , 600 mg ) . the mixture was shaken in a parr hydrogenator under h2 ( 50 psi ) for 24 h. the catalyst was removed by filtration through a ptfe syringe filter , and 1.0 m teab ( 1 ml ) was added . the solvents were removed by evaporation under reduced pressure , and the residue was purified by ion - exchange chromatography on q - sepharose fast flow resin eluting with a gradient of triethylammonium bicarbonate ( 01 m ) . fractions containing the target compound were identified by a modification of the briggs phosphate test . the combined fractions were concentrated by evaporation in vacuo , and methanol was repeatedly added and evaporated , eventually leaving the triethylammonium salt of 7 as a colorless glass ( 0.216 mmol , 85% ) ; [ ]d + 19 ( c 1.5 , meoh ) . h nmr ( 400 mhz , tea salt , d2o , approximately 1:1 mixture of - and -anomers ) : 3.41 ( dd , 0.5h , 8.9 hz , 8.5 hz , h-2 in -anomer ) , 3.553.59 ( m , 0.5h , h-5 in -anomer ) , 3.70 ( dd , 0.5h , 9.6 hz , 3.8 hz , h-2 in -anomer ) , 3.773.88 ( m , 2h , h-6a and h-6b in - and -anomers ) , 3.923.96 ( m , 0.5h , h-5 in -anomer ) , 4.004.09 ( m , 1h , h-4 in - and -anomers ) , 4.23 ( ddd , 0.5h , 9.0 hz , 9.0 hz , 9.0 hz , h-3 in -anomer ) , 4.41 ( ddd , 0.5 h , 9.0 hz , 8.6 hz , 8.6 hz , h-3 in -anomer ) , 4.70 ( d , 0.5h , 8.0 hz , h-1 in -anomer ) , 5.25 ( d , 0.5h , 3.8 hz , h-1 in -anomer ) . p nmr ( 162 mhz , tea salt , cd3od , tea added , approximately 1:1 mixture of - and -anomers ) : 2.22 ( 0.5p ) , 2.63 ( 0.5p ) , 2.79 ( 0.5p ) , 3.04 ( 0.5p ) m / z ( fab ) 338.9 [ m , 100% ] . hrms : mass calcd for c6h13o12p2 , 338.9888 [ m ] ; found , 338.9894 . a sample of d-2,3,6-tri - o - benzyl - myo - inositol 4,5-bis - o-(dibenzylphosphate ) ( 94 mg , 0.10 mmol ) was subjected to hydrogenolytic deprotection as described for 39 , above . purification of the product by ion - exchange chromatography on q - sepharose fast flow resin , as before , gave the triethylammonium salt of 2 as a colorless glass ( 0.076 mmol , 76% ) ; [ ]d 17 ( c 1.0 , meoh ) , lit . 15.4 ( c 0.6 , h2o , cyclohexylammonium salt ) ; lit . 10 ( c 1 , h2o , tetrapotassium salt ) ; lit . 4.4 ( c 0.3 , h2o , ph 6 ) ; lit . h nmr ( 500 mhz , tea salt , d2o ) : 3.60 ( dd , 1h , 10.0 hz , 2.8 hz , h-1 ) , 3.70 ( dd , 1h , 9.8 hz , 2.8 hz , h-3 ) , 3.81 ( dd , 1h , 9.7 hz , 9.5 hz , h-6 ) , 3.99 ( ddd , 9.0 hz , 9.0 hz , 9.0 hz , h-5 ) , 4.07 ( dd , 1h , 2.8 hz , 2.8 hz , h-2 ) , 4.27 ( dd , 1h , 9.3 hz , 9.2 hz , 9.2 hz , h-4 ) . p nmr ( 162 mhz , d2o , tea added ) : 4.50 ( 1p ) , 4.64 ( 1p ) . p nmr ( 162 mhz , tea salt , d2o , tea added ) : 4.50 ( 1p ) , 4.64 ( 1p ) . hrms : mass calcd for c6h13o12p2 , 338.9888 [ m ] ; found , 338.9896 . the effects of ada and its analogues on intracellular ca stores were measured using a low - affinity ca - indicator trapped within the intracellular stores of permeabilized cells . dt40 cells stably expressing only rat type 1 ip3r ( dt40-ip3r1 ) were harvested by centrifugation ( 650 g ; 2 min ) and resuspended [ ( 23 ) 10 cells / ml ] in hepes - buffered saline ( hbs : 135 mm nacl , 5.9 mm kcl , 1.2 mm mgcl2 , 1.5 mm cacl2 , 11.6 mm hepes , and 11.5 mm d - glucose , ph 7.3 ) supplemented with mag - fluo-4am ( 20 m ) , pluronic f-127 ( 0.02% ) , and bovine serum albumin ( 1 mg / ml ) . after 1 h at 20 c in the dark , the mag - fluo-4-loaded cells were harvested ( 650 g ; 2 min ) and resuspended ( 2 10 cells / ml ) in ca - free cytosolic - like medium ( clm : 140 mm kcl , 20 mm nacl , 2 mm mgcl2 , 1 mm egta , and 20 mm pipes , ph 7.0 ) . the cells were permeabilized by incubation with saponin ( 10 g / ml , 4 min at 37 c ) , harvested ( 650 g ; 2 min ) , and resuspended in mg - free clm ( 140 mm kcl , 20 mm nacl , 1 mm egta , 375 m cacl2 ( 200 nm free [ ca ] ) , and 20 mm pipes , ph 7.0 ) . the permeabilized cells ( with mag - fluo-4 trapped within the lumen of the er ) were then attached to 96-well plates ( 8 10 cells / well ) coated with poly - l - lysine ( 0.01% ) and centrifuged onto the plate ( 300 g ; 2 min ) . immediately before an experiment , the cells were washed twice in mg - free clm to remove cytosolic mag - fluo-4 , and the plates were then mounted in a flexstation fluorescence plate reader ( molecular devices , sunnyvale , ca ) , which allows automated additions to the sample wells while recording fluorescence . mag - fluo-4 fluorescence was monitored by excitation at 485 nm with emission detected at 520 nm . active ca uptake into the er was initiated by the addition of mg - atp ( 1.5 mm ) , and after 150 s , when the stores had loaded to a steady - state ca content , ada or its analogues were added . the amount of ca released was expressed as a fraction of the total ca content of the er as assessed by addition of 1 m ionomycin . data are presented as means sems from at least three independent experiments , each performed in triplicate . effect relationships were fitted to four - parameter logistic equations using nonlinear curve - fitting procedures ( graphpad prism , san diego , ca ) . the docking of ada into ip3r has been described previously . in the present work , the 1n4k crystal structure and the model of adenophostin a docked into ip3r were prepared using the protein preparation wizard , with exhaustive sampling , including sampling the water orientations , for the hydrogen bond assignment , and minimization of the resulting structures . gold version 5.1 was used for docking experiments . in the structure with ada , the resulting adenine - ribose was used as a template when docking compounds 5 , 6 , and 40 . the compounds were docked 25 times , with the five water molecules in the binding site retaining their position and orientation . the highest scoring solution had a sensible pose , and the protein ligand complex was run through the protein preparation wizard to optimize hydrogen bonding , with minimization of the resulting structure . to better enable comparison of the structures , the five protein ligand complexes were superimposed using the protein structure alignment tool . ligand interaction diagrams were prepared for all five ligands ( ip3 , adenophostins a , and compounds 5 , 6 , and 40 ) with ip3r ( see the supporting information ) .

anti - mllerian hormone ( amh ) , also known as mller inhibiting factor or mller inhibiting substance , is a glycoprotein formed from two identical subunits , each with a molecular weight of 72 kda . the hormone is part of the growth factor family , which includes 35 different peptide structures , including inhibin , activin , growth differentiation factor , and bone morphogenic protein.1 up until a few years ago , amh was known mainly for its role in the differentiation of male sexual characteristics.2,3 amh is not secreted in the female embryo , allowing development of the female sexual organs , starting from the mller ducts which do not regress , although they differ in the uterus , fallopian tube , and upper part of the vagina . expression of the hormone in women is different at various stages of life , and starts to be detected at week 36 of gestation . its concentration reaches a maximum during puberty , begins to decrease in adulthood , and disappears completely following the menopause . amh , produced from the granulosa cells of the primary follicles , reaches maximum expression in the preantral follicles , with lesser secretion by the greater antral follicles . at this point , growth starts to become dependent on follicle - stimulating hormone ( fsh ) . the data suggest that amh is a factor in regulation during the initial recruitment and cyclical recruitment phases leading to selection of the dominant follicle , and that it has a potential autocrine and paracrine role in follicular development in the female ovaries . after a period of optimal fertility at age 1830 years , oocyte quality diminishes in parallel with a progressive loss of follicles . in women with normal ovulation , serum levels of amh slowly increase , reaching a peak during puberty and then progressively diminishing with the passage of time . moreover , recent studies have shown that amh is correlated with the number of small antral follicles . this observation supports the hypothesis that serum levels of amh can reflect the state of the ovarian follicles better ( given its relative stability during the entire cycle ) than the more usual hormonal markers ( fsh , luteinizing hormone [ lh ] , estradiol , and inhibin b ) , and demonstrates how amh can be a favorable candidate as a marker of the ovarian reservoir.46 reproductive behavior has changed dramatically in the last century , and it is important to be able to identify loss of fertility in a woman as early as possible . more and more women are now delaying pregnancy to a more advanced age , when the quality and amount of ovarian follicles begins to decrease . the first sign of aging is increased levels of fsh at the age of 3540 years , when the menstrual periods tend to shorten . therefore , determining ovarian age is important for patients in whom treatment with in vitro fertilization is proposed , keeping in mind that the probability of pregnancy and subsequent birth of a child gradually diminishes from the age of 3738 years onwards . from this point of view , amh has been identified and proposed for evaluation of responses in patients undergoing assisted reproductive technology . it is now a potential candidate for inclusion in the clinical report , in order to be able to construct a strategy which is targeted and personalized to the characteristics of the patient , and able to increase the benefits of treatment from the physiological , psychological , and economic points of view.79 numerous studies have advocated the use of amh in assisted reproductive technology as a noninvasive test in order to estimate the antral follicle count.10,11 amh is now proposed as a hormonal test in the study of feminine infertility and in the diagnosis of pcos . the diagnosis depends on two of the following criteria : clinical and/or biochemical evidence of hyperandrogenism ( with exclusion of other causes of excess androgen ) , oligo or anovulation , and polycystic ovaries ( european society of human reproduction and american society for reproductive medicine , consensus conference , rotterdam , 2003).12,13 such data lead us to conclude that inclusion of serum amh levels in routine tests for patients undergoing assisted reproductive technology is useful , both quantitatively and qualitatively , not only in the study of patient responses to clinical treatment for infertility , but also in clinical assessment.1420 numerous tests and markers are used in order to identify pathologies involving the ovaries . amongst these are exclusion serum markers of other endocrinopathies ( prolactin , thyroid stimulating hormone , 17-hydroxyprogesterone ) , conf irmation of serum markers of ovarian pathology ( fsh , lh , estradiol , inhibin b ) , invasive scan markers ( transvaginal or laparoscopic ultrasound for antral follicle count ) and , over the last few years , amh levels . there are also other confirmation and monitoring serum tests for pcos ( androstenedione , testosterone , free testosterone , dehydroepiandrosterone ) . this diagnosis will not only render possible a targeted and personalized therapy in order to achieve a greater probability of a positive outcome of treatment , but will also avoid potential harmful effects of treatment , that could eventually preclude assisted reproduction altogether . in this study , we evaluated the value of serum analysis of amh as a diagnostic test in patients undergoing assisted fertility , in order to diagnose pcos prior to treatment . the purpose was to identify a cost - effective , noninvasive clinical method for assessing ovarian pathology , which would also reduce psychological stress for the patient . amh can be measured on any day of the cycle , because there are no fluctuations and it has low cyclical interindividual or intraindividual variability . the study was carried out on 236 serum samples taken from women aged 2646 years and scheduled for exogenous gonadotrophin treatment for infertility at the institute for maternal and child health , burlo garofolo , trieste , between september 2010 and june 2011 . all patients signed an informed consent form before entering the study , which was approved by the ethics committee at our institution . the sample centrifugation for 5 , as described in the manufacturer s instructions , was done to remove residual fibrin and cellular matter , prior to storage . the serum was stored at 2c8c for up to 24 hours and was then frozen at 20c . the confidence limits for amh controls were printed on the control vial labels and intra- and inter - test precision was within two standard deviations ( 2 sd ) . measurement of amh levels was carried out on the third day of the ovarian cycle using an enzyme - linked immunosorbent assay ( beckman coulter , immunotech , dsl diagnostic system laboratories , marseille , france ) . this quantitative , specific , and sensitive technique allows measurement of small amounts of molecules present in biological samples . moreover , it is possible to analyze a high number of samples in a short space of time , as a result of being able to use microplates . it is based on a colorimetric system , with the intensity of color being directly proportional to the concentration of the antigen , which is measured by spectrophotometry . the field of measurement comprises concentration of the analyte sensitivity to the concentration of the highest calibrator standard , from 0.14 ng / ml to 21 ng / ml . the precision is given by an intratest and an intertest , with respective variation coefficients of 12.3% and 14.2% , respectively . the instrument used for analysis in the enzyme - linked immunosorbent assay was a semiautomatic spectrophotometer ( pantech , new york , ny ) . the enzyme - linked immunosorbent assay used was a typical sandwich test , the peculiarity of which concerns a second biotinylated monoclonal antibody directed against the antigen and conjugated with the enzyme streptavidin and horseradish peroxidase . streptavidin is a purified tetrameric protein of bacterial origin ( streptomyces avidinii ) . in order to estimate the amh concentration in the study samples , a calibration curve for interpolation was constructed , using standard amh samples with diverse absorbance concentrations ( pasquinelli and porta , 1994 ) , according to instructions supplied in the analysis kit . fsh levels for all the patients was measured , as well as lh ( only in six patients with very elevated amh levels ) using an automated colorimetric method ( modular p , elecsys ) . in this study , we analyzed 236 serum samples from patients aged 2646 years who had been referred to our institution for medically assisted fertility in september 2010 to june 2011 . we identified 57 patients who were starting in vitro fertilization or embryo transfer with amh values within the normal range ( 3.64 1.51 ng / ml ) , 77 with values below normal ( 1.38 0.32 ng / ml ) , and 96 cases with undetectable values of amh . six patients had very high amh levels ( 10.0 2.28 ng / ml ) and , of these , five were found to have pcos on pelvic ultrasound examination ( p < 0.05 ; table 1 ) . the published studies have reported the average values for patients who were part of control groups or had pcos . comparing the values that we obtained with those of other laboratories , it can be seen that the average values of controls are lower than those in patients with pcos , confirming the validity of the test as an indicator of this syndrome ( table 2 ) . moreover , numerous studies have identified an inverse correlation between amh levels , fsh levels , and patient age . therefore , we attempted to confirm these correlations in our group of patients and fsh levels were also measured in serum samples , showing an average value of 8.53 miu / ml ( follicular phase normal range 3.512.5 miu / ml ) ( figures 13 ) . the cost - effective dosage of amh is similar to that of other hormones , such as fsh and lh . many studies published in recent years have demonstrated that the concentration of amh is 34 times higher in patients affected by pcos than in patients without the disease . one is that the follicles are transformed into cysts when they are at the preantral or antral stage , and remain at this stage and continue to secrete the hormone , and the other is that granulosa cells secrete a greater concentration of amh , detectable at the follicular level . in our case histories , the changes in reproductive state and amh levels this inverse correlation has been found in many studies in the literature , and is confirmed by the present study.2125 our data emphasize that amh can be used to identify pcos and is a reliable marker of infertility associated with patient age and other hormonal tests , such as fsh , because it is influenced by the menstrual cycle , or identification by means of invasive tests such as transvaginal or laparoscopic ultrasound for follicular count and residual ovarian capacity . in conclusion , amh is confirmed as a useful test to study folliculogenesis and ovarian potential in various situations of infertility and for identification of pcos , to avoid the possibility of subjecting patients at risk to ineffective assisted reproductive technology , and using in vitro fertilization or in vitro embryo transfer only after careful clinical assessment.2635

yoga is emerging as an important modifying factor for health and behavior to achieve better physical and mental well - being . the practice of asanas improves the muscle strength , mind - body coordination , and balance . further , it improves the blood flow , tissue perfusion and oxygenation , and enhancing functions at cellular level . meditation and breathing technique calms down the mind , improves the concentration enhancing better work output . by maintaining tranquility of mind cardiovascular diseases are the leading cause of morbidity and mortality in developed and developing countries . heart rate variability ( hrv ) is a noninvasive tool for assessment of cardiac autonomic status . hrv is the temporal variation in consecutive heart beats measured from a standard electrocardiogram ( ecg ) . r wave is the peak of qrs complex ; the duration between two consecutive r wave peaks is termed the relative risk interval . these parameters were used to assess cardiac autonomic control which is the balance between sympathetic and parasympathetic regulators of heart . reduced hrv is a potential risk factor for hypertension , thermogenesis which progress to coronary artery disease . repeated exposure to episodes of stress or continuous exposure can have an adverse impact on health in general and cardiovascular function in particular . these alterations in the autonomic functions allowed to continue over a period without intervention can lead to irreversible damage in cardiovascular functions . integration of yogic practice in day to day life can favorably impact the modifiable risk factors for cardiovascular diseases . there are studies focusing on the effect of yoga on hrv in regular long - term practitioners . a study by muralikrishnan et al . demonstrated well balanced vagal activity in practitioners of isha yoga as compared to control group . increased parasympathetic modulation the present study was undertaken to assess the value of short - term practice of yoga and its impact on cardiac autonomic functions . the study was performed in department of physiology , m s ramaiah medical college , bengaluru . forty healthy male volunteers willing to practice yoga regularly for a month in the age group of 3060 years . cardiovascular diseases , metabolic diseases , smokers , alcoholics , and on treatment with drug having potential to modify autonomic functions . pre- and post - interventional assessment of hrv using rms vagus hrv device and software . integrated yoga comprising 5 min of stretching exercises and prayer , 20 min of asanas ( padmasana , vajrasana , tadasana , vrikshasana , mathsyasana , paschimothasana , gomukhasana , bhujangasana ) , 20 min of pranayama ( nadi shudhi pranayama , suryanadi pranayama , chandranadi pranayama , bhramari ) , and 15 min of meditation and relaxation were practiced for an hour daily , 6 days a week for 1 month . the recording protocol was explained , and informed consent was obtained from all the volunteers . then , the data were extracted in the form of lead ii ecg using rms vagus hrv apparatus ( rms , india ) while subjects are resting in supine position with eyes open for duration of 15 min . the extracted ecg data were manually scanned for any artifacts and only artifact free 15 min data were used for analysis . the analysis from the hrv software provided information about time domain ( sdnn , rmssd , nn50 , and pnn50 ) and frequency domain parameters ( low - frequency [ lf ] , high - frequency [ hf ] , and lf / hf ratio ) . the pre- and post - intervention values of hrv were tabulated , and coefficient of variation was calculated to evaluate pattern of distribution . as all the values were skewed and were expressed as median and inter quartile range , nonparametric test was used to analyze data by wilcoxan signed rank test . forty healthy male volunteers willing to practice yoga regularly for a month in the age group of 3060 years . cardiovascular diseases , metabolic diseases , smokers , alcoholics , and on treatment with drug having potential to modify autonomic functions . pre- and post - interventional assessment of hrv using rms vagus hrv device and software . subjects were trained under the guidance of certified yoga instructor . integrated yoga comprising 5 min of stretching exercises and prayer , 20 min of asanas ( padmasana , vajrasana , tadasana , vrikshasana , mathsyasana , paschimothasana , gomukhasana , bhujangasana ) , 20 min of pranayama ( nadi shudhi pranayama , suryanadi pranayama , chandranadi pranayama , bhramari ) , and 15 min of meditation and relaxation were practiced for an hour daily , 6 days a week for 1 month . the recording protocol was explained , and informed consent was obtained from all the volunteers . subjects were initially rested for 15 min . then , the data were extracted in the form of lead ii ecg using rms vagus hrv apparatus ( rms , india ) while subjects are resting in supine position with eyes open for duration of 15 min . the extracted ecg data were manually scanned for any artifacts and only artifact free 15 min data were used for analysis . the analysis from the hrv software provided information about time domain ( sdnn , rmssd , nn50 , and pnn50 ) and frequency domain parameters ( low - frequency [ lf ] , high - frequency [ hf ] , and lf / hf ratio ) . the pre- and post - intervention values of hrv were tabulated , and coefficient of variation was calculated to evaluate pattern of distribution . as all the values were skewed and were expressed as median and inter quartile range , nonparametric test was used to analyze data by wilcoxan signed rank test . the age of the subject was 45 7.6 years and body mass index was 25.74 3.78 the pre- and post - interventional average heart rate in the subjects were 74.29 11.34 beats / min and 73.56 12.59 beats / min , respectively and were not statistically significant . the preinterventional value of sdnn was 33.60 ( 31.4144.82 ) ms and postinterventional value was 42.11 ( 34.4357.51 ) ms . the preinterventional value of rmssd 22.0 ( 16.033.8 ) and postinterventional value was 25.6 ( 17.034.8 ) . the preinterventional value of pnn50 2.45 ( 0.8015.38 ) and postinterventional value was 7.35 ( 1.4018.57 ) . the postinterventional value of sdnn , rmssd , and pnn50 was significantly higher ( p < 0.05 ) . the preinterventional value of nn50 was 28.5 ( 9.0101.0 ) and postinterventional value was 65.0 ( 15.0112.25 ) . however , the difference was not statistically significant . in the frequency domain , preinterventional value of lf in percentage was 39.30 ( 25.146.25 ) and postinterventional value was 30.40 ( 22.7540.62 ) . the preinterventional value of lf / hf ratio was 2.62 ( 1.914.07 ) and postinterventional value was 2.28 ( 1.43.07 ) . the postinterventional value of lf and lf / hf ratio was significantly lower ( p < 0.05 ) . the preinterventional value of hf in percentage was 13.25 ( 8.0220.0 ) and postinterventional value was 16.0 ( 8.3023.07 ) . the preinterventional value of very lf ( vlf ) in percentage was 44.0 ( 32.1567.77 ) and postinterventional value was 47.9 ( 37.3763.3 ) . there was no significant change in vlf after 1 month of practice of yoga [ table 1 ] . the preinterventional value of sdnn was 33.60 ( 31.4144.82 ) ms and postinterventional value was 42.11 ( 34.4357.51 ) ms . the preinterventional value of rmssd 22.0 ( 16.033.8 ) and postinterventional value was 25.6 ( 17.034.8 ) . the preinterventional value of pnn50 2.45 ( 0.8015.38 ) and postinterventional value was 7.35 ( 1.4018.57 ) . the postinterventional value of sdnn , rmssd , and pnn50 was significantly higher ( p < 0.05 ) . the preinterventional value of nn50 was 28.5 ( 9.0101.0 ) and postinterventional value was 65.0 ( 15.0112.25 ) . however , the difference was not statistically significant . in the frequency domain , preinterventional value of lf in percentage was 39.30 ( 25.146.25 ) and postinterventional value was 30.40 ( 22.7540.62 ) . the preinterventional value of lf / hf ratio was 2.62 ( 1.914.07 ) and postinterventional value was 2.28 ( 1.43.07 ) . the postinterventional value of lf and lf / hf ratio was significantly lower ( p < 0.05 ) . the preinterventional value of hf in percentage was 13.25 ( 8.0220.0 ) and postinterventional value was 16.0 ( 8.3023.07 ) . the preinterventional value of very lf ( vlf ) in percentage was 44.0 ( 32.1567.77 ) and postinterventional value was 47.9 ( 37.3763.3 ) . there was no significant change in vlf after 1 month of practice of yoga [ table 1 ] . their incidence is on the rise and is contributory to major health burden of a country . the increasing trend of these diseases can be attributed to lifestyle changes , food habits , lack of physical exercise associated with mental stress , environmental pollution , increase susceptibility to infections , and habits such as smoking and consumption of alcohol . there are number of risk factors for cardiovascular diseases , majority of them are modifiable . precautionary steps taken well in advance will reduce the sufferings of an individual and health burden of the country . physical exercise in general and yoga , in particular , is reported to reduce the occurrence of cardiovascular diseases and possible complications arising out of them . yoga is reported to promote physical and mental health by the performance of postures ( asanas ) , regulated breathing ( pranayama ) , and meditation ( dhyana ) . there is a need to objectively evaluate the perceived or the reported benefits of yogic practice . hrv is a potential tool for assessing the influence of autonomic nervous system on cardiovascular system . hrv can serve as a sensitive method of evaluating the early changes in cardiac autonomic function . in this study , the effect of short - term practice of yoga was evaluated on cardiac autonomic function . the time domain markers such as sdnn , rmssd , and pnn50 were found to be significantly increased after practice of yoga for 1 month . these changes are attributed to shift of autonomic balance from the sympathetic nervous system to the parasympathetic system . sdnn indicates variability in duration of diastole which in turn influences the functioning ability of the heart . increase in rmssd and pnn50 suggests parasympathetic predominance evidenced by increased duration of cardiac cycle . this may be attributed to inhibition of posterior or sympathetic area of the hypothalamus which optimizes the body 's sympathetic responses to stressful stimuli . lf / hf ratio , a marker of autonomic balance , was found to be significantly reduced suggesting the shift of autonomic balance toward parasympathetic predominance . woodyard c has reported the beneficial effects of yoga such as reduced respiratory and heart rate , reduced blood pressure , low cortisol levels , increased blood flow to the intestines , and vital organs on practice of yoga due to increased parasympathetic activity . the reduction in lf / hf ratio in this study was likely to be predominantly by sympathetic withdrawal and to a limited extent by increasing parasympathetic activity . a study on long - term practice of yoga can help establish the relative contribution of sympathetic and parasympathetic system in autonomic modulation of cardiovascular system . vlf , the nonneuronal component influencing hrv , did not show a significant change suggesting that the beneficial effect of yoga on the heart was predominantly mediated through neuronal mechanism involving autonomic nervous system . there was a fall in average heart rate in subjects after intervention but was not statistically significant . taskforce of the european society of cardiology and the north american society of pacing and electrophysiology describes hf as a representative of vagal modulation activity and lf as a representative of sympathetic or mixed sympathetic and vagal modulation activities . there is general opinion that the ratio between lf and hf components of hrv spectra ( lf / hf ratio ) represents a measure of balance of sympathovagal activity . lf / hf ratio higher than 4.8 was considered to reflect predominant sympathetic and those lower than 1.3 predominant vagal modulation activity . it can be comprehended that these parameters eventually modulate the heart rate . by considering all the above facts , our study demonstrated a significant reduction in lf and an increasing trend in hf , suggesting need to include a control group in the study for effective comparison . in view of significant reduction in lf / hf ratio and their resultant effect on heart rate , it can be concluded that short - term practice of yoga reduces sympathetic activity to greater extent than increasing parasympathetic activity . the present study establishes the fact that hrv changes can be demonstrated after practice of yoga for a month . time domain and frequency domain parameters exhibited a favorable change with short - term practice of yoga . the regular practice of yoga is known to elevate mood and relieve the stress by increasing serotonin levels . it reduces monoamine oxidase which breaks down serotonin , thus maintaining serotonin for longer duration in the brain . practice of yoga increases blood flow , levels of oxygen saturation and improves oxygenation of the tissues . yoga also reduces viscosity of the blood which can decrease the risk of heart attack and stroke . a study by bharshankar et al . , birkel and edgren et al . reported low resting heart rate , increased endurance , improved maximum uptake , and utilization of oxygen during exercise in subjects practicing yoga . practice of yoga for 8 weeks had bought about changes in frequency domain parameters along with significant decrease in lf and increase in hf value suggesting parasympathetic dominance . our study has established changes in both time and frequency domain parameters indicating sympathetic withdrawal coupled with parasympathetic predominance . practice of yoga helps achieve emotional balance , inhibits the areas in amygdala responsible for fear , aggression and rage . it stimulates the reward or pleasure centers in the median forebrain and other areas leading to a state of bliss and pleasure . this in turn lowers anxiety , respiratory rate , heart rate , and blood pressure . it is reasonable to postulate that the practice of yoga not only influences the autonomic balance at subconscious level but also controls this balance by regulating emotional changes . in our study yoga has a noticeable benefit on general health status of the individual and thus promoting positive health . it is reasonable to believe that regular and long - term practice of yoga will help reduce the incidence of noncommunicable diseases resulting in better quality of life . practice of yoga which involves lifestyle modification can be used as a nonpharmacological technique to prevent cardiovascular complications . periodic assessment of cardiac autonomic function in subjects who have practiced yoga for short duration can be undertaken . these assessments will throw light on the sustenance of beneficial effects after cessation of yogic practice . however , it is worthwhile to recommend continued practice of yoga to preserve and enhance beneficial effects obtained by short - term practice of yoga . in our study , influence of short - term practice of yoga for duration of 1 month in healthy male volunteers showed a demonstrable change in hrv , with a significant decrease in sympathetic activity and trend toward an increase in parasympathetic activity , hence shifting sympathovagal balance toward parasympathetic predominance .

fungal peritonitis ( fp ) is a rare but potentially fatal complication of chronic peritoneal dialysis ( pd ) , associated with high morbidity and mortality ranging between 20% and 30% . fp accounts for 1 - 15% of all peritonitis episodes . in those who survived peritonitis , the inflammatory process often causes irreversible damage to the peritoneal membrane leading to subsequent dropout from pd therapy in 40% of the patients . the most important risk factor associated with the development of fp includes previous antibiotic therapy , particularly for bacterial peritonitis . international society of pd guidelines for peritonitis 2010 recommend immediate catheter removal once fungus is identified by microscopy or culture . the conventional antifungal regimens include fluconazole , amphotericin b and flucytosine alone or in combination , optimally based on fungal susceptibilities . the newer agents such as caspofungin and voriconazole have the potential to alter treatment strategies for fp . the beneficial role of prophylactic antifungal in bacterial peritonitis reducing the incidence of subsequent secondary fp is controversial , with some favoring them and others showing no benefit . in this retrospective study , we reviewed the dialysis records of all 224 end stage renal disease ( esrd ) patients initiated on continuous ambulatory peritoneal dialysis ( capd ) between january 2005 and january 2012 . we divided the study period into two parts : period i ( january 2005 to january 2010 ) , when prophylactic antifungal was not used and study period ii ( january 2010 to january 2012 ) , when prophylactic antifungal ( fluconazole ) was used with bacterial peritonitis . all patients in the study period ii received oral fluconazole at a dose of 200 mg / day for 7 days as prophylaxis . during the study , demographic characteristics , cause of chronic kidney disease , details of pd prescription , presence of comorbid illness , duration on pd , peritonitis rates , prior history of fungal or bacterial peritonitis , nature of fungal isolates and clinical outcomes ( including mortality , loss of pd catheter and successful reinsertion of pd catheter ) were the variables which were analyzed . the risk of prior exposure to antibiotics within the 12 weeks period before the onset of peritonitis was also analyzed . the diagnosis of fp was based on the isolation of fungi from pd fluid in the setting of classical features of peritonitis ( fever , pain abdomen , cloudy peritoneal effluent containing 100 white blood cells/l or greater with at least 50% polymorphonuclear cells ) . distal 2.5 - 5 cm of the capd catheter was cut from the catheter hub and dropped into a sterile container . the sediment was used for microscopic examination with 10% koh and calcofluor to look for fungal elements . the capd catheter tip was flushed with sterile saline using a needle and syringe and this was used for microscopy as above . the sediment and fluid from the catheter tip were inoculated in two sabouraud 's dextrose agar tubes of which one was incubated at 37c and the other at 25c . data was analyzed using statistical package for social sciences ( spss ) 18 software version . chi - square test or fisher 's exact test were used to assess the significance of variables between the two groups . we had a total of 224 patients on capd between january 2005 and january 2012 with a cumulative follow - up of 5435.4 months . mean age of the study population was 51.9 12.54 years with male to female ratio of 14:6 . twenty out of 142 episodes of peritonitis ( 14% ) documented during the study period was due to fp . the mean duration on capd before development of fungal infection was 35.6 6.2 months . demographic characteristics of study population predominant cause of esrd in this group was diabetic nephropathy ( 50% ) . other causes includes hypertensive nephrosclerosis ( 15% , n = 3 ) , chronic glomerulonephritis ( 15% , n = 3 ) , chronic interstitial nephritis ( 10% , n = 2 ) and others ( 10% , n = 2 ) . during the study period i , 18 of 102 episodes of peritonitis ( 17.6% ) were due to fungal infection whereas during the study period ii ( with antifungal prophylaxis ) ; only 2 of 40 episodes of peritonitis ( 5% ) were due to fungal infection . the incidence of fp was significantly lower during the study period ii ( p = 0.04 ) . majority of the patients presented with pain abdomen ( 90% ) and cloudy pd effluent ( 95% ) . common fungal isolate [ figure 1 ] in our center was c. albicans accounting for 65% of the cases other fungal isolates includes non - albicans candida 25% ( n = 5 ) , rhizopus species 5% ( n = 1 ) [ figure 3 ] and alternaria alternata 5% ( n = 1 ) [ figure 4 ] . among non - albicans candida species , alternaria , a dematiaceous fungus is a very rare species , known to cause fp with only few case reports in the world literature . during the study period ii , fungal isolates in our center gram stain morphology ( 100 ) of candida species colonies showing gram - positive budding yeast cells lacto phenol cotton blue mount of rhizopus species ( 20 ) showing stolons connecting unbranched sporangiophores terminating in dark round sporangia with spores lacto phenol cotton blue mount of alternaria ( 40 ) showing dark septate hyphae bearing large conidia with transverse and longitudinal septations prompt removal of tenckhoff catheter was carried out in all 20 patients within 24 h of isolation of fungi either by culture or by demonstration of fungal filaments in gram 's stain . out of which two had non - albicans candida infection , one had c. albicans and the other one had rhizopus species infection . four ( 20% ) patients had technique failure because of severe peritoneal adhesions and were shifted to hemodialysis . remaining 12 ( 60% ) patients recovered completely and they were put back on capd after a latent period of 6 - 12 weeks . we analyzed various parameters associated with poor outcomes ( mortality + technique failure ) in patients with fp by logistic regression analysis . three factors predicted poor outcome in our cohort : ( a ) fp by non - candida species ( p = 0.004 ) , ( b ) prior exposure to antibiotics ( p = 0.03 ) and ( c ) preceding history of bacterial peritonitis ( p = 0.02 ) . though mean serum albumin was lower in patients with fp ( 2.4 g / dl ) as compared to those with bacterial peritonitis ( 2.7 g / dl ) , the difference was not statistically significant ( p = 0.09 ) . age , sex , diabetic status and clinical features were comparable between the two groups ( fp vs. bacterial peritonitis ) . on subgroup analysis , infection due to non - candida species predicted higher risk of mortality ( p = 0.03 ) [ tables 2 and 3 ] . fp accounts for 3 - 6% of all peritonitis episodes complicating pd in adults ; however , in some centers , the numbers can be higher . indian studies have reported incidence of fp rates varying from 14.3% to 23.88% , respectively . in our study most fp cases are caused by yeasts , with candida species accounting for 70 - 90% in adults and 80 - 100% in the pediatric population . the most important predisposing factor for the development of fp in capd patients is prior exposure to antibiotic therapy , especially for the treatment of bacterial peritonitis . the reported incidence of prior antibiotic exposure in capd patients with fp ranges from 34% to 80% , respectively . in our study , it has been postulated that broad - spectrum antibiotics suppress the normal intestinal flora , leading to an overgrowth of intestinal fungi , which migrate across the intestinal wall to reach the peritoneal cavity and cause fp . the causes of these de novo cases of fp vary and may include direct contamination of the dialysis catheter during the exchange procedure , underlying intestinal pathology such as diverticulosis in the host and environmental contamination . the pd catheter should be removed as soon as possible after a diagnosis of fp , as recent reports have shown that leaving the catheter in situ is associated with higher rates of mortality and technique failure . the suggestion is that fp results in formation of a biofilm around the dialysis catheter , rendering the eradication of the fungal infection difficult without removal of the catheter . isolated cases of successful continuation of capd without catheter removal have been reported with the use of various regimens of intraperitoneal antifungal agents ; however , the overall success rate of this approach is low and many patients still eventually require catheter removal . the conventional empirical treatment for fp was a combination of intravenous amphotericin b and flucytosine or oral fluconazole and flucytosine . the roles of newer antifungal agents such as caspofungin and voriconazole in the treatment of capd - related fp remain to be determined . in our study , pd catheter was removed in all the patients and was treated with appropriate antifungal agents . the mortality rate in capd - related fp ranges from 5% to 53% , respectively . consistently , many studies indicate that leaving the catheter in situ is associated with greater mortality . one of the indian study describes a mortality rate of 60.46% in which pd catheter was left in situ in most of the patients . many patients are unable to resume capd after fp because of peritoneal fibrosis , which accounts for 40% of the cases . in our study nearly 20% of the patients were shifted to hemodialysis due to technique failure . mortality rate due to fp in our center was 20% . given that recent antibiotic exposure is a recognized risk factor for fp in capd patients , administration of antifungal prophylaxis with every antibiotic prescription may help to reduce the occurrence of fp . the study of lo et al . demonstrated that 4-times a day oral nystatin 500,000 u with every antibiotic prescription significantly reduced both overall incidence and the incidence of antibiotic - related candida peritonitis in capd patients ; however , two subsequent studies failed to confirm a benefit for nystatin prophylaxis . we however did not administer antifungal prophylaxis in our pd patients with every antibiotic prescription . in patients with bacterial peritonitis , administration of prophylactic oral fluconazole throughout the time they received antibiotics significantly prevented the appearance of secondary fp . in our center , we noticed a significant reduction in the fp rates with the use of prophylactic anti - fungal agent ( fluconazole ) in patients with bacterial peritonitis . the novel feature of this study is that , for the first time in our country a study has been conducted evaluating the role of antifungal prophylaxis in capd patients with bacterial peritonitis in indian setting . however , we also noted a change in the epidemiology of fungal isolates from c. albicans to non - c . albicans in the post prophylactic era , after usage of fluconazole , which has not been reported by others in the west . we conclude that patients with prior antibiotic exposure are at higher risk of developing fp ( odds ratio : 1.22 ) and c. albicans is the most common fungus isolated . prophylactic antifungal agent in all patients with bacterial peritonitis significantly reduces the incidence of subsequent fp .

actomyosin contraction provides the force - driving contraction , membrane blebbing and apoptotic body formation during programmed cell death.apoptotic cells display cell surface markers that facilitate recognition and uptake by phagocytic cells.impaired apoptotic cell clearance may contribute to inflammation and autoimmunity . actomyosin contraction provides the force - driving contraction , membrane blebbing and apoptotic body formation during programmed cell death . how are apoptotic cell surface markers concentrated on blebs?how do markers such as calreticulin and n - acetylglucosamine come to be displayed on the surface of apoptotic cells?what is the role of blebbing in the recognition and clearance of apoptotic cells ? how do markers such as calreticulin and n - acetylglucosamine come to be displayed on the surface of apoptotic cells ? what is the role of blebbing in the recognition and clearance of apoptotic cells ? apoptotic cells can often be discriminated from viable counterparts based on several morphological hallmarks including highly conspicuous nuclear condensation and fragmentation , and frequent appearance of characteristic plasma membrane blebs ( figure 1a ) . blebs are balloon - like protrusive blisters formed when cellular plasma membrane delaminates from the cortical cytoskeleton , and which can be retracted and reformed in a dynamic cycling process covering the entire surface of apoptotic cells . the formation of apoptotic blebs is a physical process that results from increased hydrostatic pressure following actomyosin - mediated cellular contraction . subsequently , an actin cortex rapidly polymerizes within the protruding bleb , followed by the recruitment of cytoskeletal bundling proteins and myosin that then power bleb retraction . in apoptotic cells this cyclic process of bleb formation and retraction can occur over sustained periods , and as programmed cell death progresses blebs may become packed with cellular organelles and condensed chromatin to form the basis of fragmentary membrane - clad apoptotic bodies ( figure 1a ) . however , it should be noted that apoptotic blebbing is not a universal feature of programmed cell death , some cell types do not appear to generate membrane blebs nor undergo fragmentation . nonetheless , blebbing is a very common feature of apoptotic cells and has become a morphological hallmark of programmed cell death . in 2001 , it was discovered that apoptotic blebbing is dependent upon activity of the actomyosin regulator rock1 kinase . moreover , it was apparent that apoptotic rock1 activation is independent of its canonical activator rho gtpase . this atypical form of rock activation was associated with caspase cleavage of rock1 , but not rock2 , after a conserved site within the c - terminus ( 1110detd1113 ) ( figure 1b ) . further investigation revealed that caspase cleavage of rock1 yields a constitutively active kinase fragment that is sufficient to induce membrane blebbing resembling that seen in apoptotic cells . in addition , the cleaved rock1 fragment appears to be important for disruption of nuclear integrity and the packaging of fragmented dna into membrane blebs and apoptotic bodies . thus , the generation of constitutively active rock1 kinase fragments appears to be an important mechanism to complete the execution phase of cellular apoptosis . when cell death has been triggered by extrinsic factors such as tnf , ceramide or fas - receptor ligation , rock1 cleavage and activation are relatively late events , consequently rock inhibition does not halt the apoptotic process . however , in some contexts chronic or high - intensity rock activity may contribute to the initiation of apoptosis . data from rock1 knockout mice revealed that blood pressure overload was less effective at inducing cardiomyocyte apoptosis compared with control wild - type mice , suggesting a potential role for rock1 activation in myocardial failure . although rock1 cleavage and activation is associated with the formation of apoptotic blebs , and rock activity is necessary for blebbing , formal proof of the absolute requirement for rock1 cleavage as the causal event leading to apoptotic blebbing remains to be provided . although rock2 is not cleaved by caspases and is therefore unlikely to be involved in apoptotic blebbing induced by conventional intrinsic and extrinsic stimuli , it can be cleaved by granzyme b , a serine protease injected into target cells by cytotoxic t - cells and natural killer cells to induce cell death by mitochondrial disruption and caspase 3 cleavage and activation . interestingly , granzyme b cleaves rock2 analogously to caspase 3 cleavage of rock1 ; rock2 cleavage after d1131 releases the c - terminal autoinhibitory domain leading to constitutive kinase domain activation capable of inducing membrane blebs . due to the activation of caspase 3 during granzyme b - induced apoptosis , rock1 cleavage also occurs , thus the relative contribution of rock2 cleavage towards the formation of apoptotic blebs remains unclear . furthermore , as rock2 is not cleaved during apoptosis induced by conventional signals , the post - translational modification that produces constitutively active rock2 appears not to be generally required for apoptotic blebbing . although rock1 cleavage is apparently vital for blebbing , it seems dispensable for many other apoptotic phenomena including caspase activation , phosphatidylserine ( ps ) externalization , and poly adp - ribose polymerase cleavage . this leaves open the question of precisely what the purpose of rock1 cleavage , and by extension membrane blebbing , in apoptosis might be . programmed cell death , or apoptosis , is vital for the removal of problematic or unnecessary cells in multicellular organisms . first defined in 1972 , apoptosis is an active process that ultimately concludes with the final act of cellular disposal in which phagocytic cells ingest cellular corpses and associated debris , a process termed efferocytosis . as a testament to the efficiency and rapidity of efferocytosis , it is surprisingly difficult to histologically detect apoptotic cells despite > 10 cellular suicides occurring per day in adult tissues . there are several broadly defined phases of phagocytic clearance of apoptotic cells : ( 1 ) find - me , characterized by the release of soluble signals that attract macrophages to the dying cell ; ( 2 ) eat - me , in which a phagocyte becomes stimulated by engaging with signals expressed on the apoptotic cell membrane ; ( 3 ) engulfment , a series of cytoskeletal modifications in the phagocyte enabling it to take up the dead cell ; ( 4 ) processing , digestion of the cellular remains through lysosomal degradation . importantly , apoptotic cells actively participate in the initial phases by displaying significant modifications to their membranes ( which can include lipids , proteins and modified carbohydrates ) that are important aids to recognition and uptake . the best characterized of these externalized factors is ps , which is normally confined to the inner leaflet of the plasma membrane . during early apoptosis membrane asymmetry is lost ; ps becomes externalized and serves as a major factor for apoptotic cell recognition ( figure 2a ) . a protein that mediates ps externalization was recently identified as the eight transmembrane spanning transmembrane protein 16f ( tmem16f ) . externalized ps can be bound by milk fat globule epidermal growth factor 8 ( mfg - e8 ) , which tethers the phospolipid to integrin v3 and/or v5 expressed on macrophages and monocytes ( figure 2a ) . alternatively , ps can be recognized directly by one or more receptors expressed on macrophages , including ; bai1 , tim5 , and stabilin2 ( figure 2 ) . ps externalization has also been detected on viable cells in some instances , suggesting that ps exposure alone may be insufficient to trigger phagocytosis and that additional signals are necessary . in fact , enforced ps externalization induced by expression of active tmem16f did not induce engulfment by macrophages in vitro or by dendritic cells ( dcs ) in vivo . therefore , it has been proposed that the eat - me ' signal received by phagocytes must be above a threshold level to initiate efferocytosis . the strength of such a signal could be augmented by the binding of additional eat - me ' molecules , such as mfg - e8 . alternatively , eat - me ' molecules on apoptotic cell membranes may also serve as phagocytic triggers that focally surpass the required threshold ( discussed below ) . in addition to ps externalization , apoptotic cells have further modifications to their membrane constituents . the release and dissociation of sub - cellular membrane clad particles called apoptotic bodies results in bulk membrane loss that must be replaced from intracellular organelles such as the golgi or endoplasmic reticulum . this scavenging of intracellular membranes leads to the externalization of protein and glycan groups , including calreticulin and n - acetylglucosamine ( glcnac ) , that are normally expressed only on intracellular membranes and which appear to be important for efferocytosis ( figure 2a ) . externalization of glcnac is recognized as a determinant of apoptotic thymocyte phagocytosis while calreticulin binds complement c1q and aids phagocytosis of apoptotic cells ( figure 2a ) . moreover , many of the externalized proteins are modified by cleavage , likely by activated caspases , which might easily affect their function and/or recognition . the atypical externalization of intracellular material contributes to apoptotic cell - associated molecular patterns ( acamp ) , which either alone or in conjunction with plasma proteins such as mfg - e8 , complement c1q , mannose - binding lectin and surfactant protein a are then recognized by macrophages to promote clearance . the binding of a macrophage to a target apoptotic cell creates an engulfment synapse and the diverse molecular interactions between acamp and macrophages initiate important phases of efferocytosis , such as binding and engulfment . a number of studies have attempted to define the role of blebbing in apoptotic clearance and revealed some potentially contradictory roles for blebs and apoptotic bodies . several in vitro studies reported that inhibition of apoptotic blebbing significantly impaired corpse clearance by monocytes and macrophages . further investigation revealed that impaired corpse clearance following defective blebbing could be rescued by the ps - bridging protein , mfg - e8 . the implications of these studies are two - fold : firstly , apoptotic blebbing directly influences efferocytosis ; and secondly , ps externalization may be a mechanism linking blebbing and phagocytosis . although the apoptotic externalization of ps appears to be rock - independent , its sub - cellular localization is rock - dependent . in fact , microscopic analysis revealed that apoptotic blebs become highly enriched for the externalized phospholipids . thus , it appears that apoptotic blebs serve as focal points for accumulation of externalized ps , which is then recognized by macrophages to trigger engulfment . the possibility that apoptotic blebs provide topological context for macrophage recognition is consistent with data demonstrating ps exposure on viable cells is insufficient to trigger phagocytosis . surprisingly , mfg - e8 failed to further enhance the in vitro phagocytic uptake of normal blebbing apoptotic cells , suggesting that apoptotic blebbing and subsequent ps concentration on blebs is sufficient to trigger corpse clearance in the absence of additional extracellular factors . when blebbing is impaired , efferocytosis can be rescued by bridging molecules like mfg - e8 ; thus there appears to be redundancy in clearance mechanisms . such redundant compensating mechanisms may explain why several genetically modified mice with defective clearance mechanisms are neither developmentally lethal nor display severe auto - immune phenotypes ( if displayed at all ) , as measured by survival and overall health . in addition to serving as organizational centers for ps externalization , apoptotic blebs are associated with additional membrane modifications . one of the most striking examples highlighting the potential importance of apoptotic blebs is their robust opsonization with complement c1q in human endothelial cells ( figure 2b ) . the high - density opsonization on the surface of apoptotic blebs would be expected to efficiently trigger efferocytosis by activating specific complement receptors such as cd91 expressed by macrophages . although the binding of c1q to apoptotic cells appears to be important for recognition and clearance , clearance is not dependent on further activation of the complement cascade . the importance of this mechanism for triggering clearance is underscored by the autoimmune disorders observed in c1q - deficient mice . thus , rock - mediated actomyosin contraction , consequent membrane blebbing and focalized accumulation of eat - me ' factors might be expected to facilitate rapid efferocytosis and thus maintain self - tolerance . the execution phase of apoptosis and subsequent corpse clearance convey powerful anti - inflammatory signals to engulfing cells and , importantly , enable apoptotic cells to remain immunologically silent . furthermore , apoptotic cell engulfment helps induce a tolerogenic response and facilitates proteins to be appropriately recognized as self ' , thus avoiding activation of adaptive immunity towards apoptotic material . collectively , the combination of rapid apoptotic cell clearance linked to suppression of immune activation allows apoptosis to proceed rapidly and efficiently with minimal collateral damage to maintain tissue homeostasis . one of the key features of apoptotic cells that allows for the rapid and stealthy removal of cellular fragments is a stable intact membrane ( detectable by the exclusion of impermeable dyes such as propidium iodide ) that prevents release of intracellular proteins and consequent immunological activation . this is in contrast to necrotic cell death , wherein cells inappropriately lyse and release their intracellular contents leading to rapid pro - inflammatory responses . alarmins ' , of which high - mobility group protein b1 ( hmgb1 ) is the archetype , that are recognized as danger signals and provoke innate immune cells into a pro - inflammatory state ( figure 3 ) . for this reason , defects in efferocytosis are believed to cause inappropriate pathological inflammation leading to the development of autoimmune diseases . indeed , genetically modified mouse models in which genes for vital elements of cell recognition and clearance machinery such as compliment c1q or mfg - e8 have been deleted display an autoimmune phenotype resembling systemic lupus erythematosus ( sle ) . sle is a chronic systemic autoimmune disease that affects multiple organ systems including joints , skin , lymph and kidneys in nearly 5 million people globally , 90% of whom are female . the disease is characterized by the generation of auto - reactive antibodies ( particularly against nuclear antigens ) , the formation of antibody immune complexes and pro - inflammatory cytokine production . animal models with defective efferocytosis develop a similar age- and sex - dependent pathology as seen in human sufferers , associated with the presence of anti - nuclear antibodies ( ana ) , splenomegaly and glomerulonephritis . although the pathophysiology of sle is multifactorial , the best - defined abnormality associated with the disease is defective apoptotic cell clearance . not only are macrophages from sle patients deficient in autologous efferocytosis in vitro , but the number of tingible body macrophages that are responsible for the ingestion of apoptotic corpses in lymphoid tissue germinal centers are frequently reduced in sle sufferers . consistent with these observations , sle is associated with elevated circulating apoptotic bodies and an accumulation of apoptotic cells in lymph node germinal centers . furthermore , compliment c1q deficiency , which is associated with increased undigested apoptotic debris , is a potent trigger for sle . the increase in free uningested apoptotic debris likely contributes to the induction of anas , which is a classic diagnostic feature of sle . overcoming self - tolerance is a pathological process closely associated with failed efferocytosis that results in immune activation towards intracellular material , including nuclear proteins and dna . supporting this possibility , sle - associated anas can be specific for novel epitopes produced only after enzymatic modifications such as caspase - mediated cleavage . furthermore , these autoreactive antibodies are somatically mutated igg isotypes suggesting that they are products of b - cell affinity maturation and thus the result of an antigen - driven immune response . the generation of self - reactive antibodies appears to be linked to phagocytosis of apoptotic debris by professional antigen - presenting dcs . dc are potent stimulators of adaptive immune responses and in an inflammatory context present peptides generated from apoptotic proteins and potently stimulate immune responses consistent with the generation of self - reactive antibodies ( figure 3 ) . in fact , the ingestion of secondarily necrotic apoptotic bodies by dc is vital for their maturation leading to expression of co - stimulatory molecules necessary for adaptive immunity . these features of dc make them likely candidates to mediate auto - antibody generation following phagocytosis of apoptotic debris accumulated due to failed efferocytosis and further suggests that additional signals associated with secondary necrosis , such as hmgb1 release , are important components in the development of autoimmunity . moreover , the ingestion of apoptotic bodies by dc can stimulate the release of pro - inflammatory cytokines , such as interleukin-6 ( il-6 ) , thereby inducing auto- and paracrine signaling loops favoring the generation of auto - reactive antibodies . once an auto - reactive antibody is produced , it would be expected to opsonize apoptotic cells and potentially encourage inappropriate inflammatory responses leading to the development of auto - immune / inflammatory diseases such as sle ( figure 3 ) . although auto - immune diseases resulting from failed efferocytosis are clearly multifactorial , apoptotic blebbing appears to lie at foundational stages of disease onset . although apoptotic blebs certainly accumulate a collection of important eat - me ' factors such as ps and c1q , they also appear to be rich in auto - antigens frequently associated with autoimmune disorders such as sle . in particular , apoptotic blebs and discrete apoptotic bodies display many nuclear auto - antigens such as dna , nucleosomes , ro and la ( figure 4 ) . the implication of these observations is that blebs and apoptotic bodies are reservoirs of antigens that may contribute to the generation of auto - immune disease . as previously mentioned , self - tolerance can be challenged by dc uptake of apoptotic cells . apoptotic blebbing appears to participate in this process as dc prefer smaller apoptotic body - sized cell remnants that are rich in potential auto - antigens . furthermore , the ingestion of this material can stimulate production of the pro - inflammatory cytokine il-6 and induce dc maturation . the uptake of antigen - rich apoptotic bodies by dc coupled with the subsequent release of inflammatory mediators and cellular maturation appears to drive adaptive immunity leading to auto - immunity ( figure 4 ) . because of these observations , inhibition of apoptotic blebbing has been proposed as a potential therapy to avoid or attenuate auto - immune disease severity . in fact , inhibition of blebbing with the rock selective inhibitor y27632 not only impaired dc phagocytosis of apoptotic bodies but completely abolished enhanced uptake following auto - antibody opsonization . these observations underscore the importance of apoptotic cell clearance in the maintenance of self - tolerance . however , it is important to note that apoptotic clearance failure in itself may be insufficient to promote auto - immune disease ; in fact , mannose - binding lectin - deficient mice have demonstrated apoptotic clearance defects without autoimmunity . this suggests that determinants , in addition to clearance , participate in the immunological processing of apoptotic cell debris . it has been proposed that immunosuppressive transforming growth factor ( tgf- ) release stimulated by binding of apoptotic cells to macrophages may be sufficient to avoid potentially problematic auto - antibody generation , even in the absence of clearance . nonetheless , defective cell clearance , resulting from impairment or elimination of the myriad components of efferocytosis , is undoubtedly linked to autoimmune disease as well as several other disorders in human and mice including atherosclerosis , neuropathy , arthritis , and anemia . collectively , these studies indicate that apoptotic blebbing , as a mechanism to promote cell clearance , is a double - edged sword . although blebs appear to be important for rapid uptake and clearance to maintain homeostasis , simultaneously they also are sources of auto - antigens ( figure 4 ) . it appears that the same material recognized by macrophages to trigger clearance may also be recognized by other cell types , such as dcs , to generate auto - immune antibodies . the mechanisms that may lead to these opposing outcomes is currently unclear ; however , defects in macrophage uptake or increases in apoptosis appear to be important determinants . hypothetically , the accumulation of apoptotic debris would likely lead to increased probability of dc activation and , over time , this inappropriate activation would overcome self - tolerance and lead to the generation of auto - reactive antibodies characteristic of autoimmunity . although the linkage between apoptotic blebbing and autoimmune disease has been inferred , there has been no definitive demonstration of the importance of apoptotic blebbing in vivo . to date , studies investigating apoptotic blebbing in the context of clearance and auto - immune disease have been largely limited to in vitro experimentation that can not recapitulate the complexity of interactions between apoptotic cells and their environment . furthermore , these studies may also be compromised by certain aspects of their experimental design that could affect outcomes in subsequent assays , such as their dependence on chemical inhibitors to interfere with apoptotic blebbing , and extensive washing steps that might alter the stability and structure of the apoptotic cells . as a result , many of the observations from in vitro studies regarding the possible influence of blebbing towards apoptotic cell clearance and consequently on the development of autoimmune disease are potentially compromised . ultimately clear determination of the role that apoptotic blebs have in cell clearance and/or the generation of autoimmune disease will require an in vivo model of defective blebbing .

tuberculous meningitis ( tbm ) is among the most fatal forms of extrapulmonary tuberculosis ( eptb ) accounting for 7080% of all neurological tb cases [ 24 ] . the development of tbm infection occurs with infection of meninges with tuberculous bacilli , resulting in formation of tuberculous lesions ( rich foci ) . although tuberculous bacilli can remain dormant in subependymal surface of the brain for years [ 57 ] , however , reactivation may occur due to rupture or growth of small lesions in the meninges producing active infection [ 8 , 9 ] . latent tuberculous meningitis ( ltbm ) continues to pose a diagnostic problem , as it remains nonsymptomatic and shows only inflammatory changes in cerebrospinal fluid ( csf ) . biomarkers aiding in early diagnosis of ltbm are therefore urgently needed for early initiation of treatment and also to avoid further neurological complication and reactivation to active tbm infection . rv2623 is a major dormancy regulon protein of mycobacterium tuberculosis ( mtb ) which is involved in promotion of mycobacterial transition to latency . although many studies suggests role of rv2623 as a major diagnostic marker for latent infection , there are no studies reported involving evaluation of rv2623 in csf of suspected latent and active tbm patients . keeping the existing situation in mind , the present study was therefor designed with an objective to investigate diagnostic utility of rv2623 in csf samples of suspected latent and tbm patients for the diagnosis . apart from that , to further investigate the utility of rv2623 as a prognostic maker in suspected ltbm cases , telephonic followup was taken for a period of two years to monitor conversion into active tbm cases . a total of 100 csf samples were collected from patients of infectious neurological disorders admitted to the neurology department of central india institute of medical sciences ( ciims ) , nagpur . the average age of the patients ranged between 10 and 50 years , and there were 54 males and 46 females . diagnosis of tbm was based on the clinical features , which included subacute or chronic fever and signs of meningeal irritation with or without other features of central nervous system ( cns ) abnormality . all patients recruited were positive for acid - fast bacilli and/or mtb csf culture and started on antituberculous drugs treatment ( att ) . csf findings in these patients included increased protein levels , decreased glucose ( csf / blood glucose ratio , < 0.5 ) , and pleocytosis with lymphocyte predominance . all patients were culture negative for other microorganisms . this category included patients having exposure with active tb subjects . patients having clinical features such as subacute or chronic fever and signs of meningeal irritation with or without other features of cns abnormality csf findings in these patients included increased protein levels and decreased glucose ( csf / blood glucose ratio , 0.5 ) . this category included patients with no clinical symptoms suggestive of meningitis , normal csf protein and sugar level with no evidence of cns or extra - cns tuberculosis . patients included in this category had no exposure to tb cases and were negative for mtb csf culture and acid - fast bacilli . periodically , telephonic followup was taken from suspected ltbm cases for a period of two years based on initial rv2623 positivity in their csf samples . out of 22 suspected cases , followup of was taken from 16 suspected ltbm cases to know persistence of any existing complications during the two - year period . followup was not available in 6 cases due to unavailability of their records and due to other ethical reasons . routine csf examination , gram 's staining , india ink staining , and acid - fast bacilli staining were done in every csf sample . detection of rv2623 antigen in the csf samples was done by indirect elisa protocol as described by kashyap et al . and mudaliar et al . [ 3 , 4 ] . briefly , 100 l of csf sample ( 1 : 5 diluted in phosphate buffered saline ( pbs ) was coated on the wells of microtiter plates and incubated for 90 min at 37c . the wells were then washed once with pbst ( pbs tween-20 ) and blocked with blocking buffer ( 0.5% bsa in pbst ) and incubated at 37c for 60 min . after blocking , wells were washed three times with pbst followed by addition of 100 l monoclonal antibody ( 1 : 2000 dilutions in pbst ) against rv2623 antigen ( biotech , india ) . after 45 min of incubation , the wells were washed three time with the pbst and 100 l secondary antibody , and affinity purified anti - mouse igg ( 1 : 5000 dilution in pbst ) conjugated to horseradish peroxides ( genei , bangalore , india ) was added to wells and incubated at 37c for 45 min . after incubation , the wells were washed four times extensively with pbst followed by addition of 100 l of tmb / h2o2 substrate and incubated at 37c for 10 min . the reaction was stopped with addition of 100 l of 2.5 n h2so4 , and the absorbance of colour in each well was read at 450 nm . comparison of baseline characteristics of tbm and suspected ltbm patients was done using chi - square test for the comparison of two proportions . similarly , csf characteristic of the tbm , suspected ltbm , and non - tbm control individuals was done using student 's t - test , respectively . mean absorbance of mtb specific rv2623 antigen in csf samples of tbm and ltbm and non - tbm control group was compared using mann - whitney u test . cut - off value for the rv2623 antigen detection assay and its sensitivity and specificity were calculated by receiver operating characteristics ( roc ) curve analysis . graph of respective data was prepared using prism ( version 5 ) software ( graphpad software , inc . san diego , ca ) . a p value of < 0.05 was considered statistically significant for all the analyses . the baseline characteristics of active and suspected latent tbm patients are shown in table 1 . no significant difference in baseline characteristics was found between active tbm and suspected ltbm patients with exception of headache and vomiting ( p < 0.05 ) . increased levels of total cell count and protein were observed in samples of tbm and suspected ltbm patients as compared to non - tbm control group . however , significant increase ( p < 0.05 ) in the above characteristics was observed only in tbm patients . similarly , there was significant decrease ( p < 0.05 ) in the levels of csf sugar and sugar / parallel blood sugar ratio among tbm and suspected ltbm patients as compared to non - tbm control group . however , decrease was significantly more ( p < 0.05 ) in tbm patients as compared to suspected ltbm and control group . figure 1 shows scatter plot of absorbance value of rv2623 protein in csf samples of tbm , suspected ltbm , and non - tbm control individuals . comparison of the mean absorbance indicated significantly high rv2623 levels ( p < 0.05 ) in tbm ( 0.64 0.09 ) and suspected ltbm ( 0.65 0.14 ) patients as compared to non - tbm control ( 0.37 0.07 ) individuals . no significant difference was observed in mean absorbance between tbm and suspected ltbm subjects . table 3 shows diagnostic sensitivity , specificity , positive predictive value ( ppv ) , and negative predictive value ( npv ) of rv2623 estimation for the diagnosis of tbm and suspected ltbm patients in the csf samples . diagnostic sensitivity of rv2623 estimation in tbm and suspected ltbm patients was found to be 90.32% and 77.27% , respectively , with a specificity of around 100% for both . ppv of the test was 100% in both tbm and suspected ltbm patients , while the npv was higher in tbm patients ( 94% ) then the suspected ltbm patients ( 90% ) . among the three cases false negative for rv2623 antigen in active tbm group , one was an old case of tbm along with encephalopathy , while the other two cases were old cases of multiple granuloma of brain tuberculosis . clinical diagnosis in five , false negative cases for rv2623 in suspected ltbm group revealed that two cases were of that of encephalitis with viral meningitis , while the other three were cases of calcified granuloma and cns demyelination , respectively . figure 2 shows a flow chart analysis of follow - up samples and their conversion with respect to rv2623 levels in csf . two cases were among those who responded well on starting att , while the remaining two cases expired during followup . despite the recent advances in tb diagnostic tools , diagnosis of tbm still poses a major problem [ 12 , 13 ] . the signs and symptoms , along with routine csf and radiographic finding in patients with cns tuberculosis , are often inadequate for making confirmative diagnosis . identification of a new biomarker for rapid , confirmatory , and differential diagnosis of tbm is therefore urgently needed . in the present study , we evaluated diagnostic potential of rv2623 , a mycobacterial dormancy regulon protein in csf samples of active tbm , suspected ltbm , and control individuals . our results revealed significantly high rv2623 level in tbm and suspected ltbm patients as compared to non - tbm control individuals . however , no significant difference in rv2623 level was observed between tbm and suspected ltbm subjects . overall sensitivity of rv2623 estimation in tbm and suspected ltbm patients was 90.32% and 77.27% , respectively , with 100% specificity . rv2623 is a member of the universal stress proteins family and is reported to protect mycobacteria from multiple stress conditions like hypoxia , nitrosative stress , low ph levels , and so forth [ 1517 ] . schuck et al . in their study evaluated twenty - nine m. tuberculosis dormancy associated antigens including rv2623 and found that rv2623 induced significantly stronger t - cell responses in ltbi as compared to tb patients . similarly , it is found that a level of rv2623 protein significantly increases following phagocytosis by macrophages in lungs of chronically infected mice . in another study , monahan et al . showed increased expressions of six abundant proteins ( including rv2623 ) inside mtb infected macrophages , supporting the fact that rv2623 may promote transition of mycobacteria to latency . interestingly , rv2623 knockout mutant of virulent m. tuberculosis failed to establish a chronic persistent infection , suggesting the role of rv2623 in regulation and establishment of a persistent infection . reported that rv2623 was strongly expressed in bacteria from resting cultures and absent in shaking cultures , supporting the role of rv2623 in the anaerobic survival of m. tuberculosis inside the granuloma in the dormant state . in our earlier studies , we had also evaluated the role of rv2623 for diagnosis of latent tb infection ( ltbi ) ( unpublished data ) , and our finding are in agreement with the earlier published reports . as mentioned elsewhere , there are various reports which suggest rv2623 as a latent specific biomarker in pulmonary tb ; however , to the best of our knowledge , this is the first study to report evaluation of rv2623 antigen in the csf samples for the diagnosis of latent and active tbm infections . result from the current study supports our earlier findings that rv2623 level increases after mtb infection . in the current study , patients included under the suspected ltbm group had neurological complications and were culture negative for any other organism . as mentioned , despite absence of any clinical symptoms of tbm and culture negativity in the body fluid , we observed increased rv2623 levels in 77.27% ( 17/22 ) of cases , indicating the importance of rv2623 evaluation in csf for diagnosis ltbm infection . the main function of rv2623 is to regulate the bacillary growth inside the tuberculous lesions ( rich foci ) located in any part of brain where organism may remain dormant for a long period of time [ 59 ] . thus , evaluation of rv2623 in csf samples may be very useful for the diagnosis of persistent ltbm infection in such patients . further role of rv2623 antigen in ltbm infection can be evaluated by doing long - term followup of these subjects . similarly , it will be interesting to see the conversion of ltbm cases defined in this test to active tbm cases.we also evaluated case - wise association of rv2623 with different csf findings . we observed that absorbance of rv2623 positively correlated with total cell count and protein ; similarly , a negative correlation with sugar and sugar / parallel blood sugar ratio was observed both in tbm and ltbm groups ( supplementary figures 1 - 2 available online at http://dx.doi.org/10.1155/2013/309816 ) . we did not find any correlation between rv2623 absorbance and csf finding in control group ( supplementary figure 3 ) . this confirms our findings that rv2623 may be a useful diagnostic biomarker for the diagnosis of ltbm and tbm infections . similarly , we have also evaluated the prognostic utility of rv2623 by taking telephonic followup of 22 suspected tbm cases based on earlier rv2623 positivity . about 25% ( 4/16 ) showed conversion , of which two cases were among those that expired , while the other two cases were started on att and responded well to treatment . although the percentage of conversion reported was much less , it still suggests important findings , as we got only 16 cases for followup , which is altogether a very low number . still , four cases showing conversion were among those who earlier had no signs and symptoms of tbm , but showed higher rv2623 levels in their csf . these results suggest the utility of rv2623 as an important marker for diagnosis and prognosis in latent and active tbm cases . although the study is associated with limitation of a small sample size , results obtained in this preliminary study are very promising to carry out further investigation in large number of patients . another major limitation associated with the study is that we have not taken any gold standard like quantiferon gold test ( qft ) to define ltbm cases ; this is because of the low sample volume available for test ( 11.5 ml ) , whereas a csf volume of more than 3 ml is required to perform qft test . however , further studies can be planned to investigate the qft response in rv2623 positive cases . the results of the present study suggest that rv2623 may be useful as a diagnostic biomarker for latent and active tbm infections . further investigation in a large number of samples along with its comparison with gold standards like qft - g assay is needed to establish its role as a diagnostic biomarker of latent and active tbm .

duplications leading to functional disomy of chromosome xq28 are associated with a distinct clinical phenotype in males , characterized by severe mental retardation , infantile hypotonia , progressive neurologic impairment , recurrent infections , bladder dysfunction , and absent speech ( see and for reviews ) . this combination of features is known as the xq28 microduplication syndrome or lubs syndrome and was first described by pai et al . and lubs et al . , followed by many others . the reported xq28 duplications vary in size and location , however the majority are intrachromosomal duplications ranging from 0.3 to 2.3 mb . alternatively , duplications may be the result of another mechanism , such as rearrangements between xq and xp , or between xq and the y chromosome . the methyl - cpg binding protein ( mecp2 ) gene on xq28 is proposed to be the critical dosage - sensitive gene responsible for the severe phenotypes observed in patients with this duplication . in males , over 140 cases of xq28 duplications including mecp2 have been described to date [ 524 ] . female patients with an xq28 duplication are rare . in families with x - linked pedigrees , female carriers of an xq duplication are usually asymptomatic , due to skewed x - chromosome inactivation ( xci ) pattern with preferential inactivation of the rearranged chromosome . until recently , only three symptomatic females had been reported with large , cytogenetically visible xq28 duplications ( summarized in ) . clinically , these females presented with severe developmental delay and other features similar to those observed in affected males . in all cases the duplication was the result of an unbalanced x - autosome translocation , explaining the absence of skewing of the aberrant x - chromosome and the effect on the phenotype . after introduction of array cgh analysis , smaller , submicroscopic duplications of this region on xq28 have been detected in four females , all in combination with random xci [ 2527 ] . the patient with a mecp2 duplication described by ariani et al . should not be included in this series , as the patient turned out to have a 47,xxx karyotype ( f. ariani , personal communication ) . based on this small series , it was concluded that in females with mecp2 duplication and random xci , the typical symptoms of affected boys are not present . instead , the clinical signs in female patients consist of unspecific mild to moderate mental retardation , combined with variable symptoms ( autistic features , recurrent infections in early childhood , constipation , and late - onset neurological features ) . recently , a girl with a de novo complex x - chromosomal rearrangement was described , with a triplication of a fragment containing mecp2 . she was severely mentally retarded and had seizures , but no other symptoms as seen in boys with a duplication . here we present clinical and molecular data on a series of five females with an xq28 duplication including the mecp2 gene and these are compared with the previously reported cases of small duplications in females . in patient 1 , a mecp2 duplication was the result of a rare insertion duplication of a small segment of xq28 into an autosome . patients 2 and 3 are functionally disomic for region xq28 due to an unbalanced x - autosome translocation . the fourth patient is a mildly affected obligate carrier from an x - linked mental retardation ( xlmr ) family . we detected a familial , intrachromosomal xq duplication including mecp2 in her , but unlike previously reported carrier females in x - linked families , she showed random x - inactivation . in contrast to the previously reported series of affected females , our series includes a female patient with the typical symptoms of affected boys , therefore expanding the phenotypic spectrum of small xq28 duplications including mecp2 in females . patients were evaluated in a diagnostic setting because of mental retardation ( in the family ) . duplications were either characterized by affymetrix genome - wide snp array 6.0 ( affymetrix inc , santa clara , california , usa ; patients 1 and 5 ) or agilent 44k array ( agilent , santa clara , california , usa ; patient 2 and 3 ) according to the manufacturer 's instructions . the array design for patient 2 was modified for constitutional cytogenetic applications ( see design specification at : http://www.ngrl.org.uk/wessex/arraycgh.htm ) . data analysis was carried out with genotyping console 3.0.2 ( patient 1 ) or agilent 's analytics ( patient 2 and 3 ) . patient 4 was characterized using an x - chromosome specific tiling - path array as described previously . mlpa was performed with a specific kit for rett syndrome ( salsa p015 , mrc holland , amsterdam , the netherlands ) according to the manufacturer 's instruction . fish analysis was carried out by standard procedures , using bac clones selected within the duplicated and deleted regions ( patients 1 , 2 , 5 ) and telvision subtelomeric xq probe ( vysis ) ( patient 3 ) . in patients 1 , 2 , 4 , and 5 , x - chromosome inactivation was studied using the highly polymorphic small tandem repeat within the human androgen receptor gene , as described by allen et al . . inactivation was considered to be random if the ratio of active to inactive x was less than 75:25 . extreme skewing of x inactivation was defined as the preferential inactivation of one x chromosome in 9095% of cells . table 1 provides a summary of the cytogenetic and phenotypic characteristics on five female patients with a mecp2 duplication . patient 1 is a 10-year old girl , first born to a 24-year old mother and a 25-year old father . the maternal grandfather developed epilepsy around the age of 40 years , otherwise the family history is unremarkable . the patient was born at term with a birth weight of 3040 g ( 1 sds ) . it was noted early on that her neuromotor development was slow ( rolling over at 10 months of age , standing and walking a few steps ( both with support ) at the age of 3.5 years ) . in the first year of life she made little contact , but this improved gradually and she became a friendly , sociable girl . she had noisy breathing from birth on and laryngoscopy at the age of 2.5 years showed laryngomalacia . in infancy she was repeatedly admitted because of recurrent infections ( at 7 years of age she had had several episodes of pneumonia ( 13 times ) , otitis media ( five times ) , and pyelonephritis ( twice ) ) . her deciduous teeth did not fall out spontaneously , resulting in a double row of teeth , and had to be removed surgically . at the age of 8 years and 2 months she was operated because of a luxation of the right hip and a subluxation of the left hip . afterwards her condition deteriorated , she lost the ability to crawl and to walk with support . at the age of 8.5 years she developed febrile convulsions , followed by seizures and she was diagnosed with lennox gastaut type of epilepsy , with a poor response to medical treatment . she has severe constipation , sleeping problems ( refusing to go back to sleep after waking up in the middle of the night ) , and feeding problems ( unable to eat solid food ) . she had a nasogastric tube for fluid , extra feeding and medication . at the age of 10 years she needed a peg tube . placement was complicated and prolonged due to an aberrant position of the liver ( ventral to the stomach ) . at 8 years of age she was able to communicate using pictures , she has limited understanding of sign language . after the hip surgery and development of epilepsy she lost most of these abilities . also from that time on , parents noted loss of appetite , loss of energy and reported her to be increasingly lethargic . iq testing using kent infant development scale confirmed severe developmental delay and regression ( at the ages of 18 , 32 , 68 , and 108 months , her development was conform 7 , 8 , 12 , and 9 months , respectively ) . when first assessed at the age of 17 months , her head circumference was 50.5 cm ( + 2.3 sds ) . she showed mild dysmorphic features : prominent broad and high forehead , thin curly hair , telecanthus and epicanthus , thin eyebrows , small nose , full cheeks , open mouth with everted lower lip , broad alveolar ridges , narrow palate , widely spaced teeth , slightly pointed ears , short neck and inverted nipples ( fig . her height was 98 cm ( 0.8 sds ) , her weight 16.4 kg , ( + 0.7 sds for height ) and her head circumference 52.5 cm ( + 1.7 sds ) . most facial features had become more obvious , however her forehead had grown normal and her philtrum was short and prominent ( fig . she had no apparent breathing abnormalities . on follow up at the age of 7 years ( fig . follow up at the age of 9 years her height was 128 cm ( 1.5 sds ) , her weight was 25 kg ( 0.5 sds for height ) and her head circumference 54.5 cm ( + 1.4 sds ) . she had a limitation of 20 in the extension of right hip and knee , for which she wears nightly splints . a brain mri at the age of 10 months showed mildly enlarged ventricles and prominent sulci , suggestive of mild brain atrophy . mri was repeated at 4 years of age and showed a dandy-walker malformation and demyelination . subsequent snp array analysis identified a 279 kb duplication on chromosome xq28 and a 207 kb duplication on chromosome 3q25.33q26.1 . the duplication on xq28 encompasses eight protein coding genes including mecp2 , opn1lw , tex28p2 , opn1nw , tex28p1 , tex28 , opn1nw2 and tktl1 . parental analysis showed that both rearrangements occurred de novo . additional fish analysis showed that the xq28 duplication has been inserted into chromosome 3 , adjacent to the 3q25.33q26.1 duplication ( fig . patient 2 is a currently 7-year old girl , born at term after an uneventful pregnancy with a birth weight of 2940 g ( 1 sds ) . postnatally , she was diagnosed with laryngomalacia at 3 days of age , which improved with time . she presented at the age of 2 years and 8 months with failure to thrive despite a good appetite ( height 81 cm , 3.5 sds ; weight 10.6 kg , 2.4 sds , 0.2 sds for height ) , microcephaly ( ofc 45.5 cm , 2.2 sds ) , and developmental delay . her development was moderately delayed , with sitting at the age of 14 months and crawling at 22 months . she had no speech , although her level of understanding was thought to be better than her expressed speech . she had some repetitive behaviour ( hair pulling , hand flapping , biting herself ) . she had sleeping problems ( refused to go back to sleep after waking up in the middle of the night ) . on examination she had no apparent dysmorphic features , apart from prominent infraorbital fullness ( the appearance is of very prominent she was seen for follow up at the age of 4 years and 6 months ( fig . she had started to walk at the age of 3 years and 9 months , she walked with a wide - based gait . she was smiling a lot and she might use mama , dada , and bye she was about to start at a normal school , with full time personal help . apart from a marginally elevated tsh , additional investigations were normal , including an eeg and a brain mri . array cgh analysis showed a 1.69 mb duplication on chromosome xq28 and a 1.54 mb deletion on chromosome 21q22.3 . confirmatory fish experiments using tiling path bac clones , showed that bac clones rp11 - 119a22 , rp11 - 103m23 , and rp11 - 402h20 from the xq28 region have been translocated to the distal long arm of one of the chromosomes 21 homologues . fish analysis with specific clones from the distal 21q region , rp11 - 162f19 and rp11 - 71a7 , confirmed the telomeric deletion of one of the chromosome 21 homologues . consequently , this patient carries a cryptic unbalanced translocation between chromosomes x and 21 , der(21)t(x ; 21)(q28 ; q22.3 ) . studies of parental chromosomes showed that the rearrangement is de novo and occurred on the paternal chromosomes . patient 3 is a 6.5-year old girl , first child of non - consanguineous and healthy caucasian parents . she was born at term after an uneventful pregnancy by caesarian section , due to breech presentation . at birth , weight was 2320 g ( 1.5 sds ) , length 47 cm ( 1.0 sds ) and head circumference 33.5 cm ( 0.5 sds ) . her development was delayed : sitting at the age of 10 months , walking with ataxic gait at 24 months , babbling at 4 years . she had several episodes of upper airway infections ( bronchitis , pneumonia , and tonsillitis ) since the age of 7 months , as well as nocturnal apnea . follow up at the age 6 years and 5 months she showed little interest in people . on physical examination her height was 112 cm ( 1.0 sds ) and weight 23 kg ( + 0.7 sds ) . she was microcephalic ( head circumference 48.1 cm , 2.0 sds ) , with a round face , up - slanting palpebral fissures , severe bilateral ptosis of eyelids ( also noted in her paternal grandmother ) , bilateral epicanthic folds , flat and wide nasal bridge , small and widely spaced teeth , normal hand and foot length , bilateral hallux valgus , and cutis marmorata . she walked with ataxic gait , did not speak and she made repetitive movements with her head ( stretching upward ) . a cerebral ct recorded at the age of 7 months showed a cyst of the septum pellucidum and cavum vergae . a brain mri at 2 years and 7 months of age showed an immature aspect of cortical white matter , mainly in the frontal lobes . an eeg , recorded at the age of 4 years and 10 months showed slowing down of background rhythm . array cgh analysis identified a chromosome x subtelomeric duplication of about 2.10 mb ( fig . confirmatory fish experiments showed that the xq28 region has been translocated to the short arm of one of the chromosomes 22 homologues . the duplication was identified by an x - chromosome array - cgh and previously published ( case 5 , pedigree e in ) . only one branch of the family could be studied ( iii-6 ; iv-2 ; iv-3 and the index patient v-1 ) . a detailed description of the index is provided in the supplementary data , clinical details on his mother and grandmother are presented here . clinical data from other family members are scarce , but confirm x - linked inheritance of severe mental retardation . she was born at 39 weeks of gestation , birth weight 2850 g ( 1.1 sds ) , length 48 cm ( 1.2 sds ) , and ofc 32 cm ( 1.7 sds ) . during early childhood she presented with learning difficulties at school and she could not finish primary school . before having her son , psychiatric symptoms had become apparent ( depression , compulsions ) . she is currently rather impulsive and has a strong and difficult character when she is upset . her cognitive level is below average ( iq 84 ) and below the level in her family ( see suppl . table 1 for wechsler adult intelligence scale ( wais - iii ) results ) . her height was 162 cm ( 0.3 sds ) , weight was 68 kg ( + 1.2 sds ) , and ofc 56.5 cm ( + 0.7 sds ) . patient 4 's mother , grandmother of the index case ( iii-6 ) is healthy , with a cognitive level within the normal range ( see suppl . table 1 for the results of formal testing ) . she reported not to be very skillful with her hands and to suffer from a panic disorder . on physical examination weight and height were within normal limits , ofc is 56.5 cm ( + 0.7 sds ) . apart from clinodactyly of fifth fingers and hyperextensible interphalangeal joints , no dysmorphic features were present ( fig . her son ( iv-4 ) suffered from meningitis when he was 9 days of age . subsequently he presented with severe mental retardation , he never developed speech although he was able to understand simple tasks . he presented progressive epilepsy at 11 years of age , had recurrent episodes of severe pneumonia and died when he was 15 years old due to a complicated respiratory infection . mlpa confirmed the xq duplication in the index patient ( fig . 2c ) and identified the same duplication in his mother ( patient 4 , iv-3 ) and grandmother ( iii-6 , fig . 2c ) x - inactivation studies in the mother , patient 4 , showed random x - inactivation ( 63.3:36.7 ) , whereas it showed skewed x - inactivation in the grandmother ( 88.2:11.8 ) . the girl was born at 38 weeks of gestation , weighing 3430 g ( 0 sds ) , length 53.3 cm ( + 1.7 sds ) and with normal apgar scores . apart from eczema , no health problems were noted in the neonatal period . at 6 months of age hypotonia and her motor development was delayed ( walking around 22 months of age ) , as was her speech development ( first words around 3 years of age ) . at the age of 7 years she could speak in 5-word sentences , though she was at times difficult to understand . formal assessment for autism could not diagnose autism spectrum disorder . when first assessed in a genetics clinic at the age of 22 months , she had a history of recurrent otitis media . on physical examination , length was 82.2 cm ( 0.5 sds ) , weight 10.8 kg ( 1.0 sds ) , and head circumference 47.7 cm ( + 0.5 sds ) . follow up at the age of 7 years , she had a history of chronic constipation and chronic ear infections . on examination , her height was 121.8 cm ( 0.5 sds ) , her weight was 23 kg ( 0.2 sds ) , and her head circumference was 53.3 cm ( + 1.0 sds ) . family history is unremarkable , her younger sister is doing well without concern for any delays . snp array analysis detected a 107.5 kb duplication on xq28 and an 824.5 kb duplication on chromosome 2q23.1q23.2 . fish experiments with bac clone rp11 - 119a22 confirmed the duplication on the x chromosome . parental analyses showed that the phenotypically normal father carried the 2q23 duplication , the xq28 rearrangement is de novo . in summary , all females described in this study had mental retardation or learning difficulties ( table 1 ) . whereas the phenotypic effect of a mecp2 duplication is already well documented in males , it is a comparatively rare cause of mental retardation in females . in a recent paper , only two cases out of 1000 unselected patients with mental retardation were identified . though females with large xq28 duplications have been documented ( as the results of x - autosome translocations , summarized in ) , only after introduction of array techniques were females with small de novo duplications including mecp2 reported [ 2527 ] . in addition , two affected carrier females in x - linked families have been reported . our series is compared with published cases in table 1 , array data ( where available ) are summarized in fig . 4 , the minimal critical region in this series of females contains only the mecp2 gene , confirming its role in mental retardation in females . previously , it has been stated that females with a ( de novo ) mecp2 duplication lack the typical symptoms of affected boys , such as seizures , poor speech development , and recurrent severe infections ( , table 1 ) . several females in our series however , do have poor speech development and patient 1 has recurrent severe infections . furthermore , as patient 1 in our series only developed seizures after the age of 8 years , the younger patients with a de novo duplication may still be at risk of developing this feature . compared to the compiled data in affected males with a mecp2 duplication ( table 1 ) , the course of the disease in patient 1 is strikingly similar , with regression after the start of seizures . we conclude that the associated phenotype in females with a mecp2 duplication may be as severe as seen in affected males . in our series , several mechanisms were found that resulted in functional disomy for region xq28 : i.e. x - autosome translocation , duplication ( either familial or de novo ) on the x - chromosome combined with random x - inactivation , and insertion duplication into an autosome . in unbalanced x - autosome translocations , the translocated segments will escape x - inactivation and cause functional disomy for genes contained within the translocated segments . in our series , patients 2 and 3 carry an unbalanced x - autosome translocation , as does the case described by auber et al .. previously reported x - autosome translocations have been excluded from the comparison as duplicated regions were either very large ( 16 mb ) or undefined . patients in this group show various phenotypes , ranging from apparently mild mental retardation in patient 2 to a more severe clinical course in patient 3 , with regression , loss of attention and emerging dystonic and repetitive movements , to a clinical picture that is comparable with the male xq28 duplication syndrome in the patient described by auber et al . . as the concurrent imbalance in these x - autosome patients is most likely of minor significance ( see below ) , the phenotype is most likely determined by the xq duplication . in this small series , the size of the xq duplication appears to correlate with the severity of the clinical course . patient 4 is a mildly affected obligate carrier from an x - linked mental retardation ( xlmr ) family . previously reported families demonstrated asymptomatic carriers with extreme or complete skewing of x - chromosome inactivation . unlike previously reported carrier females however , patient 4 showed random x - inactivation . taking only her iq score into account , she is not mentally retarded , yet she has notable learning difficulties and a striking difference in iq compared to her mother . we hypothesize that this difference in performance is caused by the difference in xci in mother and daughter ( 88:12 versus 63:37 ) and that the clinical features in patient 4 are caused by random x - inactivation . she had non - specific developmental delay , without seizures , speech problems , or recurrent infections . describe a manifesting carrier with mild learning disability who had a mosaic x - inactivation pattern : in blood she showed complete skewing , however in hair roots xci was random ( 74:26 ) . it has been suggested that a 70% skewing or less will lead to manifestation of the disease in female carriers of a familial xq duplication . data on our patient support this hypothesis and indicate that the resulting phenotype is probably mild . on the other hand , in a recent study focused on clinical and neuropsychiatric phenotype of mecp2 duplication carriers , three out of nine female carriers of a familial mecp2 duplication had iqs in the low normal range . female carriers also had psychiatric symptoms , including anxiety , depression , and compulsion , despite 100% skewing of x - inactivation in blood . in comparison , the phenotype of patient 4 may fit into the clinical spectrum depicted in that paper , indicating that low normal iq and psychiatric symptoms may be part of the clinical spectrum in female carriers , regardless of their xci status . alternatively , as x - inactivation pattern has only been tested in blood , the females with low scores in ramocki 's series may in fact have mosaic xci , leading to tissue - specific dosage alterations , and probably to poor performance . a final conclusion awaits further studies . a separate group is formed by patients with a de novo intrachromosomal mecp2 duplication . it has been suggested previously that in these cases random xci may be causative for the phenotype . to date , two females with a de novo xq duplication of this type and random xci have been reported , revealing moderate mental retardation in childhood and development of neurological features in the second decade . analysis in blood however showed skewed x - inactivation , though not complete ( 84:16 ) . this may indicate that skewing needs to be complete to avoid a phenotypic effect of an xq duplication . the xci in patients 4 's mother does not support this presumption , as she is normal functioning despite incomplete skewing ( 88:12 ) . alternatively , the phenotypic effect in patient 5 may be caused by an unfavourable skewing pattern , leading to preferential inactivation of the normal x chromosome , or by a mosaic xci pattern , with random xci in other tissues . with regard to the mechanism of preferential x - inactivation , it has been suggested that co - duplication of neighbouring genes ( i.e. ard1a or hcfc1 ) may be responsible for complete skewing of x - inactivation in female carriers of an xq28 duplication . , the xci patterns in patient 4 and her mother do not support this hypothesis , as the same duplication , including the aforementioned genes , leads to either random xci or almost extreme skewing in members of the same family . reported a patient with an insertion duplication of a small segment of xq28 into an autosome , causing a short segment on the x - chromosome to escape x - inactivation . also the additional copy of mecp2 in patient 1 is inserted into an autosome and therefore constitutionally active . yet the clinical course of both patients is completely different : the patient described by makrythanasis et al . is mildly affected , whereas the course of the disease in patient 1 is comparable to that in males , with regression after the start of seizures . we have no explanation for this discordance , however a difference in expression level may be postulated . it has been demonstrated in males that a triplicated mecp2 gene resulted in the most severe phenotype . recently , a severely mentally retarded girl with a triplication including mecp2 was described , suggesting a phenotypic effect of copy number . also therefore , it may be speculated that the difference in phenotype between the two insertion / duplication cases is caused by different levels of expression , for instance because the translocated mecp2 gene in patient 1 has been coupled to a strong promotor , thus enhancing the mecp2 level . on the other hand , expression studies in males alternatively , under the influence of another promotor , transcription of the translocated mecp2 gene may have been silenced in the patient described by makrythanasis . as yet , the various mechanisms do not correspond to a distinct clinical phenotype , only familial duplications with random x - inactivation seem to result in a mild phenotype ( table 1 ) . in addition to the xq duplication , three patients in our series showed an imbalance of another chromosome region ( table 1 ) . in patient 1 , a de novo duplication of 3q on the site of the insertion of xq in the long arm of chromosome 3 was found . no phenotype has been demonstrated for a duplication of this gene , but clinical relevance can not be excluded . as a result of an unbalanced x - autosome translocation , patient 2 is also monosomic for distal 21q . the contribution of the deleted genes from this region to her phenotype is probably negligible , as larger distal 21q deletions have been described without phenotypic effect . in patient 5 , the additional duplication was inherited from her phenotypically normal father , therefore indicating a most probably rare polymorphism . gene content of additional cnvs in patient 1 , 2 and 5 is listed in suppl . interestingly , second de novo imbalances were also found in previously reported patients ( , see table 1 ) . in both cases , an association between the additional imbalance and the clinical phenotype was deemed unlikely . many authors have stressed the recurrent infections in males with xq duplications ( table 1 ) . our data do not support this hypothesis , as in patient 1 irak1 is not included in the duplicated fragment , yet she has a typical pattern of recurrent infections as seen in boys with a mecp2 duplication . as none of the other duplicated genes in the region are associated with recurrent infections , this clinical course suggests that this symptom can be attributed to duplication of the mecp2 gene . in summary , an xq duplication including mecp2 is described in five females with various grades of developmental delay . with our series of mecp2 duplication carriers we conclude that a duplication of mecp2 may be associated with a severe phenotype in both males and females . especially de novo duplications that escape x - inactivation the phenotype of intrachromosomal duplications of this region is more difficult to predict and may be mild . however , the highly variable clinical presentation makes genetic counselling in terms of prognosis difficult , especially in prenatal cases . it has been postulated that carriers of a familial mecp2 duplication may express a phenotype if x - inactivation is not completely skewed . further studies of more females with a mecp2 duplication are needed to gain better insight in the clinical variability and into the potential pathology associated with rearrangements in this area .

total knee arthroplasty ( tka ) is a surgery that improves patient mobility and quality of life , but causes severe postoperative pain during the first 2472 hours.1 adequate postoperative pain control promotes patient ambulation and physiotherapy,2 leading to early recovery , fewer complications ( ie , deep - vein thrombosis or nosocomial infection ) , and a shorter hospital stay.3 there are many methods for relieving postoperative pain in tka , including patient - controlled analgesia ( pca),4 patient - controlled epidural analgesia,4 spinal morphine,5 femoral nerve block,3 and continuous posterior lumbar plexus block.6 these methods , however , require personal skills and expensive equipment . the transdermal fentanyl patch ( tfp ) is a skin - patch opioid that steadily releases fentanyl into the bloodstream according to the dosage applied.7 the subsequent plasma level and clearance are similar to intravenous use.8 tfps are commonly used for chronic pain management.9,10 typically , a tfp has a slow onset ( plateauing in 15 hours ) , which makes it inappropriate for acute pain control.1113 if , however , it is applied 1214 hours before surgery , it may effectively relieve postoperative pain in tka . our hypothesis was that a tfp ( 50 g / hour ) applied 1012 hours before surgery would provide superior analgesia for 48 hours compared with placebo for postoperative pain control in tka . the primary outcome was a difference in cumulative morphine consumption at 48 hours after surgery . the current study was approved by the institutional review board of khon kaen university ( he521183 ) and registered at www.clinicaltrials.gov ( nct01348984 ) . written informed consent was obtained from all subjects . using minville et al14 as a guide , we determined that for an -value of 0.05 and a power ( 1- ) of 0.80 , the sample size needed to be 19 patients in each group . we included patients between 20 and 80 years of age , scheduled for elective tka under spinal anesthesia , having an american society of anesthesiologists ( asa ) physical status of i ii , and able to use a pca . we excluded patients who : 1 ) were pregnant or breastfeeding , 2 ) had a history of allergy to tfps or morphine , 3 ) had a contraindication for spinal anesthesia , 4 ) had major organ diseases , and 5 ) had a history of drug abuse . the patients , admitted 1 day prior to the surgery , were then allocated to two groups : group t received a single tfp ( duragesic 50 g / hour matrix fentanyl patch ; janssen pharmaceutica , beerse , belgium ) affixed to the anterior chest wall 1012 hours before surgery by the preoperative - visit resident ; and group p received a placebo patch in the same manner . pca was started after the nrs had fallen to 3 in response to intravenous morphine supplementation ( at 2 mg/5 minute intervals ) . the pca device was set at 1 mg of morphine with a 5-minute lockout and a 1-hour limit of 8 mg . every 4 hours until 48 hours , we recorded morphine consumption , blood pressure , respiratory rate , nrs score at rest and when moving , ambulation , sedation , and nausea / vomiting ( n / v ) score . ambulation scoring was 0= unable to sit up in bed , 1= able to sit up in bed , 2= able to sit on the edge of the bed with feet hanging down over the side , and 3= able to move from bed to a chair with assistance . sedation scoring was 0= fully alert , 1= mild sedation , easy to rouse , 2= moderate sedation , arousable with gentle shaking , and 3= deep sedation , not aroused by speaking or gentle shaking . n / v scores were 0= none , 1= mild , 2= moderate , and 3= severe . we noted all adverse effects and postoperative complications , such as itching and severe respiratory depression ( respiration rate 8 breaths / minute ) . statistical analyses were performed using spss 17.0 for windows ( spss , chicago , il , usa ) . continuous data are presented as mean ( standard deviation ) and categorical data as n ( % ) . to compare the differences between groups , student s t - test , test , or analysis of variance was used as applicable . the demographic data and anesthetic time for both groups were comparable ( table 1 ) . compared to the placebo , the tfp significantly reduced cumulative morphine consumption over 24 and 48 hours by 54.2% and 56.9% , respectively ( ie , 18.2 and 32.9 mg ; table 2 and figure 2 ) . the average nrs scores at rest and during joint movement over the 48 hours were significantly lower in group t ( figure 3 ) . in addition , ambulation scores over 48 hours were significantly higher in group t. sedation scores over 48 hours were not significantly different between the groups . n / v scores over 48 hours were significantly higher in group t ( table 2 ) . our study demonstrates that a tfp ( 50 g / hour ) applied 1012 hours before surgery can safely relieve postoperative pain from tka for 48 hours . over 24 and 48 importantly , nrs scores were lower both at rest and during movement , with comparable low sedation scores . although ambulation and n / v scores were statistically different , there was no clinical significance , as both scores were lower than 1 . the results of the present study are in accord with previous studies in which tfps provided dose - dependent analgesia after lower abdominal surgery.15 a tfp administering 75 g / hour is also used as a safe and effective analgesic after major shoulder surgery.16 other studies showed that tfps can safely reduce morphine consumption and pain scores for patients undergoing hemorrhoidectomy,17 major urological operations,18 abdominal surgery,19 and total hip arthroplasty.14 by contrast , some studies have reported that tfps did not significantly relieve postoperative pain.20,21 in the latter , the tfp was placed just before or within 2 hours of surgery . for tfps to be effective , its serum level must plateau ( ie , 15 hours after being affixed ) , which would be before the end of surgery.13 osipova et al studied the effect of tfps for prevention and treatment of postoperative pain syndrome in extensive thoracoabdominal oncological surgery , and concluded that tfps in the early postoperative period may prevent acute opioid tolerance and hyperalgesia , underscoring the benefit of their use in multimodal postoperative analgesia with nonsteroidal anti - inflammatory drugs ( nsaids).22 although we did not encounter any severe respiratory depression , this may have been due to the small sample size , as in other studies.1419 the adverse effects of tfps are dose - dependent , as with other narcotic administration . sedation scores do not increase , albeit reductions in the respiratory rate rise , with doses up to 75 g / hour.15,16,23 we concur with bulow et al that a tfp administering 100 g / hour would be too potent , because of the potential for life - threatening respiratory depression.24 for patient safety , we chose the lower dosage , ie , 50 g / hour , for our study . nevertheless , cole et al reported that variability of tfp metabolism and excretion in pain patients contributed to unpredictable adverse effects.25 in a review , nelson and schwaner concluded that close observation by well - trained personnel is needed , due to serious adverse effects from unintentional misuse or even in normal use.26 in cases of severe bradypnea , naloxone can be used to treat the symptoms promptly.27 since the duration of tfps is much longer than naloxone , one dose of naloxone may be insufficient , and a continuous infusion may be needed . the tfp has many advantages : it can easily adhere to the skin , obviating an intravenous line , so there is little risk of infection , it is easily procured and costs less than a pca pump , and it needs no programming , so no human error occurs.14 it may be a good alternative in acute pain management . despite our using safer tfp dosing ( 50 g / hour ) , the sample size of the study was limited , so we can not conclude that there is no danger of severe respiratory depression . as our inclusion criteria included an asa physical status of i ii and since these patients very often had an asa physical status of iii , we can not conclude whether the tfp is suitable for use in these patients . similarly , we can not conclude whether or not tfps would be effective for other major surgeries either . despite our using safer tfp dosing ( 50 g / hour ) , the sample size of the study was limited , so we can not conclude that there is no danger of severe respiratory depression . as our inclusion criteria included an asa physical status of i ii and since these patients very often had an asa physical status of iii , we can not conclude whether the tfp is suitable for use in these patients . similarly , we can not conclude whether or not tfps would be effective for other major surgeries either . a tfp ( 50 g / hour ) applied 1012 hours before surgery can be used as a postoperative analgesic for tka , and can reduce morphine consumption over 48 hours by more than 55% without serious complications . the patients were more comfortable , and this was evidenced by lower pain scores both at rest and during movement . tfps , we propose , may be effectively used in multimodal mode , in conjunction with other moderate analgesics ( eg , nsaids ) in accordance with the world health organization pain ladder.28 severe bradypnea may however occur as a result of any route of narcotic administration , so close monitoring by well - trained personnel having naloxone close at hand in the event of severe respiratory depression is recommended .

pancreatic tuberculosis ( tb ) is a rare condition affecting those from endemic areas as well as those with immunocompromise.1 within the past decade , there has been an increase in the number of cases reported within the united states.2345 we report a case of pancreatic tb in a young female that initially presented as a pancreatic mass lesion . a 41-year - old thai female presented to her primary physician with a history of right upper quadrant pain . while the pain had been present for several years , it had worsened considerably over the past year , prompting her to seek medical attention . the patient denied weight loss , but did complain of low - grade fevers and chills . the patient was born in thailand and had migrated to the united states 6 years ago . on physical examination , there were no significant findings on examination of his lungs , heart , or abdomen . her laboratory studies results were as follows : white blood cell count 7.4/mm3 ( reference range : 3.8 - 10.8/mm3 ) , hemoglobin 11.8 g / dl ( reference range : 13.2 - 17.1 g / dl ) . her sedimentation rate was elevated at 45 mm / h ( reference range : 0 - 20 mm / h ) . other studies including serum chemistries , liver function tests , and blood cultures were non - revealing . gastrointestinal tumor markers carbohydrate antigen 19 - 9 ( ca19 - 9 ) and carcinoembryonic antigen ( cea ) were both within normal limits . multi - loculated solid lesion in the head of the pancreas concerning for a primary malignancy along with several enlarged lymph nodes in the peripancreatic region . an endoscopic ultrasound ( eus ) was performed which revealed a 4.3 cm 2.5 cm hypoechoic , homogenous mass lesion with a cystic component within the pancreatic head ( fig . an oval , 1.1 cm 1.2 cm heterogeneous lymph node adjacent to mass was seen ( fig . eus- guided fine needle aspiration ( eus - fna ) of the lesion was performed with 25-g needle . subsequently , the afb culture was found to be positive for mycobacterium tuberculosis complex from the pancreatic mass cell block and found to susceptible to ethambutol , isoniazid , pyrazinamide and rifampin . she was treated with these 4 drugs for 2 months followed then rifampin and isoniazid for a further 7 months . at the end of therapy , her abdominal pain and fever had resolved and she maintained a normal appetite and weight . endoscopic ultrasound visualization of an enlarged peri- pancreatic lymph node adjacent to the pancreatic mass . even in countries where tb is endemic , pancreatic tb is rare . of the 300 cases of abdominal tb reported by bhansali et al , the pancreas may have intrinsic qualities that protect itself from mycobacterium tuberculosis , specifically the presence of pancreatic enzymes that may interfere with the colonization of the bacteria.6 however , in cases of pancreatic tb , the two possible routes for tb to reach the pancreas include hematogenous spread in military tb or direct spread from contiguous lymph nodes.7 it is important to note that tb of the pancreas is most likely to develop in immunocompromised individuals or individuals who are from or travel to endemic areas . pancreatic tb may present as a pancreatic abscess , pancreatitis or a cystic or solid pancreatic mass . despite the rarity of this condition , one must consider it in the differential diagnosis of a solid pancreatic lesion since it can mimic pancreatic cancer . literature as early as 1944 showed this association as auerbach found 14 cases of generalized miliary tb with pancreatic involvement that mimicked neoplasia.8 in more recent times , franco - paredes and colleagues reviewed literature between 1980 and 2002 and found 50 cases of pancreatic tb , of which 13 were masses thought to resemble a carcinoma.6 these statistics alone highlight that despite the rarity of pancreatic tb it can frequently resemble carcinoma and therefore warrants thorough evaluation . concluded that the three most common symptoms were abdominal pain , jaundice and weight loss,3 three symptoms which are also commonly found in patients with pancreatic carcinoma . in the initial stages of a workup , many imaging modalities can be employed ranging from ct scans to magnetic resonance imaging ( mri ) . however , even with all of the different modalities of imaging currently available , pancreatic tb does not have any pathognomonic features on imaging and therefore only a tissue sample can give a definitive diagnosis . in recent years , the use of eus - fna has become an essential tool in the evaluation of a pancreatic lesion.3 ahlawat and his colleagues were the first to report using eus - fna in diagnosing pancreatic or peripancreatic tb . since then , the utility of using eus - fna in diagnosing pancreatic tb has been further established.459101112 however , the overall accuracy remains difficult to determine due to the rarity of this condition . , reports that pancreatic tb was diagnosed in 76.2% of their patients using eus - fna.13 ueda et al . have suggested that combining eus - fna with contrast ultrasonography may help identify what area should be biopsied and therefore increase diagnostic yield.11 as illustrated in our case , the analysis of the fna sample shows cytology consistent for granulomatous inflammation and a negative acid - fast bacilli stain . due to the limited utility of an acid fast bacilli stain in this scenario , it is imperative that clinicians culture the fna sample for mycobacterium tuberculosis . this reinforces that practice that bacterial culture remains the most specific test for diagnosing pancreatic tb.14 once a diagnosis is made , the patient can be started on antituberculin therapy ; resolution of symptoms as well as of the pancreatic lesion should be seen after a full course of treatment . pancreatic tb should be suspected in patients with solid pancreatic lesions , especially if the patient is young , immunocompromised , or from an endemic area . when the diagnosis is suspected , appropriate screening for tb and eus - fna of the pancreatic lesion can lead to diagnostic confirmation of the disease and thus avoid unnecessary explorative laparotomy or pancreatic resection .

the recent boom in genome - wide association ( gwa ) studies has resulted in a vast expansion of our knowledge of common variants influencing human diseases . so far , 1,888 single nucleotide polymorphism ( snp ) associations have been reported , 1,435 of which are unique to the snp . they account for only 36 publications , reporting 63 unique snps , out of a total of 812 publications and 3,942 unique snps . if we exclude the apoe locus and the hla region of chromosome 6p21 ( which are associated with multiple diseases ) , the number of unique significant neurological loci found drops to 42 . a probable explanation for the underrepresentation is the cost and difficulty of obtaining large sample sets ; for anthropomorphic traits such as height and readily quantifiable measures such as blood lipids , sample sizes of up to 100,000 have been analyzed in widely successful gwa studies . a further complication in neurological diseases is the complexity of phenotyping brain phenotypes ( description - based only , as in migraine ) , and the myriad diagnostic divisions ( as in epilepsy ) , which together make collecting sufficiently large samples of any given subtype a hard task . estimates from several diseases suggest that sample sizes exceeding 10,000 are required to reach sufficient statistical power to detect new loci . the recent publication of the large - scale gwa study by the international headache genetics consortium in nature genetics was the first gwa study reported for a headache disorder . as the primary finding , it reported the first genome - wide significant association in the group of paroxysmal neurological diseases , which comprises epilepsy , migraine , episodic ataxia and various cerebrovascular and sleep disorders . in this study , a total of 5,933 cases and 50,809 controls were used to establish a single significant locus . the discovery sample consisted of 2,731 migraine cases collected from four european headache centers located in three countries . the initial finding was replicated in 3,202 cases and 40,062 independent controls from four european countries . using rna expression data from lymphoblastoid cell lines , the identified variant rs1835740 was found to be an expression quantitative locus ( eqtl ) affecting glutamate metabolism . as glutamate is a major excitatory neurotransmitter in the central nervous system ( cns ) the eqtl data suggest that the predisposing allele of rs1835740 stimulates the expression of metadherin ( mtdh , also called astrocyte elevated gene-1 , aeg-1 ) , which downregulates excitatory amino - acid transporter 2 ( eaat2 , also called glutamate transporter 1 , glt-1 ) , the main glutamate transporter in the brain . this finding stimulates the hypothesis that accumulation of glutamate , a potent neurotransmitter , in the synaptic cleft might contribute to the occurrence of the migraine attack . a problem in uncovering the genetic component of migraine has been the dearth of unambiguous results . after the early encouraging findings of the mutations causing the rare mendelian forms of migraine ( familial hemiplegic migraine , fhm ) and the loci identified in the first linkage scan for common migraine the genes identified in fhm , similar to the corresponding findings for epilepsy , pinpointed ion channel defects , grouping these diseases into channelopathies . however , neither targeted ion channel association studies nor the first gwa studies have provided evidence of the involvement of common variants in ion channel genes in common forms of migraine or epilepsy . candidate gene studies covering obvious targets ( the ion channels and the estrogen system ) and up to 1,000 migraine cases and controls turned up conflicting results at best . although a number of loci using family - based linkage studies were identified , no genes for the common forms were found . thus , the genetic and functional link between fhm and common forms of migraine remained unclear . interestingly , the gwa association and the eqtl data point to the same synaptic transmission mechanism ( the imbalance in glutamate release and its clearance from the synaptic cleft ) that has been shown to be a key component of fhm pathogenesis in migraine with aura ( figure 1 ) , although through a more peripheral part of the pathway in the latter . although this provides a potential link between fhm and common migraine pathophysiology , it should be noted that because of the ascertainment of the gwa study cases from tertiary headache clinics , it is not possible to estimate the effect of the identified variant on a population level from the current data . what we can conclude is that among patients whose migraine is severe enough to need tertiary care , this variant is significantly overrepresented . furthermore , mutations in the gene encoding the eaat1 transporter also result in an episodic disease phenotype . the diversity of pathways resulting in similar synaptic events might reflect one of the challenges we might encounter in dissecting the genetic predisposition of paroxysmal cns disorders . localization and effect of a variant identified in the recent genome - wide association study of migraine in synaptic transmission , together with the previously known mutations in familial hemiplegic migraine ( fhm : genes are fhm1 , cacna1a ; fhm2 , atp1a2 ; fhm3 , scn1a ) . the asterisk indicates the excitatory amino acid transporter 2 ( eaat2/glt-1 ) recently linked to migraine . glu , glutamate ; fhm1 - 3 , products of genes reported for familial hemiplegic migraine ; mglur , metabolic glutamate receptor . the obvious next steps for gwa studies are to address different migraine subtypes ( such as migraine without aura ) and from different recruitment settings ( such as population - based , instead of clinic based migraine cases ) . as mentioned above , many neurological diseases lack such easily quantifiable phenotypes as serum lipid or blood sugar levels that are available elsewhere . the lack of quantitative phenotypes is also reflected in dissecting the umbrella diagnosis into subphenotypes , as they may similarly be based on non - objective measures . thus , there is a chance that clinical subtypes might be of limited help and traditional diagnostic boundaries might not correlate with identified susceptibility genes . although data are limited , there is emerging evidence that susceptibility loci can cross diagnostic boundaries and be associated with multiple traits , such as schizophrenia and bipolar disorder . there is evidence that the same locus or even same variant can contribute to the susceptibility of different disease outcomes . a case in point is that in another major paroxysmal cns disorder , epilepsy , there is a long tradition of rigorous clinical subgrouping . if secondary factors contribute to the precise form of the disease , such strong divisions might distort from the ultimate goal of identification of the biological basis of seizure susceptibility , as was discussed in a recent editorial . in the case of migraine , the classification recognizes that most patients suffer from various different forms of attacks , such as a combination of migraine attacks with and without aura . a migraine patient may , over the course of decades , pass through different types of migraine . diagnostic flexibility accounts better for the varying severity spectrum both between patients and along a timeline . although this flexibility does not abolish the phenotyping challenges , it is likely to be helpful in large gwa meta - analyses . when subsequent migraine association studies have identified more loci and we start to tackle their interplay in disease susceptibility , this might provide us with new tools for disease classification . it should perhaps not be surprising that a highly adaptable system such as the brain , with its myriad , cross - compensating pathways , can react with a very limited set of overt phenotypes , such as headache , to a variety of biological challenges . therefore , summing over all possible symptom backgrounds in a large - scale gwa study is likely to result in only small odds ratios and thus sample sizes exceeding 10,000 may well be necessary . these large samples should also allow secondary analyses addressing questions related to disease subclassification and co - morbidity . the first genetic link to common forms of migraine was recently reported , pointing the way towards alterations in glutamate homeostasis . upcoming larger migraine gwa studies , across different ascertainment schemes , are likely to identify more genes and cellular pathways contributing to migraine susceptibility and will hopefully also shed light on the potentially different genetic background of different migraine subtypes . the emerging wealth of gwa data from other neurological and neuropsychiatric traits will also provide an opportunity to study whether some loci or pathways contribute to the susceptibility of co - morbid traits and whether genetic data will cross traditional diagnostic boundaries . however , it is evident that not all of genetic predisposition is explained by common variants , and future exome and whole - genome sequencing studies in large datasets will probably identify contributing highly penetrant low - frequency variants and expand our knowledge of the migraine susceptibility landscape .

microorganisms are responsible for development of many diseases , which directly or indirectly affect reproductive performance in various animal species . knowledge of the microflora of animal skin and mucous membranes is essential for better understanding of pathological processes . , in cows , these include candida albicans ( 39.1 % ) , geotrichum ( 8.7 % ) , cr . neoformans ( 4.3 % ) , and other yeasts ( 13 % ) . in horses , pathogenic fungi are candida albicans , candida parapsilosis , candida lusitaniae , candida rugosa , cr . neoformans , hansenula anomala , hansenula polymorpha , rhodotorula minuta , rhodotorula rubra , and torulopsis candida , and in dogs , according to cleff et al . , c. parapsilosis ( 21.7 % ) , candida guilliermondi ( 8.4 % ) , candida kefyr ( 6 % ) , and candida albicans ( 4.8 % ) . previously , not much attention was paid to fungal infections of the reproductive tract in animals . however , extensive antibioticsand hormonal therapies have resulted in rising incidence of fungal infections in humans . . demonstrated that various fungi , including aspergillus , penicillium , acremonium , cladosporium , mortierella , aureobasidium pullulans , zygomycetes , and candida , might cause infections of the reproductive organs in cows and buffalos . vaginal , uterine , and cervical inflammations caused by fungal infections have also been reported from horses [ 6 , 7 ] , cat , and dogs . the microflora present in the breeding environment of various groups of healthy horses was described by raski et al . . the 13 species ( 8 of which belonged to the genus candida ) comprised only yeast - like opportunistic microorganisms that are regarded as invasive species by other authors , for example , c. albicans , candida glabrata , candida tropicalis , candida krusei , c. guilliermondi , c. rugosa , and trichomonascus ciferrii . given the potential causative role of yeast - like fungi in endogenous infections , identification of fungal flora occurring on the skin and mucous membranes of english full blood horses will contribute to elucidation of the role of these microorganisms in various types of infections , including asymptomatic infections of reproductive organs . furthermore , this investigation will be helpful in determination of the species composition of the physiological yeast - like microflora occurring on the skin and mucous membranes in english full blood horses . the aim of the study was a quantitative and qualitative analysis of microflora , presentation of current data about prevalence of the microflora on the skin and mucous membranes , and determination of its possible effect on reproduction of english full blood horses bred in poland . the investigations were carried out on material sampled from 55 english full blood mares aged between 4 and 12 . all the horses were kept in separate boxes , in two brick , metal - roofed stables in one of the equestrian centres in poland . the mares were classified into three groups , where group i comprised 12 high - quality mares kept in the boxes together with their offspring in stable b. group ii consisted of mares that had not conceived after mating . these were 24 mares , which had previously had healthy foals , but during the last 2 seasons failed to conceive ; they were kept in separate boxes in stable a. group iii was composed of 19 barren mares that had not foaled within three or more years and were excluded from reproduction ( stable b ) . mares that had foaled at an approximate time were randomly chosen for analyses from a bigger group of mares in the stud . the mean values of temperature and relative humidity were , respectively , 23 c and 54 % outside , and 21 c and 76 % inside the boxes . smears from nostrils , mouth , ear , back , groin , vagina , and collateral groove were taken from each mare . all the samples were inoculated on the sabouraud medium ; next , macroscopically homogenous colonies were obtained in selective cultures , which , after growing , were assayed with the api 20c aux ( biomrieux ) biochemical tests . all the horses kept in the stables were fed in accordance with the current horse feeding standards ( horse feeding standards . collaborative work , institute of physiology and animal nutrition , polish academy of sciences , jabonna 1997 ) providing mineral - vitamin supplements . none of them received any treatment before ( at least 1 month earlier ) or after the study ( within minimum 1 month ) . the greatest abundance of yeast fungi was found in the smear samples from mouths , nostrils , and collateral grooves ( 78.8 , 64.4 , and 68.0 % , respectively ) in all the mares . the samples collected from the vaginal mucous membrane and groin skin contained the smallest number of the microorganisms ( 14.4 and 18.9 % , respectively ) . representatives of six microbial species , including five species of the genus candida , were detected on the skin and mucous membranes of the experimental mares ( table 1 ) . growth of yeasts was detected in over a half of the samples taken from mares that had foaled and in ca . 46 % of the samples collected from mares that had not conceived during previous oestrus and mares that had been barren for minimum 3 seasons . the smallest number of species was identified on the skin and mucous membranes of mares that had foaled . there were five species isolated in the samples from each of the other two mare groups ( table 1 ) . two species , that is c. albicans , isolated from the mares that had not conceived during the previous oestrus , and c. lusitaniae , isolated from the same group and mares that had been barren for minimum 3 seasons were not detected in the mares that had foaled . none of the 182 isolated yeast strains exhibited the ability to form biofilm.table 1frequency of yeast species isolated from the skin and mucous membranes of english full blood mares in relation to the reproduction performanceisolated strainsgroup i no . ciferrii1 ( 1.2)6 ( 3.6)1 ( 0.8)no - growth samples40 ( 47.6)91 ( 54.2)72 ( 54.1)number of samples84 ( 100.0)168 ( 100.0)133 ( 100.0 ) frequency of yeast species isolated from the skin and mucous membranes of english full blood mares in relation to the reproduction performance growth of yeasts was detected in more than 52 % of the samples collected from the mares that had foaled ( table 2 ) . yeast - like flora was isolated from the vagina and groin in the smallest number of the mares . c. tropicalis was found in the vagina of one mare only . various microbial species were detected on the mouth and nostril mucosa in 92 and 75 % of the mares , respectively ( table 2 ) . the most common yeast in mares that had foaled was c. guiliermondii , which was not found on the vaginal mucosa only.table 2frequency of yeast species isolated from the skin or mucous membranes of english full blood mares that had foaled ( group i)isolated strainsnostrilsmouthearbackgroinvaginacollateral groovec . guiliermondii4 ( 33.3)6 ( 50.0)2 ( 16.7)4 ( 33.3)3 ( 25.0)0 ( 0.0)6 ( 50.0)c . sp.2 ( 16.7)2 ( 16.7)0 ( 0.0)1 ( 8.3)0 ( 0.0)0 ( 0.0)1 ( 8.3)c . tropicalis2 ( 16.7)3 ( 25.0)3 ( 25.0)2 ( 16.7)0 ( 0.0)1 ( 8.3)1 ( 8.3)t . ciferrii1 ( 8.3)0 ( 0.0)0 ( 0.0)0 ( 0.0)0 ( 0.0)0 ( 0.0)0 ( 0.0)no growth3 ( 25.0)1 ( 8.3)7 ( 58.3)5 ( 41.6)9 ( 75.0)11 ( 91.7)4 ( 33.3)no . ( frequency)applies to tables 2 , 3 , 4 frequency of yeast species isolated from the skin or mucous membranes of english full blood mares that had foaled ( group i ) no . ( frequency)applies to tables 2 , 3 , 4 among the seven sample collection sites in the mares with conception disorders , the biggest numbers of yeasts were isolated from the smears taken from the back skin and nostril mucosa ( in 71 and 67 % , respectively ) . the number of isolates obtained from other sites was smaller ; they were detected in 2164 % of the samples . the smallest number of strains was isolated from the groin ( 12.6 % ) and vaginal ( 21 % ) material . in group ii , c. guiliermondii was most prevalent and constituted over 75 % of all microorganisms identified in the mares with conception failure . yeast growth was detected in 46 % of the samples taken from the barren mares ( table 4 ) . the highest growth was found in the mouth and collateral groove ( 89 and 79 % , respectively ) . yeast growth on the vaginal mucosa was noted only in 11 % of the samples . the species identified in those sites were c. guiliermondii and c. tropicalis , which were the most prevalent yeasts in the group of the barren mares and constituted 52 and 26 % , respectively , of all the isolated yeasts ( table 4 ) . available literature does not provide information about prevalence and composition of yeast - like microflora on the skin and mucous membranes of english full blood horses . such data may confirm or exclude the relationship between the yeast colonizing the horse s organism and reproductive failure . in order to determine the above - mentioned correlations , knowledge of quantitative and qualitative characteristics of the normal microflora occurring on the horse skin and mucous membranes is indispensable . the greatest abundance of various yeast strains indentified in the mouth , nostrils , and collateral groove in the horses ( tables 2 , 3 , 4 ) may indicate widespread prevalence of microflora in the breeding environment . analyses of the microflora in the living environment of several groups of healthy horses were performed and its prevalence described by raski et al . . the authors identified 13 species of various yeasts in the breeding environment of five horse groups , including four species present in the environment of english full blood horses ( c. guiliermondii , c. tropicalis , c. sp . , and t. ciferrii ) . interestingly , the microbial presence in the test material was not accompanied by any deleterious health effects in the animals . the representatives of the fungal microflora were natural components of the environmental flora .table 3frequency of yeast species isolated from the skin or mucous membranes of english full blood mares with reproductive conception disorders ( group ii)isolated strainsnostrilsmouthearbackgroinvaginacollateral groovec . albicans0 ( 0.0)2 ( 8.4)0 ( 0.0)0 ( 0.0)0 ( 0.0)0 ( 0.0)0 ( 0.0)c . guiliermondii13 ( 54.1)12 ( 50.0)3 ( 12.5)13 ( 54.1)2 ( 8.4)4 ( 16.8)11 ( 45.9)c . lusitaniae0 ( 0.0)0 ( 0.0)2 ( 8.4)2 ( 8.4)0 ( 0.0)0 ( 0.0)0 ( 0.0)c . sp.0 ( 0.0)1 ( 4.2)1 ( 4.2)0 ( 0.0)1 ( 4.2)1 ( 4.2)3 ( 12.5)t . ciferrii3 ( 12.5)0 ( 0.0)1 ( 4.2)2 ( 8.4)0 ( 0.0)0 ( 0.0)0 ( 0.0)no growth8 ( 33.4)9 ( 37.4)17 ( 70.7)7 ( 29.1)21 ( 87.4)19 ( 79.0)10 ( 41.5)table 4frequency of yeast species isolated from the skin or mucous membranes of english full blood barren mares ( group iii)isolated strainsnostrilsmouthearbackgroinvaginacollateral groovec . guiliermondii9 ( 47.4)7 ( 36.8)1 ( 5.3)3 ( 15.9)2 ( 10.6)1 ( 5.3)9 ( 47.4)c . lusitaniae0 ( 0.0)3 ( 15.9)2 ( 10.6)2 ( 10.6)1 ( 5.3)0 ( 0.0)0 ( 0.0)c . sp.0 ( 0.0)1 ( 5.3)0 ( 0.0)1 ( 5.3)1 ( 5.3)0 ( 0.0)1 ( 5.3)c . tropicalis1 ( 5.3)5 ( 26.3)3 ( 15.9)1 ( 5.3)0 ( 0.0)1 ( 5.3)5 ( 26.3)t . ciferrii0 ( 0.0)1 ( 5.3)0 ( 0.0)0 ( 0.0)0 ( 0.0)0 ( 0.0)0 ( 0.0)no growth9 ( 47.4)2 ( 10.6)13 ( 68.4)12 ( 63.1)15 ( 78.9)17 ( 89.4)4 ( 21.2 ) frequency of yeast species isolated from the skin or mucous membranes of english full blood mares with reproductive conception disorders ( group ii ) frequency of yeast species isolated from the skin or mucous membranes of english full blood barren mares ( group iii ) it is noteworthy that the yeast growth in the samples collected from the vagina was low in all the horse groups ( from 8 to 21 % of all the samples analysed ) . yet , it was twofold higher in mares with reproductive failure than in the foaling and barren mares . this may lead to a conclusion that a correlation between the presence of yeasts in the vagina and reproduction performance can not be ruled out ; 80 % of the microflora isolated from the vaginal mucosa of the mares with conception failure were c. guiliermondii , which was the most common yeast in the mares from all the groups ( table 1 ) . pfaller and diekema found 35 % serious invasive candida - associated fungal infections to be caused by several different species , for example c. guilliermondii or c. lusitaniae . it was described as a causative agent of cervical , uterine , and vaginal infections in mares . the results obtained in this investigation and data provided by the literature cited imply a possible relation between c. guilliermondii occurrence and reproductive failure in english full blood mares . the microflora in hucul horses demonstrated existence of various strains within the c. rugosa species . it should be mentioned that genetic differences may exist also within the c. guilliermondii species , depending on its occurrence site . , we proved that 79 % of mares with reproductive conception disorders show no growth of yeast species from vaginal samples ( tab . 3 ) . however , from 16,8 % of mares from this group , there was isolated c. guiliermondii . it can be assumed that only c. guiliermondii may be indirectly associated with reproductive failure . c. tropicalis may be regarded as opportunistic microflora in mares , which is corroborated by its presence in the vaginas of mares that have foaled ( tables 1 , 2 ) . in contrast , this species has been detected in patients with haematological malignancies . in mares , two species , which were not detected in mares that had foaled , are of special interest : c. albicans isolated from non - conceiving mares and c. lusitaniae from non - conceiving and barren animals ( tables 3 , 4 ) . since these species did not occur on the vaginal mucosa in mares with conception failure and barren mares , the species can not be directly regarded as causative agents of reproductive failure . their occurrence may seem peculiar , as the experimental horses did not exhibit any disease symptoms . diseases caused by both yeast and mould fungi are often reported to be pathogenic to humans and various animal species [ 5 , 6 , 10 , 12 ] . blue found that fungal inflammation of the reproductive tract in mares was caused by aspergillus fumigatus and c. albicans infections . besides c. rugosa and c. krusei , c. albicans is one of the most frequently isolated yeasts causing mycotic mastitis in cattle . reilly and palmer described foals with birth hypoxia ( renal failure and necrotizing enterocolitis ) and septicaemia during the first 2 days of life . they were diagnosed with systemic candidiasis after c. albicans had been isolated from one or several internal sites . the fungi that were most frequently isolated included aspergillus , candida , and fusarium spp . candida albicans has been reported to be the most prevalent agent of candidiasis in humans . yeast species from the genus candida ( c. albicans , c. parapsilosis , c. glabrata , and c. tropicalis ) are regarded as the predominant etiological disease factors worldwide . similarly , pfaller and diekema reported that severe invasive candida - associated fungal infections in humans were caused by several species , for example c. albicans , c. tropicalis c. guilliermondii , and c. lusitaniae . all these species were isolated from the skin and mucous membranes of the english full blood horses , which showed no signs of disease ( tables 2 , 3 , 4 ) . it was reported to be the causative agent of human invasive external and internal mycosis . the occurrence of t. ciferrii on the skin and mucous membranes of all the mares in our study ( tables 1 , 2 , 3 , 4 ) was not accompanied by any discernible health effects . it should be stressed that t. ciferrii was not isolated from the vaginal mucosa in any of the horse groups examined . this may indicate that t. ciferrii occurring on the skin and mucous membranes of the english full blood horses is an opportunistic rather than invasive fungus . however , none of the strains isolated and described in this paper exhibited such properties . the presence of the yeasts that are commonly regarded as pathogenic in mares ( c. albicans , c. lusitaniae , c. tropicalis ) is baffling ; therefore , further investigations should be undertaken to elucidate the reasons for the absence of clinical symptoms normally caused by the microflora in english full blood horses . the results obtained suggest that a majority of the yeasts isolated may be components of normal microflora in horse organisms . even as commensals , yeasts occurring in horses are extremely important from an epidemiological point of view . they can undergo transformation from opportunistic to virulent organisms , due to the effect of a number of environmental factors that have direct or indirect immunosuppressive action , for example viral infection or antibiotic therapy . representatives of five microflora species of the genus candida and t. ciferrii were isolated from the skin and mucous membranes of the english full blood mares . three species ( c. guiliermondii , c. sp . and t. ciferrii ) were present in all the groups of mares , irrespective of their reproduction performance . c. albicans and c. lusitaniae did not occur in the mares that had foaled . however , since the yeasts were absent from the vaginal mucosa of the mares with conception failure and barren mares , they should not be associated with reproductive disorders . the growth of the yeasts isolated from mares vaginas , compared to that of all the isolated species , was insignificant in all the groups of horses under study and ranged from 8 to 21 % . in mares that exhibited conception failure , it was almost threefold higher ( 21 % ) than in the high - quality mares ( 8 % ) . c. tropicalis may be regarded as opportunistic flora in mares , as it was isolated from the vaginal mucosa of the mares that had foaled . t. ciferrii occurring on the skin and mucous membranes of the english full blood horses is an opportunistic rather than invasive fungus . the results obtained suggest that the yeasts isolated may constitute the normal microflora in horses organisms , although their contribution to reproductive disorders can not be excluded clearly .

azoxymethane ( aom ) and its metabolic precursor , 1 , 2-dimethylhydrazine ( dmh ) , are commonly used carcinogens to study the molecular mechanisms of colon carcinogenesis in rodents . they are preferred model carcinogens because they induce tumors preferentially in the distal colon of rodents and because the tumors have pathological features known to be associated with human sporadic colorectal cancer . dmh and aom are procarcinogens , which require metabolic activation by cytochrome p450 ( p450 ) enzymes , primarily cyp2e1 . dmh undergoes n - oxidation to form aom , which , upon hydroxylation , yields methylazoxymethanol ( mam ) . mam is unstable , with a half - life of 12 h. it subsequently decomposes to yield formaldehyde and a highly reactive methyldiazonium ion , which alkylates the dna bases , resulting in the formation of dna adducts , including o - methylguanine ( o - mg ) and n - methylguanine ( n - mg ) . persistence of o - mg can lead to mutation in oncogenes and initiation of tumorigenesis . previous in vitro studies have demonstrated that colon epithelial cells are capable of metabolizing dmh into carcinogenic metabolites , without the need for prior metabolism by other tissues or colonic bacteria . however , the prevailing hypothesis is that the liver plays a critical role in dmh / aom bioactivation in vivo and that the reactive intermediates produced by the liver are transported to the colon via the blood or bile to induce carcinogenicity . this is a plausible hypothesis , given that the colon generally possesses much lower levels of p450 enzymes , relative to the liver . nonetheless , the relative contributions of the liver and the intestine to dmh / aom - induced dna damage in the colon have not been directly determined , and the bioactivation in the target organ may also explain the organ - specific induction of tumors in the distal colon by aom . in the present study , we determined the respective roles of hepatic and intestinal p450 enzymes in aom metabolic activation in vitro and in vivo by studying the liver - specific cpr - null ( lcn ) mouse and the intestinal epithelium - specific cpr - null ( iecn ) mouse . the cytochrome p450 reductase ( cpr or por ) is required for the monooxygenase activity of all microsomal p450 enzymes . the lcn and iecn mouse models have been found valuable for differentiating between hepatic and extrahepatic or between intestinal and extra - gut p450 contributions to xenobiotic metabolism or toxicity . we chose to study aom instead of its precursor dmh , owing to aom s higher potency and greater stability in dosing solutions . we compared tissue levels of o - mg and n - mg adducts in the liver , small intestine ( si ) , and colon among wild - type ( wt ) , lcn , and iecn mice that were treated with aom according to an established protocol for the induction of colon dna damage . we further compared microsomal aom metabolic activities in the various tissues among the three strains of mice . finally , we assessed aom - induced colonic aberrant cryptic foci ( acf ) formation , which represents the precursor lesions of colon cancers . our findings indicate that knockout of liver cpr or ie cpr alone was not sufficient to block or reduce colonic dna adduction and acf formation by aom and that p450 enzymes in both the liver and intestine likely contribute to aom - induced o - mg formation and the eventual colon carcinogenesis in wt mice . aom , o - mg , and formaldehyde were purchased from sigma - aldrich ( st . louis , mo ) . n - mg was obtained from santa cruz biotechnology ( dallas , tx ) . the sources of o - methyl - deoxyguanosine ( o - m - dg ) and o - trideuteriomethyl - deoxyguanosine ( o - cd3-dg ) were the same as described previously . all solvents ( acetonitrile , methanol , and water ) were of high - performance liquid chromatography ( hplc ) grade ( thermofisher scientific , waltham , ma ) . all studies with mice were approved by the wadsworth center institutional animal care and use committee . wt b6 , vil - cre / cpr ( ie - cpr - null or iecn ) mice ( on b6 background ) , and alb - cre / cpr ( liver - cpr - null or lcn ) mice ( on b6 background ) were obtained from breeding stocks maintained at the wadsworth center ( albany , ny ) and used for cpr expression , aom metabolism , and dna adduct formation studies . wt , iecn , and lcn mice used for studying aom - induced colonic acf formation were on the susceptible a / j background . iecn - a / j and lcn - a / j mice were generated by backcrossing iecn - b6 and lcn - b6 to a congenic ( a / j - n11 ) strain of cpr mice for 35 generations ; the cpr - a / j mice were produced by backcrossing the original cpr - b6 to wt a / j mice ( jackson laboratory , bar harbor , me ) . wt - a / j mice used for experiments were produced from breeding pairs maintained at the wadsworth center . all animals were 2- to 3-month old at the beginning of each study described below . mice were genotyped using tail dna for the cre transgene and the cpr allele , as described previously . the colon from male wt and iecn mice were obtained and cut into two equal halves , representing proximal and distal sections , and prepared as swiss rolls for embedding and sectioning . immunohistochemical analysis of cpr expression in paraffin sections of the colon was conducted as described previously for si . si mucosa from two mice or colonic mucosa from four mice were pooled for each microsomal sample , prepared as reported previously . liver microsomes were prepared from individual mice as described but with use of protease inhibitors . microsomal protein concentrations were determined using the bicinchoninic acid protein assay kit ( pierce chemical , rockford , il ) with bovine serum albumin as standard . for the determination of tissue levels of o - mg and n - mg , male wt , iecn , and lcn mice were treated with a single injection of aom ( at 14 mg / kg , s.c . ) in saline . the liver , si ( duodenum , jejunum and ileum ) , and colon ( proximal , distal ) were obtained 6 h after aom treatment . the si and colon segments were slit open and rinsed with ice - cold saline before being stored at 80 c until use . for dna isolation , the middle lobe of the liver , the entire segments of duodenum , jejunum , ileum , proximal colon , and distal colon were homogenized in 4 ml of genomic dna buffer ( 10 mm tris - hcl , 100 mm nacl , 2.5 mm edta , and 0.5% sds ) . the homogenate corresponding to 100 mg of tissue was incubated with proteinase k ( 250 g ) at 55 c for 2 h. dna was extracted with phenol / chloroform / isoamyl alcohol ( 25:24:1 ) ( invitrogen ) , and precipitated with ethanol . the resuspended dna was incubated with rnase a ( 100 g ) and rnase t1 ( 0.5 l ) for 1 h at 37 c to remove rna contamination . the final dna preparations were stored at 20 c until used for adduct analysis . the assay for aom - induced in vitro dna adduct formation was based on a published method . briefly , microsomes ( 0.52.0 mg / ml ) were incubated with calf thymus dna ( 1 mg / ml ) and aom ( 200 m ) in a total volume of 1.0 ml . the assay buffer consisted of 0.1 m tris hcl ( ph 7.4 ) , 1 mm edta , 20 mm mgcl2 , 0.3 m kcl , and 1.5 mm nadph . incubations were carried out at 37 c for 60 min in a shaking water bath . the reaction was stopped by the addition of 0.5 ml of ice - cold 7.5 m ammonium acetate . levels of o - mg and n - mg were determined , for both in vivo and in vitro dna samples , essentially as described with minor modifications . briefly , dna samples ( 100200 g ) were fortified with the internal standard o - cd3-dg ( 6 pmol ) and hydrolyzed in 0.1 n hcl at 80 c for 90 min . the samples were allowed to cool , neutralized with nh4oh , and analyzed using lc - ms . control genomic dna from corresponding tissues were used for the preparation of calibration curves for the quantification of o - mg and n - mg , with o - mg and n - mg standards added in 40 to 1000 nm . blank controls for the solvent and matrix were included in each set of calibration samples . the lc - ms method for the detection of o - mg was according to ref ( 24 ) . n - mg was detected using the same method ; the parent / product ion pairs were monitored at m / z 166/149 and m / z 166/124 , using the mrm scan mode . the retention time was 7.2 min for n - mg and 7.6 min for o - mg and o - cd3-dg . the detection limits for n - mg and o - mg were 0.02 pmol and 0.04 pmol ( on column ) , respectively , with an injection of 6 g of hydrolyzed dna . the dna adduct levels were normalized to guanine levels for all samples , determined using hplc , as described previously . mam formed from aom in microsomal incubations was detected as formaldehyde using the chromotropic acid method . the microsomal incubations were performed at 37 c , using 500 m aom and 0.2 mg / ml microsomal protein for 10 min . control assays were performed in the absence of either aom or microsomes to correct for any nonenzymatic conversion of aom to formaldehyde . male , 810 week old , wt - a / j , iecn - a / j , and lcn - a / j mice ( 8 per group ) were treated with either saline or aom ( 7.5 mg / kg bw , s.c . ) , once weekly for 3 weeks . mice were sacrificed 6 weeks post - treatment for acf detection , as described previously . the entire colon ( from the cecum to anus ) was excised ( within 4 min from the time of euthanasia ) . a longitudinal incision was made along the entire length of the colon , which was further cut into two equal - length segments , representing proximal and distal portions of the colon . the segments were dipped in pbs to remove fecal pellets and then kept flat between filter papers in 10% buffered formalin for at least 24 h. subsequently , the colons were immersed in freshly prepared 0.1% methylene blue for 10 min and rinsed briefly in deionized h2o to remove excess dye . the colon was mounted carefully on a microscope slide with the mucosal surface side up and viewed under a light microscope ( nikon te2000 ) with 40 magnification . the acf in the entire mucosal surface of the colon were counted blindly and independently by two investigators and recorded . statistical significance of differences among the three mouse strains in various parameters was examined using one - way analysis of variance ( anova ) , followed by dunnett s post - hoc test for pair wise comparisons , with the use of graph pad prism 5 ( graph pad , san diego , ca ) . in all cases , p < 0.05 was considered statistically significant . the respective roles of the liver and intestinal microsomal p450 enzymes in the bioactivation of aom in vivo was determined by comparing levels of aom - induced dna adducts in wt , iecn , and lcn mice ( table 1 ) . levels of o - mg and n - mg , which are known to be produced by aom treatment , were determined in the liver , duodenum , jejunum , ileum , proximal colon , and distal colon at 6 h after aom treatment , at a dose ( 14 mg / kg ) that was shown previously to be effective in inducing adduct formation in mice . the levels of n - mg were ( 39 times ) greater than o - mg levels in the various tissues examined , which is consistent with previous reports . regardless of the strain , the amounts of o - mg and n - mg produced by aom were highest in the liver , followed by proximal and distal colons , which had similar levels , and then by duodenum , jejunum and ileum ( table 1 ) . for o - mg , the wt levels in the liver dna was 5 times higher than that in colon dna , 10 times higher than that in duodenal dna , and 32 and 83 times higher than that in jejunum and ileal dna . male wt , iecn , and lcn mice were injected with aom at a dose of 14 mg / kg ( s.c . ) , and levels of o - mg and n - mg , as well as total guanine , were determined in the liver , si ( duodenum , jejunum , and ileum ) , and proximal and distal colon at 6 h after the injection . data represent the means sd of eight determinations , each of a separate mouse . p < 0.05 , compared with the corresponding wt tissue ; one way anova with dunnett s post - hoc test . the loss of p450 activity in the liver , in the lcn mice , caused a significant decrease in hepatic o - mg and n - mg levels to < 40% of the wt level , confirming the role of microsomal p450 enzymes in aom bioactivation in the mouse liver in vivo . in contrast , there was a significant increase in o - mg levels ( by 1.7-fold ) in the duodenum and significant increases in both o - mg ( by 1.5-fold ) and n - mg ( by 2.12.9-fold ) levels in the proximal and distal colons of lcn mice compared to those in wt mice ( table 1 ) . these data indicated that the aom - induced dna adduct formation in the si and colon does not depend on bioactivation by hepatic p450 enzymes . the loss of intestinal p450 activity , in iecn mice , did not change adduct levels in the liver , but it led to significant decreases in o - mg and n - mg levels in the duodenum , jejunum , and ileum to < 50% of the wt level . interestingly , in the proximal and distal colons , there was no significant difference in the abundance of dna adducts formed between the iecn and wt mice ( table 1 ) . previous studies have shown through immunoblot analysis that cpr protein expression was abolished in colonic microsomes from iecn mice . to be sure , we further examined cpr expression in the colon of wt and iecn mice by immunohistochemical analysis . as shown in figure 1 , the cpr protein was abundantly detected in the colon epithelium in both proximal and distal colons from wt mice , but it was absent in colons from ie - cpr - null mice . paraffin sections of the proximal and distal colon from 2-month - old male ie - cpr - null mice and wt littermates were processed for immunohistochemistry . the tissue sections were incubated with a polyclonal rabbit anti - rat cpr antiserum . antigenic sites were visualized with a peroxidase - conjugated goat anti - rabbit secondary antibody , with alexa fluor 594-conjugated tyramide as the peroxidase substrate . fluorescent signals were detected with a tetramethylrhodamine isothiocyanate filter ( for alexa 594 , red ) and a dapi filter ( for dapi , blue ) ; scale bar , 100 m . no signal was detected in negative control slides ( data not shown ) , which were incubated with a normal goat serum in place of the anti - cpr antibody . aom is known to induce acf in the colon as a downstream event to aom - induced dna adduct formation and a precursor to the eventual tumorigenesis . thus , we further compared the extent of aom - induced acf formation in wt , iecn , and lcn mice after they were backcrossed 35 generations to the susceptible a / j background . irrespective of the mouse strain , no acf was detected in the colons of saline - treated mice ; in contrast , colonic acf was detected in all three strains of aom - treated mice ( figure 2 ) . as shown in figure 2a , the aberrant crypts in acf , which are preneoplastic formations , are distinguished from normal crypts by their larger size , increased pericryptal area , irregular lumen with slit shaped appearance , greater staining intensity , and/or elevation above adjacent normal crypts . acf was detected in methylene - blue - stained colon , as described in materials and methods . representative images of acf ( arrows ) with 2 ( left ) or 8 ( right ) aberrant crypts are shown . male wt - a / j , iecn - a / j , and lcn - a / j mice were treated with saline or aom at a dose of 7.5 mg / kg ( s / c ) , once weekly for three weeks , and sacrificed 6 weeks later for the detection acf in the proximal and distal colon . , n = 4 8 ) for proximal and distal colons , as well as the combined data for the entire colon ( total ) , are presented . there was no difference between the two mouse strains ( p > 0.05 , compared to wt ; one - way anova with dunnett s test ) . no significant difference in the total acf counts was found among the strains for either the proximal or the distal region of the colon ( figure 2b ) . these results are largely consistent with the dna adduct data , showing that colonic acf formation is not critically dependent on aom bioactivation by hepatic or intestinal microsomal p450 enzymes . to further confirm that the liver and intestinal cpr deletion did reduce the capacity of the respective tissues to activate aom to dna - reactive electrophiles , we analyzed the alkylation of calf thymus dna by reactive metabolites of aom formed in incubations with the liver , si , and colon microsomes from wt , iecn , and lcn mice ( table 2 ) . notably , although we performed analysis to detect both o - mg and n - mg , the levels of o - mg were below the limit of detection . the rates of formation of formaldehyde or dna adducts were measured for hepatic , si , and colon microsomes of wt , iecn , and lcn mice on a b6 background . each intestinal microsome preparation was obtained from pooled tissues from 2 to 4 adult male mice ; three microsomal preparations were analyzed for each group . hepatic microsomes were obtained from individual animals ( n = 4 ) . for dna adduct formation , reaction mixtures contained 0.52.0 mg of microsomal protein , 200 m aom , 1.0 mg of calf thymus dna , and other components as described in materials and methods in a total volume of 1.0 ml . reactions were carried out at 37 c for 60 min in the presence or absence of 1.5 mm nadph . o - mg formation was not detected under the conditions used ( limit of detection was 2 pmol/mol g / h / mg protein ) . for formaldehyde formation , reaction mixtures contained 0.2 mg of microsomal protein , 500 m aom , and other components as described in materials and methods in a total volume of 1.0 ml , and reactions were carried out for 10 min . p < 0.01 , compared with corresponding wt microsomes ; one way anova with dunnett s post - hoc test . below the limit of quantification ( loq , 1 ) . on an equal protein basis , hepatic microsomes were much more active than si and colon microsomes in nadph - dependent aom bioactivation and n - mg adduct formation . interestingly , colon microsomes were competent in this reaction , showing 60% of the activity seen in si microsomes in wt mice ( table 2 ) . microsomes of the liver ( but not those of the si or colon ) of lcn mice showed significantly lower activity in n - mg formation compared to that of wt mice . similarly , microsomes of the si and colon from iecn mice showed minimal or no activity in the formation of n - mg , whereas the liver microsomes from iecn mice had activity similar to that of wt in n - mg formation ( table 2 ) . we also compared the liver , si , and colon microsomes from wt , iecn , and lcn mice for their ability to metabolize aom to formaldehyde via the formation of mam ( table 2 ) . in accordance with the in vitro n - mg formation data , hepatic microsomes showed the highest activity in the hydroxylation of aom , followed by si and colon microsomes . with the loss of hepatic cpr , liver microsomes of lcn mice had no activity in formaldehyde formation , whereas the activities of the intestinal microsomes of lcn mice were comparable to those of wt mice . in iecn mice , neither si nor colon microsomes had detectable activity in formaldehyde formation from aom , while the liver activity was similar to that of wt ( table 2 ) . considering the high incidence of cancers in the colon and the fact that the gastrointestinal tract is a major portal of entry for myriad chemical carcinogens and toxicants , it is important to determine the metabolic mechanisms of chemical carcinogenesis in the colon , including the source of reactive intermediates , and the role of target tissue metabolic activation . although the liver is the most abundant in p450 enzymes , some extrahepatic tissues , such as the lung and small intestine , have been shown to be highly efficient in target - tissue bioactivation of carcinogens and other toxicants , leading to tumorigenesis or tissue toxicity . the colon appears to possess a somewhat unique profile of p450 expression , both in terms of expression levels and isoforms present , and the role of colonic p450s in xenobiotic metabolism and toxicity is not well understood . although human exposure to aom , derived from a rare plant , is uncommon , our exposure to other , structurally related hydrazine derivatives that are found in mushrooms , tobacco , herbicides , rocket fuels , and drugs are frequent . hence , the metabolic mechanisms of aom may have broad implications . in that regard , while several studies had reported efficient in vitro metabolism of aom by colon microsomes from rodents , hamsters , and humans , others failed to detect such activity in the colon . when non - p450-mediated bioactivation of mam in colon was investigated in vitro , alcohol dehydrogenase ( adh ) we determined the influence of tissue - specific suppression of p450 activity , via conditional cpr deficiency , in the liver and intestine on aom metabolism in vitro and aom - induced dna adduct formation in vivo . for in vivo studies , we chose subcutaneous aom administration since it was reportedly the most effective route for producing colon tumorigenesis . we collected tissues for analysis at 6 h after aom administration , a time point that was previously found to yield maximal alkylation of target tissue dna . all bioactivation studies were conducted with mice on the b6 genetic background . in that connection , it should be noted that although mouse strain - related differential sensitivity was reported for aom - induced carcinogenesis , with a / j being the most sensitive strain , a strain difference between b6 and a / j mice was not observed in aom - induced dna adduct formation ( data not shown ) . our in vitro studies clearly demonstrated the predominant role of p450 enzymes in microsomal metabolism of aom , in the liver , si , and colon . it is interesting that si and colon microsomes showed somewhat similar ability to bioactivate aom , as indicated by their rates of in vitro formation of formaldehyde and n - mg , even though the total p450 concentration in si is reportedly several folds higher than that in the colon . this finding may be related to the reported presence of cyp2e1 in the colon , and the known activity of cyp2e1 toward aom . the apparent absence of o - mg adduct formation in vitro by microsomes from any of the mouse tissues analyzed was consistent with the fact that n - mg was much more abundant than o - mg in vivo , in aom - treated mice ( table 1 ) , which has been noted previously with adducts formed by another compound . the results of aom - induced dna adduct formation in vivo ( table 1 ) are more complex to explain . in aom - treated lcn mice , compared to similarly treated wt mice , hepatic o - mg and n - mg levels were substantially decreased , consistent with a major role of hepatic p450 enzymes in aom bioactivation in the liver . note , however , that the contributions of hepatic microsomal p450s might have been underestimated by the data from the lcn mice , where the loss of hepatic microsomal p450-mediated aom clearance would lead to increases in aom concentrations in the liver and extrahepatic tissues , and consequently increased dna adduct formation via alternative metabolic pathways and/or in extrahepatic tissues . the dna adduct levels were significantly increased , rather than decreased , in most parts of the intestine , including the colon , by the loss of hepatic microsomal p450 activity ( table 1 ) . this result clearly indicated that hepatic microsomal p450-mediated metabolism is not required for aom to induce dna adduct formation in the colon . however , the data could not tell us whether liver - produced reactive aom metabolites contributed any part to dna adduct formation in the colon , given the likely increase in aom bioavailability in the target organ ( and thus a possible overestimation of local contribution to dna adduct formation ) in the lcn mice . given that aom was administered subcutaneously and based on previous studies on pharmacokinetics of other compounds in the iecn mouse , we believe that the bioavailability of aom was unchanged in iecn compared to that of wt mice . as expected , the lack of microsomal p450 activity in the intestine resulted in much reduced levels of aom - induced dna adducts in the si but not in the liver . surprisingly , dna adduct levels in the colon were also unchanged , which contrasted with results of in vitro microsomal assays showing substantial decreases in aom bioactivating activity in the iecn mice relative to that in wt mice ( table 2 ) . the reasons for this apparent discrepancy between in vitro and in vivo results remain to be determined . however , it is worth noting that although the colon had the lowest in vitro activity among the three tissues analyzed ( table 2 ) , the level of dna adducts in the colon was the highest among all intestinal segments ( table 1 ) . the latter fact was at least partly related to a possible colonic accumulation of the reactive metabolite derived from the proximal si or to colonic bacterial -glucuronidase activity , which can act on mam - glucuronide ( derived either from the liver or the si ) to release free mam in the colon , as depicted in figure 3 . the regenerated mam , once absorbed , can either undergo further bioactivation or spontaneously decompose , to reactive methyldiazonium ion in the colon , leading to adduct formation . the bacterial source of reactive aom metabolites might have overshadowed the amounts of mam generated directly from aom by intestinal p450 , thus obliterating any decreases in colonic dna adducts resulting from the loss of intestinal p450 activity . at any rate , these data suggested that intestinal microsomal p450 enzymes are not essential to ( though they can contribute to ) aom - induced dna damage in the colon , under the conditions ( dose and route ) used in this study . additional studies are warranted in order to determine whether intestinal ( and hepatic ) p450 plays a more essential role in colonic dna adduct formation by orally ingested aom . as expected , the results of the acf studies were largely consistent with those of the dna adduct studies , in that the loss of either hepatic or ie cpr did not lead to a noticeable decrease in colonic acf formation . the multiplicity of colonic acf was not different among the three mouse strains , even though colonic dna adduct levels were 50% higher in the lcn mice than in wt mice . this latter discrepancy may be related to the different aom dose and dosing regime used for the two studies . it should also be noted that the current study was focused on conventional acf ; further , more discriminating studies are required to elucidate the degrees of dysplasia in the acf found in the different strains . additionally , gross adduct levels may not accurately represent adduct levels in colonic stem cells , which may be more critical for acf formation and carcinogenesis . in summary , we show that liver , si , and colon microsomal p450 enzymes are all capable of bioactivating aom and that p450 enzymes in both the liver and intestine likely contribute to aom - induced o - mg formation and the eventual colon carcinogenesis in wt mice . our results suggest that the overall ( both hepatic and extrahepatic ) bioactivation capacity is more useful than either hepatic or colonic activity alone for assessing the risks of chemical toxicity from aom ( and related compounds ) in the colon .

neonatal respiratory failure is a serious clinical problem[13 ] associated with high morbidity , mortality , and cost[46 ] . the major risk factor is low birth weight[7 , 8 ] , which is more prevalent among the poor , and the uninsured[912 ] . the standard method of management for respiratory failure is supportive care with mechanical ventilation and high concentration of inspired oxygen . a study in the united states reports a mechanical ventilation rate of 18 per 1,000 live births and the total cost of $ 4.4 billion for treating respiratory failure . devices used to generate cpap include conventional ventilators , the bubbly bottle system and the infant flow driver . the infant flow driver has been shown to be a feasible device for managing respiratory distress syndrome in preterm infant . it splints the upper airway and reduces obstruction and apnea , assists expansion of the lungs , and prevents alveolar collapse . underwater bubble cpap ( b - cpap ) and ventilator - derived cpap ( v - cpap ) are two of the most popular cpap modes , and they use different pressure sources . in v - cpap , a variable resistance in a valve is adjusted to provide resistance to the flow of air . in b - cpap the positive pressure in the circuit is achieved by simply immersing the distal expiratory tubing in a water column to a desired depth rather than using a variable resistor[19 , 20 ] . lee et al demonstrated the superiority of b - cpap as compared to v - cpap in premature infants . teresa et al showed that the use of b - cpap is a potentially useful practice among very low birth weight infants with rds . although these two different pressure sources for cpap delivery have been used for three decades , surprisingly there are no large randomized trials of b - cpap vs conventional management with mechanical ventilation , a fact that reflects the common dilemma in clinical research . conducting a large trial too early risks failure due to both inadequate knowledge of optimal treatment strategy to design the trial correctly and lack of expertise in the use of the new technique / device . what is clear , however , is that in resource - limited settings b - cpap is an effective and inexpensive way to provide respiratory support that appears to be at least as good as the respiratory support generated by far more expensive equipment . the objective of the present study was to compare the survival rate of neonates with respiratory failure treated with application of b - cpap vs v - cpap and to study any possible complications caused by these methods . this study was conducted at a level iii neonatal care unit of afzalipoor hospital between june 2009 and may 2010 in kerman university of medical sciences . the aim of this study was to compare the effectiveness of b - cpap and v - cpap in the treatment of neonates with respiratory distress syndrome . all consecutively born preterm infants with birth weight between 1000 and 2000 grams who had respiratory distress and a silverman - anderson retraction score of 6 and 7 were included . babies were excluded if there was significant morbidity apart from rds including cardiac disease ( not including patent ductus arteriosus [ pda ] ) , congenital malformation including congenital diaphragmatic hernia , tracheoesophageal fistula , and cleft lip / palate , and babies who had either respiratory distress secondary to severe asphyxia ( apgar score3 at 1 and 5 minute or ph7.12 ) , cardiovascular or respiratory instability because of sepsis , anemia , or severe intraventricular hemorrhage ( ivh ) on admission . setting the power and type - one error at 80% and 5% , we have estimated that the total number of patients required was 50 ( i.e. , 25 per treatment group ) . to randomly assign patients into treatment groups , the minimization technique was applied with respect to baby 's gender and birth weight ( 1500 vs > 1500 grams ) . by implementing this method , we balanced the gender and weight distribution in treatment groups . in both groups cpap was implemented nasopharyngeally . indication for cpap included ( i ) fio2 > 0.4 to maintain pao2 60 mmhg associated with ph<7.25 ; and ( ii ) paco2 < 50 mmhg . uk ) involves a source of gas flow ( 6 - 8 l / min ) , an air oxygen blender ( biomed devices belendez . cpap level delivered is equivalent to the distance that the distal end of expiratory tubing is underwater , which was submerged under 5 cm of water to obtain 5 cm h2o of cpap in our study . us ) ventilator - derived cpap also provided base flow of gas at a rate of 5 l / min ; however , its hose was connected to the exhalation valve of the ventilator . the pressure tube was connected to the y - piece and the pressure was adjusted at 5 cm h2o . cpap was considered to be successful if the respiratory distress improved and the baby could be successfully weaned off cpap . the criteria for weaning was absence of respiratory distress ( minimal or no retractions and respiratory rate between 30 and 60 per minute ) and spo2>90% on fio2 < 30% and peep < 5 cm of water . mechanical ventilation was considered for failure of cpap ; i.e. , in babies with pao2 < 50mmhg or paco2 > 60 mmhg and ph<7.25 with fio2 > 0.6 ; or those with clinical deterioration ( increased respiratory distress ) including severe retractions on peep > 7 cm of water ; or prolonged ( > 20 seconds ) or recurrent apneas ( > 2 episodes within 24 hours associated with bradycardia ) requiring bag and mask ventilation[26 , 27 ] . infant variables evaluated included birth weight , gestational age , apgar score at 1 minute , delivery room management ( oxygen , bag and mask , intubation ) , chest x - ray , arterial blood gas , fio2 requirement and treatment with surfactant ( survanta ) . we applied survival analysis to compare the survival rate in the treatment groups at different time points . by definition the survival function is the probability of observing a survival time greater than some stated value x. this indicates that being event free all the way to the end of x year depends on no event in any of the preceding years , and also none in the x year , so this method considers aging information . to display the results graphically we also compared treatment options in terms of duration of oxygen therapy , duration of hospital stay , and hospitalization costs . we reported the incidence of neonatal morbidities in 2 treatment groups : pneumothorax , pda by echocardiography ( spacelabs medical . usa ) , ivh by cranial ultrasonography ( accuvix10 ) performed by our neonatologist who was blinded to failure as an outcome which was typically performed on admission day , day 7 , and when the baby failed each mode of treatment , severe ivh ( grades iii - iv ) , chronic lung disease ( cld ) , and trauma to nasal septum and nostrils . independent sample t and chi - square tests were used to compare continuous and categorical variables between treatment groups , respectively . the study protocol was approved by the local ethical committee of kerman university of medical sciences ( ethic code : k-88 - 235 ) . this study has been registered in iranian registry clinical trail ( irct.ir ) ( irct i d : irct13890208325 0n2 ) . as summarized in table 1 , the b - cpap and the v - cpap groups had comparable demographic characteristics . bubble - cpap proved to be effective in 24 ( 96% ) babies ; only 1 baby required mechanical ventilation on the 6 day . patient characteristics in b - cpap and v - cpap modes a total of 25 babies received surfactant ( survanta ) : 12 in b - cpap and 13 in v - cpap group with no significant difference . a total of 4 neonates had ivh : 1 in b - cpap group and 3 in v - cpap group . nasal trauma was seen in 12% of patients , but this did not include trauma to septum ; the only complication was minimal nostril lesions all of which had improved before discharge . mean treatment duration in b - cpap was not statistically significantly different from v - cpap ( 39.8h vs 49.4h ) . focusing on patients who responded to treatment , the mean duration of treatment for the two groups was 35.531.92h and 57.533.99h respectively and the difference was statistically significant ( p=0.04 ) . also , we found a significant difference between b - cpap and v - cpap for the mean duration of hospital stay ( 8.73.3 vs 11.97.8 days , respectively ) . the characteristics of patients who did not respond to v - cpap are given in table 2 . patient characteristics by failure of treatment in v - cpap group neither sex nor birth weight influenced the response to treatment . no similar analysis was performed for the b - cpap group since only 1 patient did not respond to the treatment applied . we also compared the survival rates between the two treatments every 12 hours ( table 3 ) . in the first 3 days , the estimated survival rate in the b - cpap group was 100% . comparison of estimated success rate in survival however , in the v - cpap group a decrease in survival rate was seen . in the first 24 hours the difference between survival rates was about 25% ( 100% in b - cpap vs 77% in v - cpap ) , indicating the vital importance of the first hours of management of patients . the survival rate of neonates who received v - cpap was 59% at the end of the 3 day and remained constant afterward ( fig 1 ) . it should be noted that when we developed a multifactorial cox regression to adjust the treatment effect in the presence of other variables , the model did not converge to a solution . survival rate of neonates in b - cpap ( top line ) and v - cpap ( bottom line ) the mean duration of hospital stay and treatment time were similar in the 2 treatment groups in neonates weighing < 1500 g ( p - values=0.84 and 0.63 , respectively ) ; however , the mean duration of hospital stay and treatment time of neonates weighing > 1500 g were significantly longer in the v - cpap group ( 25.2617.09 h and 7.22.6 d in b - cpap vs 47.230.24 h and 9.52.9 d in v - cpap ) . the mean cost of hospitalization in the b - cpap and v - cpap groups was $ 947.3726 and $ 1436.7934 , respectively , and the difference was significant ( p=0.04 ) . the main goal of this study was to compare the effectiveness of and complications associated with b - cpap and v - cpap . different modalities of ventilators and systems producing cpap have provided opportunities to compare these methods . our findings showed that the failure rate associated with b - cpap was lower than that associated with v - cpap , which was inconsistent with the results of the study carried out by tagare et al . likewise , lee showed that b - cpap was significantly more effective than v - cpap . on the other hand , the studies by morley and pillow demonstrated that b - cpap increases the respiratory effort in the neonate more so than v - cpap . we observed only one single failure in the b - cpap group in our study ; we did not investigate the cause for this failure . however , in the study by ammari the cpap failure observed was associated with positive pressure ventilation at delivery and severe rds . also , urs noted that the chance for success was limited to patients with mild to moderate rds . in our survey the hospital stay and treatment in neonates weighing more than 1500 g differed between the b - cpap and v - cpap groups and this was not shown in patients weighing less than 1500 g. in another study the positive effect of b - cpap was seen in neonates weighing more than 1250 g , and in the study by tagare the hospital stay was longer in the b - cpap mode than v - cpap . b - cpap delivers mechanical oscillatory vibrations that simulate waveforms produced by high - frequency ventilation ( hfv)[19 , 33 ] . accordingly , b - cpap may possess the characteristics of cpap and hfv at the same time . it has been reported that hemodynamics is better preserved during hfv than during conventionally controlled mechanical ventilation[34 , 35 ] , and also when using b - cpap . in this study we did not investigate the hemodynamic changes in the two groups but that may be why we saw fewer ivh cases among those who were under b - cpap . several studies have shown that the columbia approach[37 , 38 ] , in which b - cpap is used early in the course of respiratory distress in both premature and term - gestation infants , can effectively lower the incidence of cld[3941 ] . at columbia university , the early initiation of nasal prong b - cpap in combination with a tolerance to elevated pco2 levels has been shown to reduce the incidence of cld to < 5% in infants weighing less than 1500 g , consistent with our findings . the mean cost of hospitalization was lowered by using b - cpap in our study . lanieta et al have successfully demonstrated the usefulness of b - cpap in a developing country , and have also reported the cost effectiveness of b - cpap . pieper et al have shown the importance of cpap in the absence of neonatal intensive care and also the improved outcome in neonates treated with cpap prior to transfer to a tertiary unit . the small sample size of this study does limit its applicability . a multicenter randomized controlled trial is needed to further confirm these findings . based on our results b - cpap seems to be superior to v - cpap in terms of treatment of rds in preterm infants due to fewer complications , shorter hospital stay , and lower cost . the simplicity and low cost of b - cpap compared with v - cpap makes it an attractive option in resource - poor setups .

the present study was carried out on 150 professional mbbs students of tertiary care hospital . students were briefed about the purpose of the study and informed written consent was obtained . a pretest was conducted by giving 10 questions of general awareness and 15 questions regarding pharmacotherapy of hiv / aids . after completion of integrated teaching , posttest comprising multiple choice questions ( mcqs ) and problem - based question ( pbq ) was taken . a two - hour session of cm using preprepared cm on general awareness and pharmacotherapy of hiv and aids participant feedback regarding their views about cm was taken using five - point likert s scale . we analyzed the data using spss version 22 ( spss south asia pvt . ltd . marks obtained in mcq and pbq after integrated teaching and by cm were compared using student s t - test . we analyzed the data using spss version 22 ( spss south asia pvt . ltd . marks obtained in mcq and pbq after integrated teaching and by cm were compared using student s t - test . the pre- and post - test scores of integrated teaching and after the cm when compared were found to be statistically significant ( p < 0.05 ) [ figure 1 ] . in the pretest fifty - eight percent had < 40% . in the posttest evaluation , 60% students scored between 40% and 60% marks and 39% scored between 70% and 100% marks [ table 1 ] . the percentage change in score after integrated teaching and concept map ( * p < 0.05 as compared to pretest . # p < 0.001 as compared to integrated teaching ) the evaluation of students knowledge by pre- and post - test the posttest scores of integrated teaching and cm were compared by paired t - test , which was found to be significant ( p < 0.05 ) [ table 2 ] . a significant improvement was seen in mcq and pbq scores in both general awareness and pharmacotherapy of hiv after cm as compared to integrated teaching [ figure 2 ] . in pbq , performance was found higher ( 60% ) after the cm session than after integrated teaching ( 32% ) p < 0.001 [ table 2 ] . the percentage change in multiple choice questions and problem - based question score ( * p < 0.05 as compared after integrated teaching . # p < 0.01 as compared after integrated teaching ) performance scores after integrated teaching and concept map student s perception on cm sessions was recorded using a prevalidated questionnaire . out of 124 students , 107 ( 87% ) opined that cm improved their learning [ table 3 ] . it is important for medical students to understand , relate the relevant medical concepts , and linked them to the prior knowledge . medical teachers are now required to apply teaching methodologies that facilitate deep meaningful learning rather than memorize by rote . in our study , integrated teaching module was followed by cm session so that students able to integrate basic and integrated information through cm . it was also suggested in literature that meaningful learning occurs when the student links new knowledge with previous knowledge thus creating integrated cognitive knowledge . we used cms used during the session as preprepared cms offer alternative and innovative learning and teaching opportunities in large classes . in the present study , there was a significant improvement in the test score after integrated teaching ( 59% ) as compared to pretest ( 33% ) as shown in figure 1 . in pretest , 90% of the students scored below 40% and 10% of them scored above the 60% . at this stage , without any formal teaching , we can say students have some knowledge about the topic . in posttest , most of the students ( 60.4% ) were above 40% followed by 33% were above 60% [ table 1 ] . we found that there was a remarkable change in the mcq score after the session of cm on general awareness ( 77% ) and pharmacotherapy of hiv and aids ( 80% ) compared to posttest after the end of lectures taken in integrated teaching 67% and 51% , respectively [ figure 2 ] . studies also mentioned cm assessment scores improved after cm course instructions . in the current study with the use of cm , there was a significant improvement in the percentage of pbq score based on pharmacotherapy of hiv and aids ( p < 0.001 ) and also improvement in mcq score [ figure 2 ] . similar findings were shown in a study of problem - solving examination versus a multiple - choice examination . findings indicated that the group using cms performed significantly better on pbq and performance on mcq was similar to the traditional group . in our study , the improvement in the mcq and pbq may be due to the reinforcement of topic through cm teaching . successful use of cm in the pbl was demonstrated in a study of experimental group and control group . to solve pbq , students should connect descriptive knowledge with procedural knowledge and cross - linkages in their knowledge structures , which will benefit clinical reasoning in the future . pbl and cm have been proven to be complementary tools because the way of information collection , hypothesis generation , and identification of learning issues allowed for an exposure of wider knowledge through the use of cms . student feedback : frequent feedbacks may help teachers plan the curriculum and improve upon the teaching and assessment methods . students ( 90% ) were enthusiastic about the new teaching methodology , and 88% prefer cm as teaching method add on to theoretical lecture . eighty - seven percent opined that this method helped them to learn better as it summarizes key ideas about hiv / aids . eighty - eight percent candidates agree that class activity engages their interest [ table 3 ] . a study in a medical school in australia also found that 87% of the students agreed that cm was helpful in making links , 87% found it enjoyable , for 93% , it is a helpful tool in revision , and 97% admitted that it provides valuable learning . this study has revealed that the students have improved in their learning by virtue of cm . cm can be a useful tool as add on lectures and also to summarize the topic in an effective way .

pulmonary surfactant is a lipoprotein complex composed of lipids ( 90% ) and proteins ( 10% ) , secreted by the alveolar type ii pneumocytes , that reduces the surface tension of fluids that coat alveoli , maintaining the stability of alveolar structures . surfactant proteins include surfactant protein a ( spa ) , b ( spb ) , c ( spc ) , and d ( spd ) . previous studies on spa expression in the developing human fetal lung showed the first appearance of reactivity for spa at 21 weeks of gestation in scattered epithelial cells in the main and segmental bronchi , whereas spa immunostaining in alveolar type ii cells appeared at 29 weeks , increasing until the 39 week of gestation . the use of knockout mice evidenced the critical role of spb in integrating the synthesis and metabolism of the surfactant complex , the absence of spb being invariably fatal in the neonatal period . in other studies carried out in transgenic mice , the expression of mature spb in type ii cells was confirmed to be required for lung function , whereas spb expression in club cells was not able to substitute this function . further studies on spb and spc expression in the fetal human lung evidenced that both surfactant proteins are expressed primarily in distal bronchi and in terminal airway ( bronchiolar ) epithelial cells by the 15 week of gestation , well in advance of expression in type ii pneumocytes , starting around the 25 week . a major role is played by spb in the regulation of spc synthesis , complete deficiency of spb resulting in marked decreased levels of spc . recently , surfactant protein c has been reported in pulmonary mouse cells displaying proliferation , differentiation , and self - renewal capacity , suggesting the hypothesis that alveolar type ii cells should be considered as progenitor cells for all alveolar epithelial cell types . these spc - expressing bronchiolo - alveolar stem cells have been identified as alveolar epithelial progenitor cells , different in function from club cells that , according with this hypothesis , might represent the epithelial progenitors in trachea and bronchioles . the finding in the developing mouse of a preceding and overlapping expression of thyroid transcription factor-1 ( ttf-1 ) in the same cells later expressing spb and spc supported the hypothesis of a possible regulatory role for ttf-1 in lung expression of surfactant genes . a role for hepatocyte nuclear factor-3beta ( hnf3- ) , a nuclear protein belonging to the winged family of transcription factors , has been assigned in the activation of multiple target genes critical for differentiation of respiratory epithelial cells , including ttf-1 , spb , and club cell secretory protein ( ccsp ) . the earliest expression of spa in the fetal human lung has been reported around the 15 week of gestation , spa - positive epithelial cells being mainly found in the larger bronchi . a delay in the synthesis of spa by alveolar type ii cells has been reported in the lung of newborns affected by congenital diaphragmatic hernia ( cdh ) , suggesting a role for spa deficiency in the development of respiratory insufficiency often observed in these patients . spd has been reported as the earliest surfactant protein to be expressed during lung development . spd - reactivity has been reported in the bronchial epithelium since the 12 week of gestation , gradually increasing during canalicular to saccular stage . during the saccular stage , immunoreactivity for spd shifts from the bronchial epithelium to alveolar type ii pneumocytes . in developing rat lung , the developmental profiles of spa and spb have been found to be different from each other : the former increased during late gestation , whereas spb expression was low during gestation and increased after birth . on the basis of these data , it seemed of some interest to better analyze , by immunohistochemistry , spa and pro - spb expression during human development , in order to reach a better knowledge on the timing of expression of these surfactant proteins in bronchial , bronchiolar cells and in type ii alveolar cells . in particular , this study was aimed at verifying if surfactant protein expression during human development shows any variability among different subjects , possibly being modulated by epigenetic factors acting during intrauterine life . only spa and spb were evaluated because are generally considered to represent the most essential protein components of human lung surfactant . this study was performed according the code of conduct of the committee on publication ethics ( cope ) and the cope international standards for editors and authors guidelines . the human fetuses we received from the obstetric division of the university of cagliari were as voluntary termination of pregnancy ( vtop ) or from autopsy for diagnostic purpose . all procedures performed were approved by the ethics human studies committee of university medical centre of cagliari ( according to the instructions of the declaration of helsinki ) . this study was carried out on 40 subjects , including 15 fetuses , ranging from 14 to 22 weeks of gestation , and 25 neonates , from 24 to 41 weeks . lung samples were formalin - fixed by immersion in neutral buffered formalin ( nbf ) for 24 h , followed by processing in an automatic processor for histology for 12 h , then paraffin - embedded with a paraffin temperature closed to 50c and routinely processed . tissue sections were then dewaxed , rehydrated and pre - treated for immunohistochemical analysis with a 10-min heat - induced epitope retrieval in buffer ph 6.00 ( envisiontm flex target retrieval solution low ph - dako denmark a / s , glostrup , denmark ; code k8005 ) . slides were then incubated for 20 min at room temperature with anti - human surfactant protein a ( spa ) mouse monoclonal antibody clone 32e12 ( novocastratm , code ncl - sp - a ) and with anti - human pro - surfactant protein b ( pro - spb ) mouse monoclonal antibody clone 19h7 ( abcam , cambridge , uk ; catalog numbers ab49571 ) , both at 1:100 dilution . staining procedures were performed with the envisiontm flex+ ( dako , code k8002 ) detection system and the autostainerlink 48 instrument according to the manufacturer s instructions . a negative control , with the omission of the primary antibody , immunohistochemical staining for spa and pro - spb were carried out on all tissue lung included for each fetus . all tissue areas were used for the quantitative assessment and viewed for each fetus to directly compare the spa and pro - spb staining . magnification for view of each compartment for the quantitative assessment were 40 and 63 hpf . a semi - quantitative grading system ( 1 to 4 ) was developed , based on the number of reactive cells and the intensity of immunostaining ( figure 1 ) : grade 0 , negative ( supplementary figure 2 ) ; grade 1 , < 10% positive cells ( figure 1a ) ; grade 2 , 10 - 50% positive cells ( figure 1b ) ; grade 3 , 51 - 70% positive cells ( figure 1c ) ; grade 4 , > 70% positive cells ( figure 1d ) . surfactant protein immunostaining was evaluated in three compartments of the developing lungs : bronchi , bronchioles and alveoli . the association between the values of surfactant proteins and gestational age was assessed using pearson s correlation coefficient ( r ) . all statistical analyses were performed using the statistical package for social science ( spss ) software . in same cases the clinician administrated surfactant : case 19 at 25 weeks , case 24 at 28 weeks , cases 26,27,28 at 30 weeks , case 33 at 36 weeks , and case 36 at 39 weeks . both surfactant proteins spa and pro - spb showed a preferential cytoplasmic pattern staining and both were observed in three compartments of the developing lung : the bronchial epithelium , the bronchiolar epithelium and the alveolar epithelium . in some cases , in addition , reactivity for surfactant proteins was also found in the alveolar spaces and in the bronchiolar lumen . the expression of spa showed no marked differences when compared with pro - spb expression . for this reason , the results of the two surfactant proteins will be reported separately . immunostaining for spa was detected in 18 out of 40 ( 45% ) lungs in the bronchial epithelium ( table 1 ) . this surfactant protein was expressed in the cytoplasm of scattered epithelial cells that , at morphology , did not differ from the neighboring bronchial epithelial cells ( figure 2 a - d ) . even though the three cases showing the highest degree of bronchial reactivity for spa ( grade 3 and 4 ) were all at term , on the other hand the expression of this surfactant protein was not strictly related to the gestational age of fetuses and newborns . spa was expressed in two 14-week - old fetuses , but it was not detected in four neonates of 30 weeks . differences were also found among fetuses of the same gestational age : at 21 weeks , one showed grade 2 , another grade 1 positivity , whereas in the other three 21 week - old subjects spa was not found ( table 1 ) . immunoreactivity for spa was observed in 21 cases ( 52% ) in the bronchiolar epithelium , spa being detected in the cytoplasm of scattered cells intermingled between the epithelium covering the small airways ( figure 2 e - h ) . the expression of spa in the bronchioles was not strictly related to the gestational age : in particular , fetuses ( see 21 weeks ) and neonates ( see 30 weeks , table 1 ) of the same gestational age showed significant differences among them regarding the expression or not of the protein in the bronchiolar lining cells . the highest levels ( grade 4 ) of immunostaining for bronchiolar spa have been observed in infants born at 39 - 40 weeks of gestation ( table 1 ) . iii ) the alveolar expression of spa appeared later : the first mild reactivity on the alveolar epithelium was detected in three fetuses of 21 weeks of gestation , other two fetuses carrying the same gestational age being negative at alveolar level ( table 1 ) . the expression of spa in the alveolar epithelial cells was not related to gestational age : grade 3 of immunostaining was found at 22 , 33 , 36 and 40 weeks of gestation . changes were also found in newborns of the same gestational age : in 39 week - old neonates , alveolar reactivity for spa ranged from grade 1 to grade 4 , whereas a newborn of 41 weeks showed grade 2 immunostaining ( table 1 ; figure 2 i - l ) . this surfactant protein was found , at bronchial level , in 20 out of 40 cases analyzed ( 50% ) ( table 1 ) . pro - spb protein was expressed in the cytoplasm of scattered cells intermingled between the bronchial epithelium ( figure 3 a - d ) . moreover , the highest levels of pro - spb bronchial expression ( grade 3 ) were observed at different gestational ages , ranging from 21 up to 40 weeks ( table 1 ) . scattered pro - spb - reactive cells were found in 20 out of 40 cases ( 50% ) ( figure 3 e - h ) . pro - spb expression in the small airways was first found in two 14 week - old fetuses . it was not correlated with the gestational age and was frequently different even in fetuses and newborns of the same age . in 30 week - old newborns , the degree of pro - spb immunoreactivity ranged from 0 to 2 ( table 1 ) . the expression of pro - spb in the alveolar epithelium was first observed at 21 weeks of gestation . immunoistaining for pro - spb appeared as a thin reactive layer covering the surface of the alveolar epithelium ( figure 3 no correlation ( p>0.05 ) was found between pro - spb alveolar reactivity and gestational age . the highest degree ( grade 3 ) of pro - spb immunostaining was detected at different gestational ages , ranging from 25 up to 39 weeks of gestation ( table 1 ) . when spa and pro - spb expression were compared , marked differences were detected between their expression in all three lung compartments examined . at bronchial level ( figure 4 ) , pro - spb showed a higher degree of reactivity in 11 cases , whereas spa was more expressed in 6 cases . in some subjects , the two surfactant proteins showed striking differences regarding their expression : in a 40 week - old newborn , the low degree of reactivity for pro - spb grade 1 contrasted with grade 4 for spa . marked differences between the two surfactant proteins in the same lung were also observed in the small airways : a predominant expression of spa on pro - spb , grade 4 to 1 and grade 4 to 2 , was observed in bronchioles of two at term newborns of 40 weeks , whereas the other 40 week - old neonates showed a equal expression of pro - spb at bronchiolar level ( figure 5 ) . the inter - individual variability in surfactant protein expression at bronchiolar level is well evidenced by two preterms of 36 and 38 weeks of gestation : in the younger , spa and pro - spb were highly expressed ( grade 3 ) ; in the 38-old newborn , an opposite pattern was present , characterized by lack of expression of pro - spb and spa ( figure 5 ) . different patterns of expression were also found regarding the expression of spa and pro - spb at alveolar level ( figure 6 ) . whereas the highest values of spa expression ( grade 4 ) were concentrated in the last weeks of gestation , pro - spb expression appeared more irregular , its highest values ( grade 3 ) being detected at different gestational ages , ranging from 25 to 39 weeks of gestation ( figure 6 ) . the marked interindividual variability in the expression of these two surfactant proteins is well evidenced by the analysis of the five 30 week - old neonates : one was devoid of both proteins ; two showed grade 1 reactivity for spa and absence of pro - spb ; the other two were characterized by a marked expression of pro - spb ( grade 3 ) in the absence of any reactivity for spa ( figure 6 ) . the other newborn carrying the same gestational age ( 30 weeks ) , showed a completely opposite pattern : the strong expression of pro - spb ( grade 3 ) contrasted with the absence of any alveolar reactivity for spa . statistical analyses evidenced a significant and positive correlation ( r=0.65 ; p<0.01 ) between the expression of alveolar spa and gestational age . in fact , in spite of the interindividual variability at all gestational ages , the highest values ( 3 and 4 ) are more frequent in the last months of gestation , starting from the 31 week , whereas 0 values are more concentrated in the first weeks ( figure 7 ) . the association between spa expression and gestational age ( r=0.63 ; p<0.01 ) was confirmed when subjects were subdivided into three groups according with the different gestational age : early ( 14 - 21 weeks ) , intermediate ( 22 - 30 ) and late ( 31 - 41 ) ; 75% of fetuses included in the early group did not show any reactivity for spa ; the percentage of non reactive cases was 55% in the intermediate group and 10% in the late group ( figure 7 ) . with regard to spa values in bronchi and bronchioles , and pro - spb values in all pulmonary compartments of fetuses and newborns , statistic analyses confirmed the absence of any significant correlation with gestational age . i ) bronchial reactivity . immunostaining for spa was detected in 18 out of 40 ( 45% ) lungs in the bronchial epithelium ( table 1 ) . this surfactant protein was expressed in the cytoplasm of scattered epithelial cells that , at morphology , did not differ from the neighboring bronchial epithelial cells ( figure 2 a - d ) . even though the three cases showing the highest degree of bronchial reactivity for spa ( grade 3 and 4 ) were all at term , on the other hand the expression of this surfactant protein was not strictly related to the gestational age of fetuses and newborns . spa was expressed in two 14-week - old fetuses , but it was not detected in four neonates of 30 weeks . differences were also found among fetuses of the same gestational age : at 21 weeks , one showed grade 2 , another grade 1 positivity , whereas in the other three 21 week - old subjects spa was not found ( table 1 ) . immunoreactivity for spa was observed in 21 cases ( 52% ) in the bronchiolar epithelium , spa being detected in the cytoplasm of scattered cells intermingled between the epithelium covering the small airways ( figure 2 e - h ) . the expression of spa in the bronchioles was not strictly related to the gestational age : in particular , fetuses ( see 21 weeks ) and neonates ( see 30 weeks , table 1 ) of the same gestational age showed significant differences among them regarding the expression or not of the protein in the bronchiolar lining cells . the highest levels ( grade 4 ) of immunostaining for bronchiolar spa have been observed in infants born at 39 - 40 weeks of gestation ( table 1 ) . iii ) the alveolar expression of spa appeared later : the first mild reactivity on the alveolar epithelium was detected in three fetuses of 21 weeks of gestation , other two fetuses carrying the same gestational age being negative at alveolar level ( table 1 ) . the expression of spa in the alveolar epithelial cells was not related to gestational age : grade 3 of immunostaining was found at 22 , 33 , 36 and 40 weeks of gestation . changes were also found in newborns of the same gestational age : in 39 week - old neonates , alveolar reactivity for spa ranged from grade 1 to grade 4 , whereas a newborn of 41 weeks showed grade 2 immunostaining ( table 1 ; figure 2 i - l ) . this surfactant protein was found , at bronchial level , in 20 out of 40 cases analyzed ( 50% ) ( table 1 ) . pro - spb protein was expressed in the cytoplasm of scattered cells intermingled between the bronchial epithelium ( figure 3 a - d ) . moreover , the highest levels of pro - spb bronchial expression ( grade 3 ) were observed at different gestational ages , ranging from 21 up to 40 weeks ( table 1 ) . scattered pro - spb - reactive cells were found in 20 out of 40 cases ( 50% ) ( figure 3 e - h ) . pro - spb expression in the small airways was first found in two 14 week - old fetuses . it was not correlated with the gestational age and was frequently different even in fetuses and newborns of the same age . in 30 week - old newborns , the degree of pro - spb immunoreactivity ranged from 0 to 2 ( table 1 ) . the expression of pro - spb in the alveolar epithelium was first observed at 21 weeks of gestation . immunoistaining for pro - spb appeared as a thin reactive layer covering the surface of the alveolar epithelium ( figure 3 i - l ) . no correlation ( p>0.05 ) was found between pro - spb alveolar reactivity and gestational age . the highest degree ( grade 3 ) of pro - spb immunostaining was detected at different gestational ages , ranging from 25 up to 39 weeks of gestation ( table 1 ) . when spa and pro - spb expression were compared , marked differences were detected between their expression in all three lung compartments examined . at bronchial level ( figure 4 ) , pro - spb showed a higher degree of reactivity in 11 cases , whereas spa was more expressed in 6 cases . in some subjects , the two surfactant proteins showed striking differences regarding their expression : in a 40 week - old newborn , the low degree of reactivity for pro - spb grade 1 contrasted with grade 4 for spa . marked differences between the two surfactant proteins in the same lung were also observed in the small airways : a predominant expression of spa on pro - spb , grade 4 to 1 and grade 4 to 2 , was observed in bronchioles of two at term newborns of 40 weeks , whereas the other 40 week - old neonates showed a equal expression of pro - spb at bronchiolar level ( figure 5 ) . the inter - individual variability in surfactant protein expression at bronchiolar level is well evidenced by two preterms of 36 and 38 weeks of gestation : in the younger , spa and pro - spb were highly expressed ( grade 3 ) ; in the 38-old newborn , an opposite pattern was present , characterized by lack of expression of pro - spb and spa ( figure 5 ) . different patterns of expression were also found regarding the expression of spa and pro - spb at alveolar level ( figure 6 ) . whereas the highest values of spa expression ( grade 4 ) were concentrated in the last weeks of gestation , pro - spb expression appeared more irregular , its highest values ( grade 3 ) being detected at different gestational ages , ranging from 25 to 39 weeks of gestation ( figure 6 ) . the marked interindividual variability in the expression of these two surfactant proteins is well evidenced by the analysis of the five 30 week - old neonates : one was devoid of both proteins ; two showed grade 1 reactivity for spa and absence of pro - spb ; the other two were characterized by a marked expression of pro - spb ( grade 3 ) in the absence of any reactivity for spa ( figure 6 ) . the other newborn carrying the same gestational age ( 30 weeks ) , showed a completely opposite pattern : the strong expression of pro - spb ( grade 3 ) contrasted with the absence of any alveolar reactivity for spa . statistical analyses evidenced a significant and positive correlation ( r=0.65 ; p<0.01 ) between the expression of alveolar spa and gestational age . in fact , in spite of the interindividual variability at all gestational ages , the highest values ( 3 and 4 ) are more frequent in the last months of gestation , starting from the 31 week , whereas 0 values are more concentrated in the first weeks ( figure 7 ) . the association between spa expression and gestational age ( r=0.63 ; p<0.01 ) was confirmed when subjects were subdivided into three groups according with the different gestational age : early ( 14 - 21 weeks ) , intermediate ( 22 - 30 ) and late ( 31 - 41 ) ; 75% of fetuses included in the early group did not show any reactivity for spa ; the percentage of non reactive cases was 55% in the intermediate group and 10% in the late group ( figure 7 ) . with regard to spa values in bronchi and bronchioles , and pro - spb values in all pulmonary compartments of fetuses and newborns , statistic analyses confirmed the absence of any significant correlation with gestational age . the surfactant complex plays multiple relevant roles in the early phases of human development , protecting the fetus during gestation and the newborn at birth . the multiple surfactant components decrease alveolar surface tension , bind and inactivate bacteria and viruses , facilitate their phagocytosis by alveolar macrophages and modulate inflammation by decreasing harmful inflammatory responses . as a consequence , surfactant deficiency at birth , due to lack of mature alveolar type ii epithelial cells , is associated with the development of respiratory distress syndrome ( rds ) and hyaline membrane disease . in recent years , surfactant dysfunction due to multiple mechanisms including protein leakage into alveolar spaces and meconium inhalation has been associated with the insurgence of acute respiratory distress syndrome ( ards ) in pediatric patients affected by pneumonia and severe bronchiolitis . given the relevant role of a proper surfactant synthesis and secretion in the optimal development of the human lung , this study was aimed at improving the knowledge on the timing of the production of two main surfactant components , spa and pro - spb , during gestation . our data first evidence a marked interindividual variability in the expression of both spa and pro - spb among the 40 fetuses and newborns analyzed . this variability regards surfactant protein expression in three pulmonary compartments , including bronchial , bronchiolar and alveolar epithelium . high degrees of spa and pro - spb bronchial and/or alveolar expression were found in some fetuses at very early gestational ages ( 21 weeks ) , suggesting their definition as fast surfactant producers ; on the other extreme of the spectrum , the absence or a very low level of expression was detected in at term babies , indicating the existence of late surfactant producers . marked interindividual variability was observed in the cases with surfactant administration as well , even at the same gestational age , for example cases 26 , 27 and 30 , all at 30 weeks , showed too many differences in the grading of the expression either of spa and pro - spb . in fact this 7 cases were not enough to allow us any speculation of the specific therapy . statistical analyses evidenced a significant correlation between surfactant expression and gestational age restricted to spa alveolar secretion . no correlation with gestational age was found between spa bronchial and bronchiolar expression and pro - spb expression . these data taken together indicate that other genetic or epigenetic factors may influence significantly surfactant protein production , leading to marked differences in spa and pro - spb expression in the newborn lungs . regarding the timing of surfactant protein production during the intrauterine life , in this study both spa and pro - spb were first detected in bronchial and bronchiolar epithelium at 14 weeks of gestation , confirming previous data from xu et al . the first expression at alveolar level of both spa and pro - spb was observed starting from the 21 week of gestation : this finding suggests , a more precocious production than previously reported by endo et al . and by khoor et al . the synthesis of spa and pro - spb appears , on the basis of our data , completely independent . only in few cases , moreover , given the major role played by pro - spb in lung function in the perinatal period , an interesting datum emerging by our study is the detection of low pro - spb levels in the majority of newborns with more than 29 weeks of gestation . among 15 neonates aging 30 - 41 weeks , seven did not show any reactivity ( grade 0 ) , three showed grade 1 , two had grade 2 , three had grade 3 , and none showed grade 4 reactivity . these findings may suggest a prevalent postnatal production of pro - spb , at least in the majority of neonates . in conclusion , our data clearly indicate that the production of two components of the human surfactant complex , spa and pro - spb is characterized by a marked interindividual variability . these findings suggest that a reduced surfactant synthesis may occur during gestation , probably due to a delay in maturation or to injury of type ii pneomocytes and/or bronchial and bronchiolar epithelial cells . further studies should be aimed at analyzing the pathways by which type ii cells might be injured during gestation , ending with a decrease or with the absence of one or multiple surfactant components at birth .

most case reports are of ingestion of sharp objects that can be retrieved by indirect laryngoscopy or flexible endoscopy in the majority of cases . foreign bodies have been found to migrate to the pancreas from the gastrointestinal ( gi ) tract . presentation varies widely from a 45-year - old man who was asymptomatic by clinical and laboratory data , to a 39-year - old man with pancreatitis , gastric varices , and splenic artery pseudoaneurysm , to a 60-year - old female who presented with what appeared to be locally advanced pancreatic carcinoma . also , reports exist of foreign body migration to the liver as well as into the pancreas . there are isolated reports of complications of fish bone ingestion including perforation to the pharynx , esophagus , stomach , small intestine , meckel 's diverticulum , and colon . there have been published reports of laparoscopic removal of foreign objects , such as sewing needles from a pelvic cul - de - sac , intrauterine devices , and a broken intraperitoneal catheter . however , only one report has been made of laparoscopic removal of fish bone from the head of the pancreas . we report the successful laparoscopic removal of a piece of wire that had perforated the stomach and migrated into the head of the pancreas , resulting in a peripancreatic abscess . a 44-year - old man presented to our hospital on september 2 , 2005 with epigastric pain . his white blood cell ( wbc ) count was 16.1 ; hemoglobin ( hgb ) , 14 ; amylase 119 ; lipase 190 ; his urinalysis ( ua ) was negative . a computed tomographic ( ct ) scan of the abdomen and pelvis was performed , and the patient was given the preliminary diagnosis of diverticulitis . . however , the next day , the formal ct scan read showed that he had a foreign body in the gastric body with a peripancreatic abscess ( figure 1 ) . he was admitted to the hospital and reported continued epigastric pain but did not have nausea , vomiting , melena , hematemesis , or recollection of ingesting a foreign body . a gastroenterology consult was obtained , and an attempted esophagogastroduodenoscopy with endoscopic ultrasound for guidance was performed to remove the foreign body . this was unsuccessful , and the patient agreed to undergo a laparoscopic removal of the pancreatic foreign body . a hyperdense foreign body is present in the posterior wall of the stomach migrating into the head of the pancreas ( black arrow ) . we approached the foreign body and abscess cavity by gaining entrance to the lesser sac through the gastrocolic ligament . the posterior antrum of the stomach was dissected off the head of the pancreas , until a small abscess cavity was found near the head of the pancreas . this abscess was entered , and a small amount of pus was irrigated from the cavity . further dissection revealed a small black wire that was removed with a maryland grasper ( figure 2 ) . we presumed that a gastric perforation was present in this area , so dilute methylene blue solution was instilled into the stomach , which failed to detect a perforation . an omental flap was raised and brought up in a retrogastric manner and secured with a single intracorporeal suture . the patient 's amylase and lipase peaked to 341 and 375 , respectively , on postoperative day 1 , but went down to 81 and 57 on postoperative day 3 . after tolerating a diet , the patient 's drain was removed , and he was discharged home on postoperative day 3 . at 2-week follow - up , he was symptom free . previous reports suggest that if the patient has no symptoms , then they can be observed and followed by repeated clinical examinations and plain abdominal films . however , if the patient becomes symptomatic or has disturbances in the gi tract , then further intervention is warranted . most case reports are of patients who have psychiatric illness , developmental immaturity , altered level of consciousness , or who ingest high - risk foods ; most patients remember what they ingested . when the foreign body has sharp ends at one or both ends , the risk of perforation increases . the site of perforation occurs at points of narrowing or angulation in the gi tract , such as the cricopharyngeal ring , aortic arch , lower esophageal sphincter , pylorus , duodenal curve , ligament of treitz , iliocecal valve , appendix , or the rectosigmoid junction . many case reports are of penetration into the pancreas , which suggests that the narrowing of the pylorus may be the mechanism by which foreign objects penetrate into the pancreas . there have been reports of foreign body ingestion with subsequent removal through open techniques ; however , only one other report exists of laparoscopic removal of a foreign body from the pancreas . the smaller abdominal incisions result in decreased risk of infection and dehiscence , less postoperative pain , and faster recovery time . many abdominal and pelvic surgeries , such as adrenalectomies , colectomies , esophagectomies , and hysterectomies , are now being performed laparoscopically . some argue that visualization for certain procedures , such as the nissen fundoplication , is made easier with the laparoscopic technique . for removal of foreign bodies , the magnified view from the laparoscope aids in visualization of small structures , and the reflected light can aid in differentiation between metallic foreign bodies and the surrounding tissues . in our case , we were able to visualize and enter the lesser sac with careful dissection to locate and remove the wire in the pancreas . since many foreign bodies migrate to the pancreas , a laparoscopic approach may be beneficial over open procedures because it allows the surgeon to approach the lesser sac with minimal manipulation of surrounding tissues while being aided by optimal magnification and illumination . our successful laparoscopic retrieval of a pancreatic foreign body provides a basis for further innovative thinking for complicated surgical problems , and emphasizes the need to incorporate minimally invasive techniques into the practice of all surgeons .

in 2011 in cambodia , environmental samples were collected from 4 lpms each week for 7 weeks , including during the khmer new year festival ( figure 1 ) . two of the markets were in phnom penh , the capital city : orussey market ( m1 ) and chamkar doung market ( m2 ) , which also served as an overnight resting place and a place to keep unsold birds from various markets . the third market ( m3 ) was in takeo ( takeo province ) , and the fourth ( m4 ) was in kampong cham ( kampong cham province ) . local chickens , sampov ( domesticated mallards ) , and kaki campbell ducks ( domesticated muscovy ducks ) were the only live poultry observed in the markets . other poultry species were usually available only upon customer request , or they were sold dead . prevalence of influenza a(h5n1 ) virus positive environmental samples from live poultry markets , by collection week , during the khmer new year festival , cambodia , 2011 . m1 , orussey market ( phnom penh ) ; m2 , chamkar doung market ( phnom penh ) ; m3 , takeo market ( takeo province ) ; m4 , kampong cham market ( kampong cham province ) . samples positive for the matrix , hemagglutinin 5 , and neuraminidase 1 genes by quantitative real - time reverse transcription pcr were considered positive for subtype h5n1 virus . in rare instances , neuraminidase 1negative samples that were positive for the matrix and hemagglutinin genes were considered positive for subtype h5n1 virus . during the study , we observed that chickens and ducks were mixed together in cages or stalls . in each market , we collected environmental samples from 45 poultry cages or from stalls where poultry were gathered . from each sampling site , we collected the following into sterile 50-ml tubes : 50 ml of water used by poultry for drinking , 50 ml of water used to wash carcasses or found on the floor near the slaughtering area , 4050 g of soil / mud , and 23 g of fresh feces present on the soil . feathers ( 1020 g ) dropped by birds were gathered and placed in sterile plastic bags . virus in water , soil , and mud samples was concentrated , as described ( 6,12,13 ) , in the biosafety level 3 laboratory at institut pasteur , phnom penh . samples were then tested by quantitative real - time reverse transcription pcr ( qrt - pcr ) targeting the matrix ( m ) , hemagglutinin 5 ( h5 ) , and neuraminidase 1 ( n1 ) genes . feces and feather samples were homogenized with sterile phosphate - buffered saline before nucleic acid extraction and testing . samples were considered subtype h5n1 virus positive if qrt - pcr was positive for the m , h5 , and n1 genes . the n1 qrt - pcr we used is less sensitive than those used for detection of the m and h5 genes . free embryonated hen eggs for virus isolation ( 6 ) . of 502 samples collected , 90 ( 18% ) were positive for subtype h5n1 virus by qrt - pcr , and 10 ( 2% ) were positive by virus isolation ( table ) . we did not detect > 1 positive sample at a time in each cage sampled ; thus , each positive sample corresponded to 1 contaminated sampling site . no correlation was observed between viral load measured by qrt - pcr and the ability to isolate the virus in eggs . the overall positivity rate for detection of rna was > 20% for water , feather , and soil / mud samples ; the rate was significantly lower for feces samples ( 6% ; p<0.05 ) ( table ) . the virus was isolated from 8 ( 6% ) water samples and 2 ( 2% ) soil / mud samples . * qrt - pcr , quantitative real - time reverse transcription pcr ; m1 , orussey market in the capital city of phnom penh ; m2 , chamkar doung market in phnom penh ; m3 , a market in takeo , takeo province ; m4 , a market in kampong cham , kampong cham province . free embryonated hen eggs for virus isolation . the percentage of samples that were positive was significantly different ( by test ) for feces vs. water ( p = 0.0007 ) , feces vs. soil / mud ( p = 0.0003 ) , and feces vs. feathers ( p = 0.0005 ) . the percentage of samples that were positive was significantly different ( by test ) for water vs. feces ( p = 0.001 ) and water vs. feathers ( p = 0.009 ) . the percentage of environmental samples that were positive was significantly different ( by test ) for m4 vs. m1 ( p = 0.002 ) , m4 vs. m2 ( p = 0.002 ) , and m4 vs. m3 ( p = 0.0008 ) . compared with the market in kampong cham ( m4 ) , the markets in phnom penh and takeo ( m13 ) had a higher percentage of samples positive for h5n1virus ( 8% vs. > 20% ; p<0.05 ) . overall , the level of environmental viral contamination in lpms was highest at the beginning of the study ( i.e. , 4 weeks before the khmer new year , when poultry sales began for the annual festival ) and corresponded with intense movement of poultry within the country and higher densities of poultry populations on farms ( 2,4 ) ; contamination levels tended to progressively decrease , reaching low levels 2 weeks after the event ( figure 1 ) . the full genomic sequence of 4 strains and the hemagglutinin sequence of 3 other isolates were generated ( genbank accession nos . phylogenetic analyses showed that the virus strains detected during this study belong to lineage 6 , a group of viruses that seems to be endemic to cambodia ( 14 ) ( figure 2 ) , and not to lineage 5 , a more regional group of viruses that was also circulating in cambodia at that time and that includes strains originating from cambodia and vietnam . sequence analyses did not detect reassortment events or mutations associated with higher virulence or increased transmission to humans . sequences for a virus detected in march 2011 in m3 ( takeo ) clustered with sequences for strains isolated from 2 subtype h5n1 virus infected humans in february near phnom penh and in april in prey veng province , respectively . this finding suggests that the strain detected in takeo was part of a phylogroup that circulated in different regions of the country for several months . sequences for that strain did not cluster with those for the isolates from humans in phnom penh and prey veng province ; however , the strain shared a high degree of homology with a strain detected a week later in phnom penh , suggesting the cocirculation in markets of strains with different origins . phylogenetic relationship of the hemagglutinin ( ha ) gene among various influenza a(h5n1 ) strains ; ha sequences for 48 strains ( 36 from cambodia , 11 from vietnam and one from china ) were included in the analysis . black triangles indicate viruses detected during this study of environmental samples from live poultry markets in cambodia . phylogenetic trees were generated by using the distance method and applying the neighbor - joining algorithm with bootstrap analysis ( 1,000 replicates ) . the trees were rooted to a / goose / china / guangdong/1/96 ( h5n1 ) . lineage numbers 16 , clades , and subclades indicate strains that are grouped in closely related phylogenetic lineages , as described ( 14 ) . hpai a(h5n1 ) virus circulation in cambodia has traditionally been monitored by using the moderately sensitive egg inoculation method to test cloacal and tracheal swab samples from birds randomly selected from lpms or farms . our results show that a more effective approach especially before and during the main annual festivals , when the movement of poultry within the country is increased would be to use highly sensitive qrt - pcr to test environmental samples from lpms . in our study , water samples proved to be the best choice for isolation of infectious subtype h5n1 virus ( table ) . the lower detection rate of virus among feces samples was expected because the analysis of such samples represents viral shedding by only 1 or a few birds . available sequence data from other surveillance efforts indicate that all strains detected in this study originated in cambodia . in cambodia , birds not sold the same day they arrive at a live poultry market are transported to an overnight resting place , which is sometimes another market ( 7 ) . such movement of poultry could increase exposure to environmental contamination with hpai a(h5n1 ) virus and thus contribute to virus spread among poultry . it is not known what effect the high levels of hpai a(h5n1 ) virus contamination in lpms in cambodia have on human health ; the effect should be evaluated by conducting clinical and serologic surveillance of vendors and poultry workers .

we used commercial single - layer graphene samples ( ted pella inc . , redding / ca 21712 - 5 pelco ) grown with chemical vapor deposition and deposited on sinx transmission electron microscopy grids with a regular pattern of holes with an approximate diameter of 2.5 m . fully and partially sputtered areas were written on different single - layer graphene samples using a focused beam of 35 kev ga ions ( raith ionline fib ) . the beam size was approximately 2030 nm , and the writing was performed in a linelike fashion with a step size of 1 nm and a dwell time of 0.0179 ms for the partially sputtered areas , which were later confirmed to be amorphized . for fully sputtered areas , the dose was 3800 pc / cm ( dwell time of 0.0482 ms ) . for the sample with the lower dose , a pattern of 27 6 slits , each 500 nm long , and separated 100 nm from each other , was designed to completely cover the 2.5 m substrate holes in an area fully covered by graphene . the whole pattern was milled into the holes by taking a fib image of a 30 30 m area covered with graphene ( with as short as possible exposure to the beam to avoid additional damage to the graphene ) and fitting the pattern onto the holes . the sem image in figure 1a was recorded with jeol 6700f sem and the tem image in figure 1b with a table top delong instruments lvem5 microscope . the device is equipped with a cold field emission gun , which was operated at 60 kv in ultrahigh vacuum ( 5.3 10 mbar at the sample ) . a medium angle annular dark - field detector was used to record the images . at the end of the experiment , we let air into the microscope column under a parallel electron beam to partially remove the contamination and to test the chemical reactivity . the pressure was increased over a period of an hour to 1.1 10 mbar . in nonirradiated areas , this procedure uncovered pristine graphene . in the amorphized parts , the chemical processes lead additionally to the appearance of pores .

worldwide , colorectal cancer is the fourth most common cancer in men and the third most common cancer in women . each year more than 1 million new diagnoses are made and more than 500,000 die of the disease ( 1 ) . similarly , in korea , colorectal cancer is a major cause of morbidity and mortality . the majority of colorectal cancers arise from preexisting adenomatous polyps ( 2 ) , which can be classified as diminutive ( 5 mm ) , small ( 6 - 9 mm ) , sub - centimeter ( < 10 mm ) , or large ( 10 mm ) ( 34 ) . ( 3 ) in an analysis of four studies , which included 20,562 screening subjects , found that advanced adenoma was detected in 1,155 ( 5.6% ) , and that diminutive , small , and large polyps accounted for 4.6% , 7.9% , and 87.5% respectively . in another study , advanced adenoma among small polyps was found to be relatively common ( rates ranged from 6.6% to 12.5% ) , which was primarily attributed to the presence of villous features ( 56 ) . however , a change in the paradigm of the western colonoscopic management of diminutive colorectal polyps was suggested recently . this is new strategy , which is referred to as the ' predict - resect - and - discard ' policy , involves dispensing with postpolypectomy pathological examinations to improve the cost - effectiveness of screening colonoscopy ( 78 ) . according to the widely accepted adenoma - carcinoma sequence , which can explain > 80% of colorectal cancers development , colorectal cancer screening of average - risk adults colonoscopy enables detection and removal of precancerous lesion , and may effectively prevent up to 90% of colorectal cancers ( 910 ) . recently , due to the increased use of colonoscopy for health promotion , the detection rates of diminutive and small polyps are showing rapid increases . previous studies on colorectal polyp in korea have almost all focused on large polyps ( 10 mm ) . in the present study , we investigated the clinicopathological characteristics of diminutive and small polyps and sought to identify the risk factors of advanced adenoma . the medical records of 4,711 patients who underwent first colonoscopy at our hospital from january 2009 to december 2012 were reviewed retrospectively . the exclusion criteria applied were : 1 ) a diagnosis of colorectal cancer or a history of colectomy , 2 ) inflammatory bowel disease and subepithelial lesion or hereditary polyposis syndrome , 3 ) lack on information regarding polyp size and morphology of histologic findings , 4 ) a polyp of 10 mm , 5 ) previous colonoscopy for polypectomy or as a follow - up study . however , cases with confirmed malignancy after biopsy or endoscopic mucosal resection were included in the analysis . polyps were classified into diminutive polyp ( 5 mm ) or small polyp ( > 5 mm and < 10 mm ) . anatomic locations where classified as cecum , ascending colon , transverse colon , descending colon , sigmoid colon , and rectum , and they were reclassified into right side and left side colon polyp . right - sided polyps were defined as proximal to and including the splenic flexure up to cecum , and left - sided polyps were defined as distal to the splenic flexure . patient characteristics , and polyp sizes , gross morphologies , locations , and histologies were evaluated . gross morphologies were classified as pedunculated ( ip ) , subpedunculated ( isp ) , sessile ( is ) , or flat polyp ( iia ) , and histologies as tubular adenoma , tubulovillous adenoma , villous adenoma , intramucosal adenocarcinoma , hyperplastic , lymphoid hyperplasia , and chronic inflammation . we also reclassified colorectal polyps histologically as neoplastic ( adenomatous ) or non - neoplastic ( hyperplastic ) . advanced adenoma was defined as villous or tubulovillous with or without high - grade dysplasia or intramucosal carcinoma that is determined histologically , a size of 10 mm , or > 3 polyps per patient ( 111213 ) . we calculated the proportion of advanced adenomas among small and diminutive polyps and evaluate the risk factors of advanced adenoma in polyps of < 10 mm by comparing patient 's clinical characteristics advanced and non - advanced adenoma . chicago , il , usa ) was used for the analysis and p values of < 0.05 were considered statistically significant . results are expressed as means sds ( continuous variables ) or as percentages ( categorical data ) . differences in clinical characteristics were explored using the test ( categorical variables ) or by analysis of variance ( quantitative variables ) . the study protocol was approved by the institutional review board of yeungnam university hospital ( irb no . the study protocol was approved by the institutional review board of yeungnam university hospital ( irb no . in the study population , the male to female ratio was 1:0.65 and mean age was 56.2 13.0 years . of the 4,711 patients , 2,525 ( 53.6% ) patients were found to have polyps and total 5,058 polyps were detected . of the 5,058 polyps , 93% ( 4,704 ) were < 10 mm , 2,230 polyps ( 47.4% ) were right - sided and had mean size of 4 2 mm . a cold biopsy technique was used for 82.2% of the polyps and the others were removed by standard polypectomy . of the 4,704 polyps sized < 10 mm , adenomatous ( neoplastic ) polyps were detected in 58.7% ( 2,761/4,704 ) ( table 1 ) . of the 2,761 cases , 1,858 were diminutive ( 67.3% ) and 903 were small ( 32.7% ) . regarding , non - neoplastic and other histologies , 16.0% ( 754/4,704 ) were hyperplastic polyps , 24.0% ( 1,129/4,704 ) were attributed to non - specific inflammation , and 1.3% ( 60/4,704 ) to lymphoid hyperplasia . among the 4,704 polyps sized < 10 mm , advanced adenomas were noted in 0.6% ( 28/4,704 ) . among them , 19 had a villous component , 3 were of high - grade dysplasia , and 6 were of adenocarcinoma ( table 2 ) . mean size of advanced adenomas was 6 2 mm , the sessile type was the most common and were most commonly detected in rectum ( table 3 ) m , male ; f , female ; ip , pedunculated polyp ; isp , subpedunculated polyp ; is , sessile polyp ; iia , flat polyp . patients with advanced adenoma were significantly older than non - advanced adenoma group ( 65.4 9.6 vs. 61.2 11.1 , p = 0.03 ) . furthermore , the proportion of males was significantly higher in the advanced adenoma group ( 15:13 vs. 71.4:28.6 , p = 0.038 ) . among 28 advanced polyps sized < 10 mm , 6 were diminutive polyps and 22 were small polyps . advanced adenomas were larger than non - advanced adenoma ( 6 2 mm vs. 4 2 mm , p = 0.005 ) . advanced adenomas were detected in the rectum ( 28.6% ) , a - colon ( 25% ) , and t - colon ( 14.3% ) . however , the distribution of advanced adenomas of < 10 mm was equal for right and left sides ( right : left = 14:14 ) . the shape of advanced adenoma consist of is ( 42.9% ) , iia ( 28.6% ) , isp ( 21.4% ) and ip ( 7.1% ) . there is no meaningful statistical difference in shape and distribution between advanced and non - advanced adenoma ( table 3 ) . histologically , tubulovillous adenoma was noted in 18 ( 64% ) , villous adenoma in 1 ( 4% ) , high - grade dysplasia in 3 ( 11% ) , and adenocarcinoma in 6 ( 21% ) . adenocarcinoma was also noted in 6 patients , and was more common in men ( 4 cases vs. 2 cases , p = 0.024 ) . among the carcinomas , three involved diminutive polyps . adenocarcinoma rates were similar for right and left colons . for small and diminutive polyps , age , gender , and polyp size patients older than 65 had more advanced adenoma ( p = 0.033 , or 2.287 ) , men had a higher risk of advanced adenoma than women ( p = 0.043 , or 2.166 ) , and small polyps had a 6-fold higher risk of advanced adenoma than diminutive polyps ( p < 0.001 , or 6.306 ) . multivariate analysis showed that an age of > 65 , a male gender , and a polyp size > 5 mm were risk factors of advanced adenoma for polyps < 10 mm ( table 4 ) . in the study population , the male to female ratio was 1:0.65 and mean age was 56.2 13.0 years . of the 4,711 patients , 2,525 ( 53.6% ) patients were found to have polyps and total 5,058 polyps were detected . of the 5,058 polyps , 93% ( 4,704 ) were < 10 mm , 2,230 polyps ( 47.4% ) were right - sided and had mean size of 4 2 mm . a cold biopsy technique was used for 82.2% of the polyps and the others were removed by standard polypectomy . of the 4,704 polyps sized < 10 mm , adenomatous ( neoplastic ) polyps were detected in 58.7% ( 2,761/4,704 ) ( table 1 ) . of the 2,761 cases , 1,858 were diminutive ( 67.3% ) and 903 were small ( 32.7% ) . regarding , non - neoplastic and other histologies , 16.0% ( 754/4,704 ) were hyperplastic polyps , 24.0% ( 1,129/4,704 ) were attributed to non - specific inflammation , and 1.3% ( 60/4,704 ) to lymphoid hyperplasia . among the 4,704 polyps sized < 10 mm , advanced adenomas were noted in 0.6% ( 28/4,704 ) . among them , 19 had a villous component , 3 were of high - grade dysplasia , and 6 were of adenocarcinoma ( table 2 ) . mean size of advanced adenomas was 6 2 mm , the sessile type was the most common and were most commonly detected in rectum ( table 3 ) m , male ; f , female ; ip , pedunculated polyp ; isp , subpedunculated polyp ; is , sessile polyp ; iia , flat polyp . patients with advanced adenoma were significantly older than non - advanced adenoma group ( 65.4 9.6 vs. 61.2 11.1 , p = 0.03 ) . furthermore , the proportion of males was significantly higher in the advanced adenoma group ( 15:13 vs. 71.4:28.6 , p = 0.038 ) . among 28 advanced polyps sized < 10 mm , 6 were diminutive polyps and 22 were small polyps . advanced adenomas were larger than non - advanced adenoma ( 6 2 mm vs. 4 2 mm , p = 0.005 ) . advanced adenomas were detected in the rectum ( 28.6% ) , a - colon ( 25% ) , and t - colon ( 14.3% ) . however , the distribution of advanced adenomas of < 10 mm was equal for right and left sides ( right : left = 14:14 ) . the shape of advanced adenoma consist of is ( 42.9% ) , iia ( 28.6% ) , isp ( 21.4% ) and ip ( 7.1% ) . there is no meaningful statistical difference in shape and distribution between advanced and non - advanced adenoma ( table 3 ) . histologically , tubulovillous adenoma was noted in 18 ( 64% ) , villous adenoma in 1 ( 4% ) , high - grade dysplasia in 3 ( 11% ) , and adenocarcinoma in 6 ( 21% ) . adenocarcinoma was also noted in 6 patients , and was more common in men ( 4 cases vs. 2 cases , p = 0.024 ) . among the carcinomas , three involved diminutive polyps . for small and diminutive polyps , age , gender , and polyp size were significantly different for advanced and non - advanced adenoma . patients older than 65 had more advanced adenoma ( p = 0.033 , or 2.287 ) , men had a higher risk of advanced adenoma than women ( p = 0.043 , or 2.166 ) , and small polyps had a 6-fold higher risk of advanced adenoma than diminutive polyps ( p < 0.001 , or 6.306 ) . multivariate analysis showed that an age of > 65 , a male gender , and a polyp size > 5 mm were risk factors of advanced adenoma for polyps < 10 mm ( table 4 ) . colonoscopy studies have reported that colorectal adenoma could be detected 40% in those aged > 50 years ( 1415 ) . in the present study , polyps of < 10 mm constituted the majority ( 93% ) detected by colonoscopy . recently , a ' resect and discard ' strategy was recommended for small polyps based on considerations of cost effectiveness . before such strategy is adopted , we need to be aware of the clinical significance of colorectal polyps of < 10 mm . however , few korean studies on diminutive or small polyps have been reported during the last ten years . accordingly , the aim of the present study was to evaluate the clinical significances of diminutive and small polyps by analyzing clinical characteristics and by determining the frequency of advanced adenoma . in the present study , the overall percentage of polyps of < 10 mm was 93.0% ( 4,704/5,058 ) and of these 58.7% ( 2,761/4,704 ) were adenomatous ( 1,858 diminutive and 903 small ) , which concur percentages obtained in the west . furthermore , the frequency of advanced adenoma determined in the present study was also similar to those determined by previous western studies ( tables 5 and 6 ) ( 51617 ) . colorectal cancer ( crc ) screening aims to reduce crc mortality by identifying and subsequently removing advanced adenoma . however , the frequency of advanced adenoma are rare in diminutive or small polyps , and therefore , the limited clinical significance of polyps of < 10 mm supports the recently proposed ' resect and discard ' strategy ( 718 ) . previously , many authors have suggested that the risk factors of advanced adenoma are strongly associated with polyp size , location ( 192021 ) . and current reports have identified a male gender , old age , obesity , and cigarette smoking as independent risk factors of advanced adenoma ( 192021 ) . in spite of efforts to identify the risk factors of adenomatous colonic polyps , study is lacking regarding the risk factors of advanced adenoma for polyps of < 10 mm . in the present study , polyp size , male sex , and an age of > 65 an advanced age has been previously associated with advanced histology amongst polyps of < 10 mm ( 5622 ) . the american society for gastrointestinal endoscopy ( asge ) has recommended two strategies , namely , a ' predict - resect - and - discard ' strategy without pathological assessment for non - rectosigmoid lesions of < 5 mm and a ' predict - and - do - not - resect ' strategy for rectosigmoid diminutive polyps predicted to be hyperplastic by electronic chromoendoscopy ( ec ) ( 18 ) . these strategies offer cost savings with respect to polypectomy and postpolypectomy pathological examinations in a substantial proportion of cases . however , ec - based strategies require careful reassessment of current postpolypectomy surveillance guidelines ( 23 ) . in the present study , the percentage of hyperplastic polyp in the rectosigmoid colon was 11.0% ( 555/5,058 ) , and most ( 98.2% ) were < 5 mm in diameter . generally , most hyperplastic polyps are small , are found on the left side , and are not associated with an increased risk of colon cancer . therefore , routine comprehensive resection for diminutive or small hyperplastic polyps of the rectosigmoid colon could be unnecessary . however , in korea , a ' predict - resect - and - discard ' strategy could not be adopted because electronic chromoendoscopy data is limited and the technique is not commonly available . according to current western trends , uniform resection of diminutive polyp furthermore , the complete resection rate of subcentimetric lesions by forcep biopsy is not satisfactory and removal might have no clinical meaning . nevertheless , regardless of size , advanced polyps , especially advanced adenoma , should be removed completely . this study was undertaken to determine the proportion of advanced adenomas among diminutive and small polyps and to identify the risk factors of advanced adenoma . in the present study , when polyp size was restricted to < 10 mm , the rate of advanced adenoma was 0.6% , and for diminutive polyps , the rate of advanced adenoma was only 0.1% . although two cases of intramucosal adenocarcinoma were found among diminutive polyps , the clinical significance of diminutive polyps is extremely low when we consider the incidence . however , in countries like korea , where the costs of colonoscopy and polyp resection are relatively low , efforts to detect small and diminutive polyps can be helpful . furthermore , in view of relatively high missing rate of polyp , incomplete resection rates and relatively low medical costs , in korea , meticulous efforts are needed to find and remove polyps of < 10 mm completely , especially in older men with a polyp of > 5 mm . the present study is intrinsically limited by its retrospective nature . in addition , the accuracies of polyp sizes are questionable because they were determined using endoscopic findings . furthermore , the achievement of complete resection was indeterminate in many cases , because resection margins were not detailed in pathologic reports . however , the present study involved a larger cohort than previous studies , and efforts were made to minimize errors having an endoscopist review endoscopic findings . summarizing , in our center , the prevalence of polyps of < 10 mm was 93% , and the advanced adenoma rate for these polyps was 0.6% . polyp size 5 mm , a male gender , and an age of > 65 years are identified risk factors of advanced adenoma for polyps of < 10 mm in this study . although the risk is low , meticulous attention is required to avoid missing and to achieve complete removal of advanced adenoma among polyps smaller than 10 mm , especially in the patients with these three risk factors .

pancreatic cancer is one of the most lethal malignant diseases of the gastrointestinal system and curative resection in pancreatic cancer is essential for long - term survival . with the advance of surgical techniques and perioperative management , conventional pancreatectomy , such as distal pancreatectomy or pancreaticoduodenectomy , is regarded as a safe and effective surgical procedure as a treatment of pancreatic cancer . with active clinical support from interventional radiology , most postoperative pancreatic fistula ( popf ) combined with postoperative fluid collection , bleeding , and abscess formation can be managed in a conservative management.1,2 percutaneous catheter drainage is a common procedure and helpful method for the postoperative management of infected or non - infected abnormal fluid that is collected in the peritoneal cavity.3 however , we recently experienced an unexpected , life - threatening liver laceration immediately after removing a percutaneous drainage catheter from a patient who had a huge fluid collection following distal pancreatosplenectomy for left - sided pancreatic cancer , which became most embarrassing clinical situation to the patient as well as to the surgeons . this unexpected clinical event occurs very rarely , but it still needs to be considered its possibility in the daily practice of pancreatic surgery . a 74-year - old man presented with epigastric pain for 2 months and was diagnosed with pancreatic body cancer through diagnostic imaging studies . computed tomography ( ct ) , endoscopic ultrasonography ( eus ) , and magnetic resonance imaging ( mri ) revealed a 3-cm - sized mass located on the body of the pancreas with suspicious perivascular infiltration around the celiac axis and superior mesenteric artery with distal pancreatic duct dilatation . several endoscopic trials had failed to obtain tissue samples for the pathologic conformation . finally , exploratory laparotomy was performed for tissue diagnosis . no peritoneal metastasis was confirmed after the opening of peritoneum through the midline incision . in opening the lesser sac to evaluate for a pancreatic mass and celiac or sma invasion , a hard pancreatic mass consistent with malignancy dissection of soft tissue around the celiac trunk was performed and the resected tissue was sent to a pathologic laboratory for prompt frozen section biopsy . the patient 's postoperative recovery was uneventful and there was no remarkable postoperative complication . a routine postoperative follow - up imaging using abdomen ct scan was performed on postoperative day 7 , in which there was free - fluid collection of 5.52.2 cm in size ( fig . the pathologic examination confirmed pancreatic ductal adenocarcinoma with lymph node metastasis in 7 out of 19 lymph nodes . the resection margin was free from carcinoma with a 2.5-cm safety margin , but the tangential margin near the superior mesenteric artery was very close to the malignant cells . one month after discharge , a follow - up abdomen ct scan was performed as baseline study for adjuvant chemoradiation therapy , and revealed that a large amount of fluid ( 18 cm in diameter was collected in the right subhepatic space ( fig . therefore , percutaneous drainage for this fluid collection in the subhepatic area was performed through a transhepatic approach . amylase and lipase levels of the drained fluids were reportedly 3,921 u / l and 6,057 u / l , respectively . the amount of drained fluid and the levels of amylase / lipase decreased significantly 1 week after percutaneous drainage . the percutaneous drainage catheter was removed , as usual ; however , after removal of the catheter , the patient presented with severe abdominal pain around the catheter removal site and systolic blood pressure fell to below 60 mmhg . after managing the shock , an emergency ct scan was performed , in which a large , newly developed hematoma with active extravasation of contrast material and severe tearing of the right liver parenchyma was noted , and total collapse of the intrahepatic inferior vena cava due to subcapsular hematoma ( fig . emergency hepatic angiography was performed to identify the bleeding focus and reveled active extravasations of contrast from branches of the right hepatic artery , however , there was no evidence of pseudo - aneurysm formation at the hepatic artery or other major arteries . liver enzymes had dramatically increased to more than 10,000 iu / l after embolization of the hepatic artery . despite of vigorous supportive management in the intensive care unit , he died due to liver failure and cardiovascular complications at 4 days after the bleeding event . popf is regarded as the most critical morbidity after pancreatectomy.5 however , with the advance of interventional radiology , most cases of popf can be successfully managed without an operative approach.1,2 likewise , it is a common practice to recommend percutaneous catheter drainage for abnormal fluid collection following pancreatectomy.3 intraperitoneal fluid collection can be accessed by a direct percutaneous approach or a transhepatic approach . approximately 15% of patients with percutaneous catheter drainage experienced several serious complications , such as infection , bleeding , and non - target catheterization or puncture.4 however , it is extremely rare that catheter removal causes catastrophic liver damage leading to mortality , as shown in this case . two questions remain unanswered in this case patient : first , how did such a large amount of subhepatic , amylase - rich fluid collected ? it is very unusual to find such a quantity of subhepatic fluid that has collected after a left - sided pancreatosplenectomy . in most cases of distal pancreatectomy , abnormal fluid usually collected around the resected pancreatic stump . second , did catheter removal really cause this life - threatening laceration of hepatic parenchyma ? the possibility of complication related to catheter removal seems to be low , but it is still possible . nevertheless , the extent of liver damage was massive and aggressively destructive . therefore we can assume another factor that contributed to worsening this catastrophic process . amylase - rich fluid contacting the liver surface may , somehow , have affected the consistency of the liver parenchyma . there was no evidence of infection in the collected fluid and the cystic fluid looked clear and serous . in addition , pancreatic fistula after distal pancreatectomy is known to be pure leakage of pro - enzyme . it is not clear whether non - activating pancreatic enzymes can really affect hepatic consistency . finally , we can assume the possibility of expanding subcapsular hematoma compressing liver parenchyma from laceration originated from traumatic catheter removal . extensive hemorrhage identified at mainly peripheral side of the liver and collapsed inferior vena cava indicated the possibility of expanding subcapsular hematoma of liver . additionally , early timing of catheter removal before the maturation or granulation of punctured tract within the liver parenchyma could contribute to this extensive hemorrhagic event . the transhepatic approach for percutaneous catheter drainage is regarded as a safe and effective procedure.3 it is largely the responsibility of the interventional radiologist , however , to avoid the potential risk for a lethal complication , such as the one shown in our case . direct percutaneous catheter drainage is more commonly recommended in managing abnormal fluid collection following conventional pancreatectomy . in current clinical practices where percutaneous catheter drainage is common , we suggest that pancreatic surgeons consider the possibility of lethal complication described herein , as it can cause unnecessary morbidity , mortality , and medico - legal problems . prudent decision for timing of catheter removal and meticulous care during procedure can reduce the possibility of major liver injury in patients with percutaneous transhepatic catheter drainage .

small organic osmolytes are molecules that virtually all organisms use to counter cellular stresses . many of these molecules are known to have a profound impact on biological macromolecules and are thus of broad research interest . a debate has been going on for decades about the mechanism of the action of individual types of osmolytes for example , a mixture of five osmolytes counters the combined deleterious effects of high concentrations of salt and urea in mammalian kidneys . the use of a diverse set of osmolytes permits protection of multiple classes of biomolecules from deleterious effects of urea . also , the concentrations of renal osmolytes in vivo do not all seem to scale linearly with the abundance of stressor molecules , again pointing toward synergy as a factor to be considered . here general equations are derived , which are valid beyond osmolytes and proteins . as an illustration we use experimental data on several proteins to determine the cause for synergy in various cases . we start out with a brief discussion of the thermodynamic basis of osmolyte action the concept of preferential interaction . the protein stability data were fit using a stability equation that depends on both osmolytes concentrations:5the m - values for urea ( mu + mutct ) and trimethylamine n - oxide ( tmao ) ( mt + mutcu ) depend mutually on each other s concentration . the populations of the n state , 1/(1 + k ) , and d state , k/(1 + k ) , are weighted by the respective state s signal to obtain the fits shown in figure 1a , as explained previously . markov chain metropolis monte carlo simulations using the absinth implicit solvation model and the opls - aa / l charge set were performed in the canonical ensemble ( t = 288 k for nank47 * , and t = 298 k otherwise ) with a properly adjusted dielectric constant . we modeled explicitly represented na and cl ions sufficient to neutralize the net polypeptide charge . the systems were equilibrated for 30 million steps , and data were collected for at least 70 million steps . such an excluded volume approach can be used for quantifying the thermodynamic effect of inert additives ( governed by hard - core repulsion ) at dilute concentrations . the van der waals volume of tmao plus two water molecules gives an effective spherical radius of only 2.89 for the dihydrate . replacing one or both hydration waters with urea results in 3.24 and 3.54 , respectively . the exclusion of tmao in the presence of urea was calculated , weighing the results obtained for each of these radii by the corresponding population of that species . there are a few examples that show the thermodynamics of proteins in osmolyte mixtures , and synergy is found to exist . tmao has been shown to lessen the m - value of guanidinium chloride ( gdmcl ) for a thermophilic ribonuclease hii by a remarkable 25% per molar concentration of tmao . note that this effect goes beyond the trivially expected stabilization of the protein by tmao , which leads to the requirement to add more gdmcl to reach the transition midpoint concentration c1/2 . tmao decreases the efficiency of gdmcl as a denaturant on top of such simple additivity . an example of synergy between two protein stabilizers is that between glucose and fructose . the thermal stability of ribonuclease a in mixtures of these two osmolytes is less than would be expected from additive contributions of the individual sugars , as seen by comparing the transition midpoint temperatures t1/2 . the causes of such synergistic effects can not be easily identified without knowledge of some additional thermodynamic parameters . therefore , we focus on an example for which all essential data are available , viz . , the effect of mixtures of tmao with urea on the notch ankyrin domains nank17 * and nank47 * and on barnase . figure 1a c shows spectroscopic traces of the three proteins as a function of the osmolyte concentration . a fit to eq 5 reveals that the m - values for urea and tmao depend on each other to different degrees for the three proteins , as seen in table 1 . to be able to compare the synergies ( mut ) with each other , we divide mut by the proteins molecular weight , because m - values scale with the size of the proteins . figure 1d shows that the synergies of the three proteins show a concentration pattern when plotted together . at 0 m urea ( nank47 * ) the synergy starts at a substantial level corresponding to about a 25% change of the m - value for urea between 0 and 1.5 m tmao . this could indicate involvement of denatured state expansion / contraction , because at elevated urea the denatured proteins may converge toward a maximally extended state . then mut would be sampled in a region without expansion / contraction when the transition is observed at a higher urea concentration . urea - induced unfolding at variable tmao concentrations of nank47 * , nank17 * , and barnase ( a c ) . molar tmao concentrations ( from left to right ) are 0 , 1/8 , 1/4 , 3/8 , 1/2 , and 3/4 ( a ) , 0 to 1/2 ( b ) , and 0 to 1 ( c ) . dashed line : tmao - induced folding of nank47*. the points are experimental data and the lines a global fit to eq 5 . the insets show native structures ( 1rnb ( pdb ) and full - length / truncated 1ot8 ( pdb ) ) drawn with chimera . ( d ) dependence of the mw - normalized synergy between urea and tmao on cm of the urea - induced unfolding . there are several possible explanations for the variable degrees of synergy , including a mutual influence of the chemical activities of the various bulk solution species on each other , enhanced exclusion of tmao from the protein surface by a layer of urea that builds up as denaturant is added , or a change in d state excluded volume by chain expansion / contraction with osmolyte concentration . in the following sections we will first analyze where such synergy can come from in principle . then we will investigate the given data to assess how the synergy arises in these specific systems . the m - value can be expressed in two alternative ways which are based on either preferential interaction parameters of solution components with protein , ip , or the relative excess / deficit of each solution component around the protein , ip . as shown in the supporting information , the equation is6for small protein concentration , where p stands for protein , mj is the m - value for component j , and indicates differences between the two protein states , and we define7where ai is the chemical activity of component i. note that the sum excludes water ( component 1 ) in one case and includes it in the other . it reveals that the m - value of a protein transition with respect to component j depends on two major factors : first , m - values depend on the change in protein solvation upon unfolding , ip or ip , with respect to each of the solution components . this factor quantifies the direct interaction of the solution with the protein , and it depends on both the type and the amount of solvent - exposed surface . however , osmolyte - dependent changes in d state compaction can affect m - values through alterations in the amount of exposed area , and this effect seems to play a role in osmolyte synergy as well ( see below ) . second , m - values depend on the degree to which each component s activity coefficient changes with the concentration of the variable component j , ij . this factor is rooted in the interactions in the bulk solution , where the added component can alter how much other components are worth in terms of their chemical activity . note that synergy can thus occur even if the osmolytes act independently of each other at the protein surface , because with increasing concentration of osmolyte type i the term ijciip for that osmolyte is dialed in , thereby modifying mj ( eq 6 ) . on the basis of eq 6 , there are only three extreme cases that could lead to an absence of synergy between two osmolytes : ( 1 ) their chemical activities are independent of each other ( ij = 0 for i j ) . ( 2 ) the change in solvation upon unfolding ( ip ) is zero for both osmolytes ; i.e. , neither of them affects the protein anyway . then synergy may be expected to be the norm , rather than an exception . there are only a few studies of the effects of mixtures of osmolytes on proteins . also , it can be difficult to detect synergy with conventional data analysis methods , even if the synergy is significant . to calculate the individual terms in eq 6 , we need an equation for ip . the other components of eq 6 have been published previously for aqueous urea / tmao . in the supporting information we show exact equations for kp and kp ( eqs s10 and s11 , supporting information ) . for better readability , we use the following three convenient simplifications : the compressibility is negligibly small for our purposes , the change in volume upon unfolding , vp , is small as well ( on the order of less than 0.1 l / mol ) , and we are dealing with dilute protein . in vitro protein concentrations are usually low . typical in vivo conditions involve an abundance of proteins , many of which are present at very low concentrations . therefore , despite high total protein , most individual protein types are dilute . the change in protein solvation upon unfolding , kp , is given by the difference of eq s10 between the n and d states . we obtain8and9where we used mk = rtpk ( eq 4 ) . there is no m1 value ( cf . eq s23 , supporting information ) , and thus , the hydration of the protein 1p needs to be calculated from the other gkp through eq s6 ( supporting information):10 to calculate the solvation behavior around the protein from eqs 8 and 10 , we use the experimental m - values from table 1 along with published activity coefficients . the resulting curves are shown in figure 2 . we first note that up is positive , i.e. urea becomes more accumulated at the protein surface upon unfolding . thus , the water contributes comparatively little to the change in preferential interaction ( eq 3 ) , as pointed out previously . solvation change of nank47 * ( a ) , nank17 * ( b ) , and barnase ( c ) upon unfolding with respect to protein solvation by urea ( up , orange ) , tmao ( tp , red ) , and water ( wp , blue ) . each group of curves represents increasing urea concentration from 0 to 3.5 m in 0.5 m steps ( long to short curves ) . the dashed lines in panel a indicate a solvation pattern that would result in a lack of synergy . panels d f show an estimate for the change of tmao excluded volume upon unfolding vs the radius of gyration of the d state . distributions / averages for tmao dihydrate are shown in black / red . from these solvation data it is also possible to calculate all contributions to the m - values . the right - hand side of eq 6 sums three terms in aqueous solutions of urea and tmao . the general observation is that the primary contribution to the urea mu - values comes from the urea term and that to the tmao mt - values from the tmao term . only upon the addition of osmolyte are the water term and the respective other osmolytes terms dialed in to some degree . the bulk solution contribution to each of the three solvation terms in eq 6 is shown in figure 3 g . urea and tmao enhance each other s chemical activity ( positive ut and tu ) . in the absence of any further consideration , one may therefore be tempted to assume that urea and tmao enhance each others effect on proteins ; i.e. , urea becomes a stronger denaturant and tmao a stronger stabilizer . however , this can not be , because opposite slopes of mu and mt would violate the maxwell relations mentioned above . thus , it is obvious that a more careful analysis of the solvation is necessary . contributions to the m - values of nank47 * ( a , b ) , nank17 * ( c , d ) , and barnase ( e , f ) with respect to urea ( right ) and tmao ( left ) . the m - values are given by the bold dashed line and the various additive terms in eq 6 by orange ( urea ) , blue ( water ) , and red ( tmao ) lines . each group of lines of decreasing length represent increasing concentrations of the other respective osmolyte from 0 to 3.3 m ( urea ) or 2 m ( tmao ) . ( g ) bulk solution terms : dependence of the chemical activities of urea ( u ) , tmao ( t ) , and water ( w ) on the tmao concentration ( ij are defined in eq 7 ) . note that the solid lines add up to zero , as well as the dashed lines ( gibbs duhem relation ) . in figure 3a f the water term , wicwwp , always becomes more positive when urea is added and more negative when tmao is added . the cause for this phenomenon is classical preferential binding / exclusion , as follows . in figure 2a c we see that addition of tmao leads to preferential hydration ( positive wp ) , whereas addition of urea ( going from the longer to the shorter lines ) leads to preferential exclusion of water ( negative wp ) . this makes sense , because accumulation of urea should mean that water becomes excluded and exclusion of tmao that water is accumulated . therefore , wp has the opposite trend compared to both up and tp , but wicw is negative ( water gets diluted upon osmolyte addition ) , so that the water term , wicwwp , always tracks with the effect of the osmolyte that is added . the change in protein solvation by urea upon unfolding , up , is shown in figure 2a c as a group of orange lines representing one urea concentration each . this makes sense , because accumulated ( urea ) and depleted ( tmao ) osmolytes should not interfere with each other at the protein surface . note , however , that up slightly increases as a function of tmao when no or little synergy is observed ( figure 2b , c ) . this can be illustrated also by setting mut to 0 ( figure 2a , dashed lines ) , which results in a clear upward slope for up . it is known that tmao compacts the d state of proteins including nank47 * , which should lead to a reduced accessibility to urea and hence a smaller urea accumulation and a smaller m - value . one may conclude then that in the case of nank47 * ( panel a ) there is more compaction of the d state ensemble with tmao , compared to nank17 * ( panel b ) and barnase ( panel c ) , because nank47 * shows the least increase of up . tmao solvation tp . in the absence of synergy up increases slightly as a function of tmao , and the question is why it increases at all . even if competition between urea and tmao occurred at the protein surface , it would lead to the opposite effect of displacing urea , and not accumulating more of it . also changes in the total surface area would lead to the opposite effect , as discussed in the previous paragraph . what is left as a reason for the increase in up are bulk solution effects . as tmao is added , the chemical activity of urea increases . as a consequence , more urea is driven to the protein surface than normally expected at the same nominal urea concentration . figure 2 shows the change in protein solvation by tmao , tp , as red lines . comparing the solvation of the proteins , there are both similarities and differences . a similarity is that for all three proteins tp changes to a third of its value between 0 and 2 m tmao in the absence of urea . such a pattern is expected for an entity such as tmao that is dominated by hard - core repulsion . a difference between the proteins is that for nank47 * tp becomes more negative by over half its value from 0 to 3.5 m urea in the limit of 0 m tmao , whereas it is only about one - third for the other two proteins . we previously postulated that tmao should become spaced further from the protein in the presence of urea , because the effective size of tmao increases as it becomes solvated by urea . this postulate is clearly consistent with the current observation , but can not be the whole truth since the magnitude of the increase in tmao exclusion is dependent on the type of protein , pointing again to d state contraction / expansion . as tmao can contract d state ensembles of proteins , urea is expected to expand them in general . expansion may not hold for all proteins , but is specifically known to happen in the case of nank47*. a more extended d state results in more exclusion of tmao , which is consistent with the observed enhancement of tp with added urea . for nank47 * , this change in protein tmao solvation is larger than for the other proteins , so the d state of nank47 * likely expands most , just as it contracts most with tmao as discussed above . both d state expansion and increased spacing away of tmao from the protein surface by urea could thus contribute to the observed tp . estimating the contribution of the latter effect is comparably straightforward when considering only hard - core repulsion . tmao exists in solution as a strong dihydrate that is approximately spherical , and the water can be replaced by urea to increase the effective spherical radius . the spherical dimensions of tmao capture its own solvation in aqueous urea fairly well , and simulations indicate that tmao likely interacts with proteins only in a manner mediated by the solvent , as expected for mandatory hydration / urea solvation . in the limit of ideal dilution ( 0 m osmolyte and protein ) , the pt is simply given by the negative of the change in contact volume , when only hard - core repulsion plays a role . the calculation of the n state contact volume is straightforward . to get an estimate for the d state the difference between the d and n state exclusion volumes is shown in figure 2d f . the average exclusion volume , v , for the dihydrate ( red dots ) is close to the corresponding values in panels a c ( 0 also the radius of gyration ( rg ) of about 26 for nank47 * that we find at 15 c makes sense , given that the experimental hydrodynamic radius is 29.5 at 55 c . therefore , the generated ensemble appears to generally make sense , and plain volume exclusion of tmao from the protein is a reasonable assumption . on the basis of the simulated d states , we are now in the position to estimate the contribution of tmao becoming more excluded from the protein by urea functioning as a spacer ( in the absence of d state expansion ) . we obtain about 0.51 l / mol enhancement of tp between 0 and 3.5 m urea using any of the simulated d state structures . this suggests that our original postulate of urea acting as spacers is not sufficient to explain the solvation of proteins by tmao in aqueous urea and that d state expansion needs to be considered . moreover , previous simulations indicated that urea and tmao likely do not interfere with each other at the protein surface . then synergy between urea and tmao is mediated mostly by an increase in total area through changes in the d state ensemble , rather than either bulk solution or surface competition effects . our estimated d state ensembles provide additional qualitative information on the question of why the d state of nank47 * may be more responsive to osmolytes than the other proteins . the ensemble sampled for nank47 * ( figure 2d ) not only covers a broader range than the ensembles sampled for nank17 * and barnase ( figure 2e , f ) , but also has a larger variance in v , which likely enables nank47 * to be much more responsive to changes in solution conditions that favor contraction or expansion . we have only discussed addition of two osmolytes so far , but our equations can be easily extended to any number of interacting components , including specific binding partners . as an illustration , we consider a single binding site on a protein , which is occupied by ligands whose number is given by11where cl is the ligand concentration and kb the binding constant . then because nik = ciik , we have12with such specific interactions , stronger synergies may be expected even at low ligand concentrations , because osmolytes can have significant interactions with free ligands . allosteric effects are an example of the other extreme of synergy solely based on surface effects ( ij ) . we have presented rigorous , yet concise equations that capture the thermodynamic synergy between any number of solution components . these equations show how surface solvation and bulk solution interactions can lead to synergies . using three example proteins , we illustrated the extent to which these various interactions contribute to synergy . the actual interactions of the osmolytes with the surface are not very dependent upon each other , but it is the change in d state exposed area that appears to be mainly responsible for synergy in protein conformational changes .

diabetic patients with or without cardiovascular disease , have a decreased heart rate variability ( hrv ) related to increased mortality risk [ 13 ] hrv is a measure of the imbalance between sympathetic and parasympathetic autonomic activity , and its decrease is a sign of dominance of sympathetic activity . decreased hrv has been shown to be linked with the presence of cardiovascular disease , with the incidence and severity of ischemic heart disease , with the systolic heart failure and has been related with some cardiovascular risk factors . among them , several cross - sectional studies in non - diabetic adults evidenced that markers of autonomic function were negatively associated with fasting glucose , insulin resistance and all components of the metabolic syndrome . cardiovascular risk factors as high blood pressure can also alter heart rate variability . among the studied risk factors are the different components of serum lipids , but the relationship between plasma lipid fractions and hrv have provided less consistent results . some research has suggested that increased serum lipid fractions as ldl cholesterol and total cholesterol were linked to a decreased hrv , although there are still some conflicting results [ 68 ] . so far no correlation has been definitively established between serum triglyceride values and hrv indexes . correlations between serum lipid components and hrv were less studied in diabetic patients than in the general population with cardiovascular risk factors . we raised the question whether these discordant results regarding the relationship between plasma lipid fractions and hrv could be in relation to lipid - lowering therapy applied to the diabetic and dyslipidemic patients . thus , we aimed to investigate the relationship between lipid profile and hrv in diabetic patients with statin associated therapy . we aimed to find out if regardless of serum lipid fractions levels , statins may influence the relationship with hrv also through the direct effect of statin therapy on the atherosclerotic plaque and on ischemia in different vascular territories including coronary arteries . from the original cohort ( 97 diabetic patients ) , we studied an extracted a group of 81 type 2 diabetic patients on statin associated therapy . all patients were admitted to the department of cardiology , rehabilitation hospital cluj - napoca . the study protocol was reviewed and approved by the local institutional review board and the local ethics committee ; an informed consent was obtained from every subject , according to the world medical association declaration of helsinki , revised in 2000 , edinburgh . all patients were holter ecg 24 hours monitored with three channel monitor ( labtech ecg holter monitor ) , and data were analyzed on a commercially available software ( cardiospy pc sw / ev 5.02.06.02 ) . patients were classified as diabetes patients on the basis of history regarding the duration of the disease or need for antidiabetic therapy . the diagnosis has been based on a previous diagnosis of diabetes based on : fasting glucose level > 126 mg / dl on two measures or receiving diet therapy or taking oral antidiabetic therapy or receiving insulin therapy . criteria for inclusion in the study were type 2 diabetic patients with statin associated therapy ( atorvastatin , simvastatin , pravastatin , rosuvastatin ) but without considering the daily dose used at the time of admission in the study . the exclusion criteria were : presence of congestive heart failure , late stage of chronic kidney disease , acute ischemic coronary syndrome , associated antiarrhythmic therapy . blood samples were collected in test tubes , preserved at 4c and delivered to the laboratory department of the rehabilitation hospital cluj - napoca . concentrations of biochemical parameters were determined using specific enzymatic assays on an autoanalyzer olympus au 680 . fasting plasma lipid profile assessed total cholesterol ( tc ) , low - density lipoprotein ( ldl - c ) , high - density lipoprotein ( hdl - c ) , and triglyceride ( tg ) levels . serum tc levels were determined by the enzymatic method , hdl c levels were determined by precipitation with mgcl2 and phosphotungstate method . serum uric acid concentrations were measured by standard analytical method ( uricase enzymatic test ) . in order to evaluate the renal function correctly , estimated glomerular filtration rate ( egfr ) was calculated using the modification diet in renal disease ( mdrd ) equation , based on the concentration of serum creatinine : 175 serum creatinine age 0.742 ( if female ) . the body mass index ( bmi ) , we analyzed holter/24 hours monitoring reports with respect to heart rate variability indexes , arrhythmic events and myocardial ischemia . participants were instructed not to consume caffeinated food and beverages on the day of assessment and were also advised to maintain their usual daily activities . time domain hrv indexes were calculated from 24 h ecg recordings : sdnn ( standard deviation of all nn intervals ) , sdann ( standard deviation of the averages of nn intervals in 5-minute segments ) , rmssd ( square root of the mean of the sum of the squares of differences between adjacent nn intervals ) , pnn50 ( nn count divided by the total number of all nn intervals ) . frequency domain ( spectral ) indexes were then assessed : high frequency power hf ( 0.150.5 hz ) , low frequency power lf ( 0.040.15 hz ) , and the ratio of low frequency to high frequency ( lf / hf ratio ) . the hf component reflects mostly parasympathetic activity and the lf component is mainly related to the sympathetic tone . lf / hf ratio ( during night and day periods ) was calculated for each patient as a measure of sympathovagal balance . myocardial ischemia was diagnosed based on electrocardiographic st changes , including st depression ( descendent or horizontal depression ) more than 0.1mv and 1 min duration , at least two episodes/24 hours . supraventricular ectopic complexes ( pac ) were considered those with normal qrs morphology and were detected by their precocity in the cardiac cycle . complexes considered to be ventricular ectopic complexes were visually analyzed and classified before validation monitoring reports . for the assessment of atrial ectopy we used the following measures : average hourly isolated premature atrial beats ( 30 pac / h ) , number of atrial tachycardia episodes/24h ( at/24 h ) defined as three or more consecutive atrial ectopic complexes with mean rr length < 600 ms / per 24 h at a rate of 100 beats / minute . assessment of ventricular ectopy was performed by measuring : hourly isolated ventricular ectopic beats ( 6 pvc ) , number of paired ventricular beats ( cpl/24 h ) defined as two consecutive ventricular extrasystoles , number of ventricular tachycardia episodes/24h ( vt/24 h ) defined as three or more consecutive ventricular ectopic beats , at a rate of 100 beats / minute , with mean rr length < 600/ms . data were analyzed using the statistical package for social sciences ( spss ) version 17 for windows . skewed data are presented as median [ median ( 1 quartile-3 quartile ) ] . a p value 0.05 for two sided comparisons student s t - test was used for comparison of variables with normal distribution and mann - whitney u was used for comparison of variables with abnormal distribution . univariate analysis was used to evaluate correlations between hrv indexes as dependent variables and hdl - c levels , ldl - c levels , tc , tg . pearson s correlation was used for data with normal distribution , and spearman s correlation was used for variables with abnormal distribution . the main clinical and demographic characteristics of the studied group are shown in table i. table ii shows the mean values sd of serum lipids and fasting blood glucose in the studied group . it is noticed that the mean values of serum tg were slightly elevated , tc levels were close to the limits specified by guidelines for diabetic patients and for patients with cardiovascular diseases , with no significant differences between males and females . serum ldl - c mean values exceeded the levels recommended by american diabetic association ( ada ) and american heart association ( aha ) guidelines ( 100mg / dl ) and substantially exceeded 70 mg / dl recommended as the optimal value for diabetic and cardiovascular patients . serum ldl - c levels were found to be higher than 70 mg / dl in 77 ( 93% ) patients while in 51 ( 62% ) patients ldl - c levels were found to be higher than 100 mg / dl . hdl - c levels were found to be higher in females ( 37.22 10.75 ) compared with males ( 35.36 7.70 ) , with statistical significance ( p=0.00081 ) . we found no strong correlations between any of the hrv indexes and any of the lipid fractions ( table iv ) . overall rmssd and day rmssd showed a negative correlation with tc and ldl - c ; day sdnn and overall sdann showed a negative correlation with tg . hrv indexes analyzed in frequency domain ( lf / hf day ratio , day lfn ) showed a positive correlation with ldl - c and tc and day hfn showed a negative correlation with tc and ldl - c the results of holter monitoring concerning rhythm disorders are shown in table v. all patients presented atrial and/or ventricular arrhythmias on holter ecg . isolated ventricular extrasystoles 6 pvc per hour were detected in 33 ( 40.74% ) patients , with an average of 1054.763425.60/24 hours , ranging from 160 to 25206 . a number of 3 patients ( 3.70% ) presented episodes of non - sustained ventricular tachycardia with 1 to 13 runs , ranging from 6 to 39 beats . as we have already shown , data regarding correlations between serum lipids and heart rate variability are controversial . in the general population , dyslipidemia may be an important factor for the development of autonomic dysfunction . studies have shown that postmenopausal women with decreased values of hrv parameters also present a significant increase of tc , ldl - c and tg values , but insignificant decrease of hdl - c . a previous study found a low hrv in both middle - aged women and men and also indicated that a decreased hrv might predict the incidence of coronary heart disease ( chd ) . on the other hand , a comparative study of plasma lipid profile in relation to hrv tests in healthy young population showed that tc and ldl - c levels were significantly increased in men . the same study showed that hdl - c levels were significantly decreased in men associated with decreased hrv compared with bmi and age matched women . most studies have revealed that decreased hrv , as a strong predictor for chd , was associated with hypercholesterolemia [ 1315 ] . it may be observed that all these studies emphasize that the pathological lipid levels are associated with decreased hrv . regarding diabetic patients , researche on the relationship between serum lipids and hrv is scarce . it has been shown that in diabetic patients , an impaired function of autonomic nervous system , and a decreased hrv have been linked to an increased arrhythmic risk . decreased hrv and sympathovagal imbalance the sympathovagal imbalance has been considered as the main pathophysiological basis of metabolic disorder in diabetes mellitus [ 1619 ] . in the general population hrv shows negative correlations with all cardiovascular risk factors ( overweight , hypertension , smoking , alcohol consumption , high non hdl - c levels ) . age was inversely associated with frequency domain indexes but some studies found this association only in males . hrv consistent values for standard measurements by age and gender in different populations are still not defined . the toronto international consensus recommends the use of a set of hrv measurements ( totaling seven tests ) by adding to the carts another three tests of analysis in the frequency domain [ 2225 ] . an improvement in the autonomic function has been reported in statin associated therapy in chd and hyperlipidemia . on multivariate analysis statin therapy was an independent predictor for an increased hrv [ 2831 ] . regarding the relationship between hrv and statin therapy , studies indicated that after atorvastatin therapy there were no correlations between hrv indexes and ldl - c levels . a study of 37 subjects with combined hyperlipidemia , revealed that hrv indexes in time and frequency domains were improved by both atorvastatin and fenofibrate . the present study aimed to evaluate hrv parameters and lipid profile in diabetic patients regarding the presence of the specific pattern of cardiac autonomic neuropathy in diabetic and dyslipidemic patients with statin - associated therapy and to assess whether there is an improvement in hrv parameters in relation to the reduction of lipid levels . our data suggest that an increased level of tg was associated with a decreased sdnn , considered as a marker of overall hrv . we found that increased levels of ldl - c and tc were associated with decreased rmssd and hfn day indexes , markers of parasympathetic function suggesting that dyslipidemia contributes to an impaired parasympathetic function and these results are in accordance with previous studies regarding general population and type 1 diabetic patients . we found that increased ldl - c and tc levels were associated with increased lfn , considered a marker of sympathetic overdrive . an increased lf / hf day ratio , representing the sympathovagal imbalance was associated with increased ldl - c and tc levels , and these results are in accordance with previous studies regarding the general population . the study of arrhythmic events in relation to statin - associated therapy was not our goal . however , in the studied patients , the risk of arrhythmia is not high considering that malignant arrhythmias were present in a small percentage ( three patients ) . although decreased hrv has been associated with an increased arrhythmic risk and silent myocardial infarction , we could not directly quantify the reduction in overall hrv in our studied group . considering that on holter monitoring reports , we found a small incidence of malignant arrhythmias and we have not found ischemic episodes , we could appreciate that statin - associated therapy may improve hrv and reduce the clinical implications of the decreased hrv . based on the absence of strong correlations between lipid fractions and any of hrv indexes , we may consider that the effect of statins on hrv is more important than the effect derived from reducing the level of serum lipid fractions . considering that it was performed in a single hospital it could be subjected to a bias inherent of this type of study . also , it includes a small number of patients who have fulfilled the inclusion criteria . regarding the assessment of hrv indexes , especially frequency domain indexes , the guidelines of the task force for pacing and electrophysiology recommend optimal conditions as a temperature controlled and quiet room . in our study , these conditions could not be entirely fulfilled . on the other side in the group that we investigated , although serum lipid values exceeded normal values in a significant percentage of patients , the excess was modest and pathological mean values were not high . further research based on prospective studies , are needed to quantify the pleiotropic effects of statins related to hrv in diabetic patients . . this can be an explanation for the small correlations between heart variability and lipid profile in diabetic patients treated with statins and represents another reason to recommend statin therapy in this category of patients .

appendicitis is an inflammation of the appendix , that comprises approximately 25% of the surgical emergency admissions and 40% of the total laparotomy emergencies . the standard treatment for acute appendicitis is the surgical removal of the appendix called appendectomy this may be done by an open incision in the abdomen or through laparoscopy . laparoscopy appendectomy surgeries are increasing daily because of its facilities and advantages such as less postoperative pain , faster recovery , shorter hospital stay , less postoperative complications , and minimally sized incisions / scars . the main concern in laparoscopic appendectomy is the matter of closure of the appendiceal stump or base . therefore , many methods have been recommended and examined for its closure , some of these methods include endoloop , double endoloop , cutting with ultrasonic knife , tying with instrument , metal or plyometric clips , ligator and thread , hemolock , and linear endostapler . linear stapler and endoloop are nowadays often used as alternatives for closing appendiceal stump in laparoscopic appendectomy since they are equally safe . regarding each of these methods , the matter of being economic the main problem with this method is that the knot may be loose due to the surgeon being concerned with the thread breaking when it is pulled . this could lead to the appendiceal stump leaking ; however , if the clips are used , they will not open after being locked ; they may however slip and fall but they are easier to use and they are less expensive . we may not have sufficient stump when stapler is used since its diameter is large and it is possible to damage the secum and cause a leak . many researches have been conducted so far to examine each of these methods ; but there are a few studies that have compared these two methods . therefore , with regard to the importance of this subject , we have compared the two methods of closing the appendiceal stump with endoloop and clips in the present study in terms of the length of operating time , postsurgical complications , and the duration of hospitalization . this prospective randomized clinical trial study was conducted on the patients diagnosed with acute appendicitis applying to the emergency ward of shariati hospital between march 1 , 2013 and may 25 , 2015 . a total of 76 qualified patients who were clinically diagnosed with acute appendicitis , after obtaining informed consent from all patients , randomly were assigned into two groups with 38 individuals in each groups [ figure 1 ] . the exclusion criteria for this research included the following : patients who were in pain more than 4 days , finding a mass in the right lower quadrant area in the examination , phlegmon in images or peritonitis symptoms also the patients who underwent surgeries which turned into open laparoscopic due to adhesion and improper anatomic conditions were excluded from the study ( did not occur in our study ) . almost all patients had inflammation of the appendix , it should also be mentioned that all operations were performed by single surgeon . consort flow diagram of trial three ports were inserted in both groups , two 10-mm ports and one 5-mm port . the mesoappendix was cut with ligasure in both groups and the appendiceal stump was closed with endoclips in one group and with endoloop in the other group , and they underwent laparoscopic appendectomy . the surgery duration was calculated from the time the skin was cut until the time it was closed . the patients were then compared regarding the surgery duration , postsurgical symptoms such as pain , wound infection , and leakage from the appendiceal stump , the hospitalization period , and the need for repeating the surgery . the study was conducted after registration in iranian registry of clinical trials ( irct ) center and approved by the university ethics committee . clinical trial registration number is : irct201507096925n4 . after collecting the essential data using a checklist and examination of patients , the data were analyzed with ibm corp . the continuous variables are reported as means standard deviation , and categorical variables are reported by number and percentage . wilk test , which revealed that the continuous variables showed normal distributions ( p > 0.05 ) . the unpaired t - test was used for comparison of variables between groups . for statistical evaluation of categorical variables the study protocol was either approved by the institutional review board and medical ethics committee of tehran university of medical sciences . the study protocol was also registered with iranian registry for clinical trials ( irct201507096925n4 ; www.irct.ir ) . the study was conducted after registration in iranian registry of clinical trials ( irct ) center and approved by the university ethics committee . after collecting the essential data using a checklist and examination of patients , the data were analyzed with ibm corp the continuous variables are reported as means standard deviation , and categorical variables are reported by number and percentage . wilk test , which revealed that the continuous variables showed normal distributions ( p > 0.05 ) . the unpaired t - test was used for comparison of variables between groups . for statistical evaluation of categorical variables the study protocol was either approved by the institutional review board and medical ethics committee of tehran university of medical sciences . the study protocol was also registered with iranian registry for clinical trials ( irct201507096925n4 ; www.irct.ir ) . in total , 76 patients underwent laparoscopic appendectomy who were randomly divided into two groups , and none of the patients were excluded from the study during the research . the endoclip group consisted of 38 patients ( 18 male , 20 female ; mean age 22 3.69 years ) , and the endoloop group consisted of 38 patients ( 16 male , 22 female ; mean age 24.26 5.99 years ) . overall , based on the findings of our study , the mean age of the all patients was 23.13 5.07 years and 44.7% of the patients were males . no statistically significant differences were detected between the groups in terms of the distribution of age , sex percentage ( p > 0.05 ) . the demographic and clinical outcomes of the two groups ( distribution and significance ) the mean surgery duration was 23.2 min in the endoloop group and 21.5 min in the clips group which indicated a statistically significant difference ( p = 0.021 ) . although this difference value but may not be of much importance clinically . moreover , the mean hospitalization stay was almost the same in the eldoloop and clips groups ( 1.63 days ) , and there was therefore no statistically significant difference between the hospitalization stay of the two groups ( p > 0.05 ) . there were no cases of surgical wound infection and postsurgical complications in the group which used clips , but one infection case was reported in the endoloop groups but this difference was not statistically significant . the two under - study groups were not different regarding the technical complications either but one of case in the clips group experienced the clips falling off . however , the comparison between the two groups indicated that the frequency distribution of pain in the surgery site was different in the two groups [ table 1 ] . about 68% of the patients of the group who had used clips were complaining from pain in the surgery site , but this value was equal to 55% in the endoloop groups ( p < 0.023 ) . it is worth mentioning that no cases of stump leak were seen in the two groups and none of the patients are needed to repeat the surgery . appendiceal stump closure is the most controversial issue in the laparoscopic appendectomy procedure . despite the fact that many authors have described several modifications with new materials for appendiceal stump closure moreover , most of these materials may prolong the operation time or increase cost , which may limit the popularity of laparoscopic appendectomy . recently , linear staplers and endoloops , both equally safe , have frequently been used as an alternative in the closure of the appendiceal stump during laparoscopy . the main problem with this method is that the knot may be loose due to the surgeon being concerned with the thread breaking when it is pulled . this could lead to the appendiceal stump leaking ; however , if clips are used they will not open after being locked . but yet , has not been leading to the introduction a standard way for stump closure , so it seems that further studies are needed . the results of the present study showed that the mean surgery duration was 23.2 min in the endoloop group and 21.5 min in the endoclips group which indicated a statistically significant difference ( p = 0.021 ) . there was no statistically significant difference in the duration of hospitalization between the two groups also the complications in two groups were not statistically significant ( p > 0.05 ) . the need to repeat the surgery and leaking was not seen in any of the groups . in a prospective clinical trial study , 28 patients who were divided into two groups of 14 individuals underwent laparoscopic appendectomy ( appendiceal stumps of one group were closed with endoclips and the other through endostapler method ) . they concluded that the surgery duration was shorter in the endoclips method in comparison with the endostapler method ( 53.4 min vs. 62.5 min ) . while in our study , the surgery duration was statistically significantly shorter in the clips method in comparison with the endoloop method although this difference may not be clinically important . however , in another clinical trial on 61 patients , endoclips method was compared with endoloop the findings indicated that the endoclips method was safer and the surgery duration was statistically significantly shorter than the endoloop method ( 41.27 vs. 62.81 ) . the safety of the two methods in our study was the same as the abovementioned study . in an randomized controlled trial ( rtc ) study conducted in this field , the mean surgery duration was reported to be 53.4 min when closing the appendiceal stump with clips in laparoscopic appendectomy , this period was specifically shorter in our study ( 21 min ) in comparison with the mentioned study with regard to the skillfulness of the surgeon . moreover , in another prospective randomized trial , the mean operating time was 53.4 min in the endoloop method , which was longer than the periods observed in our study ( 23 min ) . delibegovic also examined animal samples and demonstrated that using endoloop to close the appendiceal stump is more efficient than using clips in another rtc , 35 patients underwent laparoscopic appendectomy using endoloop and a total of three cases were affected by complications and the mean hospitalization period was also 2 days . the hospitalization period was 1.6 days in our study which is a bit lesser than the mentioned study but no serious complications were seen after or during the surgery , only one case of infection and one case of the clips falling off . another study examined 242 patients who had undergone laparoscopic appendectomy and indicated that endoloop is efficient and safe , especially in cases where the perforation is highly likely to occur ; this method also proved to be safe in our study . generally , based on the obtained results from present study , we concluded that closing the appendiceal stump with endoloop and clips in patients who undergo laparoscopic appendectomy were not different in terms of postsurgical complications and the length of hospital stay , but the operating time was shorter in the endoclips method . both methods could be used based on the opinion of the surgeon without expecting a statistically significant difference in the results . however , it is recommended to study this subject with larger samples to obtain more reliable and valid results . sass : contributed in the conception of the work , conducting the study , revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the workshn : contributed in the conception of the work , drafting and revising the draft , approval of the final version of the manuscriptash : contributed in the revising of draft , approval of the final version of the manuscript , and agreed for all aspects of the workmj : contributed in data analysis , conducting the study , revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the workaga : contributed in the conception of the work , approval of the final version of the manuscript , and agreed for all aspects of the workay : contributed in the data collection , approval of the final version of the manuscript , and agreed for all aspects of the workayn : contributed in the data collection , revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the workars : contributed in the conception of the work , revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work and data analysis . sass : contributed in the conception of the work , conducting the study , revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work shn : contributed in the conception of the work , drafting and revising the draft , approval of the final version of the manuscript ash : contributed in the revising of draft , approval of the final version of the manuscript , and agreed for all aspects of the work mj : contributed in data analysis , conducting the study , revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work aga : contributed in the conception of the work , approval of the final version of the manuscript , and agreed for all aspects of the work ay : contributed in the data collection , approval of the final version of the manuscript , and agreed for all aspects of the work ayn : contributed in the data collection , revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work ars : contributed in the conception of the work , revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work and data analysis .

the neuro - cardio - facial - cutaneous syndromes consist of neurofibromatosis type 1 , noonan , leopard , costello and cardio - facio - cutaneous ( cfc ) syndromes . psychomotor retardation , congenital heart diseases ( chd ) , facial abnormalities , short stature , skin problems and cancer predisposition are common findings in these syndromes . hras gene mutations are responsible for costello syndrome while those in several others ( braf , kras , mek-1 or mek-2 ) cause cfc syndrome . differentiation between these two entities in this patient was not possible solely on the clinical findings . however , ross operation was reported neither in patients with costello syndrome nor in those with cfc syndrome to the best of our knowledge . the patient was a girl with subaortic stenosis , keratosis pilaris , growth retardation , nail dystrophy , bitemporal hollowing , macrocephaly and sparse scalp hair [ figure 1 ] . at 5 years of age , her weight was 14 kg ( below 5 percentile ) , height 91 cm ( below 5 percentile ) and head circumference 54 cm . at 9 years , her weight was 16.5 kg ( below 5 percentile ) and height 110 cm ( below 5 percentile ) . her biopsy - proven keratosis pilaris was widespread , involving almost all parts of her body . hyperkeratosis pilaris on the scalp , chest , abdomen and feet is visible , as well as macrocephaly , low - set ears , sparse hair and nail dystrophy the heart disease was diagnosed since 4 years of age . a grade iii / vi systolic murmur pressure gradient ( pg ) between the left ventricle ( lv ) and the aorta was 50 mmhg on echocardiography and 30 during catheterism . because of the progressive aortic insufficiency and subaortic restenosis ( pg = 70 mmhg echocardiographically , st segment depression on electrocardiogram ) , ross operation was carried out at the age of 9 years . the pulmonary valve is translocated to the aortic valve position ( neoaortic valve ) and a homograft is implanted in the pulmonary valve position . two and a half years after the ross operation , she returned complaining of shortness of breath and easy fatigability . aortic root ( 2.84 mm ) and lv ( 5.3 mm end - diastolic diameter ) had greatly increased dimensions . after the operation , a stormy course occurred with low cardiac output leading to renal and hepatic failures , severe coagulation abnormality , progressive loss of consciousness and , finally , death of the patient at the age of 11 years and 10 months . rv , right ventricle ; lv , left ventricle ; la , left atrium ; aov , aortic valve ; sub ao , subaortic the presented case had certain manifestations such as failure to thrive , chd , widespread hyperkeratotic skin lesions , sparse hair and relative macrocephaly , which are consistent with both the diagnosis of costello and cfc syndromes . however , differentiation between these two entities was difficult based only on the clinical findings . cardiac abnormalities were found in 63% of the patients with costello syndrome , consisting of structural defects in 30% ( most commonly pulmonic stenosis ) , myocardial hypertrophy in 34% and arrhythmias in 33% . pulmonary valvar stenosis is the leading abnormality in this syndrome as well , being seen in 47% . hypertrophic cardiomyopathy ( 40% ) and atrial septal defects ( 23% ) follow that abnormality . as far as the authors know , subaortic stenosis as the cardiac manifestation of cfc syndrome was reported only once . ross operation consists of autografting pulmonary valve in place of the aortic valve and putting a homograft in place of the pulmonary valve . this operation is used when the aortic valve should be replaced and a prosthetic valve is not desirable . severe autograft dysfunction with free regurgitation 2.5 years after the ross operation , like that seen in our patient , is rare . in the cohort of bhm et al . , severe autograft regurgitation occurred in 14 of 467 patients ( 3% ) , requiring reoperation after a mean of 39.3 months . in that of de kerchove et al . , the autograft was reoperated due to severe regurgitation in 18 of 218 patients ( 8.3% ) . we did not see such an occurrence in our patients after ross operation , as well . as far as the authors know , this patient is the first patient with either cfc or costello syndrome on whom a ross operation was carried out . relatively rapid destruction of the neoaortic valve ( 2.5 years ) in spite of echocardiographical normality before the operation may be due to a subtle structural pathology in the pulmonary valve . although it is difficult to come into conclusion based only on one patient , it may be advisable to avoid ross operation in these patients even if the pulmonary valve seems to be normal echocardiographically .

colon diverticulosis is a frequent condition in adults in western countries and several patients experience clinical symptoms even when diverticulosis is not complicated by diverticulitis . udd symptoms pathogenesis remains unknown , but alterations in the diet and gut microbiota may be involved and could be responsible for chronic low mucosal inflammation . intestinal motility exerts a major control on gut microflora through the sweeping of luminal contents . an alteration of the intestinal motility , especially decreasing anaerobic bacteria , can influence intestinal inflammation and be beneficial in both clinical and experimental models of colitis . animal data indicate that a reduced load of bacteria may be useful in the prevention of colitis in susceptible individuals . although there is no supporting evidence from placebo - controlled trials , recommendations for management of acute episodes of udd include medical treatment with broad - spectrum antibiotics [ 6 , 7 ] . we have recently shown that both central and mucosal immunity are altered in udd with increased recruitment of cd103 lymphocytes ; treatment with rifaximin ameliorates clinical symptoms ( when present ) and reduces cd103 levels , suggesting decreased mobilization of mucosal homing . rifaximin is an antibiotic that acts locally in the gastrointestinal tract with a broad spectrum of antibacterial activity . fecal concentrations of rifaximin are known to largely exceed the minimum inhibitory concentration values of pathogenic enteric bacteria . rifaximin , instead of other systemic absorbed antibiotics , acts in the gastrointestinal tract modifying the gut microbiota ( at the concentrations used , its action is mainly directed to pathobionts and much less to physiological gut flora ) . furthermore , at the same time , rifaximin , being a nonabsorbed antibiotic , has only little systemic effects . to better understand the mechanisms involved , we reasoned that rifaximin treatment may reverse immune system alteration by reducing bacteria related activation . bacteria activate the immune system through specific receptors referred to as toll - like receptors ( tlrs ) . bacterial lipopeptides ( blp ) and lipopolysaccharides ( lps ) are recognized by tlr2 and tlr4 , respectively . tlrs are involved in the generation of innate and adaptive immunity [ 11 , 12 ] . recent studies have shown that t cells also express certain types of tlrs [ 13 , 14 ] . these tlrs can function as costimulatory receptors that complement t cell receptor- ( tcr- ) induced signals to enhance effector t cell activation . we therefore investigated tlr2 , tlr4 , and intestinal homing in udd before and after a course of rifaximin . the local ethics committee approved the study protocol and a written informed consent was obtained according to the principles of the declaration of helsinki ( 1983 ) . over a period of 6 months , 40 consecutive patients with udd ( abdominal pain in the lower abdominal quadrant and change in bowel habit ) and 20 healthy asymptomatic subjects undergoing screening colonoscopy for colorectal cancer were enrolled . the 40 patients with udd were randomly assigned into two groups:20 patients with udd were assigned to a 2-month treatment with rifaximin 1.2 g / day for 15 days / month.20 patients with udd on the same time received placebo . 20 patients with udd were assigned to a 2-month treatment with rifaximin 1.2 g / day for 15 days / month . colonoscopy with multiple biopsies and blood samples were taken from patients and controls and repeated in patients at the end of the 2-month rifaximin treatment or placebo course . control healthy group was matched for gender , age , and body mass index ( bmi ) to the other two groups of patients . inclusion criteria in udd patients group were as follows : endoscopic evidence of extensive diverticula limited to the sigmoid and descending colon ; continuous gastrointestinal symptoms for at least 3 months ; and age 18 years . exclusion criteria were as follows : inflammatory bowel diseases ( ibd ) ; mucosal inflammation at endoscopy and histology ; present or past episodes of acute diverticulitis ; colonic surgery ; intestinal and extraintestinal cancer ; use of antibiotics , anti - inflammatory drugs , probiotics , ppi , steroids , or fibers in the previous 12 weeks ; hematological diseases ; and pregnancy . patients ' identification was performed by the presence of left colonic diverticula , whilst controls had a normal colon . bioptic tissue samples were incubated with 100 ui / ml of human recombinant interleukin-2 ( il-2 ) to allow lymphocyte growth as previously described . when tissue infiltrating lymphocytes ( tils ) reached a sufficient number to perform the immunophenotype , surface markers were studied by immunofluorescence . peripheral blood mononuclear cells ( pbmc ) were isolated by ficoll - hypaque according to standard procedures . whole blood cells ( wbc ) , for granulocytes analysis , were isolated from edta - treated blood through red cell lysis . briefly , 1 ml of venous blood was incubated with 1 ml of pbs and 10 ml of isotonic nh4cl solution ( 155 mm nh4cl , 10 mm khco3 , 0.1 mm edta , and ph 7.4 ) for 10 min . next , after two washes in pbs , the cells were stained as described below . pbmc , wbc , and tils were stained for 30 min at 4c with the following anti - human monoclonal antibodies ( mab ) : pe - cy7 or pe conjugated - cd3 ( clone sk7 ) , pe - cy7 or pe conjugated - cd4 ( clone sk3 ) , pe - cy7 or pe conjugated - cd8 ( clone sk1 ) , fitc conjugated - cd103 ( clone ber - act8 ) , pe conjugated - tcrgd ( clone 11f2 ) , pe - cy7 conjugated - cd14 ( clone m5e2 ) , alexa 482 conjugated - tlr2 ( clone 11g7 ) ( all from bd , san diego , ca ) , and apc conjugated - tlr4 ( clone hta125 ) ( ebiosciences , san diego , ca ) . each analysis was performed using at least 100.000 cells that were gated in the region of the lymphocyte - monocyte population or in granulocytes population , as determined by light - scatter properties ( forward scatter versus side - scatter ) . flow analysis was performed by a standardized 3- or 4-colour analysis protocol that was gated on cell stained with one fluorochrome , followed by 2-colour analysis of cells stained with the prescribed remaining fluorochromes . appropriate fluorochrome - conjugated isotype - matched mabs ( beckman coulter ) were used as control for background staining in each flow acquisition . in these assays , mean fluorescence intensity ( mfi ) was calculated only for positive events after subtraction of specific isotype control mfi . all samples were analyzed with a facs calibur and cellquest software ( bd , franklin lakes , nj ) . the statistical analysis was carried out using the graphpad 6.0 statistical package . the mann - whitney u test was applied to the continuous variables , the changes observed in unpaired groups , and the wilcoxon test in paired groups . the kruskal - wallis test h was applied to evaluate whether significant differences exist between different samples and also for comparisons between independent samples . no statistical differences in smoking habits , alcohol daily intake , and body mass index ( bmi ) were observed between the two groups . good compliance to rifaximin ( > 90% of the appropriate dose ) was observed in all patients . no adverse events to the drug or complications were observed . in peripheral blood , at baseline , both the percentages of trl2 and trl4 lymphocytes were significantly higher ( p = 0.0004 and p < 0.0096 , resp . ) in patients than in controls ( figures 1(a ) and 1(b ) ) . after rifaximin treatment ( ar ) , the percentages of trl2 and trl4 lymphocytes in patients remained similar to basal values obtained before rifaximin treatment ( br ) . however , tlr2 and tlr4 increased significantly ( p = 0.0003 and p = 0.0104 , resp . ) in patients who received placebo treatment ( after placebo or ap ) , as compared with patients who received rifaximin treatment ( figures 1(a ) and 1(b ) ) . these data suggest that , in the lack of antimicrobial treatment , patient with udd experiences an increase of tlrs expression . in the sigmoid mucosa , at baseline , the percentages of trl2 lymphocytes were lower ( p = 0.0091 ) in patients than in controls , while tlr4 showed no significant differences ( figures 1(c ) and 1(d ) ) . in patients after rifaximin , in a pattern similar to that observed in the peripheral blood , patients expressed significantly reduced percentages of both tlr2 and tlr4 ( p = 0.0424 and p = 0.0022 , resp . ) in comparison to values observed in placebo treated patients ( figures 1(c ) and 1(d ) ) . our data suggest that rifaximin treatment contributes to maintain stable levels of tlrs and this is possibly related to the control of intestinal microflora . since the transverse mucosa of patients with udd is supposed to be normal , lymphocytes in the transverse mucosa were studied as controls . in fact , no significant differences were observed before and after rifaximin treatment ( figure 1(e ) ) . for a better understood role of tlr2 and tlr4 we also analyzed the subpopulations cd4 and cd8 lymphocytes as reported in table 2 . tlr2 and tlr4 were analyzed in pbmc and sigma mucosa of same patient . to clarify the way in which the modulation of tlr2 and tlr4 in pbmc and sigma mucosa occurred , we compared the modulation of tlr2 and tlr4 expression between pbmc and gut in the different patient groups ( br and ar and bp and ap ) ( figure 2 ) . we observed the same trend of tlrs modulation in both the mucosa and the pbmc . we observed coexpression of trl2 and tlr4 on lymphocyte in both pbmc and sigma mucosa of the same patient . moreover , we reported that the modulation of tlr2 and tlr4 correlated in pbmc ( 95% confidence interval 0.21 to 0.447 ; r = 0.2366 ; p < 0.05 ) and in transverse mucosa ( 95% confidence interval 0.052 to 0.687 ; r = 0.4195 ; p < 0.05 ) , but not in sigma mucosa ( 95% confidence interval 0.334 to 0.256 ; r = 0.043 ; p < 0.05 ) . the phenotype of tlr lymphocytes was also evaluated for the cd4 and cd8 lymphocytes subpopulations to better understand the effect of rifaximin in udd patients ; the results are summarized in table 2 . we show that both tlr2-cd8 and tlr2-cd4 cells were increased in patients pbmc as compared to controls . in the sigma mucosa , after rifaximin , tlr4-cd4 cells were significantly reduced . in peripheral blood , at baseline , no changes were found in trl2 monocytes ( cd14 + ) percentages . the percentages of trl4 monocytes were lower ( p = 0.0019 ) in patients with respect to controls ( figures 3(a ) and 3(b ) ) . after rifaximin treatment the percentages of trl2/cd14 + increased significantly ( p = 0.0039 ) with respect to before rifaximin ( figure 3(a ) ) ; no changes were found in trl4 monocytes percentages ( figure 3(b ) ) . analysis of mfi showed that , in monocytes , the tlr4 mfi baseline was significantly lower than control ( p = 0.0014 ) , while after rifaximin treatment no change was found ( figure 3(d ) ) . on the other hand , tlr2 mfi was increased after placebo ( p = 0.0238 ) , while remained unchanged in the after rifaximin patients . in granulocyte populations , at baseline trl2 mfi decreased ( p = 0.0029 ) , while tlr2 mfi increased after placebo ( p = 0.0398 ) ( figure 3(e ) ) . all these findings suggest that rifaximin treatment contributes to maintain stable levels of tlrs and possibly related to the control of intestinal microflora . we did not find any correlation between tlrs expression in lymphocytes and monocytes ; instead , we found correlations for both tlr2 and tlr4 in monocytes and granulocytes ; in fact , the direct associations were found between mfi monocytes and mfi granulocytes in udd patients at t0 ( tlr2 correlation coefficient : 0.530 , p = 0.013 ; tlr4 correlation coefficient : 0.478 , p = 0.033 ) . cd103 is a gut homing receptor present on the surface of lymphocytes and marks gut - homing recruitment of lymphocytes . considering both mucosal cd4 and cd8/cd103 cells , no significant variations were observed between patients and controls in colonic tissue ( data not shown ) . in peripheral blood , in udd patients , we found an increased recruitment of cd103 lymphocytes ( as reported in our previous work ( 8) ) . when we evaluated cd4/cd103 and cd8/cd103 in sigma mucosa before and after rifaximin treatment , we did not find any change . however , in patients treated with placebo the percentage of cd8/cd103 lymphocytes was lower after placebo ( p = 0.0072 ) than before placebo ( figure 4(b ) ) . this suggests that rifaximin may keep a constant homing flux to the sigma of the cd8 cells . we therefore evaluated these cells in combination with the homing marker cd103 in tils derived from sigma of udd patients . after treatment with rifaximin the percentages of the sigma cd103 tcr - gamma / delta lymphocytes decreased significantly ( p = 0.0182 ) with respect to the before rifaximin percentages , while no differences were found in patients treated with placebo ( figure 4(c ) ) . no correlations were found between tlrs and cd103 expression in tcr - gamma / delta lymphocytes . we have investigated bacterial ligands tlr2 and tlr4 and other markers in peripheral blood and mucosa and on lymphocytes , monocytes , and granulocytes of patients with udd before and after antibacterial treatment . we showed that udd induces significant modifications of tlr2 and tlr4 expression on several immune system cell subpopulations isolated from both peripheral blood and affected mucosa as compared with controls . since tlr2 and tlr4 are receptors for ligands present on bacterial walls , we reasoned that antibiotic treatment could reverse colonic inflammation associated with udd . rifaximin treatment induced significant modifications of several altered conditions : either restoring the values observed in controls , or limiting the deviations from normal range observed after 2-month placebo treatment . diverticula , even when not acutely inflamed , represent an anatomical abnormality where excessive growth of bacteria occurs . we have previously shown that both clinical symptoms and immunological abnormalities can be ameliorated by a short course of rifaximin . tlr2 and tlr4 are not constitutively expressed on human t cell surface , but their expression requires activation of t cells by tcr complex . accordingly , we showed that tlr2 and tlr4 lymphocytes in the peripheral blood are increased in patients versus controls suggesting more activated circulating t cells in peripheral blood . moreover , nf-b is a critical factor in antibacterial defense and activates the secretion of proinflammatory cytokines resulting in a th1 response . thus , rifaximin keeping under control the activation of tlrs may also limit the triggering of th1 adaptive immune response . these findings suggest that rifaximin also has a systemic action on immune system . in the sigmoid mucosa , percentages of tlr2 and tlr4 lymphocytes are decreased in patients and remain stable after rifaximin , while we observed an increase of these populations after placebo . it may be suggested that in udd immunotolerance to commensal bacteria and short - term tlrs activation impairment might be related to increased inflammation that leads to the development of symptoms in udd . no differences were observed in modulation of tlr2 and tlr4 lymphocytes between pbmc and sigma mucosa . however , data showing that tlr2 and tlr4 increase in time in after placebo patients suggest that the tlrs defect is not constitutive , but it is limited to the stage of early activation . this mechanism can be the result of a lack of lymphocytes activation since tlr2 is expressed in activated cells . alternatively , lymphocytes in udd patients recognize the antigens through adaptive immune response , which requires time to be activated , rather than through innate immunity . thus , our results of reduced tlr2 expression in sigmoid mucosa could be explained by the delayed activation . it is interesting to note that we observed a reduced tlr2 expression only in tils and not in peripheral blood . our data are similar to evidences in the pleural fluid of patients with tuberculosis infection and filariasis , suggesting that downregulation of tlrs at the site of infection and not in the periphery may be connected with a reduction in the secretion of proinflammatory cytokines . alternatively , an involvement of the t regulatory cells ( tregs ) could be proposed . this may limit the triggering of th1 adaptive immune response . limiting the activation of th1 immune response , involved in the pathogenesis of several inflammatory diseases [ 23 , 24 ] , may be a mechanism by which rifaximin acts as an anti - inflammatory agent in addition to its antibiotic effect . we have also shown that both tlr2-cd8 and tlr2-cd4 cells were increased in patients pbmc as compared to controls . we hypothesize that , as in udd bacterial infections are more frequent , lymphocytes expressing tlr2 and tlr4 are already mobilized and ready to mount the immune - response . after rifaximin , tlr - cd4 cells are significantly reduced in sigmoid mucosa , thus confirming the indirect role of the antibiotic on mucosal immunity . in fact , the reduced number of tlr4-cd4 lymphocytes may be related to the fact that , after antibiotic treatment , there is a reduced need of tlr4-cd4 cells which are important in immune responses against bacteria . cd4 cells are instrumental in starting immune response to produce specific antibodies , cell to cell cross talking through production of cytokines , delivering activation signals and induction of activation markers . monocytes and granulocytes are essential cells in the innate immune response and reflect the level of inflammation ; we therefore analyzed tlrs expression in peripheral blood monocytes and granulocytes . in monocytes , tlr4 was decreased in peripheral blood both as percentages of cells and mfi , in patients versus controls . then , we hypothesized that a defect in tlr4 expression predisposes to diverticular disease by impairing antibacterial defense . this could be related to genetic polymorphism of tlr4 as described by other authors [ 27 , 28 ] . this reinforces the possibility that , in udd , the increased bacterial load may contribute to the development of symptoms related to udd . instead , both percentages and mfi of tlr2 monocytes in patients were similar to controls . these results suggest that rifaximin limits the increase of tlr2 expression , probably in relation to its bactericide action on pathogenic flora . this was reinforced by the increase of mfi expression after placebo , both in monocytes and in granulocytes , which could be related to a stimulation of proinflammatory cytokine and tlr - ligands due to increased bacterial load . sigma 's cd103 cells are normal in udd ( data not shown ) . after placebo , we observed a significant decrease of these cells , while after rifaximin their percentage remained unchanged , suggesting that rifaximin can maintain intestinal homing within the normal range . moreover , the decrease of cd103 cells can be due to cell death , which may be related to insufficient recruitment . furthermore , we analyzed the involvement of gamma - delta t cells both in peripheral blood and in tissue . these cells are a minor population in the peripheral blood but constitute a major population among intestinal intraepithelial lymphocytes . thus , we focused on gamma - delta t cells expressing the intestinal homing receptor cd103 . after rifaximin , mucosal cd103 positive gamma - delta t - cells were reduced and our data suggest that homing gamma - delta cells directly correlate with gut inflammation in udd and their reduction supports the anti - inflammatory activity of rifaximin either through the bacterial load reduction or because rifaximin has been showed to have a direct anti - inflammatory activity , as already reported above . the gamma - delta t cells may be considered as a marker of inflammation , similar to tregs , as reported in other papers of our group [ 21 , 23 , 30 ] . while our data clearly show the reduction of inflammatory - related features after rifaximin , only further studies will demonstrate if these effects are due to reduced bacterial growth or due to intrinsic anti - inflammatory activity recently observed with rifaximin . it is interesting to note that , in the mice , gamma - delta activation is associated with th17 cells acting through ligation of tlr2 and tlr4 . in summary , we have described a vast immunological pattern of several innate and adaptive cells markers including tlrs , which may be involved in the pathogenesis and clinical course of the diverticular disease , and we have showed its variations before and after the antibiotic therapy with rifaximin . the role of pathogenic flora is supported by the finding that rifaximin acts in the gut mucosa homeostasis by limiting the activation of tlrs . furthermore , rifaximin may also have a luminal anti - inflammatory function modulating the adaptive immune response in an inhibitory sense . rifaximin keeps under control tlrs expression in peripheral blood suggesting that , in addition to its activity in gut mucosa , it may also have a systemic action on immune system . we have shown that , in udd , tlrs and several immune cell populations are altered in patients with respect to controls , suggesting that in udd inflammation is present even in the absence of severe clinical symptoms .

thyroid carcinoma is the most common endocrine neoplasm and is increasing worldwide ( in the usa , 8.7 per 100,000 people ) [ 14 ] . papillary thyroid carcinomas ( ptcs ) accounted for 74% of all thyroid carcinomas in 1973 and 87% in 2003 . in this period , its incidence ( including that of the follicular variant of ptc ) increased by 189% ; the rate of follicular carcinomas remained stable , and the rate of anaplastic carcinoma decreased by 22% . thyroid cancer may be found in thyroid nodules , the nature of which can be investigated by means of cytological examination ( fine - needle aspiration biopsy , fnab ) . most thyroid nodules are benign ( 85% ) and in most cases it is possible to distinguish clearly between benign and malignant nodules [ 5 , 6 ] . gray zone comprising thyroid nodules classified as thy 3-thy 4 ( according to the classification of the british thyroid association ) , the diagnosis of which is indefinite between benignity and malignancy ( 25% of thy 3 and 70% of thy 4 cases are malignant on final histology ) [ 79 ] . recently , molecular diagnostics has offered new techniques for detecting the most common mutations in thyroid cancer ( braf , ras , ret / ptc , and pax 8/ppar ) in order to optimize the management of indeterminate follicular lesions and to guide the therapeutic approach more appropriately [ 1013 ] . the braf gene encoding serine / threonine kinase is regulated by ras , which mediates the pathway of cellular growth and malignant transformation . the most common mutation in ptc is braf v600e ( substitution of a thymine with an adenine at nucleotide 1799 and , consequently , substitution , on the transcribed protein at residue 600 , of a valine with a glutamate ) , which is detected in 50% of ptcs on definitive histological diagnosis [ 14 , 15 ] ; searching for this mutation is therefore extremely useful . there are other mutations of the braf gene , such as k601e , which displays lower oncogenic activity in vitro than v600e ; indeed , the kinase activity of v600e is 2.5 times greater than that of the k601e that has been identified in follicular adenomas and , more rarely , in some follicular carcinomas [ 16 , 17 ] . the incidence of ptc seems to vary , as does the presence of braf mutations , according to the amount of alimentary iodine in the population under study [ 18 , 19 ] . the purpose of our study was to investigate the presence of braf mutations in our ligurian population with a view to modifying the therapeutic approach and follow - up , considering the numerous literature data on the worse prognosis of braf - mutated ptcs and their loss of iodine uptake [ 2022 ] . it is common opinion in the literature that molecular cytology following fine - needle aspiration biopsy can usefully guide the therapeutic approach in thyroid nodules with indeterminate follicular lesions ( bta thy 3-thy 4 ) [ 2326 ] . between january 2013 and july 2014 , 70 caucasian out - patients living in liguria were referred to our thyroid clinic with an indeterminate cytological diagnosis according to the 2009 bta classification ( table 1 ) . cytological - histological correlation was available only in 56/70 ( 80% ) patients ( 13 men and 43 women ; age 2076 years ; average age 51 years ; 38 thy 3 samples , and 18 thy 4 samples ) . the thyroid fine - needle aspiration biopsy ( fnab ) material was fixed with cytofix on slides , one of which was used for molecular diagnostics . sonography revealed a uninodular goiter ( gun ) in 36 subjects and a multinodular goiter ( gmn ) in 20 subjects ; a thyroditic pattern was discerned in 8 subjects . a clinical condition of acromegaly was present in two patients and primary hyperparathyroidism was diagnosed in one gmn and two gun . all patients were informed of the method used and provided both written and verbal consent . the purpose of the study was to evaluate the effectiveness of a surgical choice based not only on the cytological diagnosis but also on the detection of braf mutations , in our ligurian population . the following protocol was adopted : if a sample was positive for a braf mutation , we suggested total thyroidectomy ( with lymphadenectomy if the initial cytological diagnosis was thy 4 ; without lymphadenectomy if the initial cytological diagnosis was thy 3).if a sample was negative for the presence of mutation , we chose a less aggressive approach : if the initial cytological diagnosis was thy 4 , we suggested total thyroidectomy without lymphadenectomy ; if the initial cytological diagnosis was thy 3 and no nodular disease was observed in the contralateral lobe , we suggested only lobe - isthmectomy ; if the initial cytological diagnosis was thy 3 but there were nodules in the contralateral lobe and/or chronic thyroiditis , we suggested total thyroidectomy without lymphadenectomy . if a sample was positive for a braf mutation , we suggested total thyroidectomy ( with lymphadenectomy if the initial cytological diagnosis was thy 4 ; without lymphadenectomy if the initial cytological diagnosis was thy 3 ) . if a sample was negative for the presence of mutation , we chose a less aggressive approach : if the initial cytological diagnosis was thy 4 , we suggested total thyroidectomy without lymphadenectomy ; if the initial cytological diagnosis was thy 3 and no nodular disease was observed in the contralateral lobe , we suggested only lobe - isthmectomy ; if the initial cytological diagnosis was thy 3 but there were nodules in the contralateral lobe and/or chronic thyroiditis , we suggested total thyroidectomy without lymphadenectomy . thyroids were evaluated by ultrasonography ( us ) using color doppler equipment ( mylab five , esaote biomedica , genoa , italy ) equipped with a 7.5 mhz linear probe . ultrasound - assisted fnab was performed with the aid of the same machine . in accordance with the current guidelines for ultrasound [ 2628 ] , the nodule parameters evaluated were size , composition ( solid or mixed ) , echogenicity , presence or absence of microcalcified spots , vascularization , margin halo , and irregularity of the margin . biochemical evaluation included free thyroid hormones , thyrotropin ( tsh ) , anti - thyroperoxidase antibodies ( tpoab ) and calcitonin ( ct ) . tpoab were determined by means of a commercial assay ( radim ) with a cut - off of 100 u / l . tsh and free thyroid hormones were evaluated by means of highly sensitive chemiluminescence ( roche diagnostics ) . l for free t3 ( f - t3 ) ; and 11.521.8 pmol / l for free t4 ( f - t4 ) . ct was determined by means of diasorin immunochemiluminescence reagents ; in our laboratory the normal value of calcitonin is less than 10 pg / ml . somatic point mutation in the braf v600 gene was determined on cytological material smeared on a slide after the pathologist had verified the adequacy of the sample and had selected areas with the highest number of neoplastic cells . the presence of nonneoplastic cells , that is , normal thyrocytes , stromal cells , and blood - derived leukocytes , was evaluated to determine the ratio of neoplastic / nonneoplastic cellular compartment . only areas with a neoplastic / nonneoplastic cells ratio of > 50% after removal of the coverslip ( 4872 hours ) , dna was extracted from selected areas by means of a home - made buffer ( ph 8 , 1% tween ) and digestion with proteinase k , as recommended ( qiagen , hilden , germany ) . two methods were used to study the mutation : ( i ) conventional pcr followed by the direct sanger sequencing method ( according to the recommendations of the italian association of medical oncology ( aiom ) and the italian society of pathology and cytology ( siapec ) ) ; and ( ii ) real time pcr ( rt pcr ) with commercial kits approved for clinical use ( therascreen braf rgq pcr , qiagen ) . briefly , 100200 ng of genomic dna was amplified by pcr using 1.5 u platinum taq dna polymerase ( thermo fisher scientific , tfs , milan , italy ) , 1x buffer , 2 mm mgcl2 , 200 nm dntps , 30 pmoles of forward and reverse primers in a final volume of 50 l . the set of primers ( braf 15 forward : 5 tgcttgctctgataggaaaatg and braf 15 reverse : 5 agcatctcagggccaaaaat ) was used to amplify the entire codon region of exon 15 of the braf gene and produce amplicons of 230 bp . the amplified pcr products were then treated with exosap ( ge healthcare , waukesha , usa ) as recommended and both strands sequenced by means of dye terminator cycle sequencing ( bigdye terminator v3.1 , tfs ) . nucleotide sequence detection was performed on an abi prism 3130 genetic analyzer ( tfs ) , according to standard protocols . the sequence data were analyzed by means of mac vector software version 11 ( macvector inc . , north carolina , usa ) in order to identify mutations and to assign genotypes to individual dna samples . a braf mutation was assigned only when at least 3/4 sequences from two independent pcr amplifications yielded the same result . the therascreen braf rgq pcr kit is a molecular diagnostic tool for detection of the 4 different v600 mutations ( v600e , v600d , v600k , and v600r , including the v600e complex ) and utilizes two technologies : arms ( amplification refractory mutation system ) , which allows mutation - specific amplification , and scorpions probes for the detection of amplification . the real time pcr protocol and analysis of the data were performed on a rotor - gene q mdx 5 plex hrm instrument by using the rotor - gene q software v. 2.2.3 according to the manufacturer 's instructions . the sensitivity of sanger sequencing was about 12.5% mutated dna / wt dna , as determined in home - made experiments described in , while the limit of detection ( lod ) of the rt pcr commercial kit ranges from 1.82% to 4.85% among the different v600 mutations , as indicated by the manufacturer ( therascreen braf rgq pcr kit handbook ) . the choice of the method used for detection of braf mutations was based on the material and the amount of dna extracted and assayed . the laboratory was accredited by bureau veritas iso ( international organization for standardization ) 9001 : 2008 and the external quality control for the determination of braf mutations was promoted by aiom in 2014 siapec . statistical evaluation ( prism 6.0 , graphpad ) of the correlations among cytology , histology , and molecular analysis was performed on fully evaluable patients . all data are reported as mean standard deviation ( sd ) unless otherwise specified . the cytological diagnosis was undetermined in 70 patients ; however , cytohistological correlation was available for only 57/70 patients ( 81.4% ) a higher percentage of braf mutations were found in thy 4 lesions ( 8/18 cases , 44% ) than in thy 3 lesions ( 6/38 cases , 16% ) ( table 2 ) . the nucleotide sequence of the entire exon 15 region of the braf gene was obtained in all 56 cases , while rt pcr was performed in 32/56 cases ( 57% ) . mutations in the braf gene were detected in 14/56 cases ( 25% ) : 2/14 ( 14% ) males and 12/14 ( 86% ) females . in 12/14 cases ( 86% ) , the mutation identified was braf v600e , while in 2/14 cases ( 14% ) braf k601e was detected . notably , there was 100% concordance between the two different methods used for the detection of v600e mutations , that is , sanger sequencing and real time pcr ( 32/32 cases ) . a similar rate of v600e braf mutations was found on sanger sequencing and rt pcr ( 12/56 mutated cases ( 21.4% ) and 5/32 mutated cases ( 15.6% ) , resp . ) . the relative slightly high percentage of the v600e mutation rate among the cases analyzed by means of the sequencing method can be ascribed to the fact that the cases that proved braf nonmutated on sequencing were then preferentially selected for rt pcr . of those cases in which molecular analysis of cytology specimens revealed a braf mutation , 2/14 ( 14% ) proved benign on histology , while 12/14 ( 86% ) were malignant neoplasms : 11/12 ( 92% ) ptc and 1/12 ( 8% ) ptc follicular variant ; no follicular or medullar neoplasms were found . braf - mutated cases that were found to be benign on final histology carried the k601e mutation . of the nonmutated braf cases ( 42/56 cases , 75% ) which were later found to be malignant on definitive histology ( 14 cases ) , 5 were follicular carcinomas ( 36% ) , 3 were incidentally found papillary microcarcinomas ( 22% ) , 2 were classic papillary carcinomas ( 14% ) , 1 was a follicular variant of papillary carcinomas ( 7% ) , 1 was a medullary carcinoma ( 7% ) , 1 was a hurtle cell tumor ( 7% ) , and 1 as a combined cell carcinoma and papillary oncocytic carcinoma ( 7% ) ( table 2 ) . if we consider only the classical variant of papillary carcinoma , a correlation between braf v600e mutation and a histological diagnosis of malignancy was found in 11/12 ( 92% ) of cases . no false positive results were recorded in our series . as a result of braf gene analysis , the surgical approach was changed in 17/56 patients ( 30% of cases ) . these patients had thy 3 cytology and nonmutated braf gene ; instead of thyroidectomy , they underwent lobe - isthmectomy alone : the histological diagnosis was benign in all these cases . the decision to undertake more conservative surgery was based on ( i ) thy 3 nodule cytology , ( ii ) wild - type braf gene , and ( iii ) absence of ultrasound signs of malignancy . there was discordance between the endocrinological indication and the type of surgery performed in 2/56 cases ( 3.5% ) . this discrepancy involved only patients with thy 3 nodules on cytology without the presence of multinodular goiter or thyroiditis ; in these cases , a more aggressive surgical approach was adopted . the reasons for adopting a more aggressive approach were the following : in 1 case , the presence at ultrasound of a suspect lymph node which subsequently proved positive for metastasis from a papillary carcinoma and , in the other case , the intraoperative suspicion of malignancy ( final histology of this case : hurtle cell tumor ) . the mean size of the nodules that underwent fnab was 20.2 2.2 mm ( median 18 mm , range 580 mm ) . the patients involved were categorized by nodule size ( no significant differences in terms of number , gender , average age , sonographic features , or thyroid hormone values emerged among these size categories ) . the percentage of patients on l - t4 treatment was significantly ( p = 0.01 ) higher in the thy 3 cytology group ( 11/38 cases , 29% ) than in the thy 4 group ( 0% ) . the size of the nodule subjected to fnab and the ultrasound score were similar in the two groups of subjects . the presence of the braf v600e mutation correlated with the thy classification , being positively correlated with a thy 4 cytological diagnosis ( p < 0.0001 ) . by contrast , no correlation was seen between the presence of this mutation and any of the following parameters : lt4 hormone therapy , tsh , f - t4 and calcitonin values , the diameter of the nodule examined , age , or sex . the correlation between the ultrasound score of the nodule and the presence of the braf mutation was not statistically significant . however , as the numerical value of p ( 0.07 ) was very close to the limit considered , we can assume that a statistically significant correlation would emerge if a larger group of patients were analyzed . the correlation between braf v600e mutation and malignant histology was statistically significant ( p = 0.0021 ) . situated in the northwest of italy , liguria is a region with a population of 1,583,628 . the region is bounded on the south by the ligurian sea , on the west by france ( provence - alpes - cote d'azur ) , on the north and east by piedmont and emilia romagna , and on the southeast by tuscany . thyroid nodules with indeterminate cytology have been studied for many years , with the aim of orienting surgery more accurately and reducing the number of total thyroidectomies for benign thyroid nodules ( 80% of thy 3 lesions proved benign in our data ) . research by guerra et al . evaluated the frequency of the braf v600e mutation in thyroid nodules diagnosed in the naples area and highlighted the importance of such research in that area . in 2014 , pelizzo et al . analyzed 931 histological samples of ptc in northern italy ( padua and trieste ) and found a correlation between poor prognosis and the presence of this mutation . rossi et al . studied the presence of the braf v600e mutation in lazio ( rome ) , where they observed that the increased sensitivity and specificity of sickle - shaped nuclei were predictive of mutation . again in 2014 , rossi et al . ( ferrara ) analyzed 140 indeterminate lesions and concluded that braf mutation testing was an important contribution to cancer diagnosis in their region . it should be borne in mind that braf gene mutation , besides genetic and racial factors , seems to be influenced by the geographic area , as is testified by the percentage of papillary carcinomas in the population studied , and appears to be correlated with the amount of iodine in the diet . a recent paper by our team also highlighted the importance of ultrasound elastosonography ( use ) in nodules with indeterminate cytology . in that study , we enrolled 63 patients with thy 3 lesions in which cytological - histological correlation was available and demonstrated that evaluating the elx 2/1 index in conjunction with conventional ultrasonography was able to reduce the number of thyroidectomies . the cumulative presurgical analysis of thy 3 nodules ( by means of us , use , and contrast - enhanced us ) improved specificity . several studies [ 3639 ] have shown a strong correlation between the presence of braf mutation and lymph node metastasis , extrathyroid extension , advanced stage ( iii and iv ) on diagnosis , and disease recurrence . furthermore , the mutation would appear to be associated with a lower uptake of iodine and refractoriness to rai in relapsing ptc . in 2009 , nikiforov published one of the papers that prompted the search for mutations on fnab cytology . his study involved 84 patients with cytologically indeterminate lesions , in 97% of which was a correlation between the presence of mutations on cytology and malignant histology . in the same year , he searched for 32 mutations in 470 samples from fnab ; this study revealed the importance of searching for other mutations , such as ret / ptc , ras , and pax8/ppar , in addition to braf , in order to increase the sensitivity of the method . nikiforova also found that molecular research reduced false negative samples on thyroid cytology from 2.1% to 0.9% . in a recent paper , yip et al . proposed a clinical algorithm based not only on the initial cytology but also on mutational research , as a guide to more or less radical surgery . moreover , yip recorded a considerably lower frequency of thyroid carcinomas in patients undergoing lobectomy if presurgical mutational research had been carried out . a multicenter study conducted in 2013 confirmed the close correlation between the presence of a braf mutation and increased mortality in ptc patients . a recent study by liu et al . again emphasized the importance of molecular research . on the basis of the results obtained , these authors proposed a different approach , not only to surgery but also to postsurgical treatment , and suggested the possibility of introducing personalized targeted therapy . another recent paper demonstrated the possibility of searching for mutations not only on fresh fnab material but also in air - dried samples . having retrospectively analyzed 310 consecutive patients who had undergone surgery for thyroid nodules , these authors found that the sensitivity of fnab increased from 67% to 75% when mutational research was carried out on air - dried samples . the latest guidelines also suggest ( recommendation rating : c ) the use of molecular markers ( e.g. , braf , ras , ret / ptc , and pax8-ppar ) in the management of thyroid nodules with indeterminate cytology . thus , on the basis of the data reported , it seems that patients with a braf v600e mutation on thyroid fnab cytology should undergo more aggressive surgery , at least if a microcarcinoma is diagnosed [ 48 , 49 ] , followed by more radical postsurgical treatment [ 3651 ] . the data obtained from our population , who had never undergone mutational study , seem to support the suggestion made in the literature , that is , more aggressive initial surgery and closer follow - up . it should also be emphasized that , on considering only the classical variant of papillary carcinoma in our population , we found a correlation between mutations on cytology and a histological diagnosis of malignancy in a high percentage of cases ( 92% ) . another important finding is that no false positive results were recorded in our series . in conclusion , in agreement with the literature data , the data from our population suggest that the presence of the braf v600e mutation should determine a more aggressive surgical approach ( currently adopted only in cases of papillary carcinoma on final histology ) . in our limited number of cases , a retrospective study to determine whether patients with the braf v600e mutation have a worse outcome than those with wild - type braf is currently underway . the limitation of our study is the relatively small number of cases . in a larger population , we might have been able to discern a correlation between the elx index and both braf v600e and ras mutations .

3 mm 3 mm wedges were prepared from single crystal copper with a ( 100 ) orientation ( mateck gmbh , juelich , germany ) , using mechanical and electrochemical polishing . the subsequent experimental procedure is shown in fig . 1 : a 5 m thick and 200 m long lamella was machined out of the single crystal wedge using an fib microscope ( fei strata 235 ; fei , hillsboro , or , usa ) operated with ga ions at 30 kev . the wedge was then irradiated with a 1.1 mev proton beam , having a bragg peak at 7 m depth35 . therefore , the proton beam passes through the fib lamella , as seen from the logarithmic dose profile in fig . 1 , thereby avoiding hydrogen implantation in the relevant region of the specimen and having a relatively flat damage profile throughout the entire pillar . the irradiation setup was described in detail in ref . 1 was calculated with the experimental beam current averaging of 17 acm using the srim code35 . the actual sample temperature might be higher , which would affect the defect annihilation and result in a lower defect density . still , as copper is an excellent thermal conductor and the ion stopping region is not within the lamella , we do not expect a significantly different temperature . 1500 nm and heights at least five times the diameter were fabricated by cutting annular trenches with the fib . final milling currents were 10 pa and the samples had an inevitable axial taper of 2.5. the high aspect ratios of 5:1 were chosen to minimize for lateral boundary constraints and to avoid apparent hardening , especially after the formation of large slip offsets28 . from the dose profile and the pillar positions , the resultant dose for the nano - compression samples is estimated to be 0.8 0.01 dpa for the smaller samples and 0.8 0.09 dpa for the largest pillars . this surface fib damage has a distinct influence on the mechanical properties of a defect free material4 . however , given the large number of proton irradiation defects in the whole volume of our material and the pronounced difference to the unirradiated material , it is considered of minor concern in the present case . sample testing was performed in situ in a tem ( jeol 3010 , tokyo , japan ) working at 300 kev using a hysitron picoindenter ( hysitron , minneapolis , mn , usa ) equipped with a flat conductive diamond tip and operating in displacement controlled mode with a nominal displacement rate of ~1 nms , resulting in strain rates of ~10 s. videos were recorded with a charge - coupled device ( ccd ) camera ( gatan orius sc200d ; gatan , pleasanton , ca , usa ) at 30 frames per second . there is a slight difference in image contrast ( seen in the low intensity fig . 2c and 2d ) between the upper third of the image and the lower part . this emerges because the ccd image readout uses two channels to increase the frame rate , and there is a slight difference between the two dark currents . the recorded load displacement data is combined with the in situ video to properly evaluate yield stresses , calculated from the load right before the first load drop and the measured contact diameter ( assuming a circular pillar cross - section ) at this point . proper axial alignment was ensured by comparing the loading and unloading slopes for each test , as misalignment results in a pronounced reduction of the loading slope . further details on sample fabrication , experimental conditions and data evaluation are provided in ref . evaluation of the spiral dislocation source size to relate stress , , to source size , l , follows rao et al.33 : ( 1)=kgbmlln(lb ) , with k = 0.09 for a mixed type dislocation , shear modulus g = 47 gpa , burgers vector b = 0.256 nm , and schmid factor m = 0.408 . to calculate critical resolved shear stresses ( crss ) for single crystal or polycrystalline data , the normal stress has to be divided by 2.45 ( the inverse schmid factor ) and 3.1 ( the taylor factor ) , respectively . for more details 3 mm 3 mm wedges were prepared from single crystal copper with a ( 100 ) orientation ( mateck gmbh , juelich , germany ) , using mechanical and electrochemical polishing . the subsequent experimental procedure is shown in fig . 1 : a 5 m thick and 200 m long lamella was machined out of the single crystal wedge using an fib microscope ( fei strata 235 ; fei , hillsboro , or , usa ) operated with ga ions at 30 kev . the wedge was then irradiated with a 1.1 mev proton beam , having a bragg peak at 7 m depth35 . therefore , the proton beam passes through the fib lamella , as seen from the logarithmic dose profile in fig . 1 , thereby avoiding hydrogen implantation in the relevant region of the specimen and having a relatively flat damage profile throughout the entire pillar . the irradiation setup was described in detail in ref . 1 was calculated with the experimental beam current averaging of 17 acm using the srim code35 . the actual sample temperature might be higher , which would affect the defect annihilation and result in a lower defect density . still , as copper is an excellent thermal conductor and the ion stopping region is not within the lamella , we do not expect a significantly different temperature . 1500 nm and heights at least five times the diameter were fabricated by cutting annular trenches with the fib . final milling currents were 10 pa and the samples had an inevitable axial taper of 2.5. the high aspect ratios of 5:1 were chosen to minimize for lateral boundary constraints and to avoid apparent hardening , especially after the formation of large slip offsets28 . from the dose profile and the pillar positions , the resultant dose for the nano - compression samples is estimated to be 0.8 0.01 dpa for the smaller samples and 0.8 0.09 dpa for the largest pillars . this surface fib damage has a distinct influence on the mechanical properties of a defect free material4 . however , given the large number of proton irradiation defects in the whole volume of our material and the pronounced difference to the unirradiated material , it is considered of minor concern in the present case . sample testing was performed in situ in a tem ( jeol 3010 , tokyo , japan ) working at 300 kev using a hysitron picoindenter ( hysitron , minneapolis , mn , usa ) equipped with a flat conductive diamond tip and operating in displacement controlled mode with a nominal displacement rate of ~1 nms , resulting in strain rates of ~10 s. videos were recorded with a charge - coupled device ( ccd ) camera ( gatan orius sc200d ; gatan , pleasanton , ca , usa ) at 30 frames per second . there is a slight difference in image contrast ( seen in the low intensity fig . 2c and 2d ) between the upper third of the image and the lower part . this emerges because the ccd image readout uses two channels to increase the frame rate , and there is a slight difference between the two dark currents . the recorded load displacement data is combined with the in situ video to properly evaluate yield stresses , calculated from the load right before the first load drop and the measured contact diameter ( assuming a circular pillar cross - section ) at this point . proper axial alignment was ensured by comparing the loading and unloading slopes for each test , as misalignment results in a pronounced reduction of the loading slope . further details on sample fabrication , experimental conditions and data evaluation are provided in ref . evaluation of the spiral dislocation source size to relate stress , , to source size , l , follows rao et al.33 : ( 1)=kgbmlln(lb ) , with k = 0.09 for a mixed type dislocation , shear modulus g = 47 gpa , burgers vector b = 0.256 nm , and schmid factor m = 0.408 . to calculate critical resolved shear stresses ( crss ) for single crystal or polycrystalline data , the normal stress has to be divided by 2.45 ( the inverse schmid factor ) and 3.1 ( the taylor factor ) , respectively . for more details

to describe a patient with behet 's disease and anterior uveitis , which was not cured by local and systemic corticosteroid treatments , who underwent trabeculotomy one week after infliximab administration . neither ocular inflammatory attacks nor infectious complications were found in the operated eye of the patient during follow - up . trabeculotomy one week after administration of infliximab appears to be safe and effective in treating secondary glaucoma associated with behet 's disease . infliximab , a humanized antibody against tumor necrosis factor - alpha ( tnf- ) , reduces uveitis attacks in patients with behet 's disease ( bd ) [ 1 , 2 ] , although anti - tnf- therapy increases the risk of infections due to the systemic blockade of tnf- . cataract , glaucoma , or other vitreoretinal problems often accompany bd and patients may require intraocular surgery for treatment . however , it is not well understood whether infliximab increases the risk of infections associated with surgery or when the best time for intraocular surgery is after infliximab administration . we recently examined the safety and effectiveness of infliximab administration one week before cataract surgery , and neither ocular inflammatory attacks nor infectious complications were found . here , we report on a male patient with bd and secondary glaucoma who successfully underwent trabeculotomy one week after his second preoperative infliximab administration without suffering any postoperative complications . based on these small scale series , we suggest the appropriate timing for intraocular surgery in patients with bd may be one week after administration of infliximab . a 53-year - old japanese man was referred to our department in july 2011 due to elevated intraocular pressure ( iop ) with repeated anterior uveitis in his left eye since april 2011 . he had lost sight in his right eye after recurrent uveitis and secondary glaucoma despite topical and systemic corticosteroid treatments and trabeculectomy performed three times in october 1998 , december 2003 , and november 2005 . the ophthalmic examination disclosed that his left best - corrected visual acuity ( bcva ) was decreased ( 20/100 ) , while iop was 36 mm hg in the right and 46 mm hg in the left eye . on slit - lamp examination , both corneas were edematous due to elevated iops , and inflammation was seen in the anterior chamber ( cells 2 + , flare + , keratic precipitates ( kp ) + ) and in the vitreous ( cells 2 + ) of the left eye . fundus examination showed retinal vasculitis and increased cup - to - disc ratio in the left eye . the patient had a history of recurrent oral aphthae and erythema nodosa on his arms . the hla - b51 antigen was present in the patient and he was diagnosed with bd . the subject had already received topical treatment for uveitis and glaucoma of his left eye ; therefore , we continued eye drops containing latanoprost 0.005% , timolol maleate 0.5% , dorzolamide hydrochloride 1% , bunazosin hydrochloride 0.01% , and betamethasone sodium phosphate 0.1% . we started oral prednisolone ( 30 mg / day ) , which was gradually tapered as the anterior chamber inflammation disappeared after 3 weeks and iop decreased to 1015 mm hg . gonioscopy with a goldman 3-mirror lens showed the angle of his left eye was open and there was slight peripheral anterior synechiae but no neovascularization . four months later , this patient came to our department again because of elevated iop ( 4550 mm hg ) with inflammation in the anterior chamber ( cells 2 + , flare 2 + , kp 2 + ) and the vitreous ( cells + ) of his left eye ( fig . oral prednisolone was increased ( 30 mg / day ) , but there was no improvement . the computerized tomography to analyze his chest did not show an abnormal lesion , but his tuberculin reaction was positive ; therefore , he started prophylactic isoniazid before infliximab administration . until the glaucoma surgery , this patient received intravenous d - mannitol ( 500 ml ) and acetazolamide ( 500 mg ) twice a day . infliximab therapy ( 5 mg / kg ) was intravenously administered at weeks 4 and 6 ( fig . 1 ; week 0 was defined as the first day of the last uveitis attack ) . by the second infliximab administration , neither ocular inflammatory attacks nor infectious complications were found in the operated eye during postoperative follow - up . third infliximab therapy was intravenously administered at week 10 ( fig . 1 ) and every 8 weeks thereafter . the subject 's left eye is currently in good condition without corneal edema and inflammation in the anterior chamber for the last four months . typical glaucomatous visual field defects were detected by goldman perimetry , but the patient 's present left bcva was 20/70 and the iop was around 9 mm hg . a summary of changes in the left iop and of treatments after the last uveitis attack are shown in figure 1 . as in our previous reports , this patient received the following preoperative antibiotic therapy : 0.5% levofloxacin eye drops ( santen pharmaceutical company , osaka , japan ) and 500 mg levofloxacin oral tablets ( daiichi pharmaceutical company , tokyo , japan ) [ 4 , 5 ] . the results from this case report demonstrate that trabeculotomy one week after administration of infliximab is safe and effective for a patient with bd . there were no adverse effects , such as infection . to our knowledge , there is only one published report describing glaucoma surgery in a patient with bd undergoing treatment with infliximab therapy . in this previous report , three eyes underwent successful trabeculectomy , but the timing of the glaucoma surgery after the final preoperative infliximab administration was not described . in two reports describing cataract surgery in patients with bd receiving infliximab treatment [ 7 , 8 ] , patients underwent surgery about halfway through an eight - week interval between doses of infliximab . the serum levels of infliximab significantly correlate with its effectiveness in preventing recurrent episodes of uveitis , and this midpoint between infliximab doses may be appropriate for determining the timing of surgery , based on the risk of infection associated with drug concentration . here , we performed trabeculotomy one week after the last preoperative infliximab administration without suffering any postoperative complications , including infection . it is expected that a high serum concentration of infliximab is maintained in this short period after administration ; thus , we believe it to be a safer period for surgery than four weeks after infliximab administration in terms of preventing surgery - associated intraocular inflammation in bd patients . after the last uveitis attack , the elevated iop lasted more than 6 weeks in our patient and did not seem to be transient , which is associated with anterior uveitis . although we performed trabeculotomy for this patient , we also planned trabeculectomy several weeks later if the initial trabeculotomy was not effective . trabeculotomy was our first choice as there is a risk of postoperative infection in trabeculectomy , in spite of an excellent efficacy in reducing iop . trabeculectomy with mitomycin c has provided long - term safety and was effective in reducing iop in cases with secondary glaucoma associated with bd [ 10 , 11 ] . however , as shown here , trabeculotomy is a good surgical option for secondary glaucoma associated with bd . fortunately , inflammation in the anterior chamber drastically improved after the initial infliximab administration without the use of other systemic drugs such as azathioprine , colchicine , and cyclosporin . this allowed us to promptly perform glaucoma surgery and to preserve stable iop for several months after the surgery . this patient had already lost sight in his right eye the first time we met him ; therefore , we considered the second uveitis attack as high risk for his left eye , and consequently , planned emergent treatment to protect it . infliximab may be the first choice for treating urgent eye conditions in bd patients . however , if this patient still shows infliximab - resistant uveitis , we may need to add other systemic drugs immediately . there is no proprietary interest , and no grants and funds were received in support of the study .

cardio ankle vascular index ( cavi ) , an indicator of the overall stiffness of the artery from the origin of the aorta to the ankle , is elevated in patients who have coronary risk factors . both organic and functional factors are thought to be associated with arterial stiffness assessed by cavi , and the latter can be improved by changes in lifestyle.1,2 the principle of cavi is based on the stiffness parameter theory proposed by hayashi et al.2 arterial stiffness was originally assessed within a limited region . for the assessment of stiffness of long arteries , bramwell - hill s equation was adapted , which is based on the assumption that change in vascular caliber is associated with pulse wave velocity.1 therefore , cavi is calculated using systolic and diastolic blood pressure and pulse wave velocity.1 the vascular screening system , vasera ( fukuda denshi co. , ltd . , tokyo , japan ) , has been developed as a method to assess arterial stiffness based on this theory . the reproducibility of cavi using this device is consistent ( coefficient of variance : average 3.8%).1 several clinical studies have shown that cavi is increased in patients with atherosclerotic diseases as well as in those with coronary risk factors , however it decreases in response to control of those risk factors.2 we followed a patient who had diabetes mellitus and obstructive sleep apnea ( osa ) by measuring cavi for 8 years . osa is defined as a condition with the presence of at least five obstructive respiratory events ( eg , apnea and hypopneas ) per hour during sleep ; it is found in 9%26% of middle - aged people without specific risk factors for the disorder . osa is associated with an increased prevalence of cardiovascular and cerebrovascular disease , as well as insulin resistance.3,4 the present case was a 71-year - old male patient who had diabetes mellitus , hypertension , dyslipidemia , and osa . he had a history of acute myocardial infarction in the mid of the left coronary artery when he was 49 years old . he developed effort angina at age 63 years and underwent coronary angiography , as three affected branches were found , coronary artery bypass grafting ( cabg ) was planned . before cabg , cavi was 11.8 on the right and 11.5 on the left . his height was 178 cm , body weight was 76 kg , body mass index was 23.9 , and systolic / diastolic blood pressure was 135/81 mmhg . he received oral medication with carvedilol 10 mg / day , losartan 50 mg / day , rosuvastatin 7.5 mg / day , aspirin 100 mg / day , and biguanides 500 mg / day ; he administered self - injections of insulin humalog mix 50 ( 16 - 18 - 20 units ) . three years later , at age 66 years , he was suspected of having osa because of daytime sleepiness and he underwent polysomnography ( psg ) , which revealed severe osa with apnea continuous positive airway pressure ( cpap ) was started at age 66 . during cpap , the patient had good compliance in wearing a mask from the early stage ; during the medical examination , the usage rate was consistently 90% ( average 7 hours ) , and residual ahi was maintained at 2 events . five years after the initial cpap , at age 71 , cpap - psg was done . table 1 shows changes in sleeping parameters between the first and second psg . after the start of cpap in addition , the ratio of sleep stage 1 was decreased , while stage 2 and rapid eye movement sleep stage were increased . in the present case , when the patient was 68 years old , cavi was 10.4 on the right and 10.2 on the left , showing a marked improvement from baseline ( age 63 ; right 11.8 , left 11.5 ) ( figure 1 ) . cavi then gradually increased to the baseline level during the subsequent year and a half . owing to an increased dose of biguanides , hba1c improved , and in response , cavi also improved . nevertheless , even after the positive response to treatment with cpap and biguanides , vascular elasticity increased , as reflected by an increased cavi , following an increase in body weight due to worsened lifestyle and uncontrolled diabetes . a long - term epidemiological study conducted in spain in 2005 showed that the high incidence of cardiovascular disease in patients with severe osa was significantly decreased after patients started receiving cpap.5 cross - sectional studies showed that osa patients had a significantly higher cavi.6 another study conducted in japan reported that cavi improved after treatment with cpap in patients with osa.7 the results of a prospective study in lithuania in 2015 that investigated 2,106 patients with metabolic syndrome showed that , during the mean 3.8-year follow up , the survival rate was significantly lower in patients with cavi 7.95 due to cardiovascular disease . this suggests that in patients with metabolic syndrome cavi may be considered as a surrogate risk marker of cardiovascular disease.8 cavi is closely associated with age according to epidemiological studies , although clinical test values should be monitored on the basis of individual cases . cavi in the present case , which should have shown an increasing trend during the 8-year observation period , showed a decrease after the patient started cpap . we consider that cavi reflects functional changes including the contractural state of vascular smooth muscle cells , which are associated with sympathetic nerve and parasympathetic nerve activities , nitric oxide generating system , and vascular endothelial function . it is known that cpap therapy reduces chronic activation of the sympathetic nerves caused by osa.911 as a result , we thought that cavi was decreased by the improvement of vascular endothelial function . we performed psg with cpap 5 years after the initial cpap , and observed a decrease in ahi from 56.9 events / hour to 7.2 events / hour , an improvement of the hypoxic condition , and achievement of a deeper sleep stage ( table 1 ) . nevertheless , cavi again increased in this patient , thus , continuous management of lifestyle including body weight is essential in patients with metabolic syndrome . the potential mechanisms underlying the osa obesity metabolic syndrome interaction involve sympathetic activation , oxidative stress , inflammation , and neurohumoral changes.1214 diabetes mellitus is also associated with an increase in cavi , and antidiabetic agents decrease cavi.1517 this is considered to occur because the hyperglycemic condition worsens vascular endothelial function , causing contracture of vascular smooth muscle . in the present case , biguanides were shown to improve insulin resistance.18 in the present case , after the start of cpap , the patient had a gradual increase in hba1c due to an increase in body weight . cavi improved after biguanides dose was increased from 500 mg to 1,000 mg ( figure 1 ) . however , during further observation , hba1c and body weight increased again , and cavi also increased again . increased cavi suggests existence of cardiovascular risks like underlying vascular stiffening . cavi represents both functional and organic arterial stiffness , and reflects both the state of smooth muscle contraction and mechanical properties of the arterial wall.2 with an abundance of evidence , continuous monitoring of cavi to address a sudden change in the values would be necessary to optimize treatment for individual patients . the present case showed that cpap for osa and biguanides for diabetes are useful treatments that improve vascular endothelial function , however , the positive effects on cavi last only for a short term . increased cavi suggests the existence of cardiovascular risks like underlying vascular stiffening , and decreased cavi suggests their improvement . as for the long term , management of upstream conditions such as obesity may be more necessary . vascular function parameters including cavi may be useful not only in epidemiological studies , but also in the assessment of risk factors on an individual patient basis .

extracellular electron transfer for respiration of insoluble oxide minerals by microbes is important for the biogeochemical cycling of metals , biotechnology , and bioremediation and may represent the earliest form of respiration on earth ( 1 ) . in natural environments , microorganisms catalyze the breakdown of organic matter coupled to the reduction of a terminal electron acceptor . some of the most abundant electron acceptors in soil and sediment environments are insoluble fe(iii ) oxide minerals . ferric iron can be mobilized from anaerobic environments through the activity of extracellular electron transfer by dissimilatory metal - reducing bacteria as fe(ii ) , which is soluble and can diffuse to the anoxic / oxic interface , where it may be assimilated or reoxidized . this metabolism can also be harnessed in devices called microbial fuel cells to harvest electrical current , where poised electrodes serve as the electron acceptor for respiration ( 2 ) . though we have studied these microbes in great detail , there are several mechanisms of extracellular electron transfer being debated . to date , three strategies of extracellular electron transfer have been proposed to explain how dissimilatory metal - reducing bacteria are able to respire insoluble substrates : direct contact , nanowires , and electron shuttling . the two best - studied model systems for how bacteria respire insoluble substrates are geobacter sulfurreducens strain gsu1501 and shewanella oneidensis strain mr-1 ( mr-1 ) ( 3 , 4 ) . while both organisms utilize a variety of multiheme c - type cytochromes , only shewanella is able to respire insoluble substrates without direct contact ( 5 , 6 ) . nanowires that may facilitate respiration of insoluble substrates ( 7 , 8) ; however , these structures alone can not explain the ability of shewanella to reduce insoluble substrates at a distance . unlike the case with geobacter , all investigated shewanella cultures accumulate riboflavin ( b2 ) and flavin mononucleotide ( fmn ) in supernatants , which can act as electron shuttles to accelerate reduction of insoluble substrates ( 9 , 10 ) , including multiple forms of fe(iii ) oxide ( 11 ) , and facilitate sensing of redox gradients ( 12 ) . secreted flavins are reduced by the mtr respiratory pathway in mr-1 ( 13 ) , and the crystal structure of a paralog of the outer - membrane - associated decaheme cytochrome mtrc reveals fmn binding domains near two solvent - exposed heme groups ( 14 ) , providing biochemical insight into how flavin electron shuttles facilitate respiration . without outer - membrane cytochromes , mr-1 is unable to respire insoluble electron acceptors by either electron shuttles or direct contact ( 13 , 15 ) . however , the contribution of electron shuttles versus direct contact to total extracellular electron transfer is unknown . a mutant unable to secrete electron shuttles is required to quantify the contribution of electron shuttling , especially since mutants defective in direct electron transfer are also impaired in reduction of flavin electron shuttles ( 13 , 16 ) . s. oneidensis usha was mated with escherichia coli wm3064 ( 17 ) containing tnphoa-1 ( 18 ) to create transposon mutants . transposon selection occurred under aerobic conditions on shewanella basal medium ( sbm ) ( 19 ) plates containing 40 mm lactate ( sigma ) and 20 g ml kanamycin . isolated colonies were inoculated into 96-well plates containing liquid luria - bertani broth ( lb ) and 50 g ml kanamycin . the 96-well plates were incubated at 30c for 16 h and then transferred to 96-well plates containing liquid sbm with 40 mm lactate and 10 g ml kanamycin . plates were incubated at 22c for 72 h before fluorescence was measured at 440-nm excitation and 525-nm emission in a molecular devices spectramax m2 plate reader . cultures with two standard deviations less than the parent strain were selected , and sites of transposon insertions were determined by arbitrary pcr and sequencing . out of ~8,000 mutants screened , two transposon insertions were found in a predicted transmembrane protein encoded by so_0702 . the transporter is a member of the mate ( multidrug and toxin efflux ) family of na - driven multidrug and toxin efflux pump proteins ( cog0534 ) ( 20 ) . the electron shuttle production pathway in mr-1 requires the 5-nucleotidase usha , which processes flavin adenine dinucleotide ( fad ) into fmn and amp in the periplasm ( 19 ) . accumulation of fad in usha culture supernatants indicates that fad , not b2 or fmn , is the flavin transported across the cytoplasmic membrane of s. oneidensis . an in - frame deletion was generated , and the so_0702 locus was renamed bfe ( bacterial fad exporter ) . flavin profiles of supernatants from the mr-1 , mutant , and complemented strains grown anaerobically in sbm with lactate and fumarate were analyzed by high - performance liquid chromatography ( hplc ) ( fig . 1 ) . the fmn detected in these supernatants resulted from the cleavage of fad by usha . while in usha cultures , the major flavin detected was fad . deletion of bfe resulted in a substantial decrease in flavin export in both backgrounds . when bfe was expressed in a multicopy plasmid in mr-1 or the usha strain , there was a 2-fold increase in total flavins compared to levels for vector controls without changing the primary supernatant flavin . all shewanella strains tested grew at the same rate under anaerobic conditions in lb with 20 mm lactate and 40 mm fumarate , which indicated that no apparent deleterious effects from deletion or overexpression of bfe manifested under these conditions . anaerobic doubling times for these strains were 61 2 min ( mr-1 with empty vector ) , 59 3 min ( mr-1 with bfe in multicopy ) , 60 1 min ( bfe strain with empty vector ) , and 59 2 min ( bfe strain with bfe in multicopy ) . importantly , these strains range from background levels ( mr-1 with empty vector ) to twice the concentration ( when bfe is in multicopy ) of flavin electron shuttles in the culture supernatant , indicating that the metabolic burden of flavin electron shuttle production is not significant enough to influence growth under the conditions tested . flavin profile of s. oneidensis ( so ) or e. coli ( ec ) strains quantified by hplc . s. oneidensis cultures were anaerobically grown in sbm with 20 mm lactate and 40 mm fumarate at 30c . balch tubes were made anaerobic by flushing nitrogen gas through butyl rubber stoppers for 15 min . after 15 h of incubation , a sample was taken and cells were removed by centrifugation . the usha e. coli strain was grown in sbm with 20 mm lactate overnight at 37c . it is unlikely that expression of bfe destabilized the cytoplasmic membrane to allow increased flavins in culture supernatants . if bfe was destabilizing the cytoplasmic membrane , an increase of all flavins should be observed . however , expression of bfe in bfe usha double mutant culture supernatants resulted in a specific increase in fad ( fig . 1 ) , consistent with bfe specifically transporting fad across the inner membrane . to provide further evidence for fad transport , bfe supernatants from e. coli usha mutant strains expressing bfe contained 12.5 times more fad than empty vector controls ( fig . 1 ) . electron shuttles provide greater access for a cell to reduce insoluble electron acceptors by diffusing through biofilms or into areas too small for a cell to physically fit . in contrast , electron shuttles should have no bearing on the ability of the cell to respire soluble electron acceptors that are able to diffuse to the cell . if flavin electron shuttles are the primary mechanism for reduction of insoluble extracellular electron acceptors by mr-1 , then the removal of flavins from medium should drastically reduce the reduction rates of insoluble electron acceptors but have no effect on reduction rates of soluble electron acceptors . to determine the contribution of flavin electron shuttles to fe(iii ) reduction by mr-1 , fe(ii ) production over time was quantified with a ferrozine - based assay ( 21 ) as previously described ( 13 ) . cells were provided 5 mm fe(iii ) oxide ( ferrihydrite ) as the sole anaerobic electron acceptor ( fig . strains lacking bfe reduced insoluble fe(iii ) oxide at only ~25% of the rate of mr-1 , demonstrating the importance of flavin electron shuttles under these conditions . a similar observation was made qualitatively using mn(iv ) oxide ( birnessite ) as the terminal electron acceptor ( data not shown ) . we speculate that the residual fe(iii ) oxide reduction capacity of the bfe mutant strain was mediated by direct contact . rates of fe(iii ) oxide reduction by mr-1 were known to increase with exogenous flavin addition ( 10 , 13 ) . , resulting in strains that reduce fe(iii ) oxide faster than mr-1 ( fig . 2a ) or addition of 10 m fmn was able to alleviate the fe(iii ) oxide reduction defect ( see fig . s1a in the supplemental material ) . as predicted , flavin electron shuttles were not necessary for reduction of soluble fe(iii ) citrate ( see fig . , these experiments demonstrate the advantage of using flavin electron shuttles to reduce insoluble fe(iii ) oxide under these conditions and provide evidence that the mtr respiratory pathway itself is unimpaired in bfe mutant strains . fe(iii ) oxide ( ferrihydrite ) reduction was quantified as previously described ( 13 ) for the following strains : mr-1 + vector ( ) , mr-1 + bfe ( ) , bfe strain + vector ( ) , and bfe strain + bfe ( ) . one milliliter from an aerobic sbm culture with 20 mm lactate was added to 9 ml of an anaerobic sbm culture with 50 mm lactate and 40 mm fumarate . cultures were grown at 30c with shaking until an optical density at 600 nm of 0.4 was reached . bioreactors were continuously flushed with nitrogen gas , and electrodes were poised at a potential of + 0.242 v versus a standard hydrogen electrode using a 16-channel vmp potentiostat ( bio - logic sa ) . current measurement of mr-1 ( black ) , mr-1 + 10 m fmn ( flavin mononucleotide ) ( gray ) , the bfe mutant ( blue ) , and the bfe mutant + 10 m fmn ( red ) in bioreactors is shown . analogous to fe(iii ) oxides , graphite electrodes in three - electrode bioreactors are insoluble but do not become soluble once reduced and have different molecular surface features . three - electrode bioreactors have a distinct advantage in that electrons transferred to the electrode are quantified and measured as current in real time ( 9 ) . the electrode acts as a proxy for various forms of fe(iii ) oxides based on the set potential of the electrode . in bioreactors , strains with and without bfe were tested for their ability to reduce graphite electrodes set at a potential comparable to that of the ferrihydrate used previously . without exogenous flavin electron shuttles , the current in bioreactors containing bfe mutants did not increase , unlike the case with bioreactors containing mr-1 ( fig . the stable current over 75 h for the bfe mutant suggests that there are no other electron shuttles accumulating to substantial quantities . when current production plateaus in bioreactors , that of the bfe strain is ~75% lower than that of mr-1 without flavin supplementation , a difference similar in magnitude to the results observed with fe(iii ) oxide as an electron acceptor . the residual activity is likely due to a direct contact mechanism employed by s. oneidensis using the mtr pathway . when bioreactors are supplemented with 10 m fmn , the current of both mr-1 and bfe mutant strains is similar and higher levels of current are achieved ( fig . addition of fad to either fe(iii ) oxide reduction assays or bioreactors also alleviated bfe mutant defects ( data not shown ) , since usha rapidly converts exogenous fad to fmn ( 19 ) . electron shuttling has been a controversial hypothesis for extracellular electron transfer since it was first suggested ( 22 ) . quantifying the contribution of flavin electron shuttling to the ability of s. oneidensis to respire insoluble substrates required a mutant strain unable to accumulate flavins in the culture supernatant . our results demonstrate that electron shuttling accounts for ~75% of the insoluble substrate respiratory capacity of s. oneidensis under laboratory conditions . though we have specifically tested one form of fe(iii ) oxide ( ferrihydrite ) , graphite electrodes , and mn(iv ) oxide ( birnessite ) , we believe flavin electron shuttles will be important for the ability of s. oneidensis to respire other insoluble substrates . homologs of bfe exist in the genomes of closely related vibrio species and in all sequenced shewanella species , consistent with flavin accumulation in the culture supernatants of various shewanella species ( 9 , 10 , 13 ) . while g. sulfurreducens strain pca has a mate - like domain efflux pump homolog of bfe , the amino acid identity is below 30% , consistent with these bacteria not secreting flavin electron shuttles . characterization of bfe in s. oneidensis demonstrates the pivotal role of flavin electron shuttles in facilitating reduction of insoluble electron acceptors by these bacteria . based on evidence presented here and on recent biochemical results ( 14 , 23 ) , we propose that flavin electron shuttling and direct contact via outer - membrane - associated c - type cytochromes are sufficient to explain the extracellular electron transfer abilities of s. oneidensis . we are working to quantify the metabolic burden of flavin electron shuttle production and exploring the environmental relevance of this shuttle - based respiratory strategy . electron shuttling has been a controversial hypothesis for extracellular electron transfer since it was first suggested ( 22 ) . quantifying the contribution of flavin electron shuttling to the ability of s. oneidensis to respire insoluble substrates required a mutant strain unable to accumulate flavins in the culture supernatant . our results demonstrate that electron shuttling accounts for ~75% of the insoluble substrate respiratory capacity of s. oneidensis under laboratory conditions . though we have specifically tested one form of fe(iii ) oxide ( ferrihydrite ) , graphite electrodes , and mn(iv ) oxide ( birnessite ) , we believe flavin electron shuttles will be important for the ability of s. oneidensis to respire other insoluble substrates . homologs of bfe exist in the genomes of closely related vibrio species and in all sequenced shewanella species , consistent with flavin accumulation in the culture supernatants of various shewanella species ( 9 , 10 , 13 ) . while g. sulfurreducens strain pca has a mate - like domain efflux pump homolog of bfe , the amino acid identity is below 30% , consistent with these bacteria not secreting flavin electron shuttles . characterization of bfe in s. oneidensis demonstrates the pivotal role of flavin electron shuttles in facilitating reduction of insoluble electron acceptors by these bacteria . based on evidence presented here and on recent biochemical results ( 14 , 23 ) , we propose that flavin electron shuttling and direct contact via outer - membrane - associated c - type cytochromes are sufficient to explain the extracellular electron transfer abilities of s. oneidensis . we are working to quantify the metabolic burden of flavin electron shuttle production and exploring the environmental relevance of this shuttle - based respiratory strategy . the bfe strain reduces soluble fe(iii ) at wild - type rates , and the insoluble fe(iii ) reduction defect is rescued with the addition of exogenous flavins . the iron reduction assays were performed in a manner identical to that for fig . 2 . ( a ) reduction of insoluble fe(iii ) with exogenous 10 m fmn added by mr-1 + vector ( ) , mr-1 + bfe ( ) , the bfe strain + vector ( ) , and the bfe strain + bfe ( ) . ( b ) reduction of soluble fe(iii ) by mr-1 + vector ( ) , mr-1 + bfe ( ) , the bfe strain + vector ( ) , and the bfe strain + bfe ( ) .

many approaches have been used to prepare oral formulations of poorly water - soluble drugs to improve oral bioavailability.13 among them , solid dispersion ( sd ) , in which the drug molecule is dispersed in a polymeric matrix , has been shown to improve the aqueous solubility and oral absorption of drugs.4,5 sd produces these effects on poorly water - soluble drugs by increasing wettability , decreasing agglomeration , and altering the physical state of the drugs . although sd formulations can be prepared by several methods , hot - melt extrusion ( hme ) is an attractive and emerging method for the production of sds.6,7 the hme process has the advantage of being a continuous , solvent - free , dust - free ( environmentally friendly ) , and robust manufacturing process , as well as possessing the ability to yield several solid dosage forms ( eg , pellets or tablets).8 during the hme process , shear stress generated by extruder screws can be applied to overcome the crystal lattice energy of crystalline drugs and soften polymers . the mixing and dispersing of the drugs and polymers occur inside the extruder , from which the melted product is extruded . sds can be defined as eutectics , crystalline dispersions , and solid solutions,9 according to the state ( crystalline , amorphous , or molecularly dispersed ) of the matrix and the drug , as well as the number of phases . the physicochemical properties of sds can be influenced the hme equipment used ( eg , feeder , barrels , and die ) and the extrusion processing parameters ( eg , barrel and temperatures , screw speed , melt pressure , torque , screw configuration , etc ) . generally , the hme process temperature is set 20c30c lower than the melting point of the drug.8 furthermore , the glass transition temperature ( tg or melting temperature ( tm ) of the polymers should considered . among several polymers that are suitable for the hme process , soluplus ( sp ) and d - alpha - tocopherol polyethylene glycol 1000 succinate ( tpgs ) were chosen for this investigation . sp ( tg of approximately 70c ) , amphiphilic copolymer composed of polyethylene glycol ( peg ) 6000 , vinylcaprolactam , and vinyl acetate , has been used as a drug solubilizer and permeation enhancer across biological membranes.10,11 tpgs is a d - alpha - vitamin e ester derived from vitamin e , and its tm is approximately 40c.12 tpgs can be used as a nonionic surfactant due to its amphiphilic properties , and it can improve the solubility and permeability of poorly water - soluble drugs and stabilize amorphous drugs in sds.13 the tg and tm values of sp and tpgs seem to be appropriate for hme processing . in this study , sd formulations processed by hme were developed for the oral delivery of valsartan ( vst ) . vst is a selective angiotensin ii type 1 receptor antagonist used for the treatment of hypertension . vst has relatively low aqueous solubility ( < 0.1 mg / ml ) and low oral bioavailability ( < 25% ) due to poor solubility in acidic solutions.14 the ph - dependent drug release can induce inter- and intrasubject variability in drug absorption . to solve these drawbacks , several oral formulations have been developed for vst delivery.1416 although sd formulations using vst have already been reported,17 the application of hme technique to their preparation has not been investigated . herein , we report the development and evaluation of sds based on sp and tpgs , processed by the hme method with a high shear , for the oral delivery of vst . to the best of our knowledge , high shear - driven hme - processed sds based on sp and tpgs solid - state studies were performed to evaluate drug amorphization and dispersion in the polymer matrix . phosphoric acid and hydrochloric acid were purchased from sigma - aldrich co ( st louis , mo , usa ) . acetonitrile and other organic solvents were acquired from fisher scientific ( hanover park , il , usa ) . double deionized water ( ddw ) was prepared using super - q plus water purification systems ( merck millipore , merck kgaa , darmstadt , germany ) . drug and polymers ( about 250 g of the total amount ) were blended for 3 minutes prior to extrusion according to the ratios presented in table 1 . these mixtures were fed into a twin - screw hot - melt extruder ( sts-25hs , hankook em ltd , pyoung - taek , korea ) equipped with a round - shaped die ( 1 mm in diameter ) . the extrusion rate was 2830 g / min and the extrusion pressure was about 100 bars . a sieve with 0.21 mm wire width ( 70 mesh ) was used to prepare the powders . the dispersion of drug molecules in the polymer matrix and the transition between crystalline and amorphous forms were investigated by solid - state studies . ft - ir spectra of vst , sp , and tpgs , as well as the sd formulations f1 and f2 , were obtained by a jasco ft / ir-4200 type a ( jasco co , tokyo , japan ) instrument with the kbr method . x - ray diffraction ( xrd ) analysis was performed with a d5005 model diffractometer ( bruker , germany ) at room temperature . monochromatic cu - k radiation ( =1.5406 ) was used in the 2 angle range from 6 to 40 , with an angular increment of 0.02/s and a scan speed of 1/min at 40 ma and 40 kv . differential scanning calorimetry ( dsc ) thermograms of vst , sp , tpgs , f1 , and f2 were obtained with a dsc - q100 instrument ( ta instruments , new castle , de , usa ) . dsc analysis of the sd formulations f1 and f2 after 6 months of storage at room temperature was also performed . thermograms were scanned with aluminum from 30c to 190c at a speed of 10c / min under a nitrogen atmosphere ( 50 ml / min ) . in vitro drug release was measured with a dissolution tester ( tdt-08l ; electrolab , maharashtra , india ) . the vst powder and formulations ( f1 and f2 ) , each containing 20 mg vst , were encapsulated in gelatin capsules and immersed in 900 ml of dissolution media ( ph 1.2 : containing hydrochloric acid and 0.3% tween 80 ; ph 4.0 : acetate buffer containing 0.3% tween 80 ; ph 6.8 : containing phosphoric acid ) at 37c and stirred at 100 rpm . aliquots ( 7 ml ) of the dissolution media were collected at predetermined times ( 15 minutes , 30 minutes , 45 minutes , 60 minutes , 90 minutes , and 120 minutes ) and an equivalent volume of fresh medium was added at each sampling time to compensate . the released vst was quantitatively analyzed with a high - performance liquid chromatography ( hplc ) system ( waters co , milford , ma , usa ) equipped with a reversed - phase c18 column ( universil c18 , 1504.6 mm , 5 m ; fortis technologies ltd , cheshire , uk ) , a pump ( waters 1525 ) , an automatic injector ( waters 717 plus ) , and an ultraviolet / visible detector ( waters 2487 ) . the mobile phase was composed of acetonitrile and ddw ( 60:40 , v / v ) with ph adjusted to 3.0 with phosphoric acid . the detection wavelength and flow rate were 247 nm and 1.0 ml / min , respectively . the injection volume was 20 l , and the retention time of vst was 3.3 minutes . the correlation coefficient ( r ) of the linear regression line was 0.999 in this method . the accuracy and precision values of the inter- and intra - day samples were 92.9%109.4% and 0.1%5.5% , respectively . in vivo pharmacokinetic studies were performed in male sprague dawley rats ( 2505 g body weight ; orient bio , sungnam , korea ) . the rats were reared in a light - controlled room at a temperature of 22c2c and 55%5% relative humidity . the experimental protocols of the animal studies were approved by the animal care and use committee of the college of pharmacy ( seoul national university , seoul , republic of korea ; no snu-130722 - 1 - 1 ) . the left femoral artery was cannulated with a polyethylene tube ( pe-50 ; becton dickinson diagnostics , md , usa ) under zoletil ( virbac , carros , france ) anesthesia ( 50 mg / kg , intramuscular injection ) . vst powder or the sd formulations were encapsulated in gelatin microcapsules ( torpac inc , fairfield , nj , usa ) and administered orally at a dose of 4 mg / kg . blood samples ( 200 l ) were collected from the femoral artery at 5 minutes , 15 minutes , 30 minutes , 45 minutes , 60 minutes , 90 minutes , 120 minutes , 240 minutes , 480 minutes , and 1,440 minutes after vst administration , and an equivalent volume of normal saline ( containing 20 u / ml heparin ) was administered at each sampling time . the aliquots ( 70 l ) of plasma were stored at 70c before the quantitative analysis of drug . vst concentrations in rat plasma were determined by liquid chromatography tandem mass spectrometry ( lc - ms / ms ) . to each 50 l plasma sample , 5 l of losartan ( lst , internal standard ) solution ( 15 g / ml ) and 145 l of acetonitrile were added , and the sample was vortexed for 5 minutes . after centrifugation at 16,000 g for 5 minutes , the supernatant ( 2 l ) was injected into the lc - ms / ms system , equipped with an agilent technologies 1260 infinity hplc system ( agilent technologies , wilmington , de , usa ) and agilent technologies 6430 triple quad lc / ms system . the chromatographic separation was achieved using synergi 4 hydro - rp 80 column ( 752.0 mm ; phenomenex , ca , usa ) . the mobile phase was composed of acetonitrile and 5 mm ammonium formate buffer ( 85:15 , v / v ) and the flow rate was 0.4 ml / min . the gas temperature , gas flow , nebulizer pressure , and capillary voltage were 300c , 11 l / min , 30 psi , and 4,000 v , respectively . the fragmentation transitions were mass - to - charge ratio ( m / z ) 436.2 to m / z 291.2 for vst and m / z 423.4 to m / z 207.3 for lst . the fragmentor voltage and collision energy for vst were 98 v and 14 ev , respectively , and were 115 v and 20 ev , respectively , for lst . the retention times of vst and lst were 0.46 minutes and 0.47 minutes , respectively . the acquisition and processing were performed with masshunter workstation software quantitative analysis ( version b.05.00 ; agilent technologies , wilmington , de , usa ) . pharmacokinetic parameters for vst were calculated with winnonlin ( version 3.1 ; pharsight , mountain view , ca , usa ) : total area under the plasma vst concentration time curve from time zero to infinity ( auc ) , peak plasma concentration ( cmax ) , and time to reach cmax ( tmax ) . histological assays were performed to assess the toxicity of the tested formulations to the intestinal epithelium . pure vst and vst - loaded formulations ( f1 and f2 ) were orally administered to sprague dawley rats ( 4 mg / kg ) , and the rats were sacrificed at 24 hours postadministration . the jejunum was obtained by dissecting the peritoneal membrane , and it was fixed in 4% ( v / v ) formaldehyde solution for 1 day . fixed tissues were rinsed with ddw , dehydrated with alcohol , and embedded in paraffin . tissues were cut into 510 m thick sections and stained with hematoxylin and eosin ( h&e ) reagent . all experiments in drug dissolution and animal studies were repeated at least three times , and the data were expressed as the mean standard deviation . statistical analysis ( ie , analysis of variance ) was performed using ibm spss statistics software ( version 21.0 ; ibm corp , armonk , ny , usa ) . phosphoric acid and hydrochloric acid were purchased from sigma - aldrich co ( st louis , mo , usa ) . acetonitrile and other organic solvents were acquired from fisher scientific ( hanover park , il , usa ) . double deionized water ( ddw ) was prepared using super - q plus water purification systems ( merck millipore , merck kgaa , darmstadt , germany ) . drug and polymers ( about 250 g of the total amount ) were blended for 3 minutes prior to extrusion according to the ratios presented in table 1 . these mixtures were fed into a twin - screw hot - melt extruder ( sts-25hs , hankook em ltd , pyoung - taek , korea ) equipped with a round - shaped die ( 1 mm in diameter ) . the extrusion rate was 2830 g / min and the extrusion pressure was about 100 bars . a sieve with 0.21 mm wire width ( 70 mesh ) was used to prepare the powders . the dispersion of drug molecules in the polymer matrix and the transition between crystalline and amorphous forms were investigated by solid - state studies . ft - ir spectra of vst , sp , and tpgs , as well as the sd formulations f1 and f2 , were obtained by a jasco ft / ir-4200 type a ( jasco co , tokyo , japan ) instrument with the kbr method . x - ray diffraction ( xrd ) analysis was performed with a d5005 model diffractometer ( bruker , germany ) at room temperature . monochromatic cu - k radiation ( =1.5406 ) was used in the 2 angle range from 6 to 40 , with an angular increment of 0.02/s and a scan speed of 1/min at 40 ma and 40 kv . differential scanning calorimetry ( dsc ) thermograms of vst , sp , tpgs , f1 , and f2 were obtained with a dsc - q100 instrument ( ta instruments , new castle , de , usa ) . dsc analysis of the sd formulations f1 and f2 after 6 months of storage at room temperature was also performed . thermograms were scanned with aluminum from 30c to 190c at a speed of 10c / min under a nitrogen atmosphere ( 50 ml / min ) . in vitro drug release was measured with a dissolution tester ( tdt-08l ; electrolab , maharashtra , india ) . the vst powder and formulations ( f1 and f2 ) , each containing 20 mg vst , were encapsulated in gelatin capsules and immersed in 900 ml of dissolution media ( ph 1.2 : containing hydrochloric acid and 0.3% tween 80 ; ph 4.0 : acetate buffer containing 0.3% tween 80 ; ph 6.8 : containing phosphoric acid ) at 37c and stirred at 100 rpm . aliquots ( 7 ml ) of the dissolution media were collected at predetermined times ( 15 minutes , 30 minutes , 45 minutes , 60 minutes , 90 minutes , and 120 minutes ) and an equivalent volume of fresh medium was added at each sampling time to compensate . the released vst was quantitatively analyzed with a high - performance liquid chromatography ( hplc ) system ( waters co , milford , ma , usa ) equipped with a reversed - phase c18 column ( universil c18 , 1504.6 mm , 5 m ; fortis technologies ltd , cheshire , uk ) , a pump ( waters 1525 ) , an automatic injector ( waters 717 plus ) , and an ultraviolet / visible detector ( waters 2487 ) . the mobile phase was composed of acetonitrile and ddw ( 60:40 , v / v ) with ph adjusted to 3.0 with phosphoric acid . the detection wavelength and flow rate were 247 nm and 1.0 ml / min , respectively . the injection volume was 20 l , and the retention time of vst was 3.3 minutes . the correlation coefficient ( r ) of the linear regression line was 0.999 in this method . the accuracy and precision values of the inter- and intra - day samples were 92.9%109.4% and 0.1%5.5% , respectively . in vivo pharmacokinetic studies were performed in male sprague dawley rats ( 2505 g body weight ; orient bio , sungnam , korea ) . the rats were reared in a light - controlled room at a temperature of 22c2c and 55%5% relative humidity . the experimental protocols of the animal studies were approved by the animal care and use committee of the college of pharmacy ( seoul national university , seoul , republic of korea ; no snu-130722 - 1 - 1 ) . the left femoral artery was cannulated with a polyethylene tube ( pe-50 ; becton dickinson diagnostics , md , usa ) under zoletil ( virbac , carros , france ) anesthesia ( 50 mg / kg , intramuscular injection ) . vst powder or the sd formulations were encapsulated in gelatin microcapsules ( torpac inc , fairfield , nj , usa ) and administered orally at a dose of 4 mg / kg . blood samples ( 200 l ) were collected from the femoral artery at 5 minutes , 15 minutes , 30 minutes , 45 minutes , 60 minutes , 90 minutes , 120 minutes , 240 minutes , 480 minutes , and 1,440 minutes after vst administration , and an equivalent volume of normal saline ( containing 20 u / ml heparin ) was administered at each sampling time . the aliquots ( 70 l ) of plasma were stored at 70c before the quantitative analysis of drug . vst concentrations in rat plasma were determined by liquid chromatography tandem mass spectrometry ( lc - ms / ms ) . to each 50 l plasma sample , 5 l of losartan ( lst , internal standard ) solution ( 15 g / ml ) and 145 l of acetonitrile were added , and the sample was vortexed for 5 minutes . after centrifugation at 16,000 g for 5 minutes , the supernatant ( 2 l ) was injected into the lc - ms / ms system , equipped with an agilent technologies 1260 infinity hplc system ( agilent technologies , wilmington , de , usa ) and agilent technologies 6430 triple quad lc / ms system . the chromatographic separation was achieved using synergi 4 hydro - rp 80 column ( 752.0 mm ; phenomenex , ca , usa ) . the mobile phase was composed of acetonitrile and 5 mm ammonium formate buffer ( 85:15 , v / v ) and the flow rate was 0.4 ml / min . the gas temperature , gas flow , nebulizer pressure , and capillary voltage were 300c , 11 l / min , 30 psi , and 4,000 v , respectively . the fragmentation transitions were mass - to - charge ratio ( m / z ) 436.2 to m / z 291.2 for vst and m / z 423.4 to m / z 207.3 for lst . the fragmentor voltage and collision energy for vst were 98 v and 14 ev , respectively , and were 115 v and 20 ev , respectively , for lst . the retention times of vst and lst were 0.46 minutes and 0.47 minutes , respectively . the acquisition and processing were performed with masshunter workstation software quantitative analysis ( version b.05.00 ; agilent technologies , wilmington , de , usa ) . pharmacokinetic parameters for vst were calculated with winnonlin ( version 3.1 ; pharsight , mountain view , ca , usa ) : total area under the plasma vst concentration time curve from time zero to infinity ( auc ) , peak plasma concentration ( cmax ) , and time to reach cmax ( tmax ) . histological assays were performed to assess the toxicity of the tested formulations to the intestinal epithelium . pure vst and vst - loaded formulations ( f1 and f2 ) were orally administered to sprague dawley rats ( 4 mg / kg ) , and the rats were sacrificed at 24 hours postadministration . the jejunum was obtained by dissecting the peritoneal membrane , and it was fixed in 4% ( v / v ) formaldehyde solution for 1 day . fixed tissues were rinsed with ddw , dehydrated with alcohol , and embedded in paraffin . tissues were cut into 510 m thick sections and stained with hematoxylin and eosin ( h&e ) reagent . all experiments in drug dissolution and animal studies were repeated at least three times , and the data were expressed as the mean standard deviation . statistical analysis ( ie , analysis of variance ) was performed using ibm spss statistics software ( version 21.0 ; ibm corp , armonk , ny , usa ) . the hme technique was used in the preparation of oral sds of vst ( figure 1a ) . according to the ratios presented in table 1 , the drug was homogeneously dispersed in the polymer using a solvent - free continuous process . in our preliminary study , sd formulations based on 9:1 , 7:3 , and 5:5 weight ratios of polymer to drug were prepared , and drug release profiles were tested . on the basis of the ease of hme processing and the drug dissolution data , a ratio of 7:3 by weight ( polymer to drug ) sp and tpgs were used as the main matrix and plasticizer , respectively , with the aim of enhancing drug solubilization and absorption.10,12 the tm of vst in this investigation was 104.6c , which was similar to previously reported values.17 given the tm and tg values of the drug and the polymers , the temperature of the melting extrusion process was set at 80c100c , as shown in table 2 . in general , the temperature of the heating zone can be set 15c60c above the tm of semicrystalline polymers or the tg of amorphous polymers.18 the established temperature ( 80c100c ) was sufficient to allow for the successful extrusion of polymers . in addition , knowledge of thixotropic behavior , which describes the decrease in viscosity of a polymer with an increase in shear stress , can guide the process of blending and codispersing drugs and polymers . it is known that the addition of plasticizers , such as the tpgs included in the f2 formulation ( table 1 ) , can decrease tg and the melting viscosity of polymers during extrusion processing.19 the use of high - shear twin screws and a die with a 1 mm diameter also contributed to the production of a homogeneous extrudate ( figure 1b and c ) . as shown in figure 1b , multiple kneading disk blocks were introduced to the full flight screw for generating a high shear stress . it is noteworthy that the twin - screw extruder can alter both the crystallinity of a drug and its release characteristics from sd formulations.20 moreover , high shear rates , as determined by the screw configuration , can result in a more efficient melting process and can produce extrudates with low viscosity . as shown in figure 1 , vst ( active pharmaceutical ingredient [ api ] ) , sp , and tpgs were fed into the extruder . the molecularly dispersed api in the polymer matrix was confirmed by solid - state studies ( figures 24 ) . the ft - ir spectra of vst , sp , tpgs , f1 , and f2 are shown in figure 2 . vst has two carbonyl absorption bands at 1,730 cm ( c = o group ) and imine band at 1,603 cm ( c = n band).14 the spectrum of sp exhibits a peak at 2,924 cm ( aliphatic c h stretching ) , as well as at 1,730 cm and 1,629 cm ( c = o stretching).8 the tpgs spectrum has peaks at 2,885 cm ( aliphatic c the alteration of the representative peaks of vst in the spectra of the f1 and f2 formulations suggested intermolecular interactions between the drug and the polymers ( sp and tpgs ) . the xrd patterns of vst , sp , tpgs , f1 , and f2 are presented in figure 3 . the diffractogram of vst exhibited a strong broad peak , as previously reported.17,21 unprocessed sp exhibited an amorphous halo without crystallinity , as previously reported.22 in contrast , the crystallinity of tpgs was shown by its xrd pattern.12 the xrd results of f1 and f2 suggested the generation of interactions between drug and polymer molecules by hme processing . the thermal behaviors of the drug , the polymers , and the formulations were evaluated by dsc ( figure 4 ) . the dsc curve of vst had a sharp endothermic peak at 104.6c , which indicated the crystallinity and melting point of the drug.17 the dsc thermogram of sp exhibited a broad peak around 70c , indicating the transition of the amorphous polymer from a glassy state to a rubbery state with enthalpy relaxation.8 the thermogram of tpgs included an endothermal peak at 39.7c , indicating its crystallinity and tm value , which corresponded with previously reported results.23 the disappearance of the sharp endothermal peak of vst in the thermograms of f1 and f2 revealed that the drug was altered from a crystalline to an amorphous form during the hme process . the results from these solid - state studies indicated the amorphization of the drug and its dispersion in the polymer matrix . over time , an amorphous drug with a higher energy level tends to transform to a crystalline form with a lower free energy.24,25 several factors , including atmospheric moisture and residual crystalline drug ( acting as a seed crystal ) , can accelerate the transformation from an amorphous to a crystalline state during storage.7 one common strategy to inhibit recrystallization of drugs is to prepare sds . in this investigation , dsc thermo - grams of f1 and f2 ( after 6 months at room temperature ) were acquired and are shown in figure s1 . a sharp endothermic peak of vst was not observed in the thermograms , indicating the absence of recrystallization of the drug after 6 months of storage . judging from the absence of recrystallization ( after 6 months ) in the thermograms of the f1 and f2 formulations , the sd developed in this study seemed to be resembling a solid glassy solution . the molecular dispersion of a drug may be immobilized via its interaction ( eg , hydrogen bonding ) with sp . it is assumed that the hme process reported herein may contribute to the maintenance of the kinetic stability of amorphous drugs . in vitro drug release was assessed at ph values of 1.2 ( simulated gastric fluid ) , 4.0 , and 6.8 ( simulated intestinal fluid ) ( figure 5 ) . drug release profiles from the sds ( f1 and f2 ) were compared to the profile of pure vst . as shown in figure 5 , the released amounts of vst from the f1 and f2 preparations were significantly higher than that of the pure drug under all ph conditions . improved drug release from the sds developed in this study seems to be related to the low aqueous solubility of vst . vst has low aqueous solubility at low ph values due to its weak acidity.26 because of the low solubility of vst at ph 1.2 and ph 4.0 , 0.3% ( w / w ) tween 80 was added to the release media ( ph 1.2 and ph 4.0 ) . vst solubility at ph 1.2 and ph 4.0 in media containing 0.3% tween 80 was 0.410.05 and 0.940.01 mg / ml , respectively ; thus , the sink condition seemed to be maintained during the drug release test . solubility of vst at ph 6.8 was 9.600.42 mg / ml in this study ; therefore , solubilizers were not added to these release media to maintain sink condition . due to the ph - dependent solubility of vst , the amount of drug released at ph 6.8 was greater than that released at ph 1.2 and ph 4.0 . notably , in the ph 6.8 medium , drug release from f1 and f2 reached nearly 100% within 15 minutes . thus , fast and complete drug release from the developed sd formulations was observed in comparison to pure vst at ph 6.8 . considering that the primary site of drug absorption is usually the small intestine , the improved drug release from the developed formulations at ph 6.8 , rather than at ph 1.2 , could be beneficial . tpgs , only included in f2 , did not induce a significant difference in the drug release pattern at all ph values in this investigation . drug amorphization may be related to the enhanced release of poorly water - soluble drugs in hme - processed products . furthermore , sp seems to contribute to the release of drugs from sds in aqueous environments . as previously reported,10,27 sp enhances the release rate and the released amount of drug from sd formulations . improved drug release can lead to absorption enhancement in the gastrointestinal tract , in the absence of permeability problem . oral absorption of vst from the developed sds was assessed in rats . in this study , pure vst , f1 , and f2 as shown in table 3 and figure 6 , auc values were ranked from lowest to highest as follows : vst < f1<f2 . the f2 group showed 5.49- and 1.91-fold higher auc values , respectively , than the pure vst and f1 groups ( p<0.05 ) . compared to the vst and the f1 groups , the cmax value of the f2 group was 6.56- and 5.62-fold higher , respectively ( p<0.05 ) . the auc values in this study indicate that sp enhanced drug absorption . due to its solubilizing capacity , sp enhances the absorption of orally administered drugs.11 the enhancement of the oral bioavail - ability of drugs seems to be based on the in vivo interaction of the drug , sp , and the intestinal fluid , which contains bile salts and phospholipids that act as sources of micelles.11 tpgs , included in the f2 preparation , also significantly improved the relative oral bioavailability of the drug in this investigation . although tpgs did not produce different drug release patterns ( figure 5 ) , it contributed to an increase in oral drug absorption . as a plasticizer the ability of tpgs to enhance drug permeation in transmucosal drug delivery has already been reported.2831 the feasibility of vst as a p - glycoprotein ( p - gp ) substrate was reported earlier;32,33 thus , p - gp can act as a barrier for the intestinal absorption of vst . tpgs , as one of p - gp inhibitors , can improve the oral absorption of vst.30,34 conclusively , improvement of drug absorption in this study can be explained by the amorphization of the drug , increased drug dissolution , and enhanced drug penetration across the mucosal membrane in the presence of surfactant ( ie , tpgs ) . the absorbed fraction of the vst dose in humans ranged from 23% ( for capsules ) to 39% ( for solutions ) , and considerable individual variability in auc and cmax values has been reported.26 with the reported oral dosage forms of vst,1416,3539 sd formulation with hme processing could produce higher oral bioavailability of vst with lower variability among subjects , as compared to the bioavailability of the pure drug . histological evaluation of the intestinal epithelium was performed in rats after the administration of pure drug and the formulations f1 and f2 . the toxicity of the treatment drugs to the jejunum epithelium was assessed by h&e staining ( figure 7 ) . the epithelium , mucosal structures , microvilli , and junctions in the control group were normal and showed no symptoms of inflammation . no significant pathological changes were observed in the groups treated with vst , f1 , and f2 , as compared to the control group . these results exhibit that sd formulations processed by hme methods have no significant toxicity to the intestinal epithelium . sp is a grafted copolymer composed of peg 6000 , vinylcaprolactam , and vinyl acetate . according to the manufacturer data ( basf se , ludwigshafen , germany ) , the oral and dermal median lethal dose ( lethal dose , 50% ; ld50 ) values of sp , which are indicators of acute toxicity , given the vst dose ( 4 mg / kg ) and formulation composition in this study , oral administration of the developed formulations was not expected to produce serious toxicity . however , the toxicity of sp against tissues and organs , as well as its hematocompatibility , should be further investigated . tpgs , alpha - tocopherol ( vitamin e ) grafted with a peg oligomer via a succinate diester linker , is known as a generally regarded as safe ( gras ) material . it was reported that a chronic oral tpgs dose of 1525 iu / kg / day did not produce clinical or biochemical signs of gastrointestinal , hepatic , renal , or hematological toxicity.40 moreover , tpgs1000 was approved by the us food and drug administration as a solubilizer for parenteral , oral , nasal , topical , rectal , and vaginal drug delivery.41 we have also reported on the good safety profile of tpgs in the gastrointestinal tract in a previous study.1 taken together , our results show that sp and tpgs - based sd formulations can be used as biocompatible oral drug delivery vehicles . the hme technique was used in the preparation of oral sds of vst ( figure 1a ) . according to the ratios presented in table 1 , the drug was homogeneously dispersed in the polymer using a solvent - free continuous process . in our preliminary study , sd formulations based on 9:1 , 7:3 , and 5:5 weight ratios of polymer to drug were prepared , and drug release profiles were tested . on the basis of the ease of hme processing and the drug dissolution data , a ratio of 7:3 by weight ( polymer to drug ) sp and tpgs were used as the main matrix and plasticizer , respectively , with the aim of enhancing drug solubilization and absorption.10,12 the tm of vst in this investigation was 104.6c , which was similar to previously reported values.17 given the tm and tg values of the drug and the polymers , the temperature of the melting extrusion process was set at 80c100c , as shown in table 2 . in general , the temperature of the heating zone can be set 15c60c above the tm of semicrystalline polymers or the tg of amorphous polymers.18 the established temperature ( 80c100c ) was sufficient to allow for the successful extrusion of polymers . in addition , knowledge of thixotropic behavior , which describes the decrease in viscosity of a polymer with an increase in shear stress , can guide the process of blending and codispersing drugs and polymers . it is known that the addition of plasticizers , such as the tpgs included in the f2 formulation ( table 1 ) , can decrease tg and the melting viscosity of polymers during extrusion processing.19 the use of high - shear twin screws and a die with a 1 mm diameter also contributed to the production of a homogeneous extrudate ( figure 1b and c ) . as shown in figure 1b , multiple kneading disk blocks were introduced to the full flight screw for generating a high shear stress . it is noteworthy that the twin - screw extruder can alter both the crystallinity of a drug and its release characteristics from sd formulations.20 moreover , high shear rates , as determined by the screw configuration , can result in a more efficient melting process and can produce extrudates with low viscosity . as shown in figure 1 , vst ( active pharmaceutical ingredient [ api ] ) , sp , and tpgs were fed into the extruder . the molecularly dispersed api in the polymer matrix was confirmed by solid - state studies ( figures 24 ) . the ft - ir spectra of vst , sp , tpgs , f1 , and f2 are shown in figure 2 . vst has two carbonyl absorption bands at 1,730 cm ( c = o group ) and imine band at 1,603 cm ( c = n band).14 the spectrum of sp exhibits a peak at 2,924 cm ( aliphatic c h stretching ) , as well as at 1,730 cm and 1,629 cm ( c = o stretching).8 the tpgs spectrum has peaks at 2,885 cm ( aliphatic c the alteration of the representative peaks of vst in the spectra of the f1 and f2 formulations suggested intermolecular interactions between the drug and the polymers ( sp and tpgs ) . the xrd patterns of vst , sp , tpgs , f1 , and f2 are presented in figure 3 . the diffractogram of vst exhibited a strong broad peak , as previously reported.17,21 unprocessed sp exhibited an amorphous halo without crystallinity , as previously reported.22 in contrast , the crystallinity of tpgs was shown by its xrd pattern.12 the xrd results of f1 and f2 suggested the generation of interactions between drug and polymer molecules by hme processing . the thermal behaviors of the drug , the polymers , and the formulations were evaluated by dsc ( figure 4 ) . the dsc curve of vst had a sharp endothermic peak at 104.6c , which indicated the crystallinity and melting point of the drug.17 the dsc thermogram of sp exhibited a broad peak around 70c , indicating the transition of the amorphous polymer from a glassy state to a rubbery state with enthalpy relaxation.8 the thermogram of tpgs included an endothermal peak at 39.7c , indicating its crystallinity and tm value , which corresponded with previously reported results.23 the disappearance of the sharp endothermal peak of vst in the thermograms of f1 and f2 revealed that the drug was altered from a crystalline to an amorphous form during the hme process . the results from these solid - state studies indicated the amorphization of the drug and its dispersion in the polymer matrix . over time , an amorphous drug with a higher energy level tends to transform to a crystalline form with a lower free energy.24,25 several factors , including atmospheric moisture and residual crystalline drug ( acting as a seed crystal ) , can accelerate the transformation from an amorphous to a crystalline state during storage.7 one common strategy to inhibit recrystallization of drugs is to prepare sds . in this investigation , dsc thermo - grams of f1 and f2 ( after 6 months at room temperature ) were acquired and are shown in figure s1 . a sharp endothermic peak of vst was not observed in the thermograms , indicating the absence of recrystallization of the drug after 6 months of storage . judging from the absence of recrystallization ( after 6 months ) in the thermograms of the f1 and f2 formulations , the sd developed in this study seemed to be resembling a solid glassy solution . the molecular dispersion of a drug may be immobilized via its interaction ( eg , hydrogen bonding ) with sp . it is assumed that the hme process reported herein may contribute to the maintenance of the kinetic stability of amorphous drugs . in vitro drug release was assessed at ph values of 1.2 ( simulated gastric fluid ) , 4.0 , and 6.8 ( simulated intestinal fluid ) ( figure 5 ) . drug release profiles from the sds ( f1 and f2 ) were compared to the profile of pure vst . as shown in figure 5 , the released amounts of vst from the f1 and f2 preparations were significantly higher than that of the pure drug under all ph conditions . improved drug release from the sds developed in this study seems to be related to the low aqueous solubility of vst . vst has low aqueous solubility at low ph values due to its weak acidity.26 because of the low solubility of vst at ph 1.2 and ph 4.0 , 0.3% ( w / w ) tween 80 was added to the release media ( ph 1.2 and ph 4.0 ) . vst solubility at ph 1.2 and ph 4.0 in media containing 0.3% tween 80 was 0.410.05 and 0.940.01 mg / ml , respectively ; thus , the sink condition seemed to be maintained during the drug release test . solubility of vst at ph 6.8 was 9.600.42 mg / ml in this study ; therefore , solubilizers were not added to these release media to maintain sink condition . due to the ph - dependent solubility of vst , the amount of drug released at ph 6.8 was greater than that released at ph 1.2 and ph 4.0 . notably , in the ph 6.8 medium , drug release from f1 and f2 reached nearly 100% within 15 minutes . thus , fast and complete drug release from the developed sd formulations was observed in comparison to pure vst at ph 6.8 . considering that the primary site of drug absorption is usually the small intestine , the improved drug release from the developed formulations at ph 6.8 , rather than at ph 1.2 , could be beneficial . tpgs , only included in f2 , did not induce a significant difference in the drug release pattern at all ph values in this investigation . drug amorphization may be related to the enhanced release of poorly water - soluble drugs in hme - processed products . furthermore , sp seems to contribute to the release of drugs from sds in aqueous environments . as previously reported,10,27 sp enhances the release rate and the released amount of drug from sd formulations . improved drug release can lead to absorption enhancement in the gastrointestinal tract , in the absence of permeability problem . oral absorption of vst from the developed sds was assessed in rats . in this study , pure vst , f1 , and f2 were administered orally to rats at 4 mg / kg . as shown in table 3 and figure 6 , auc values were ranked from lowest to highest as follows : vst < f1<f2 . the f2 group showed 5.49- and 1.91-fold higher auc values , respectively , than the pure vst and f1 groups ( p<0.05 ) . compared to the vst and the f1 groups , the cmax value of the f2 group was 6.56- and 5.62-fold higher , respectively ( p<0.05 ) . the auc values in this study indicate that sp enhanced drug absorption . due to its solubilizing capacity , sp enhances the absorption of orally administered drugs.11 the enhancement of the oral bioavail - ability of drugs seems to be based on the in vivo interaction of the drug , sp , and the intestinal fluid , which contains bile salts and phospholipids that act as sources of micelles.11 tpgs , included in the f2 preparation , also significantly improved the relative oral bioavailability of the drug in this investigation . although tpgs did not produce different drug release patterns ( figure 5 ) , it contributed to an increase in oral drug absorption . as a plasticizer the ability of tpgs to enhance drug permeation in transmucosal drug delivery has already been reported.2831 the feasibility of vst as a p - glycoprotein ( p - gp ) substrate was reported earlier;32,33 thus , p - gp can act as a barrier for the intestinal absorption of vst . tpgs , as one of p - gp inhibitors , can improve the oral absorption of vst.30,34 conclusively , improvement of drug absorption in this study can be explained by the amorphization of the drug , increased drug dissolution , and enhanced drug penetration across the mucosal membrane in the presence of surfactant ( ie , tpgs ) . the absorbed fraction of the vst dose in humans ranged from 23% ( for capsules ) to 39% ( for solutions ) , and considerable individual variability in auc and cmax values has been reported.26 with the reported oral dosage forms of vst,1416,3539 sd formulation with hme processing could produce higher oral bioavailability of vst with lower variability among subjects , as compared to the bioavailability of the pure drug . histological evaluation of the intestinal epithelium was performed in rats after the administration of pure drug and the formulations f1 and f2 . the toxicity of the treatment drugs to the jejunum epithelium was assessed by h&e staining ( figure 7 ) . the epithelium , mucosal structures , microvilli , and junctions in the control group were normal and showed no symptoms of inflammation . no significant pathological changes were observed in the groups treated with vst , f1 , and f2 , as compared to the control group . these results exhibit that sd formulations processed by hme methods have no significant toxicity to the intestinal epithelium . sp is a grafted copolymer composed of peg 6000 , vinylcaprolactam , and vinyl acetate . according to the manufacturer data ( basf se , ludwigshafen , germany ) , the oral and dermal median lethal dose ( lethal dose , 50% ; ld50 ) values of sp , which are indicators of acute toxicity , were both > 5 g / kg . given the vst dose ( 4 mg / kg ) and formulation composition in this study , oral administration of the developed formulations was not expected to produce serious toxicity . however , the toxicity of sp against tissues and organs , as well as its hematocompatibility , should be further investigated . tpgs , alpha - tocopherol ( vitamin e ) grafted with a peg oligomer via a succinate diester linker , is known as a generally regarded as safe ( gras ) material . it was reported that a chronic oral tpgs dose of 1525 iu / kg / day did not produce clinical or biochemical signs of gastrointestinal , hepatic , renal , or hematological toxicity.40 moreover , tpgs1000 was approved by the us food and drug administration as a solubilizer for parenteral , oral , nasal , topical , rectal , and vaginal drug delivery.41 we have also reported on the good safety profile of tpgs in the gastrointestinal tract in a previous study.1 taken together , our results show that sp and tpgs - based sd formulations can be used as biocompatible oral drug delivery vehicles . vst - loaded oral sds based on sp and tpgs were prepared using the hme process . an hme system with twin screws for inducing a high shear rate was adopted for providing drug amorphization and its molecular dispersion in the polymer matrix . drug amorphization and related thermodynamic properties of the prepared formulations were investigated by ft - ir , xrd , and dsc . drug release from the formulations was improved as compared to the level of pure drug , and enhanced drug release was observed at ph 6.8 ( simulated intestinal fluid ) in comparison to that at ph 1.2 ( simulated gastric fluid ) and ph 4.0 . the oral bioavailability of vst from the developed formulations was improved in rats as compared to that of the pure drug . h&e staining of the intestinal epithelium after oral administration of the prepared sds indicated their biocompatibility . sp and tpgs - based sds , manufactured by the hme process with a high shear , can be used to improve the oral bioavailability of drugs . abbreviations : dsc , differential scanning calorimetry ; f1 and f2 , solid dispersion formulations used in this study .

pollution of natural waters with waste water arising from various industries has become a serious problem globally . textile industries are large industrial consumers of waters as well as producers of wastewaters with the increased demand for textile products leading to increase in the generation of textile wastewater , which makes the textile industry one of the main sources of severe pollution problems worldwide [ 13 ] . effluents from the textile factory commonly contain high concentrations of organic and inorganic chemicals and are characterized by high chemical oxygen demand ( cod ) , biological oxygen demand ( bod ) , total dissolved solids ( tds ) , ph , total suspended solids ( tss ) values , and low dissolved oxygen ( do ) value as well as strong color . the major concern with color is its aesthetic character at the point of discharge with respect to the visibility of the receiving waters [ 46 ] . the textile factory in ethiopia dates back to 1939 in relation with italian colonialism era , when the first industrial textile factory was established in dire - dawa in the name of dire - dawa textile mill . since 2010 , the ethiopian government has put effort to improve , support , and expand the textile industry , serving the domestic market but mainly with the aim to export and be competitive at the global market . ethiopia has potential of building a textile factory with governmental support , offering low - cost production and raw material and with a growing young population eager for jobs . the factory is one of the largest employers in ethiopia , with 35,000 direct employees ( cotton farming ( 10% ) and textile / garment manufacturing ( 90% ) ) , excluding the 500,000 engaged in the informal hand - loom weaving sector . bahir dar textile factory is one of ethiopia textile factories , manufacturing 100% cotton products , including yarns and fabrics . it was established in 1961 from the fund of italian war reparation in the town of bahir dar , 570 km northwest of addis ababa , ethiopia . the factory has production capacity of 17 tons per day of yarns and 5,000 meters ' wool fabrics . the major factories in bahir dar town including bahir dar textile factory , bahir dar tanneries , and bahir dar abattoir are built at the edge of head of blue nile river , where most of them dispose their solid and liquid wastes directly into this river . despite the extensive work that has been conducted on bahir dar tanneries effluents with regard to physicochemical parameter and aquatic macroinvertebrates , little information is documented about the effect of bahir dar textile factory effluents on head of blue nile river . therefore , the objective of this study was to investigate the effect of bahir dar textile factory effluents on the head of blue nile river using aquatic macroinvertebrate as bioindicators through addressing the following research questions : ( 1 ) what is the pollution level of textile factory effluents ? ( 2 ) do the observed water quality parameters in the study area exceed the maximum permissible limits of national and international standards ? ( 3 ) to what extent are the water quality parameters higher than the standard ? ( 4 ) to what extent is the headwater of the blue nile river affected by the effluents from the factory ? bahir dar , the capital of amhara national regional state , is situated on the southern shore of lake tana , the source of blue nile river , approximately 565 kms northwest of addis ababa at an altitude of 1801 m.a.s.l , having latitude of 11038n and longitude of 37010e . the study area experiences average annual rainfall that ranges from 1200 to 1600 mm and it has mean annual temperature of 26c . it is a rapidly expanding town with commercial centers , small industries , and residences in all sectors of the town . the textile factory located at the edge of head of blue nile river discharges its effluents directly into head of blue nile river . however , the water from this river is used for different purposes like drinking , livestock watering , hygiene , and irrigation by the downstream communities . the most upstream site from the head of blue nile river ( u ) , the wastewater outlet of the factory ( t1 ) , neutralization pond ( t2 ) , where effluent is discharged and joins the head of blue nile river ( a ) , and 200 m downstream site of waste joining the river ( d ) were chosen ( figure 1 ) . samples for both water quality parameters and aquatic macroinvertebrates were collected in august and december , 2013 , and april of 2014 . samples for aquatic macroinvertebrates were not recorded from sampling sites t1 and t2 because these sites were concrete made ponds . samples of water quality parameters , water temperature , dissolved oxygen ( do ) , ph , total dissolved solids ( tds ) , and conductivity from all sites , were measured in situ using ysi 556 mps multiprobe field meter . water sample for bod5 , total alkalinity , and total hardiness were collected and stored in clean polythene bottles that had been prewashed with 10% nitric acid and thoroughly rinsed with deionized water using standard methods stated in . water samples for bod5 were analyzed according to the standard methods of at the laboratory of the institute of technology of bahir dar university , while samples for total hardiness and total alkalinity were analyzed at amhara design and supervision work enterprise laboratory using paqualab photometer instrument with their respective palintest tablets . samples of aquatic macroinvertebrates were taken using d - frame dip net with mesh size of 500 m from u , a , and d sampling sites . in the field , all the organisms in the sample were enumerated and identified to the family level using a dissecting microscope and standard keys [ 1922 ] . descriptive statistics were used to analyze the mean value and standard error of the water quality data . four indices of the aquatic macroinvertebrate communities were calculated for each sampling site . the shannon - wiener diversity index ( h ) h was calculated as follows : ( 1)h=pilnpi , where p i is the relative abundance ( n i / n ) of family i , n i is the number of individuals in family i , and n is the total number of individuals in all families . h is ranging from 0 for a community with a single family to over 7 for a very diverse community . the hilsenhoff family - level biotic index ( hfbi ) is a biotic index that is calculated by multiplying the number of individuals of each family by an assigned tolerance value for that family . assigned tolerance values range from 0 to 10 for families and increase as water quality decreases [ 23 , 24 ] . this index was calculated as follows:(2)hfbi=tvinin , where tvi is tolerance value for family i , n i is the number of individuals in family i , and n is the total number of individuals in the sample collection . high hfbi community values are an indication of organic pollution , while low values indicate good water quality . research has indicated that the percentage of dipterans tends to increase with a decrease in water quality ; they become increasingly dominant in terms of percent taxonomic composition and relative abundance along a gradient of increasing enrichment for heavy metals concentration [ 25 , 26 ] . this index was calculated as follows:(3)% dipterans=100 # individual dipteranstotal individuals in sample . family richness reflects the health of the community as a measurement of the variety of families present . this index was calculated as follows : ( 4)fr= # the number of different family of animals in the sample . excel spreadsheets and statistical package for social sciences software ( spss version 20 ) were used for the statistical analysis . one - way anova was used to evaluate differences in water quality data and aquatic macroinvertebrate metrics among the sampling sites . the mean values of dissolved oxygen ranged from 3.7 mg / l at sampling site t1 to 7.8 mg / l at u and showed significant variation among sampling sites ( f = 15.259 , p = 0.000 ) . the value at site u was significantly higher than that at the other sites ( table 1 ) . many studies also showed that dissolved oxygen level of textile effluents is low and varied from 0.42 to 4.60 mg / l with average value of 2.36 mg / l , 4.8 mg / l8 mg / l , about 0.4 mg / l , and 0.28 mg / l5.12 the mean values of dissolved oxygen at sampling sites from head of blue nile river ( u and d ) were not acceptable for drinking purpose . the mean values of bod5 which varied from 5.3 mg / l at sampling site u to 40.3 mg / l at site t1 showed significant variation among sampling sites ( f = 95.767 , p = 0.000 ) . the value at sampling site t1 was higher than that at the other sites ( table 1 ) . the high value of bod5 at t1 could be due to higher content of organic load and the high levels of bod5 are the indicators of the pollution strength of the waters [ 13 , 14 ] . the mean value of bod5 of the study at sampling sites from head of blue nile river ( u and d ) was found to be above the permissible limit set for drinking water . the mean value of effluent joining the head of blue nile river ( a ) was within the range of acceptable levels of for textile effluents to be discharged into inland surface water bodies but was above standard limits of . the mean values did not differ significantly among sampling sites ( f = 2.367 , p = 0.123 ) . the temperature mean values ranged from 20.4c at a to 25.2c at t1 and values did not vary among sampling sites ( f = 0.718 , p = 0.599 ) ( table 1 ) . the mean values of temperature and ph of the study were within as well as guideline values . similar to present study , [ 33 , 34 ] reported the mean ph value of textile effluents in the range of 69 . the temperature of textile effluents was also reported in the range of 2734c [ 12 , 35 ] . the mean values of tds varied from 101.7 ppm at sampling site u to 612.3 ppm at t1 and showed significant variation ( f = 60.039 , p = 0.000 ) , with the value at t1 being significantly higher than that at other sampling sites ( table 1 ) . studies of these authors [ 27 , 36 ] reported tds values of textile effluents as 860 mg / l and 1260 mg / l , respectively , which are much higher than the tds values recorded in the present study . the mean values of tds at sampling sites u and d were within standards of since water with a tds < 1200 mg the mean value for conductivity varied from 141 s / cm at sampling site u to 1050 s / cm at sampling site t1 . there was significant variation among sampling sites ( f = 110.142 , p = 0.000 ) , with the value at t1 being significantly higher than that at other sampling sites ( table 1 ) . the conductivity for textile effluent was recorded in the range of 38041704 s / cm . the mean value of conductivity at sampling sites ( u and d ) was within the range of the standard limit of which is in the range of 400800 s / cm for drinking purposes . the mean values of total hardiness varied from 84 ml / g at sampling site u to 117 total hardiness did not show significance among sampling sites ( f = 0.733 , p = 0.590 ) ( table 1 ) . based on the classification khopkar , hardness of natural water was classified into five categories on the basis of total ion content : soft ( 040 mg / l ) , moderately hard ( 40100 mg / l ) , hard ( 100300 mg , the head of blue nile river water can be put in the category of moderately hard at upstream site ( u ) and hard at the most downstream site ( d ) . as compared to present study , some studies [ 40 , 41 ] reported higher mean values for textile effluents ( in the range of 4701010 mg / l caco3 ) and one study reported slightly lower mean values ( in the range of 6388 mg / l caco3 ) for textile effluents . total alkalinity mean values ranged from 91 mg / l at u to 247 mg the mean values differ significantly among sampling sites ( f = 16.8 , p = 0.00 ) ( table 1 ) . the mean values at sampling sites u and d are found to be above the permissible limit set for drinking water < 75 mg / l and this could be due to the use of soaps by local people for bathing and washing clothes which was apparent activities at these sampling sites . studies of [ 27 , 35 ] reported similar findings about the high alkalinity mean value of textile effluents . a total of 836 individuals composed of 21 families were collected from the three sites ( u , a , and d ) . the total number of families present at each site ranged from 9 ( d ) to 11 ( a ) . the most dominant families were veliidae ( 103 ) , belostomatidae ( 102 ) , planorbidae ( 96 ) , gerridae ( 79 ) , and corixidae ( 64 ) . the families least encountered were tetragnathidae ( 4 ) , lestidae ( 4 ) , and aeshnidae ( 5 ) . furthermore , it is found out that more than 82.3% of the individuals collected belong to insect orders while less than 17.7% belong to the noninsect order like acarina and snail orders . among the insect orders , hemiptera and coleopteran were the most dominant with 47.4% and 8% , respectively ( figure 2 , table 2 ) . stated as in , sites that are with greater than 26 families are considered as nonimpacted , 1926 as slightly impacted , 1118 as moderately impacted , and 0 - 1 as severely impacted . based on this finding , sampling sites u and d fall under moderately impacted while sampling site a fall under severely impacted site . the mean value of shannon - wiener diversity index ( h ) ranged from 2 at sampling site u to 1.8 at a indicating this site has less diversity than upstream and the most downstream sites ( table 3 ) . the h value did not show significant variation among sampling sites ( f = 1.00 , p = 0.422 ) . h is ranging from 0 for a community with a single family to over 7 for a very diverse community . h value of less than 1 indicates highly polluted , 13 moderately polluted , and greater than 4 unpolluted water bodies . in present study , the mean values for hilsenhoff family - level biotic index ( hfbi ) ranged from 6 at sampling site u to 7.9 at d. mean values showed significant variation among sampling sites ( f = 7.678 , p = 0.022 ) , with value being higher at the most downstream site ( table 3 ) . this index was developed to detect organic pollution . in this study , all sites showed higher hfbi values , suggesting fair water quality conditions at sampling site u and poor at a and d. the mean values for percent dipterans ranged from 0% at sampling site d to 10.7% at a and values showed significant variation among sampling sites ( f = 9.494 , p = 0.014 ) , with mean value being high at site a ( table 3 ) . since most dipterans larvae contain hemoglobin , they are able to survive low oxygen conditions and their higher abundance is indication of poor water quality . we conclude that the textile factory poses serious pollution load to the aquatic habitat of the head of blue nile river which in turn makes the water highly polluted . the values of most metrics follow pollution gradient and showed deteriorated water quality conditions of the head of blue nile river . therefore , hence , there are many immediate downstream users of the water river for drinking , fishing , bathing , and irrigation ; the effluent demands frequent control and proper treatment before being discharged to the environment .

zinc is an essential element for all cells , as it is used as a cofactor for many enzymes and transcription factors that mediate key cellular processes , such as protection against oxidative stress , deoxyribonucleic acid ( dna ) repair , dna replication , proliferation , differentiation and apoptosis . the total zinc content per cell differs according to cell type , and mammalian pancreatic cells have one of the highest zinc concentrations of the whole organism , with estimated values between 10 and 20 mmol / l cell space in insulincontaining vesicles . as the mammalian body has no or only limited zinc stores , it depends on daily zinc intake . inadequate zinc intake is an important health problem , as the prevalence is approximately 20.5% of the world s population . as a dramatic result , zinc deficiency is one of the most important dietrelated factors in human disease , and estimated to be responsible for 0.4 million child deaths per year . furthermore , zincuria is one of the symptoms of diabetes , and zinc supplementation ameliorates glycemia in both type 1 and type 2 diabetes . these observations show that understanding zinc homeostasis in health and disease is of importance . in the present review , we give an overview of the zinc transporters in the pancreatic cell with a focus on the recently discovered transporter , zinc transporter 8 ( znt8 ) , which has been associated with the development of both type 1 and type 2 diabetes . our understanding of cellular zinc homeostasis has increased significantly with the discovery of a large group of zinc transporter proteins that allow diffusion of zinc ions across biological membranes . these transporters are classified into two protein families ( zinc transporter [ znt ] and zrt / irtlike protein [ zip ] ) , encoded respectively by slc30a and slc39a genes that have multiplied during eukaryotic evolution by gene duplication events . the mammalian znt protein family comprises 10 members and they transport zinc out of the cytosol , both into the extracellular space and into the compartments of cellular organelles . this opposes the direction of zinc flux mediated by members of the zip family ( 14 isoforms known in mammals ) , which transport zinc back into the cytosol . because most tissues and organs express several znt and zip isoforms , the precise mechanism of zinc homeostasis in any cell type is a result of coordinated expression and activities of these zinc transporter isoforms . this interplay between transporters is further complemented with the distribution of zinc in the cell by metallothioneins ( mt ) , of which four isoforms have been identified to date . an overview of the messenger ribonucleic acid ( mrna ) expression profile of the different zinc transporters and mt in a panel of mouse tissues and organs is shown in figure 1 . pancreatic islets of langerhans do not form an exception in the sense that various mt , znt and zip isoforms are expressed together ( figure 1 ) . first , as can be seen in figure 1 , this is the only transporter with an outspoken tissuespecific expression , being detectable in pancreatic islets only and giving background signals in the other 21 examined mouse tissues . second , the expression level is highest of all isoforms and comparable with the expression of actin . pioneering studies by chimienti et al . showed that znt8 is primarily expressed in secretory granules of islet and cell , whereas its presence in the and pancreatic polypeptide ( pp)cells is still under debate . the 3d structure of znt8 dimers is based on the escherichia coli zinc transporter , yiip transporter , and consists of parallel oriented monomers held together through four zinc ions at the interface of the cytoplasmic domains , with two transmembrane domains swinging out to yield a yshaped structure . based on in silico mutagenesis , this specific conformation is similar in the different znt8 alleles , as described later . besides znt8 , znt5 and znt7 are also reported to be expressed in the cell , but these transporters are expressed in other tissues as well ( figure 1 ) . znt5 colocalizes with the golgi apparatus and secretory vesicles , whereas znt7 resides mostly in the perinuclear region . in chicken dt40 cells , znt5 forms functional heterodimers with znt6 , which might be a rationale for our observation that znt6 is also expressed in islets ( figure 1 ) . the role of znt3 in cells received some attention in the literature , because this isoform has been proposed to be responsible for the uptake of zinc in synaptic vesicles of glutaminergic hippocampal neurons , and given the fact that cells have a neuronlike phenotype . the literature , however , is somewhat ambiguous for znt3 expression in cells ; it was reported to be expressed in the insulinoma cell line ins1 , but could not be confirmed in mouse islets . although no detailed studies have been carried out to investigate the role of individual zip transporters in islet cells , it is clear that these follow a wide tissue distribution ( figure 1 ) . zinc transporter 8 ( znt8 ) is specifically and abundantly expressed in islets of langerhans . messenger ribonucleic acid expression of the different zinc transporters ( znt and zip ) and metallothioneins ( mt ) in 22 different c57bl6 mouse tissues , measured by microarray using affymetrix 430_2 arrays . data are expressed as percent expression in a specific tissue , with the sum of the expression values of a specific transporter in all tissues set as 100% . the microarray data have been submitted to the national center for biotechnology information gene expression omnibus ( http://www.ncbi.nlm.nih.gov/geo/ ) under accession nos . es cells , embryonic stem cells ; zip , slc39a zinc transporter family ; znt , slc30a zinc transporter family . it can be assumed that most of the panel of znt and zip transporters with wide tissue distribution serve a housekeeping role in cellular zinc homeostasis , ensuring an equilibrium of zinc over the different subcellular compartments where the metal is required as a protein cofactor . an important question , however , is why znt8 is intensely and specifically expressed in islets . one possibility is that the turnover of znt8 mrna and protein is very high , but this idea is not yet supported by experimental data . another possibility is that high and specific expression of znt8 protects the cell from toxic effects of excess or shortage of zinc . as stated in the introduction , there is so much zinc in cells , that this property can be used to sort cells from islet preparations . as for most essential metals , a bell shape concentration dependency exists for cell viability , so that cells need to be protected against excess and depletion of zinc . the role of znt8 in cell apoptosis during zinc depletion was studied in ins1e cells . overexpression of znt8 protected the cells against apoptosis after treatment with the zinc chelator n , n , nntetrakis()(2pyridylmethyl)ethylenediamine ( tpen ) ; in contrast , no effect on viability was reported during hyperzinc conditions . a third possibility , which will be discussed in the next section , is that the high expression of znt8 in cells is required for the process of regulated insulin synthesis , storage and secretion . zinc availability in dietary intake regulates the expression of many zinc transporters , in particular isoforms of the zip family , and this regulation supports cellular zinc homeostasis . phenotypic effects of zip knockouts can often be compensated by an increased dietary zinc or zinc supplementation , including mutations in the zinc transporter slc39a4 , mutations of which have been identified in acrodermatitis enteropatica , an autosomal recessive metabolic disorder affecting the uptake of zinc in the intestine . recently , zinc transporters have been shown to be regulated by microrna . indeed , slc39a5 ( zip5 ) translation is mediated by conserved elements in the 3untranslated region ; in primary prostatic epithelial cells , the mir18396182 cluster is overexpressed and regulates zinc homeostasis by suppressing mrna levels of six zinc transporters ( hzip1 , hzip3 , hzip7 , hzip9 , hznt1 , hznt7 ) . in cells , it has been shown that glucose and cytokines play a role in the regulation of the expression of the zinc transporters . high glucose has no effect on the expression of znt8 , but in contrast zip6 , zip7 and zip8 are upregulated in mouse islets cultured for 24 h on 16.7 mmol / l glucose . under the same conditions , mt1 and mt2 are downregulated , and this decrease depends on elevations in cyclic adenosine monophosphate ( camp ) . cytokines ( interleukin1 [ il1 ] , tumor necrosis factor [ tnf ] ) decrease the expression of zinc transporters , particularly znt8 . expression of znt8 is also under the control of the transcription factor , pancreatic and duodenal homeobox 1 ( pdx1 ) , which regulates expression through two intronic enhancers , a and b. enhancer a is a cell specific enhancer , whereas enhancer b promotes expression both in and cells . cells have the important physiological role of synthesizing , storing and secreting exactly the right amounts of insulin in order to meet the daily metabolic demands of the organism . several studies have shown that zinc is essential for the different processes involved in the insulin secretory pathway . in the endoplasmic reticulum ( er ) , proinsulin folds with the help of chaperones into its 3d structure with the formation of correct disulphide bonds ; this folding is a prerequisite for the formation of proinsulin hexamers , which occurs in the golgi apparatus . two proinsulin dimers interact through their hisb10 residues with two zinc ions to form a proinsulin tetramer , which then combines with another dimeric unit to give the zinc2 proinsulin6 hexamer . after passing the golgi apparatus , prohormone convertases ( pc ) , pc1/3 and pc2 , as well as carboxypeptidase e , convert zincproinsulin hexamers in immature secretory vesicles into zincinsulin hexamers . this conversion , together with granular acidification , cause a profound change of the surface structure of the protein hexamers ; in the presence of physiological zinc concentration , proinsulin hexamers are water soluble , whereas insulin hexamers are water insoluble . the consequence of these events is that zincinsulin crystals are formed , so that the immature secretory granules transform into mature granules with a typical ultrastructural appearance of an electrondense core surrounded by a halo ( figure 2a ) . ( a ) absence of typical insulindense core granules in znt8 ( znt8 ) deficient mice , seen by transmission electron microscopy . absence of dithizonestained islets in znt8 mice ( b ) in situ , as well as ( c ) in vitro . ( d ) bright light reflection of isolated wildtype ( znt8 ) islets compared with the more transparent appearance of znt8 islets , which lack zinc : insulin crystals . ( e ) a somewhat analogous situation occurs when comparing white light reflection of small sugar crystals vs transparent sugar solution . figures are reproduced or adapted from lemaire et al . with permission . because zinc is required for hexamerization and conversion of proinsulin to insulin , sufficient uptake of zinc ions in the er and golgi compartments is required . as explained in the previous section , possible candidates for this transport are znt5 and znt7 , both shown to be present in the islets and expressed at the appropriate location of insulin biosynthesis and folding . in contrast , znt8 seems to not be required for conversion of proinsulin to insulin , as studies with wholebody znt8deficient ( znt8 ) mice showed no defect in insulin processing . a conflicting result , however , was reported in a model of cell specific znt8 knockout mouse , in which proinsulin conversion , measured through a proinsulinspecific immunoassay , is delayed . the reason for this discrepancy is not entirely clear , but it should be mentioned that in contrast to the whole animal knockout models , expression of critical proteins for proinsulin conversion ( pc2 , carboxypeptidase e ) was also decreased in these specific knockout islets . in contrast , one study reported that patients carrying the atrisk ( r325 ) allele of znt8 have impaired conversion of proinsulin into insulin . more than 80 years ago , it was suggested that zinc plays a role in the crystallization of insulin . as aforementioned , xray diffraction analysis has shown that per insulin hexamer , two zinc ions are bound to the six hisb10 residues of the hexamer . comeasurements of insulin and zinc release from glucose stimulated islets , however , suggest that more zinc ions are present in zincinsulin crystals than the 2:6 ratio in the hexamers . indeed , zinc release from glucosestimulated islets was measured through a gadoliniumbased zinc sensor , and was 1.73 0.74 pmol / islet equivalent , whereas insulin release from the same islets was 2.65 1.13 pmol / islet equivalent , resulting in a 4:6 zinc : insulin ratio instead of a 2:6 ratio . this shows that twofold more zinc is present in the dense core granules containing insulin crystals , compared with the hexamers , and it is conceivable that this extra zinc , which is required to displace water molecules between insulinzinc hexamers , is delivered through znt8 . this idea is also supported by our observations that cells in znt8 islets are incompetent to form normal amounts of insulinzinc crystals . the most direct evidence in this work was obtained by electron microscopy , showing an almost complete replacement of dense core granules by immature granules in which a dense core is lacking ( figure 2a ) . as in these mice insulin content per islet and proinsulin conversion were found to be normal , it can be assumed that the immature granules are filled with watersoluble insulin . another piece of evidence is lack of detectable release of zinc on exocytosis of insulin granules , whereas insulin release occurs normally . this dissociation again shows that more zinc ions are bound to insulin in the crystal in addition to the two ions bound per hexamer . because of the normal insulin processing , which normally occurs in the presence of zinc in proinsulin hexamers , and the normal expression of the other znt transporters , we presume that znt8 islets store insulin as zinc : insulin hexamers . however , if this is the case , it is not clear why the znt8 islets lack detectable zinc release completely , as the crystal would only have twofold more zinc , based on the aforementioned calculations . is this because zinc : insulin hexamers are not readily dissolved on release like insulin crystals and therefore not detected with the applied technique , or is zinc reabsorbed from the mature secretory granules before exocytosis ? hence , the cell of znt8 mice has a biophysical phenotype in which the physical form of stored insulin is changed from crystalline to water soluble . this is also reflected in striking changes in familiar aspects of islets of langerhans , namely the typical staining with the dye dithizone ( figure 2b , c ) and the bright scattering of light ( figure 2d , e ) . osmosis is another consequence of the change in storage form , because soluble insulin acts as an osmolite . it can be predicted that for the same amount of stored molecules , watersoluble insulin would require more space . measurements of granule diameter in wildtype and znt8 mice have shown that insulinzinc crystals require approximately 30% less space than watersoluble insulin . besides a more compact packaging of insulin in the secretory granules , zincinsulin crystallization is also believed to protect insulin against proteolytic degradation . however , several data argue against this idea : ( i ) the presence of an intact 5808 da insulin peptide as one sharp mass peak in the spectrum of islets of both wildtype and znt8 mice , measured by in situ peptidomics ; and ( ii ) the noncrystallized guinea pig and coypu insulin would be more vulnerable to degradation , compared with human crystallized insulin . nature has allowed variations on the theme that was discussed in the last section . in several vertebrates , such as hagfish , guinea pig and coypu , variation in the insulin gene sequence causes a structural change in the insulin bchain , so that hisb10 is lacking . in these species , proinsulin does not associate with dimers and hexamers , and consequently no zincinsulin crystals are formed . consistent with the predicted consequence , the secretory granules of guinea pig cells do not contain detectable zinc . a second variation of nature is a mutant human insulin gene in which the codon encoding hisb10 is replaced by an aspartic acid codon ( hisb10asp ) . with this mutation , the cells besides pale , immature secretory vesicles , vesicles containing a rodshaped dense core are also present . overexpression of the mutant insulin gene in mice results in normoglycemic mice . in znt8 mice in which insulin crystal formation is impaired , the consequences of glucose homeostasis vary between studied strains . in our own study , where cells contained mainly pale vesicles , we observed normal fasting blood glucose levels , glucose tolerance and glucosestimulated insulin release under normal diet conditions . however , in other strains of znt8 mice studied in parallel in london and toronto , a mix of rodshaped , pale and dense core secretory vesicles were present , and relatively small abnormalities in glucose tolerance were reported . the biological difference between normal densecore , rodshaped and pale vesicles is interesting , but incompletely understood . it is conceivable that the spherical geometric positioning of znt8 molecules in the granule membrane around the granule core influences the free zinc concentrations in the water space around the crystal , and hence the flux of new zinc molecules from the water space to the crystal ( figure 3 ) . together , these factors would favor spherical symmetry in the displacement of water molecules by zinc and the growth of a spherical dense core . it is also possible that , depending on the expression of other zinc transporters in the granule membrane in the different mouse strains , different amounts of zinc are still present in the vesicles allowing growth of abnormal crystals ( rods or plates ) , which are predicted to be less efficient in terms of packaging efficiency in granules , and perhaps even harmful for the integrity of the granule membrane . thus , it is possible that , depending on the kinetics of zinc influx from the cytosol to the granular lumen and the rate of zinc incorporation into new crystal , the shape of the crystal varies between spherical and rodlike , whereas in the complete absence of transporters , no crystal is formed ( figure 3 ) . detailed realtime measurements of free zinc in maturing granules would be required to resolve this important issue . apart from differences between mouse strains , there could also be an effect of age , as secretory granules with a rodshaped core predominate in young mice , whereas the islets of older mice contain mainly immature vesicles without a dense core . the environmental influence of diet might also play a role , as we observed a progressive deterioration of glucose homeostasis with time in znt8 mice fed a highfat diet . this deterioration is a result of abnormal cell function , as insulin sensitivity remained normal , whereas glucosestimulated insulin release from isolated islets diminished . the effect of highfat diet on insulin secretory granules was not analyzed , but it is conceivable that impaired granule packaging in cells that can not form insulin crystals leads to secretory failure when the metabolic insulin demand is high . hypothetical model for the formation of insulin crystals in secretory vesicles . ( a ) in the presence of zinc transporter 8 ( znt8 ) , zinc is equally and rapidly transported into the water space around the crystal in the secretory vesicle , so that transport does not limit the symmetry of crystal formation and the granuledense core grows in a spherical manner . however , when zinc influx is hampered , for example , because of the absence of znt8 , crystal formation will be affected . ( b ) one possibility is asymmetric influx of zinc , which could cause the growth of rodshaped crystals . ( c ) another possibility is absence of zinc transporters , which could result in the lack of crystals and a secretory granule filled with watersoluble insulin . upper panels : white transporter , znt8 ; green transporter , unidentified znt transporter ; black surface , insulin crystal ; black arrows , growth direction of the crystal . lower panels : detailed electron microscopy view of a secretory granule of an islet of the znt8 and znt8 mouse . in human pharmacology , watersoluble ( rapidly acting ) insulin reaches the circulation at an earlier timepoint than crystalline insulin preparations . however , it is not known how fast secreted insulin crystals dissolve in the extracellular space . the diameter of the pore resulting from a kiss and run event of exocytosis was estimated in cells to vary between 1.5 and 6 nm ( human mouse , respectively ) , which is smaller than the diameter of the dense core . as a result , one could imagine that insulin , when stored in a noncrystallized watersoluble manner , such as what occurs in znt8 mice , would more easily be secreted during a kiss and run event than insulin crystals from dense core granules . as insulin release ( both time kinetics and percent released per cell per hour ) is well preserved in the absence of insulin crystals , it is clear that dissolving insulin crystals in the islet interstitium does not delay the rate at which insulin enters the circulation in vivo , at least not to the extent that this can be measured . furthermore , nicolson et al . also showed through total internal reflection fluorescence ( tirf ) that no differences in the number of together , these data show that insulin crystallization per se is not essential for the dynamics of insulin release and normal glucose homeostasis . at the mrna level , high amounts of znt8 expression were also found in mouse cells . however znt8 immunoreactivity is weak in cells as compared with cells , suggesting that gene expression in cells is inhibited at a posttranslational step , or that protein stability is less in these cells than in cells . the existence of paracrine effects within an intact islet of langerhans has been documented by many studies . one important physiological regulation is that cells are suppressed under conditions that cells are active , and over the past decades , insulin , gamma aminobutaric acid ( gaba ) and zinc have been proposed as important paracrine cell factors that inhibit cells . , is , however , a subject of intense debate . a detailed overview of the role of zinc on glucagon secretion can be found in recentlypublished reviews . novel evidence was collected by the study of znt8 mice , which are deficient in zinc release ; in these animals , no difference in plasma glucagon levels was observed , and glucagon release from isolated islets was the same as in control islets , suggesting that zinc secreted from cells does not regulate glucagon secretion . as was already mentioned in the introduction , a link between diabetes and zinc homeostasis was first noted in 1934 . at the genetic level , this link was recently further supported by several genomewide association studies that reported a point mutation in the znt8 gene , leading to an arg325trp polymorphism , with genetic susceptibility to type 2 diabetes . a metaanalysis , including 32 cohorts , showed that each znt8 risk callele ( argisoform ) was associated with a 14% increased risk for type 2 diabetes . the presence of the risk allele , however , had no effect on basal or stimulated ex vivo insulin secretion or on znt8 , insulin and glucagon expression . in contrast , znt8 expression was positively correlated with circulating insulin and glucagon levels . in vitro experiments carried out with ins1 cells overexpressing the arg or trpisoform of znt8 showed no difference in glucosestimulated insulin release or membrane potential , but therefore , the exact mechanistic role of the arg325trp polymorphism in the predisposition for diabetes is unclear at the moment . the reason for the discrepancy between the predisposition for diabetes in humans and the lack of a drastic effect on glucose homeostasis in znt8 mice is unclear . a first possibility is that znt8 function in mouse and human cells is not completely the same , analogous to what was proposed for facilitative glucose transporters . alternatively , the epistatic effect of an unidentified extra genetic factor could be required for the increased susceptibility in the human locus . third , the observed genetic susceptibility of the locus could be unrelated to znt8 , one example being a regulatory element belonging to a neighboring gene . the znt8 gene and its encoded protein could be linked to diabetes through other mechanisms than the arg325trp polymorphism . first , disturbances in zinc homeostasis and increased levels of oxidative stress play a major role in the pathogenesis of diabetes , both type 1 and type 2 . zinc depletion by itself can induce apoptosis , but can also promote oxidative stressinduced apoptosis , resulting in reduced cell mass . although zinc is redox inert , and therefore in itself not an antioxidant , it shows a variety of indirect antioxidant effects , thus explaining its role in oxidative stressinduced apoptosis and diabetes . therefore , increasing the capacity of the cell to store zinc for example , overexpression of znt8 or mt could protect the pancreas against zinc depletion and oxidative stress often observed in diabetes . in favor of this idea , furthermore , a single nucleotide polymorphism ( snp ) in the 3 untranslated region of znt8 , which is correlated with increased fasting glucose levels , has been identified , and an inverse association between total zinc intake and fasting glucose was observed in individuals carrying the glucoseraising allele . finally , znt8 was observed to be a major autoantigen in human type 1 diabetes and a predictive marker in risk groups before onset of the disease . . showed that znt8 was targeted by autoantibodies in 6080% of newonset type 1 diabetic patients , as compared with < 2% of control subjects . including antiznt8 antibodies to the list of alreadyused predictive markers , glutamic acid decarboxylase antibodies ( gada ) , tyrosine phosphatase antibodies ( ia2a ) , insulin autoantibodies ( iaa ) and islet cell antibodies ( ica ) , raised autoimmunity detection rates to 98% at disease onset . together , the analysis of znt8 in normal health and diabetes has so far yielded an incomplete image with many gaps that need to be filled by further study . on the one hand , the protein is required for insulin crystal formation , but this process is not essential for normal glucose homeostasis . on the other hand , a genetic polymorphism in the znt8 gene predisposes to type 2 diabetes , but in fact , there is a discrepancy between the effect of a znt8 polymorphism and human diabetes , and the lack of diabetes in mice in which znt8 is not expressed . in order to better understand this discrepancy , it might be necessary to make a knockin mouse model that recapitulates the human risk allelic variant . in this way , we will be able to analyze if a change in the encoded protein or an altered regulatory element for a neighboring gene is responsible for the increased susceptibility . finally , it is clear from many studies that zinc is essential for cell function . this has very recently been shown in a study of intraportal islet transplantation in rats that was more successful in a zincrich environment . together , all available evidence strongly shows that it is important to further study the factors that regulate zinc homeostasis in cells and the mechanisms that lead to failure of this homeostasis and cell dysfunction .

periodontitis is a chronic inflammatory disease characterized by destruction of tooth - supporting tissues . the red - complex bacteria including , porphyromonas gingivalis , tannerella forsythia and treponema denticola were shown to have the closest association with the severity of periodontitis [ 2 , 3 ] besides this group , aggregatibacter actinomycetemcomitans and prevotella intermedia . a complex cytokine network is synthesized in response to these periodontopathogenic bacteria and plays an important role in periodontal disease . the structure of bioactive bacterial compounds differs substantially between different bacteria and subsequently resulting in differences in cytokine production . exciting new evidence has emerged introducing a novel subset of t - helper ( th ) lymphocytes termed th17 . the role of th17 cells and their specific cytokines ( il-17 ) in periodontal disease is just beginning to be investigated . il-17 is a proinflammatory cytokine that stimulates a variety of cells to produce inflammatory mediators such as il-1 , il-6 , and tnf- . although th17 pathways are mostly associated with protection against bacteria via recruitment of phagocytes , they have also been proposed to enhance alveolar bone resorption . previous studies showed that il-17 was associated with chronic periodontitis [ 1113 ] suggesting that it may contribute to periodontal tissue destruction . il-11 as an anti - inflammatory mediator has been shown to play an important role in the modulation of immune response via reduction of proinflammatory cytokine production in animal models . it was predicted that il-11 may be considered as a candidate molecule for therapeutic modulation of the host response in the management of periodontal diseases [ 5 , 15 , 16 ] . regardless of the different clinical profiles between generalized aggressive periodontitis ( gagp ) and generalized chronic periodontitis ( gcp ) , it is not clear whether those patients present a distinct profile of inflammatory mediators . based on the above , the aim of this study was to determine the total amount and concentration of the cytokines il-17 and il-11 in the gingival crevicular fluid ( gcf ) from gcp , gagp patients , and healthy controls ( c ) and to investigate these levels in relation to the periodontal pathogens presented in their dental plaque . to date this is the first study to examine the gcf il-17 and il-11 levels in gagp and gcp patients in connection with periodontopathic bacteria in the dental plaque . sixty - five systemically healthy subjects were selected from the outpatient clinic , department of oral medicine and periodontology , faculty of oral and dental medicine , cairo university , between february 2010 and december 2010 , who signed an informed consent form approved by the university institutional review board after explaining the study . exclusion criteria were as follows : pregnant women , subjects with < 22 permanent teeth , having any given systemic disease , taking any type of medication and/or antibiotic therapy during the 3 months before the study , receiving previous periodontal treatment , and former or current smokers . subjects with gagp and gcp and healthy control ( c ) subjects were diagnosed based on the periodontal classification of the american academy of periodontology and met the following criteria .gcp group ( n = 25 ) : gcp patients were > 35 years of age and had a minimum of six teeth with at least one site each with pocket depth ( pd ) and clinical attachment level ( cal ) > 5 mm.gagp group ( n = 25 ) : gagp patients were < 35 years of age and had a minimum of six teeth other than the first molars and incisors with at least one site each with pd and cal > 5 mm , and familial aggregation ( subjects were asked if they had at least one other member of the family presenting or with a history of periodontal diseases).control group ( n = 15 ) : c subjects were > 20 years of age and had clinically healthy gingiva with zero plaque index , gingival index , and cal 3 mm pd . gcp group ( n = 25 ) : gcp patients were > 35 years of age and had a minimum of six teeth with at least one site each with pocket depth ( pd ) and clinical attachment level ( cal ) > 5 mm . gagp group ( n = 25 ) : gagp patients were < 35 years of age and had a minimum of six teeth other than the first molars and incisors with at least one site each with pd and cal > 5 mm , and familial aggregation ( subjects were asked if they had at least one other member of the family presenting or with a history of periodontal diseases ) . control group ( n = 15 ) : c subjects were > 20 years of age and had clinically healthy gingiva with zero plaque index , gingival index , and cal 3 mm pd . all subjects received clinical examination including the following periodontal parameters : plaque index ( pi ) , gingival index ( gi ) , pd and cal . one examiner performed all the measurements at six sites for all teeth mesiobuccal , mesiolingual , midbuccal , distobuccal , distolingual , and midlingual . pi was established by measuring the presence or absence of supragingival biofilm with a sweeping movement of the probe around the buccal , mesial , distal , and lingual regions of all teeth . pd was measured from the free - gingival margin to the base of the periodontal pocket and cal was measured from the cementoenamel junction of the tooth to the base of the periodontal pocket . measurements were rounded to the highest whole millimeter using the michigan 0 probe with williams ' markings . following the careful removal of supragingival biofilm , areas were washed with water spray , isolated with cotton rolls , and gently dried . 35 ) , which were inserted in the site with deepest periodontal pocket in each quarter and kept there for 30 s. the paper points were placed into sterile tubes containing 300 l pbs . after subgingival biofilm collection , teeth were washed again , and the area was isolated and gently dried . gcf was collected by placing filter paper strips ( perio - paper , ide interstate , amityville , ny , usa ) into the pocket until a slight resistance was perceived and then left in place for 30 s. strips contaminated by blood were excluded . immediately , the volume of the sample was measured with the aid of a calibrated periotron 800 ( oraflow inc . , after volume measurements , the strips were placed into sterile eppendorf tubes containing 300 l pbs . all samples ( subgingival biofilm and gcf ) were immediately stored at 20c until subsequent analysis . only one examiner , the same one charged with clinical measures , collected all microbial and gcf samples . gcf samples were analyzed for il-17 and il-11 using commercially available human enzyme - linked immunosorbent assay ( elisa ) kits ( biosource europe sa , nivelles , belgium , and promocell , heidelberg , germany , resp . ) . it is a sandwich - type elisa where a monoclonal anti - human il-17 and il-11 , adsorbed onto microwells , bind il-17 and il-11 in the sample , respectively . the total amount of il-17 and il-11 was determined in picograms ( pg ) and calculations of the concentration in each sample were performed by dividing the total amounts of il-17 by the volume of the sample ( pg/l ) . dna was extracted from microbial samples using the dna extraction kit ( roche , mannheim , germany ) according to the manufacturer 's recommendations . the conventional polymerase chain reaction ( pcr ) amplification of the conserved region of 16s ribosomal dna was tested for periodontal pathogens including a. actinomycetemcomitans , p. intermedia , p. gingivalis , t. forsythia , and t. denticola ( table 1 ) . all these pcr primers were obtained commercially ( gibco brl , so paulo , sp , brazil ) . 100 ng of genomic dna was added to the pcr mixture which contained 1 mol / l of the primers , 2.5 u of taq polymerase in 1x buffer , and 0.2 mmol / l of dctp , dgtp , datp , and dttp in a total volume of 50 l . pcr amplification was performed for 35 cycles of 30 s at 95c , 30 s at 55c , and 60 s at 72c in thermocycler . twenty l of each pcr reaction mixture was electrophoresed in 1.7% agarose gel in tae buffer , and the amplification products were visualized under ultraviolet light , on ethidium bromide - stained gel . one - way anova ( analysis of variance ) was used to compare mean pd and cal in the three groups . tukey 's test for pair - wise comparisons was used to determine significant differences between groups when anova test was significant . kruskall - wallis test was used to compare cytokine levels , pi , and gi in the three groups . mann - whitney u test was used in the procedure of pair - wise comparisons when kruskall - wallis test was significant and was also used to compare cytokine levels in positive and negative bacteriological cases . chi - square ( x ) test was used to compare prevalence of different bacterial species in the three groups . the significance level was set at p 0.05 . all of the clinical parameters were significantly higher in gagp and gcp groups compared to c group . pi , gi , and cal values were significantly higher in gagp group than gcp group . the gcf volume , total amounts , and concentrations of il-17 and il-11 are shown in table 3 . the gcf volume was found to be the highest in gagp group ( significantly higher than gcp and c groups , p < 0.001 ) , followed by gcp and c groups , respectively . the total amount of il-17 was significantly higher in gagp group than in gcp and c groups ( p < 0.001 ) . the total amount of il-17 was higher in gcp group than in c group but without statistical significance . meanwhile , gagp group had significantly lower il-17 concentrations than gcp and c groups ( p < 0.001 ) . the difference between the gcp and c groups was also found to be significantly ( p < 0.001 ) higher in c group ( p < 0.001 ) . the concentration of il-11 was significantly higher in c and gcp groups than in gagp group ( p < 0.001 ) . the gagp group had significantly lower il-11 concentrations when compared to gcp group ( p < 0.001 ) . no significant differences were found among the groups in the total amount of il-11 ( p = 0.309 ) . the il-11/il-17 ratio was significantly higher in the c group than gagp and gcp groups ( p < 0.05 ) . gagp group showed lower ratios of il-11/il-17 when compared to gcp group ; yet no statistically significant difference was observed between them . the occurrence of different periodontal bacteria , a. actinomycetemcomitans , t. forsythia , t. denticola , p. gingivalis , and p. intermedia , in the dental plaque of gcp and gagp patients is given in table 5 . detection frequency and percentage of a. actinomycetemcomitans were significantly higher in gagp than in the gcp patients . meanwhile , the detection frequency and percentage of t. denticola , p. gingivalis , and p. intermedia were significantly higher in gcp than in the gagp patients . no statistically significant difference was detected in the frequency of t. forsythia between gagp and gcp patients yet it was higher in gcp patients . figures 1 and 2 show the relationship between gcf levels of il-17 and il-11 and the occurrence of different bacteria ( a. actinomycetemcomitans , t. forsythia , t. denticola , p. gingivalis , and p. intermedia ) in the positive samples of gcp and gagp patients . the high occurrence of p. gingivalis in the dental plaque was associated with significantly increased gcf levels of il-17 in gcp ( p < 0.05 ) and gagp patients ( p < 0.001 ) in positive samples compared to negative samples . no significant differences in the gcf levels of the il-11 depending on the presence of any periodontal bacteria were found ( data not shown ) . the intensity , duration , and resolution of inflammation depend on shifting the balance between the activities of proinflammatory and anti - inflammatory cytokines during the periodontal inflammation . accordingly , this investigation evaluated the total amount and concentration of il-17 and il-11 in gcf of gcp , gagp , and c subjects . the current study shows , for the first time , an overexpression in the total amount of il-17 in gcf of gagp patients compared to gcp and c ones . . demonstrated that subjects with gagp presented higher serum levels of il-17 than subjects with gcp and c , and that this increase was related to gene polymorphisms coding for the synthesis of inflammatory mediators . detected il-17 in sera from gagp patients , suggesting that it could be from the locally produced cytokine in the periodontal tissues . gagp patients are known to exhibit defective neutrophils chemotactic responses and enhanced oxidative metabolic responses . it has been assumed that elevated il-17 levels noted in gagp may represent a compensatory increase in cytokine production in response to these functional defects . conversely , borch et al . found no differences between c and gagp subjects in the release of il-17 by mononuclear cells , yet results from cell - culture methodologies are not directly comparable with cytokines gcf levels . this study also showed comparable results to vernal et al . who reported significantly higher total amounts of il-17 in gcf and in the culture supernatants of gcp patients than in c. elevated tissue concentrations of il-17 could promote periodontitis progression by increasing concentrations of bone resorbing chemokines , which suggests that il-17 may be a mediator of periodontal destruction [ 12 , 25 ] . others demonstrated that il-17 has a synergy with tnf- in synthesizing il-6 and increasing bone resorption . interestingly , il-17 has been observed to act on osteoblasts inducing their differentiation into mature osteoclasts [ 28 , 29 ] . alternatively , this study demonstrated a significant decrease in il-17 gcf concentration in patients with gcp and gagp compared with c , and in gagp patients when compared with gcp patients . these results were supported by vernal et al . who reported lower il-17 gcf concentration in gcp patients compared to c and attributed this decrease to the higher gcf volume produced in diseased sites with pd > 5 mm than in healthy sites from c. johnson et al . reported lower il-11 concentrations within gingiva adjacent to deep pd , suggesting an imbalance between pro- and anti - inflammatory mediators in their study . this investigation also observed significantly lower il-11 concentrations in gagp group which had the deepest pd and cal in sampling sites , compared with gcp and c groups . furthermore , gcp group had significantly decreased concentration of il-11 than c group , which was in accordance with yetkin et al . and johnson et al il-11 has been shown to inhibit il-1 , tnf- , il-6 , and downregulated lps - induced cytokines throughout the inhibition of nf-b expression in vitro . previous investigators demonstrated that il-11 induced osteoblastic differentiation and bone formation in vivo and in vitro . it has been reported that the twice - weekly administration of recombinant human il-11 in periodontal disease model acted by blocking proinflammatory cytokines , leading to a reduction in attachment loss and bone resorption and improvement of the inflammatory reaction . taken together , the results mentioned above allow us to suggest that il-11 might be a key mediator in preventing the progressive inflammation leading to periodontal tissue breakdown . in this study the total amount and concentration of il-11 : il-17 cytokine ratio was significantly higher in c group compared to both gcp and gagp groups , and higher in gcp group compared to gagp , that is , decreased with increasing pd . johonson et al . reported that il-11 : il-17 ratios decreased from 3 mm to > 6 mm in diseased gingiva . moreover , yetkin et al . showed higher il-11 : il-17 ratio in healthy sulcus of c subjects compared to deep pockets of gcp patients suggesting that the anti - inflammatory properties of il-11 may be impaired in deeper pockets . also found significantly higher il-11 : il-1 ratio in gingivitis and c groups compared to gcp group . recently , andrukhov et al . stated that due to differences in the bacterial load different types of periodontal diseases could be associated with specific cytokine profiles . it has been suggested that the plaque bacterial load could determine the type of periodontal disease ; that is , a. actinomycetemcomitans was associated with gagp and gcp was associated with the red - complex bacteria . in this study , samples with positive p. gingivalis in gagp and gcp patients showed significantly higher total amounts of il-17 than negative samples . this agrees with another study where p. gingivalis induced a significant increase in il-17 in periodontitis patients than in gingivitis patients . considering that il-17 is capable of inducing the production of tnf- , our findings are also supported by andrukhov et al . who reported that tnf- serum levels were significantly increased in periodontitis patients with high plaque load of p. gingivalis . in conclusion , the current findings suggested a role for il-17 in the periodontal destruction of gagp and gcp along with a therapeutic role for il-11 . further investigations with larger populations are required to clarify the specific contribution of il-17 to the pathogenesis of periodontitis and to determine the therapeutic benefit of il-11 for resolution of inflammation in periodontal diseases .

many processes in nature and technology involve polymer - decorated surfaces in liquid media , and therefore understanding of interactions between such surfaces is important from both academic and technological points of view . dense grafting of polymer chains to a surface leads to the extension of these polymers due to interchain repulsions resulting in structures called polymer brushes . interactions between polymer brushes determine their effectiveness in steric stabilization , controlled by the normal forces between polymer - decorated surfaces . these interactions also determine friction between brushes , which is conventionally characterized by the friction coefficient , defined as the ratio of shear and normal forces between the two substrates sliding over each other . it was demonstrated experimentally that solid substrates decorated with charged polymer brushes have low friction coefficient when sheared against each other in polar solvents . in contrast to sliding solid surfaces with typically velocity - independent friction coefficient , shear force between two surfaces with a liquid or brush layer between them increases with shear velocity . since the friction coefficient of these sliding surfaces is velocity - dependent , the shear stress in this case is better described by the effective viscosity defined as the ratio of shear stress and the effective shear rate . the normal and shear forces between polymer - decorated surfaces were extensively studied over several decades . the theoretical predictions for normal forces arising upon compression of neutral brushes were found to be in reasonable agreement with experiments and computer simulations . , the alexander de gennes scaling model of neutral brushes , was generalized to incorporate the shear - induced deformation of tethered polymers in nonlinear response regime . the understanding of interactions between polyelectrolyte ( pe ) brushes is not as complete as between neutral ones . boltzmann model of a pair of apposing pe brushes , described the density profiles of polymer segments strongly coupled to the distribution of mobile counterions . the increase in normal force upon compression of apposing polyelectrolyte - decorated substrates is due to the increase of counterion concentration in the midplane between them ( as there is no electric field at the midplane ) . since most counterions are confined within the brushes , the sharpest increase of the normal force upon compression occurs at the distance between grafted surfaces on the order of brush thickness . at this distance the concentration of counterions at the midplane changes from a very low value outside the brushes to a very high value inside the brushes . one of the predictions of these works , is the existence of a polymer - free gap filled with solvent and counterions between brushes compressed against each other due to partial contraction of pe chains . the early theoretical studies extended the scaling models of pe brushes to analyze the change in conformations of tethered polyelectrolytes in strong flows under a constant normal load . they demonstrated the coupling between normal and shear forces due to tilting and stretching of polyions in apposing pe brushes in the direction of flow and predicted equilibrium distance between brush - decorated substrates as a function of shear and normal stresses . in this paper we consider two planar substrates decorated with charged polymer brushes sliding over each other , and examine how the resulting shear force depends on length and degree of ionization of tethered polyelectrolytes , chain grafting density , and solvent quality . we demonstrate that charged polymer brushes enhance both normal and lateral forces between substrates in comparison to bare surfaces with equivalent charge densities . chapman tails of counterions , and is therefore much smaller than the normal force between compressed polyelectrolyte brushes separated by the same distance . the friction between bare charged surfaces is governed by the solvent viscosity and is also smaller than the friction between brushes at similar distances . we demonstrate that the enhancement of normal force by polyelectrolyte brushes with respect to bare charged surfaces is much larger than the corresponding increase of friction force resulting in lower friction coefficient between polyelectrolyte brushes . the behavior of polyelectrolyte brushes in salt - free solutions considered in this paper is also retained in solutions with added salt as long as counterion concentration is higher than that of salt ions . the mechanism of relatively low friction at high normal pressure maintained in polyelectrolyte brushes and gels sheds some light on lubrication phenomenon in biological systems , e.g. , low friction at high load in synovial joints . , we review the behavior of planar polyelectrolyte brushes immersed in a salt - free solvent ( section 2.1 ) , the normal force between a pair of polyelectrolyte brushes ( section 2.2 ) and their interpenetration ( section 2.3 ) . our results on the friction between polyelectrolyte brushes are presented in section 3 and compared with the friction between bare charged surfaces in section 4 . in section 5 , , we estimate the solvent penetration length for neutral brushes and for pe brushes in the osmotic regime . properties of a single planar polyelectrolyte ( pe ) brush in contact with a salt - free solution depend on the following parameters : ( i ) contour length nb where n is the number of kuhn segments of length b , ( ii ) degree of chain ionization f ( fraction of charged kuhn segments ) , ( iii ) bjerrum length lb defined as the distance at which two elementary charges e interact with thermal energy kbt = e/(lb ) in a solvent with dielectric constant , ( iv ) grafting density ( number of chains tethered per unit surface area ) . each polyion has fn elementary charges e uniformly distributed along its backbone , and the same number fn of mobile monovalent counterions distributed in solution above the grafted surface ( both inside the brush and outside it ) . we assume relatively low charge density along the chain ( less than one charge per bjerrum length , or lb < bf ) . brushes with higher charge density and the resulting manning condensation of counterions are considered in section 5 . nonelectrostatic interactions between monomers determine local chain statistics : size r bg for a small chain section with g kuhn monomers with exponents 3/5 and = 1/2 for good and solvent conditions , respectively . balancing coulomb electrostatic energy1of a polyion with end - to - end distance l and backbone elastic free energy2leads to the average end - to - end distance of a polyion in a dilute salt - free solution,3where we define the dimensionless ratio u of bjerrum length lb and kuhn length b4 the exponent of the effective interaction parameter uf in eq 3 is 1/3 in a solvent with = 1/2 , and 2/7 in a good solvent with = 3/5 . a single polyion can be envisioned as a stretched string of n / ge electrostatic blobs with size5containing6monomers each . on length scales smaller than e , the electrostatic energy is less than thermal energy kbt , and the local chain statistics is almost unperturbed ( e bge ) . on length scales larger than e , polyion is stretched by electrostatic repulsion between charges , and its end - to - end distance in a salt - free solution is l en / ge ( see eq 3 ) . if polyions are sparsely tethered to the substrate , with grafting density l , the grafted layer is considered to be in charged mushroom ( cm ) regime with characteristic end - to - end distance of chains given by eq 3 . in contrast to neutral grafted chains in mushroom regime , polyelectrolytes in charged mushroom ( cm ) regime interact with each other . this long - range interaction can result in their orientation perpendicular to the grafted surface . the electric field due to grafted chains with charge efn on each creates surface charge density efn and electric field in solvent with dielectric constant 7 this field imposes a force on each grafted chain8 the energy gain due to orienting chain perpendicular to the grafted surface ( along the field ) is on the order of the product of this force and chain size l ( see eq 3)9which is the energy cost of rotating one chain in the electric field of other grafted chains by an angle on the order of unity . the onset of the orientation occurs at grafting densities orient at which this electrostatic orientation energy per chain uelec is on the order of thermal energy kbt . this onset of grafted polyelectrolytes , orienting each other in the cm regime , occurs at10 at lower grafting densities < orient , tethered polyelectrolytes are almost noninteracting and freely rotating . at higher grafting densities > orient , intermolecular interaction ( eq 9 ) is strong enough to orient polyelectrolytes primarily perpendicular to the grafted surface , but not strong enough to deform them significantly . at these grafting densities , the intramolecular electrostatic repulsion ( eq 1 ) is much stronger than the intermolecular one and controls chain extension ( see the first plateau in figure 1 ) . this crossover grafting density at which the intermolecular electrostatic interaction energy ( eq 9 ) becomes on the order of the intramolecular one ( eq 1 ) corresponds to the separation between chains on the order of their size l ( eq 3),11 schematic dependence of pe brush thickness h on chain grafting density in logarithmic coordinates . in contrast to tethered neutral chains , the crossover between charged mushroom and charged brush regimes occurs prior to the overlap of chain projections onto grafted surface . note that for polyions elongated by the intramolecular coulomb repulsions between charged monomers orient *. at higher grafting densities > * tethered polyions create an electric field e ( eq 7 ) which stretches each chain beyond the size of a free polyion l ( eq 3 ) . the size of the chain in this regime is determined by the balance of the electrostatic energy per chain ( eq 9 with l replaced by h)12and elastic free energy per chain ( eq 2 with l replaced by h)13resulting in the brush height14increasing with grafting density linearly in a solvent and with exponent 2/3 in a good solvent ( see figure 1 ) . this regime of unscreened electrostatics ( referred to as pincus regime ) continues as long as counterions are able to escape from the brush . chapman length ) is defined as the distance at which the energy of counterion attraction to the charged surface is higher than that at the surface by the thermal energy kbt . the upper boundary of the pincus regime corresponds to = h or to the grafting density16where h0 is the thickness of the brush with grafting density at or above the crossover value osm ( see eq 17 below ) . < < osm ) exists only for weakly charged grafted polyions with bf > lb , while for strongly charged polyelectrolytes ( bf < lb ) with condensed counterions there is no pincus regime and * osm ( see section 5 ) . at higher grafting densities > osm , counterions become localized within the brush , and their entropy ( osmotic pressure ) dominates the brush properties . this main regime of polyelectrolyte brushes is called osmotic brush ( ob ) regime . here , the size of the brush is determined by the balance of the osmotic pressure of counterions , trying to maximize their entropy by increasing the brush volume , and the elasticity of tethered chains opposing this tendency . the balance of the two forces corresponds to both , osmotic and elastic parts of the free energy per chain fnkbt , independent of the grafting density . therefore , the scaling model predicts the brush thickness in this osmotic regime17to be independent of the grafting density ( see the second plateau in figure 1 ) . the chain size h0 in the osmotic brush regime of weakly charged polyions ( with bf > lb ) is strongly stretched compared to its free polyelectrolyte size l with effective tension blobs containing one elementary charge and consisting of gp 1/f monomers of size18thus , the size of the stretched chain ( and the thickness of the osmotic brush ) is h0 pn / gp ( see eq 17 ) . at very high grafting densities19the distance between chains becomes smaller than the pincus blob size p ( eq 18 ) and the energy of short - range excluded volume interactions between monomers becomes higher than the counterion osmotic contribution to the brush free energy . for these very high grafting densities n tethered polyions enter the quasi - neutral brush ( q - nb ) regime . pe brushes in q - nb regime have the same properties as neutral brushes . the thickness of a neutral brush is determined by the balance of short - range excluded volume repulsion and chain elasticity . it can be estimated by the alexander de gennes scaling model as the length of a stretched array of correlation blobs with the size of each blob on the order of the distance between grafting points , n = . the number of correlation blobs per chain is n / gn = n(b ) , and the brush thickness increases with grafting density as20 figure 1 shows the increase in brush thickness h with grafting density in this quasi - neutral regime with the scaling exponent ( 1)/(2 ) which is half of the exponent in the pincus brush regime . in solvent with = 1/2 , the exponent ( 1)/(2 ) = 1/2 while in good solvent with = 3/5 the exponent ( 1)/(2 ) = 1/3 . in the alexander de gennes model of neutral brushes , all chain ends are assumed to be located in the outmost blob , and the density is assumed to be uniform throughout the brush . in more sophisticated models of neutral brushes , chain ends are distributed throughout the brush in such a way that the effective molecular field acting on chain segments is parabolic . this results in the almost parabolic density profile of solvated neutral brushes in good solvents . as in neutral brushes , the molecular field in polyelectrolyte brushes with fractional charge ef per kuhn monomer is also almost parabolic . however , this field in the charged brushes is essentially electrostatic acting on the charged monomers . therefore , the electrostatic potential inside a polyelectrolyte brush is parabolic , resulting in the gaussian distribution of counterions , as dictated by the boltzmann law . this parabolic electrostatic potential is produced by the combined electric charges of both tethered polyions and counterions . the parabolic shape of the electrostatic potential indicates that electric field ( derivative of the electrostatic potential ) in the brush increases linearly with the distance from the grafted surface . linear increase of the electric field implies by the gauss law that the net charge density in the brush is uniform . this net charge density is the difference between charges on the chains and counterions . therefore , the polymer density profile follows that of counterions and is also gaussian to ensure that the difference between counterion and polymer charge profiles is distance - independent . since the net charge of the brush is not exactly zero , the compensating counterions ( n per chain ) escape from the brush and form gouy chapman layer of thickness . these escaped counterions create a capacitor with characteristic thickness h0 + and the escaped charge en is related to gouy eq 15 ) outside the brush21 the electrostatic energy per unit area of this capacitor22is balanced by the entropic part of free energy per unit area gained by escaped counterions23with concentration c0 = fn/h0 of ions inside the brush and concentration of ions cout = n/ in the gouy chapman layer comparable to the polyelectrolyte brush thickness h0 in the osmotic regime ( eq 17)24up to logarithmic correction on the order of ln(c0/cout ) . the net number of charges escaped from the brush per unit area is therefore reciprocally proportional to the product of the brush thickness h0 and bjerrum length lb,25 note that the concentration of counterions in the gouy chapman layer outside the brush , cout = n/ lbn ( lbh02 ) , is much smaller than concentration of counterions inside the brush , c0 = fn/h0 , in the osmotic regime , osm , with the ratio of the two concentrations ( see eq 16)26determined by how deep the brush is inside the osmotic regime /osm . chapman length due only to charges n escaped from the brush ( eq 21 ) . we estimate the boundaries between different pe brush regimes using the values of parameters close to those in for grafted polyelectrolyte chains with n = 200 kuhn monomers of length b lb = 0.7 nm , and degree of ionization f = 0.5 one finds crossover surface densities : orient 2 10 nm , * 1.3 10 nm , osm 1.4 10 nm , and n 1 nm . note that the experimentally relevant and the widest range of surface densities of grafted chains corresponds to the osmotic regime . for example , the experimentally studied surface density of grafted chains 0.2 nm is in the osmotic regime of pe brush with predicted brush thickness h0 100 nm much larger that the bare gouy chapman length 0.01 nm and therefore with very large ratio cinside / coutside h0/ 10 . below we the main focus of this paper is on the interactions between two polyelectrolyte brushes . in contrast to neutral brushes , polyelectrolyte brushes repel each other at distances d between grafted surfaces much larger than twice the thickness h0 of each brush . the source of this long - range interaction is the confinement of counterions in the space between two surfaces . the free energy of dissociated counterions is dominated by their translational entropy , which is much larger than interaction part of their free energy . the self - energy of counterions does not change upon brush deformation and therefore does not contribute to the variation of free energy . the resulting pressure p felt by the surfaces is given by vant hoff ( ideal gas - like ) law for counterion density ci(d/2 ) in the middle of the gap , p = kbtci(d/2 ) . at distances between grafted surfaces h0 , the pressure27is determined by the tail of the gouy chapman counterion distribution , ci(z ) ( lbz ) at distance z = d/2 . note that this pressure is independent of brush parameters and depends only on the separation d between grafted surfaces and bjerrum length lb ( for monovalent counterions ) . at stronger compressions , d < h0 , counterions are distributed almost uniformly between the two grafted surfaces with concentration ci = 2fn/d , and produce osmotic pressure28 note that there is sharp crossover between these two expressions , eqs 27 and 28 , with rapidly increasing pressure from a low value of kt/(lbh02 ) to a high value of ktc0 ktfn/h0 by a large factor fnh0 lb /h0 upon the decrease of separation d by the factor on the order of unity ( for example , from d = 2h0 to d = h0 ) as depicted in figure 2 . the crossover between two asymptotic dependences of osmotic pressure ( lines with slopes 2 and 1 given by respective eqs 27 and 28 ) is indicted by the vertical dashed line . normal force per unit area in compressed osmotic pe brushes as a function of distance d between surfaces in logarithmic coordinates . the normal force between compressed polyelectrolyte brushes is dominated by counterions ( eq 28 ) as long as there is more than one free counterion per correlation volume . the normal pressure at higher compression is controlled by direct interactions between polymer chains and is similar to the pressure in neutral brushes ( see eqs 38 and 39 below)29where c is the monomer number density c = 2n/d . in contrast to neutral brushes , polyelectrolyte brushes contract upon compression leaving the gap of width d = d 2h filled with solvent and counterions . therefore , there is a regime of intermediate compression without physical contact and interpenetration of monomers from apposing brushes . this gap acts as a lubrication layer upon shear of apposing brushes at distances between plates d > l larger than the size of a free polyion ( eq 3 ) . at smaller separations between surfaces d < l , polyions penetrate into apposing brushes up to characteristic distance , called penetration length . the polymer penetration length n in neutral brushes with parabolic molecular field was estimated in refs ( 29 and 30)30it increases upon brush compression ( a decrease in brush thickness h = d/2 ) . equation 30 is applicable for chains with gaussian elasticity in both dry ( solvent - free ) and solvated neutral brushes . it can also be applied to compressed polyelectrolyte brushes on scales larger than correlation length , as we demonstrate below ( see eq 34 ) . at strong compressions d l , polyelectrolyte chains uniformly fill the space between grafted surfaces similar to semidilute salt - free polyelectrolyte solution with concentration c = 2n/d and correlation length31this solution could be envisioned as densely packed melt of correlation blobs with size . at distances r smaller than correlation length , polyelectrolytes retain the extended conformations of dilute solution polyions , and blob size is related to the number of monomers g in the blob according to eq 332at larger distances r polyions are envisioned as gaussian chains of n / g correlation blobs each . the end - to - end distance of unconstrained polyions in a semidilute polyelectrolyte solution is33which is on the order of the fluctuation size of a polyelectrolyte chain at this concentration . we distinguish two cases for a pair of apposing polyion brushes in strongly compressed regime ( d < l ) depending on the separation between grafted surfaces d in comparison to this fluctuation size r ( eq 33 ) . if r < d < l the grafted chains are stretched in comparison to their happy fluctuation size ( h > r ) and the interpenetration between apposing brushes is only partial ( < h ) . if the separation between plates is smaller than the fluctuation size d = 2h < r the grafted chains are compressed and the two brushes fully interpenetrate ( h ) . in a compressed polyelectrolyte brush with thickness h in the interval r < h < l , the chains of blobs of size each are stretched in the normal direction . to optimize their free energy , tethered polyions distribute free ends throughout the slit between surfaces with partial penetration into apposing brush . similarly to dry ( solvent - free ) brush of neutral polymers , tethered chains of correlation blobs experience parabolic potential , and interpenetration length for polyions can be found by substituting b and n n / g and h = d/2 in eq 30 to give34note that fluctuation size r of polyelectrolyte chain in solution ( eq 33 ) decreases with concentration c as r c d. therefore , interpenetration width in eq 34 is independent of spacing d between plates in the regime of partial interpenetration . in the case of weak interpenetration d , the total number of blobs per unit area in the interpenetration zone is nb = / with nb/2 from each brush . each chain section in the interpenetration zone is almost unstretched with ( / ) blobs per section . the number of chain sections per unit area in the interpenetration zone 1/( ) is smaller than the total grafting density = d/(n / g ) by the factor35where we used eqs 33 and 34 , n / g r d . therefore , the fraction of polyions with free ends in the interpenetration zone is ( /d ) , while the fraction of monomers in this zone /d , leading to the average number of monomers per chain section in the interpenetration zone n(/d ) . a decrease in spacing between plates d eventually results in the full interpenetration of apposing brushes , d , at plate separation d r. at smaller distances d < r , there is full interpenetration of apposing brushes , = d , with total number of interpenetrating blobs per unit area nb = d/ where blob size is given by eq 31 . at distances d between plates smaller than36the correlation length in compressed polyelectrolyte brushes is governed by the nonelectrostatic interactions,37as long as there are many counterions ( with translational entropy kbt each ) per correlation blob with size ( eq 37 ) , the normal force p is dominated by the osmotic pressure of counterions . this mixed regime with correlation length controlled by nonelectrostatic interactions ( eq 37 ) , but osmotic pressure dominated by counterions is expected in the interval of distances between surfaces dqn < d < dn . at the lower boundary of this interval38there is one counterion per correlation volume . at even stronger compressions with d < dqn , , both correlation length and osmotic pressure39are determined by the nonelectrostatic interactions between monomers . in this interval of plate separations ( d < dqn ) , compressed polyelectrolyte brushes behave as quasi - neutral ones . before describing the effect of pe brushes on the friction between substrates , consider the friction between bare planar surfaces with charge number density nf immersed in a newtonian liquid with viscosity s . the normal force p is determined by the counterion pressure in the middle of the gap between surfaces40 the shear stress bare ( friction force per unit area ) experienced by planar surfaces in laminar flow with effective velocity gradient v / d equal to the actual strain rate41is42 therefore , in the case of bare surfaces the effective viscosity defined as the ratio of measured shear stress and externally imposed effective shear rate v / d43is equal to the solvent viscosity s . the shear of polymer - covered substrates with a low sliding velocity v results in linear velocity dependence of shear stress ( friction force per unit area ) v. velocity v in this linear regime is low enough to allow complete relaxation of polyion conformations with almost unperturbed distribution of monomers in pe brush in both normal and lateral directions . in the case of weak compression the flow of solvent within the brush is suppressed on hydrodynamic screening length scale h much smaller than pe brush thickness h0 . the shear - induced laminar flow of the solvent is therefore limited to the gap of thickness d 2h + 2h = d + 2h , where h is the flow penetration length into each of the brushes . the thickness of this gap is estimated in the appendix for the polyions with the gaussian elasticity . the shear stress brush is obtained in this regime of weak pe brush compression by substituting d by d + 2h in eq 42,44with effective viscosity45enhanced with respect to the solvent viscosity s by the geometric factor d/(d + 2h ) . if the thickness h0 of the pe brush is much smaller than spacing between grafted surfaces h0 d , the shear stress46is similar to the shear stress between two bare charged surfaces ( eq 42 ) . the effective viscosity eff ( eq 45 ) in this regime of weak pe brush compression is approximately equal to the solvent viscosity s . the reduced viscosityis close to unity , as depicted in figure 3 by the plateau located at distances between surfaces d > h0 . reduced effective viscosity eff/s ( equal to enhancement of shear stress brush/bare ) as a function of distance d between surfaces in logarithmic coordinates . charges on polyions and mobile ions are not shown , brush interpenetration regions are shadowed gray , the gap of laminar solvent flow with width d + 2h is shadowed blue . regions with sharp increase in reduced effective viscosity eff/s are shadowed pink . as the distance between grafted surfaces approaches the thickness of uncompressed brushes d h0 , the size of the gap d 2h + 2h rapidly decreases . the corresponding shear stress ( eq 44 ) and the effective viscosity ( eq 45 ) increase and become much larger than in the case of the bare charged surfaces at the same spacing d ( eqs 42 and 43 ) . the reduced viscosity becomes much larger than unity eff/s 1 ( see figure 3 ) . as the spacing between the surfaces becomes smaller than the uncompressed brush thickness d h0 , the width d of the polymer - free gap between apposing brushes decreases below the hydrodynamic penetration length h , and the thickness of the effective gap saturates at 2h with47estimated assuming gaussian elasticity of polyions ( see appendix for details ) . in this case the shear stress due to penetration of flow inside polyelectrolyte brushes weakly increases with decreasing separation d between plates48and the reduced effective viscosity49is much larger than unity and decreases with decreasing d ( see figure 3 ) . the sharp increase of the effective viscosity at plates separation d h0 is by the large factor ( h02 ) . note that although the effective viscosity is much higher than the solvent viscosity , the actual viscosity in the lubrication layer is still solvent - like s because the concentration of polymer segments in this layer is small . the solvent - like friction is replaced with the polymer solution - type friction at the boundary between intermediate and strong compression regimes d l. this corresponds to another sharp increase of shear stress and effective viscosity upon compression ( see the vertical dashed line at h = l in figure 3 ) . the concentration of polymer segments c = 2n/d in the regime of strong compression d l , becomes almost uniform in the gap between the grafted surfaces . in this subregime , the lateral force brush is governed by the polymer solution - type friction in the interpenetration zone with thickness . polymer segments from one brush in this zone are dragged with velocity v with respect to segments from the apposing brush . assuming that hydrodynamic interactions are screened on length scales on the order of correlation length and that the chains are unentangled , the friction force per correlation blob of size can be estimated by the stocks law as vs. therefore , the total shear stress is given by50where nb / is the number of correlation blobs per unit area in the interpenetration zone . the interpenetration length for partially interpenetrating pe brushes can be estimated using eq 3451and is compression - independent and does not depend on distance d between plates in the interval of d * < d < l. the resulting friction stress52increases linearly with concentration c = 2n/d or reciprocally with spacing d between grafted surfaces upon pe brush compression ( c d ) . therefore , the reduced effective viscosity53is independent of the distance between grafted surfaces d in this strong compression regime with partially interpenetrating pe brushes . this behavior of reduced effective viscosity eff/s is depicted by the high plateau located to the left of the dashed vertical lines in figure 3 . the jump of the effective viscosity at d l is by the factor ( l ) . this regime of constant reduced effective viscosity eff/s ends at the separation between grafted surfaces d on the order of the compression - independent interpenetration length ( eq 51)54note that at this boundary of the subregime the plate separation d * ( eq 54 ) is on the order of the fluctuations of the polyelectrolyte chains r ( eq 33)the size of unstretched chains , as expected for the interpenetration zone . at smaller separations between grafted surfaces , d < r , there is full interpenetration between chains from apposing brushes and all d/ correlation blobs per unit area contribute to the friction force . the corresponding effective viscosity eff = d / v is proportional to the separation d between grafted surfaces . this behavior of the reduced viscosity56is depicted by the solid line with slope 1 in figure 3 . at very strong compressions with d < dn ( eq 36 ) the correlation length of the space between plates is governed by the nonelectrostatic interactions ( eq 37 ) , and the friction stress approaches the value for neutral brushes57with the effective viscosity58 this effective viscosity is independent of distance d between grafted surfaces for a brush in -solvent with = 1/2 . in good solvent with = 3/5 the effective viscosity in quasi - neutral regime decreases as square root of plate separation d. the reduced viscosity eff/s in this quasi - neutral regime is indicated by the line with slope ( 42)/(31 ) in the left part of figure 3 . comparison of forces between bare charged and polyelectrolyte - decorated surfaces with the same surface charge density ( eqs 42 , 44 , 52 , and 55 ) indicates that polyelectrolyte brushes considerably enhance both normal and lateral forces at distances smaller than original brush thickness d h0 . this enhancement for planar substrates decorated with pe brushes with respect to bare plates with equivalent surface charge density efn is demonstrated in figure 3 displaying the ratio of lateral ( friction ) stresses brush/bare = eff/s and in figure 4 presenting the ratio of normal pressures pbrush / pbare as functions of the separation between plates d. ratio of normal forces per unit area pbrush / pbare for pe brush - decorated and bare surfaces with the same surface charge density as a function of distance d in logarithmic coordinates . the enhancement of normal force per unit area p is very large : the ratio is59with the largest value on the order of h0/ at plate separation d h0 . the ratio of normal stresses pbrush / pbare remains much larger than unity in the whole interval of compressions d < h0 passing through a minimum at distance between plates d dqn , as shown in figure 4 . the physical reason for this large enhancement of pressure ( eq 59 ) is the difference between the counterion distributions in the two cases . counterions are localized within the volume of the polyelectrolyte brush and the pressure pbrush quickly increases upon compression of the pe brush down to d h0 . in the case of bare charged surfaces , counterions are localized very close to the surfaces with half of them within the gouy chapman layer of thickness much smaller than the brush thickness h0 . therefore , the normal stress pbare between bare surfaces is due to the confinement of loose tails of ion distributions ( eq 40 ) at distances < d < h0 , and is very small because counterion concentration is very low outside the gouy chapman layer . at separations between plates smaller than dqn at which polyelectrolyte brushes exhibit quasi - neutral behavior ( eq 39 ) , the ratio of normal forces is60with exponent (2 3)/(3 1 ) ( see figure 4 ) equal to 1 in solvents and 1/4 in good solvents . friction forces between polymer - decorated surfaces are also considerably enhanced compared to these for bare surfaces ( see figure 3 ) . the distribution of counterions is not as important because counterions do not directly participate in friction . the first sharp increase of shear stress upon compression of brushes61is due to the reduction of the thickness of lubrication layer from h0 to h at plate separations d h0 . the enhancement of shear stress in the intermediate compression regime is ( see eq 49)62the second sharp increase of shear stress by the factor ( l)at plate separations d l , occurs because solvent - like friction is substituted by polymer solution - type friction in the interpenetration zone between apposing brushes . the high ratio of friction stresses ( eq 53)63is independent of plate separation d in the first regime of strong compression because interpenetration length is d - independent in this regime ( see plateau in figure 3 ) . in the second regime of strong compression with full interpenetration of apposing brushes the ratio of friction stresses ( eq 56)64decreases linearly with distance between plates d ( see eq 56 ) . note that enhancement of friction stresses between grafted surfaces brush/bare in all regimes with d < h0 is smaller than the ratio of normal forces pbrush / pbare . this explains why polymer brushes are better lubricants than simple liquids as discussed in detail below . friction coefficient is conventionally defined as the ratio of friction to normal forces65 the normal force pressure p between apposing brushes is velocity - independent in the linear regime , while the shear stress is linearly proportional to sliding velocity v. therefore , friction coefficient for brushes is a velocity - dependent quantity , and thus does not directly characterize the properties of participating surfaces unlike the friction coefficient between solid surfaces . in particular , one can always select small enough velocity to obtain as low friction coefficient as one would like . note that the friction coefficient bare between bare charged surfaces is also velocity - dependent66where we used eqs 40 , 42 , and 65 , while the case d < is not of practical interest for strongly charged surfaces with b. nevertheless the velocity - dependent friction coefficients can be compared between different pairs of surfaces at similar shear conditions . by using the results of previous subsections , we compare friction coefficients for two systems : planar surfaces decorated by osmotic polyelectrolyte brushes and bare charged surfaces with equivalent charge density67 for polyelectrolyte - decorated surfaces at large distances d h0 between plates , the friction coefficient ( calculated with eqs 27 and 46)68is almost unaffected by the presence of polymer brushes . this behavior of is indicated in figure 5a by solid line with slope 1 at large separations d h0 between plates and is the same as between bare surfaces ( eq 66).(see the corresponding horizontal line in figure 5b ) . ( a ) friction coefficient between planar surfaces decorated by pe brushes ( solid lines ) and neutral brushes with the same degree of chain polymerization n and grafting density ( dotted lines ) as a function of distance d between surfaces in logarithmic coordinates . ( b ) ratio of friction coefficients brush/bare for pe brush - decorated and bare surfaces with the same surface charge density in logarithmic coordinates . the region of enhanced lubrication by pe brushes is shadowed pink . at the boundary between weak and intermediate compressions ( d h0 ) both the normal and shear stresses sharply increase , but the friction coefficient brush drops because enhancement of normal force by factor h0/ is stronger than enhancement of friction stress between the brush - decorated surfaces by factor ( h02)at relatively high grafting densities of polyions in the osmotic regime with /osm>(uf ) > l < d < h0 , the friction stress brush is still solvent - like , but is enhanced in comparison to shear stress between bare charged surfaces due to very thin lubrication layer between brushes . in this regime of intermediate compression the thickness d of the gap between brushes is already much smaller than the hydrodynamic penetration length h . the latter determines the effective gap thickness where the friction remains solvent - like . the normal pressure pbrush between brushes is enhanced more than shear stress brush due to the contribution to the pressure from almost all counterions . in this interval of distances d , the friction coefficient brush is estimated assuming gaussian elasticity of polyions ( using eqs 28 and 48 ) as69decreasing as brush d upon the decrease in plate separation d ( see line with slope 4/5 in figure 5a ) . the ratio of friction coefficients70drops sharply at d h0 and weakly increases as brush/bare d with decreasing d ( see figure 5b ) . the sharp increase of the friction coefficient brush at d l indicated by the left vertical dashed line in figure 5a is associated with the interpenetration of pe chains and the appearance of polymer solution - type friction . pe brushes start to overlap in the regime of strong compressions at distances between plates d < l and the friction coefficient ( calculated using eqs 28 and 52)71is independent of the distance d between plates . the ratio of friction coefficients in this regime72varies reciprocally with spacing between plates d ( brush/bare d , see the line with slope 1 in figure 5b ) . as polyelectrolyte brushes fully interpenetrate each other at distances dn < d < d * , eqs 28 and 55 give friction coefficient73linearly proportional to plate separation ( as indicated by the solid line with slope 1 at d < d * in figure 5a ) . the ratio of friction coefficients74is independent of plate spacing d ( left horizontal line in figure 5b ) . note that uf < 1 for charge density f below manning condensation threshold and uf eff = 1 for highly charged chains with f above this threshold . therefore , the ratio of friction coefficients in this regime is greater than or on the order of unity , indicating that polyelectrolyte brushes can produce solvent - like friction at very high normal loads . at larger compressions dqn < d < dn , correlation length is governed by nonelectrostatic interactions ( eq 37 ) while the normal pressure is still determined by mobile counterions . by using eqs 28 and 57 one finds friction coefficient in this mixed subregime,75with no d - dependence in -solvent ( = 1/2 ) and decreasing as d upon further compression under good solvent conditions ( = 3/5 ) . scaling dependence for in this subregime is shown in figure 5a by the solid line with exponent ( 4 2)/(3 1 ) . the corresponding ratio of friction coefficients in this mixed regime76increases with decreasing d as indicated by the line with slope ( finally the compressed polyelectrolyte brushes behave as quasi - neutral at distances between plates d < dqn . the friction coefficient in this subregime is determined by eqs 39 and 57 as77and decreases upon compression as sketched in figure 5a by the solid line with exponent ( 4 1)/(3 1 ) . in solvent with = 1/2 , this exponent is equal to 2 while in good solvent with = 3/5 it decreases to 7/4 . the ratio of friction coefficients between a pair of quasi - neutral brushes brush and a pair of bare charged surfaces bare78decreases with decreasing d , as indicated by the line with slope /(3 1 ) in figure 5b and can become less than unity at high enough compression as long as polymer volume fraction between plates is still low . as shown in figure 5b , the brush - decorated surfaces can produce noticeably smaller friction coefficient compared to friction between bare charged surfaces . a significant drop in brush/bare is achieved for polyelectrolyte brushes in the interval of distances between plates d * < d < h0 . this range of conditions is marked by shadowed ( pink ) region in figure 5b . here , charged polymer brushes behave as better lubricants than low molecular weight liquids , while supporting much higher loads . bare sv / d and bare svlbd / kbt are shear stress and friction coefficient between bare surfaces with the same charge density e f n as polyelectrolyte brushes . note that the volume fraction of monomers cb nb / d in the compressed brushes is assumed to be much less than unity in all regimes to avoid the effect of high monomeric friction coefficient and glass transition of bulk polymers . the schematic behavior of the friction coefficient for neutral polymer brushes ( with fraction of charged monomers f = 0 ) and the same grafting density is depicted by the dotted lines in figure 5a . in contrast to polyelectrolyte brushes , neutral polymer brushes start to interact with each other at distances d hn with unperturbed brush thickness hn specified by eq 20 ( indicated by the dotted vertical line in figure 5a ) . at stronger compressions , dn * < d < hn ( with distance dn * on the order of unperturbed chain length in semidilute polymer solution with concentration n/dn * ) , neutral brushes are partially interpenetrating , and the decrease in friction coefficient in this subregime is indicated by the dotted line with slope ( 4 1)/[3(3 1 ) ] ( that is , 7/12 for = 3/5 , and 2/3 for = 1/2 ) . in the regime of full interpenetration of neutral brushes at distances d < dn * , friction coefficient is described by eq 77 and is depicted by the dotted line with slope ( 4 1)/(3 1 ) ( that is , 7/4 for = 3/5 , and 2 for v = 1/2 ) in figure 5a . as shown in figure 5a , polyelectrolyte brushes provide lower friction coefficient than neutral brushes at the same conditions ( same sliding velocity , mass per unit area , and plate separation ) except for very strong compressions with distance between plates d < dqn at which polyelectrolyte brushes exhibit quasi - neutral behavior and friction coefficients of polyelectrolyte and neutral brushes are similar . our theoretical predictions were obtained for salt - free solutions , but they are also applicable for solutions with added salt as long as salt concentration cs is lower than the concentration of counterions , ci = 2fn/d . the concentration of counterions ci in the gap between apposing brushes increases upon compression ( with the decrease of the spacing d between plates ) , and the applicability of our results expands at stronger compressions . the equations discussed above and summarized in table 1 were derived for flexible weakly charged polyelectrolytes with degree of ionization below the manning condensation threshold ( bf < lb , where f is the number of elementary charges per kuhn length b ) . if the charge density f , increases up to the value of f u both the size of electrostatic blob ( e ) , and the distance between charges along the chain ( l / fn ) approach the value of the bjerrum length ( lb ) . at higher bare charge densities f > u the manning condensation of counterions maintains the distance lb between the uncondensed charges along the polyion with the effective charge density feff u. there is no pincus regime with intermolecularly induced stretching for such strongly charged brushes with condensed counterions because osm * l ( see eqs 11 and 16 ) . in this counterion condensation regime with feff u , brush height h h0 l bnu is independent of chain grafting density ( eq 17 and 3 ) . for these brushes with condensed counterions the regime of intermediate compression with interval of distances l < d < h0 between surfaces shrinks into the crossover region between the regime of weak compression ( with d h0 l ) and the regime of strong compression ( with d < there is also no mixed subregime with interval of distances between surfaces dqn < d < dn . the two remaining crossover distances separating various subregimes in the regime of strong brush compression ( eqs 54 , 36 , and 38 ) are d * ( bnu/ ) and dn dqn bnu . by substituting the effective charge density feff u and l nbu into the corresponding equations for shear stress brush and the friction coefficient , one finds the reduced effective viscosity eff/s and the ratio of friction coefficients brush/bare for strongly charged ( f > u ) flexible polyions with electrostatic interaction parameter u = lb / b > 1 ( see table 2 ) . here bare sv / d , bare svlbd / kbt are shear stress and friction coefficient between bare surfaces with the same charge density efn as polyelectrolyte brushes . in the case of stiff chains with b > lb there is another regime with increasing charge density f preceding counterion condensation regime . if charge density f is higher than u the electrostatic blob size e becomes smaller than kuhn length b. these stiff polyelectrolyte chains are almost fully stretched with end - to - end distance approaching contour length bn but for u < f f > u counterions condense on these almost fully stretched polyions saturating the effective charge density at the manning value of one charge per bjerrum length corresponding to effective charge density f 1/u charges per kuhn length . for flexible polyelectrolytes with a typical kuhn segment length b 1.52.0 nm , the value of electrostatic parameter u = lb / b is estimated in water to be u 0.30.5 . that is , in scaling terms u = lb / b is close to unity , and many experimental systems ( e.g. , ref ( 13 ) ) are at the crossover between the scaling regimes with u 1 and u 1 . for strongly charged polyelectrolytes with condensed counterions , one can approximate this crossover region by substituting u = 1 in the equations presented in this subsection to find brush thickness h0 l bn , and two threshold spacings between surfaces d * ( bn/ ) and dn dqn bn. the subregime of quasi - neutral brush behavior is shifted to very high polymer concentrations bn/dn 1 in the gap between surfaces , and is thereby eliminated . by substituting u = 1 in table 2 above we find the reduced effective viscosity eff/s and relative friction coefficient brush/bare for the case of crossover electrostatic parameter u = lb / b 1 ( table 3 ) . here d between surfaces much larger than brush thickness bn , effective viscosities , shear stresses , and friction coefficients between pairs of apposing brushes and between pairs of bare surfaces are almost the same ( all ratios are 1 ) . upon intermediate compression with partial interpenetration between brushes ( d * < d < bn ) the enhancement of shear stress brush/bare is smaller than the enhancement of normal stress pbrush / pbare and the relative friction coefficient between brushes brush is smaller than friction coefficient between bare surfaces bare by the factor brush/bare d*/d . upon further compression ( d < d * ) friction coefficients between polyelectrolyte brushes and bare surfaces are the same , but brushes support much higher load . the scaling theory developed in this paper is applicable for brushes with relatively short polyelectrolyte chains with no entanglements at salt - free conditions and for low sliding velocities v ( linear response regime with friction stress proportional to shear rate ) . in addition to the electrostatic interactions between charged species , the model accounts for the short - range two - body and three - body monomer monomer interactions ( with scaling exponents = 3/5 and = 1/2 for good or solvent conditions , respectively ) . the simple scaling model neglects the higher order nonelectrostatic interactions between monomers and the changes in the dielectric constant and monomeric friction coefficient that become significant at higher polymer concentrations ( i.e. , at strong compressions of the brushes ) . the decrease in distance d between brush - decorated surfaces gives rise to a sequence of regimes that are characterized by different scaling dependences for friction coefficient . the full set of regimes is predicted for grafting densities of polyions < bn that are not too high . for this interval of grafting densities , at the maximum compression of brushes to the polymer volume fraction between surfaces close to unity , the distance between surfaces d is smaller than the gaussian size of the polyions . for higher grafting densities we demonstrate that enhanced lubricating properties of polyelectrolyte brushes compared to bare surfaces with equivalent surface charge density are linked to confinement of mobile counterions in the volume of pe brush in the osmotic regime . compression of apposing pe brushes with interplate distances < d < h0 leads to the increase in osmotic pressure of confined counterions , pbrush d , while bare charged surfaces experience much smaller normal force , pbare d , due to significantly lower counterion concentration outside the gouy ( lbfn ) . although shear stress brush arising upon interpenetration of sliding pe brushes is larger than the stress bare between bare charged surfaces , the friction coefficient = /p remains smaller for pe brushes due to considerably higher values of pressure pbrush pbare at interplate distances < d < h0 . this enhancement in lubrication is provided by polyelectrolyte brushes with grafting densities of polyions > ( uf ) osm . in the opposite case of very low grafting densities of polyions , osm < < ( uf ) osm , the friction coefficient between bare charged surfaces is smaller than between polyelectrolyte brushes under similar conditions ( same sliding velocity v and distance < d < h0 between surfaces ) . comparison of friction coefficient = /p for charged and neutral polymer brushes with the same mass per unit area revealed enhanced lubrication ( i.e. , smaller values of ) between pe brushes . only at strong compressions of the tethered polyions in the interval of distances d < dqn ( in the quasi - neutral regime , see table 1 and figure 5a ) do the friction coefficients for the two systems become similar . recent computer simulations , confirmed smaller values of friction coefficient for charged brushes compared to neutral systems under similar conditions . however , the simulations mostly focused on the nonlinear regime with v - dependent width of the interpenetration zone and shear stress described by the sublinear dependence on the sliding velocity v. therefore , a comprehensive comparison between the results of computer simulations as well as experiments and the predictions of our model is still missing . the corresponding simulations are currently under way and the results and comparison between simulations and theory will be presented in a future publication .

b and t lymphocytes form the adaptive arm of the immune system in jawed vertebrates and can specifically respond to an astounding number of foreign antigens . this property depends largely on a series of site - specific dna rearrangement events between separate v , d , and j gene segments at antigen receptor ( ar)-encoding loci , a process referred to as v(d)j recombination . there are seven ar loci : the immunoglobulin heavy ( igh ) and light ( ig and ig ) chain loci expressed in b cells and the t - cell receptor ( tcr ) , , , and loci expressed in t cells . for v(d)j recombination to occur , the presence of the lymphoid - specific proteins rag1 and rag2 and the ubiquitously expressed dna repair factors from the non - homologous end joining pathway is required . strict regulation of this process ensures b- or t - cell lineage specificity , dictates the temporal order of ig or tcr rearrangements , respectively , and allows allelic exclusion at certain ar genes ( for a recent review , see ) . the lineage and temporal specificities of the common v(d)j recombinase are regulated primarily at the level of chromosomal accessibility . during the past decade , ar genes have served as tractable models to study the regulation of gene expression at complex genomic loci , using gene targeting technologies in particular . these studies have notably led to a better appreciation of the hierarchical function of transcriptional cis - regulatory elements ( enhancers and germline promoters ) and their impact on the control of v(d)j recombination via the modulation of chromatin structure ( e.g. , [ 4 - 6 ] ) . within a given ar locus , enhancer- or promoter - dependent chromosomal accessibility to the v(d)j recombinase generally correlate with the presence of several epigenetic marks synonymous with euchromatin ( germline transcription [ gt ] , accessibility to endonucleases , cpg demethylation , and enrichment in active histone marks ) and the delocalisation from heterochromatic regions of the nucleus ( the pericentromeric heterochromatin and nuclear periphery ) . how these epigenetic features are achieved at the molecular level is currently the focus of intense investigation . while we know that the presence of active epigenetic marks at ar loci generally correlates with tissue- and stage - specific v(d)j recombination events , its potential role in effectively targeting the recombinase to the individual loci remains unclear ( reviewed in ) . a first insight came from studies demonstrating that the phd ( plant homeodomain ) finger of rag2 binds to histone h3 dimethylated or trimethylated at k4 ( h3k4me2/3 ) , with a preference for h3k4me3 , and is enhanced by the presence of symmetrically dimethylated h3r2 ( h3r2me2s ) [ 8 - 10 ] . more recently , lieber and colleagues reported that h3k4me3 stimulates rag - mediated cis - dna cleavage in vitro , an effect that was also achieved by simply adding h3k4me3 peptide in trans to the reaction . this supports the notion of a direct impact of epigenetic environment on the recombinase catalytic activity . the authors also observed that most common cryptic recombination signals ( rss ) known to be aberrantly used in acute t - cell leukaemia - transformed cells are located nearby h3k4me3-enriched domains in normal t cells . this could link translocation frequency at cryptic rss with the epigenetic landscape in cells undergoing v(d)j recombination . the rag2-h3k4me3 connection raised the possibility that a specific histone code may restrict v(d)j recombination in vivo . however , h3k4me3 is not confined to the ar loci , and to date no particular combination of histone marks has been exclusively associated with these loci . irrespective of these concerns , the question of how active epigenetic marks are established through the recombining gene segments and associated rss remains . one possibility could be that gt , either sense or antisense , impinges on epigenetic marking before ar assembly . ( notice that the functional significance , if any , of antisense transcription at a given ig / tcr locus or cluster [ or both ] still requires thorough investigation ; also , see . ) accordingly , suppression of gt throughout the 5 tcr - j region interferes with epigenetic marking and inhibits v-j rearrangements in this region . likewise , in an inducible pre - b cell line , gt at ig/ loci appears to precede the establishment of active epigenetic marks . in this context , targeted deletion of ar - associated enhancers generally results in reduced levels of germline transcripts and active histone marks , even though the magnitude of these effects may vary depending on the locus and , within a given locus , the particular region ( i.e. , the v versus d / j region ) . ultimately , determining the precise enhancer function in chromatin remodelling may require mutational / deletional analysis of the discrete transcription factor ( tf)-binding sites within these regulatory modules . one arm of current research aims to decipher the gene expression programs that coordinate lymphoid cell differentiation and v(d)j recombination . an outstanding example is the dissection of the signalling pathways orchestrating the transition through the pre - b - cell receptor ( pre - bcr ) checkpoint during pro - b to pre - b cell differentiation and induction of ig recombination . on the one hand , pre - bcr signalling induces the expression of the tf interferon regulatory factor 4 ( irf4 ) and activation of the ras - mek - erk phosphotyrosine kinase cascade , which in turn promotes cell cycle exit ( via repression of cyclin ccdn3 ) and modulates the expression of antagonist tfs e2a and id3 - two features known to favour ig gene assembly ( notably , e2a is a direct activator of ig transcription and recombination ) . on the other hand , il7r signalling acts , via the stat5 tf , to inhibit ig recombination , in part by blocking e2a access to the intronic ig enhancer [ 21 - 23 ] . finally , irf4 also promotes the progressive loss of il7r signalling , resulting in a full activation of ig recombination . thus , intricate pre - bcr and il7r signalling interplay regulates cell cycle exit , ig recombination , and b - cell differentiation . pioneering studies using fluorescence in situ hybridisation ( fish ) have revealed large - scale locus contraction and chromosomal looping as novel processes that may be involved in the developmental regulation of v(d)j recombination at ar loci . more recently , jhunjhunwala and colleagues used high - resolution microscopy to generate a statistical , three - dimensional ( 3d ) description of the nuclear topology of the igh locus within pre - pro- and pro - b cells . this 3d imaging revealed the existence of chromosomal domains displaying conformational changes during early b - cell development . it was suggested that the chromatin fibre , once poised for v(d)j recombination , folds into dynamic loops of variable sizes , which may depend on indeed , the dna - binding profile of ctcf throughout the igh locus , together with that of rad21 ( a component of the cohesin complex that physically and functionally interacts with ctcf ) , tends to support this assumption . intriguingly , another potential candidate , the tf pax5 , which is known to impinge on igh locus contraction and rearrangements of distal vh gene segments ( and references therein ) , may do so , at least in part , by promoting enrichment of the suppressive h3k27me3 mark at the proximal side of the vh gene cluster . fish analyses of the subnuclear organisation of ar genes have , in addition , revealed a strong correlation between gene repression and positioning at the nuclear periphery or pericentromeric heterochromatin . using an inducible system , singh and colleagues demonstrated that recruitment of a chromosomal reporter to the nuclear lamina indeed results in its physical interaction with proteins associated with the inner nuclear membrane and transcriptional repression . whether the subnuclear organisation of ig / tcr loci impacts on the initiation of allelic exclusion , a process that essentially relies on the dissociation of v - to-(d)j rearrangement between the two alleles , is a matter of debate . experimental evidence supports both a deterministic ( or instructive ) and a stochastic ( or probabilistic ) model of gene activation ( or a combination of both ) to explain this phenomenon . in the former scenario , ar alleles are believed to randomly display distinct epigenetic marking acquired during development such that , in individual cells , one will be preferentially used for initial rearrangement . instead , stochastic models argue that allele dissociation results from inter - allelic competition and , usually , a low probability of locus activation . in this context , primary fish - based studies have revealed a preferential mono - allelic association of ig loci with pericentromeric heterochomatin , suggesting that a deterministic mechanism may in this way direct the inactivation of the non - functional allele ( and references therein ) . conversely , a similar approach applied later on to the analysis of the tcr locus instead demonstrated high levels of biallelic association with the nuclear lamina or pericentromeric compartments ( or both ) , arguing for a stochastic component in allelic primary choice . in the meantime , however , re - examination of a gfp knockin mouse model long considered to provide strong evidence for probabilistic gene expression at ig alleles ( hence supporting the stochastic view for initiation of allelic exclusion at this locus ) has questioned the validity of this experimental system , thus casting doubt on prior interpretation . first , the igh and ig loci appear to frequently associate in pre - b cell nuclei . this association requires the ig 3 enhancer and contributes to the pericentromeric recruitment and decontraction of the igh locus but appears dispensable for allelic exclusion . second , the two alleles of the igh and ig loci may at some point during b - cell differentiation also be paired in a stage - specific way . this pairing would require the rag1 protein , with the resulting dna cut at one single allele then inducing the repositioning of the opposite allele toward pericentromeric chromatin , a process mediated by the dna damage response protein ataxia telangiectasia mutated ( atm ) , which could thereby prevent biallelic recombination . whether similar processes also occur at tcr alleles during t - cell development remains to be investigated . this could be relevant considering , for example , all the evidence that germline v segments adjacent to a vdj-c domain maintain a chromosomal accessible configuration following tcr feedback signalling , and yet are not subjected to recombination . little is known about the epigenetic pattern or patterns that correlate with the late , dna repair joining phase of v(d)j recombination . recombinase - generated dna double - strand breaks induce phosphorylation of the histone variant h2ax over long distances . the aforementioned involvement of atm in the nuclear positioning of ig loci also suggests a link between the regulation of v(d)j recombination and dna repair . indeed , atm appears to exhibit various effects on ar gene assembly , and additional dna repair factors may also be involved . likewise , the 53bp1 protein that functions in a subset of atm - dependent responses may also play a more specific role in long - range contraction of ar loci or the maintaining of genomic stability during their recombination ( or both ) . given all of these connections , it might also be interesting to investigate whether epigenetic marks contribute to the recruitment / spreading and activity of at least some dna repair factors at v(d)j recombination foci . new concepts require further investigation , in particular regarding their generalisation to all ig / tcr loci ( and other immune loci ) . it will be equally important to decipher the precise links between epigenetic modifications , intergenic transcription , chomosomal organisation and connection with dna - transacting machineries at these loci , and the precise mechanisms behind the establishment and enforcement of allelic exclusion . significant progress may come from the thorough characterisation of tf and nucleoprotein complexes bound at ar loci , ideally in a developmental order , using high - throughput technologies ( chromatin immunoprecipitation [ chip]-on - chip , chip - seq ) . given the complexity of these biological systems in which the molecular / cellular outcome may not at first be obvious , mathematical models and simulations could also help in connecting hypotheses with experimental observations .

head and neck cancers have a global annual incidence of about 560,000 new cases , and cause approximately 300,000 deaths per year throughout the world.1 while radical surgery is the most important treatment among the comprehensive therapies for head and neck cancers , radiotherapy has been extensively used as primary therapy , adjuvant to surgery , in conjunction with concurrent chemotherapy , or as palliative treatment for late - stage and unresectable malignancies.2 although radiotherapy has been shown to lead to an approximately 10% absolute increase in 5-year cancer - specific and overall survival,3 the patient is susceptible to side effects , including tooth decay , mucositis , dysphagia , xerostomia , dermatitis , and , worst of all , osteoradionecrosis ( orn ) of the jaw.4 orn , first described by regaud in 1922,5 is a chronic disease process with devitalization and devascularization of bone due to irradiation , and does not tend to heal spontaneously.6 obliterative endarteritis , hyperemia , hyalinization , cellular loss , hypovascularization , thrombosis , and fibrosis are common histologic findings in orn . this can lead to intolerable pain , pathologic fracture , trismus , ulceration , sequestration of devitalized bone , and fistulae , making oral feeding impossible and sometimes even leading to death.6,7 despite advances in radiotherapy technique and increased attention to predisposing factors in recent years , there is no reliable evidence showing that the incidence of orn has decreased , much less been totally eliminated.7 an investigation in a large study population of 830 patients over a period of 30 years showed that the overall incidence of orn was 8.2%,8 and a recent investigation showed that the incidence in the mandible is as high as 40% at 5 years.4 because of the relatively high associated morbidity and severe clinical symptoms , doctors have been trying to find effective methods to prevent and cure orn for decades . unfortunately , treatment remains unsatisfactory , and even the etiopathogenesis and definition of orn are still not agreed on by consensus . deeper understanding of the pathogenesis of orn would be most helpful in developing strategies for prophylaxis of orn and improve its prognosis . since orn was described , several theories have been proposed and each has led to sequential changes in treatment . the radiation , trauma , and infection theory was proposed by meyer and dannenberg in 1970.9 this theory suggested that injury provided the opportunity for invasion of oral microbiologic flora into the underlying irradiated bone , which led to orn being referred to as secondary infection after injury to devitalized bone , or as radiation - induced osteomyelitis . this theory lasted for a decade and became the foundation of antibiotic therapy for orn . however , this theory was later brought into question , in view of the failure to demonstrate bacterial invasion in compromised bone and an unsatisfactory curative effect . marx proposed the hypoxic - hypocellular - hypovascular theory as a new understanding of the pathophysiology of osteoradionecrosis.10 he concluded that orn was a complex metabolic and homeostatic deficiency in tissues created by radiation - induced cellular injury . radiation - induced hypoxia and ischemia could result in an imbalance between cell death and cell replacement , as well as between collagen degradation and synthesis , leading to a chronic nonhealing wound . this theory formed the cornerstone for the use of hyperbaric oxygen in the treatment of orn and still dominates . although many clinical guidelines mention the possibility of using hyperbaric oxygen therapy as a coadjuvant measure for treating orn in minor cases or in the early stages , its clinical value remains the subject of considerable debate.11,12 until now , no consensus has existed regarding either the mechanism of action or the effectiveness of hyperbaric oxygen in the prevention and treatment of orn . a randomized , placebo - controlled , double - blind study of hyperbaric oxygen for treating overt orn of the mandible showed no benefits of hyperbaric oxygen over placebo in recovery , and neither did it slow the progression of disease or relieve pain.13 recent papers have shown that radiogenic cellular effects on bone occur earlier than the well known vascular alterations , and there is comparable transcutaneous po2 in irradiated and nonirradiated skin , which also challenged marx s theory.14 in recent years , a new theory for the pathogenesis of orn has arisen , suggesting that orn is a radiation - induced fibroatrophic disease.15,16 cells in the radiated region are damaged as a result of acute inflammation , with free radical formation , microvascular thrombosis , chronic activation of fibroblasts by a series of growth factors , and finally , bone and tissue necrosis . according to this theory , the key event in the progression of orn is activation and dysregulation of fibroblastic activity , which leads to atrophic tissues within a previously irradiated area . apart from the nature and timing of stimuli , the pathophysiology process of orn is almost similar to fibrosis occurring in the lung , liver , vessels , or kidney , which can be induced by a number of factors , including injury , drugs , virus infections , autoimmune reactions , and alcohol . some antifibrosis medicines , eg , pentoxifylline and tocopherol ( vitamin e ) , have been used to treat orn , with dramatic results.17,18 given that radiation - induced fibroatrophy or radiation - induced fibrosis is essentially a type of fibrosis , it should share analogous pathophysiologic processes with other fibrosis diseases . it is now widely agreed that the myofibroblast is the cell type most responsible for accumulation of the interstitial matrix and the consequent structural deformations associated with fibrosis.19 myofibroblasts have been identified in few normal tissues , and their function in normal tissues has been little explored . on the other hand , it has been confirmed that the myofibroblast plays a pivotal role in pathologic tissues , including hypertrophic scarring , fibromatosis , fibrocontractive diseases , and the stromal reaction to epithelial tumors.20 myofibroblasts can be derived from heterogeneous origins and activated by biological and mechanical stimuli . once activated , the myofibroblast acquires a phenotype characterized by excessive production of collagenous extracellular matrix and tensile force , which endows on itself a critical role in resolution of inflammation and scar formation during wound healing to maintain tissue integrity.19,20 in normal conditions , when stimulating factors have gone , the myofibroblast will disappear during extensive apoptosis at the end of tissue repair and remodeling . however , in the development of hypertrophic scars and other fibrotic diseases , myofibroblasts acquire a capacity for uninterrupted accumulation and persistent excess production of extracellular matrix and tensile force.2123 this phenomenon has been investigated extensively , and lack of apoptosis by myofibroblasts has now been suggested as the most likely mechanism for fibrogenesis in the liver , lung , and kidney , as well as during atheromatous plaque formation , which eventually result in complete loss of organ function.19,24 although some researchers have been investigating the function of myofibroblasts in radiation fibrosis , the evidence for the myofibroblast being key in the pathogenesis of radiation fibrosis are few and obscure . further , no literature has been published about the relationship between myofibroblasts and orn as yet . could myofibroblasts be the main effector cells in orn , like in other fibrosis diseases ? this paper focuses on this issue and attempts to establish a novel hypothesis regarding the role of the myofibroblast in the development of orn and tries to clarify the possible pathophysiologic mechanism . we propose the hypothesis that the myofibroblast is the key effector cell in the pathogenesis of orn , as with fibrosis in other organs . orn should not be regarded as radiation fibrosis being only involved with bone , but also with all other tissues in the radiated area , including skin , vessels , and muscles . myofibroblasts may derive from resident fibroblasts , epithelial cells , endothelial cells , smooth muscle cells , and bone marrow cells in the irradiated region . myofibroblasts can also become resistant to apoptosis , which enables their uninterrupted accumulation and long - term existence . with high rates of proliferation , excess secretion of extracellular matrix protein , and increased tensile force , the balance between synthesis and degradation is destroyed in irradiated tissues , resulting in a reduction in the bony matrix and its replacement with fibrous tissues . ultimately , even decades after radiotherapy , these irradiated areas remain fragile , and are still subject to late physicochemical stimuli , so have a tendency to develop orn . the myofibroblast , which has a spindle or stellate shape , as well as contractile , secretory , and macrophage properties , is not a typical component of normal tissues , and can only be found in granulation tissue , non - neoplastic fibrosing conditions , and tumor stroma.25 the myofibroblast is essentially a reactive cell , which means it can be differentiated by its heterogeneous origins , depending on the physiologic or pathologic situation . these precursors in fibrosis include local fibroblasts , epithelial cells , endothelial cells , smooth muscle cells , pericytes , hepatic perisinusoidal cells or stellate cells , as well as bone marrow - derived cells.19,25 local fibroblasts are believed to represent the major source of myofibroblasts in most situations.20 the role of epithelial mesenchymal transition and its specific form of endothelial - mesenchymal transition have been demonstrated to exist and to contribute to progression of cardiac , lung , liver , and corneal fibrosis.26,27 pericytes and smooth muscle cells from the vasculature have also been found to serve as myofibroblast progenitors and have been suggested to contribute to fibrosis in scleroderma , atherosclerosis , and radiation - induced fibrosis of the gastrointestinal tract.21,28 in addition , bone marrow - derived cells known as fibrocytes have been suggested to represent an alternative source of myofibroblasts during skin wound healing and in liver , lung , and kidney fibrosis , as well as in the stromal reaction to epithelial tumors.29 except for some specific cell types , such as hepatic stellate cells or alveolar septal cells , most of the potential progenitor cells mentioned above exist in the maxillofacial region , which provides cytologic evidence for differentiation of myofibroblasts in orn . the differentiation of myofibroblasts is a key event in the pathogenesis of fibrosis , but the underlying mechanism is complex . it has been demonstrated that inflammation accompanies most fibrotic states and plays an initiating role . under the influence of numerous growth factors , cytokines , hormones released by inflammatory and other cell types , precursor cells are activated and differentiate into myofibroblasts.30 it is likely that the heterogeneity of myofibroblast origin requires specific factors and specific mechanical conditions in each situation , but regardless , transforming growth factor - beta 1 ( tgf-1 ) , which is produced by a wide range of inflammatory , endothelial , and epithelial cell types , is the principal growth factor responsible for differentiation of myofibroblasts . tgf-1 activates progenitors by binding and activating specific plasma membrane receptors , and by activating its downstream target signal , connective tissue growth factor , to promote differentiation and proliferation of myofibroblasts.20 in addition to tgf-1 , other cytokines such as interleukin-13 , interleukin-4 , basic fibroblast growth factor , and platelet - derived growth factor , also help in this process and sustain fibrogenesis.31,32 apart from inflammation and inflammatory cytokines , there are other factors inducing myofibroblast differentiation in fibrosis . microvascular injury is regarded as the prominent profibrogenesis factor in systemic sclerosis and diabetic nephropathy.28,33 in these diseases , damage to vascular endothelium by autoantibodies stimulates the release of chemokines and other factors , including endothelin-1 , platelet - derived growth factor , basic fibroblast growth factor , and vascular endothelial growth factor , which cause the vessel wall to become more permeable and promote recruitment and proliferation of inflammatory cells and differentiation into myofibroblasts . hypoxia secondary to microvascular damage is also regarded as a possible mechanism of fibrosis in human interstitial renal tubular fibrosis.34 excess reactive oxygen species ( ros ) and oxidative stress are postulated to play roles in the initiation and perpetuation of a wide range of fibrotic diseases , including atherosclerosis , cardiac fibrosis , idiopathic lung fibrosis , and systemic sclerosis . ros can upregulate the expression of several fibrogenic genes by activating hypoxia - inducible factor 1 alpha and release - activated tgf-1 from extracellular reservoirs by ros - mediated oxidation of a methionine residue in the latency - associated protein.35 in fibrosis associated with a prominent adaptive immune response , ros is believed to direct the differentiation of cd4 + t cells towards the thy-2 lymphocyte phenotype , which is characterized by release of strongly profibrotic cytokines , ie , interleukin-4 and interleukin-13.36 high levels of ros oxidize the phagocytosed lipid and stimulate fibrogenic cytokines inducing some progenitor cells , eg , smooth muscle cells in atherosclerosis , to undergo differentiation or transition to myofibroblasts . however , research on radiation - induced fibrosis in the skin , lung , and rectum has revealed some pathophysiologic characteristics . after radiation , immediate oxidative damage to dna , proteins , and lipids are the initiating chemical events which lead to cell injury or death , and the acute inflammatory responses in the endothelium are proposed as important determinants of radiation fibrosis.37 chemokines , which are released in response to radiation injury , attract leukocytes to the site of injury , thereby triggering an inflammatory response , and generate further release of multiple cytokines , including tumor necrosis factor alpha , platelet - derived growth factor , basic fibroblast growth factor , interleukin-1 , interleukin-4 , interleukin-6 , tgf-1 , and , more recently identified , connective tissue growth factor . according to the immunocytochemical report by canney and dean,38 tgf-1 is considered to be the main cytokine involved in radiation - induced fibrosis . another confirmed important factor in the development of radiation - induced fibrosis is ros , with its function of profibrosis . ros can release activated tgf-1 from extracellular reservoirs and other cytokines , resulting in unregulated fibroblastic activation and persistence of the myofibroblast phenotype.35 it is well known that radiation can lead to vascular injury , which is a prominent feature of radiation injury and a possible primary pathogenic signal that precedes fibrosis . the vascular injury includes epithelial cell injury and loss of this as a natural barrier , thrombosis and microvascular atrophy , and luminal stenosis of the large vessels , may lead to necrosis of the microvessels , local ischemia , and secondary hypoxia . it has been verified that changes in the permeability of the vessel wall and hypoxia could promote release of a series of cytokines and activation of myofibroblasts , possibly by activated hypoxia - inducible factor 1 alpha and tgf-1 pathways.37,39 compared with normal fibrosis , the pathophysiologic processes of orn , although not quite clear yet , are very similar . pathologic events , including the inflammatory reaction , release of multiple cytokines , in particular tgf-1 , injury to the vasculature and secondary hypoxia , and ros or oxidative stress , commonly exist and are believed to function as profibrogenesis factors . the myofibroblast is essential for the integrity of the mammalian body by virtue of its role in wound - healing.20 under normal conditions , myofibroblasts play an essential role in the resolution of inflammation and scar formation . after recovery from injury , myofibroblasts subsequently disappear by apoptosis from the injured site to maintain tissue homeostasis . when the apoptotic mechanism fails , prolonged formation and accumulation of extracellular matrix lead to such conditions as hypertrophic scar and keloid or fibrosis in different organs.25 resistance of myofibroblasts to apoptosis has been demonstrated in systemic sclerosis , idiopathic pulmonary fibrosis , and liver fibrosis , and shown to be the main mechanism of fibrogenesis . in radiation - induced fibrosis , myofibroblasts have also been found to be persistent during the constitutive fibrotic phase and to correspond with the histopathologic description of hypercellularized fibrosis areas and with the clinical observation of radiation - induced fibrous swelling.39 there has been no clear evidence indicating that myofibroblasts in orn can resist apoptosis until now , but in view of the theory of radiation - induced fibrosis , we have reason to believe that the fate of myofibroblasts in orn has much in common with other types of fibrosis . how myofibroblasts obtain this capability is not fully clear , and some hypotheses have been proposed when trying to explore the underlying mechanism . an ability of myofibroblasts to evade immune surveillance is one of them , and has been investigated extensively . some recent experiments have indicated that myofibroblasts possess the ability to not only evade death but also actively promote apoptosis of t lymphocytes via the fas / fasl pathway , which allows them to escape immune surveillance , resulting in organ fibrosis such as sclerosis or lung fibrosis.40 could these findings be transferred to orn ? certainly , the possible mechanism needs to be studied further . since 2004 , pentoxifylline and tocopherol have been shown to be effective in treating radiation tissue injury and established orn.17 pentoxifylline can exert an antitumor necrosis factor alpha effect , increase erythrocyte flexibility , and inhibit inflammatory reactions and production of extracellular matrix . vitamin e can scavenge reactive oxygen species , as well as inhibit tgf-1 and expression of procollagen genes . interestingly , pentoxifylline and tocopherol have both been shown to be able to induce apoptosis of malignant cells . pentoxifylline can trigger a series of events leading to apoptosis in cutaneous t cell lymphoma cells by upregulating expression of fas and trail , and by enhancing fasl - mediated killing in t cell lymphoma.41 specific forms of tocopherol display potent apoptotic activity against a wide range of cancer cell types , while having little or no effect on normal cell function or viability.42 it is also well known that evasion of immune surveillance is a classic mechanism of tumor formation in cancer cells , which have been shown to resist fas - induced apoptosis . possibly , this is also evidence that myofibroblasts in orn can resist apoptosis and perpetuate themselves by evasion of immune surveillance , like cancer cells . our hypothesis indicates that myofibroblasts and their resistance to apoptosis might be the main pathophysiologic mechanism in orn . these myofibroblasts could be isolated from zones of fibrosis in patients with orn and be cultivated by primary cell culture . further , given that there is a risk of poor wound healing if surgery is performed in patients with orn , established animal models of orn could be used for isolation , cultivation , and identification of myofibroblasts.43 morphologic observation and immunohistochemical examination of distinctive proteins , such as -smooth muscle actin , vimentin , and eda cellular fibronectin , are the main techniques for identification of myofibroblasts . myofibroblasts isolated and cultured from patients with orn or animal models of orn could be used to determine if decreased apoptosis occurs . if this is the case , further studies should be undertaken to clarify the underlying mechanism . the proapoptotic pathway for myofibroblasts should also be investigated in animal models of orn to determine if there is a possibility for prevention or reversal of orn , which could further strengthen our hypothesis and identify a potential treatment for orn . some strategies have been developed to increase apoptosis of myofibroblasts experimentally and been shown to have an effect of antifibrogenesis in liver and lung fibrosis and in scleroderma.4446 these strategies include specific delivery of apoptosis - inducing drugs ( eg , single - chain antibody to an extracellular domain of a myofibroblast membrane protein ) , using protein kinase inhibitors ( phosphatidylinositol 3-kinase or focal adhesion kinase ) as specific inducers of apoptosis in myofibroblasts , and some cytokines ( eg , hepatocyte growth factor ) . orn is a devastating complication of radiotherapy after treatment of head and neck cancer . while predisposing factors are clearly evident , the pathophysiologic process of osteoradionecrosis is still not clarified completely , and there is ongoing debate regarding the best treatment . based on recent advances in cellular and molecular biology , a new theory of radiation - induced fibroatrophy has been developed . we have focused on the myofibroblast , which exists in all types of fibrosis and is widely assumed to be the key effector cell involved in development of orn . activation of the myofibroblast and its defective apoptosis might be the overriding factor in the pathogenesis of orn . ours is a novel explanation for the pathogenesis of orn , and if confirmed , might create an opportunity to establish a noninvasive prediction system with the cytologic characteristics of myofibroblasts , and could even create a reliable method to evaluate the risk of orn , monitor its development , and evaluate the effects of therapeutic agents . this novel hypothesis could also create an opportunity to develop a therapeutic protocol for orn . some strategies have been proposed for the prevention and treatment of fibrosis , but depend on a deeper understanding of the pathophysiological mechanism of fibrosis . however , there are a multitude of pathways ranging from the initial pathologic stimulus to abnormal collagen synthesis , offering a bewildering range of therapeutic targets , and possibly with uncertain therapeutic effects . antibodies against tgf-1 have long been shown to reduce bleomycin - induced lung fibrosis in mice,47 but a randomized clinical trial of recombinant human tgf-1 antibody ( cat-192 ) in patients has failed to demonstrate any therapeutic effect on human fibrosis so far , and has had adverse effects.48 this reflects the pleiotropic effects of tgf-1 on a wide range of cell types , and the complex interactions between different cytokines , which have made tgf-1-targeted therapy difficult . in addition , orn is usually diagnosed when tissue destruction is well underway , and it is likely that future therapies would need to target an established resident myofibroblast population . therefore , inducing disappearance of myofibroblasts by stimulating them to enter the apoptosis pathway may be a promising therapeutic strategy in orn . moreover , proapoptotic therapy in orn might have the potential benefit of preventing tumor recurrence , but this needs further investigation . in summary , the present hypothesis reflects a novel view of the pathophysiologic mechanism of orn , and further research on this hypothesis will help us to gain an insight into the pathogenesis of orn , and could pave the way for more effective therapy in the future .

it can be caused by posture induced common peroneal nerve ( cpn ) palsy , a kind of peripheral nerve entrapment syndrome common in asian culture as a result of sitting preferences . peroneal nerve innervates muscle groups related to ankle motion while walking , and patients have difficulties in normal gait if injured . as the clinical symptoms presented by peroneal nerve palsy are similar to that of discogenic foot drop , it is easy to misdiagnose , and may occasionally lead to unnecessary evaluations and treatments . although several studies concerning peroneal nerve injury related with surgery , trauma , and tumor have been reported3 ) , it is difficult to find clinical reports on posture induced peroneal nerve palsy , which is common in asian culture . this study will explain the clinical characteristics of peroneal nerve palsy patients developed after maintaining a certain posture for a long time and will stipulate several important differentiation points for making a diagnosis in review of the literature . from june 2008 to june 2012 , a retrospective study examined the records of 35 patients diagnosed with peroneal nerve palsy in neurophysiologic study among patients experiencing foot drop after maintaining a certain posture for a long time . the information on individual clinical characters , such as motor and sensory presentations , related postures , period and pattern of clinical improvement , muscle strength assessments , such as ankle dorsiflexion ( akdf ) , big toe dorsiflexion ( btdf ) , and ankle eversion , were retrieved from medical records with a follow - up period of a minimum of 3 months to 36 months . nine patients were excluded due to improper medical records ; as such , 26 patients were enrolled in this study . this study was confirmed with hallym university institutional review board , # 2012 - 71 . the median age at diagnosis was 54 years ( range , 22 - 76 years ) . affected legs were on the right leg for 11 patients , left 14 patients and bilateral legs for 1 patient . the inducing postures were squatting ( 14 patients ) , sitting cross - legged ( 6 patients ) , lying down ( 4 patients ) , walking for 4 hours ( 1 patient ) and driving for 2 hours ( 1 patient ) . the peroneal nerve was affected by maintaining the same posture for an average of 124.2 minutes . all patients visited the hospital for foot drop , but sensory deficit was observed in the dorsum of the foot , lateral side of the affected leg through physical examination . except for 4 patients that slept in a drunken state , 22 patients preferentially experienced sensory disturbance ( tingling sensation 63% , numbness 27% , burning sensation 10% ) in the affected leg , while maintaining the same posture before experiencing a foot drop . although these areas were related with sensory dermatome innervated by cpn or its branches , the affected areas complained by 14 patients ( 53% ) included in the knee or the lower part of the thigh . the muscle tones of akdf , btdf , and foot eversion were evaluated using medical research council ( mrc ) scale for muscle strength and the mean mrc grade 3/5 on akdf and btdf , 2/5 on foot eversion were observed . delayed sensory conduction velocity of cpn was observed in 24 patients , deep peroneal nerve in 2 patients . the mean motor conduction velocities of affected cpn were 41.13 ( m / sec ) on the right side and 42.26 ( m / sec ) on the left side ( normal reference : 33 - 53 m / sec ) . only one patient was observed with a severe delayed motor conduction velocity , 20.50 ( m / sec ) . sixteen patients showed clinical improvement within 4 weeks , 6 patients during 4 to 6 weeks , and 4 patients improved late , after 12 weeks . when examined at 12 months , 20 patients had fully recovered , whereas 6 patients still had motor deficit and sensory disturbance . the period of clinical improvement was not related to the time in which patients maintained a posture that affected peroneal nerve . the inducing postures were squatting ( 14 patients ) , sitting cross - legged ( 6 patients ) , lying down ( 4 patients ) , walking for 4 hours ( 1 patient ) and driving for 2 hours ( 1 patient ) . the peroneal nerve was affected by maintaining the same posture for an average of 124.2 minutes . all patients visited the hospital for foot drop , but sensory deficit was observed in the dorsum of the foot , lateral side of the affected leg through physical examination . except for 4 patients that slept in a drunken state , 22 patients preferentially experienced sensory disturbance ( tingling sensation 63% , numbness 27% , burning sensation 10% ) in the affected leg , while maintaining the same posture before experiencing a foot drop . although these areas were related with sensory dermatome innervated by cpn or its branches , the affected areas complained by 14 patients ( 53% ) included in the knee or the lower part of the thigh . the muscle tones of akdf , btdf , and foot eversion were evaluated using medical research council ( mrc ) scale for muscle strength and the mean mrc grade 3/5 on akdf and btdf , 2/5 on foot eversion were observed . delayed sensory conduction velocity of cpn was observed in 24 patients , deep peroneal nerve in 2 patients . the mean motor conduction velocities of affected cpn were 41.13 ( m / sec ) on the right side and 42.26 ( m / sec ) on the left side ( normal reference : 33 - 53 m / sec ) . only one patient was observed with a severe delayed motor conduction velocity , 20.50 ( m / sec ) . sixteen patients showed clinical improvement within 4 weeks , 6 patients during 4 to 6 weeks , and 4 patients improved late , after 12 weeks . when examined at 12 months , 20 patients had fully recovered , whereas 6 patients still had motor deficit and sensory disturbance . the period of clinical improvement was not related to the time in which patients maintained a posture that affected peroneal nerve . posture induced cpn palsy is a nerve entrapment syndrome presented as a foot drop after maintaining certain positions , such as squatting , kneeling or habitual leg crossing while seated in asian culture . as unique cultural specificity , the previous reports about cpn palsy have been restricted to mechanical direct injuries , like as laceration , fracture , and surgery , and there are few reports on the etiology or clinical characteristics of posture induced cpn palsy . patient history and neurological examination area are the most important initial clinical approach to reach a diagnosis of suspected peroneal neuropathy . hematologic and metabolic condition studies may give some clue regarding the risk factors like diabetes mellitus , hyperthyroidism , polyarteritis nodosa , and alcoholic polyneuropathy . although an accurate misdiagnosis rate has not been reported , baima has reported that ankle inversion by tibialis posterior muscle showed ankle dorsiflexion , making it difficult to discriminate from foot drop caused by peroneal nerve palsy3 ) . in this study , 5 out of 26 patients received a lumbar mri examination . the examination was performed not because of difficulties in diagnosis , but to check the possibility of acute herniated lumbar disc as these patients were treated with radiculopathy prior to foot drop . there are several clinical pitfalls that make differentiation from discogenic foot drop difficult . first , in their first visit patients that experienced back pain and paresthesia of the affected lower extremity in the past explained that they were treated for herniated lumbar disc and had visited the hospital once again due to worsened herniated lumbar disc symptoms . this prevented clinicians from having enough time to conduct history taking and make an accurate diagnosis , leading to inappropriate evaluations and unnecessary treatments . second , as the referred pain by cpn can be formed from the knee and the lateral thigh to the dorsum of the foot , patients can describe referred pain as radiculopathy flowed from the above and complain of paresthesia and sensory deficit . clinicians accustomed to referred pain related to discogenic radiculopathy can mistake the symptoms for herniated lumbar disc . third , in some clinical aspects , complete palsy of cpn caused by direct injury can be seen as the only foot drop that is not always accompanied by sensory disturbance and can easily be diagnosed . however , in cases of posture induced cpn palsy with sensory deficit , caused by ischemia due to compression or stretching after maintaining posture8,12 ) , humphreys et al.6 ) reported that sensory disturbances were identified in 92% on cpn palsy patients , incomplete information that cpn is a pure motor nerve that may lead to misdiagnosis . the problem in our patients developed with sensory disturbance in the affected legs before foot drop , except for the four drunken patients with deep sleep . thus , sensory neurologic change should be checked from the onset time to the end of treatment , and the first symptom of sensory disturbance is not implicated only as a discogenic radiculopathy . although studies of clinical characteristics or physical examinations may be helpful for determining posture induced cpn palsy , they have not been reported , and several reports will be reviewed in relation to this study . as the gluteus muscle is mostly innervated by the lumbosacral plexus , assessment of hip abductor muscle strength in foot drop patients is useful in differentiating cpn palsy and lumbar radiculopathy , with 85.7% sensitivity and 96.4% specificity7 ) . the author also believes that as ankle foot motion is variable or patients are not accustomed to specific ankle motions , such as ankle inversion or eversion , it is useful to evaluate the strength of muscles that cpn does not innervate . a diminished hip abductor muscle tone can be simultaneously observed in patients with lumbar disc herniation that can induce a foot drop . a similar method tests non - evoked pain in straight leg raising test of the affected leg , meaning the possibility of discogenic foot drop is low . tinel 's sign is an examination to detect an injured nerve by tapping over the fibro - osseous tunnel to induce a sensory disturbance along distribution of the nerve . if the cpns are entrapped or irritated , tapping over the fibro - osseous tunnel will trigger pain or sensory presentation in peroneal nerve distribution . as with other entrapment syndromes , although understanding the clinical characteristics mentioned above helps differentiate discogenic foot drop and cpn palsy , the most important part of a diagnosis is careful , complete history taking and gathering information on symptoms after maintaining a certain posture or engaging in certain activities . also , it is important to inspect trauma history and check bruising or skin changes , such as ulcer or inflammation in the affected legs of patients . neurophysiologic evaluations can decide confirm diagnosis , establish the site of injury , assess the nerve damage , predict the prognosis8,10,12 ) . in most cases of peroneal nerve palsy induced by posture , hence , although a peroneal motor nerve conduction study ( ncs ) should be performed first , recording from the extensor digitorum brevis ( edb ) muscle , the superficial peroneal sensory nerve action potential ( snap ) is important to help differentiate l5 radiculopathy . the abnormality of snap implies that the lesion is distal to the dorsal root ganglion . in case of demyelination , however , recovery from the axonal injury requires many months or may be incomplete8 ) . this study found symptoms improved within 4 weeks for 61% of our patients and after 12 weeks for 16% . according to aprile et al.2 ) , good recovery was achieved from 3 - 18 months for 36 peroneal nerve palsy patients , excluding 2 chronic alcoholics . in another study that classified 34 patients into 4 groups according to motor nerve conduction velocity results4 ) , all 13 patients over 30 m / sec velocity by the initial neurophysiologic study achieved good recovery for over a year , whereas most of the patients below 30 m / sec were improved to moderate or poor recovery with gait discomfort . generally , medications without surgical decompression are primary treatment methods , since most patients experience spontaneous recovery within 3 months . however , not all patients have clinical improvements spontaneously , and some patients have permanent walking disability . in practice , posture induced cpn palsy patients tend to undergo passive treatments and waiting by clinicians due to a benign prognosis . in another clinical study4 ) , 2 out of 14 patients ( 14% ) were in the poor recovery group , and in this study , 4 patients ( 15% ) have difficulty in walking at 2 years follow - up . for this reason , close observation for detecting clinical recovery is important , and more favorable results will be experienced by patients through regular neurophysiologic study and peroneal distribution mrc grade check up to perform surgical decompression1,5,11 ) . a study on the clinical outcomes after fibrous - osseous tunnel decompression found that if clinical improvement is not achieved within 12 months , early decompression surgery will bring improved muscle strength and good prognosis in sensory recovery . improved motor strength was reported in 74% , with an odds ratio at 14.7 ( 95% ci , 1.4 - 133.5 ) , although the sample group only consisted of 22 patients . sensory improvement was reported in 68% and complete sensory improvement was achieved in 47%11 ) . as mentioned earlier , changes in clinical symptoms and improvement of neurophysiologic study are important in determining the prognosis of patients . in another surgical outcome study6 ) , the author performed cpn decompressions for 51 cpn palsy patients by trauma , previous surgery , no identifiable causes irrelevant to clinical injured period . postoperatively , 85% patients had motor improvement ( p<0.01 ) and 48% patients had sensory improvement ( p<0.01 ) with 61% pain relief . in addition , there were no patients with motor and sensory function downgraded after surgery . we suggest that although observation is the primary treatment method , as full recovery is always not achieved at follow up six months or later , it is necessary to consider the surgical treatments by repeated neurophysiologic evaluation at the regular interval3 ) . there were no prospective or retrospective studies on clinical results from early cpn decompression in only posture induced cpn palsy groups . therefore , a clinical study on surgical outcome must be conducted . in another surgical outcome study6 ) , the author performed cpn decompressions for 51 cpn palsy patients by trauma , previous surgery , no identifiable causes irrelevant to clinical injured period . postoperatively , 85% patients had motor improvement ( p<0.01 ) and 48% patients had sensory improvement ( p<0.01 ) with 61% pain relief . reduced muscle strength makes it impossible to maintain normal walking balance , and patients can maintain normal gaiting posture by wearing an ankle foot orthosis ( afo ) to prevent passive foot plantar flexion and contraction of the ankle joint . therefore , a clinician might recommend this brace for foot drop patients as early as possible . recently , the peroneal nerve stimulator was developed in foot drop patients to be clinically used to stimulate and contract muscles innervated by peroneal nerves according to the walking posture of patients13 ) . however , while this device is effective in cases of preserved peroneal nerve function , such as stroke or spinal cord injury , it is ineffective in patients with damaged peroneal nerve function . posture induced peroneal nerve palsy is an entrapment syndrome that is encountered in the seating habits of the asian culture . we suggest that awareness of this clinical characteristics and diagnostic assessment methods ( table 2 ) may help clinicians make a diagnosis of posture induced cpn palsy and preclude unnecessary studies or inappropriate treatment in foot drop patients .

similarly to its human ortholog , docrl associates with the membrane of several class of endosomes . docrl insures that ptdins(4,5)p2 pools are principally restricted at the plasma membrane by dephosphorylating this phosphoinositide on endomembranes . when docrl is knocked - down by rnai , drosophila cells in culture abnormally accumulate ptdins(4,5)p2 at the surface of giant endocytic vacuoles . interestingly , it has been recently reported that ocrl1 also regulates ptdins(4,5)p2 levels on endosomes of human cells . similarly to what we observed in drosophila , hela cells rnai - depleted for ocrl1 , present abnormal , enlarged endosomes enriched in ptdins(4,5)p2 . therefore , regulation of ptdins(4,5)p2 homeostasis and control of endosomal morphology by ocrl proteins is a general mechanism conserved across evolution . in addition , the function of ocrl proteins in the establishment of ptdins(4,5)p2 homeostasis is likely to participate to the underlying causes of the lowe syndrome since cells from patient suffering from this disease have been shown to present elevated levels of ptdins(4,5)p2 . we established that docrl does not preferentially associate with one specific endosomal compartment , and is found at the surface of early , late and recycling endosomes . however , two - hybrid experiments have revealed that its human ortholog , ocrl1 , interacts with 16 members of the rab protein family , which regulate membrane trafficking . furthermore , it has been shown that rab5 and rab6 directly stimulate the inositol 5-phosphatase activity of ocrl1 . therefore , it is tempting to speculate that rab proteins regulate ocrl proteins recruitment at the surface of endosomes to control homeostasis of ptdins(4,5)p2 . inactivation of ocrl proteins in drosophila and in human , leads to a strong disorganization of the endocytic compartments with the apparition of enlarged endosomes . in drosophila , these large endocytic vacuoles appear to be the result of an unregulated fusion of early , late and recycling endosomes . the molecular explanation of this defect is still unclear but our observations suggest that the abnormal accumulation of ptdins(4,5)p2 on endocytic compartments , disrupt the phosphoinositide signature of each family of endosomes and trigger homotypic fusion of these undefined endosomes . we found that when docrl is depleted by dsrna , up to 40% of drosophila cells fails cytokinesis and become multinucleated . this cytokinesis failure is characterized by an abortive cleavage furrow that still forms but regresses rapidly and does not successively separate the two daughter cells . this phenotype is directly linked to the deregulation of ptdins(4,5)p2 homeostasis : during cytokinesis , the abnormal accumulation of ptdins(4,5)p2 on endomembrane mis - targets essential components of the cytokinetic ring such as rhoa , actin , myosin and anillin . these components are recruited on endomembranes , at the expense of the cleavage furrow , and can not establish a stable , efficient , cortical cytokinetic ring . these observations brought into light the essential role of ptdins(4,5)p2 as one of the major spatial cue that secures cleavage furrow positioning and stability during cytokinesis . rnai depletion of ocrl1 in human cells delays abscission of the intercellular bridge connecting the two daughter cells after cytokinesis . in human cells , rab35 recruit ocrl1 at the intercellular bridge where it locally dephosphorylates ptdins(4,5)p2 and modifies lipid and actin composition . this remodeling of the intercellular bridge was proved to be necessary to the subsequent step of abscission . accordingly , intercellular bridge of cells from lowe syndrome patient show an abnormal accumulation of ptdins(4,5)p2 and actin that delays cell abscission . while ocrl proteins are important for cytokinesis in drosophila and in mammals , their inactivation does not trigger similar cell division defects . one possible explanation is that human cells also express inpp5b that could partially substitute for ocrl1 function during cell division . interestingly , we have found that human inpp5b could partially rescue docrl function during cytokinesis in drosophila cells ( unpublished results ) . these two studies have identified a novel and unexpected role of ocrl proteins during cell division . drosophila which expresses only one ortholog of ocrl1 appears as a powerful and promising model to further dissect in vivo the different functions of proteins of the ocrl family .

heart failure ( hf ) is a major health problem for many developed world populations and has a relatively poor prognosis . within the us population , the incidence approaches 1% , with a lifetime risk of 1 in 5 for both men and women at the age of 40 years . in 2005 , there was an estimated near 1.1 million admissions to american hospitals associated with hf , which was up from approximately 400,000 in 1979 . this substantial increase in prevalence and hospitalisation meant an epidemic was declared [ 3 , 4 ] . over the coming years , the prevalence is likely to increase due to changing lifestyles and diets of the developing world , advances in heart failure therapeutics , an increase in prevalence of conditions which have cardiovascular consequences such as obesity and diabetes , and better survival from other heart conditions where hf is the end stage especially with the increased use of primary angioplasty for myocardial infarction . figures from the united states show an estimated bill totalling $ 39.2 billion in 2010 , to cover the direct and indirect cost of hf . one in 8 death certificates in america mentioned hf , and in 20% of cases , it was the primary cause . in 2006 , five - year mortality is 4560% , and hospitalisations increased in the months prior to their death ; moreover , after the first hospitalisation , the 5-year mortality was greater than 75% . this deadly syndrome , where the renin - angiotensin - aldosterone system ( raas ) is of great importance , is characterised by dyspnoea , venous congestion , and oedema , the consequences of anatomical and functional defects within the heart . this bioactive endogenous heptapeptide is taking increasing amounts of interest from investigators because of its potential as a therapeutic agent . angiotensin-(1 - 7 ) ( ang-(1 - 7 ) ) is becoming recognised as an increasingly important player of the raas where accumulating evidence suggests that it may have a key role in the regulation and homeostasis of the raas , exerting cardiovascular protection . ang-(1 - 7 ) is different from angiotensin ii due to the absence of an amino acid at position 8 , described as the most pleiotropic metabolite of angiotensin i ( ang i ) , and is known to have actions which on most occasions are opposite ( but may be identical ) of those known for angiotensin ii ( ang ii ) [ 9 , 10 ] . many effects of ang-(1 - 7 ) are mediated via the high - affinity g protein - coupled receptor mas , where ang-(1 - 7 ) is an endogenous ligand . endopeptidases ( such as neutral endopeptidase ( nep ) ) and angiotensin - converting enzyme-2 ( ace2 ) contribute to the alternative pathways of ang-(1 - 7 ) generation , using the substrates angiotensin i ( ang i ) and angiotensin ii ( ang ii ) , respectively [ 1214 ] , whereas it has been shown that ang-(1 - 7 ) is degraded to angiotensin- 1 - 5 ( ang-(1 - 5 ) ) by angiotensin - converting enzyme ( ace ) . in contrast , ace has also been shown to generate ang-(1 - 7 ) from angiotensin-(1 - 9 ) . ang-(1 - 7 ) studies have shown that it is a potential endogenous counterregulator of the raas cascade [ 15 , 17 ] . physiological concentration of ang-(1 - 7 ) in man is thought to be 10 pmol / l [ 18 , 19 ] . in 1988 , schiavone et al . suggested that ang-(1 - 7 ) peptide was indeed biologically active , raising the possibility of potential benefits of ang-(1 - 7 ) . there has been an abundance of animal studies investigating the effects of ang-(1 - 7 ) in a variety of environments . angiotensin converting enzyme inhibitors are commonly seen in the management plan of hf ; one reason is to reduce arterial pressure and to reduce the levels of ang ii . it does so by various postulated mechanisms such as releasing nitric oxide ( no ) and prostaglandins [ 2225 ] . both brosnihan et al . and porsti et al . , by administering no synthase inhibitors , suggested that the vasodilatory effect of ang-(1 - 7 ) may be at least partly dependent on the release of no . 's work would suggest that ang-(1 - 7 ) might oppose the haemodynamic actions of ang ii . another peptide contributing to the vasodilatory effects of ang-(1 - 7 ) is bradykinin ( bk ) , a molecule ang-(1 - 7 ) is shown to interact with . paula and colleagues suggested that ang-(1 - 7 ) potentiates the hypotensive effect of bradykinin in vivo and prostaglandins may participate in the mechanism of potentiation by ang-(1 - 7 ) . . the objective of this systematic review will be to discuss human studies on the beneficial effects of angiotensin-(1 - 7 ) focusing on patients with heart failure . the following electronic databases were searched : pubmed , embase , and cochrane . in addition , conference proceedings and reference lists of all included studies were scanned to identify additionally potentially relevant studies . there were no start year restrictions , but the studies examined were restricted to english language reports . two reviewers screened the titles ( and abstracts if available ) of all reports identified by the search strategy . full copies of potentially relevant reports were obtained , studied , and assessed for inclusion . figure 1 helps the reader appreciate the close relationship between angiotensin-(1 - 7 ) and angiotensin ii . the main finding of this systematic review is that ang-(1 - 7 ) plays an important cardioprotective role in heart failure in animals and in patients without heart failure . however , to date , the evidence for the role of ang-(1 - 7 ) in human heart failure is limited ( table 1 ) , whilst there are many more studies in non - heart - failure patients ( table 2 ) . the only study which evaluated the effects of ang-(1 - 7 ) on patients with heart failure examined only 8 patients . ang-(1 - 7 ) did not have any significant effect on the pulse rate , blood pressure , or forearm blood flow in the noninfused arm during infusion of the peptide . slight vasoconstriction was observed during ang-(1 - 7 ) infusion at 500 pmol / min and 5000 pmol / min ; however , this was not statistically significant , and the absolute magnitude of the effect was very small . when ang-(1 - 7 ) was coinfused with bk , the results were very similar to the initial infusion of bk alone . interestingly , it showed a slight reduction in response to bk , though this was not statistically significant . thus , intriguingly , the results from this study are contradictory to the wealth of evidence gained from animal studies . nevertheless , the findings were similar to another small study conducted on 8 non - heart - failure subjects . another study also found that if ang-(1 - 7 ) was administered above a certain concentration ( dose ) , its actions were abolished . it is important to bear in mind the species gap between humans and animals and also the differences in methodologies used in the studies ( e.g. , some animal studies studied the effect of ang-(1 - 7 ) on coronary arteries and others looked at mesenteric arteries ) . it seems that ang-(1 - 7 ) is biologically inactive , in keeping with a study by kono et al . who also reported biological inactivity . if anything , its effects appear to have opposite actions ( albeit nonsignificantly ) to what is generally believed , a vasodilating , antiproliferative , and counterregulatory peptide . it should be noted that the study had a relatively small sample size : 8 patients with chronic heart failure secondary to left ventricular dysfunction were recruited . the study could be underpowered statistically . all the patients in the study were already taking ace inhibitors ; therefore , the effect of ang-(1 - 7 ) potentiating bk may have been obscured . on the other hand , ang-(1 - 7 ) attenuates vasoconstriction and increases blood flow in some studies , involving a larger number of patients , across different vascular beds , including the forearm and internal mammary artery [ 18 , 32 , 34 , 44 ] . thus , there are human studies demonstrating that the vasodilating property ang-(1 - 7 ) is believed to hold . ueda et al . provided evidence of ang-(1 - 7 ) 's action of attenuating vasoconstriction by ang ii in a dose - dependent manner . were also consistent with the detection of a vasodilatory effect of ang-(1 - 7 ) . reference had a study population of 25 patients undergoing cabg ( one did not have cabg ) , and here , ang-(1 - 7 ) was found to behave like an ace inhibitor . the blockade of vasoconstriction in this study could be due to many mechanisms which include the counterregulation of ang ii signalling and the inhibition of ace . reference involved a double - blind crossover design , allowing less room for bias . coinfusion of ang-(1 - 7 ) at 1000 pmol / min with bk significantly shifted the dose - response curve to the left ; this was not the case at 100 and 10 pmol / min ( additional analysis was performed to take into account the possible tachyphylaxis of bk in the study , which then found ang-(1 - 7 ) at 100 pmol / min to show effect ) . ang-(1 - 7 ) seems to operate within a specified range according to a few human studies so far [ 31 , 37 , 44 , 63 ] . result of ang-(1 - 7 ) having no significant effect on bk may have been due to fact that wilsdorf et al . did not take into account tachyphylaxis in the data ; therefore , the effect of ang-(1 - 7 ) may have been masked by this possible phenomenon . references [ 44 , 65 ] both found tachyphylactic responses to bk . moreover , wilsdorf and colleagues did not analyse and measure greater doses of ang-(1 - 7 ) , which did and found a significant effect . other studies about ang-(1 - 7 ) in human heart failure have provided important insight into its role and suggested mechanisms , whereby it might be further exploited as a peptide with cardioprotective therapeutic benefits . validated a potential role for ang-(1 - 7 ) in the human failing heart in an elegant study involving explanted hearts . this study involved 22 patients with heart failure due to either end - stage idiopathic cardiomyopathy ( idc ) or primary pulmonary hypertension ( pph ) , compared with 13 patients with normal left ventricles ( lv ) on echocardiography prior to organ donation , which eventually sadly could not take place due to abo blood type or donor / recipient size mismatch . in the transplanted hearts , ang-(1 - 7 ) forming activity was significantly increased in the idc left ventricle ; the forming activity was greater for ang ii as a substrate than that for ang i. furthermore , the forming activity was greater than 4-fold ( ang ii as substrate ) compared to the nonfailing left ventricle . ang ii as a substrate for ang-(1 - 7 ) appears to have activity in more areas of the heart than for ang i , increasing the levels of ang-(1 - 7 ) in both idc ventricles and the pph right ventricle . it should be remembered that the pph left ventricle was not dysfunctional , which may explain the lack of increased ang-(1 - 7 ) forming activity in the left ventricles of patients suffering from primary pulmonary hypertension . . indicated a role for neutral endopeptidase and ace2 in the formation of ang-(1 - 7 ) . the ang-(1 - 7 ) forming activity was greater when ang ii was the substrate ; moreover , the forming activity was identified in more areas of the heart , suggesting a major role for ace2 in the failing heart . this has potentially beneficial consequences : it may positively influence the remodelling process known to be detrimental to cardiac function . however , it is unlikely that a direct relation between ang-(1 - 7 ) and the at2 receptor exists because it is not a natural ligand for it . it may be possible for there to be cross - talk between the mas receptor and at2 receptor . there is a strong correlation between ang-(1 - 7 ) and ang ii , being efficiently converted , and the given evidence from previous studies in favour of ang-(1 - 7 ) as a promising peptide to oppose ang ii effects suggests a potential counterregulatory role of ang-(1 - 7 ) in the raas , thus being cardioprotective . this study has a few drawbacks ; because of the method used to homogenise tissue , influential enzymes may have been lost , therefore unable to exert their effects on either ang i or ang ii . not only that , but also , as the authors were focusing on membrane - bound angiotensinases , they may have not identified the potential effects of the soluble ace2 . ace2 gene expression was shown to be upregulated in the human failing heart in a study by goulter et al . . , goulter et al . , and pan et al . who declared positive influences by ang-(1 - 7 ) on metalloproteinases ( as a measure of myocardial fibrosis in the failing human heart ) together , they showed ang-(1 - 7 ) to be a promising physiological peptide in the failing human heart . in the postmyocardial infarction period , an increased matrix metalloproteinase ( mmp)/tissue inhibitors of matrix metalloproteinases ( timps ) ratio contributes to the remodelling stage . schwartzkopff et al . also reported changes in the mmp / timp ratio in the human failing heart . have importantly provided evidence of ang-(1 - 7 ) 's presence within the coronary sinus and arterial ( radial ) circulation of patients with heart failure taking ace inhibitors . here , an increased level of ang-(1 - 7 ) was shown , by 39- and 22-fold in the coronary sinus and radial arterial blood , respectively , compared to non - heart - failure patients who were also not on ace inhibitors . ang-(1 - 7 ) appeared to rise in a parallel manner with ang i levels . these are significant findings as ace inhibitors now form the cornerstone of the management plan for heart failure . in patients treated with ace inhibitors , angiotensin i goes up , leading to a rise in ang-(1 - 7 ) via the nep - like pathway . thus , the nep pathway is recognised as an alternate route for the production of ang-(1 - 7 ) [ 12 , 71 ] . when associated with ace inhibition , the ang-(1 - 7)/ang ii ratio has been found to be increased by 7.5- and 2.25-fold in the coronary sinus and arterial blood respectively . this provides further strong evidence in support of the role of the nep - like pathway . as discussed , ang-(1 - 7 ) attenuates vasoconstriction and increases fbf in some studies [ 18 , 34 , 44 , 63 ] . further , ang-(1 - 7 ) has anti - aggregatory effects [ 37 , 43 ] , opposes ang ii signalling in endothelial cells , and has beneficial effects against human atherosclerosis . therefore , finding it within the coronary sinus is highly regarded . however , davie and mcmurray and wilsdorf et al . did not find any effect on the fbf in a small heart failure cohort and another small study of non - heart - failure patients . campbell and colleagues have presented data displaying a shift in the balance within the raas towards ang-(1 - 7 ) , increasing the physiological armoury against the deleterious effects of the ace - ang ii - angiotensin subtype 1 receptor ( at1r ) axis . lin et al . suggested a positive feedback loop where increased levels of ang-(1 - 7 ) could increase the levels of ace2 which would further increase ang-(1 - 7 ) . the study population of was relatively small , involving 9 patients ; however , this study has provided results proposing a beneficial cardioprotective role for ang-(1 - 7 ) in heart failure . the study population was not homogeneous ; moreover , there were a number of differences between the two groups , for instance , drug therapy . one possible explanation for the results in the study is that ace inhibitor therapy can increase ang-(1 - 7 ) levels . additionally , in 33 patients with end - stage hf undergoing heart transplant , as well as 11 controls , mas17 , mmp3 , and collagen i mrna expression were analysed in myocardial biopsies . the patients were relatively young ( mean age 54 ) but suffered severe left ventricular impairment ( mean ef 21% ) . just over half had ischaemic heart failure , and 16 had nonischaemic aetiology . in this study , perales et al . demonstrated that the level of mmp3 and collagen i expressions was suggestive of the tissue being in the remodelling stage in a proportion of myocardium studied . importantly , within the same subset of myocardium , there was an increased expression of the mas receptor . as this receptor has been shown to mediate many actions of ang ii , it suggests a role for ang-(1 - 7 ) in the remodelling process . interestingly , in the small sample of hearts studied , there was no significant difference between patients with mmp3 expression regarding aetiology , severity of symptoms as measured by nyha class , medication , or left ventricular dilation , although the abstract ( which is as yet unpublished in full ) did not specify whether there was any significant effect of ejection fraction on mmp3 expression . heart failure ( hf ) is a common condition associated with significant morbidity and mortality despite major advances in medical , revascularization , and modern cardiac resynchronisation therapy ( crt)/implantable defibrillator ( icd ) devices . in 2006 , more than 400,000 hospitalisations were recognised as due to or complicated by hf , accounting for about 4 million nhs hospital bed - days annually . the uk national hf audit for 2008/2009 showed that 26% of patients aged < 75 years and 56% of those aged > 75 years would be dead within a year . angiotensin ( ang)-(1 - 7 ) is an endogenous ligand for the g protein - coupled receptor mas , which has a pivotal role in preserving normal endothelium - dependent relaxation . the theoretical beneficial effects of ang-(1 - 7 ) in animal research on endothelial progenitor cells need to be further tested in humans . human studies already suggest that ang-(1 - 7 ) attenuates vasoconstriction , increases fbf in non - heart - failure patients , and opposes ang ii signalling in endothelial cells . importantly , professor walther 's team has also found that infusion of ang-(1 - 7 ) after mi in an animal model increased the number of c - kit- and vascular endothelial growth factor - positive cells in infarcted hearts , inhibited cardiac hypertrophy , and improved cardiac function . furthermore , the nonpeptidic ang-(1 - 7 ) receptor agonist ave0991 also improved cardiac contractility in diabetic rats . in addition , ang ( 1 - 7 ) stimulates haematopoietic progenitor cells in vitro and in vivo . ang-(1 - 7 ) has already been studied in phase i / ii trials in patients with solid tumours [ 77 , 78 ] . daily subcutaneous doses of 2.5100 micrograms / kg / day were safe and well tolerated . thus , ang-(1 - 7 ) is a candidate molecule that has already been administered to patients with breast cancer undergoing chemotherapy to correct anaemia ( a common comorbidity in hf ) . in a small study of 8 patients with chronic hf , ang ( 1 - 7 ) had no significant effect on blood pressure ( bp ) and caused no adverse effects . absence of a vasodilator response in patients who are already on ace inhibitors might be explained at least in part by the fact that the peptide ang-(1 - 7 ) is metabolised by ace . there is growing evidence to suggest that the beneficial effects of ace inhibitors and angiotensin receptor blockers ( arbs ) are at least in part mediated via ang-(1 - 7 ) . in addition , chronic angiotensin-(1 - 7 ) selectively prevents cardiac fibrosis in the doca - salt model of hypertension , without any effect on blood pressure or cardiac hypertrophy . further support of the role of ang-(1 - 7 ) in helping myocardial fibrosis came from observation by raizada 's team that the antifibrotic effect of an ace2 activator correlated with increased cardiac ang-(1 - 7 ) immunostaining . metalloproteinases and timps appear to have an important role in myocardial fibrosis and cardiac dysfunction in hf . demonstrated how ang-(1 - 7 ) decreased ratios of mmps to timps in human cardiac cells . a study performed on patients with heart failure examining the effects of ang-(1 - 7 ) on the expression of mmps and timps will prove beneficial . the ratios of these enzymes are altered to some degree in hf [ 69 , 70 ] . this may show direct effects of ang-(1 - 7 ) on the remodelling process known to be detrimental to the failing myocardium . to follow on from davie and mcmurray , it would be worthwhile to recruit a much larger sample size to test the hypothesis that ang-(1 - 7 ) has beneficial effects on haemodynamics in human heart failure . we are planning to conduct a randomised controlled trial to test the hypotheses that ang-(1 - 7 ) might improve cardiac hypertrophy and function . investigating the expression of mas - gene mrna or mas - receptor distribution throughout the human failing heart will provide good insight into activity of ang-(1 - 7 ) . furthermore , the study can also check if there is a correlation between expression and stage of hf and the remodelling process , ventricular size , and ejection fraction . the nonpeptidic ang ( 1 - 7 ) receptor agonist ave0991 has already been shown to improve cardiac contractility in diabetic rats . development of an oral nonpeptidic ang ( 1 - 7 ) receptor agonist will enable us to perform a well - designed randomised controlled trial to study the cardioprotective effects of ang-(1 - 7 ) in patients on ace inhibitors or arbs . the main finding of this systematic review is that ang-(1 - 7 ) plays an important cardioprotective role in heart failure in animals and in patients without heart failure . however , to date , the evidence for the role of ang-(1 - 7 ) in human heart failure is limited . nevertheless , accumulating evidence from a few studies demonstrated the importance of ang-(1 - 7 ) as a potential therapeutic agent in heart failure .

in 1993 , skibbens and salmon published a study using high - resolution time - lapse video microscopy that provided crucial insight into how chromosomes move in living cells ( skibbens et al . , 1993 ) . their four key observations were that ( 1 ) the rates of chromosome movement are the same at different positions on the spindle , ( 2 ) the transitions between poleward and away - from - pole movement are abrupt , ( 3 ) sister kinetochore movement is highly coordinated , and ( 4 ) chromosome congression is favored in prometaphase because kinetochores spend more time moving away from the pole than they do moving poleward . based on these observations , the authors proposed that kinetochores toggle between states of poleward force generation and neutral ( or pushing ) , and tension experienced by the kinetochore regulates the switching between those two states . as poleward motion moves the chromosome progressively closer to the spindle pole , the leading kinetochore encounters increasing tension due to the antagonistic polar ejection force pushing the chromosome arms away from the spindle pole . that tension causes the leading kinetochore to cease poleward force production and shift into neutral permitting the polar ejection force to move the chromosome away from the pole . kinetochores on bioriented chromosomes moving poleward experience tension derived from both the polar ejection force and the activity of the sister kinetochore pulling toward the opposite pole . high tension on the leading kinetochore will cause it to switch into neutral permitting the poleward force derived from the sister kinetochore , along with the ejection force from the proximal pole , to move the chromosome toward the spindle equator . repeated iterations of these switches lead to congression because chromosomes spend more time moving away from the pole toward the spindle equator , and the spindle equator is the position where the polar ejection forces are equal and , presumably , minimal between the poles . this model provides explanations for chromosome oscillations on both bipolar and monopolar spindles in animal cells and for chromosome congression . although growing microtubule plus - ends may contribute to the polar ejection force , recent evidence demonstrates that a majority of this force is generated by the kid subfamily of kinesin - related proteins ( antonio et al . , 2000 ; funabiki and murray , 2000 ; levesque and compton , 2001 ) . kid localizes along chromosome arms , and consistent with the kinetochore directional instability model , inhibition of kid function in cultured cells abolished chromosome oscillation on both monopolar and bipolar spindles ( levesque and compton , 2001 ) . moreover , in the absence of kid function , chromosomes were unable to maintain their distance from monopolar spindle poles , suggesting that the poleward force at the kinetochore dominates in the absence of the polar ejection force and drags the chromosome into the pole . as chromosome oscillations were eliminated after kid inhibition , it follows that the polar ejection force regulates switching of kinetochores between poleward and neutral states . however , the surprise was that bioriented chromosomes congressed normally in kid - deficient cells despite the lack of oscillation . thus , whereas biased durations of oscillatory motion are likely an important mechanism driving chromosome congression in animal cells , these new results suggest that another mechanism exists to provide positional cues to chromosomes and that this alternative mechanism can efficiently drive chromosome congression if the oscillation - based pathway is inoperative . one potential source of positional information for chromosomes during early stages of mitosis may come from the number of microtubules attached to each sister kinetochore as the magnitude of kinetochore force , hence the direction of chromosome movement , may depend on the number of kinetochore microtubules ( hays and salmon , 1990 ) . mcewen and colleagues recently tested this model using correlative light and electron microscopy and observed no positive correlation between the number of microtubules bound to kinetochores and direction of chromosome movement ( mcewen et al . , 1997 ) . thus , these data argue against chromosome congression models in which the direction of chromosome movement is dependent , either directly or indirectly , on the number of microtubules bound to kinetochores . another potential mechanism for chromosome congression could involve the precise regulation of kinetochore - associated microtubule motors . microtubule marking experiments demonstrated that most poleward chromosome movement coincided with the disassembly of microtubule plus - ends at the kinetochore , indicating that in vertebrate cells chromosome movement may primarily be driven by kinetochore - associated motors ( gorbsky et al . , it was proposed that forces generated by the kinetochore - associated motors dynein , cenp - e , and/or mcak / xkcm1 could drive chromosome congression if appropriately regulated and coupled to microtubule plus - end dynamics ( also known as the pac - man model ) ( gorbsky et al . , regulation of the activity of these motors could occur through a variety of mechanisms including changes in the phosphorylation state or the abundance of the proteins at kinetochores ( hyman and mitchison , 1991 ) . concordantly , cenp - e is known to undergo cell cycle dependent phosphorylation , and the abundance of both cenp - e and dynein has been shown to be dependent on microtubule occupancy at kinetochores ( liao et al . , 1994 ; king et al . recent experiments in cultured animal cells have tested the potential role of each of these motors in chromosome congression . disruption of kin i kinesin ( mcak ) function in cultured cells using either antisense or overexpression of dominant negative fragments caused defects in chromatid segregation at anaphase , but prior chromosome alignment at the spindle equator did not appear altered ( maney et al . , 1998 ) . inhibition of cytoplasmic dynein activity impaired chromosome congression in fruit fly embryos ( sharp et al . , 2000 ) , but did not cause any detectable effect on the rate or extent of chromosome congression in cultured vertebrate cells ( howell et al . , 2001 ) . finally , depletion of cenp - e from kinetochores by antibody injection caused cell cycle arrest with multiple chromosomes lying adjacent to the spindle poles instead of at the spindle equator ( schaar et al . , 1997 ) . although suggestive of a failure in congression , careful analysis of these cells by electron microscopy demonstrated that the unaligned chromosomes failed to congress because they were monooriented ( mcewen et al . , 2001 ) . bioriented chromosomes in the same cells showed chromosome congression and oscillation indistinguishable from control cells even though the kinetochores lacked detectable cenp - e . thus , although these data do not exclude the possibility that chromosome congression is driven by regulated kinetochore motor activity , the molecular mechanisms for regulating the activities of these proteins to determine the position of chromosomes in spindles have not been characterized . another possible source of positional information in the spindle is based on the traction fiber model , perhaps the oldest and most widely discussed model for chromosome congression ( ostergren , 1951 ) . although the traction fiber model can not explain the complex oscillatory movements of chromosomes , it offers an alternative to the oscillation - based mechanism to explain how chromosomes sense their position on spindles . in its developed form , this model proposes that kinetochore microtubules are translocated poleward generating a poleward force that is proportional to the length of the kinetochore fiber ( fig . 2 ) ( for review see rieder and salmon , 1994 ; and for an alternative view see pickett - heaps et al . , 1996 ) . hays and salmon provided evidence that poleward force was proportional to the length of kinetochore microtubules in agreement with a traction fiber based mechanism ( hays et al . , 1982 ) . however , the most compelling evidence that a traction fiber based mechanism exists comes from the direct observation of the poleward translocation of kinetochore microtubules , referred to as poleward microtubule flux , in spindles in many different cell types ( mitchison , 1989b ; mitchison and salmon , 2001 ) . postional cues for chromosome congression may be derived by integrating two force gradients in the spindle , the polar ejection force and the traction fiber mechanism . red arrows indicate translocation of the traction fiber with the number of arrows proportional to the length and therefore the forces acting along the kinetochore fiber . the kinetochores ( red ) are under tension and stretched ( pulled apart ) due to forces acting on chromosomes . the magnitude of tension at kinetochores can regulate the movement of a chromosome . to explain how the microtubule lattice translocates toward the spindle pole , while keeping the length of the spindle constant , a nonmicrotubule mechanical ensemble , or spindle matrix , has been proposed ( for reviews see mcintosh et al . , 1969 ; pickett - heaps et al . , 1982 ) . motor proteins may bind to this structure and generate force to drive microtubule translocation poleward . however , such a spindle component has not been biochemically characterized and the existence of the spindle matrix remains controversial . recently , two observations have once again focused our attention on the possible existence of a spindle matrix . skeletor in fixed drosophila embryos suggests that a non - microtubule spindle like structure exists ( walker et al . , 2000 ) . whether this is in fact the long sought after spindle component is still unclear as the biochemical function of skeletor is unknown and homologous proteins in other cell types have not been identified or characterized . second , examining the translocation and turnover of the bimc kinesin eg5 in bipolar spindles using fluorescent speckle microscopy , it was found that the motor protein was static relative to spindle microtubules that fluxed polewards ( kapoor and mitchison , 2001 ) . an interpretation of this observation is that eg5 is static while it interacts with a nonmicrotubule matrix in the spindle . however , other interpretations , including the possibility that the motor protein itself forms higher order oligomers with limited diffusion , can not be ruled out . validating a candidate spindle matrix component may be particularly challenging for at least two reasons . first , the matrix may not be a stable framework but a dynamic assembly , consistent with the observation that fluorescent eg5 speckles persist for few seconds and the protein rapidly exchanges in and out of the spindle ( kapoor and mitchison , 2001 ) . the rate of poleward microtubule flux has been shown to be equal to that of poleward chromosome movement in anaphase in frog egg extracts , suggesting that it may be the primary poleward driving force in that system ( desai et al . , 1998 ) . however , the rate of poleward microtubule flux has been found to be significantly slower than the rate of poleward chromosome movement in many other cell types that have been examined ( mitchison and salmon , 1992 ) . thus , contrary to the simple tug - of - war idea originally proposed in the traction fiber model , poleward microtubule flux may not be responsible for directly powering chromosome congression to the spindle equator in many cell types . however , this does not rule out the possibility that the force generated by poleward microtubule flux regulates kinetochore activity to appropriately position chromosomes at the spindle equator . if the findings of hays and salmon indicating that the magnitude of the force at the kinetochore were dependent on kinetochore microtubule length were confirmed in all cell types ( hays et al . , 1982 ) , then we envision that poleward microtubule flux may be a mechanism to bias chromosome movement to the spindle equator . this mechanism would most likely act independently of the polar ejection force and chromosomes may utilize both mechanisms to determine their position on the spindle . in this context , the traction fiber alone may provide all the positional information needed to correctly align chromosomes at the center of the spindle , which offers an explanation for how chromosomes congressed efficiently after perturbation of the polar ejection force generating motor kid . however , it is currently unknown if the poleward translocation of spindle microtubules occurs during prometaphase , the critical period of mitosis for congression , and no direct test of this idea is possible at this time because no reagents are available to specifically inhibit poleward microtubule flux . a parallel exists between the mechanisms by which the polar ejection force and the traction fiber based poleward microtubule flux could direct chromosome congression . these two forces are most likely manifested as force gradients within the spindle lattice with the magnitudes of force generated by polar ejection and poleward microtubule flux decreasing and increasing , respectively , as chromosomes move away from the spindle pole toward the spindle equator . it is appealing to speculate that both these force gradients influence kinetochore activity by generating tension at the kinetochore ( fig . tension has been shown to stabilize kinetochore - microtubule attachment and kinetochore motility in meiotic cells ( nicklas and koch , 1969 ; nicklas , 1977 ) and to influence kinetochore motility in mitotic cells ( skibbens et al . , 1995 ) . it has been shown that poleward microtubule flux can generate sufficient force to maintain interkinetochore stretching ( waters et al . , 1996 ) , an observation consistent with idea that a traction fiber mechanism could generate tension to regulate kinetochore activity ( mitchison , 1989a ) . furthermore , the polar ejection force has been shown to regulate chromosome oscillations , presumably , through altering kinetochore tension ( levesque and compton , 2001 ) . a key component of such tension - regulated mechanisms is the elastic properties of the centromeric dna linking the kinetochore to the chromosome , a rather unexplored aspect of chromosome and spindle biology . significant stretching of centromeric chromatin in response to spindle forces has been observed in both budding yeast and human cells ( shelby et al . , 1996 ; pearson et al . , 2001 ) . it has also been argued that the elastic properties of centromeric dna influences the coordination between sister kinetochores during oscillatory chromosome movements ( skibbens et al . , 1995 ; pearson et al . , . moreover , centromeric elasticity is most likely responsible for syntelic chromosome orientation , where both sister kinetochores attach to microtubules emanating from the same spindle pole ( rieder , 1982 ; kapoor et al . it is not understood why kinetochore tension resulting from polar ejection forces is manifested as oscillatory chromosome movement , whereas tension generated at kinetochores by poleward microtubule flux is not . we speculate that this difference may result from the fact that the polar ejection force needs to be transduced from the chromosome arms through the elastic centromeric chromatin to the kinetochore , whereas the force exerted by poleward microtubule flux acts directly on the kinetochore , the likely location for the tension - sensitive mechanism . data from inhibition of molecules and examination of the dynamics of spindle components has begun to fill the gaps in our understanding of the process of chromosome congression . however , our complete understanding of congression may require the application of multiple experimental approaches as something of a gulf exists between dynamics - centered and motor - centered views of spindle assembly and force generation thus , answers to outstanding questions , such as how does poleward microtubule flux contributes to chromosome congression , what is the tension - sensitive molecular switch that allows kinetochores to change direction of movement , and how can mechanisms of force generation be distinguished from sources of positional information , may only come through combining tools that perturb specific molecules with powerful new imaging technologies such as fluorescent speckle microscopy ( waterman - storer et al . , 1998 ) .

prostaglandins ( pgs ) are an important class of lipid hormones that have been extensively investigated and implicated in regulating reproduction , immunity , and development in a wide array of organisms . pgs are ideally suited for comprehensive systems biology analyses because they comprise a series of lipids derived from a common precursor(s ) . the nematode c. elegans is one of the most widely used model organisms to address fundamental questions in genetics and systems biology . we have demonstrated that c. elegans synthesizes f - series pgs that guide motile sperm to oocytes . f - series pgs derived from 20-carbon pufas with three , four , and five double bonds , comprising the f1 , f2 , and f3 classes , respectively have been identified . these pgs are synthesized independent of cyclooxygenase enzymes , yet pgf1 and pgf2 stereoisomers are still generated . for qualitative and quantitative analyses of c. elegans pgs , lc - ms / ms is a powerful and sensitive analytical technique . before performing this analysis , it is important to develop an optimized extraction method because the performance of the analytical process heavily depends on the extract quality . liquid chromatography and mass spectrometry can only provide anticipated mass to charge ratio ( m / z ) , as well as desirable peak shape and retention time of the pg parent ion . metabolic profiling of pgs in c. elegans is a challenging task requiring various ms acquisition strategies . lc - ms full scan or survey scanning ( q1 scanning ) has the advantage of ensuring that most ionizable pgs will generate a mass spectrometric response . while the survey scan provides useful information on total profiling of pgs with respect to wild - type and mutant c. elegans , detection of minor pgs is compromised due to low sensitivity . nevertheless , lc - ms survey scanning can give a global view of pgs and is particularly useful for analyzing mutants predicted to affect metabolism of a large pg population . lc - ms / ms analysis of chemically synthesized pg standards is first performed to obtain their product ion spectra as reference compounds . an mrm experiment is accomplished by specifying the parent ion / product ion mass transition of a compound . by knowing the mass and structure of the target analytes , it is possible to predict theoretical mrm transitions for many unknown metabolites . an optimized lc - ms / ms method for profiling isomeric pgs in c. elegans has not been reported . here we describe an extraction and integrated mass spectrometry approach consisting of lc - ms and lc - ms / ms methods for detecting , quantifying , and investigating c. elegans pg metabolites . the protocol as described below is divided into three sections : worm culture , prostaglandin extraction , and prostaglandin analysis . as noted , there are multiple points when samples can be temporarily stored at -80 c or -20 c . we recommend approximately 6 g of mixed stage worms for comprehensive lc - ms / ms . for quantification of known pgs by mrm in a single injection or two , 1 - 2 g are sufficient . prepare 65 x - large ( 16 cm ) ngm plates and concentrated bacteria for supplemental feeding . grow at least four liters of na22 in lb medium for 16 - 24 hr . spin down , remove the supernatant , and resuspend bacteria in 100 ml of m9 buffer . 200 to 400 ml of this concentrated bacterial solution may be required for each worm strain . grow worms for approximately 3 to 4 generations until plates are full of gravid adults . concentrated bacteria should be added to plates to prevent starvation , as necessary ( ~ 1 ml / plate and let dry completely before replacing lid ) . wash gravid hermaphrodites off plates with m9 buffer and collect the worms in a 50 ml conical polypropylene tube . allow gravid hermaphrodites to settle to the bottom ( usually about 3 - 5 min ) . keep worm solution mixed well until all plates have been seeded to ensure that they receive roughly equal numbers of worms . supplement with concentrated bacteria as needed ( ~1 ml / plate/12 to 24 hr period ) to prevent starvation . grow worms for 2 - 4 generations , depending on the original number of seeded worms , or until plates are full of gravid adults . wash worms off the plates with m9 buffer and collect in 50 ml polypropylene tubes ( e.g. 6 tubes ) . use m9 buffer to wash a plate , then transfer the worm - filled buffer to the next plate . after washing a number ( e.g. 10 ) of plates , transfer the worm - filled buffer to the 50 ml tube . fill the tube to the top with m9 buffer . repeat the wash for the rest of the plates . as the gravid adults settle to the bottom in 5 - 6 min , remove the supernatant ( ~ 35 ml ) and consolidate into one or two tubes . fill the tubes to 50 ml with fresh m9 buffer , let stand for 3 - 5 min , and remove supernatant leaving gravid adults . repeat 3 times or until the supernatant is transparent . using a large bore pasteur pipette , transfer as many worms as possible to two 15 ml polypropylene conical tubes . spin down at 1,000 rcf ( ~3,500 rpm in centrasl2 ) for 5 min in a clinical centrifuge . remove supernatant and repeat until all worms are transferred and pelleted in the same tube . the method is modified from that of golovko and murphy and includes acetone extraction followed by liquid - liquid purification , which enhances lc - ms / ms sensitivity . a bullet blender 5 homogenizer is used in the procedure , although similar results can be obtained with a dounce homogenizer . butylated hydroxytoluene ( bht ) and evaporation under nitrogen ( n2 ) gas are used to prevent oxidation transfer approximately 6.0 g of frozen worms from the 15 ml conical tube stored at -80 c by cutting through the tube with a hot razor blade near the 6.5 ml mark . a methanol - cleaned spatula can be used to remove the frozen worm pellet from the bottom of the tube . by cutting through the pellet to retrieve the lower portion , less dense larval worms and residual bacteria from the top of the pellet are left behind . if multiple samples are being processed , use the same amount ( 6.0 g ) of tissue for comparative studies . as the worms thaw into a paste , add or remove worms with the spatula to obtain the desired mass . optional : add 1.00 ng of pgf2-d4 standard as an internal control for extraction efficiency . add 12 ml of ice - cold 2:1 acetone / saline with 0.005% bht to the worm suspension and mix well by vortexing . dispense 1.5 ml of the worm slurry to each of twelve 5 ml self - standing plastic tubes for use in the bullet blender . add 0.7 - 0.8 ml of 0.5 mm diameter ceria stabilized zirconium oxide beads to each 5 ml tube . run the blender for 3 min at speed 8 - 9 and place the tubes on ice . be sure to close the caps very tightly or the content may spill out . check 10 l of homogenate from one tube on a slide using a stereoscope . repeat at the same speed for another minute , if necessary . evenly transfer the homogenates to four 10 ml conical glass tubes using a 9 " pasteur pipette . wash the beads from three tubes sequentially with 1 ml of 1:2 acetone / saline containing bht . transfer the remaining solution ( ~ 4 ml ) to the 10 ml glass tubes and place them on ice . centrifuge the 10 ml glass tubes at 4 c in a clinical centrifuge at ~1,000 x g for 10 min . transfer the supernatant from each tube to a clean 10 ml glass conical tube . in a chemical hood , add an equal volume of hexane to each 10 ml glass tube . centrifuge the 10 ml glass tubes at 4 c in a clinical centrifuge at ~1,000 x g for 10 min . acidify the lower phase to ph 3.5 using 2 m formic acid ( approximately 100 - 150 l ) . vortex at maximum speed for 30 sec and centrifuge the tubes at 4 c in a clinical centrifuge at ~1,000 x g for 10 min . insert a pipette tip through any residual milky interphase to the lower chloroform phase , avoiding the interphase . collect the lower phase from each of the 4 tubes to a clean 15 ml conical glass tube . take the extract out of the freezer and discard the remaining milky aqueous top layer , if present . transfer the chloroform phase to a labeled teflon - lined -dram glass vial using a new pasteur pipet . in a chemical hood , evaporate the chloroform soluble fraction to dryness under a gentle flow of n2 gas . prepare stock solutions of individual reference prostaglandins , such as pgf2 or pgf2 -d4 ( 1 g / ml ) in methanol and dilute with methanol : water ( 8:2 v / v ) to obtain a working solution . prepare a series of dilutions ( 100 , 10 , 1 , 0.1 , 0.01 ng / ml ) to generate a standard curve . add 200 l methanol : water ( 8:2 v / v ) to the dried c. elegans lipid extract(s ) and mix thoroughly . if less than 6 g of worm tissue was extracted , the dried extract should be resuspended in less volume of methanol : water solution . prepare the mobile phase consisting of 0.1% formic acid in water [ a ] and acetonitrile containing 0.1% formic acid [ b ] . set up the autosampler at 4 c and place the sample vials in a 70-count 1.5 ml vial rack . equilibrate the synergy hydro rp - c18 column with 0.1% formic acid at a flow rate of 0.2 ml / min for about 5 min . perform gradient elution starting with 10% b and going up to 80% b from 0 - 11 min , 80 - 100% b from 11 - 14 min , and returning back to 10% b at 16 min . introduce the column effluent into the mass spectrometer using an esi interface operating in the negative ion mode . the collision gas , collision energy , and temperature are set at 10 , -35 ev and 600 c , respectively . declustering potential ( dp ) , collision energy ( ce ) , and cell exit potential ( cxp ) are set at -90 , -35 and -10 , respectively . for survey scans ( q1 scans ) , use negative ion mode in the mass range of m / z 315 - 360 for most pgs ( figure 2 ) . the range can be altered , depending on the mass of the compound(s ) of interest . extract ions from total ion current ( tic ) of lc - ms ion chromatograms and determine whether the extracted ions correspond to deprotonated or adduct ions , or to fragment ions . for mrm experiments , mass transition m / z 355/311 is used to detect the f1 class , m / z 353/193 is used for the f2 class , and m / z 351/193 or 351/191 is used for the f3 class ( figure 3 ) . mrm is also used to detect the internal standard ( for example , m / z 357/197 for pgf2-d4 ) and to generate the standard curve . see murphy et al . for additional information on pg mass transitions . for ms / ms experiments , use m / z 355 for f1 class , m / z 353for f2 class , and m / z 351for f3 class pgs . c. elegans ms / ms data for f - series pgs is available in figure 4 and table 2 . we recommend approximately 6 g of mixed stage worms for comprehensive lc - ms / ms . this should provide enough material for detection at least six separate injections . for quantification of known pgs by mrm in a single injection or two , 1 - 2 g are sufficient . analysis of extracts from synchronized cultures consisting of a specific stage is also possible . up to 4 different strains prepare 65 x - large ( 16 cm ) ngm plates and concentrated bacteria for supplemental feeding . use na22 bacteria for seeding . to make concentrated bacteria for supplemental feeding , grow at least four liters of na22 in lb medium for 16 - 24 hr . spin down , remove the supernatant , and resuspend bacteria in 100 ml of m9 buffer . 200 to 400 ml of this concentrated bacterial solution may be required for each worm strain . grow worms for approximately 3 to 4 generations until plates are full of gravid adults . concentrated bacteria should be added to plates to prevent starvation , as necessary ( ~ 1 ml / plate and let dry completely before replacing lid ) . wash gravid hermaphrodites off plates with m9 buffer and collect the worms in a 50 ml conical polypropylene tube . allow gravid hermaphrodites to settle to the bottom ( usually about 3 - 5 min ) . keep worm solution mixed well until all plates have been seeded to ensure that they receive roughly equal numbers of worms . supplement with concentrated bacteria as needed ( ~1 ml / plate/12 to 24 hr period ) to prevent starvation . grow worms for 2 - 4 generations , depending on the original number of seeded worms , or until plates are full of gravid adults . wash worms off the plates with m9 buffer and collect in 50 ml polypropylene tubes ( e.g. 6 tubes ) . use m9 buffer to wash a plate , then transfer the worm - filled buffer to the next plate . after washing a number ( e.g. 10 ) of plates , repeat the wash for the rest of the plates . as the gravid adults settle to the bottom in 5 - 6 min , remove the supernatant ( ~ 35 ml ) and consolidate into one or two tubes . fill the tubes to 50 ml with fresh m9 buffer , let stand for 3 - 5 min , and remove supernatant leaving gravid adults . repeat 3 times or until the supernatant is transparent . using a large bore pasteur pipette , transfer as many worms as possible to two 15 ml polypropylene conical tubes . spin down at 1,000 rcf ( ~3,500 rpm in centrasl2 ) for 5 min in a clinical centrifuge . remove supernatant and repeat until all worms are transferred and pelleted in the same tube . the method is modified from that of golovko and murphy and includes acetone extraction followed by liquid - liquid purification , which enhances lc - ms / ms sensitivity . a bullet blender 5 homogenizer is used in the procedure , although similar results can be obtained with a dounce homogenizer . butylated hydroxytoluene ( bht ) and evaporation under nitrogen ( n2 ) gas are used to prevent oxidation transfer approximately 6.0 g of frozen worms from the 15 ml conical tube stored at -80 c by cutting through the tube with a hot razor blade near the 6.5 ml mark . a methanol - cleaned spatula can be used to remove the frozen worm pellet from the bottom of the tube . by cutting through the pellet to retrieve the lower portion , less dense larval worms and residual bacteria from the top of the pellet are left behind . if multiple samples are being processed , use the same amount ( 6.0 g ) of tissue for comparative studies . as the worms thaw into a paste , add or remove worms with the spatula to obtain the desired mass . optional : add 1.00 ng of pgf2-d4 standard as an internal control for extraction efficiency . add 12 ml of ice - cold 2:1 acetone / saline with 0.005% bht to the worm suspension and mix well by vortexing . dispense 1.5 ml of the worm slurry to each of twelve 5 ml self - standing plastic tubes for use in the bullet blender . add 0.7 - 0.8 ml of 0.5 mm diameter ceria stabilized zirconium oxide beads to each 5 ml tube . run the blender for 3 min at speed 8 - 9 and place the tubes on ice . be sure to close the caps very tightly or the content may spill out . check 10 l of homogenate from one tube on a slide using a stereoscope . repeat at the same speed for another minute , if necessary . evenly transfer the homogenates to four 10 ml conical glass tubes using a 9 " pasteur pipette . wash the beads from three tubes sequentially with 1 ml of 1:2 acetone / saline containing bht . transfer the remaining solution ( ~ 4 ml ) to the 10 ml glass tubes and place them on ice . centrifuge the 10 ml glass tubes at 4 c in a clinical centrifuge at ~1,000 x g for 10 min . transfer the supernatant from each tube to a clean 10 ml glass conical tube . in a chemical hood , add an equal volume of hexane to each 10 ml glass tube . centrifuge the 10 ml glass tubes at 4 c in a clinical centrifuge at ~1,000 x g for 10 min . acidify the lower phase to ph 3.5 using 2 m formic acid ( approximately 100 - 150 l ) . vortex at maximum speed for 30 sec and centrifuge the tubes at 4 c in a clinical centrifuge at ~1,000 x g for 10 min . remove and discard the upper aqueous phase . insert a pipette tip through any residual milky interphase to the lower chloroform phase , avoiding the interphase . collect the lower phase from each of the 4 tubes to a clean 15 ml conical glass tube . take the extract out of the freezer and discard the remaining milky aqueous top layer , if present . transfer the chloroform phase to a labeled teflon - lined -dram glass vial using a new pasteur pipet . in a chemical hood , evaporate the chloroform soluble fraction to dryness under a gentle flow of n2 gas . prepare stock solutions of individual reference prostaglandins , such as pgf2 or pgf2 -d4 ( 1 g / ml ) in methanol and dilute with methanol : water ( 8:2 v / v ) to obtain a working solution . prepare a series of dilutions ( 100 , 10 , 1 , 0.1 , 0.01 ng / ml ) to generate a standard curve . add 200 l methanol : water ( 8:2 v / v ) to the dried c. elegans lipid extract(s ) and mix thoroughly . if less than 6 g of worm tissue was extracted , the dried extract should be resuspended in less volume of methanol : water solution . prepare the mobile phase consisting of 0.1% formic acid in water [ a ] and acetonitrile containing 0.1% formic acid [ b ] . set up the autosampler at 4 c and place the sample vials in a 70-count 1.5 ml vial rack . equilibrate the synergy hydro rp - c18 column with 0.1% formic acid at a flow rate of 0.2 ml / min for about 5 min . perform gradient elution starting with 10% b and going up to 80% b from 0 - 11 min , 80 - 100% b from 11 - 14 min , and returning back to 10% b at 16 min . introduce the column effluent into the mass spectrometer using an esi interface operating in the negative ion mode . the collision gas , collision energy , and temperature are set at 10 , -35 ev and 600 c , respectively . declustering potential ( dp ) , collision energy ( ce ) , and cell exit potential ( cxp ) are set at -90 , -35 and -10 , respectively . for survey scans ( q1 scans ) , use negative ion mode in the mass range of m / z 315 - 360 for most pgs ( figure 2 ) . the range can be altered , depending on the mass of the compound(s ) of interest . extract ions from total ion current ( tic ) of lc - ms ion chromatograms and determine whether the extracted ions correspond to deprotonated or adduct ions , or to fragment ions . for mrm experiments , mass transition m / z 355/311 is used to detect the f1 class , m / z 353/193 is used for the f2 class , and m / z 351/193 or 351/191 is used for the f3 class ( figure 3 ) . mrm is also used to detect the internal standard ( for example , m / z 357/197 for pgf2-d4 ) and to generate the standard curve . see murphy et al . for additional information on pg mass transitions . for ms / ms experiments , use m / z 355 for f1 class , m / z 353for f2 class , and m / z 351for f3 class pgs . c. elegans ms / ms data for f - series pgs is available in figure 4 and table 2 . sample preparation was carried out by liquid - liquid extraction adapted from golovko and murphy . chromatographic conditions were optimized to provide baseline separation of > 30 eicosanoid standards ( table 1 shows 13 standards ) . a hydro - rp column ( 250 x 2.0 mm i.d ) with water and acetonitrile containing 0.1% formic acid provided the best separation and sensitivity . survey scans of wild - type and fat-3 mutant extracts shown in figure 2 document global levels of ions within the mass range of 315 - 360 atomic mass units . mrm analyses of a wild - type extract show multiple pg isomers of the f1 ( figure 3a ) , f2 ( figure 3b ) , and f3 ( figures 3c and 3d ) classes . the f3 class can be detected with either of two mass transitions , m / z 351/193 or m / z 351/191 . figure 4 shows the collision - induced decomposition of cepgf2 ( rt=11.8 ) compared to the pgf2 standard ( rt=11.8 ) . minor differences in product ions are likely due to low cepgf2 abundance and co - eluting compounds in the extract . note that acetone / saline and chloroform both have 0.005% bht to minimize lipid oxidation . survey scans of m / z 315 - 360 of wild - type and fat-3(wa22 ) mutant extracts . extracted ions at rt = 11.3 are shown for wild - type [ b ] and fat-3(wa22 ) [ c ] extracts . f1 class pgs are detected with mass transition m / z 355/311 [ a ] . notice that several hydrophobic compounds ( rt > 14 min ) , which are unlikely to be pgs , are also detected with this transition . f2 class pgs are detected with mass transition m / z 353/193 [ b ] . f3 class pgs are detected with either mass transition m / z 351/193 [ c ] or m / z 351/191 [ d ] . arrows in panel [ a ] indicate product or fragmentation ions shared between pgf2 and cepgf2 ( rt=11.8 ) . the product ions at m / z 309 and m / z 193 are generated from indicated cleavage sites ( highlighted a and b ) , correspond to the structures shown , and are characteristic of f - series pgs [ b ] . retention times and key product ions of 13 eicosanoid standards from the lc - ms / ms method . over 30 standards an exception is pgf1 and pgf2. nevertheless , these pgs are distinguished by their parent ion masses ( [ m - h]- m / z ) and collision - induced decomposition spectra ( ms / ms ) . table 2 . collision - induced decomposition product ions for several major c. elegans f1 , f2 , and f3 pgs shown in figure 3 . these data are from multiple analyses and not all product ions may be visible in a given run . given the complexity of the extracts , some less abundant product ions may derive from another parent ion with similar retention time or result from interference . peak 2 is likely a stereoisomer of cepgf1 and peak 4 is likely a stereoisomer of cepgf2 . we describe a procedure for eicosanoid extraction and analysis , focusing on f - series pgs . first , it is critical that the worm cultures do not starve , as starvation can alter pg metabolism . for supplemental feeding , na22 bacteria are recommended instead of the more commonly used op50 bacteria because na22 reaches higher density . less tissue ( 1 - 2 g ) can be used if the dried extract is resuspended in less methanol : water solution to increase pg concentration . however , only one to two injections can be performed . the detection limit of our lc - ms / ms system is about 10 pg pgf2 /ml . one ml of densely packed mixed stage worms ( about 1 g ) yields roughly 25 - 50 pg of cepgf2 . more sensitive mass spectrometry systems can reduce the amount of worm tissue required for analysis . we have found that extraction efficiency is very similar when tissues are extracted in parallel . to determine the efficiency , mrm using mass transition m / z 357/197 is used to measure pgf2-d4 concentration relative to a 1 ng / ml standard solution . the chromatography parameters and mass transitions we include can be altered to detect other pgs and eicosanoids . despite considerable effort , we have not been able to identify d - series or e - series pgs in the extracts . furthermore , we have not detected 8-iso pgf2 and 8-iso pge2 that are characteristic of free radical - initiated peroxidation , which generates a nonselective mixture of pg stereoisomers . endocannabinoids and various epoxy and hydroxy metabolites of arachidonic and eicosapentaenoic acids have been found in c. elegans extracts . we recommend the use of both mrm and ms / ms compared to authentic standards for quantification and identification , respectively . for novel eicosanoids , these analyses should be combined with a comparative study of fat mutants , which are deficient in pufa synthesizing enzymes , as well as a functional assay , if possible . a caveat to analyzing fat mutants is that minute quantities of pufas present in worms are sufficient for pg synthesis . for example , fat-2(wa17 ) mutants have a small amount of d12 desaturase activity ( ~5% of wild type ) and these mutants still produce pgs . fat-3(wa22 ) and fat-4(wa14 ) mutants fail to synthesize pgs derived from arachidonic and eicosapentaenoic acids . we also have found that fat mutants compensate for the loss of pufa classes by up - regulating pg synthesis from remaining classes . instead , they appear to up - regulate novel pgs derived from 18-carbon pufas . to date , we have not identified a c. elegans strain that is completely deficient in pg synthesis .

substantial evidence indicates that smoking bans reduce the adverse effects of exposure to tobacco smoke . as a result of this evidence , furthermore , partial smoking bans in indoor public places and workplaces are becoming a common occurrence . however , the issue of implementing complete smoking bans in all indoor public places has been debated in several countries . this disagreement depends on several factors including the societal view of smoking , compliance with existing smoke - free legislation , and other sociopolitical considerations . in 1995 , the republic of korea passed a law that banned smoking in public places . excluded from this ban were restaurants , recreational facilities , and entertainment venues , although some were subject to a partial smoking ban ( i.e. , facilities had to have both smoking and non - smoking areas that were physically separated ) . for example , one type of recreational facility , personal computer ( pc ) rooms , underwent a partial smoking ban . however , it is well - known that individuals within pc rooms will still be exposed to secondhand smoke ( shs ) , as there is air flow between the separated smoking and non - smoking areas . in korea , there are 15,817 pc rooms , all of which provide a facility for individuals to play computer games . survey data indicated that 45.2% of the population spends their leisure time in pc rooms . this percentage is higher than that at cinemas ( 33.5% ) , cafes ( 31.2% ) , or bars ( 26.2% ) . pc rooms became a top priority for the 2011 complete smoking ban placed on public indoor facilities . however , the implementation of this ban on pc rooms was delayed until 2013 . this ban was delayed because owners of pc rooms and smokers groups argued that the ban was not necessary , citing smokers rights and the lack of evidence supporting the effectiveness of a partial ban in protecting individuals from shs exposure . in this study , we investigated the levels of shs exposure in smoking and non - smoking areas of pc rooms prior to 2013 , to determine whether a complete smoking ban in pc rooms in necessary . thus , the results from this study will provide data that will impact the debate on a complete smoking ban in pc rooms . from june to september 2012 , particulate matter ( pm2.5 ) and air nicotine concentrations ( anc ) were measured in the smoking and non - smoking areas of a random sample of 28 pc rooms . pc rooms were located in goyang city , a residential satellite city of the capital seoul . for each pc room , field researchers completed an observational questionnaire on the ventilation , air conditioning , and heating systems as well as the facility s policies on smoking ( e.g. , restricted or permitted smoking , tobacco sales permitted , tobacco advertising allowed ) . monitoring equipment was concealed and measurements occurred in a blind manner ( i.e. , owners , employees , patrons , etc . had no knowledge of this study ) . pm2.5 concentrations were measured using a metone acrocet 531 aerosol particulate profiler ( grants pass , or ) for a minimum of 30 minutes in the smoking and non - smoking areas of each pc room . all pm2.5 concentrations measured were multiplied by 8.33 to adjust for the underestimation associated with monitoring the gravimetric pm2.5 concentration using that machine . anc was measured using passive samplers ( a 37-mm polystyrene sampling cassette holding a teflon - coated glass fiber filter treated with 4% sodium bisulfate and 5% ethanol ) . passive samplers were hung 1 - 2 m from the floor and at least 1 m from open windows and ventilation systems in order to avoid air circulation ( i.e. , dead spots ) . the sampling rate was 24 ml / min and the calculated limit of detection was 0.05 g / m over a 7-day sampling period . exposed filters were extracted and nicotine was analyzed using a gas chromatograph equipped with a nitrogen phosphorous detector ( 7820a , agilent technologies , santa clara , ca ) , with 10% of the samples duplicated . final anc values were calculated by subtracting out background levels measured using blank samples . geometric means ( gm ) and geometric standard deviations were calculated and statistical analyses were performed using sas ver . 9.3 ( sas institute inc . , cary , nc ) . this study was approved by the institutional review board of national cancer center of korea . all pc rooms had centralized air conditioning and heating systems that were functioning during the rooms hours of operation . according to the partial smoking ban implemented at the time this study was performed , all pc rooms were required to obey the following regulations : install a ventilation system for extracting smoke , prohibit the sale of tobacco , ban promotion and advertisement of tobacco , and had to post no smoking signs in non - smoking areas . in all pc rooms , evidence of smoking was identified in both smoking and non - smoking areas in all pc rooms . the gm of pm2.5 concentration in both smoking ( gm , 174.77 g / m ; range , 45.81 to 399.51 g / m ) and non - smoking areas ( gm , 93.38 g / m ; range , 31.57 to 250.48 g / m ) was significantly higher than the guidelines set forth by the world health organization ( who ) . pm2.5 concentrations in smoking areas were approximately twofold higher than those in non - smoking areas ( table 1 ) . the gm of anc in smoking and non - smoking areas was not significantly different , 48.95 g / m ( range , 38.97 to 82.71 g / m ) and 41.30 g / m ( range , 37.75 to 70.38 g / m ) , respectively . we did not observe any difference in the gm of pm2.5 concentrations between pc rooms in which anc was detected ( n=19 ; gm , 98.81 g / m ; range , 41.07 to 250.48 g / m ) and those rooms in which the anc was below the limit of detection ( n=9 ; gm , 82.88 g / m ; range , 31.57 to 239.24 g / m ) ( table 1 ) . on may 16 , 2005 , korea ratified the framework convention on tobacco control , which accelerated implementation of laws protecting individuals from the negative side effects of shs and reduced the prevalence of smoking ( 48.1% males and 6.1% females ) . in june 2011 , the amended national health promotion law expanded the complete smoking ban to include recreational facilities . recreational facilities , such as pc rooms , are a location in which individuals spend the majority of their leisure time . the partial smoking ban implemented prior to the rewritten national health promotion law of 2011 required facilities to construct a wall or air curtain between smoking and non - smoking areas as well as install ventilation systems to combat tobacco smoke . however , the partial smoking ban did not prevent the flow of tobacco smoke between areas . opponents of the 2011 law , including the owners of pc rooms , organized to repeal the complete smoking ban and argued that the law was unconstitutional . this action was ultimately unsuccessful , but did delay implementation until june 8 , 2013 . in this study , we measured the levels of tobacco smoke in pc rooms prior to june 8 , 2013 , during the period of delay of the complete smoking ban . our results indicated that the pm2.5 concentrations and anc in the smoking and non - smoking areas of pc rooms were similar . we observed ancs that were greater than 10-fold higher that those in a previous report of ancs in an entertainment venue in seoul that permits smoking without restriction . the pm2.5 concentration observed in non - smoking areas of pc rooms was very high . the pm2.5 concentration in smoking and non - smoking areas combined was similar to those previously reported in cafes , bars / clubs , entertainment venues , and smoking rooms worldwide [ 11 - 15 ] . our results support previous data in that we observed that shs exposure in pc rooms was very high and that the partial smoking ban is unlikely to protect individuals in non - smoking areas from shs exposure . by means of an official government report and an article in a major daily newspaper , we announced our findings to the public and informed korean citizens that the most effective protection from shs exposure in non - smoking areas is implementation of a complete smoking ban in pc rooms . although our study sampled only a small number of pc rooms in one city , it supports the necessity of a complete smoking ban . the complete ban on smoking in pc rooms has been in force since january 1 , 2014 . we conclude that our research supports the complete smoking ban and may provide the necessary scientific evidence for other countries that have not yet implemented comprehensive smoke - free policies .

extraskeletal myxoid chondrosarcoma ( emc ) is a rare malignancy with distinctive morphologic , histologic , and immunohistochemical features . it occurs preferentially in men at a 2:1 ratio , with 50% of all cases occurring during the 5th or 6th decade of life . this cancer has historically been described as slow - growing and late to metastasize , with 10-year survival rates ranging from 65 to 78% [ 2 , 3 , 4 ] . wide local excision is the only treatment to date that offers a potential cure for emc . radiation in doses of up to 70 gy has been reported to achieve substantial reduction in tumor size in individual patients , but this modality has not been associated with better outcomes in larger comparative studies . no prospective trials have yet examined the effectiveness of radiation therapy for the treatment of emc . there is little comparative data supporting the superiority of specific chemotherapeutic regimens due to the low incidence of the disease . several reports have claimed responses , but these have tended to be small , such as one retrospective analysis observing 1 partial response out of only 3 patients treated with chemotherapy . larger analyses of multiple different chemotherapeutic regimens have observed no responses [ 2 , 7 ] and a best outcome of stable disease for 6 months occurring in only 25% of patients . to our knowledge , there are no studies that demonstrate a meaningfully effective systemic treatment for emc , and no large prospective trials exist . as such , outcomes for patients with recurrent or metastatic disease that can not be managed by local modalities remain poor , despite its slow progression . though patients may survive for years with systemic involvement , most patients who do not achieve a surgical cure will eventually succumb to their disease . emc with high - grade histology has been reported in rare cases in the literature . it is unclear whether or not there is any relationship between high - grade histology and aggressive clinical behavior . herein , we report on notable clinical and histopathological features of a patient diagnosed with high - grade emc , and discuss the pathologic , prognostic , and genetic characteristics of high - grade emc . a 49-year - old man without a significant past medical history presented to an outside institution in april 2009 with a painful , enlarging left flank mass . he was treated with oral analgesics for several months , before computed tomography of the abdomen in september 2009 revealed a 6.2 4.5 cm solid mass in the subcutaneous tissue of the left flank . pathological review of a biopsy in october 2009 characterized the lesion as high grade ( fnclcc 3/3 ) with numerous mitotic figures . histology was characterized by short , anastomosing chords and strands of ovoid cells with eosinophilic cytoplasm within a myxoid matrix , areas of necrosis , and nodularity ( fig . immunohistochemistry was positive for vimentin and synaptophysin , supporting the diagnosis of emc [ 4 , 9 ] . the mass had grown to 7.7 7.8 cm , but no treatment was initiated at this time . in january of 2010 the patient was referred to surgical oncology at bellevue hospital center ( bhc ) ; however , he presented to the emergency department before his scheduled appointment due to uncontrollable flank pain . his physical exam on arrival to bhc was notable for a large , fungating mass protruding from his posterior left flank at the costal margin . ct imaging showed that the mass had now grown to 12.4 10.4 13.2 cm and was invading the musculature of the abdominal wall ( fig . a retrocrural lymph node measured 2.7 1.6 cm , but it was not biopsied . all other images in january 2010 , including bone scan and brain mri , were unremarkable and not suggestive of distant metastases . the morphology was consistent with the cellular variant for emc , though there were none of the typical , less - cellular areas that , when present , allow definitive diagnosis of the cellular variant of emc . immunohistochemical staining was consistent with emc , showing positivity for vimentin and synaptophysin ( fig . 3d ) [ 4 , 9 ] , focal positivity of neuron - specific enolase , and cytokeratin . ema , positive in the biopsy performed in 2009 , was now negative , as were s-100 , desmin , gfap , and anti - smooth muscle actin , also consistent with this diagnosis . there were up to 10 mitotic figures per 10 high power fields , extensive areas of necrosis , and positive ki-67 staining in over 95% of cells ( fig . cytogenetic studies did not identify the common t(9:22)(q22;q11 ) translocation , nor the other documented translocations involving 17q11 , 15q21 , or 3q11 - 12 . the patient subsequently developed a second mass located in the right flank which was removed by excisional biopsy in march 2010 . he soon developed increasing pain from a rapidly growing , locally recurrent mass in his left flank . the mass was visible by imaging studies and physical examination , though no biopsy of the resection bed was performed to confirm local recurrence . additional imaging revealed emergence of abdominal lymphadenopathy ( now involving the retrocrural , para - aortic , common iliac , and external iliac nodes ) and interval development of two discrete nodules in the left adrenal gland . further surgery was not deemed beneficial , and the patient underwent chemotherapy , first with one cycle of cisplatin and adriamycin and then with one cycle of ifosfamide , adriamycin , and vincristine , in april 2010 . he continued to have rapid growth of the left flank mass as well as the nodal disease despite chemotherapy . the patient consequently deteriorated clinically and was referred for palliative radiation and transitioned to supportive care . our developing understanding of emc is that this disease may be less indolent than previously believed , given its high rates of recurrence and propensity for lung metastasis . the single largest study of emc found that approximately one half of patients will experience local recurrence after resection , and one half will develop metastatic disease . this is in line with findings from smaller studies that a majority of patients will experience some form of recurrence after surgical treatment . predicted 21% disease - free survival at 10 years , and antonescu et al . observed an overall metastasis rate of 65% the development of metastasis decreases the likelihood of survival [ 2 , 3 ] , but this is variable . median survival after detection of metastasis has been reported from 1.7 years to 5.5 years , with individuals surviving up to 14 years after spread of emc to the lung . given the exquisite rarity of this uncommon subtype of an uncommon malignancy , high - grade emc has been difficult to study and remains poorly characterized . the tumor in this case was remarkable for its aggressive histologic appearance and clinical behavior , both of which are atypical for emc . the initial histology on first biopsy was characteristic for emc by morphology and surface markers . however , when surgically excised several months later , the morphology was hypercellular with no resemblance to typical emc . this transformation suggests that dedifferentiation had occurred , a process seen not uncommonly in aggressive malignancies . this patient had a number of factors age > 45 years , large primary tumor , tumor located on trunk rather than extremity that have previously been identified as poor prognostic features for emc [ 3 , 4 ] . however , it remains unclear whether histological signs of aggressive behavior , such as dedifferentiation , ki-67 staining , mitotic rate , and necrosis provide additional prognostic information . anecdotally , our case is remarkably similar to a previously reported case of emc , in which excision of the primary mass was followed by growth of a recurrent , dedifferentiated tumor and rapid clinical deterioration with metastatic disease . several small studies of emc found that high - grade lesions were associated with a worse prognosis . the presence of rhabdoid cells was correlated with worse outcomes in a series of 36 patients . a follow - up study of 20 patients with emc found that high - grade tumors were associated with shorter overall survival ( p = 0.045 ) ; tumor grade showed a trend toward increased likelihood of metastasis , but this finding was not statistically significant ( p = 0.065 ) . a study of 23 patients found that high cellularity , atypia , and the presence of focal regions of ki-67 staining above 25% were all significant predictors of lower overall survival . necrosis and ki-67 labeling were significant predictors of metastasis , and metastasis predicted worse survival . however , neither necrosis , ki-67 staining , high cellularity , mitotic activity , nor atypia were statistically significant independent predictors of worse prognosis . the only report dedicated solely to high - grade emc , a case series , observed survival times of 2 , 3.5 , and 10 months from diagnosis in the 3 patients for whom full follow - up was available . this study is limited by the small size of its cohort , but it supports the conclusion that the median survival for high - grade emc is shorter than that of lower - grade disease . emc genetics are typically defined by one of several chromosomal translocations involving the tec gene . the t(9:22)(q22q11 ) translocation and/or the resultant ewsr1/tec fusion product is identifiable in approximately 70% of emc cases . another fusion product , rbp56/tec , associated with translocation t(9:17)(q22;q11.2 ) , is the primary mutation in an additional 15% of emc . interestingly , none of these translocations were found on cytogenetic analysis in this case . while the presence of these mutations is typically confirmatory of a diagnosis of emc , there are documented cases in which no known tec translocation was identifiable using conventional methods . one such study of 18 emc cases found 12 tumors with ewsr1/tec and 3 with rbp56/tec by rt - pcr , but 3 tumors had no identifiable fusion products . these results raise the possibility that other unidentified molecular abnormalities contribute to the pathogenesis of emc . the two most common fusion products , eswr1/tec and rbp56/tec , are found in only 90% of emcs , leaving room for tcf12/tec , tgf / tec , and potentially other undescribed molecular abnormalities . our developing understanding of emc is that this disease may be less indolent than previously believed , given its high rates of recurrence and propensity for lung metastasis . the single largest study of emc found that approximately one half of patients will experience local recurrence after resection , and one half will develop metastatic disease . this is in line with findings from smaller studies that a majority of patients will experience some form of recurrence after surgical treatment . predicted 21% disease - free survival at 10 years , and antonescu et al . observed an overall metastasis rate of 65% the development of metastasis decreases the likelihood of survival [ 2 , 3 ] , but this is variable . median survival after detection of metastasis has been reported from 1.7 years to 5.5 years , with individuals surviving up to 14 years after spread of emc to the lung . given the exquisite rarity of this uncommon subtype of an uncommon malignancy , high - grade emc has been difficult to study and remains poorly characterized . the tumor in this case was remarkable for its aggressive histologic appearance and clinical behavior , both of which are atypical for emc . the initial histology on first biopsy was characteristic for emc by morphology and surface markers . however , when surgically excised several months later , the morphology was hypercellular with no resemblance to typical emc . this transformation suggests that dedifferentiation had occurred , a process seen not uncommonly in aggressive malignancies . this patient had a number of factors age > 45 years , large primary tumor , tumor located on trunk rather than extremity that have previously been identified as poor prognostic features for emc [ 3 , 4 ] . however , it remains unclear whether histological signs of aggressive behavior , such as dedifferentiation , ki-67 staining , mitotic rate , and necrosis provide additional prognostic information . anecdotally , our case is remarkably similar to a previously reported case of emc , in which excision of the primary mass was followed by growth of a recurrent , dedifferentiated tumor and rapid clinical deterioration with metastatic disease . several small studies of emc found that high - grade lesions were associated with a worse prognosis . the presence of rhabdoid cells was correlated with worse outcomes in a series of 36 patients . a follow - up study of 20 patients with emc found that high - grade tumors were associated with shorter overall survival ( p = 0.045 ) ; tumor grade showed a trend toward increased likelihood of metastasis , but this finding was not statistically significant ( p = 0.065 ) . a study of 23 patients found that high cellularity , atypia , and the presence of focal regions of ki-67 staining above 25% were all significant predictors of lower overall survival . necrosis and ki-67 labeling were significant predictors of metastasis , and metastasis predicted worse survival . however , neither necrosis , ki-67 staining , high cellularity , mitotic activity , nor atypia were statistically significant independent predictors of worse prognosis . the only report dedicated solely to high - grade emc , a case series , observed survival times of 2 , 3.5 , and 10 months from diagnosis in the 3 patients for whom full follow - up was available . this study is limited by the small size of its cohort , but it supports the conclusion that the median survival for high - grade emc is shorter than that of lower - grade disease . emc genetics are typically defined by one of several chromosomal translocations involving the tec gene . the t(9:22)(q22q11 ) translocation and/or the resultant ewsr1/tec fusion product is identifiable in approximately 70% of emc cases . another fusion product , rbp56/tec , associated with translocation t(9:17)(q22;q11.2 ) , is the primary mutation in an additional 15% of emc . interestingly , none of these translocations were found on cytogenetic analysis in this case . while the presence of these mutations is typically confirmatory of a diagnosis of emc , there are documented cases in which no known tec translocation was identifiable using conventional methods . one such study of 18 emc cases found 12 tumors with ewsr1/tec and 3 with rbp56/tec by rt - pcr , but 3 tumors had no identifiable fusion products . these results raise the possibility that other unidentified molecular abnormalities contribute to the pathogenesis of emc . the two most common fusion products , eswr1/tec and rbp56/tec , are found in only 90% of emcs , leaving room for tcf12/tec , tgf / tec , and potentially other undescribed molecular abnormalities . survival even after recurrence is , on average , prolonged , despite ineffective systemic therapy . however , there are reports in the literature suggesting that survival for patients who have high - grade tumors is reduced . subsequent work has failed to demonstrate statistically significant prognostic values of individual high - grade histologic features . it is difficult to draw meaningful conclusions from these studies , given they are not adequately powered to demonstrate a small difference in prognosis between low- and high - grade disease . this patient 's tumor was both exquisitely high - grade by histologic criteria and remarkably aggressive clinically . this behavior stands in stark contrast to the indolent growth that , historically , has typified emc . as others have , this report suggests a relationship between histologic grade and prognosis . larger prospective case series are needed to illustrate a definitive correlation between histologic features and clinical outcomes . another interesting feature in this case is the absence of the typical molecular abnormalities involving the tec gene . this contributes to a body of literature that has demonstrated that a subset of emc patients lacks these abnormalities by initial cytogenetic analysis . some , but not all , of these patients are found to have the characteristic or documented abnormalities following additional testing by more sensitive means . the existence of a subset of patients which demonstrates no identifiable chromosomal or molecular abnormalities by even the most sensitive existing means suggests that other , unknown molecular abnormalities may contribute to emc . further study is necessary to identify and characterize other possible pathogenic mechanisms , and to investigate the potential for correlation between clinical behavior and the various tec gene translocations . this case also reinforces early , wide local excision as the only effective treatment for emc . in concurrence with previous studies , chemotherapy provided no observable response in this patient . given the ineffectiveness of chemotherapy and radiation in the treatment of this disease , early and aggressive surgical resection remains the only opportunity for extended disease - free survival and a small chance of permanent disease eradication . as evidenced by prior larger patient cohorts , wide local excision in patients who present with localized disease offers a marginal but measurable chance for cure . sadly , this patient 's disease went undetected for several months , and the window during which curative resection might have been possible was missed .

before starting the experiment , one needs to prepare the internal solution for the patch clamp recordings , as well as the artificial cerebrospinal fluid ( acsf ) for the hippocampus preparation . you will furthermore need a dissection kit consisting of surgical scissor and fine iris scissor , two spatulas and forceps ( fine science tools ) ; a glass gassing device ( micro - filter candle , robu germany ) and tissue grid ( mosquito net or nylon tight ) , as well as superglue ( uhu dent ) . the configuration of the electrophysiology slice patch setup was described by finkel & bookman , 2001 . for the internal solution , dissolve ( in mm ) : 105 k - gluconate , 30 kcl , 10 hepes and 0.3 egta in deionized water ( in 70 - 80% of the final volume ) . cool the solution to 4 c and add ( in mm ) : 4 atp - mg , 0.3 gtp - tris and 10 phosphocreatine . adjust the ph to 7.4 with koh and fill up with deionized water to the final volume . unless otherwise stated , the acsf used for hippocampus preparation and recordings of cells in the ca1 region , contains ( in mm ) : 119 nacl , 2.5 kcl , 2.5 cacl2 , 1.3 mgso4 , 1 nah2po4 , 26.2 nahco3 and 11 glucose . dissolve these salts in deionized water ( osmolarity ~ 320 mosm ) and oxygenate this solution for at least 10 min ( ph ~ 7.3 - 7.4 ) with carbogen ( 95 % o2 and 5 % co2 ) . particular care should be taken for preparation of hippocampal tissue that will be used to perform experiments in the ca3 region of the hippocampus . thus synaptic activity should be strongly reduced during slice preparation , and this is achieved by performing the hippocampus dissection in ice - cold sucrose solution containing ( in mm ) : 87 nacl , 2.5 kcl , 0.5 cacl2 , 7 mgcl2 , 1 nah2po4 , 25 nahco3 , 10 glucose and 75 sucrose . in this solution , the combination of low sodium , low calcium and high magnesium concentrations massively reduce presynaptic firing and release probability , as well as postsynaptic nmda receptor activity , thus minimizing spontaneous activity and cell death . once prepared , hippocampal slices used for recordings of cells from the ca3 region are perfused with modified acsf , containing 4 mm cacl2 and 4 mgso4 , to minimize polysynaptic activity . cool down ~ 300 ml of acsf for the slicing chamber , as well as for the preparation at 4 c , while constantly oxygenating with carbogen . prepare a small beaker with acsf at room temperature ( rt ) for slice storage , which is also oxygenated with carbogen ( scheme figure 1 ) . anesthetize the mouse under a hood with a small paper towel soaked with 1 ml isoflurane that is added into the cage . after the mouse is deeply anesthetized , cut the head off and add it directly into a small dish with ice - cold oxygenated acsf . remove the scalp with a small scissor and transfer the head onto tissue for the subsequent steps . start to dissect the hippocampus , as illustrated and described in figure 1 . cut 300 - 400 m thick transverse slices at low speed ( 3 m / sec ) and vibration frequency of 70 hz in ice cold oxygenated acsf , and transfer them into a storage chamber . slices for ca3 experiments are stored 25 min at 34 c and at least 30 min at rt , to recover from the slicing process . we here describe how to record synaptically - evoked astroglial and neuronal responses , i.e. responses induced by synapse activation through afference stimulation using an extracellular electrode . constantly perfuse the recording chamber with oxygenated acsf ( 1.5 - 2 ml / min , rt ) , containing 100 m picrotoxin ( gabaa antagonist ) to isolate excitatory responses . transfer a slice onto a poly - l - lysine ( 1.5 to 3 mg / ml ) coated coverslip , soak the liquid to achieve a good slice adhesion and add a drop of ascf on top of the slice . blockade of inhibitory transmission by picrotoxin can result in epileptiform activity , i.e. spontaneous , synchronous firing of neuronal populations , which will distort the measurement of evoked events . thus , to prevent epileptiform activity , make a flat cut ( only the surface ) between the ca1 and ca3 regions to prevent the propagation via the schaffer collaterals ( as indicated in figure 2a ) . stratum radiatum astrocytes can be identified by their small soma size ( ~ 10 m ) and stellate process assembly . mount a glass stimulation electrode ( tip resistance ~ 1 m ) on the silver wire that is connected to the stimulus isolation box and grounded to the bath ( simply by wrapping the second silver wire around the glass pipette ) . place the stimulation electrode into the schaffer collateral region , as indicated in figure 2a at a distance of 200 - 300 m away from the chosen astrocyte . mount the field recording electrode ( ~2 - 5 m ) onto a chlorinated silver wire connected to the headstage of the amplifier . choose in multiclamp the mode i=0 , which disables external command input and place the electrode ~ 50 m away from the astrocyte into the stratum radiatum region ( figure 2a ) . record the responses with gain 2 to 10 and filter with a 2 khz bessel filter . electric current injection into the brain slice triggers action potentials in the surrounding schaffer collateral axons and subsequent transmitter release at the presynaptic terminals that project to postsynaptic ca1 pyramidal neurons . the released transmitters will trigger a positive charge flow into the cells through postsynaptic ionotropic receptors , which is measurable extracellularly as a small negative potential . this field excitatory postsynaptic potential ( fepsp ) integrates the activity of a group of simultaneously active neurons , while inhibitory transmission is blocked pharmacologically . apply some test pulses ( 0.1 msec duration ) to evoke a fepsp ; some repositioning of the stimulation electrode might help to increase the fepsp . a typical ca1 stratum radiatum fepsp is illustrated in figure 2b . further details on positioning and response waveforms can be found in yuan et al . 2003 . the fepsp amplitude in a healthy hippocampal slice should usually be more than twice as big as the amplitude of the fiber volley . for accurate quantification of fepsp amplitude or slope , the evoked reponse should be monosynaptic , as polysynaptic activity ( detectable as a multi - peak response ) indicates synaptic activity independent of the electrical stimulation , which could be a sign for hyperexcitability . for experiments performed in the ca3 region of the hippocampus , stimulation and recording pipettes are positioned as illustrated in figure 3c . to clearly identify mossy fiber inputs , which are strongly facilitating , paired - pulse stimulation ( 50 msec interpulse interval ) and 1 hz stimulation for a few seconds are applied to massively enhance the initially low amplitude evoked fepsp responses.at the end of the experiment , dcgiv , a mglur2/3 receptor antagonist , can be washed in to further verify that indeed mossy fiber inputs were stimulated . application of this antagonist should reduce the fepsp by ~ 90% due to the high expression of mglur2/3 receptors , inhibiting presynaptic release from mossy fiber boutons . fill a patch pipette ( ~ 2 - 5 m ) with filtered internal solution and mount it onto a chlorinated silver wire connected to the second headstage , apply positive pressure with a syringe , which is connected via tubing to your pipette holder . constantly apply a 20 msec test pulse of 10 mv and move the pipette into the tissue until you reach the cell surface and a deflection in the membrane becomes visible . zero the pipette offset , remove the positive pressure , and clamp the membrane to - 80 mv . wait until a gigaseal ( at least 1 g ) is reached ( it should not take longer than several seconds ) break into the cell is achieved by a short application of negative pressure or using the zap function in multiclamp . start the simultaneous recording of the schaffer collateral evoked fepsp and the astroglial response in voltage clamp ( vhold - 80 mv ; frequency 0.1 hz , bessel filter 2 khz , gain 10 ) . the astroglial current response is biphasic : first you will see a fast transient outward current , reflecting fepsps generated by adjacent pyramidal cells . this is followed by a slowly rising and decaying inward current ( persisting several seconds ( > 10 sec ) after termination of neuronal responses ) . this current is mainly due to potassium entry into astrocytes , following release by surrounding depolarized postsynaptic terminals . a simultaneously activated fast transient glutamate transporter current ( glt ) , triggered by presynaptic glutamate release is masked by the potassium current . the holding potential of the astrocyte , as well as the access resistance of the patch should be monitored throughout the experiment and should not vary more than ~ 20% , to avoid inaccurate monitoring of astroglial reponses due to changes in the recording conditions . only astrocytes with an initial holding potential > -70 mv should be investigated to study healthy cells . switch from voltage to current - clamp in order to record the evoked astrocytic membrane depolarization . isolate the glial glutamate transporter ( glt ) current by perfusion of the ionotropic glutamate receptor blocker kynurenic acid ( 5 mm ) , until the fepsp is fully blocked and the glt amplitude has reached a plateau . to clearly identify the glt current , apply the specific antagonist dl - threo--benzyloxyaspartatic acid ( dl - tboa , 200 m ) . increase the stimulation strength by 2-fold to 5-fold to record neuronal and astroglial responses at different synaptic strength , and apply two closely spaced stimuli ( 50 msec interval ) to investigate responses to paired pulse stimulation . stability of series resistance and membrane potential of the glial cell should be monitored throughout the recording . to visualize the extent of the gap - junction mediated astroglial networks , dye - coupling experiments should be performed in current clamp mode , without any current injection , to enable passive diffusion of low molecular dyes ( < 1.5 kda ) , such as sulforhodamine - b , through gap junction channels . to minimize dye spillover into the surrounding tissue , positive pressure should be applied through the patch pipette just when entering the tissue and the patch should be reached as soon as possible . before starting the experiment , one needs to prepare the internal solution for the patch clamp recordings , as well as the artificial cerebrospinal fluid ( acsf ) for the hippocampus preparation . you will furthermore need a dissection kit consisting of surgical scissor and fine iris scissor , two spatulas and forceps ( fine science tools ) ; a glass gassing device ( micro - filter candle , robu germany ) and tissue grid ( mosquito net or nylon tight ) , as well as superglue ( uhu dent ) . the configuration of the electrophysiology slice patch setup was described by finkel & bookman , 2001 . for the internal solution , dissolve ( in mm ) : 105 k - gluconate , 30 kcl , 10 hepes and 0.3 egta in deionized water ( in 70 - 80% of the final volume ) . cool the solution to 4 c and add ( in mm ) : 4 atp - mg , 0.3 gtp - tris and 10 phosphocreatine . adjust the ph to 7.4 with koh and fill up with deionized water to the final volume . unless otherwise stated , the acsf used for hippocampus preparation and recordings of cells in the ca1 region , contains ( in mm ) : 119 nacl , 2.5 kcl , 2.5 cacl2 , 1.3 mgso4 , 1 nah2po4 , 26.2 nahco3 and 11 glucose . dissolve these salts in deionized water ( osmolarity ~ 320 mosm ) and oxygenate this solution for at least 10 min ( ph ~ 7.3 - 7.4 ) with carbogen ( 95 % o2 and 5 % co2 ) . particular care should be taken for preparation of hippocampal tissue that will be used to perform experiments in the ca3 region of the hippocampus . thus synaptic activity should be strongly reduced during slice preparation , and this is achieved by performing the hippocampus dissection in ice - cold sucrose solution containing ( in mm ) : 87 nacl , 2.5 kcl , 0.5 cacl2 , 7 mgcl2 , 1 nah2po4 , 25 nahco3 , 10 glucose and 75 sucrose . in this solution , the combination of low sodium , low calcium and high magnesium concentrations massively reduce presynaptic firing and release probability , as well as postsynaptic nmda receptor activity , thus minimizing spontaneous activity and cell death . once prepared , hippocampal slices used for recordings of cells from the ca3 region are perfused with modified acsf , containing 4 mm cacl2 and 4 mgso4 , to minimize polysynaptic activity . cool down ~ 300 ml of acsf for the slicing chamber , as well as for the preparation at 4 c , while constantly oxygenating with carbogen . prepare a small beaker with acsf at room temperature ( rt ) for slice storage , which is also oxygenated with carbogen ( scheme figure 1 ) . anesthetize the mouse under a hood with a small paper towel soaked with 1 ml isoflurane that is added into the cage . after the mouse is deeply anesthetized , cut the head off and add it directly into a small dish with ice - cold oxygenated acsf . remove the scalp with a small scissor and transfer the head onto tissue for the subsequent steps . cut 300 - 400 m thick transverse slices at low speed ( 3 m / sec ) and vibration frequency of 70 hz in ice cold oxygenated acsf , and transfer them into a storage chamber . slices for ca3 experiments are stored 25 min at 34 c and at least 30 min at rt , to recover from the slicing process . we here describe how to record synaptically - evoked astroglial and neuronal responses , i.e. responses induced by synapse activation through afference stimulation using an extracellular electrode . constantly perfuse the recording chamber with oxygenated acsf ( 1.5 - 2 ml / min , rt ) , containing 100 m picrotoxin ( gabaa antagonist ) to isolate excitatory responses . transfer a slice onto a poly - l - lysine ( 1.5 to 3 mg / ml ) coated coverslip , soak the liquid to achieve a good slice adhesion and add a drop of ascf on top of the slice . blockade of inhibitory transmission by picrotoxin can result in epileptiform activity , i.e. spontaneous , synchronous firing of neuronal populations , which will distort the measurement of evoked events . thus , to prevent epileptiform activity , make a flat cut ( only the surface ) between the ca1 and ca3 regions to prevent the propagation via the schaffer collaterals ( as indicated in figure 2a ) . stratum radiatum astrocytes can be identified by their small soma size ( ~ 10 m ) and stellate process assembly . mount a glass stimulation electrode ( tip resistance ~ 1 m ) on the silver wire that is connected to the stimulus isolation box and grounded to the bath ( simply by wrapping the second silver wire around the glass pipette ) . place the stimulation electrode into the schaffer collateral region , as indicated in figure 2a at a distance of 200 - 300 m away from the chosen astrocyte . mount the field recording electrode ( ~2 - 5 m ) onto a chlorinated silver wire connected to the headstage of the amplifier . choose in multiclamp the mode i=0 , which disables external command input and place the electrode ~ 50 m away from the astrocyte into the stratum radiatum region ( figure 2a ) . record the responses with gain 2 to 10 and filter with a 2 khz bessel filter . electric current injection into the brain slice triggers action potentials in the surrounding schaffer collateral axons and subsequent transmitter release at the presynaptic terminals that project to postsynaptic ca1 pyramidal neurons . the released transmitters will trigger a positive charge flow into the cells through postsynaptic ionotropic receptors , which is measurable extracellularly as a small negative potential . this field excitatory postsynaptic potential ( fepsp ) integrates the activity of a group of simultaneously active neurons , while inhibitory transmission is blocked pharmacologically . apply some test pulses ( 0.1 msec duration ) to evoke a fepsp ; some repositioning of the stimulation electrode might help to increase the fepsp . a typical ca1 stratum radiatum fepsp is illustrated in figure 2b . the fepsp amplitude in a healthy hippocampal slice should usually be more than twice as big as the amplitude of the fiber volley . for accurate quantification of fepsp amplitude or slope , the evoked reponse should be monosynaptic , as polysynaptic activity ( detectable as a multi - peak response ) indicates synaptic activity independent of the electrical stimulation , which could be a sign for hyperexcitability . for experiments performed in the ca3 region of the hippocampus , stimulation and recording pipettes are positioned as illustrated in figure 3c . to clearly identify mossy fiber inputs , which are strongly facilitating , paired - pulse stimulation ( 50 msec interpulse interval ) and 1 hz stimulation for a few seconds are applied to massively enhance the initially low amplitude evoked fepsp responses.at the end of the experiment , dcgiv , a mglur2/3 receptor antagonist , can be washed in to further verify that indeed mossy fiber inputs were stimulated . application of this antagonist should reduce the fepsp by ~ 90% due to the high expression of mglur2/3 receptors , inhibiting presynaptic release from mossy fiber boutons . fill a patch pipette ( ~ 2 - 5 m ) with filtered internal solution and mount it onto a chlorinated silver wire connected to the second headstage , apply positive pressure with a syringe , which is connected via tubing to your pipette holder . constantly apply a 20 msec test pulse of 10 mv and move the pipette into the tissue until you reach the cell surface and a deflection in the membrane becomes visible . zero the pipette offset , remove the positive pressure , and clamp the membrane to - 80 mv . wait until a gigaseal ( at least 1 g ) is reached ( it should not take longer than several seconds ) break into the cell is achieved by a short application of negative pressure or using the zap function in multiclamp . start the simultaneous recording of the schaffer collateral evoked fepsp and the astroglial response in voltage clamp ( vhold - 80 mv ; frequency 0.1 hz , bessel filter 2 khz , gain 10 ) . the astroglial current response is biphasic : first you will see a fast transient outward current , reflecting fepsps generated by adjacent pyramidal cells . this is followed by a slowly rising and decaying inward current ( persisting several seconds ( > 10 sec ) after termination of neuronal responses ) . this current is mainly due to potassium entry into astrocytes , following release by surrounding depolarized postsynaptic terminals . a simultaneously activated fast transient glutamate transporter current ( glt ) , triggered by presynaptic glutamate release is masked by the potassium current . the holding potential of the astrocyte , as well as the access resistance of the patch should be monitored throughout the experiment and should not vary more than ~ 20% , to avoid inaccurate monitoring of astroglial reponses due to changes in the recording conditions . only astrocytes with an initial holding potential > -70 mv should be investigated to study healthy cells . switch from voltage to current - clamp in order to record the evoked astrocytic membrane depolarization . isolate the glial glutamate transporter ( glt ) current by perfusion of the ionotropic glutamate receptor blocker kynurenic acid ( 5 mm ) , until the fepsp is fully blocked and the glt amplitude has reached a plateau . to clearly identify the glt current , apply the specific antagonist dl - threo--benzyloxyaspartatic acid ( dl - tboa , 200 m ) . increase the stimulation strength by 2-fold to 5-fold to record neuronal and astroglial responses at different synaptic strength , and apply two closely spaced stimuli ( 50 msec interval ) to investigate responses to paired pulse stimulation . stability of series resistance and membrane potential of the glial cell should be monitored throughout the recording . to visualize the extent of the gap - junction mediated astroglial networks , dye - coupling experiments should be performed in current clamp mode , without any current injection , to enable passive diffusion of low molecular dyes ( < 1.5 kda ) , such as sulforhodamine - b , through gap junction channels . to minimize dye spillover into the surrounding tissue , positive pressure should be applied through the patch pipette just when entering the tissue and the patch should be reached as soon as possible . a representative simultaneous recording of synaptically - evoked astroglial and neuronal responses ( fepsps ) in the ca1 area of the hippocampus is shown in figure 2 a - b . the evoked astroglial current is biphasic , i.e. it consists of a transient outward current and a slowly decaying inward current ( > 10 sec ) ( figure 2b ) . the outward current reflects the evoked fepsp , and is blocked after inhibition of ionotropic glutamate receptors by kynurenic acid ( dark grey trace , figure 2b ) . the majority of the slow inward current reflects potassium entry into the astrocyte following postsynaptic depolarization , since it is also abolished by kynurenic acid , which inhibits postsynaptic ionotropic glutamate receptor activity ( figure 2b and figure 2c1 ) , known to represent the main source ( 80 % ) of potassium release . the remaining rapidly rising and decaying inward current is inhibited by the glt antagonist dl - tboa ( light grey trace , figure 2b and figure 2c2 ) . post - hoc subtraction of the remaining slow current in tboa ( light grey trace ) from the current in kynurenic acid ( dark grey trace ) allows the isolation of the pure astroglial glutamate transporter current ( black trace ) , as illustrated in figure 2c2 . the persistent slowly decaying current in kynurenic acid and tboa ( light grey trace , figure 2b and figure 2c2 ) can be blocked by ttx ( data not shown ) , and reflects most likely the accumulation of extracellular k released during presynaptic afferent firing . moderate single stimulation of schaffer collaterals induces a relatively large synaptically - evoked astroglial current compared to the small evoked depolarization recorded in the same cell ( figure 2d ) . recording of the synaptically - evoked astroglial membrane potential dynamics , as illustrated in figure 2d , is a direct measure of local extracellular potassium levels . normalization of the evoked astroglial responses to the underlying neuronal activity allows the direct comparison of different experiments , as recently shown . astroglial currents can furthermore monitor very reliably alterations in excitatory transmission , as the total synaptically - evoked astroglial current follows linearly the increase in the fepsp ( figure 2e ) . astroglial currents also reflect short - term synaptic plasticity , since they show , as neurons , paired - pulse facilitation ( figure 2f ) . paired whole - cell recording of a ca1 pyramidal cell and an astrocyte reveal very different electrophysiological behavior in both cell types , since the neuron display action potentials in response to a depolarizing pulse , while the neighboring astrocyte is silent ( figure 3a - b ) . however , moderate stimulation of the schaffer collaterals can evoke simultaneously a fast excitatory posynaptic potential in the ca1 pyramidal cell and a fast outward and slow inward currents in the adjacent astrocyte ( figure 3b2 ) . dual recordings of synaptically - evoked neuronal and astroglial responses can also be recorded in the ca3 area of the hippocampus , as shown in figure 3c . indeed , single stimulation of ca3 mossy fibers evokes in basal conditions very small neuronal responses , recorded as local fepsps , associated to small fast outward and slow inward currents in astrocytes ( figure 3d1 ) . in contrast , 1 hz stimulation of ca3 mossy fibers for a few seconds strongly potentiates the fepsp , while it only moderately increases the astroglial response ( figure 3d2 ) . make a coronal cut at the level of the olfactory bulb ( b ) and subsequently at the level of the cerebellum ( c ) . carefully remove the scull with the help of a forceps ( d ) , separate the two hemispheres with a blade ( e ) , and transfer them on a small spoon into cold oxygenated acsf ( f ) . after ~ 5 min equilibration , place one hemisphere on dry tissue with the medial surface up ( g ) . with the help of two spoons the hippocampus is now visible , as illustrated by the dashed lines ( k ) . dissect the hippocampus with a spoon out , starting from the fimbria , visible as white structure ( l - m ) . prepare a small agarose - block , position the two hippocampi with the alveus side up and the ventral hippocampus facing the edge of the agar block , and soak carefully all liquid away to allow a good attachment to the agar ( n ) . glue the hippocampus attached to the agar block onto the ventral part ( o ) . simultaneous neuronal and astroglial responses evoked - synaptically in the ca1 area of the hippocampus . a ) scheme of the hippocampal slice illustrating the arrangement of the stimulating electrode , to activate the schaffer collaterals ( sc ) , the patch pipette electrode , to record astrocytic currents , and the extracellular electrode , to record fepsp , evoked by sc stimulation in the hippocampal ca1 area . b ) representative traces of simultaneous recordings of fepsps ( upper panel ) and astrocytic currents ( lower panel ) evoked - synaptically by sc stimulation in the presence of pharmacological drugs . the responses are first recorded in the presence of a gabaa receptor blocker ( picrotoxin , 100 m , black traces ) to isolate excitatory responses . subsequent application of an ionotropic glutamate receptor blocker ( kynurenic acid , 5 mm , dark grey traces ) , inhibits the fepsp and the major part of the long - lasting astroglial current , unmasking a small and fast transient component of the astrocytic current response , which is sensitive to a glutamate transporter blocker ( tboa , 200 m , light grey traces ) . sample trace of the astroglial potassium current ( 1 - 2 ) , which can be isolated from the evoked response , shown in b ( lower panel , black trace ) , by subtracting the current component remaining in kynurenic acid ( 2 ) from the total current ( 1 ) . c2 ) sample trace of the glutamate transporter current ( 2 - 3 ) , obtained by subtraction of the tboa insensitive slow component ( 3 ) from the current in kynurenic acid ( 2 ) . d ) sample traces of an inward current recorded in voltage - clamp ( lower panel ) and the corresponding membrane depolarization recorded in current - clamp ( upper panel ) induced in an astrocyte by sc stimulation . scale bar , current - clamp 1.5 mv , voltage - clamp 5 pa , 1 sec . e ) input - output curves illustrating the relationship between the presynaptic fiber volleys ( input ) and the total astroglial current ( output ) recorded simultaneously in response to sc stimulation ( n = 6 ) . the astroglial current increases linearly with the increased fiber volleys , as the neuronal fepsp . f ) sample traces of the neuronal response ( fepsp ) and the astrocytic current are shown for paired - pulse stimulation at a 40 msec interpulse interval . the synaptically - evoked astroglial current exhibits , like neurons , paired - pulse facilitation . dual recordings of synaptically - induced neuronal and astroglial responses in the ca1 and ca3 areas of the hippocampus . a ) reconstruction of a ca1 pyramidal cell injected with sulforhodamine - b ( red , 0.1 % ) and an astrocyte filled with fluorescein dextran ( green , 0.1 % ) , using the whole - cell patch - clamp technique . b1 ) representative traces of simultaneous whole - cell recordings of membrane potentials recorded in current - clamp from a ca1 pyramidal cell and an adjacent astrocyte . neuronal action potential firing ( black trace ) , evoked by injection of a 20 pa depolarizing current pulse , evokes no response in the adjacent astrocyte ( grey trace ) . b2 ) sample traces of dual whole - cell recordings of a ca1 pyramidal cell in current - clamp and a neighboring astrocyte in voltage - clamp after sc stimulation in the presence of picrotoxin ( 100 m ) . sc stimulation evokes an excitatory postsynaptic potential ( epsp , black trace ) , associated to a small and long - lasting astrocytic current ( grey trace ) . c ) scheme of the hippocampal slice depicting in the dentate gyrus ( dg ) and ca3 areas the arrangement of the stimulating electrode , to activate the mossy fibers , the patch pipette electrode ( grey ) , to record astrocytic currents , and the extracellular electrode , to record fepsp , evoked by ca3 mossy fibers stimulation . d , e ) representative traces of paired recordings of ca3 fepsps ( upper panels , black traces in d1 and d2 ) and astrocytic whole - cell responses ( lower panels , grey traces in d1 and d2 ) to single stimulation of ca3 mossy fibers at 0.02 hz ( zoom in the inset ) ( d1 ) or at 1 hz stimulation frequency ( d2 ) . scale bar for d1 and d2 , 0.2 mv , 15 pa , time : d1 1 sec ; d2 100 msec . dual recording of synaptically - induced neuronal and glial responses is a useful method to study online alterations in pre- and postsynaptic activities associated to changes in astroglial properties . the synaptically - evoked glial membrane depolarization is a direct measure of the extracellular potassium rise , due in part to presynaptic action potential firing , but mostly to postsynaptic depolarization . therefore recordings of glial membrane potential dynamics can be used to investigate modifications in presynaptic excitability , postsynaptic activity , extracellular space volume and potassium buffering capacities . the astroglial glutamate transporter current is a sensitive measure of presynaptic glutamate release , able to monitor short - term changes in release probability . it can furthermore be used to characterize the functional synapse - glia interactions at different synapses or at different developmental stages . it should be highlighted that glts are highly temperature sensitive and are driven by the electrochemical gradient of na , k and h. thus the amplitude and kinetics of the glt current highly depend on the chosen experimental conditions . furthermore , the actual time course of astroglial glutamate clearance derived from the recorded glt current is known to be partially obscured . this is due to the filtering of glt currents by factors such as the electrotonic properties of astrocytes or the asynchronous transmitter release , which distort their kinetics . methods extracting the temporal features of the filtering mechanisms have been developed and can be used to derive the actual glutamate clearance time course in physiological or pathological situations , as recenly performed . additionally , the simultaneous recording of the astroglial membrane depolarization , in current clamp , can provide insights into possible alterations of extracellular potassium transients . single astrocytes contact up to 100,000 synapses of ~ 100 different neurons , and do therefore integrate and modulate the activity of local neuronal networks . when using the technique presented here , i.e. recording electrophysiological whole - cell responses from astrocytes to gain insights into basal synaptic activity , one should keep in mind that in astrocytes , patch - clamp recordings at the soma level allow detecting currents mostly originating from the cell soma or proximal processes . indeed , currents detected at the soma only partially originate from fine distal processes when a strong activation of receptors and channels occuring in multiple fine processes can generate currents propagating to the cell soma . thus basal receptor and channel activity in individual small astroglial processes covering synaptic compartments is hardly detectable . this is due in part to the limited spatial and temporal control of membrane currents and voltages by whole - cell patch - clamp recordings from astrocytes in situ . however , it should be noted that the surface of the abundant tiny astrocytic processes exceeds by far the membrane area of the soma and main processes . in addition , these perisynaptic astroglial microdomains contain the functionally relevant receptors and channels , which likely play an important role in neuroglial communication and synaptic regulation . the technique we presented here is therefore mostly useful to study the astrocytic integration of synchronous activity from neuronal ensembles , occurring in particular during afference stimulation . it should not be used to study the dialogue between individual synapses and adjacent fine astrocytic processes occurring during basal spontaneous activity . an alternative method to study local astroglial responses induced by basal synaptic activity would be to perform patch - clamp recordings from fine processes , as done in dendrites . although patching these fine astroglial processes is likely challenging due to their small size , it is probably an avenue to pursue to unravel more intimate dialog between astroglial microdomains and individual synapses . however , the likely small electrophysiological astroglial responses resulting from individual fine astroglial processes may be below threshold detection , since electrical noise reaches in average 3 - 5 pa in patch - clamp recordings . another method to study astroglial responses to synaptic activity is calcium imaging , since activation of astrocytic membrane receptors or transporters by neuroactive substances can trigger intracellular calcium transients . however , bulk loading of astrocytes with calcium indicators may also mainly reflect somatic activity . the combination of electrophysiology and calcium imaging also enables detecting small calcium signals from fine astroglial processes , either occurring spontaneously or triggered by minimal synaptic stimulation . however , one should keep in mind that high - affinity calcium indicators might act like calcium buffers , inhibiting important calcium signaling pathways , whereas low - affinity indicators might work below detection level . finally , an elegant and non - invasive technique to study calcium events in fine astrocytic processes , which also circumvents the washout of intracellular signaling molecules during whole - cell patch - clamp , consists in using a membrane targeted calcium sensor , which can be expressed in astrocytes in situ , as well as in vivo however , calcium imaging can only provide information about one signaling molecule , which is involved in many , but not all cellular activities , whereas whole - cell patch - clamp provides quantitative information about all the different ionic currents triggered upon channel and receptor activation . therefore simultaneous electrophysiological recordings from neurons and astrocytes are a unique and powerful method to unravel online the dynamics of neuroglial ionic signalling and its role brain information processing .

we conducted a prospective case control study ( case : control ratio 1:3.5 ) of patients admitted to ttsh during june 21november 21 , 2015 ( epidemiologic weeks 2546 ) . using a standardized , interviewer - administered questionnaire , we collected information on food exposure history , in particular consumption of raw or undercooked fish , beef , eggs , and vegetables , during the 2 weeks before admission . information on demographics , clinical history , and laboratory results were obtained from medical records . all gbs isolates were sent to the national public health laboratory and serotyped by pcr ( 3 ) and genotyped by multilocus sequence typing using a standard s. agalactiae strain ( 4 ) . we defined case - patients as inpatients at ttsh during epidemiologic weeks 2546 who had laboratory - confirmed gbs infections detected in samples from any sterile site ( blood , synovial fluid , cerebrospinal fluid ) ( 5 ) within 48 hours after admission ( 6 ) . controls were defined as inpatients at ttsh with negative culture results for any sterile site ( i.e. , without invasive disease ) within 48 hours after admission . we compared characteristics , food and nonfood exposures , and clinical presentation of persons infected with st283 with those infected with non - st283 and controls ( table 1 ) . we constructed a multivariable logistic regression model based on major variables of interest from univariable analysis to assess for independent factors associated with st283 and non - st283 infections ( table 2 ) . aor , adjusted odd ratio ; nc , not calculable ; st , sequence type . a total of 22 case - patients ( 17 with bacteremia , 2 with septic arthritis , and 3 with bacteremia complicated by meningitis , epidural space abscess , and septic arthritis ) and 76 controls ( 73 provided blood , 2 provided joint fluid , 1 provided both ) were included in this study . among 22 case - patients , none of the other serotype iii strains , namely st17 ( 1 ) and a new st not previously reported ( 1 ) , were single - locus variants of st283 . other serotypes not typed were ia ( 3 ) , ii ( 5 ) , v ( 2 ) , and vii ( 1 ) . most ( 8/9 ) st283 infections were identified during epidemiologic weeks 2529 , before suspension of sale of raw fish dishes . during epidemiologic weeks 3046 , only 1 st283 case was identified , compared with 10 ( 77% ) of 13 of non - st283 cases . persons infected with st283 tended to be younger than persons infected with non - st283 ( median age 59.4 years vs. 74.0 years ) ( p = 0.033 ) , and they were also less likely to have a preexisting medical condition ( 33.3% vs. 84.6% ; p = 0.014 ) . seven ( 77.8% ) of 9 st283-infected patients had eaten raw or undercooked fish < 2 weeks before admission , compared with 0 of non - st283infected patients ( p<0.001 ) and 3 controls ( p<0.001 ) . two of the st283-infected patients who had eaten raw or undercooked fish had also eaten raw or undercooked beef . st283-infected persons were more likely than controls to have high fever ( temperature > 38c ) and musculoskeletal pain ( 55.6% vs 10.5% ; p<0.001 ) ; however , this comparison was not significant for persons with non - st283infection ( 23.1% ; p = 0.12 ) . only 45 ( 60% ) controls had a noninvasive infection . multivariate analysis showed that eating raw or undercooked fish during the 2 weeks before admission was independently associated with st283 infection , but not with non - st283 infection ( table 2 ) , when compared with controls . none of the non - st283infected patients had eaten raw or undercooked fish during the timeline . we also conducted a subanalysis that compared st283-infected patients with onset up to epidemiologic week 29 with controls ( who had similar infection onset and opportunity to purchase and eat raw fish ) . we observed a stronger association with eating raw fish among persons who could purchase raw fish dishes ( adjusted odds ratio 12,423.62 , 95% ci 1.51 to 1.02 10 ; p = 0.04 ) . however , 2 of the st283-infected patients did not report eating raw fish , which suggests other means of acquiring st283 infections . several population - based studies have raised concerns about the increasing incidence of invasive gbs disease in men and nonpregnant women ( 7,8 ) . we report an outbreak of invasive gbs serotype iii st283 infections in men and nonpregnant women . molecular epidemiology studies have showed that st283 strains from fish in asia had the same virulence gene profile as human invasive isolates , which suggests potential exposure of humans and fish to common environmental sources of st283 or transmission of the bacterium between different host species ( 9 ) . fish consumption was associated with an increased risk for acquisition of gbs in a prospective cohort study in the united states ( 10 ) . however , data are limited for the likelihood and routes of interspecies transmission of this strain associated with fish and invasive disease in humans . we found a strong association between consumption of raw or undercooked fish and invasive st283 infections in men and nonpregnant women . being older and having severe concurrent conditions were negatively associated with infection , contrary to findings in previous studies ( 11,12 ) . our findings suggest that non - st283 strains caused symptomatic infection in more susceptible populations ( those with more concurrent conditions ) , whereas st283 might be more invasive and affected less susceptible persons . an additional contributing factor could be differences in food consumption in local populations ; elderly persons and those with severe concurrent conditions might avoid eating raw or undercooked foods ( 13 ) . the finding that no non - st283infected patients had eaten raw or undercooked fish before admission strengthened our hypothesis of a link between the st283 and consumption of raw or undercooked fish . after isolation of st283 from 4% of freshwater fish samples from restaurants , markets , stores , and fisheries , use of freshwater fish in all ready - to - eat raw fish dishes sold at retail food establishments was banned in singapore on december 5 , 2015 ( 14,15 ) . the number of reported invasive gbs infections in singapore has decreased , although sporadic invasive st283 infections have been identified . ttsh has seen no new invasive st283 infections identified since the study ended on november 21 , 2015 , despite continued active case - finding . the relatively small number of st283 and non - st283 infections in this study is a limitation that precludes drawing definitive conclusions . however , isolation of st283 from fish samples , the strong association of raw fish consumption with st283 infection , and the sharp decrease of st283 infections after the food ban strongly suggest a food - related outbreak . although the outbreak of gbs disease in singapore has been controlled , further studies on the virulence , transmissibility , and epidemiology of st283 and risk factors are warranted to better manage future infections .

an estimated $ 58 billion in medical costs are associated with chronic wound complications afflicting over 18 million diabetics in the united states ; 24% of diabetics can expect to undergo limb amputation within their lifetime as the result of a chronic , nonhealing wound . the social and economic burdens of these types of wounds are severe and growing rapidly . while chronicity of the wound likely results from multiple factors such as dysfunctional circulation and compromised immunity , wound bioburden in the form of bacterial biofilm is a major contributing factor in the shift from acute to chronic wound . bacterial biofilms are structured communities of cells that adhere to a surface and display phenotypic heterogeneity . in the case of the wound bed , is sustained via exudate seeping from the wound , resulting in a complex nutritional environment . relatively little is known about the metabolism of these bacterial communities and whether there exists potential small molecule biomarkers associated with their metabolism that could be of diagnostic , prognostic , or therapeutic use . one of the most common , opportunistic , bacterial colonizers found across multiple types of chronic wounds is the gram - positive staphylococcus aureus , which can be either methicillin - resistant ( mrsa ) or methicillin - susceptible ( mssa).s . aureus is a facultative anaerobe that can grow by utilizing either oxygen or nitrate for respiration or by mixed acid fermentation . despite the prevalence of s. aureus in chronic wounds , the basic physiology of this opportunistic pathogen is still poorly understood , especially with regard to the biofilm phenotype . within biofilms , bacterial cells can experience significant environmental heterogeneity , and these microenvironments appear to be related to virulence . it has been postulated that altered metabolism contributes to the higher tolerance of bacterial biofilms to therapeutic agents and , while biofilms have traditionally been regarded as metabolically dormant , recent transcriptomic and proteomic analyses of s. aureus biofilms indicate that cells within a biofilm have active , though altered , metabolic activity relative to planktonic growth . these investigations are , however , distantly removed from direct detection of phenotype . in contrast , metabolomic analysis of small molecule metabolites present in both the extracellular and intracellular environments provides a more direct assessment of the defining characteristics of cellular phenotype . for example , zhu and coworkers investigated the role of selective amino acid uptake by biofilms , suggesting that cells within a biofilm do not have ready access to external electron acceptors necessitating organic acid - producing fermentative strategies and that ammonia generation by arginine deiminase enzymatic activity offsets ph decreases due to accumulation of these organic acids . however , mutational analysis demonstrated that arginine deiminase is not essential for s. aureus biofilm growth . how selective uptake of amino acids by the biofilm impacts biofilm physiology remains an open question , warranting further investigation . correlations between virulence and metabolism have been observed at the transcriptomic , proteomic , and metabolic levels for s. aureus(12,14,15 ) and strain - dependent differences in the biofilm forming capacity of s. aureus have been demonstrated , suggesting a correlation between metabolic activity and pathogenicity ; however , direct time course comparison of metabolic changes between strains that exhibit different virulence traits and between planktonic and biofilm growth conditions have not been performed . in the present study , we have utilized quantitative h nmr spectroscopy to detect and identify both intracellular and extracellular water - soluble small - molecule metabolites . the metabolic profiles of a methicillin - resistant and a methicillin - susceptible s. aureus strain , grown both as biofilm and planktonic cell cultures over extended time periods , were characterized . the model biofilm culturing system used here mimics a chronic wound environment by growing the biofilm colonies at a solid surface air interface with nutrients absorbed from growth media in a fashion similar to biofilms extracting nutrients from seeping exudate of a chronic wound . this culturing strategy is in stark contrast with previous metabolic comparisons between biofilm and planktonic cultures of s. aureus that used a closed - system , flow - cell model of biofilm growth , in which oxygen exchange with air is limited . the ability to readily quantify metabolites confers an advantage to nmr metabolomics and facilitates the use of unsupervised , orthogonal projection - based , statistical analyses such as principal component analysis ( pca ) . pca analysis yields insights into metabolic relationships between different bacterial phenotypes without biasing the statistical clustering output of those phenotypes . using pca analysis , it was possible to differentiate between pathogenic ( mrsa ) and nonpathogenic ( mssa ) strains of s. aureus based on metabolite profiles . in addition , it was possible to distinguish between s. aureus biofilm and planktonic phenotypes using pca analysis of metabolite profiles in a complex growth medium . this study lays the groundwork for assessing the efficacy of therapeutic strategies based on small - molecule targets identified through metabolomics approaches for s. aureus biofilm colonization of chronic wounds , while also gaining insights into metabolic strategies that characterize biofilm physiology . two phylogenetically distinct strains of s. aureus were used in this study : the methicillin - resistant ( mrsa ) clinical wound isolate s. aureus 10943(17,20 ) and the methicillin - susceptible ( mssa ) laboratory strain s. aureus atcc 6538 . growth media for both planktonic and biofilm cultures consisted of tryptic soy broth ( tsb ) ( fluka analytical ) . inocula for both planktonic and biofilm growth conditions consisted of batch cultures grown in tsb at 37 c to an optical density reading of 1.7 at 600 nm ( od600 nm ) . aliquots ( 1 ml ) were collected for serial dilution , drop plating , and calculation of colony forming units ( cfu ) . for planktonic studies , inoculum cultures were diluted 1:100 in fresh tsb and cultured at 37 c in 1 l flasks shaking at 150 rpm . planktonic cultures were grown under aerobic conditions with flask - to - medium volume ratios of 3:1 . cultures ( 10 ml ) of cells and supernatant were harvested every 2 h up to 12 h , then at 24 and 48 h post inoculation . biofilm growth was cultured as previously described . in brief , tissue culture inserts ( millipore millicell , 0.4 m pore size ) were inoculated with five 10 ul droplets of overnight inoculum culture ( 10 cfu / ml ) and grown for 72 h at 37 c , at which point the biofilms had reached linear growth , which is referred to here as the t0 biofilm growth point . although pore size on the tissue culture insert did not prevent bacterial cells from escaping into the growth medium in the well below , the biofilms constituted the primary growth phenotype for the cultures . to maintain biofilm viability , we refreshed growth media every 24 h. once biofilms reached linear growth phase ( t0 ) , biofilms were collected every 24 h , up to 72 h ( referred to as t24 , t48 , and t72 in the text ) . for each biofilm growth time point , spent supernatant was collected from the plate well , and biofilms were harvested from the insets by gently pipetting with 1 ml of sterile pbs to dislodge the biofilms and were immediately centrifuged at 4700 rpm for 10 min at 25 c to pellet the cells . as with planktonic samples , biofilm supernatant and pellet were immediately flash - frozen in liquid nitrogen and stored at 80 c . in addition , sham controls ( i.e. , tsb media only with no bacterial inoculation ) were included on each plate to assay for leaching of plate materials into media as well as loss of volatile compounds from media due to culture conditions . for all growth conditions , samples were harvested in technical triplicates and repeated in biological duplicates . nmr samples were prepared from duplicate experiments with triplicate technical replicates for each growth condition and each time point . metabolites were extracted as previously described . although leakage of intracellular metabolites into the extracellular environment has been reported for certain metabolism quenching procedures , limited loss of organic acids during sample preparation and statistical reliability across methods indicated that the cold methanol extraction method is most suited for harvesting and extracting metabolites from our samples . in brief , supernatants were filtered through an extensively prewashed centrifuge filter ( with sterile - filtered water ) with a 3 kda molecular weight cutoff ( millipore amicon ) prior to lyophylization overnight at room temperature . cell pellets were washed in 60% ice - cold methanol ( sigma - aldrich ) and centrifuged at 5000 rpm for 10 min . pellets were resuspended in a 2:1 ice - cold methanol / chloroform solution ( sigma - aldrich ) prior to cell lysis by sonication . a 1:1 aqueous chloroform solution ( sigma - aldrich ) was added , samples were gently mixed , and aqueous layers were collected by centrifugation and transferred by pipetting to a clean microcentrifuge tube . , lyophilized samples were resuspended in 500 l of nmr buffer ( 10 mm nah2po4/na2hpo4 containing 0.25 mm 4,4-dimethyl-4-silapentane-1-sulfonic acid [ dss ] in 100% d2o , ph 7 ) and transferred to 5 mm wilmad nmr tubes . h nmr spectra were acquired at 298 k ( 25 c ) on a bruker 600-mhz ( h larmor frequency ) avance iii solution nmr spectrometer equipped with a samplejet automatic sample loading system , a 5 mm triple resonance ( h , n , c ) liquid - helium - cooled tci probe ( cryoprobe ) , and topspin software ( bruker version 3.2 ) . one - dimensional h noesy experiments were performed using the bruker supplied noesypr1d pulse sequence with 256 scans , h spectral window of 9600 hz . fids were collected in 32k data points , with a dwell time interval of 52 sec amounting to an acquisition time of 1.7 s , using a 2 s relaxation recovery delay between acquisitions and a noesy mixing time period of 50 ms . pulse sequence settings were based on standard recommendations by the chenomx guide for recording 1d h nmr spectra of small molecule metabolites . spectral processing and analysis was performed using the chenomx nmr software ( version 7.6 ) ( chenomx ) . for each sample , nmr spectra were phased and baseline - corrected , and a line broadening function of 0.5 to 1.5 hz was applied according to recommended chenomx protocols and previously reported metabolomics analysis methods . variable line broadening was applied to each sample to account for small sample variations in ph and shimming as well as to optimize metabolite identification and quantification . for metabolite identification , the chenomx small - molecule library for 600 mhz ( h larmor frequency ) magnetic field strength nmr was used , and nmr spectral patterns were fitted for each sample independently . the internal dss standard was used for quantitation of identified metabolites . this study involved two strains of s. aureus , each grown in both the biofilm and planktonic modes of growth , with three growth time points for the biofilm and eight growth time points for the planktonic phenotypes . for each strain and phenotype and time point combination , triplicate experimental replicates were performed ; thus for each strain , 66 samples were analyzed resulting in an overall experimental matrix of 132 total samples profiled in duplicate . from the analysis of h 1d nmr spectra , an overall number of 120 compounds were identified with 30 compounds identified per sample spectrum , including many common metabolites such as amino acids , fermentation products , and metabolites of central metabolism . for statistical analysis using pca , over 120 and 40 identified metabolites were attributed to at least one time point from at least one growth condition , for extracellular and intracellular metabolite samples , respectively . to ensure objective metabolite identification and quantification , multiple operators performed spectral fitting independently , and determination of metabolite concentrations was consistent and comparable between different operators . to verify metabolite i d , select metabolites of particular interest to the analysis were confirmed using 2d nmr or by spiking in pure standards into samples ( when available ) . h total correlation spectroscopy ( tocsy ) spectra were acquired using a bruker supplied dipsi2gpph19 pulse sequence and collected with h spectral windows of 7200 hz , 256 points and 2048 points for digitization of the indirect and direct spectral dimensions , respectively , and a 60 ms tocsy spin lock mixing period . h tocsy spectra were processed using topspin software ( bruker version 3.2 ) and compared with corresponding spectra of pure standards . quantified concentrations of metabolites were normalized to cfu , and averages were calculated across technical replicates prior to 2d pca . comparison of pca plots was performed on duplicate experiments , and similar clustering patterns were observed . clustering of metabolite variables by pca was performed using xlstat version 3.1 software ( addensoft ) and pearson correlation . 2d pca accounted for 50% of the total variance , significantly more than the cumulative variance of 30% commonly observed in complex biological systems , supporting the statistical clustering reported here . for each distinct metabolite pattern , the principal components ( pcs ) that accounted for the largest percentage of the variability were used for visual projection on the scores plots of the segregation of metabolite profiles that distinguished growth phenotypes in pca scores plots . for each pc , the correlation coefficient of the factor loadings and the square of the cosine of the variable were calculated to identify compounds that most significantly contributed to the separation of the different samples and to establish how significantly a given metabolite variable is correlated to the axis of the principal component ( i.e. , pc1 , pc2 ) . a mathematical rule of thumb is that a factor loading is significant if the correlation coefficient is 0.7 or higher because this accounts for over half of the observed variance ; however , in biological systems , the threshold of 0.4 is more commonly used and has been used here . while a correlation coefficient signifies the contribution of a metabolite to a statistical grouping of a given phenotype , the square of the cosine indicates which metabolites are most statistically related to the pcs used to build 2d pca scores plots . while the factor analysis tables indicate which metabolites most significantly contribute to the separation of samples , they do not represent either positive or negative fold changes in concentrations across samples ; therefore , representative , statistically significant fold changes in concentration for metabolites involved in metabolic pathways that most distinguished biofilm and planktonic cultures from a single representative experiment were calculated separately and plotted relative to the concentration of metabolites identified and quantified in the planktonic exponential growth stage . representative fold changes in select metabolites were calculated using two - tailed unpaired t tests and considered significant at p < 0.05 using the xlstat software plug - in to excel ( addinsoft , version 3.01 ) . two phylogenetically distinct strains of s. aureus were grown under identical planktonic and biofilm conditions over time courses to comprehensively quantify metabolic differences between planktonic and biofilm phenotypes . s. aureus 10943 is a community - acquired , methicillin - resistant ( ca - mrsa ) clinical isolate from a chronic wound . for comparison , the common , nonvirulent methicillin - susceptible ( mssa ) laboratory strain s. aureus 6538 ( rosenbach ) was also investigated . phylogenetic separation of these two strains demonstrates that each strain inhabits distinct branches of the s. aureus genetic family tree and exhibits distinct degrees of virulence . s. aureus 10943 most closely aligns with ca - mrsa strain s. aureus usa300 tch1516 as well as related mrsa strains such as s. aureus usa300 fpr3757 and s. aureus tw20 . s. aureus 6538 most closely clusters phylogenetically to a related s. aureus rosenbach strain , s. aureus atcc 51811 , as well as the mssa laboratory strain s. aureus newman ( figure 1a ) . two phylogenetically distinct strains of s. aureus have unique pigmentation . ( a ) phylogenetic separation of s. aureus 6538 and s. aureus 10943 indicates that s. aureus 10943 is most closely related to common ca - mrsa strains , while s. aureus 6538 is most closely related to non - mrsa strains . blue lines indicate phylogenetic branches associated with methicillin resistance and red lines indicate phylogenetic branches associated with s. aureus species with no known antibiotic resistance . ( b ) two phylogenetically dissimilar strains of s. aureus were inoculated onto tissue culture inserts and grown as biofilms in six - well tissue culture plates at 37 c . images represent mature biofilms that have been cultured a total of 72 h to reach linear growth phase ( referred to as the t0 biofilm growth time point ) . left panel depicts the chronic wound isolate , mrsa strain s. aureus 10943 and right panel depicts the lab - adapted , mssa strain s. aureus the planktonic cultures were grown under aerobic batch conditions in nonmodified tsb at 37 c in 1 l shaking flasks . the biofilms were grown in an aerobic - modified tissue culture model that mimics growth conditions found in a chronic wound . while no visible growth differences between the strains were observed in the planktonic cultures , distinct pigmentation differences were noticeable in the biofilm cultures ( figure 1b ) . thus , the observable difference in biofilm pigmentation between the strains ( figure 1b , right and left panels , respectively ) corroborates with the known clinical significance of s. aureus 10943 as a mrsa strain . growth profiles for s. aureus 10943 and s. aureus 6538 batch cultures grown in tsb were similar based on optical density ( od600 nm ) readings ( figure 2a ) and transitioned through the growth phases at very similar rates , that is , exhibiting exponential growth between 2 and 6 h , transitioning to stationary phase between 8 and 10 h and maintaining stationary phase through the 48 h experimental time course . s. aureus 10943 and s. aureus 6538 biofilm cultures also exhibited very similar growth profiles with slightly higher optical densities ( od600 nm ) for s. aureus 6538 biofilm at all time points ; however , this od600 nm difference was not statistically significant . the od600 nm readings for all biofilm time points suggested the biofilms reached a linear growth phase beginning at the t0 biofilm time point ( figure 2a ) . changes in glucose concentration and ph in the bulk media correspond to transitions between growth phases in s. aureus cultures . ( a ) growth curves for s. aureus 6538 and s. aureus 10943 planktonic and biofilm cultures were plotted for all growth time periods . cultures were inoculated with an equal amount of cell mass , as determined by comparable absorbance readings of seed flasks ( i.e. , od600 nm ) . time zero refers to mature biofilms grown up to 72 h ( t0 ) and inoculum for planktonic cultures , respectively . error bars have been calculated from growth curve measurements of duplicate biological replicates for each growth condition and growth time point . ( b ) decreasing glucose concentration in the media for planktonic cultures corresponds in time to transition from exponential to stationary phase of growth . for biofilm cultures , consumption of glucose is below the detection limit of h 1d nmr for all time points of growth . ( c ) changes in ph profile for planktonic cultures correspond in time to changes in growth rate , with significant ph differences between strains observed for biofilm cultures . slight differences in bulk ph were detected between the two strains based on growth phase and growth phenotype . metabolic transitions accompanying different growth phases in planktonic cultures correlated with glucose availability . glucose concentrations were measured by quantitative h nmr for each sample at each time point ; the values correspond to the extracellular glucose concentrations ( mm ) normalized to the viable cell counts ( log or absolute number ) . the transition from exponential growth to stationary phase was characterized by the complete exhaustion of glucose , which occurred within 8 h of inoculation ( figure 2b ) . during biofilm growth experiments both strains also exhibited nearly identical profiles for glucose consumption with the glucose being completely consumed within each 24 hour time point , that is , before the biofilm medium was refreshed ( figure 2b ) . both s. aureus 10943 and s. aureus 6538 planktonic cultures exhibited a drop in medium ph during exponential growth ( figure 2c ) . for example , the extracellular ph drops from ph 7.13 at inoculation to a ph of 5.21 at stationary phase and from ph 7.17 to ph 5.96 for s. aureus 10943 and s. aureus 6538 , respectively . in contrast with the planktonic cultures , the biofilm cultures exhibited increased bulk ph levels in the spent medium ; the s. aureus 10943 medium increased from an initial ph of 7.67 to ph 8.24 and s. aureus 6538 medium increased from ph 7.18 to 7.99 . intracellular and extracellular metabolites were identified and quantified for both s. aureus 10943 and s. aureus 6538 strains grown under planktonic and biofilm conditions . samples were collected over an extended time course ranging from exponential growth to late - stationary phase for the planktonic cultures and every 24 hours , up to 72 h , for the biofilm cultures , which demonstrated a linear growth phenotype . metabolism was quenched and metabolites extracted using an ice - cold aqueous methanol / sonification protocol , as described in the experimental procedures . extracted metabolites were identified and quantified using 1d h nmr , and nmr spectral features were assigned to particular metabolites by spectral pattern fitting to reference spectra of small - molecule metabolites annotated in the chenomx ( version 7.6 ) metabolomics database . of the greater than 300 verified compounds in the chenomx library , more than 120 water - soluble compounds from the sample supernatant and 40 water - soluble compounds from cell pellets were identified in at least one sample from at least one growth condition . differences in the two phylogenetically distinct s. aureus strains 10943 and 6538 , grown both as biofilm cultures and planktonic cultures were distinguished based on pca of their respective metabolite profiles . pca utilizes orthogonal transformation of correlated metabolite profiles into linearly uncorrelated pcs to separate samples according to distinct patterns , and provides a quantitative basis for distinguishing the s. aureus strains ( figure 3a d ) . both the mrsa ( i.e. , s. aureus 10943 ) and mssa ( i.e. , s. aureus 6538 ) strains were separated along the principal component 1 ( pc1 ) axis for both the intracellular and extracellular metabolite profiles of the planktonic cultures as well as the extracellular metabolite profiles of the biofilm cultures ( figure 3a c , respectively ) . pc1 accounted for 50% of the statistical variability within the samples , suggesting the two strains used distinguishably different metabolic strategies ; however , the biofilm intracellular metabolite profiles clustered nearly identically ( figure 3d ) . principal component analysis ( pca ) comparison of two s. aureus strains . 2d pca scores plots indicate statistically significant sample separations along the first dimension ( pc1 ) between the metabolite profiles of s. aureus 10943 ( blue lines ) and s. aureus 6538 ( red lines ) for both intracellular and extracellular metabolites of planktonic cultures ( panels a and b , respectively ) and biofilm extracellular metabolites ( panel c , as detected by 1d h nmr ) . in contrast , metabolite profiles for biofilm intracellular metabolites cluster nearly identically ( panel d ) . dark colors ( red and blue ) indicate planktonic cultures , and light colors ( red and blue ) indicate biofilm cultures . numbers correspond to hours postinoculation for planktonic cultures ( e.g. , t2 , t4 , t6 , etc . ) and hours past reaching linear growth in biofilms ( e.g. , t24 , t48 , t72 ) . pca comparison of both intracellular and extracellular metabolite profiles for both strains was analyzed concomitantly ( figures 4 and 5 ) to establish whether biofilm and planktonic phenotype of s. aureus can be quantitatively distinguished based on metabolic differences , irrespective of strains and growth stages ( i.e. , exponential , stationary , linear ) . pca analysis of intracellular or extracellular metabolite profiles resulted in biofilm samples for both strains clustering into a single quadrant with no overlap of biofilm phenotype with planktonic phenotype ( figures 4 and 5 ) . because of biofilm metabolite profiles segregating into a single quadrant ( lower , left quadrant , figures 4 and 5 ) , the combination of pc1 and pc2 identified those metabolites for which correlation coefficients are most significantly associated with the biofilm phenotype of s. aureus ( tables 1 and 2 ) . as is conventional for many biological analyses , a 0.4 threshold for the correlation coefficients was used here to identify the most significant metabolite contributors to the pca variations . in addition , correlation coefficient values in bold indicate which metabolites are most significantly related to the pcs from which 2d pca scores plot are built , further highlighting the statistical significance of these metabolites as contributing variables for sample distinction ( tables 1 and 2 ) . pca analysis of intracellular metabolites for s. aureus 10943 and 6538 biofilm and planktonic cultures results in statistical clustering of biofilm phenotype . pca analysis of intracellular metabolites in s. aureus 10943 and 6538 biofilm and planktonic cultures detected by 1d h nmr separates the biofilm phenotype into a single quadrant of the 2d pca scores plot as a result of significant statistical separations from s. aureus 6538 planktonic cultures along pc1 and from s. aureus 10943 planktonic cultures along pc2 . pca analysis of extracellular metabolites for s. aureus 10943 and 6538 biofilm and planktonic cultures results in statistical separation of the biofilm phenotype from its planktonic counterpart . pca analysis of extracellular metabolite profiles in s. aureus 10943 and 6538 biofilm and planktonic cultures detected by 1d h nmr separates the biofilm phenotype into a single quadrant of the 2d pca score plots as a result of statistically significant separations from s. aureus 10943 planktonic cultures along pc1 and from s. aureus 6538 planktonic cultures along pc2 . correlation coefficient numbers in bold indicate metabolites for which the statistical relatedness of the variable is most correlated to the pc , as indicated by the square of the cosine . correlation coefficient numbers in bold indicate metabolites for which the statistical relatedness of the variable is most correlated to the pc as indicated by the square of the cosine . amino acid profiles suggest that distinct selective amino acid uptake may be a key feature differentiating between biofilm and planktonic cultures in s aureus , regardless of strain . interestingly , pca factor loadings analysis demonstrated that distinct amino acid profiles for both intracellular and extracellular pools of metabolites contribute significantly to the separation of the biofilm samples for both strains , including amines such as arginine ( table 1 ) , hydroxy acids such serine ( table 1 ) , amido acids such as asparagine ( tables 1 and 2 ) , and aromatic amino acids such as histidine ( table 2 ) . arginine metabolism has been suggested to play an important role in biofilm survival , and the factor loadings analysis conducted here suggests that arginine catabolism is an important feature of the biofilm phenotype ( table 1 ) . indeed , amino acid catabolism may be a significant component of biofilm metabolism , as multiple metabolites associated with amino acid degradation contribute significantly to the statistical separation of the biofilm cultures in the pca scores plots shown here , including metabolites associated with alanine , aspartate , cysteine , isoleucine , methionine , serine , threonine , and histidine metabolic pathways ( tables 1 and 2 ) . whether s. aureus biofilms are selectively utilizing amino acids or catabolizing whichever small molecule is most available remains to be established . the pca factor loadings analysis suggests that biofilms opt for the latter option because metabolites associated with catabolism of other amino acids , such as glycine , tryptophan , and lysine , do not contribute significantly to the separation of the biofilm samples on the pca scores plots . secondary energy sources also appear to be important to distinguishing the biofilm phenotype from its planktonic counterpart . both intracellular and extracellular metabolites associated with lipid catabolism such as glycerol ( table 2 ) , glycerate ( table 2 ) , malonate ( table 2 ) , and propionate ( table 1 ) contribute to the statistical separation of the biofilms into a single quadrant of the pca scores plots . while genes for this pathway have been sequenced in staphylococcus species , a functional pathway has yet to be demonstrated ; however , in support of a role for purine and pyrimidine catabolism in biofilm formation , multiple metabolites associated with catabolism of these molecules were identified as contributing to the discrimination between biofilm and planktonic phenotypes ( tables 1 and 2 ) . in addition , pyrimidine nucleotides serve as precursors for synthesis of teichoic acids and peptidoglycan in s. aureus , and may indicate biofilm metabolic investment in cell - wall synthesis and matrix deposition . in addition , biofilms may effectively utilize alternative carbohydrate metabolic pathways once glucose has been consumed because hexose catabolism of galactose and mannose contributes to biofilm separation ( table 2 ) . the correlation coefficient for acetoin indicates that this ketone contributes significantly to distinction between biofilms and planktonic cultures irrespective of s. aureus strains and highlights the importance of butanediol fermentation in biofilms , as has been suggested . other studies have suggested that upregulation of glycolysis in biofilms is not directed toward production of energy but instead directs metabolic flux to other metabolic pathways engaged in the production of cell - wall components and matrix deposition . to this effect , correlation coefficients for metabolites associated with cell - wall synthesis such as n - acetylglutamine and udp - n - acetylglucosamine are shown here to contribute significantly to segregating the biofilm samples into a single quadrant of the pca scores plot ( figure 5 ) . using the information embedded in correlation coefficients of key metabolites , pca score plots indicated which metabolic activities might most distinguish the biofilm phenotype from its planktonic counterpart ( summarized in figure 6 ) . glucose consumption by the biofilm suggests that while glucose is available , glycolysis is active ( figure 2b ) ; however , once glucose is consumed , the biofilms appear to readily switch to alternative energy sources . as noted by others , relatively high intracellular concentrations of acetoin , a metabolic precursor to 2,3-butanediol , indicate that butanediol fermentation is part of a mixed acid fermentation strategy employed by the biofilms . the fermentative metabolite profiles suggest that microaerobic and anaerobic environments exist within the biofilm , as has been previously suggested . schematic representation of central metabolism and secondary metabolic activity in s. aureus characteristic of the biofilm phenotype . bar charts represent fold changes in metabolite concentrations for biofilm and stationary planktonic samples , respectively , normalized to the metabolite concentrations in each respective exponential planktonic culture for select intracellular and extracellular biofilm metabolites that contribute to statistical separation of the biofilm phenotype from the planktonic phenotype irrespective of strain . s. aureus 10943 is indicated by blue bars and s. aureus 6538 is indicated by red bars . also as previously reported , selective uptake of amino acids may differentiate between biofilm and planktonic cultures ; however , in our study , the patterns of intracellular and extracellular amino acids are most significantly correlated with amino acid fermentation through the stickland reaction , in which one amino acid serves as an electron donor and one amino acid serves as an electron acceptor . for example , both s. aureus 10943 and s. aureus 6538 biofilms selectively transported isoleucine , an electron donor , into the cytosol , while concomitantly increasing intracellular pools of sarcosine , an electron acceptor , as well as secreting relatively high levels of ammonia ( data not shown ) , a byproduct of amino acid catabolism . this suggests that amino acid catabolism serves as an important source of energy for the biofilm phenotype and that amino acid uptake may not be specific , as previously suggested , but rather is an adaptive strategy to environmental conditions and nutrient availability , a finding consistent with other data . it has been hypothesized that s. aureus biofilms adapt to strongly reduced conditions through production of reduced organic acids like lactate and alcohols including butanediol . while butanediol fermentation was observed in both s. aureus 10943 and s. aureus 6538 biofilms ( figures 4 and 5 ) , additional intracellular metabolites of importance to the pca analysis included compounds associated with poly--hydroxybutyrate ( phb ) synthesis and degradation . to regulate nadh and nad+ levels relatively high intracellular pools of 3-hydroxybutyrate and acetoacetate , metabolites associated with phb synthesis and degradation , were measured as s. aureus maintains a favorable redox balance through appropriate nadh to nad ratios ( tables 1 and 2 ) . finally , in the biofilm model used here , the biofilms reach a linear phase and do not significantly increase in biomass over time ( figure 2a ) ; however , the biofilms consume and secrete significant amounts of metabolites , suggesting a very dynamic metabolic state . as previously proposed , the output of this metabolic activity may be cell - wall synthesis in response to cellular turnover and deposition of eps components . in support of this hypothesis , the pca analyses shown here ( figures 4 and 5 ) indicate that alternative hexose utilization contributes significantly to the statistical separation of the biofilm and planktonic phenotypes . while hexose sugars can be catabolized via glycolysis , both mannose and galactose may be channeled into the production of rhamnose , a component found in exopolysaccharide repeating units . cell - wall synthesis entails the building of murein monomers from precursors udp - n - acetylglucosamine and udp - n - acetylmuramate , both synthesized in the cytoplasm of s. aureus.(35 ) both n - acetylglucosamine and its precursor udp - n - acetylglucosamine were metabolites for which pca correlation coefficients indicated that secretion of these metabolites is an important characteristic of both s. aureus 10943 and s. aureus 6538 biofilm phenotypes ( table 2 ) . while selective uptake of alanine by the biofilms may be important for amino acid fermentation via the stickland reactions , as previously mentioned , it may also play a significant role as a precursor for the synthesis of cell - wall components as well as eps deposition . these results suggest that flexible metabolic activity specific to the biofilms not only includes the previously reported energy production from mixed acid fermentation and tca activity but also involves significant energy expenditure for maintenance of a proper redox balance , synthesis of cell - wall components , and eps matrix deposition ( figure 6 ) . nonhealing of wounds such as diabetic and pressure ulcers is , in part , due to the persistence of bacterial biofilm - based infections ; however , metabolic contributions to persistence of the bacteria in the wound remain an area of investigation . specifically , there is interest in identifying small - molecule biomarkers that distinguish between biofilm and planktonic phenotypes , which could be used as a noninvasive , prognostic tool indicating bacterial biofilm colonization in a wound . in addition , such profiles could provide insights into physiological differences between biofilm and planktonic cell cultures , which could be exploited to therapeutic advantage . it has been speculated that pathogenicity in bacteria is the result of an evolutionary drive to obtain nutritional resources . while traditional antibiotics have been designed against planktonically grown bacteria and to treat metabolically active bacteria , bacteria in a biofilm are metabolically different from planktonic bacteria ; therefore , the design of novel therapies for wounds necessitates considering and accounting for the unique ability of the biofilm to resist treatment , especially through adaptive metabolic changes . because of the correlation between chronicity in wounds and bacterial biofilm contamination , a number of biofilm - targeted antimicrobials have emerged including the iron - binding innate immune molecule lactoferrin ; however , metabolic characterization of the biofilm phenotype has the potential to uncover many other biofilm - specific targets for the development of novel wound therapeutics . previous transcriptomics and proteomics analyses of s. aureus biofilm and planktonic cultures demonstrated that , when grown as a biofilm , this facultative anaerobe switches to fermentative metabolism within the biofilm . consistent with these observations , our data demonstrate that for both strains of s. aureus anaerobic metabolism is induced in the biofilm cultures and suggest that mixed acid fermentation is active , contributing to a biomarker profile that distinguishes between biofilm and planktonic phenotypes . selective amino acid uptake profiles have been reported for s. aureus biofilm cultures when compared to planktonic cultures . while statistical pca analysis of the biofilm and planktonic cultures did identify both intracellular and extracellular metabolite patterns that distinguished between the biofilm and planktonic phenotypes , regardless of strain type , these profiles did not exactly match those previously reported . whereas zhu and coworkers reported selective uptake of glutamine , serine , proline , glycine , threonine , and arginine , and wu and coworkers reported selective uptake of arginine , we observed metabolite trends that distinguish between biofilm and planktonic phenotype based on differential intracellular pools of arginine , aspartate , glutamine , leucine , and serine and extracellular pools of alanine , asparagine , histidine , isoleucine , methionine , threonine , and tyrosine . these results suggest that while amino acid metabolism by the biofilm is important , the specific profile of amino acids transported into the cytosol is not a discriminant in and of itself of biofilm versus planktonic modes of growth . metabolic discrimination of biofilms independent of strain type is due in part to different intracellular concentrations of amino acids that function as electron donors ( alanine , leucine , isoleucine , histidine ) and electron acceptors ( leucine and sarcosine ) for amino acid fermentation by the stickland reaction . these data suggest that while selective amino acid uptake profiles do indicate significant amino acid utilization by s. aureus in response to redox needs , these profiles may not be specific to any particular set of amino acids and may rather reflect the opportunistic scavenging of the bacteria for whichever electron donor or acceptors may most readily be available . furthermore , metabolic discrimination of biofilms as established by pca analysis of different metabolite expression patterns suggests that s. aureus biofilms might utilize secondary metabolic pathways to address redox stress . for example , when oxygen is limited , the synthesis of poly--hydroxybutyrate ( phb ) could serve as an efficient electron sink . degradation of phb would contribute to cellular redox balance by reducing nad to nadh concomitantly with the breakdown of phb to acetoacetate and entry of acetate into the tca cycle ( figure 6 ) . although phb was detected in s. aureus nearly 50 years ago , the complete metabolic pathway for both synthesis and degradation of this polymer has yet to be firmly established in s. aureus . putative s. aureus genes for phb biosynthesis and degradation have been identified and annotated to be associated with virulence ; however , demonstration of a functional phb metabolic pathway in s. aureus remains to be accomplished . the question of whether s. aureus biofilms selectively utilize this pathway as a mechanism to maintain an appropriate intracellular redox balance warrants further investigation . consistent with previous observations , metabolic investment in synthesis of cell - wall components and eps deposition contributes significantly to the statistical separation of the biofilm and planktonic phenotypes in the pca analysis ( figures 4 and 5 ) . despite having reached linear growth phase , the biofilm cultures exhibit significant central metabolism activity without a significant increase in the number of viable cells . strain - independent pca statistical grouping of metabolite variables characteristic of the biofilm phenotype identified metabolites associated with alternative hexose utilization , suggesting that rhamnose incorporation into eps may be important for the s. aureus biofilm mode of growth . while rhamnose incorporation into the eps is important for the common wound colonizer pseudomonas aeruginosa(43 ) and rhamnose synthesis may occur in s. aureus , the intricacies of hexose metabolism in s. aureus have yet to be dissected . in contrast , cell - wall synthesis metabolism is well established in s. aureus , and in this study precursor metabolites were shown to significantly contribute to the distinctive characteristics of the biofilm phenotype compared with its planktonic counterpart in a strain - independent manner . whether this metabolic investment indicates static , viable cell turnover within the biofilm or some strategy for biofilm persistence is a question of significant clinical interest , especially considering that cell - wall teichoic acids play a major role in host pathogen interactions and alterations in cell - wall components can significantly affect microbial susceptibility to antibiotics and cell - wall disrupting agents . while identification of a single , robust small molecule biomarker that distinguishes between biofilm and planktonic cultures would have significant translational research appeal for clinical diagnostics , it is unlikely that such a universal metabolite biomarker exists despite encouraging data to the contrary . indeed , the nmr metabolomics analysis presented here indicates that even within a single bacterial species significant differences in metabolite patterns can be observed for both biofilm and planktonic phenotypes . despite the complexity of such an analysis and by using a comprehensive experimental approach that included phylogenetically distinct strains of s. aureus and metabolite sampling through time courses that account for multiple growth phases , we have demonstrated herein the ability to distinguish biofilm from planktonic cultures based on distinct metabolite profiles . while the nmr metabolomics approach presented is robust , the research strategy incorporated only two strains of a single species ; it will be of significant interest to explore whether comparable metabolite profile analyses can distinguish between biofilms and planktonic cultures of other gram - positive opportunistic pathogens , as well as gram - negative pathogens and potentially mixed species biofilms . in addition to demonstrating the use of global metabolite profiling for discriminating between s. aureus biofilm and planktonic cultures , the contribution of metabolite variables to the statistical separation of the biofilm phenotype from its planktonic counterpart in the pca analyses presented here sheds light on some tantalizing areas of bacterial metabolism for further investigation and indicates how little is known about the physiology and metabolic characteristics of this important common , opportunistic pathogen .

this paper outlines the rationale for choosing outcome measures to assess the effectiveness of virtual reality for children with burns undergoing dressing changes at the red cross children s hospital ( rcch ) in cape town , south africa . we have previously reported a profile of burns inpatients at the rcch.1 over 600 children up to 15 years of age are admitted to the rcch annually with burns from hot water , explosions , or fires . the criterion for admission to the rcch is a burn greater than 10% of total body surface area , although all burns involving inhalation , electrical injuries , or face , hands , perineum , or body circumference are admitted . most inpatients are indigenous xhosa - speaking south african children who , along with their parents , are often poorly educated and illiterate , with minimal exposure to computers . their home lives are often violent , and they suffer significant impact from human immunodeficiency virus / acquired immune deficiency syndrome , poverty , and community disintegration.2,3 the burns treated at the rcch are rarely seen in the western world where building standards , occupational health and safety legislation , child protection legislation , and product design have all but eliminated pediatric burns hazards.13 however , in the informal south african townships , many thousands of children live in poorly built shacks with no electricity , running water , or sanitation , with unprotected open - flame cooking , heating , and lighting.4 similar situations are reported in other developing countries , including africa , india , and southeast asia.57 most burns patients at the rcch endure serial painful , and prolonged wound dressing changes to prevent infection and promote healing . these procedures can last up to 40 minutes.1 despite the standard use of opioid and anxiolytic pharmacological interventions , many children still suffer high levels of distress811 which commence prior to and throughout the burn dressing change . parents sometimes accompany children to the treatment room and then wait outside , thus becoming partly involved in the procedure . the children s distress is frequently manifested by extreme behaviors , such as fighting , biting , kicking , and resisting these nurses , as well as screaming and crying . this can hinder efficiency by making the procedure longer and more distressing for everyone involved , and requiring more nursing staff . a bath bed with a mobile shower head is used for most dressing changes ( figure 1 ) . firstly , removal of the soiled burn wound dressing ( part 1 ) , secondly , showering and debridement ( part 2 ) , and , lastly , redressing ( part 3 ) . when the child has multiple burnt areas and/or skin grafts , dressings may be changed at two or more sites simultaneously . nursing staff often need to restrain children physically during the first two parts of the procedure . children who are very anxious prior to a dressing change generally experience greater distress , and if the procedure is repeated , distress levels escalate.1113 this makes it difficult to estimate adequate analgesic requirements and to measure distress.815 it is acknowledged worldwide that medication management for painful medical procedures in children could be improved.14,15 our recent systematic review16 reported consistent evidence that virtual reality successfully distracts adult and adolescents from the reality of burns dressing changes . there is some evidence that virtual reality is similarly effective in western world children during painful medical procedures,1724 including children with burns.2124 the burns described in these papers2124 were less extensive than the ones for which children are admitted to the rcch , and consequently the dressing changes were not as complex or lengthy . given the western world environment of the research , it is likely that the children were computer - literate and familiar with computer games.2124 in all the virtual reality research , subjects acted as their own controls , to address the within - subject nature of pain perception.13 we wanted to test the effectiveness of virtual reality at rcch for burns inpatients aged 5 years or older . our experiences , and the virtual reality literature , suggest that virtual reality games could provide an important nonpharmacological distraction to decrease children s distress prior to and during wound dressing procedures . it is essential that we establish valid measures of distress as outcomes for any virtual reality trial at the rcch . children s education , literacy , home environments , pain - reporting culture , and indigenous languages make it unlikely that they will understand the notion of numeric , pictorial , or analog pain scales which are reported in current pediatric virtual reality research.2124 the children would also need to act as their own controls , hence the measures should be reliable within - child over repeated administrations . furthermore , the children s distress is likely to be multifaceted and variable throughout each dressing change , related to its regularity and unavoidability , seeing their burnt bodies uncovered , post - traumatic stress related to the burn event , and the frequent absence of parents / caregivers.1115 thus , we hypothesized that unidimensional abstract pain scales may not capture the complexity of the children s distress . different levels of distress are likely to be associated with each phase of the dressing change . therefore , children s distress may fluctuate , making it difficult to pinpoint a moment of worst or average distress ( the usual instruction when using visual analog scales ) . many children are reported by staff to be so traumatized that it seems unethical to ask them directly to quantify their distress.1113 children are not the only participants in the dressing change procedure . nursing staff and parents / caregivers will also have important insights into children s behaviors . we thus established a framework within which to identify potentially useful outcome measures for our virtual reality research : participants perspectives of the child , parents / caregivers , and nursing staff should be measured regularly ( for instance at every dressing change ) research requirements objective measures of pediatric distress which were psychometrically sound , clinically sensitive , and could be ethically and efficiently administered in contained physical spaces comprehensiveness a suite of measures was needed to capture the range and complexity of children s distress appropriately , and the impact of this on a dressing change . the research design included two targeted literature reviews . the first literature review comprised published studies on the use of virtual reality for children with procedure - related pain , using the search terms virtual reality , we used morris et al16 as a starting point , because the authors identified and critiqued all relevant studies on the use of virtual reality with pediatric patients up to january 2009 . we conducted a further search for new literature published from that date to december 2010 . we did not review the more recent literature for study quality , because we were only interested in how distress had been measured . the second literature review searched for recently published secondary evidence describing outcome measures for pediatric pain , using the broad search terms of p(a)ediatric procedural pain / distress / anxiety to interrogate the common library databases ( ovid , pubmed , medline ) for recent systematic reviews assessing the psychometric properties and clinical utility of outcome measures of pediatric pain , anxiety , and distress . we sought secondary evidence because it would provide an overview of the types of outcome measures available , the pediatric populations in which these measures had been developed , and the quality of the included studies . we used the prisma ( preferred reporting items for systematic reviews and meta - analyses ) statement to assess the methodological quality of the included reviews.26 for data extraction , we listed the outcome measures recommended in the reviews , and sought further information about their developmental details to assess their appropriateness for 5- to 17-year - olds . for analysis , we developed matrices to record the elements of potentially relevant outcome measures for our research framework ( research requirements , participants , and comprehensiveness . in our first literature review , we identified the review by morris et al16 as being of high methodological quality ( prisma 14 , appendix 1 ) . it identified five studies which included at least some children in our age range of interest ( 517 years ) , as shown in table 1 . our search for more recent literature identified three further relevant studies18,19,25 ( table 1 ) . the most common method for measuring effectiveness of virtual reality in pediatric distress was the use of subjective scales ( mostly variations on the visual analog scale ) to measure pain , anxiety , and/or distress . in our second literature review , we found two relevant recent reviews of pediatric pain assessment measures27,28 and two focused reviews commissioned by the pediatric initiative on methods , measurement , and pain assessment in clinical trials ( ped - immpact , a children s self - report of pain29 and observational measures of children s pain).30 the methodological quality of these reviews ranged from 114 . the reviews differed in scope and purpose , although all used the society of paediatric psychology assessment task force criteria reported by cohen et al,28 and all framed the reports of outcome instruments using terminology of well established , approaching well - established , and promising . measures were supported by two or more peer - reviewed articles , with sufficient detail in the article to allow replication and evaluation , and psychometric properties were reported in at least one published paper . there was congruence between the reviews in terms of the outcome measures which were reported to be three main methods were reported to assess children s pain , anxiety , and distress , ie , self - reported measures from children , observed behaviors using checklists or classifications of distress behavior underpinned by numeric rating scales reported by parents or health care workers , and objective physiological measures . the reviews synthesized a large amount of primary literature , which indicated that children s self - reports of pain using one - dimensional numeric or analog scales , or diagrams ( such as a series of faces ) , are valid and reliable within - child . such scales are commonly reported in virtual reality research.1,18,19,25 however , the self - report instruments were developed on procedural pain suffered by children in the western world undergoing injections or invasive medical procedures , mostly for cancer . the scales were generally one - dimensional , which would potentially be insensitive to the gamut of a child s emotions experienced during the multistage burns dressing change process . thus , all the measures reviewed by stinson et al,29 as well as the subjective measures reported by cohen et al28 ( visual analog scale,32 oucher,33 and faces34 scales , and the poker chip tool)35 were unlikely to be appropriate for research in our environment . these reviews consolidated our earlier concerns regarding how to apply such scales at the rcch , particularly in light of cohen et al28 who suggested that pain assessment is limited because of racial and ethnic difference . the reviews reported instruments which purported to classify and score children s observed behaviors related to their distress . observed behaviors could be measured by research staff or nurses , and some instruments asked for parent / care - giver or nurse perspectives on children s behaviors . von baeyer and spagrud30 reported three well - developed observational scales which used video to capture real - time information on distress during a medical procedure and then assessment of the video post - treatment to quantify distress ( observational scale of behavioral distress scale,36 behavioral approach - avoidance and distress scale,37 and brief behavioural distress scale).38 table 2 outlines the well established measures of distress identified from the review . these were extracted from cohen et al,28 von baeyer and spagrud,30 and blount and loiselle.27,3944 heart rate was reported by chalmers et al45 as a measure of children s pain in an experimental pain paper . the use of heart rate was also reported in the comfort scale,14 which provides classifications for continuous heart rate data to identify physiological stress . a number of process - based objective measures of the dressing change were noted but not specifically explored in the literature . two which appeared to be appropriate to our study were the time taken to complete the dressing change and the number of nursing staff required to complete the dressing change . the reviews synthesized a large amount of primary literature , which indicated that children s self - reports of pain using one - dimensional numeric or analog scales , or diagrams ( such as a series of faces ) , are valid and reliable within - child . such scales are commonly reported in virtual reality research.1,18,19,25 however , the self - report instruments were developed on procedural pain suffered by children in the western world undergoing injections or invasive medical procedures , mostly for cancer . the scales were generally one - dimensional , which would potentially be insensitive to the gamut of a child s emotions experienced during the multistage burns dressing change process . thus , all the measures reviewed by stinson et al,29 as well as the subjective measures reported by cohen et al28 ( visual analog scale,32 oucher,33 and faces34 scales , and the poker chip tool)35 were unlikely to be appropriate for research in our environment . these reviews consolidated our earlier concerns regarding how to apply such scales at the rcch , particularly in light of cohen et al28 who suggested that the reviews reported instruments which purported to classify and score children s observed behaviors related to their distress . observed behaviors could be measured by research staff or nurses , and some instruments asked for parent / care - giver or nurse perspectives on children s behaviors . von baeyer and spagrud30 reported three well - developed observational scales which used video to capture real - time information on distress during a medical procedure and then assessment of the video post - treatment to quantify distress ( observational scale of behavioral distress scale,36 behavioral approach - avoidance and distress scale,37 and brief behavioural distress scale).38 table 2 outlines the well established measures of distress identified from the review . heart rate was reported by chalmers et al45 as a measure of children s pain in an experimental pain paper . the use of heart rate was also reported in the comfort scale,14 which provides classifications for continuous heart rate data to identify physiological stress . a number of process - based objective measures of the dressing change were noted but not specifically explored in the literature . two which appeared to be appropriate to our study were the time taken to complete the dressing change and the number of nursing staff required to complete the dressing change . our literature review showed that we could not immediately adopt any one measure with which to assess the effectiveness of virtual reality on children s distress at the rcch burns unit . our review framework of participants , research requirements , and comprehensiveness allowed us to consider the specific requirements of our research in our subjects in the burns dressing change environment . however , there were a number of potentially useful objective measures ( see table 3 ) . we had already discounted the validity of self - reported pediatric distress using visual analog scales on cultural , ethical , and linguistic grounds , and with regard to the practical difficulties of identifying worst or average pain during the three - phase , often lengthy , dressing change procedure . we believed that it would be problematic to obtain ethical approval to retain copies of sensitive footage for long - term research use , given the extensive nature of the children s burns , their state of undress during the dressing change , and parents religious and cultural beliefs regarding photographs . the varni - thompson questionnaire,31 premature infant pain profile,42 parents postoperative pain measure,44 and comfort14 scales were not relevant to our pediatric population or dressing change environment , and therefore were not considered further . whilst the observational scale of behavioral distress36 is well reported and has previously been used for burns research,46 we concur with von baeyer and spagrud30 that it poses too large a burden for regular use in our setting , particularly considering the physical limitations of the environment , and the cultural and religious contexts of videoing these children whilst in distress . we similarly discounted the campis ( child - adult medical procedure interaction scale).39 however , the campis - short form ( sf ) scale39 was potentially useful . this scale has been validated by comparing it with the observational scale of behavioural distress36 and the behavioral approach - avoidance and distress scale.37 the campis - sf scale involves an independent observer recording four dimensions of children s and caregivers responses to the child s distress in relation to a medical procedure . the instrument uses a five - point likert scale for rating the frequency of each dimension over the total observation period , ie , none or one ( 1 ) , minimal or few ( 2 ) , moderate or adequate ( 3 ) , substantial or considerable ( 4 ) , and maximum or nearly continuous ( 5 ) . the child dimensions are coping and distress , and the caregiver dimensions are coping - promoting and distress - promoting . however , the development and validation of the campis - sf was based on procedural pain associated with injections , and thus this scale may not capture the extent of distress during burns dressing change procedures at the rcch . the reviews included in this research universally reported this instrument to have sound psychometric properties . it has been used in interventional studies of different procedures ( bone marrow aspiration , lumbar puncture , radiation therapy , and immunization ) . the behaviors comprise muscle tension , screaming , crying , restraint used , pain verbalized , anxiety verbalized , verbal stalling , and physical resistance . an advantage of the pbcl is that it separately scores three phases of a procedure ( prior to , preparation for , and delivery ) . behaviors are scored based on occurrence ( 1 if present and 0 if absent , for a possible total score ranging from 0 to 8 per treatment phase ) and intensity ( scale of 1 to 5 , where 1 indicates very mild and 5 indicates extremely intense the pbcl score is derived from the three occurrence subscores and the three intensity subscores . the children s hospital of eastern ontario pain scale ( cheops)41 is widely reported and has sound psychometric properties . this instrument has been used in studies of general surgery , myringotomy and ear tube insertion , bladder nerve stimulation , closed fracture reduction , intravenous cannulation , sickle cell episodes , circumcision , and immunizations . the face , legs , arms , cry , consolability ( flacc)43 scale is an instrument that uses items similar to cheops but with a 010 metric . it is reported as imposing a low burden whilst having sound psychometric properties . it has been used in studies of postoperative pain , minor noninvasive procedures , ear , nose , and throat operations , and is routinely used at the rcch . thus , it seemed sensible for us to collect pilot data using these three scales ( pblc , cheops , and flacc ) administered independently , and then compare their clinical utility and scores in order to identify the most appropriate measure for our virtual reality research . the literature indicates that parent and health care provider reports of children s perceived distress rarely correlate with children s self - reports of pain.25 this is because parents ( and health care workers ) bring their own distress to the perception of child distress , and may over - estimate the child s responses if they are the sole respondents . thus , we did not include specific parent / caregiver / health care provider perspectives on children s distress . pulse rate and respiration were reported by mott et al as measures of distress.25 the child s heart rate ( beats per minute ) , measured every 5 seconds using a polar model chest strap and watch was reported as a measure of distress in an experimental paper by chalmers et al.45 heart rate was expressed as mean values over the time that the experimental pain ( cold ) was tolerated . grossi porto and junqueira 47 demonstrated that a polar model heart rate monitor provided time - domain variability of heart interval series ( r ri ) similar to that provided by a conventional electrocardiogram . in our research setting , heart rate could be measured noninvasively using a heart rate monitor that records continuous information which could be downloaded later for analysis . heart rate could be classified using the domains of the comfort scale.14 heart rate also appears to be a useful measure of distress for parents / caregivers as well , and could be collected whilst they wait for their child outside the burns dressing room . two process - based objective measures of the dressing change identified from the literature potentially reflected the within - child efficiency of the dressing change procedure related to the child s distress . thus , we could record the time taken to complete the dressing change ( from the time the child leaves the bed until completion of the procedure ) and the number of nursing staff required to complete the dressing change . the rcch nurses are a constant factor in the burns dressing change procedure , and they get to know children well during their time in hospital . thus , they could provide contextual information to enhance our understanding of measures of observed behaviors and objective measures . we had already discounted the validity of self - reported pediatric distress using visual analog scales on cultural , ethical , and linguistic grounds , and with regard to the practical difficulties of identifying worst or average pain during the three - phase , often lengthy , dressing change procedure . we believed that it would be problematic to obtain ethical approval to retain copies of sensitive footage for long - term research use , given the extensive nature of the children s burns , their state of undress during the dressing change , and parents religious and cultural beliefs regarding photographs . the varni - thompson questionnaire,31 premature infant pain profile,42 parents postoperative pain measure,44 and comfort14 scales were not relevant to our pediatric population or dressing change environment , and therefore were not considered further . whilst the observational scale of behavioral distress36 is well reported and has previously been used for burns research,46 we concur with von baeyer and spagrud30 that it poses too large a burden for regular use in our setting , particularly considering the physical limitations of the environment , and the cultural and religious contexts of videoing these children whilst in distress . we similarly discounted the campis ( child - adult medical procedure interaction scale).39 however , the campis - short form ( sf ) scale39 was potentially useful . this scale has been validated by comparing it with the observational scale of behavioural distress36 and the behavioral approach - avoidance and distress scale.37 the campis - sf scale involves an independent observer recording four dimensions of children s and caregivers responses to the child s distress in relation to a medical procedure . the instrument uses a five - point likert scale for rating the frequency of each dimension over the total observation period , ie , none or one ( 1 ) , minimal or few ( 2 ) , moderate or adequate ( 3 ) , substantial or considerable ( 4 ) , and maximum or nearly continuous ( 5 ) . the child dimensions are coping and distress , and the caregiver dimensions are coping - promoting and distress - promoting . however , the development and validation of the campis - sf was based on procedural pain associated with injections , and thus this scale may not capture the extent of distress during burns dressing change procedures at the rcch . the reviews included in this research universally reported this instrument to have sound psychometric properties . it has been used in interventional studies of different procedures ( bone marrow aspiration , lumbar puncture , radiation therapy , and immunization ) . the behaviors comprise muscle tension , screaming , crying , restraint used , pain verbalized , anxiety verbalized , verbal stalling , and physical resistance . an advantage of the pbcl is that it separately scores three phases of a procedure ( prior to , preparation for , and delivery ) . behaviors are scored based on occurrence ( 1 if present and 0 if absent , for a possible total score ranging from 0 to 8 per treatment phase ) and intensity ( scale of 1 to 5 , where 1 indicates very mild and 5 indicates extremely intense the pbcl score is derived from the three occurrence subscores and the three intensity subscores . the children s hospital of eastern ontario pain scale ( cheops)41 is widely reported and has sound psychometric properties . this instrument has been used in studies of general surgery , myringotomy and ear tube insertion , bladder nerve stimulation , closed fracture reduction , intravenous cannulation , sickle cell episodes , circumcision , and immunizations . the face , legs , arms , cry , consolability ( flacc)43 scale is an instrument that uses items similar to cheops but with a 010 metric . it is reported as imposing a low burden whilst having sound psychometric properties . it has been used in studies of postoperative pain , minor noninvasive procedures , ear , nose , and throat operations , and is routinely used at the rcch . thus , it seemed sensible for us to collect pilot data using these three scales ( pblc , cheops , and flacc ) administered independently , and then compare their clinical utility and scores in order to identify the most appropriate measure for our virtual reality research . the literature indicates that parent and health care provider reports of children s perceived distress rarely correlate with children s self - reports of pain.25 this is because parents ( and health care workers ) bring their own distress to the perception of child distress , and may over - estimate the child s responses if they are the sole respondents . thus , we did not include specific parent / caregiver / health care provider perspectives on children s distress . pulse rate and respiration were reported by mott et al as measures of distress.25 the child s heart rate ( beats per minute ) , measured every 5 seconds using a polar model chest strap and watch was reported as a measure of distress in an experimental paper by chalmers et al.45 heart rate was expressed as mean values over the time that the experimental pain ( cold ) was tolerated . grossi porto and junqueira 47 demonstrated that a polar model heart rate monitor provided time - domain variability of heart interval series ( r ri ) similar to that provided by a conventional electrocardiogram . in our research setting , heart rate could be measured noninvasively using a heart rate monitor that records continuous information which could be downloaded later for analysis . heart rate could be classified using the domains of the comfort scale.14 heart rate also appears to be a useful measure of distress for parents / caregivers as well , and could be collected whilst they wait for their child outside the burns dressing room . two process - based objective measures of the dressing change identified from the literature potentially reflected the within - child efficiency of the dressing change procedure related to the child s distress . thus , we could record the time taken to complete the dressing change ( from the time the child leaves the bed until completion of the procedure ) and the number of nursing staff required to complete the dressing change . the rcch nurses are a constant factor in the burns dressing change procedure , and they get to know children well during their time in hospital . thus , they could provide contextual information to enhance our understanding of measures of observed behaviors and objective measures . virtual reality has strong evidence of effectiveness in distracting western children and alleviating their distress during painful burns dressing change procedures . whether it is similarly effective for indigenous african children with extensive burns , who are from different cultures , illiterate , non - english - speaking , and with no experience of computers , is yet to be determined . the influences of culture , language , illiteracy , and familiarity with computers in our children underpinned our concerns about the validity of using the self - report scales in current pediatric virtual reality research . our research framework of considering the participants , research requirements , and comprehensiveness assisted us to sort through the range of alternative measures of pediatric distress reported in the literature . considering our analysis framework , our proposed measures of pediatric distress for virtual reality research at the rcch considers the perspectives of all participants in the burns dressing change procedure . the measures are also comprehensive , in that they measure different aspects of children s distress prior to and during burns dressing changes . these three measures will be assessed in a preliminary ( pilot ) study to correlate scores and to consider clinical utility . this will assist us in identifying the most appropriate observed behavior measure for our virtual reality research . child s heart rate measured over short time periods ( eg , every 5 seconds ) parent s heart rate measured in the same manner whilst they are outside the treatment room during the dressing change time taken to complete the dressing change from the time the child leaves his / her bed number of staff required to complete the dressing change . nurse perspectives on the efficiency of each dressing change will be captured using semistructured interviews at the completion of the dressing change procedure . these three measures will be assessed in a preliminary ( pilot ) study to correlate scores and to consider clinical utility . this will assist us in identifying the most appropriate observed behavior measure for our virtual reality research . child s heart rate measured over short time periods ( eg , every 5 seconds ) parent s heart rate measured in the same manner whilst they are outside the treatment room during the dressing change time taken to complete the dressing change from the time the child leaves his / her bed number of staff required to complete the dressing change . nurse perspectives on the efficiency of each dressing change will be captured using semistructured interviews at the completion of the dressing change procedure .

osteoporosis is a very common disease in japan that is associated with significant morbidity , mortality , and economic / social burdens [ 17 ] . indeed , recent estimates from japan suggest that 3.4%12.4% of men and 16.3%26.5% of women ( mean ( standard deviation ) age : 69.9 ( 11.2 ) years ) have lumbar , femoral neck , or hip osteoporosis . if left untreated , osteoporosis can lead to osteoporotic fractures and increased mortality [ 25 ] . a number of factors increase the risk of subsequent fractures , including advanced age , low bone mineral density ( bmd ) , previous vertebral fracture , and previous clinical fracture . the number of osteoporotic fractures in japan has increased during the last 20 years as the elderly population has increased in number [ 2 , 3 , 9 ] . as the size of the elderly population is expected to continue increasing in the future , the prevalence of osteoporosis in japan will also increase . long - term adherence and persistence with medications in the treatment of chronic conditions are crucial for preventing increases in morbidity , mortality , and healthcare costs . in particular , long - term adherence and persistence are important factors underlying the effectiveness of osteoporosis treatments [ 11 , 12 ] ; both are essential for increasing bmd and reducing the risk of fracture . common reasons for poor adherence and persistence include adverse events , inconvenience of treatment , and the lack of appropriate patient education . poor adherence can have serious health consequences , including smaller increases in bmd and an increased risk of new fractures . indeed , there is an inverse relationship between treatment adherence and fracture probability [ 1518 ] . poor adherence also increases general healthcare costs and decreases the cost - effectiveness of treatment [ 19 , 20 ] . adherence and persistence with osteoporosis treatments in clinical practice are generally poor [ 2123 ] , with approximately 50% of patients not adhering or persisting with treatment after 12 months . further , a meta - analysis of observational studies found that only 53% of patients achieved a medication possession ratio ( mpr ) 0.8 six months after starting treatment and that only 43% of patients achieved an mpr 0.8 712 months after starting treatment . there are very limited data in the peer - reviewed literature on adherence and persistence with osteoporosis medications in japan [ 2628 ] . findings from the only real - world clinical practice study in japan published to date suggest that adherence with osteoporosis medications may be low , with approximately 45% of patients found to be adherent with bisphosphonates 12 months after starting treatment . once - daily teriparatide , the recombinant 134 fragment of human parathyroid hormone , became available in japan in october 2010 for the treatment of osteoporosis in patients with a high risk of fracture . given as a subcutaneous injection , teriparatide stimulates osteoblastic activity and the formation of new trabecular and cortical bone . clinical studies have shown that once - daily teriparatide administered over 1824 months significantly reduces the incidence of vertebral , nonvertebral , and fragility fractures , reduces back pain , and improves quality of life in postmenopausal women with osteoporosis [ 30 , 31 ] . adherence and/or persistence with once - daily teriparatide have been investigated in studies carried out in europe and north america [ 18 , 3136 ] . after 12 months , adherence ( mpr ) in these studies ranged from 0.660.81 [ 18 , 34 ] , whereas persistence ranged from 57%87% [ 18 , 31 , 32 , 34 , 35 ] . it is unclear whether once - daily teriparatide adherence and persistence patterns in japan are similar to those in other countries or to those for other osteoporosis treatments . the aim of this prescription database study was to describe real - world adherence and persistence with once - daily teriparatide during the first year of treatment for patients who started treatment during the first eight months of availability in japan . data were obtained from a pharmacy prescription database provided by japan medical information research institute inc . the database comprises the deidentified , pharmacy - specific records of approximately 630,000 patients , 840,000 prescriptions , and 45,000 prescribing physicians per month . further , the database includes 0.8% ( 400/50,000 ) of pharmacies and 1.5 to 2.0% of prescriptions nationwide and contains information on demographics , dispensing records , prescribers , hospital size , and type of insurance . the age , sex , and prescriber distributions in the database are consistent with those of the general japanese population ( japan medical information research institute inc . , men and women were eligible for inclusion if they had an index date ( first claim for once - daily teriparatide 20 g ( forteo , rhpth(1 - 34 ) , eli lilly japan k.k . , kobe , japan ) ) between october 2010 and may 2011 , a preindex period 6 months , a postindex period 12 months , and aged > 45 years . the primary study objectives were to assess adherence and persistence during the first 12 months of treatment . adherence was measured by calculating the mpr , defined as the sum of the days ' supply of medication dispensed between the start and the end of the study period divided by the total number of days in the study period . once - daily teriparatide is prescribed in 30-day increments ( note that once - daily teriparatide received an exemption from the 14-day supply limit that is standard during the first 12 months after approval for any new medication in japan ) . therefore , the days ' supply of medication for most prescriptions fell into one of three increments : 30 ( one month ) , 60 ( two months ) , or 90 days ( three months ) . persistence was calculated using the time from the start of treatment to the discontinuation of treatment or the end of the study period . discontinuation was defined as a 60-day gap between two prescriptions or discontinued use of once - daily teriparatide . secondary objectives were to compare baseline demographic and clinical characteristics between patients who had and had not been prescribed glucocorticoids during the pre - index period ; to compare baseline demographic and clinical characteristics , adherence , and persistence between patients who were early ( months 14 of availability ) and later ( months 58 of availability ) initiators of treatment ; and to assess the proportion of patients switching treatment / restarting treatment after discontinuation . we compared characteristics between patients who had and had not been prescribed glucocorticoids because glucocorticoid use is an established risk factor for osteoporosis . we compared characteristics , adherence , and persistence between patients who were early and later initiators of once - daily teriparatide to explore potential differences ( e.g. , due to patient education and prescribing physicians ' attitudes / knowledge ) related to the timing of approval in japan . demographic and clinical characteristics were summarised for the full analysis sample and were compared ( two - sample t - test for continuous variables / fisher 's exact test for categorical variables ) between patients who had and had not been prescribed glucocorticoids during the pre - index period and between patients who were early and later initiators of treatment . variables associated with high adherence ( mpr > 0.80 ) were identified using stepwise logistic regression ( odds ratio ( or ) and 95% confidence interval ( ci ) ) , with age , sex , timing of treatment initiation , prescribing physician 's specialty , hospital size , insurance type , and previous medications as potential covariates . the cut - off for high adherence was selected in accordance with previous studies reporting adherence with osteoporosis medications [ 16 , 18 ] . a kaplan - meier survival curve for persistence variables associated with persistence were identified using a stepwise cox proportional hazard model ( hazards ratio ( hr ) and 95% ci ) , with age , sex , timing of treatment initiation , prescribing physician 's specialty , hospital size , insurance type , and previous medications as potential covariates . adherence and persistence for patients who were early and later initiators of treatment data were analysed using sas software , version 9.2 ( sas institute inc . , cary , nc ) . a total of 287 patients in the database initiated treatment between october 2010 and may 2011 . of these patients , 123 ( 42.9% ) met the eligibility criteria and 164 ( 57.1% ) did not ( figure 1 ) . of the 123 patients included in the study , the majority ( 70% ) were aged 70 years , were women , and were prescribed once - daily teriparatide by physicians who were orthopaedic specialists ( table 1 ) . two - thirds of patients had been prescribed osteoporosis medications during the pre - index period , most commonly bisphosphonates . other common ( 40% of patients ) disease prescriptions during the pre - index period included medications for rheumatoid arthritis and cardiovascular disease . there were several statistically significant differences in demographic and clinical characteristics between patients who were and were not prescribed glucocorticoids during the pre - index period and between patients who were early and later initiators of treatment ( table 1 ) . compared with patients who were not prescribed glucocorticoids , patients who were prescribed glucocorticoids were younger , were more commonly prescribed medications for osteoporosis , rheumatoid arthritis , and cardiovascular disease , and were more commonly prescribed immunosuppressants and anticoagulants during the pre - index period ( p < 0.05 ) . compared with patients who were early initiators of once - daily teriparatide , patients who were later initiators of once - daily teriparatide were less commonly prescribed raloxifene , vitamin d , and calcium and more commonly prescribed medications for rheumatoid arthritis during the pre - index period ( p < 0.05 ) . overall mean ( standard deviation ) mpr was 0.702 ( 0.366 ) , with 61.0% of patients having high adherence ( mpr > 0.8 ) ( table 2 ) . adherence ( mean and mpr > 0.8 ) was numerically , but not statistically significantly , higher for patients who were later initiators of treatment compared with patients who were early initiators of treatment ( table 2 ) . adherence was similar between patients who were and were not prescribed glucocorticoids during the pre - index period ( data not shown ) . the odds of high adherence were significantly greater for patients aged 7079 years than those aged 80 years ( or : 4.001 ; 95% ci : 1.53310.445 ; p = 0.014 ) and for women than for men ( or : 6.377 ; 95% ci : 1.23332.980 ; p = 0.027 ) . the percentage of patients remaining on treatment was 65.9% at 180 days and 61.0% at 365 days ( table 2 , figure 2 ) . persistence with treatment was numerically , but not statistically significantly , higher for patients who were later initiators of treatment compared with patients who were early initiators of treatment ( table 2 , figure 3 ) . the decrease in persistence was most evident within the first 60 days , particularly for patients who were early initiators ( figure 3 ) . persistence was similar between patients who were and were not prescribed glucocorticoids during the pre - index period ( data not shown ) . the likelihood of discontinuation was significantly lower for women than men ( hr : 0.404 ; 95% ci : 0.1790.910 ; p = 0.029 ) and for patients prescribed rheumatoid arthritis medications during the pre - index period ( hr : 0.535 ; 95% ci : 0.2900.989 ; p = 0.046 ) and was significantly higher for patients prescribed calcium ( hr : 2.588 ; 95% ci : 1.2835.222 ; p = 0.008 ) or anticonvulsants ( hr : 6.510 ; 95% ci : 1.82923.169 ; p = 0.004 ) during the pre - index period . of the 123 patients , 27 ( 22.0% ) switched to other osteoporosis medications and 6 the most common osteoporosis medications switched to were bisphosphonates ( 7 patients ; 25.9% ) and alfacalcidol + calcium ( 6 patients ; 22.2% ) . in this study , we evaluated real - world adherence and persistence with once - daily teriparatide in japan . we extracted data from a pharmacy claims database and determined 12-month rates of adherence and persistence with once - daily teriparatide for patients who started treatment during the first eight months of availability . given the importance of adherence and persistence for maintaining the effectiveness of osteoporosis treatments and that once - daily teriparatide has only recently become available in japan , our findings represent timely information on the clinical use of once - daily teriparatide in japan . in general , the estimates for once - daily teriparatide adherence and persistence in our study are consistent with those from similar studies conducted in other countries . using yu et al . reported mean mprs for once - daily teriparatide at 12 months of 0.66 and 0.81 and persistence rates of 56.7% and 69.0% . the most likely explanation for the higher mpr and rate of persistence in the yu et al . study is that patients were excluded from the study if they had only one prescription for once - daily teriparatide . study , where all patients with at least one prescription for once - daily teriparatide were included . the use of prescription data to estimate adherence does not allow for confirmation of medication administration and , therefore , may overestimate adherence . despite this , several nonprescription database studies carried out in canada and europe [ 31 , 35 ] have reported higher estimates for adherence and persistence with once - daily teriparatide than in our study . however , these studies involved patients with severe disease [ 31 , 35 ] and/or patient - reported assessments of adherence and persistence [ 31 , 35 , 38 ] , which may have contributed to the higher estimates compared with our own . the estimates of adherence and persistence with once - daily teriparatide in our study compare favourably with those for other osteoporosis medications . of note , our estimates of adherence and persistence are not greatly different to those from a prescription database study of once - daily alendronate ( 12-month mpr : 0.576 ; persistence : 31.7% ) , a claims database study of osteoporosis medications ( medication days < 80% of possible : 70% of patients at 12 months ; persistence : 53% ) , and a meta - analysis of observational studies examining real - world adherence with osteoporosis medications ( mpr 0.8 at 712 months : 43% ; persistence : 50% ) . our estimates of adherence compare favourably with those from a clinical practice study of japanese women with osteoporosis , in which approximately 45% of patients were adherent with bisphosphonates at 12 months . overall , the available evidence suggests that treatment with once - daily teriparatide is not associated with decreases in adherence and persistence relative to other osteoporosis medications . this is an important point because teriparatide is administered as a once - daily , self - administered subcutaneous injection , which is unlike most other osteoporosis medications that are taken orally and may require less frequent dosing . however , these results are limited by the small number of patients and because we did not have information on a number of other factors that may have affected adherence and persistence , such as disease severity , fracture history , or adverse events . as adherence and persistence are critical for osteoporosis treatments to be effective [ 11 , 12 ] , identifying reliable predictors of adherence and persistence with once - daily teriparatide in japan may help provide information on how to optimise treatment strategies . hence , more robust analyses on factors affecting adherence and persistence with once - daily teriparatide in japan are warranted as additional data become available . subgroup analysis of the data in our study suggests that later initiators of treatment had higher rates of adherence and persistence than early initiators of treatment . one potential explanation for this finding is the support program for patients taking once - daily teriparatide . indeed , the importance of patient support / education for persistence with teriparatide has been demonstrated in studies carried out in europe [ 32 , 33 ] . in japan , the support program for patients taking once - daily teriparatide aims to educate and train patients on the use of once - daily teriparatide to improve adherence and persistence . although we did not assess the effectiveness of the support program in this study , we suggest that the teriparatide support program may have been less well established in the earlier part of the study , which commenced shortly after once - daily teriparatide became available . therefore , patients who were early initiators of treatment may have received less comprehensive education / training than patients who were later initiators of treatment . interestingly , we found that the decrease in persistence was most pronounced shortly after starting treatment . this finding further emphasises the importance of early and effective patient education to help maximise adherence and persistence . therefore , another potential explanation for the different rates of adherence and persistence between early and later initiators of treatment is differing physician attitudes and knowledge about once - daily teriparatide . for example , physicians treating patients who were early initiators of treatment may have been less knowledgeable about teriparatide than physicians treating patients who were later initiators of treatment . the strengths of our study are that the data were obtained from clinical practice settings within a short time after once - daily teriparatide became available in japan . indeed , our study highlights the benefits of using prescription databases to rapidly obtain and analyse data on drug use in clinical settings . however , the small number of patients in our study and the lack of available information on additional patient variables ( e.g. , disease diagnosis and severity , comorbidities , fracture history , fractures during treatment , adverse events , hospitalisation , functioning , treatment costs , and reasons for changing medication / treatment discontinuation ) limited our capacity to produce definitive statistical conclusions regarding the association between these variables and the rates of adherence and persistence in this patient population . similar prescription database studies carried out in the united states have examined some of these associations . reported that bmd screening , use of antiresorptive therapies within 12 months of starting teriparatide , and lower treatment costs were associated with better persistence with teriparatide . yu et al . reported that risk of fracture was lower in patients with high adherence ( mpr 0.80 ) and that persistence with teriparatide for 19 to 24 months was associated with a lower risk of vertebral and nonvertebral fractures compared with persistence for 1 to 6 months . an additional limitation of our study is that , because once - daily teriparatide has only recently become available in japan , the length of follow - up was relatively short given that the treatment regimen is 24 months . hence , a study with a greater length of follow - up and a larger number of patients is warranted . in conclusion , our findings suggest that adherence and persistence with once - daily teriparatide in japan , as determined using prescription data for patients who started treatment during the first eight months of availability , are similar to adherence and persistence with once - daily teriparatide in other countries . despite requiring once - daily injection , adherence and persistence with teriparatide appear to be similar to adherence and persistence with other osteoporosis medications , including oral medications with less frequent dosing .

a 67-year - old obese man was referred for further investigation following an episode of sudden - onset left - sided loin pain that had lasted for 6 h and then resolved spontaneously . he had type 2 diabetes mellitus , but no other relevant past medical history . physical examination revealed a large left - sided irreducible , non - tender inguino - scrotal hernia , and laboratory investigation , including serum creatinine was within normal limits . an ultrasound scan of his renal tract revealed left - sided hydronephrosis , and a subsequent computed tomography scan showed left - sided hydronephrosis with a dilated ureter that was seen to enter the large inguino - scrotal hernia [ figures 1 and 2 ] . it then took a path back out of the hernia where it became non - dilated and inserted into the bladder in its usual position . non - contrast ( left ) and delayed phase ( right ) coronal computed tomography scan showing dilated left ureter entering large left inguino - scrotal hernia ( arrows ) venous phase coronal computed tomography showing left ureter after having left the inguino - scrotal hernia as it enters the bladder . note , how the ureter is now of normal calibre ( arrow ) a subsequent dimercaptosuccinic acid ( dmsa ) scan confirmed reduced function of the affected kidney , contributing 35% to overall renal function and hence he underwent a mesh repair of this hernia with careful dissection of the ureter from the hernial sac and his post - operative recovery was uneventful . uretero - inguinal hernia in patients with non - transplant kidneys is a rare phenomenon with the majority diagnosed intra - operatively when found unexpectedly during the hernia repair . two types have been described - paraperitoneal , accounting for 80% of cases , in which the ureter is pulled into the hernia alongside the peritoneal sac due to an adherent layer of posterior peritoneum ; and extraperitoneal , in which no peritoneal sac is present in the hernia and the ureter is involved alone or in combination with retroperitoneal fat . in our case , the rarer extraperitoneal form is more commonly associated with renal tract anomalies ( such as renal ptosis ) , and hence renal tract imaging should be performed even if it is incidentally found at surgery . as this condition is associated with inguinal herniation , it is more common in men , typically in the fifth or sixth decade . reported pre - disposing features include obesity and a deficiency in collagen synthesis . pre - operative diagnosis is important to reduce the significant risk of ureteral injury during surgery . although stenting of the ureter facilitates identification and protection during the hernia repair , the length and tortuosity of the herniated ureter make endourological procedures ( such as ureteric stent insertion ) difficult and hence careful dissection of the ureter from the hernial sac and replacement in the retroperitoneal space is imperative to prevent injury .

capture management ( cm ) is a programmable feature that allows automatic adjustment of pacing amplitudes in response to changing pacing thresholds . it monitors whether pacing pulses capture the myocardium and , optionally , adjusts their amplitude to changing patient conditions . in cm operation , the device prepares for a pacing threshold search , conducts the pacing threshold search , and determines the pacing threshold . over time , the threshold measurements are collected to create threshold trends . if cm is programmed to adaptive , the device may automatically adjust the pacing outputs . if cm is programmed to the automatic right atrial ( ra ) and right ventricular ( rv ) cm features have been incorporated for the first time in high - power devices ( secura icd and consulta crt - d ) . the consulta crt - d devices also have the previously validated automatic lv cm incorporated . the algorithms included in secura icd and consulta crt - d devices are very similar to those included in recent medtronic pacemakers . automatic threshold measurements occur near 1 a.m. every day and will retry on half - an - hour intervals in the event of an unsuccessful measurement ( e.g. if the intrinsic rhythm is fast or unstable ) . the algorithms measure thresholds based on progressively lowering test pace amplitudes , until loss of capture is determined . right atrial cm determines atrial capture by application of a test pace to the atrium and evaluating either the response of the intrinsic rhythm or by evaluating the timing of the conducted ventricular response . ventricular cm determines capture by applying a test pace to the rv and evaluating the timing of the evoked response signal . left ventricular cm determines capture by applying a test pace to the lv and comparing the timing of a conducted response in the rv to pre - determined a rv and lv , the algorithms confirm capture at the threshold amplitude of 0.125 v above the loss of capture voltage . when programmed to the adaptive mode , pacing output amplitudes are adjusted automatically by applying the programmed safety margin to the measured threshold . for ra and rv cm , the safety margin is a multiple of the measured threshold ( nominally , 2.0 for both ra and rv cm ) . the pacing output is therefore maintained at a voltage that is larger than the measured threshold by at least a factor of the safety margin . right atrial and rv cm also each have a programmable minimum adapted amplitude ( nominally , 1.5 v and 2.0 v , respectively ) below which pacing output will never be automatically programmed . right atrial and rv cm will not adjust pacing outputs > 5 v with a 1.0 ms pulse width . left ventricular cm uses a different safety margin , nominally 1.5 v above the measured threshold . left ventricular cm also has a programmable maximum adapted amplitude such that potential stimulation concerns at high pacing outputs can be avoided . there has been a long - standing concern about inappropriate high measurements based on the original cm algorithm . however , more recent generations incorporate features ( such as the ability to switch sensing of the evoked response from bipolar to unipolar ) that have mitigated this problem in pacemakers . capture management will inevitably be increasingly important in the era of remote follow - up . as the number of patients with implantable cardiac devices continues to increase with current patient demographics , the need to reduce the follow - up burden increases . the primary objective of the secura and consulta clinical studies was to evaluate the safety of these devices . a secondary objective was to evaluate the automated ra and rv cm features in high - power devices . the lv cm algorithm has already been validated in a previous crt - d study and therefore was not validated in the current clinical study . in this manuscript , we report on the results of the first validation of the ra and rv cm algorithms in high - power devices , the applicability of ra , rv , and lv cm , and the effects that ra , rv , and lv cm features have on pacing outputs . two separate prospective , multicentre , non - randomized clinical studies ( secura icd and consulta crt - d ) were conducted in 28 centres in europe and israel ; see appendix for a list of participating investigators . both clinical studies were conducted in compliance with the declaration of helsinki , the research protocols were approved by the local ethics committees , and for all patients , informed consent was obtained prior to enrolment in the study . the eligibility criteria were primarily designed to reflect current indications for implantable cardioverter defibrillator ( icd)/cardiac resynchronization therapy defibrillator ( crt - d ) implantation . patients with an established indication for icd or crt - d implantation according to international guidelines , or elective device replacement ; who were receiving optimal medical therapy , and were geographically stable and available for follow - up . in addition for the consulta study , patients receiving new implants who were in nyha class iii or iv and had intrinsic qrs duration > 120 ms within 30 days prior to baseline ; and lv ejection fraction ( lvef ) 35% within 180 days prior to baseline ( patients undergoing crt - d unit replacement were assumed to have met these criteria at the time of original implant ) . local ethics committee approval and written informed consent patients with a life expectancy less than the duration of the study ; with medical conditions precluding the testing required by the study protocol or otherwise limiting study participation ( including pregnancy and breastfeeding ) ; with mechanical tricuspid heart valves ; participating in any concurrent device study , or any drug study that might confound the results of this trial ; in need of device replacement with lead integrity problems ( and the lead(s ) can or will not be replaced ) . manual threshold measurements were obtained at the 1-month follow - up and the automatic ra and rv cm data were compared with manual threshold measurements for all implanted subjects with a valid manual threshold test and a successful cm threshold measurement completed 2 days beforehand . the thresholds were determined by decreasing the amplitude in steps of 0.125 v ( automatic ) and 0.25 v ( manual ) , respectively . applicability was defined as the percentage of patients who had successful threshold measurement over a given time period prior to the 3-month visit . applicability was examined based on the data of the 3-month visit in subjects with device programming that allowed automatic threshold measurements . the 3-month follow - up was chosen for analysis because the maximum number of patients had device data for this period . although cm applicability may be higher with more frequent measurement attempts , a daily measurement was chosen as a trade - off between achieving the highest applicability without excessive measurement attempts . the cm applicability was determined for the following periods : 1 , 3 days , 1 week , 1 , and 3 months prior to the 3-month follow - up . at the 6-month follow - up visit , automatic threshold data were analysed in patients with devices programmed to the adaptive cm mode ( ra , rv , and lv cm ) , to determine how often and in which direction the current cm algorithms adjusted the pacing outputs since the pre - discharge visit . the 6-month follow - up was chosen for this analysis to ensure that the leads had matured past the acute implant phase and that the cm algorithms had time to adjust the pacing outputs . data from the comparison between the manual threshold results and the automatic cm threshold results are presented as n , mean , standard deviation ( sd ) , median , range , and 95% confidence interval . data from the adjustment of the pacing output are represented as n , mean , sd , range , and percentages . two separate prospective , multicentre , non - randomized clinical studies ( secura icd and consulta crt - d ) were conducted in 28 centres in europe and israel ; see appendix for a list of participating investigators . both clinical studies were conducted in compliance with the declaration of helsinki , the research protocols were approved by the local ethics committees , and for all patients , informed consent was obtained prior to enrolment in the study . the eligibility criteria were primarily designed to reflect current indications for implantable cardioverter defibrillator ( icd)/cardiac resynchronization therapy defibrillator ( crt - d ) implantation . patients with an established indication for icd or crt - d implantation according to international guidelines , or elective device replacement ; who were receiving optimal medical therapy , and were geographically stable and available for follow - up . in addition for the consulta study , patients receiving new implants who were in nyha class iii or iv and had intrinsic qrs duration > 120 ms within 30 days prior to baseline ; and lv ejection fraction ( lvef ) 35% within 180 days prior to baseline ( patients undergoing crt - d unit replacement were assumed to have met these criteria at the time of original implant ) . local ethics committee approval and written informed consent patients with a life expectancy less than the duration of the study ; with medical conditions precluding the testing required by the study protocol or otherwise limiting study participation ( including pregnancy and breastfeeding ) ; with mechanical tricuspid heart valves ; participating in any concurrent device study , or any drug study that might confound the results of this trial ; in need of device replacement with lead integrity problems ( and the lead(s ) can or will not be replaced ) . manual threshold measurements were obtained at the 1-month follow - up and the automatic ra and rv cm data were compared with manual threshold measurements for all implanted subjects with a valid manual threshold test and a successful cm threshold measurement completed 2 days beforehand . the thresholds were determined by decreasing the amplitude in steps of 0.125 v ( automatic ) and 0.25 v ( manual ) , respectively . applicability was defined as the percentage of patients who had successful threshold measurement over a given time period prior to the 3-month visit . applicability was examined based on the data of the 3-month visit in subjects with device programming that allowed automatic threshold measurements . the 3-month follow - up was chosen for analysis because the maximum number of patients had device data for this period . although cm applicability may be higher with more frequent measurement attempts , a daily measurement was chosen as a trade - off between achieving the highest applicability without excessive measurement attempts . the cm applicability was determined for the following periods : 1 , 3 days , 1 week , 1 , and 3 months prior to the 3-month follow - up . at the 6-month follow - up visit , automatic threshold data were analysed in patients with devices programmed to the adaptive cm mode ( ra , rv , and lv cm ) , to determine how often and in which direction the current cm algorithms adjusted the pacing outputs since the pre - discharge visit . the 6-month follow - up was chosen for this analysis to ensure that the leads had matured past the acute implant phase and that the cm algorithms had time to adjust the pacing outputs . patients with an established indication for icd or crt - d implantation according to international guidelines , or elective device replacement ; who were receiving optimal medical therapy , and were geographically stable and available for follow - up . in addition for the consulta study , patients receiving new implants who were in nyha class iii or iv and had intrinsic qrs duration > 120 ms within 30 days prior to baseline ; and lv ejection fraction ( lvef ) 35% within 180 days prior to baseline ( patients undergoing crt - d unit replacement were assumed to have met these criteria at the time of original implant ) . patients with a life expectancy less than the duration of the study ; with medical conditions precluding the testing required by the study protocol or otherwise limiting study participation ( including pregnancy and breastfeeding ) ; with mechanical tricuspid heart valves ; participating in any concurrent device study , or any drug study that might confound the results of this trial ; in need of device replacement with lead integrity problems ( and the lead(s ) can or will not be replaced ) . manual threshold measurements were obtained at the 1-month follow - up and the automatic ra and rv cm data were compared with manual threshold measurements for all implanted subjects with a valid manual threshold test and a successful cm threshold measurement completed 2 days beforehand . the thresholds were determined by decreasing the amplitude in steps of 0.125 v ( automatic ) and 0.25 v ( manual ) , respectively . applicability was defined as the percentage of patients who had successful threshold measurement over a given time period prior to the 3-month visit . applicability was examined based on the data of the 3-month visit in subjects with device programming that allowed automatic threshold measurements . the 3-month follow - up was chosen for analysis because the maximum number of patients had device data for this period . although cm applicability may be higher with more frequent measurement attempts , a daily measurement was chosen as a trade - off between achieving the highest applicability without excessive measurement attempts . the cm applicability was determined for the following periods : 1 , 3 days , 1 week , 1 , and 3 months prior to the 3-month follow - up . at the 6-month follow - up visit , automatic threshold data were analysed in patients with devices programmed to the adaptive cm mode ( ra , rv , and lv cm ) , to determine how often and in which direction the current cm algorithms adjusted the pacing outputs since the pre - discharge visit . the 6-month follow - up was chosen for this analysis to ensure that the leads had matured past the acute implant phase and that the cm algorithms had time to adjust the pacing outputs . data from the comparison between the manual threshold results and the automatic cm threshold results are presented as n , mean , standard deviation ( sd ) , median , range , and 95% confidence interval . capture management applicability data from the adjustment of the pacing output are represented as n , mean , sd , range , and percentages . in total , 160 patients were successfully implanted and included in the two clinical studies . those 160 patients had a mean age of 64.6 10.4 years , 77% were male , mean lvef was 27.6 9.6% , 80 were icd , and 80 were crt - d patients . of the 160 patients , 42 ( 26% ) had atrial fibrillation ( af ) at baseline with 24 paroxysmal af , 9 persistent af , and 9 permanent af . the crt - d and the icd patient groups had similar demographics and device threshold data ( table 1 ) . table 1patient demographicsnumber of subjects160age ( years ) , mean ( sd)64.6 10.4male123 ( 77%)myocardial infarction90 ( 56%)atrial fibrillation42 ( 26%)paroxysmal af24persistent af9permanent af9nyha class ii30 ( 19%)nyha class iii113 ( 71%)nyha class i , iv8 ( 5%)beta - blocker139 ( 87%)ace - inhibitor140 ( 88%)diuretics124 ( 78%)no heart failure6 ( 4%)lvef ( % ) , mean ( sd)27.6 9.6ischaemic cardiomyopathy90 ( 56% ) table 2 details 1-month paired ( manual and cm ) data that were available for 159 patients including 114 paired atrial measurements and 139 paired rv measurements . the combined results showed that for ra and rv cm , respectively , 86 and 84% of automatic measurements were within 0.125 v of the manual measurement , 97 and 96% were within 0.25 v of the manual measurement , and 100 and 99.3% were within 0.5 v. all differences were well within the standard two - fold safety margin for output automatically set by the device ( figures 1 and 2 ) . table 2automatic threshold measurements ( cm ) vs. manually determined thresholdautomatic thresholdmanual thresholddifference , cm manualra threshold ( n = 114 ) mean sd0.713 0.2420.730 0.2310.018 0.141 median0.6250.7500.000 range0.2501.6250.2501.5000.5000.375 95% ci0.668 , 0.7580.687 , 0.7730.044 , 0.009rv threshold ( n = 139 ) mean sd0.843 0.4300.885 0.4250.042 0.147 median0.7500.7500 range0.3752.5000.2502.2500.5000.625 95% ci0.771 , 0.9150.814 , 0.9560.067 , 0.018 automatic threshold measurements ( cm ) vs. manually determined threshold overall distribution of difference in atrial thresholds obtained by ra cm and manual testing ( 1-month data ) . overall distribution of difference in rv threshold obtained by rv cm and manual testing ( 1-month data ) . the cm applicability was measured at 1 , 3 days , 1 week , 1 , and 3 months prior to the 3-months follow - up visit . right atrial cm applicability was 119 of 135 ( 88% ) , 122 of 135 ( 90% ) , 122 of 135 ( 90% ) , 122 of 135 ( 90% ) , and 125 of 134 ( 93% ) when measured within 1 , 3 days , 1 week , 1 , and 3 months , respectively . the rv cm applicability was 141 of 144 ( 98% ) , 142 of 144 ( 99% ) , 142 of 144 ( 99% ) , 142 of 144 ( 99% ) , and 143 of 144 ( 99% ) when measured within 1 , 3 days , 1 week , 1 , and 3 months , respectively . the lv cm applicability was 62 of 68 ( 91% ) , 62 of 68 ( 91% ) , 66 of 68 ( 97% ) , 66 of 68 ( 97% ) , and 66 of 68 ( 97% ) when measured within 1 , 3 days , 1 week , 1 , and 3 months , respectively . of the 16 patients without an atrial threshold measurement within 1 day , 8 were due to persistent atrial tachycardia / af , 5 were due to significant pacemaker dependence ( i.e. nearly 100% atrial and ventricular paced ) , and 3 were due to high or variable rates . high threshold when the measured threshold is > 2.5 v. in these cases , when programmed to the adaptive mode , the algorithm adjusts pacing output to 5 v with a 1.0 ms pulse width . the cm results based on 160 patients indicated high ra threshold in seven patients ( 4.4% ) and high rv threshold in nine patients ( 5.6% ) . because lv thresholds tend to be higher than a and rv thresholds , the lv cm algorithm will measure thresholds up to 6.0 v. the lv cm results based on 80 patients indicated that the algorithm was unable to maintain the programmed safety margin due to high thresholds in three patients ( 3.8% ) at some point prior to the 6-month follow - up . all of these indications of high thresholds were due to appropriate measurement of high thresholds ( five patients ) , lead dislodgements ( four patients ) , acute effects of lead maturation ( six patients ) , or incomplete connection of the lead in the header block ( one patient ) . right atrial , rv , and lv cm were programmed to the adaptive mode with 6 months of follow - up data in 133 , 132 , and 51 devices , respectively . the cm adapted pacing outputs were compared with the clinician programmed pre - discharge pacing outputs ( in a majority of cases , the pre - discharge pacing output was the pacemaker nominal setting ) . capture management increased the ra output in four patients ( 3.0% ) , increased the rv output in nine patients ( 6.8% ) , and increased the lv output in one patient ( 2.0% ) . the maximum output increase in each chamber was 1.5 v. capture management decreased the ra output in 112 patients ( 84.2% ) , decreased the rv output in 115 patients ( 87.1% ) , and decreased the lv output in 49 patients ( 94.2% ) . for icd subjects , the mean decreases in ra and rv were 1.7 and 1.1 v , respectively . for crt - d subjects , the mean decreases in ra , overall , the output decreased > 1 v in each chamber : the mean decreases in ra , rv , and lv were 1.5 , 1.2 , and 1.4 v , respectively ( table 3 ) . all adjustments were found to be appropriate when cm and manual threshold measurements were examined . table 3comparison between the amplitude at pre - discharge and at the 6-month follow - up visitamplitude ( v)ra cm ( n = 133)rv cm ( n = 132)lv cm ( n = 51)mean sdimplant3.5 0.53.5 0.44.0 0.56-month2.0 0.82.3 0.72.6 0.7difference ( 6-month implant)1.5 0.91.2 0.81.4 0.8implant2.05.02.05.02.256.0range6-month0.55.01.55.01.755.5difference ( 6-month implant)3.5 to 1.53.0 to 1.53.5 to 1.5no . of amplitude decreases from implant to 6-month ( n , % ) 112 ( 84.2)115 ( 87.1)49 ( 96.1)no . of amplitude increases from implant to 6-month ( n , % ) 4 ( 3.0)9 ( 6.8)1 ( 2)no . of unchanged amplitudes from implant to 6-month ( n , % ) 17 ( 12.8)8 ( 6.1)1 ( 2 ) comparison between the amplitude at pre - discharge and at the 6-month follow - up visit in total , 160 patients were successfully implanted and included in the two clinical studies . those 160 patients had a mean age of 64.6 10.4 years , 77% were male , mean lvef was 27.6 9.6% , 80 were icd , and 80 were crt - d patients . of the 160 patients , 42 ( 26% ) had atrial fibrillation ( af ) at baseline with 24 paroxysmal af , 9 persistent af , and 9 permanent af . the crt - d and the icd patient groups had similar demographics and device threshold data ( table 1 ) . table 1patient demographicsnumber of subjects160age ( years ) , mean ( sd)64.6 10.4male123 ( 77%)myocardial infarction90 ( 56%)atrial fibrillation42 ( 26%)paroxysmal af24persistent af9permanent af9nyha class ii30 ( 19%)nyha class iii113 ( 71%)nyha class i , iv8 ( 5%)beta - blocker139 ( 87%)ace - inhibitor140 ( 88%)diuretics124 ( 78%)no heart failure6 ( 4%)lvef ( % ) , mean ( sd)27.6 9.6ischaemic cardiomyopathy90 ( 56% ) table 2 details 1-month paired ( manual and cm ) data that were available for 159 patients including 114 paired atrial measurements and 139 paired rv measurements . the combined results showed that for ra and rv cm , respectively , 86 and 84% of automatic measurements were within 0.125 v of the manual measurement , 97 and 96% were within 0.25 v of the manual measurement , and 100 and 99.3% were within 0.5 v. all differences were well within the standard two - fold safety margin for output automatically set by the device ( figures 1 and 2 ) . table 2automatic threshold measurements ( cm ) vs. manually determined thresholdautomatic thresholdmanual thresholddifference , cm manualra threshold ( n = 114 ) mean sd0.713 0.2420.730 0.2310.018 0.141 median0.6250.7500.000 range0.2501.6250.2501.5000.5000.375 95% ci0.668 , 0.7580.687 , 0.7730.044 , 0.009rv threshold ( n = 139 ) mean sd0.843 0.4300.885 0.4250.042 0.147 median0.7500.7500 range0.3752.5000.2502.2500.5000.625 95% ci0.771 , 0.9150.814 , 0.9560.067 , 0.018 automatic threshold measurements ( cm ) vs. manually determined threshold overall distribution of difference in atrial thresholds obtained by ra cm and manual testing ( 1-month data ) . overall distribution of difference in rv threshold obtained by rv cm and manual testing ( 1-month data ) . the cm applicability was measured at 1 , 3 days , 1 week , 1 , and 3 months prior to the 3-months follow - up visit . right atrial cm applicability was 119 of 135 ( 88% ) , 122 of 135 ( 90% ) , 122 of 135 ( 90% ) , 122 of 135 ( 90% ) , and 125 of 134 ( 93% ) when measured within 1 , 3 days , 1 week , 1 , and 3 months , respectively . the rv cm applicability was 141 of 144 ( 98% ) , 142 of 144 ( 99% ) , 142 of 144 ( 99% ) , 142 of 144 ( 99% ) , and 143 of 144 ( 99% ) when measured within 1 , 3 days , 1 week , 1 , and 3 months , respectively . the lv cm applicability was 62 of 68 ( 91% ) , 62 of 68 ( 91% ) , 66 of 68 ( 97% ) , 66 of 68 ( 97% ) , and 66 of 68 ( 97% ) when measured within 1 , 3 days , 1 week , 1 , and 3 months , respectively . of the 16 patients without an atrial threshold measurement within 1 day , 8 were due to persistent atrial tachycardia / af , 5 were due to significant pacemaker dependence ( i.e. nearly 100% atrial and ventricular paced ) , and 3 were due to high or variable rates . high threshold when the measured threshold is > 2.5 v. in these cases , when programmed to the adaptive mode , the algorithm adjusts pacing output to 5 v with a 1.0 ms pulse width . the cm results based on 160 patients indicated high ra threshold in seven patients ( 4.4% ) and high rv threshold in nine patients ( 5.6% ) . because lv thresholds tend to be higher than a and rv thresholds , the lv cm algorithm will measure thresholds up to 6.0 v. the lv cm results based on 80 patients indicated that the algorithm was unable to maintain the programmed safety margin due to high thresholds in three patients ( 3.8% ) at some point prior to the 6-month follow - up . all of these indications of high thresholds were due to appropriate measurement of high thresholds ( five patients ) , lead dislodgements ( four patients ) , acute effects of lead maturation ( six patients ) , or incomplete connection of the lead in the header block ( one patient ) . right atrial , rv , and lv cm were programmed to the adaptive mode with 6 months of follow - up data in 133 , 132 , and 51 devices , respectively . the cm adapted pacing outputs were compared with the clinician programmed pre - discharge pacing outputs ( in a majority of cases , the pre - discharge pacing output was the pacemaker nominal setting ) . capture management increased the ra output in four patients ( 3.0% ) , increased the rv output in nine patients ( 6.8% ) , and increased the lv output in one patient ( 2.0% ) . the maximum output increase in each chamber was 1.5 v. capture management decreased the ra output in 112 patients ( 84.2% ) , decreased the rv output in 115 patients ( 87.1% ) , and decreased the lv output in 49 patients ( 94.2% ) . for icd subjects , the mean decreases in ra and rv were 1.7 and 1.1 v , respectively . for crt - d subjects , the mean decreases in ra , rv , and lv were 1.2 , 1.2 , and 1.4 v , respectively . overall , the output decreased > 1 v in each chamber : the mean decreases in ra , rv , and lv were 1.5 , 1.2 , and 1.4 v , respectively ( table 3 ) . all adjustments were found to be appropriate when cm and manual threshold measurements were examined . table 3comparison between the amplitude at pre - discharge and at the 6-month follow - up visitamplitude ( v)ra cm ( n = 133)rv cm ( n = 132)lv cm ( n = 51)mean sdimplant3.5 0.53.5 0.44.0 0.56-month2.0 0.82.3 0.72.6 0.7difference ( 6-month implant)1.5 0.91.2 0.81.4 0.8implant2.05.02.05.02.256.0range6-month0.55.01.55.01.755.5difference ( 6-month implant)3.5 to 1.53.0 to 1.53.5 to 1.5no . of amplitude decreases from implant to 6-month ( n , % ) 112 ( 84.2)115 ( 87.1)49 ( 96.1)no . of amplitude increases from implant to 6-month ( n , % ) 4 ( 3.0)9 ( 6.8)1 ( 2)no . of unchanged amplitudes from implant to 6-month ( n , % ) 17 ( 12.8)8 ( 6.1)1 ( 2 ) comparison between the amplitude at pre - discharge and at the 6-month follow - up visit this study demonstrates that the cm algorithms perform as intended , reducing or increasing pacing outputs where appropriate without compromising the safety margin . the cm algorithms adjust the ra , rv , and lv pacing outputs appropriately and only in response to true changes in the patients ' pacing thresholds . the inappropriate adjustments to high pacing outputs that were occasionally observed in earlier pacemakers were not observed in this study . all of the indications of high output were due to appropriate measurement of high threshold caused by chronic high thresholds , lead dislodgements , acute effects of lead maturation , or incomplete connection of the lead in the header block . the differences that were seen between cm threshold data and manual threshold data in this study may be explained by : normal and circadian variation ; although threshold variation is typically quite low , because the measurements were taken at different points in time , there is some normal variation that can occur.manual thresholds are performed using 0.25 v threshold steps , whereas the automatic thresholds use 0.125 v steps . when all other variables are equal , this difference in step size will result in manually measured thresholds that are on average slightly larger than automatically measured thresholds . this accounts for the slight left shift in the data presented in figures 1 and 2.the cm features in the consulta crt - d and the secura icd provide daily confirmation of pacing capture and appropriate maintenance of patients ' safety margins while avoiding adverse effects . the adjustments to pacing outputs can maximize battery longevity in patients who require pacing . in addition , cost - effectiveness may increase as the number of clinic visits reduces , and the time required for follow - up visits may decrease . at the same time , reliable cm allows for an increase in the number of remote device follow - ups , which may add to cost - effectiveness . normal and circadian variation ; although threshold variation is typically quite low , because the measurements were taken at different points in time , there is some normal variation that can occur . manual thresholds are performed using 0.25 v threshold steps , whereas the automatic thresholds use 0.125 v steps . when all other variables are equal , this difference in step size will result in manually measured thresholds that are on average slightly larger than automatically measured thresholds . this accounts for the slight left shift in the data presented in figures 1 and 2 . the cm algorithms adjust the ra , rv , and lv pacing outputs appropriately and only in response to changes in the patients ' pacing thresholds . complete cm reliably and safely manages pacing outputs , may reduce the number of routine in - office visits , and may maximize battery life . the study design was developed by medtronic and most of the detailed data analysis was performed by medtronic . funding to pay klinikum kreuzschwestern wels , wels ; finland : dr virtanen , tampere university hospital , tampere ; germany : dr gradaus , university hospital mnster , mnster ; e.h . , c.m . , medical clinic of university saarland , homburg ; dr oswald , hannover medical school , hannover ; prof . zabel , university hospital gttingen , gttingen ; greece : dr rokas , general hospital alexandra , athens ; saudi arabia : dr al khadra , prince salman heart centre king fahad medical city , riyadh ; sweden : dr brandt , university hospital lund , lund ; the netherlands : dr scholten , medisch spectrum twente , enschede ; dr simmers , amphia hospital , breda . austria : dr mayr , zentralklinikum st plten , st plten ; denmark : dr mortensen , aarhus university hospital , skejby , aarhus ; germany : dr drnberger , university hospital tbingen , tbingen ; prof . schwab , university of bonn , bonn ; dr zenker , university hospital gttingen , gttingen ; israel : a.k . , barzilai medical center , ashkelon ; norway : dr gjestvang , sorlandet sykehus , kristiansand ; sweden : dr brandt , university hospital lund , lund ; switzerland : dr burri , hug - university hospital geneva , geneva ; the netherlands : dr meijer , catharina hospital , eindhoven ; dr boersma , st antonius hospital , nieuwegein ; france : prof . le marec , chu de nantes , nantes ; uk : dr murgatroyd , kings college hospital , london . klinikum kreuzschwestern wels , wels ; finland : dr virtanen , tampere university hospital , tampere ; germany : dr gradaus , university hospital mnster , mnster ; e.h . , c.m . , medical clinic of university saarland , homburg ; dr oswald , hannover medical school , hannover ; prof . zabel , university hospital gttingen , gttingen ; greece : dr rokas , general hospital alexandra , athens ; saudi arabia : dr al khadra , prince salman heart centre king fahad medical city , riyadh ; sweden : dr brandt , university hospital lund , lund ; the netherlands : dr scholten , medisch spectrum twente , enschede ; dr simmers , amphia hospital , breda . austria : dr mayr , zentralklinikum st plten , st plten ; denmark : dr mortensen , aarhus university hospital , skejby , aarhus ; germany : dr drnberger , university hospital tbingen , tbingen ; prof . schwab , university of bonn , bonn ; dr zenker , university hospital gttingen , gttingen ; israel : a.k . , barzilai medical center , ashkelon ; norway : dr gjestvang , sorlandet sykehus , kristiansand ; sweden : dr brandt , university hospital lund , lund ; switzerland : dr burri , hug - university hospital geneva , geneva ; the netherlands : dr meijer , catharina hospital , eindhoven ; dr boersma , st antonius hospital , nieuwegein ; france : prof . le marec , chu de nantes , nantes ; uk : dr murgatroyd , kings college hospital , london .

bipolar disorder ( bd ) is a major affective disorder marked by recurrent / cyclical episodes of mania / hypomania and depression as described in the diagnostic and statistical manual of mental disorders , 5th edition.1 the subtypes of bd include bipolar disorder i ( bd - i ) and bipolar disorder ii ( bd - ii ) . patients with bd - i experience manic episodes and nearly always experience major depressive and hypomanic episodes whereas bd - ii is marked by at least one hypomanic episode , at least one major depressive episode , and the absence of manic episodes . to satisfy a clinical diagnosis of bd , the abnormal mood episodes should have a detrimental effect on the social and occupational functioning of the individual . late - life bd or geriatric bd usually refers to patients older than 60 years with bd . however , some authorities use an age cut - off of 50 , 55 , or 65 years . late - life bd includes both patients diagnosed in their younger years ( early - onset bd ) and in late - life , often called late - onset bd . due to no validated age - at - onset threshold , this definition remains arbitrary.2 one out of four bipolar patients is reported to be older than 60 years.3 a systematic review of the prevalence of bd in population - based studies revealed heterogeneous findings concerning the prevalence of bd , ranging from 0.1% to 7.5%.4 community surveys in 14 countries found that the lifetime prevalence of bd was 2.8%,5 while another set of community surveys in eleven countries found a considerably lower lifetime prevalence of bd , with rates of bd - i and bd - ii reported to be 0.6% and 0.4% , respectively.6 in both sexes , the pattern of bipolar diagnoses has been reported to increase similarly over the years until middle age where it was observed to reach a plateau.7 the considerable variety of prevalence rates in bd may be related to the consideration of subthreshold criteria upon diagnosis , differences in study design , and psychiatric assessment . the annual incident rate has been reported to be 30 per 100,000 capita.7 the mean standardized mortality ratio for bd has been reported to be 2.00 with a reduced life expectancy of 9 years among bipolar patients.7 the relative risk of all - cause mortality was reported to be 2.9 in the age group 6575 years and highest among adults under 45 years ( 8.95 ) , suggesting that the younger population with bd have a specially reduced life expectancy compared to the general population.7 an elevated leukocyte count often seen in acute affective episode has previously been suggested to increase the risk of early natural death from all causes in bipolar patients , independent of smoking and other cardiovascular risk factors.8 due to physiological age - related changes , different pharmacodynamics and kinetics , cognitive impairment , medical comorbidity and concomitant medication , long - term treatment with mood stabilizers and their potential negative effect , older patients may have different clinical characteristics and treatment response than the younger bipolar population.9,10 late - life bd has been associated with multiple medical comorbidities , and the dominating conditions observed are type ii diabetes , respiratory and cardiovascular conditions , and other endocrine abnormalities.10 it has been suggested that medical comorbidity accounts for 40%70% of personal and societal costs of bd.11 yet , it is not clear whether medical disorders among individuals with bd are truly comorbid disorders , or a consequence of treatment , or a combination of both.12 lifestyle characteristics such as smoking , diet , substance abuse , and metabolic abnormalities related to psychotropic drug use contribute to medical complication and poor prognosis.13 psychiatric comorbidities have previously been reported to be less prevalent than physical comorbidities , and the prevalence has appeared to be lower in elderly bipolar patients compared to the younger bd population , with anxiety and substance abuse disorders being the most common concurrent psychiatric illnesses.10 there are however some limitations to be considered regarding this literature , as no prospective studies have evaluated this topic and most studies have been small , retrospective , and conducted only on hospitalized patients.10 there seems to be an increase in the amount of published research on this topic over the past decade.9 emerging research suggests that bd is not solely an illness of mood but that it affects multiple domains impacting overall functioning , considering it to be a multisystem condition in which medical comorbidity , cognitive impairment , and early mortality may have underlying common mechanistic elements . to our knowledge , all of the reviews regarding this topic consider there is a lack of adapted assessment for this group of patients , as their treatment is based on guidelines drawn up for younger patients with bd . the aim of the study was to identify specific clinical characteristics in individuals older than 60 years with bd and to gain more knowledge of how aging in these individuals might affect cognitive function and treatment . pubmed / medline was searched for studies about elderly ( > 60 years ) patients with bd and their characteristics . selected articles were those with medical subject headings term bipolar disorder , restricted to medical subject headings major topic , and aged . the search was limited to studies published in the period january 2012 till january 2015 in order to obtain the most recent scientific articles . the database was searched for original research reports published in english from the period november 2014 to january 2015 . titles and abstracts from the obtained articles were reviewed and all retrieved papers were screened to meet the following inclusion criteria : studies including patients aged 60 or older or studies with participants of any age , only if separate data were reported for the patients aged 60 years and older.minimum sample size of n=30 , as small samples may reduce the likelihood that findings reflect a true effect.14a clear definition of bd with diagnostic criteria of diagnostic and statistical manual of mental disorders - iv and -v , and icd-9 and -10 . studies including patients aged 60 or older or studies with participants of any age , only if separate data were reported for the patients aged 60 years and older . minimum sample size of n=30 , as small samples may reduce the likelihood that findings reflect a true effect.14 a clear definition of bd with diagnostic criteria of diagnostic and statistical manual of mental disorders - iv and -v , and icd-9 and -10 . a total of 398 articles were excluded , resulting in 16 studies meeting the inclusion criteria . we identified six articles that reported medical comorbidity,2,7,1518 two on suicide,19,20 six on cognitive impairment / dementia,2126 and two on aspects related to pharmacological therapy in bd.27,28 elderly bipolar patients were more likely to be diagnosed with diabetes mellitus,2 cancer,7 thyroid disorders,2,15 and hypertension,2,7 compared to age - matched controls . one of the studies comparing comorbidities in bipolar versus non - bipolar subjects found a high prevalence of viral hepatitis and parkinson s disease among older bipolar patients.15 a recent study reported that most of the elderly bipolar patients did not present psychiatric comorbidities , and those who did were mainly patients with early - onset bd . however , the majority of the patients ( 81.2% ) had various physical comorbidities.2 a recent cross - sectional analysis found that elderly individuals with bd were significantly less likely to have no recorded physical conditions and significantly more likely to have one ( odds ratio [ or ] 1.27 ) , two ( or 1.45 ) , and three or more ( or 1.44 ) physical conditions compared to age - matched controls.15 the same study also reported that individuals with bd and coronary heart disease or hypertension were less likely to have a primary - care record and experienced much less intensive prescribing for these conditions and were treated less intensively compared to non - bipolar subjects . another physical health problem observed to be highly prevalent was obesity.16 findings from a longitudinal study examining the impact of obesity on comorbidity in bd showed that obese subjects were observed to be significantly more likely to report any new - onset medical condition ( or 2.32 ) , new - onset hypertension , arthritis , diabetes , and hyperlipidemia.17 there are indications that obesity independently predicts the accumulation of medical conditions among adults with bd . results from a recent cross - sectional study showed that bd was independently associated with an increased risk of having a diagnosis of chronic pain conditions.17 this study investigated the rates of seven chronic , noncancer pain conditions in veterans with bd , finding elevated rates of pain in these patients compared to controls . patients with bd had significantly higher odds of having any pain condition ( or 1.83 ) , as well as specific pain condition ( adjusted odds ratios [ aor ] ranging from 1.50 to 6.24 ) . elevated rates of chronic pain conditions were also reported by another recent cross - sectional study.15 bd is associated with an elevated risk of suicide and suicide mortality in bd has been estimated to be approximately nine times that of the general population.10 elevated levels of suicide incidents in elderly persons with bd have also been documented by other studies , especially in those presenting a current mood episode.19 mixed and depressive episodes of bd as well as major depression were found to be the most frequent diagnoses in elderly individuals committing suicide . the same study suggested that bipolar subjects with depressive episodes might have a greater risk of committing suicide than subjects with unipolar depression . another study observed a considerable lower rate of suicides in the oldest group of patients compared to the middle age groups ( 2564-year age groups ) in which the highest rates of suicides were reported . the majority of suicides in the sample of bipolar patients took place at least 5 years after diagnosis.20 a possible high - risk group of bipolar patients with alcohol dependence , concomitant personality disorder , depression , and current or recent in - patient admission was also identified.20 dementia and cognitive impairment in later life are common features of bd . elderly people with bd have been reported to have an increased risk of stroke , dementia , and other cognitive impairments.9 compared to non - bd subjects , euthymic older adults with bd have been found to perform worse on cognitive tests such as the clock drawing test and the verbal fluency test , but not on the mini mental state examination.21 findings from a recent population - based study of older patients with bd suggested a positive association between the presence of a lifetime history of bd and an increased risk of developing dementia ( aor 4.07 ) , even after controlling for pertinent risk factors.22 these subjects tended to develop dementia already in middle age ( aor 3.77 ) . a recent longitudinal study investigated the neurocognitive performance in the elderly with bd.23 at baseline and follow - up , the bipolar patients performed worse on all neurocognitive measures compared to the healthy elderly group , although the cognitive decline during this period was similar in both groups . the association between subjective complaints of cognition and objective neuropsychological performance has also been investigated . the results provided evidence for a clear association between few subjective complaints and poorer attentional and executive functioning in euthymic elderly bipolar patients.24 it is not clear whether bd and major depressive disorder ( mdd ) have similar or different cognitive profiles and levels of impairment in older age . cognition in aged euthymic bipolar patients was compared with older adults with mdd by using multiple tests measuring different cognitive domains.25 the results showed that subjects with bd and mdd were impaired across all cognitive domains compared with controls , and this was remarkably so concerning information processing speed and executive function . bipolar patients did worse than patients with mdd across all cognitive domains , despite protective effects of having a higher education and lower vascular burden . cognitive abilities of older bipolar patients ( bd - i ) in euthymic state have also been compared with patients with schizophrenia in the same age range.26 strikingly limited differences in cognitive performance between the community - living patients with schizophrenia and the bipolar patients were found . however , both groups were impaired compared to controls in terms of executive functions . in a descriptive study comparing a group of geriatric bipolar patients with a sample of younger bipolar patients , the older patients were distinguished from the younger by having a lower overall cognitive and executive functioning.27 alterations in pharmacokinetics and dynamics , increasing comorbidity , drug interactions , and the subsequent polypharmacy combined with functional and cognitive limitations related to aging condition the response to mood stabilizers , which is necessary to consider when prescribing medication . previous evidence suggests that pharmacological treatment of bd may reduce not only suicide risk but also premature mortality from natural causes , such as respiratory and circulatory diseases.8 a recent study observed that most of the sample of elderly outpatients received surprisingly only pharmacological therapy rather than additional psychosocial interventions for bd,2 even though there is evidence that these interventions are effective , especially in early stages of the disease.29 an average of three different psychotropic medications were prescribed to the elderly patients.2 a similar need of polytherapy has previously been reported in late - life bd.30 as expected , antidepressants were more frequently prescribed to patients with bd - ii than to patients with bd - i and twice as much to patients with an early - onset bd than to patients with late - onset bd . lithium still remains a pharmacological cornerstone for the prevention of manic and depressive recurrences in bd.27 it has been previously suggested that lithium may also have neuroprotective abilities and may reduce the risk of developing dementia.31 in a recent longitudinal study , lithium treatment was not associated with cognitive decline.23 considering the narrow therapeutic window of lithium and the well - known harmful adverse effects of chronic lithium intoxication , lithium concentration monitoring is considered to be essential . pharmacological variability , comorbidities , and polypharmacy related to the aged could also result in instability of serum lithium concentrations . for instance , a variety of antihypertensives ( thiazide diuretics , angiotensin - converting - enzyme inhibitors ) and nonsteroidal anti - inflammatory agents , which are common medications in elderly patients , can increase lithium concentrations.32 however , a retrospective study which compared serum lithium concentrations of bipolar patients in different age groups concluded that age does not seem to be a determinant of serum lithium concentration instability as they found no significant difference between the age groups.28 in the majority of patients on long - term lithium therapy , a decrease in urinary concentration ability is observed and chronic interstitial nephropathy may develop . a study assessing the long - term effect of lithium on kidney function compared older patients on long - term lithium therapy ( with a mean of 16 years of treatment ) with age - matched patients never exposed to lithium.27 they found that lithium treatment caused an impairment of kidney function reflected also by abnormal levels of novel markers of kidney injury such as plasma neutrophil gelatinase - associated lipocalin and urinary beta-2 microglobulin , the latter probably being a better predictor because it showed multiple clinical and biochemical correlations . elderly bipolar patients were more likely to be diagnosed with diabetes mellitus,2 cancer,7 thyroid disorders,2,15 and hypertension,2,7 compared to age - matched controls . one of the studies comparing comorbidities in bipolar versus non - bipolar subjects found a high prevalence of viral hepatitis and parkinson s disease among older bipolar patients.15 a recent study reported that most of the elderly bipolar patients did not present psychiatric comorbidities , and those who did were mainly patients with early - onset bd . however , the majority of the patients ( 81.2% ) had various physical comorbidities.2 a recent cross - sectional analysis found that elderly individuals with bd were significantly less likely to have no recorded physical conditions and significantly more likely to have one ( odds ratio [ or ] 1.27 ) , two ( or 1.45 ) , and three or more ( or 1.44 ) physical conditions compared to age - matched controls.15 the same study also reported that individuals with bd and coronary heart disease or hypertension were less likely to have a primary - care record and experienced much less intensive prescribing for these conditions and were treated less intensively compared to non - bipolar subjects . another physical health problem observed to be highly prevalent was obesity.16 findings from a longitudinal study examining the impact of obesity on comorbidity in bd showed that obese subjects were observed to be significantly more likely to report any new - onset medical condition ( or 2.32 ) , new - onset hypertension , arthritis , diabetes , and hyperlipidemia.17 there are indications that obesity independently predicts the accumulation of medical conditions among adults with bd . results from a recent cross - sectional study showed that bd was independently associated with an increased risk of having a diagnosis of chronic pain conditions.17 this study investigated the rates of seven chronic , noncancer pain conditions in veterans with bd , finding elevated rates of pain in these patients compared to controls . patients with bd had significantly higher odds of having any pain condition ( or 1.83 ) , as well as specific pain condition ( adjusted odds ratios [ aor ] ranging from 1.50 to 6.24 ) . elevated rates of chronic pain conditions were also reported by another recent cross - sectional study.15 bd is associated with an elevated risk of suicide and suicide mortality in bd has been estimated to be approximately nine times that of the general population.10 elevated levels of suicide incidents in elderly persons with bd have also been documented by other studies , especially in those presenting a current mood episode.19 mixed and depressive episodes of bd as well as major depression were found to be the most frequent diagnoses in elderly individuals committing suicide . the same study suggested that bipolar subjects with depressive episodes might have a greater risk of committing suicide than subjects with unipolar depression . another study observed a considerable lower rate of suicides in the oldest group of patients compared to the middle age groups ( 2564-year age groups ) in which the highest rates of suicides were reported . the majority of suicides in the sample of bipolar patients took place at least 5 years after diagnosis.20 a possible high - risk group of bipolar patients with alcohol dependence , concomitant personality disorder , depression , and current or recent in - patient admission was also identified.20 dementia and cognitive impairment in later life are common features of bd . elderly people with bd have been reported to have an increased risk of stroke , dementia , and other cognitive impairments.9 compared to non - bd subjects , euthymic older adults with bd have been found to perform worse on cognitive tests such as the clock drawing test and the verbal fluency test , but not on the mini mental state examination.21 findings from a recent population - based study of older patients with bd suggested a positive association between the presence of a lifetime history of bd and an increased risk of developing dementia ( aor 4.07 ) , even after controlling for pertinent risk factors.22 these subjects tended to develop dementia already in middle age ( aor 3.77 ) . a recent longitudinal study investigated the neurocognitive performance in the elderly with bd.23 at baseline and follow - up , the bipolar patients performed worse on all neurocognitive measures compared to the healthy elderly group , although the cognitive decline during this period was similar in both groups . the association between subjective complaints of cognition and objective neuropsychological performance has also been investigated . the results provided evidence for a clear association between few subjective complaints and poorer attentional and executive functioning in euthymic elderly bipolar patients.24 it is not clear whether bd and major depressive disorder ( mdd ) have similar or different cognitive profiles and levels of impairment in older age . cognition in aged euthymic bipolar patients was compared with older adults with mdd by using multiple tests measuring different cognitive domains.25 the results showed that subjects with bd and mdd were impaired across all cognitive domains compared with controls , and this was remarkably so concerning information processing speed and executive function . bipolar patients did worse than patients with mdd across all cognitive domains , despite protective effects of having a higher education and lower vascular burden . cognitive abilities of older bipolar patients ( bd - i ) in euthymic state have also been compared with patients with schizophrenia in the same age range.26 strikingly limited differences in cognitive performance between the community - living patients with schizophrenia and the bipolar patients were found . however , both groups were impaired compared to controls in terms of executive functions . in a descriptive study comparing a group of geriatric bipolar patients with a sample of younger bipolar patients , the older patients were distinguished from the younger by having a lower overall cognitive and executive functioning.27 alterations in pharmacokinetics and dynamics , increasing comorbidity , drug interactions , and the subsequent polypharmacy combined with functional and cognitive limitations related to aging condition the response to mood stabilizers , which is necessary to consider when prescribing medication . previous evidence suggests that pharmacological treatment of bd may reduce not only suicide risk but also premature mortality from natural causes , such as respiratory and circulatory diseases.8 a recent study observed that most of the sample of elderly outpatients received surprisingly only pharmacological therapy rather than additional psychosocial interventions for bd,2 even though there is evidence that these interventions are effective , especially in early stages of the disease.29 an average of three different psychotropic medications were prescribed to the elderly patients.2 a similar need of polytherapy has previously been reported in late - life bd.30 as expected , antidepressants were more frequently prescribed to patients with bd - ii than to patients with bd - i and twice as much to patients with an early - onset bd than to patients with late - onset bd . lithium still remains a pharmacological cornerstone for the prevention of manic and depressive recurrences in bd.27 it has been previously suggested that lithium may also have neuroprotective abilities and may reduce the risk of developing dementia.31 in a recent longitudinal study , lithium treatment was not associated with cognitive decline.23 considering the narrow therapeutic window of lithium and the well - known harmful adverse effects of chronic lithium intoxication , lithium concentration monitoring is considered to be essential . pharmacological variability , comorbidities , and polypharmacy related to the aged could also result in instability of serum lithium concentrations . for instance , a variety of antihypertensives ( thiazide diuretics , angiotensin - converting - enzyme inhibitors ) and nonsteroidal anti - inflammatory agents , which are common medications in elderly patients , can increase lithium concentrations.32 however , a retrospective study which compared serum lithium concentrations of bipolar patients in different age groups concluded that age does not seem to be a determinant of serum lithium concentration instability as they found no significant difference between the age groups.28 in the majority of patients on long - term lithium therapy , a decrease in urinary concentration ability is observed and chronic interstitial nephropathy may develop . a study assessing the long - term effect of lithium on kidney function compared older patients on long - term lithium therapy ( with a mean of 16 years of treatment ) with age - matched patients never exposed to lithium.27 they found that lithium treatment caused an impairment of kidney function reflected also by abnormal levels of novel markers of kidney injury such as plasma neutrophil gelatinase - associated lipocalin and urinary beta-2 microglobulin , the latter probably being a better predictor because it showed multiple clinical and biochemical correlations . the present review examined mainly specific clinical characteristics , common comorbid physical conditions , and cognitive dysfunction in elderly with bd . the reviewed studies suggest that the burden of bd is not limited to higher disability and comorbidity , but is also reflected in earlier mortality . comorbid cardiovascular diseases , suicide , and cancer have earlier been suggested as the leading causes of excess mortality among bipolar patients33 based on findings similar to those of the studies included in this review . the reviewed studies investigating medical comorbidities found many similarities to previous research , providing further evidence of high comorbidity in elderly patients with bd . cardiovascular and respiratory conditions , type ii diabetes , and endocrinological abnormalities have previously been reported as the most frequent comorbidities in bipolar elderly.10 in addition , parkinson s disease and viral hepatitis were found to be highly prevalent.15 although cardiovascular diseases were not particularly prevalent in the reviewed studies , several comorbidities well known as risk factors to cardiovascular disease , such as hypertension , diabetes , obesity , and alcohol abuse , were reported as highly prevalent among bipolar elderly compared to the elderly in general . these results underscore the importance of contemplating these risk factors when assessing and treating bd in elderly patients . evidence for a systematic under - recognition and undertreatment of cardiovascular illnesses in primary medical care was also found,15 which has been mentioned previously.34 there are several possible reasons for this association . mood episodes and/or low awareness of cardiovascular risk factors and associated symptoms could have resulted in lower attendance rate to the general practitioner . additionally , individuals with bd frequently experience social isolation and lower levels of education , which are also associated with higher unmet need for treatment . we can not rule out that the cardiovascular risk factors in these subjects may be overlooked by the general practitioners while engaging their attention toward their mental illness . an average of three to four medical comorbid conditions have previously been reported in elderly bipolar patients;10 similar findings are reported in the reviewed studies . a strong association between obesity and a high medical burden in bd was also observed16 suggesting that overweight is an additional burden in many elderly with bd . it is noteworthy to consider that treatment of obesity could potentially mitigate the psychiatric and medical burden of bd . also , pain conditions were reported to be highly prevalent in bipolar elderly.15,17 this association has previously received little attention , despite being related to reduced quality of life among those with mental illness . even though such an association may be caused by depressive symptoms , it demonstrates another clinical area of need for this population that is being overlooked . chronic pain conditions have also been related to an increased suicide risk , an aspect that needs to be considered also in the approach of the elderly bipolar population.35 the extent to which chronic pain might impact mental health recovery remains to be investigated . the pathophysiology behind the relationship between bd and the subsequent development of dementia largely remains unclear . many possible mechanisms may underlie cognitive deficits in older adults with bd , such as residual mood symptoms , structural brain abnormalities , long - term side effects of medications , adverse psychosocial conditions , and medical comorbidities . bipolar elderly performed significantly worse on some screening tests of cognitive function,21 and a positive association between the presence of bd and an increased risk of developing dementia was found.22 the elderly , in particular , represented a heterogeneous group , suggesting that various causes of cognitive impairment may have played a role in its development , emphasizing the need for further investigation of the underlying neuropathophysiological and pathological mechanisms that connect bd and dementia . one of the studies reviewed compared older bipolar subjects with a group of non - bd patients matched for distinct degrees of cognitive impairment , providing greater evidence to the results.21 however , it is important to consider confounding factors that can bias the link between cognitive dysfunction and bd , such as educational level , a family history of dementia , and socioeconomic status . even though data were statistically significant , the clinical meaning of these differences is uncertain . results showed that older adults with bd exhibited worse cognitive functioning compared to healthy controls , regardless of comparable vascular risk factors.23 this implies that there may be inherent factors related to the disease process that results in cognitive impairment , and not simply a manifestation of vascular risk factors . even though disease exacerbations are associated with increasing cognitive dysfunction , there is increasing evidence of a higher risk of permanent cognitive impairment in bipolar patients . it is important to underline that all of the reviewed studies regarding this topic compared only bipolar patients in euthymic state with controls . another important finding was the relation between having few subjective complaints about cognition and poor attentional and executive functioning suggesting that impaired awareness of cognition might be a reflection of cognitive deterioration . if so , this may influence assessment and treatment of these individuals as poor perception of such function may compromise communication of symptoms and functional deficits . subjects with bd were observed to have cognitive dysfunction comparable to patients with schizophrenia and they were also reported to be more impaired across all cognitive domains compared with patients with mdd.25,26 recommendations to preserve cognitive function target known risk factors associated indirectly with cognitive decline , such as hypertension , hypercholesterolemia , and diabetes mellitus . the relative neglect of the management of severe medical comorbidity associated with bd is still a significant challenge . the consensus regarding high suicide risk among elderly bipolar patients compared to elderly in general was also suggested by the studies included in our review.19 although , the risk was found to be lower among older patients compared to middle - aged,20 which is consistent to previous findings.36 nevertheless , the committed suicide rates are higher among the elderly in comparison with young people,37 an aspect not mentioned in the included studies in this review . long - term treatment with lithium is often indicated in bd , which means extensive monitoring is essential to minimize adverse effects . due to age - related factors , age has been suggested as a determinant of serum lithium concentration instability , which may be one of several reasons why lower daily dosages of lithium have been used in older patients with bd.30 findings in one recent study differed from this idea suggesting that age is not an indication to not initiate or discontinue lithium therapy.28 as lithium can be associated with nephropathy , kidney function should be assessed frequently . novel markers of kidney injury were compared in one study , suggesting urinary beta-2 microglobulin , a marker of tubular function , to be a better predictor than plasma neutrophil gelatinase - associated lipocalin.27 it remains to be seen if beta-2 microglobulin can make a better marker of kidney function than estimated glomerular filtration rate . as most of the included studies were cross - sectional analyses , causal relationship can not be established . this highlights the importance of future longitudinal studies allowing inferences to be drawn about important characteristics of this population . due to limited age criteria in our search , sample sizes of the included studies varied further , some cross - sectional studies used data from nationwide datasets with reasonably large samples while other study designs were longitudinal having smaller samples . however , given the relatively sparse number of longitudinal studies in the field the results from these studies contribute significantly to the current knowledge . few articles were identified within our searched timeframe ; thus , this topic was not emphasized in the review . a global tendency in the reviewed articles was a lack of bipolar subtype specificity , which means that some of the findings may be more suitable for either bd - i or bd - ii . this is a major problem in general as the prevalence of the two bipolar types is different , with bd - i being rather rare compared to bd - ii . the majority of the studies are either european or north american and hence the findings reflect mainly the population in these areas . it would be interesting that future investigation on this topic would highlight the possible differences among bipolar subtype , sex , and ethnicity . there was a lack of recent studies published regarding pharmacotherapy and considering its essential role in bd treatment , it would be convenient for more empirical data concerning psychotropic medications in late - life bd . our review supports what recent studies have suggested : there is a high burden of comorbidities in late - life bd and cognitive impairment is common . individuals with the disorder have an elevated risk of being affected by several comorbid psychiatric and especially somatic disorders , and hence clinicians should be especially attentive to physical comorbidity and early signs of cognitive decline , which may decrease mortality and herald polytherapy and the dementia outcome . bipolar elderly may be under - recorded and undertreated in primary medical care , particularly for cardiovascular comorbidity , which is one of the leading causes of excess mortality in bd ; thus , improved recognition of bd and provision of primary medical care may effectively reduce mortality and cognitive decline among these patients . integrated treatment focusing simultaneously on psychiatric and medical outcomes may offer substantial advantages over usual care , which is often fragmented . the review of the literature indicates that clinical characteristics between the elderly and the younger population differ , suggesting that the clinical assessment of each group should be different and adapted . the heterogeneity of function and comorbid symptoms in this group of elderly bipolar patients clearly shows that it is important to highlight the need of an individual approach to each patient .

coenzyme q10 ( coq10 ) , also known as ubiquinone or ubiquinone-10 , occurs widely in animals , plants , and the cells of microorganisms . it plays a crucial role in generation of cellular energy and in free radical scavenging in the human body . accordingly , it has been used in therapeutic applications for several diseases such as heart disease , breast cancer , and alzheimer 's and parkinson 's diseases . moreover , coq10 has been used as a food supplement and cosmetic ingredient because of its various physiological functions . extensive attempts have been made to increase coq10 production to meet growing demands for this product . to date , production of coq10 is produced by one of three methods : extraction from biological tissues , chemical synthesis , and microbial fermentation . in the wake of recent environmental awareness , the first two methods became least desirable because of the inherent uses of solvents and chemicals in the process . microbial fermentation , conversely , offers an environmentally benign option based on the enzymatic catalysis at the cellular level for coq10 assembly . also , this approach is attractive to the industry because the process is easy to control and has a relatively low production cost [ 8 , 9 ] . among all strains investigated so far , a. tumefaciens has been shown to be an excellent producer of coq10 [ 7 , 1013 ] . however , the yield of coq10 in liquid cultivation using the wild - type strain of a. tumefaciens remains limited because of its low specific coq10 content . to increase the specific coq10 content of a. tumefaciens , further strain development by physical and chemical mutagenesis has been used to obtain high - coq10-producing mutants . well - known mutagens such as ultraviolet radiation and diethyl sulfate ( des ) have been tested . however , the chemicals used for these mutagenesis procedures are harmful to human health . it is desirable to find new mutagenic treatments to increase coq10 yield . in recent years , there were reports about high hydrostatic pressure ( hhp ) treatment that influenced the structure of genes and proteins in microorganisms [ 1416 ] . there were also reports that hhp treatment in laboratory could cause beneficial mutagenesis to e. coli [ 17 , 18 ] , r. glutinis [ 19 , 20 ] , and g. xylinus . compared with traditional physical and chemical mutagenesis methods , hhp treatment as a mutagen could offer some advantages such as easier handling , savings in time and money , and negligible effects to the environment [ 19 , 20 ] . however , little is known related to the effectiveness of hhp treatment on improving the production of coq10 in microorganisms . aside from the optimization of carbon and nitrogen sources , the use of fed - batch culture by controlling the nutrient feeding is one of the most popular methods to achieve high cell density of e. coli [ 2224 ] and enhance the production of coq10 [ 11 , 12 ] . so far , there seem to be no published reports related to the coq10 production under exponential feeding fed - batch control . in this study , hhp treatment was investigated as a new mutagenic treatment to increase the specific coq10 content of a. tumefaciens . a mutant strain pk38 was isolated using selection markers and the optimal carbon and nitrogen sources for coq10 production with pk38 were selected . the parental strain a. tumefaciens 1.2554 was purchased from china general microbiological culture collection center ( cgmcc , beijing , china ) . this strain was inoculated on mannitol agar slants , incubated for 2 days at 28c , and then stored at 4c . all media were sterilized by autoclaving at 121c for 20 min and were adjusted to ph 7.2 before sterilization . the complete medium contained 5 g / l glucose , 3 g / l beef extract , 3 g / l yeast extract , 10 g / l peptone , and 0.2 g / l mgso47h2o . the selective medium was made by adding a certain amount of one of the following four substances : sodium azide , ethionine , daunomycin , or vitamin k3 . the seed medium consisted of 10 g / l glucose , 5 g / l peptone , 5 g / l yeast extract , and 5 g / l nacl . the basal fermentation medium contained 20 g / l glucose , 10 g / l peptone , 10 g / l yeast extract , 0.5 g / l k2hpo4 , 0.5 g / l kh2po4 0.5 one loop of bacterial cells grown overnight on a mannitol agar slant was inoculated to 250 ml erlenmeyer flask containing 50 ml of a seed medium and incubated on a rotary shaker ( 200 rpm ) at 28c for 24 h. after the culture entered the log phase ( about 1824 h in this study ) , 20 ml culture broth was centrifuged under 4c at 10,000 rpm ( 21,000 g ) for 10 min ( pm180r , alc international , milan , italy ) , washed twice with sterile physiological saline , and suspended in sterile 0.1 m potassium phosphate buffer of ph 7.2 ( cells density 1010 cell / ml ) for hhp treatment . the cell suspension in potassium phosphate buffer was transferred aseptically into sterile polyethylene pouches and heat - sealed following the expulsion of air . the prepared pouches were placed into the hhp equipment , containing a 2 l working pressure chamber ( uhpf-750mp , baotou kefa new type hi - tech food machine limited company , baotou , china ) . hhp treatments at constant pressures from 100 to 400 mpa with holding time ( 10 to 30 min ) were carried out at room temperature ( about 25c ) using castor oil as the pressure medium . control samples were maintained at atmospheric pressure within the constant temperature housing during the experiment . to assess loss of viability caused by the hhp treatment , untreated and treated cell suspensions inactivation was expressed as a logarithmic viability reduction log(n0/n ) , with n0 and n representing the colony counts before and after treatment , respectively . the cell suspension was spread onto a presterilized plate ( 9 cm diameter ) , and a uv lamp ( 254 nm , 30 w ) was used for the mutation by irradiating cells at a distance of 30 cm from the plate for 60 s. after uv radiation treatment , the cell suspension was treated with 1% ( v / v ) des for 20 min . the results show that the frequency of positive mutant generation is 12% . after each treatment , cell suspensions were spread on the selective medium and incubated at 28c for 48 h. the selective medium contained l - ethionine ( 500 mg / l ) , daunomycin ( 20 mg / l ) , vitamin k3 ( 160 mg / l ) , or sodium azide ( 20 mg / l ) . all these chemicals were purchased from ding guo biological technology co. , ltd ( beijing , china ) . the fast - growing , large , and single colony was transferred onto the selective medium plate and then incubated for 48 h at 28c . for screening , each mutant was taken and used in fermentation , and the content of coq10 from each mutant was determined . the seed culture was transferred into a stirred tank fermentor ( bioflo 110 , new brunswick , nj , usa ) with a working volume of 2 l production medium . the temperature , agitation speed , and air flow rate during the culture were 28c , 300 rpm , and 0.6 l / min , respectively . the ph was controlled at 7.2 0.1 by addition of 3 m naoh or 2 m hcl . the cell mass concentration was determined using a calibration curve constructed by optical density at 620 nm and dry cell weight ( dcw ) . the optical density at 620 nm was measured with a spectrophotometer ( uv-2500 , shimadzu , tokyo , japan ) . the dcw was determined after the culture broth was centrifuged at 10,000 rpm ( 21,000 g ) for 10 min under 4c using an ultracentrifuge . cell lysis and coq10 extraction conducted in this study were similar to that described by tian et al . . the extracted coq10 was dissolved in ethanol and applied to a high - performance liquid chromatography ( hplc ) system ( lc-2010a , shimadzu , tokyo , japan ) with a hypersil ods c18 ( 5 m , 4.6 mm 250 mm , germany ) coupled with a uv detector ( waters 486 ) . the column was eluted with ethanol and methanol ( 9 : 1 , v / v ) at a flow rate of 1.0 ml / min , and a chromatogram was obtained by monitoring the absorbance at 275 nm . with an authentic coq10 standard ( sigma co. , shanghai , china ) , coq10 was identified according to retention time and quantified by using a calibration curve . the residual sugar was quantified by fehiling 's reaction . statistical analysis was performed using the spss package ( version 11.5 , spss inc . , data were analyzed by analysis of variance ( p < 0.05 ) , and the means were separated by duncan 's multiple range test . to determine the optimum mutagenic conditions by hhp treatment , cell suspensions of a. tumefaciens were subjected to different hhp treatments combining pressure with holding time at 25c . the data revealed that hhp treatment had a significant effect on a. tumefaciens , a gram - negative bacterium . in general , gram - negative bacteria are less resistant than the gram - positive bacteria to hhp treatments . in this study , the cell viability during hhp treatment decreased with the increase of processing pressure and holding time . based on the curve ( figure 1 ) , deactivation of cells occurred between 4.0 and 4.5 log units at 200 mpa for 30 min , 250 mpa for 20 min , or 400 mpa for 10 min . under these three levels , therefore , these three levels were chosen for subsequent mutagenesis . table 1 shows the effect of hhp treatments on mutation of a. tumefaciens . it is evident that the hhp treatment , at 200 mpa for 30 min , is better than the other two treatments : 250 mpa for 20 min and 400 mpa for 10 min . positive mutations accounted for 16% of these mutants , and 12 strains had a specific coq10 content higher than that from the wild - type strain . among those 12 strains , maximum specific coq10 content was achieved from the mutant pn07 with an approximate 17.5% increase compared with the wild - type strain . so the hhp treatment at 200 mpa for 30 min was selected as the optimal condition for inducing mutation . coq10 biosynthesis is typically composed of three parts : synthesis of a quinonoid ring , synthesis of decaprenyl diphosphate , and quinonoid ring modification . for example , decaprenyl diphosphate synthase ( dpps ) can catalyze the synthesis of decaprenyl diphosphate , which appears to be a rate - limiting step and critical in coq10 production [ 9 , 27 ] . the present study found that hhp treatment can have beneficial mutagenic effects on a. tumefaciens for coq10 production , which agrees with the finding of wu et al . who found that the bacterial cellulose mutant m438 was obtained after hhp treatment at 250 mpa for 15 min . [ 19 , 20 ] obtained the barotolerant mutant pr68 after five repeated cycles of hhp treatment at 300 mpa for 12 min . they found that the dna segments of mutant pr68 were different from the original strain . reported that pressure triggered a stress response which activated distinct chaperones and dna repair proteins . so the change of specific coq10 content of a. tumefaciens might occur at the gene level , and hhp treatment might have effects on the three enzymatic steps of coq10 biosynthesis . random mutagenesis is an easy tool to use in achieving genetic and functional modifications of an organism . using progressive stepwise mutagenesis - selection protocols and various mutagens with differing modes of action has been proven effective in increasing product yield . to obtain a high - coq10-producing strain from the wild type , mutagenesis was carried out by the hhp treatment ( 200 mpa , 30 min ) and uv+des mutation . after each mutagenic treatment , the mutant strain was selected and assessed in shake flask cultures . the most promising strain was subjected to the next mutagenic treatment . according to the general pathway of coq10 synthesis , two means of additional coq10 production are possible : the mutant could overcome growth inhibition during coq10 biosynthesis or its related metabolisms might overproduce coq10 . these chemicals included l - ethionine ( an analogue of l - methionine , which is a precursor for the methoxy moiety of coq10 ) , daunomycin , and vitamin k3 ( structural analogs of coq10 ) . an electron flux inhibitor , such as sodium azide , can be used for screening the mutant , which can be resistant to this inhibitor because of high intracellular coq10 . moreover , tyrosine is located at a final branch point in the pathway of coq10 biosynthesis . as figure 2 shows , the mutant strains isolated with respective chemicals at each mutation step were tested for their coq10 production by flask culturing , and the best strain was used as the parent for successive mutations . figure 2 also shows the methods and the maximal specific coq10 content for such mutants . among those chemicals used for selecting a high producer , daunomycin had no significant effect on the coq10 content . finally , the strain with the highest specific coq10 content , named pk38 , was obtained , containing about 52.83% higher specific coq10 content when compared with the original strain . the mutant pk38 was selected , and its stability of producing specific coq10 content was investigated ( table 2 ) . this illustrated pk38 strain has a good genetic stability and has the potential to be used for coq10 production . to determine the optimal carbon and nitrogen source for coq10 production , cultures were prepared in 250 ml flasks containing 100 ml of fermentation medium with various carbon and nitrogen sources and incubated for 72 h on a rotary shaker ( at 180 rpm ) at 28c . figure 3 shows the effect of different carbon sources on pk38 growth and coq10 production . among the various carbon sources ( glucose , fructose , lactose , maltose , sucrose , and xylose ) , sucrose proved to be the best carbon source for the growth of pk38 with biomass reaching 5.28 g / l after 72 hours of cultivation . also , coq10 production was the highest when sucrose was used as a carbon source , reaching 12.27 mg / l . to evaluate the effect of the initial concentrations of sucrose on pk38 growth and coq10 production , different concentrations of sucrose ( 10 , 20 , 30 , 40 , and 50 as table 3 shows , coq10 production was highest at 30 g / l of sucrose , reaching 14.88 g / l , was selected as carbon source for coq10 production with pk38 . the results demonstrate that crop steep powder ( csp ) was more desirable than other nitrogen sources . mg / l ) was obtained with 20 g / l of csp , with the highest biomass at 7.16 csp comprises the water soluble components of the crop , the composition of which is primarily amino acids , peptides , carbohydrates , and salts . different concentrations of csp ( 10 , 20 , 30 , 40 , and 50 g / l ) were used to evaluate the effect of the initial concentrations of csp on pk38 growth and coq10 production . as table 4 shows , coq10 production was the highest with 30 g / l of sucrose , reaching 18.92 knowles and redfearn found that the cells of azotobacter vinelandii grown on ammonium medium produced comparatively high concentrations of coq10 . obviously , the complex nitrogen source ( csp + ammonium sulfate ) was more desirable than single nitrogen sources ( table 5 ) . coq10 production reached 20.62 mg / l with 30 g / l csp and 10 g / l ammonium sulfate in the production medium . figure 5(a ) shows the batch profile of dcw and coq10 production with the mutant pk38 in the 5-l fermentor under the optimal carbon and nitrogen sources . during the batch fermentation of pk38 , cell aggregation was observed after incubation , and after 42 h , the cells were not grown further . the final yield of coq10 reached 43.94 mg / l , which was significantly higher than that reached in the flask culture ( 20.62 mg / l ) , indicating that the low constant agitation ( 300 rpm ) provided in the 5-l fermentor might have enhanced cell - substrate contact , leading to the increase in coq10 productivity . g / l , which was almost 2 times that obtained in the flask culture ( 7.86 g / ml ) . this indicates that the specific coq10 content was 3.196 mg / g - dcw , which is much higher than that achieved in the flask culture ( 2.624 mg / g - dcw ) . as shown in the batch fermentation a fed - batch fermentation of pk38 was carried out to get a high cell density and to increase more coq10 accumulation . g / l , 100 l of a sucrose solution ( 30% ) was fed to the 5 l fermentor . as figure 5(b ) shows , sucrose feed was performed at 18 , 30 , and 40 h , respectively . the feed strategy was designed so the residual sugar was kept at a concentration of 1728 the feeding profile was found to be optimum , by maintaining a higher concentration of the residual sugar in the broth during the log phase of pk38 . as a result , g / l , which was almost twice the amount obtained in the batch fermentation . specifically , the final coq10 production reached 92.87 mg / l in 96 h of incubation , which was significantly higher than the batch operation . this demonstrates that the specific coq10 content achieved 3.575 mg / g - dcw , which is much higher than that achieved in the batch fermentation . if the feed rate of the substrate is increased in proportion to the exponential growth rate , it is possible to maintain a high rate of cell growth for a long time . also , exponential feeding can limit the negative effect on the cell growth exerted by the sudden increase of sucrose . figure 5(c ) shows the profiles of dcw and coq10 production with the mutant pk38 in the 5-l fermentor under the exponential feeding fed - batch control . the sucrose feed started from 12 h when the residual sugar concentration in the broth dropped to 21 coq10 production increased quickly after 18 h of incubation , and the final yield reached 120.01 mg / l . the production of coq10 was proportional to cell growth , and the final biomass obtained was 31.09 g / l . also , the exponential feeding fed - batch culture resulted in the highest specific coq10 content within the cell biomass , reaching 3.860 mg / g , superior to that of the aforementioned two cultures . this work demonstrates that the use of hhp could be a promising approach for mutagenesis to a coq10 producer a. tumefaciens strain . a mutant strain pk38 was obtained by hhp treatment : the intracellular coq10 content of this strain increased by 52.83% when compared to the wild - type strain . even though the mechanism of hhp - induced mutagenesis is not clear , hhp treatment might affect the three enzymatic steps of coq10 biosynthesis . sucrose was the best carbon source , and csp and ammonium sulfate were the optimal nitrogen sources for coq10 production with pk38 . by the exponential feeding strategy , the cell biomass and coq10 production increased 126.11 and 173.12% , much higher than those obtained in the batch culture .

periarticular calcification , characterized by pathological or radiographical evidence that it calcificates around articulations , may be located in cartilage , synovium , capsule , tendons , bursa , ligaments , soft tissue , and vessels ( 1 ) . acute calcific periarthritis ( acp ) is an acute periarticular inflammation associated with juxtaarticular deposits of calcium hydroxyapatite . although this entity has been involved in body sites such as shoulder , hip , knee , and elbow , there has been a relative paucity of acp involving the joints of the fingers ( 2 , 3 ) . here we report a rare case of acp in a professional golfer , who continuously practices his swing , caused by repeated minor traumas at the injury site with a review of literatures . a 22-yr - old man visited the department of orthopedic surgery due to painful swelling on the volar surface of the proximal interphalangeal ( pip ) joint of the 4th finger that had aggravated for the last 2 weeks . according to the personal history , so he started intensive practicing 4 weeks before his visit to our department . on physical examination , he had a swollen , reddened finger which was tender over the pip joint of the 4th finger . the range of motion ( rom ) at pip joint showed active motion of 10 - 30 and passive motion of 0 - 80. active and passive rom at metacarpophalangeal ( mp ) joint showed 0 - 80 and 0 - 90 , respectively . active and passive rom at distal interphalangeal ( dip ) joint showed 0 - 80 and 0 - 90 , respectively . 1a ) , a dense calcified lesion with a triangular shape measuring 53 mm was found , and this lesion was located around the 4th pip joint ; however , there was no evidence of joint space narrowing or cortical lesion . three - phasic bone scan showed a hot uptake on the 4th pip joint ( fig . 1b ) , and ct demonstrated a triangular calcification at the pip joint ( fig . , a diagnosis of acp was made , and the patient was managed conservatively by ibuprofen 800 mg b.i.d , ice compression and short arm splint immobilization . two weeks later this calcification was gradually absorbed , the symptom was relieved , and the limitation in rom was improved ( fig . one month later the area between pip joint of the left fourth finger showed only a small , residual calcification ( fig . final plain radiograms taken three months after presentation revealed nearly complete resolution of the calcification ( fig . , he showed normal rom at pip , dip , mp joints and the previous symptoms , such as swelling and redness , had completely disappeared . either discomfort or pain was not felt by the patient during his normal activities , though he felt a mild discomfort while playing golf . periarticular crystal deposition has been described by a variety of terms , such as calcareous tendonitis and bursitis , periarthritis calcarea , calcific tendonitis , peritendinitis and bursitis , and hydroxyapatite rheumatism ( 1 ) . these deposits are frequently monoarticular in distribution ( 1 ) , and the shoulder is the most commonly affected site , followed by the hip , knee , elbow , wrist and ankle joints . finger joints are less commonly involved , and the metacarpophalangeal joint is the most frequently affected site followed by the pip joint ( 3 ) . in our case , 's report ( 4 ) , this condition occurs in both women and men , with an average age of 45 yr old . yosipovitch and yosipovitch ( 5 ) reported that it occurs in women far more frequently than in men , between 40 and 70 yrs . in our case , the patient was a man and was in his early 20 's , which is different from the previous reports . the pathologic findings of this entity include calcific material formed into psammoma - like bodies , together with exudates , including many neutrophil leukocytes . electron microscopy showed the calcific material was composed of hydroxyapatite crystals ( 6 , 7 ) . acute symptoms of this condition include , as in our case , pain , swelling , erythema and restriction of motion around the joint involved ( 1 , 3 ) . chronic symptoms may be present and include mild , non - incapacitating pain and tenderness ( 1 ) . ( 4 ) reported a history of local trauma in one - third of patients . yosipovitch and yosipovitch ( 5 ) reported that the hand was constantly exposed to repetitive microtraumas , especially in manual labor . on the other hand , kim et al . ( 8) reported that it frequently occurs in association with systemic diseases , such as thyroidism , rheumatoid arthritis , diabetes mellitus , gout and pseudogout . in our case , his job was professional golfer and after intensive practicing , periarticular symptoms such as pain , swelling , and erythema occurred . therefore , we thought that repeated minor traumas of the joint would be the cause of periarticular calcification . the radiographic changes in patients with periarticular calcifications show varying patterns ; the deposits may remain static for a long period , enlarge and change shape , or diminish in size and disappear ( 3 ) . in our case , after medication and immobilization this calcification was gradually absorbed . follow - up plain radiograph after three months showed a subtle calcific deposit and he had no symptom in the joint . acp is self - limiting and usually resolves in 3 to 4 weeks even if not treated ( 9 ) . treatment for acp involves conservative measures such as splinting and nonsteroidal anti - inflammatory drugs . in this case , acp occurred in the pip joint of a professional golfer with symptoms such as pain , swelling , and erythema . repeated minor traumas in the affected site was considened to be the cause . since this entity is self - limiting ,

the integrin gp iib / iiia receptor is the final common pathway for platelet aggregation . abciximab is an anti - integrin fab fragment of a human - mouse chimeric monoclonal antibody with high affinity and a slow rate of dissociation from the gp iib / iiia platelet receptor1 ) . intravenous glycoprotein ( gp ) iib / iiia inhibitors were first used in the setting of pci in an attempt to reduce abrupt vessel closure and urgent revascularization1 , 2 ) . most cases of bleeding associated with intravenous glycoprotein inhibitors have occurred in patients who underwent pci , and bleeding primarily occurred at the femoral artery access site1 ) . this study describes a case of cardiac tamponade resulting from hemorrhagic pericarditis after the use of abciximab following pci in a patient with stemi . a 66-year - old male was admitted to our hospital due to ongoing and squeezing chest pain accompanied with left shoulder pain that had most recently occurred 3 days prior to admittance . his past medical history included hypertension and a smoking history of 40 pack - years . he had no familial history of coronary artery or cerebrovascular disease , and he was not on any medication at the time of admission . upon physical examination his blood pressure was 130/90 mmhg and his heart rate was 64 beats per minute , with regular heart and normal s1 and s2 sounds . the initial electrocardiography indicated st segment elevation up to 1.5 mm in lead v5 and v6 ( figure 1 ) . initial echocardiography showed akinesia of the lateral wall from the mid - ventricle to the apex in the left ventricle ( lv ) . creatine phosphokinase ( cpk ) , lactate dehydrogenase ( ldh ) , ck - mb and troponin t were 469 iu / l , 447 iu / l , 20.08 ng / ml and 0.169 ng / ml , respectively . we applied conventional heparin initially ( 5000 unit via subcutaneous injection ) followed by continuous infusion for 72 hours , subsequently targeting a prothrombin time ( pt ) inr from 1.5 to 2.0 . additionally , we treated the patient daily with aspirin ( 200 mg ) , clopidogrel ( 75 mg ) and cilostazol ( 200 mg ) . abciximab was applied during pci because a visible thrombus at the left circumflex coronary artery was observed during the coronary angiography ( figure 2 ) . abciximab was applied intravenously at 10 mg and was infused at 10 /min for 12 hours . vital signs were stable during and immediately following pci ( blood pressure 120/70 mmhg ; heart rate 70 bpm ) and the patient did not complain of any symptoms such as chest discomfort or dyspnea . the electrocardiography ( ecg ) taken immediately following pci showed no interval change compared with the previous ecg . subsequently , his blood pressure decreased to 60/30 mmhg and st elevation in lead v5 and v6 increased to 3.0 mm ( figure 3 ) . we conducted an emergent angiography to ascertain whether acute thrombus after pci or coronary perforation had occurred , however the angiography showed no leakage of dye or thrombus in any coronary arteries ( figure 4 ) . vital signs had remained stable and the patient had not complained of any more chest discomfort . three days after the pci , the patient complained of chest discomfort and dyspnea , and shock occurred again . echocardiography after the shock showed a large amount of pericardial effusion , which confirmed cardiac tamponade ( figure 5 ) . the patient was discharged 6 days later and underwent follow up observation at an outpatient clinic and has remained well and free of any symptoms for more than 2 years . three intravenous gp iib / iiia inhibitors ( abciximab , eptifibatide , and tirofiban ) are approved for treatment in the united states . abciximab ( reopro , centocor / lilly ) , the first gp iib / iiia inhibitor approved for clinical use , is a chimeric antibody directed against the gp iib / iiia molecule . abciximab acts by binding to the gp iib / iiia receptor , thereby preventing binding of physiologic ligands ( e.g. , fibrinogen , von willebrand factor ) and interfering with platelet aggregation . abciximab is currently approved for prevention of ischemic complication in patients undergoing pci and in patients with unstable angina when pci is planned within 24 hours2 ) . use of gp iib / iiia inhibitors for treating nstemi patients has been approved and gp iib / iiia inhibitors are currently being used to reduce postprocedural ischemic complications in patients undergoing pci . despite the proven effect of gb iib / iiia inhibitors on patients with nstemi who undergo pci , their use is associated with major or minor bleeding and thrombocytopenia , especially when abciximab is used3 ) . the risk of bleeding can be reduced by the use of low - dose adjuctive heparin , early sheath removal , and careful postprocedural care and attention to the vascular access site . major vascular complications after pci when gp iib / iiia inhibitors are used , such as psudoaneurysm , arteriovenous fistula , and retroperitoneal hematoma reportedly occur in 0.5~9% , 0.2~2.1% and 0.15~0.44% of cases , respectively4 ) . although abciximab can increase the possibility of bleeding complications after pci , as occurred in this case , hemorrhagic pericarditis leading to cardiac tamponade is rare . additionally , cardiac tamponade associated with acute myocardial infarction or pci is a rare complication . in the case of pci , pericardial effusion that causes hemodynamic compromise is usually the result of hemorrhagic pericarditis and it is reported that anticoagulation therapy ( use of heparin , aspirin , clopidogrel , etc . ) clearly increases the risk for hemorrhagic pericarditis . cardiac tamponade following pci can occur due to a guide wire perforation of the coronary artery5 ) , however , in our case , emergent angiography showed no evidence of coronary artery perforation . hemorrhagic pericarditis following abciximab treatment associated with pci was demonstrated by echocardiography , suggesting pericardial effusion and coronary angiography , which in turn confirms that coronary artery perforation did not occur . therefore , we concluded that cardiac tamponade was caused by hemorrhagic pericarditis , which developed as a complication of abciximab treatment . in conclusion , we reported a case of hemorrhagic pericarditis presenting with cardiac tamponade following abciximab treatment associated with pci in a patient who recently underwent stemi . further clinical trials are needed to evaluate and prevent probable complications associated with the increased use of gp iib / iiia inhibitors . it is particularly important to study the relationship between heparin and gp iib / iiia inhibitors .

injury , disease , and congenital malformation have always been part of the human life . so if damaged body parts can be restored with natural tissue , one would have no complaints of such undesired events . tissue engineering or tissue regeneration is a multidisciplinary field with the perspective to replace tissue loss as a result of the traumatic defect , oncosurgery , or organ damage.1 the reconstruction of large tissue defects is one of the main challenges to face the modern oral and maxillofacial surgeon . while the transfer of autologous tissue such as bone grafts or tissue free flaps are well - described , they are not without complications.2 with this in mind , the prospect of using principles of tissue engineering to reconstruct defects in soft and hard tissues of the head and neck continues to gain the attention of the reconstructive surgeon.3 as an alternative to current surgical techniques developments in tissue regeneration using the gene therapy and stem cell research endeavor to develop cells , scaffolds and cell signaling molecules to rejuvenate large oral and maxillofacial tissue defect with accurate reproduction of normal tissue . a tissue engineering approach provides numerous prospective benefits , including a declination in donor site morbidity , a decrease in procedural sensitivity of the repair , and the capacity to intimately ape the in vivo tissue environment into recapitulate normal craniofacial development.4 principles of tissue engineering are basically a triad of stem cells , signaling molecules , and scaffolds or extracellular matrix ( figure 1 ) . a stem cell is defined as an unspecialized cell that can renew and maintain itself for a longer period of time with the potential to commit to a cell or tissue lineage with specialized functions . the use of stem cells , either embryonic or adult - derived ( adscs ) , is a reality of regenerative medicine and dentistry . adscs are multipotent cells not derived from embryonic or primordial germ cell lineage , and they have the potential to differentiate into bone , muscle , cartilage , nerve , and vasculature under appropriate conditions.5 these stem cells can differentiate into various cells like chondrocytes , osteoblasts , myoblasts , hematopoietic cells , neural cells as well ( figure 2 ) . signaling molecules : various growth factors and cytokines are mixed to the ecm , like bone morphogenetic proteins ( bmp ) , fibroblast growth factor-2 ( fgf-2 ) , interleukin-6 , insulin - like growth factor ( igf ) , platelet - derived growth factor ( pdgf ) , transforming growth factor-1 , etc . this co - localization works as a storage pool of growth factors and may diminish growth factor degradation , protecting them from the local microenvironment while facilitating the presentation of the growth factors to cell surface receptors.6 - 8 scaffold : a scaffold ( figure 3 ) is a permanently or temporarily placed three - dimensional porous and permeable natural or synthetic biomaterial that is biocompatible . it can be natural or synthetic . it acts as a matrix and allows the attachment , migration , and differentiation of progenitor cells . properties of scaffolds ( such as biodegradability , porosity , stiffness , and strength ) influence cell adhesion , migration , and proliferation ( such as osteoconduction ) . the greatest challenges faced in tissue - engineered devices , regardless of tissue type , is promoting healing in three dimensions . scaffolds have been made - up with a variety of innate and synthetic biomaterials , such as ceramics , metals , proteins , and polymers . an appropriate scaffold for tissue engineering will be one that is created with biology in mind . the function of the scaffolds is providing structural support to cells , reservoir for growth factors and provide flexible , physical environment for remodeling.9 3-d synthetic polycaprolactone scaffold.9 there are three main proposals taken in the branch of tissue engineering : conduction , induction , and cell transplantation shown in figure 4 . the approach taken to regenerate a tissue relied upon numerous factors , together with the extent of the deficiency , the contribution of cells from adjoining areas , cell resettlement rate , and the available contiguous vasculature . when a pretty small amount of tissue is required , cell conduction and cell induction procedures are frequently used to uphold cell movement from host tissue keen on a scaffold . the alternate of little larger defects habitually requires the straight transplantation of cells . in conductive approach , like guided tissue regeneration , the innately derived or synthetic template simply acts as a submissive 3-d mechanical scaffold to which cells can connect , propagate , transfer , and discriminate . the guided tissue regeneration approach is currently extensively used for the treatment of periodontal diseases . it is over and over again enviable , however , to manage the cell colonization into the scaffold , discrimination of these cells , and consequent tissue fabrication . a potential tissue engineering method is an inductive approach in which bioactive scaffold signaling molecules are used to tempt cell movement and organized cellular behavior . a general inductive technique is the deliverance of soluble signaling molecules s like growth factors to the adjacent tissues . gene therapy likewise is used to convey specific genetic information to host cells ; once introduced , the host cells can then create definite growth factors to sway tissue development . when a huge tissue defect is there or the limited supply of appropriate cells in the tissue environment , cell transplantation is more suitable . this procedure typically includes a biopsy procedure from a donor source , separating and escalating the donor cells in vitro , and implanting the cells directly onto polymers characteristically made up of the physical forms of a fiber - based mesh , a sponge , or a hydrogel . the cells affix to the scaffold , propagate , and eventually form a tissue regenerate . this regenerated tissue is then set in into the individual in the tissue deficient area ( figure 5).10 the components of tissue engineering , msc : mesenchymal stem cells , epsc : epithelial stem cells , dfpc : dental follicle precursor cell , dfsc : dental follicle stem cells , shed : stem cells from human exfoliated deciduous teeth , scap : stem cells from apical papilla , pdlsc : periodontal ligament stem cells , dpsc : dental pulp stem cells , bmp : bone morphogenic proteins , fgf : fibroblast growth factor , il : interleukins , igf : insulin - like growth factor , pdgf : plasma - derived growth factor , tgf : transforming growth factor , vegf : vascular endothelial growth factor.9 three approaches to the engineering of a tissue . ( a ) in conductive approaches , a scaffold can act as a resorbable barrier conniving which cells can penetrate and instigate repair . ( b ) inductive approaches can entail the discharge of bioactive molecules that attach to specific host cells with receptors for the molecules . the specific cells migrate into the defect and begin to form a new extracellular matrix . ( c ) in the cell transplantation approach , cells from a donor source are placed directly into a polymer scaffold in vitro , and the cell - scaffold construct is consequently implanted into the tissue defect site . the transplanted cells , along with host cells form a tissue regenerate that is structurally and functionally incorporated with the host tissue . steps involved in tissue regeneration ( figure 6 ) : steps of tissue regeneration and implantation.1 cell harvesting from bodyisolation , cultivation , and proliferation of cells into scaffold in presence of growth factors or signaling molecules ( in vitro)implantation of the tissue regenerate . cell harvesting from body isolation , cultivation , and proliferation of cells into scaffold in presence of growth factors or signaling molecules ( in vitro ) implantation of the tissue regenerate . application of tissue engineering in oral and maxillofacial surgery : bone regenerationcartilage regenerationsoft tissue regenerationsalivary gland regenerationfat , muscle , and nerve regeneration cartilage regeneration soft tissue regeneration salivary gland regeneration fat , muscle , and nerve regeneration the restoration of the large sized bony defect after resection or due to trauma is a big challenge for the maxillofacial surgeon mesenchymal stem cells are best cells as they can convert into osteoblasts and osteoclasts.12 - 14 bmp are the widely used growth factors for bone regeneration by osteoinduction and osteogenesis . bmp 7 , bmp 2 , prp , and platelet - derived growth factors are currently researched growth signaling molecules.13 scaffolds for the bone regeneration are polymers , bovine collagen , hydroxyapatite , tricalcium phosphate.14 this regenerated bone can be used in mandibular small are large defects , in maxillary cleft repair , maxillary and mandibular ridge augmentation , and maxillary sinus augmentation . in craniofacial region , cartilage present in the articular disc of temporomandibular joint , nasal septum , and ear . cells with chondrogenic potential like bone marrow - derived mesenchymal cells , and periosteum - derived mesenchymal cells used in concurrence with a diversity of scaffolds such as carbon fiber pads , decalcified bone fibrin glue , collagen gels , and alginate hydrogels in the presence of fgf2 , fgf- , bfgf the need for the cartilage regeneration is for restoration of these body parts as in congenital or traumatic defect.15 skin : skin is composed of superficial epidermal and deeper dermal layer . it acts as a protective barrier and prevents water loss and also helps in temperature regulation . skin loss most commonly is due to burns followed by trauma and surgical removal in cancer surgery.16 full thickness skin grafts are the choice for the repair but donor site morbidity , infections , scar formation are the common complications.17 the ideal skin replacement for the facial region shall grant the same aesthetic results as an autograft and it should have all idyllic properties of normal skin . alloderm ( dead de - epidermized dermis ) and integra ( collagen sponge ) are commercially available skin substitutes which are already in use.11 to generate complex skin grafts poised of both an epidermal and a dermal layer , fibroblasts and keratinocytes have been planted into various scaffolds.18 but none of these substitutes fulfills all fully functional properties of skin . the research to achieve versatile and universal engineered skin tissue is oriented to add vascular endothelial cells ( angiogenesis ) , melanocytes ( melanin pigments ) sweat glands , and hair follicles . oral mucosa : oral mucosa is differing from the skin in very few but important aspects . oral mucosa is thin and more vascular with the absence of hair follicles and sweat glands . the tissue - engineered oral mucosa can be used for intraoral defects such as cleft lip and palate , traumatic tissue loss , and pathological mucosal loss after surgery . evpome , alloderm are commercially available tissue engineered oral mucosa.19 salivary gland hypofunction and dysfunction are common after radiotherapy in cancer . artificial salivary gland regeneration is quite a challenge due to the complex structure of salivary gland . they developed this using an in vitro collagen and matrigel culture system to reconstitute human salivary gland tissue and showed functional , differentiated salivary units of acini and ducts in a 3-d construct , with the production of secretory granules and expression of aquaporin 5 protein.20 secretion of saliva in the artificial salivary gland is in research . all the muscles have innervations from the nerves . to reconstruct the facial defects including eye and mouth , muscle has the low regenerative capacity , and traumatic damage may result in fibrous connective tissue formation.21 adipose tissue , myotubes , and nerves have been regenerated in laboratories with relevant signaling molecules and scaffolds , but motor end plate is must for a muscle to contract and retract . tissue engineers have failed to regenerate such functional muscle and research is ongoing for the same.22 the restoration of the large sized bony defect after resection or due to trauma is a big challenge for the maxillofacial surgeon . mesenchymal stem cells are best cells as they can convert into osteoblasts and osteoclasts.12 - 14 bmp are the widely used growth factors for bone regeneration by osteoinduction and osteogenesis . bmp 7 , bmp 2 , prp , and platelet - derived growth factors are currently researched growth signaling molecules.13 scaffolds for the bone regeneration are polymers , bovine collagen , hydroxyapatite , tricalcium phosphate.14 this regenerated bone can be used in mandibular small are large defects , in maxillary cleft repair , maxillary and mandibular ridge augmentation , and maxillary sinus augmentation . in craniofacial region , cartilage present in the articular disc of temporomandibular joint , nasal septum , and ear . cells with chondrogenic potential like bone marrow - derived mesenchymal cells , and periosteum - derived mesenchymal cells used in concurrence with a diversity of scaffolds such as carbon fiber pads , decalcified bone fibrin glue , collagen gels , and alginate hydrogels in the presence of fgf2 , fgf- , bfgf the need for the cartilage regeneration is for restoration of these body parts as in congenital or traumatic defect.15 it acts as a protective barrier and prevents water loss and also helps in temperature regulation . skin loss most commonly is due to burns followed by trauma and surgical removal in cancer surgery.16 full thickness skin grafts are the choice for the repair but donor site morbidity , infections , scar formation are the common complications.17 the ideal skin replacement for the facial region shall grant the same aesthetic results as an autograft and it should have all idyllic properties of normal skin . alloderm ( dead de - epidermized dermis ) and integra ( collagen sponge ) are commercially available skin substitutes which are already in use.11 to generate complex skin grafts poised of both an epidermal and a dermal layer , fibroblasts and keratinocytes have been planted into various scaffolds.18 but none of these substitutes fulfills all fully functional properties of skin . the research to achieve versatile and universal engineered skin tissue is oriented to add vascular endothelial cells ( angiogenesis ) , melanocytes ( melanin pigments ) sweat glands , and hair follicles . oral mucosa : oral mucosa is differing from the skin in very few but important aspects . oral mucosa is thin and more vascular with the absence of hair follicles and sweat glands . the tissue - engineered oral mucosa can be used for intraoral defects such as cleft lip and palate , traumatic tissue loss , and pathological mucosal loss after surgery . artificial salivary gland regeneration is quite a challenge due to the complex structure of salivary gland . they developed this using an in vitro collagen and matrigel culture system to reconstitute human salivary gland tissue and showed functional , differentiated salivary units of acini and ducts in a 3-d construct , with the production of secretory granules and expression of aquaporin 5 protein.20 secretion of saliva in the artificial salivary gland is in research . all the muscles have innervations from the nerves . to reconstruct the facial defects including eye and mouth , muscle has the low regenerative capacity , and traumatic damage may result in fibrous connective tissue formation.21 adipose tissue , myotubes , and nerves have been regenerated in laboratories with relevant signaling molecules and scaffolds , but motor end plate is must for a muscle to contract and retract . tissue engineers have failed to regenerate such functional muscle and research is ongoing for the same.22 maxillofacial rehabilitation after ablative surgery or trauma is a challenging goal for the maxillofacial surgeon . as the technology advances , the ability to construct more detailed bioactive tissue will be more sophisticated . tissue engineering is a highly active field to develop products and devices with all the needful components and following all principles of regenerative medicine . the oral and maxillofacial surgeon should be aware of these advances and should be able to use it for the restoration of the maxillofacial defects . until now , simple tissue regeneration has been successfully achieved to restore tissue defect but complex tissue structure and its functional restoration are still in the research withstanding challenge . maxillofacial surgeons and tissue engineers should work as a team by expressing functional need and principles of tissue engineering , respectively . thus , future developments in the field of tissue engineering will have a significant impact on managing anatomic and physiological changes due to disease process by the most accepted tissue .

using dc targeting for vaccination requires in the first instance an overview of the different mouse and human dc subsets and their functions in immunity . although extensive work has been undertaken in characterizing mouse dc subsets , their human counterparts have remained difficult to define due to their paucity in blood and the difficulty in accessing human lymphoid organs . however , recent reports from several leading laboratories have now identified the human equivalents to mouse dcs . mouse and human dcs can be divided into two major subsets mostly localized in lymphoid tissues : the plasmacytoid dc ( pdc ) and the conventional / myeloid dc ( mdc ) . mouse and human pdcs have an important role during viral infection by producing large amounts of type i interferon in response to toll - like receptor ( tlr)-7 and tlr-9 ligation . in contrast , pdc have poor antigen presentation capacity , although several studies have demonstrated that antigen targeting to endocytic receptors at the surface of pdcs induces high mhc - i and mhc - ii antigen presentation . mouse mdcs comprise two major subsets : cd8 dcs ( and migratory cd103 dcs ) and cd8 dcs . their human counterparts are defined as cd141 ( also named as blood dc antigen ( bdca)3 ) dcs and cd1c ( also known as bdca1 ) dcs , respectively . common surface markers of mouse cd8 dcs and human cd141 dcs include the c - type lectin receptor clec9a and the chemokine ( c motif ) receptor 1 xcr1 . furthermore , both subsets share the expression of the transcription factors , interferon regulatory factor ( irf ) 8 and basic leucine zipper transcription factor , atf - like 3 ( batf3 ) . mouse cd8 dcs and human cd1c dcs have a highly similar transcriptional program , and both subsets express the transcription factor irf4 . the antigen presentation function by dcs is clearly divided between the two mouse subsets , with cd8 dcs and cd103 dcs having superior capacities to induce cd8 t - cell immune responses via the presentation of extracellular antigen by mhc - i molecules ( termed cross - presentation ) . in contrast , mouse cd8 dcs are specialized in cd4 t - cell priming by capturing and processing extracellular antigens for mhc - ii presentation . indeed , both cd141 and cd1c dcs robustly cross - present antigen on mhc - i molecules . furthermore , langerhans cells ( lcs ) reside both in mouse and human epidermis , and are characterized by the expression of langerin and e - cadherin . mouse and human lcs are strong stimulators of cd4 t cells . however , whereas mouse and human lcs are strong cross - presenting cells ex vivo , there is conflicting evidence regarding their in vivo cross - presentation capacity . this subset seems to be specialized in the humoral immune response ; however , cd14 dermal dcs are poor stimulators of allogenic t cells and rather induce regulatory t cells . the mouse subset originates from monocytes and expresses macrophage - specific markers such as f4/80 , cd64 and the high - affinity ige receptor , fcri . the human counterpart , that has been identified in different inflammatory tissues has a transcriptome that closely resembles macrophages and therefore this subset is also likely derived from monocytes . human monocyte - derived dcs ( modcs ) , that are differentiated in vitro from the culture of monocytes with granulocyte macrophage colony - stimulating factor and interleukin ( il)-4 , are also closely related to inflammatory dcs found in organs . mouse inflammatory dcs activate cd4 t cells and drive their polarization into t - helper cells ( th ) 1 or th 2 . inflammatory dcs stimulate autologous cd4 t cells and induce il-17 secretion , although their ability for cross - presentation remains unknown . a comprehensive understanding of the antigen - processing pathways , downstream of the delivery of antigen to dc , is also critical in the design of effective dc - targeted vaccines . for mhc - ii antigen presentation antigen is endocytosed and transported to late endosomes / lysosomes , where it is degraded in the acidic lumen by lysosomal proteases . resulting peptides are loaded onto mhc - ii molecules by the chaperone human leukocyte antigen dm ( hla - dm ) in the endosomal compartment and mhc - ii - peptide complexes are exported to the cell surface . mhc - ii antigen presentation is a well - studied pathway and has been the subject of several excellent reviews , for example . in contrast , to mhc - ii presentation , less is known about the trafficking of endocytosed antigen for presentation via mhc - i molecules ( cross - presentation ) . two major routes have been proposed referred to as the cytosolic ' and vacuolar ' pathways . the cytosolic cross - presentation pathway involves the endocytosed antigen being exported from the endosomes into the cytosol for proteasomal degradation . reduction of disulfide bonds and unfolding of the endocytosed antigen is a prerequisite for antigen export to the cytosol , with the antigen then being rapidly refolded in the cytosol , a process that can be facilitated by heat - shock protein 90 . a role for the endoplasmic reticulum ( er)-associated degradation ( erad ) machinery has been proposed to export the endocytosed antigen through the endosomal membrane . this was based on the presence of er - resident proteins at the surface of phagosomes , including the translocon sec61 . a functional study also suggested that p97 , a cytosolic atpase essential for erad , was also involved in protein translocation . after antigen breakdown by the proteasome , resulting peptides are transported through the transporter associated with antigen processing ( tap ) into the er for loading onto mhc - i molecules . there is also the possibility that peptides are reimported directly into phagosomes that contain tap . trafficking of the er - resident proteins to the endosomal compartment for cross - presentation requires sec22b , an er - resident soluble n - ethylmaleimide - sensitive factor attachment protein receptor ( snare ) . the vacuolar cross - presentation pathway involves the antigen being processed in a proteasome and a tap - independent mechanism . proteolysis is achieved by lysosomal proteases and peptides are loaded onto mhc - i molecules that recycle from the cell surface . one important feature that distinguishes dcs from other antigen - presenting cells is their reduced level of antigen proteolysis in the endosomal pathway . although antigen degradation is required for the generation of peptides for mhc molecules , complete proteolytic destruction would eliminate potential antigenic epitopes . dcs , unlike macrophages , display lower expression lysosomal proteases and a higher lysosomal ph , thereby limiting the level of antigen degradation . the susceptibility of antigen to lysosomal proteolysis is also a critical factor that determines of mhc - i and mhc - ii antigen presentation in murine dcs . indeed , in mice , the presence of lysosomal protease inhibitors enhances antigen cross - presentation by dcs . furthermore , mouse cross - presenting dcs , including cd8 dcs , specifically express an active system to reduce antigen degradation by overexpressing nadph oxidase ( nox)-2 at the phagosomal membrane . this nadph oxidase produces reactive oxygen species that maintain phagosome alkalinization and promote antigen cross - presentation . mouse cd8 dcs also have lower expression of lysosomal proteases compared to non - cross - presenting cd8 dcs . similar to mouse dcs , human cross - presenting dcs , including cd141 and cd1c dcs , also maintain an alkaline ph in their phagosomal lumen and this process occurs in a nox-2 dependent manner . pioneering work has demonstrated the principle of dc targeting using antigen - conjugated antibodies specific to the c - type lectin receptor dec-205 ( figure 1 ) . in mice , dec-205 expression is predominant on thymic epithelial cells and dcs , including cd8 dcs , dermal dcs and lcs . in humans , dec-205 is expressed at high levels on mdcs and monocytes , at intermediate levels by b cells and at low levels on natural killer cells , t cells and pdcs . a major function of this endocytic receptor is suggested to involve binding dying cells for uptake and cross - presentation of debris - associated antigens by dcs . dec-205 also binds to the class b cpg oligonucleotide , a synthetic tlr-9 ligand , and enables its uptake . several reports have demonstrated that ex vivo targeting of mouse dcs , and more specifically cd8 dcs , with ovalbumin ( ova)-conjugated anti - dec-205 antibodies induces robust mhc - i cross - presentation to ova - specific cd8 t cells . furthermore , these conjugates elicit high ova presentation by mhc - ii molecules , and this process is enhanced following targeting of cd8 dcs , despite their low expression of dec205 , relative to cd8 dcs . in vivo , injection of ova - conjugated rat anti - dec205 antibodies into mice , in the presence of an adjuvant , also induces substantial proliferation and accumulation of ova - specific naive cd8 and cd4 t cells , leading to their differentiation into effector t cells . interestingly , this process is concomitant with prolonged antigen presentation by mhc - i , but not by mhc - ii molecules . injected mice also display a strong humoral response with high levels of anti - rat and anti - ova antibodies detected in the serum . using irradiated mice reconstituted with equal ratios of dec-205 and dec-205 bone marrow , we have shown that only targeted dcs , but not non - targeted dcs , are responsible for mhc - i and mhc - ii presentation in response to dec205 targeting in vivo . importantly , the administration of an adjuvant , along with antigen - conjugated anti - dec-205 antibodies , is a prerequisite to induce a robust t - cell immune response . in the absence of a dc maturation signal , the delivery of antigens to dec-205 in vivo is associated with t - cell tolerance . in this case , an initial expansion of antigen - specific cd8 and cd4 t cells occurs , but these cells do not differentiate into effector t cells and are ultimately deleted . furthermore , mice that are immunized in these settings become unresponsive to rechallenge with the same unconjugated antigen . interestingly , mahnke et al . have reported that dec-205 targeting under these conditions leads to the activation of cd25 regulatory t cells , again suggesting the induction of peripheral t - cell tolerance . for b - cell - mediated immunity induced by dec205 targeting , indeed , although in some studies a potent anti - rat humoral response is observed following adjuvant - free immunization with rat anti - dec205 antibodies , others report very poor antibody responses in mice immunized in a similar manner . this may be due to the specific antibody used for targeting given that in the absence of adjuvant , significant differences in the igg response to different anti - dec205 antibodies are observed . this suggests that targeting outcomes will be impacted by inherent properties of the targeting antibodies themselves . most vaccination strategies are based on intradermal or intramuscular inoculation of the antigen , raising the question of the fate of the antigen - conjugated anti - dec-205 antibodies injected via this route . a few hours after deposition under the skin , conjugates are detected at the surface of cd8 dcs in both lymph nodes and spleen , leading to systemic antigen presentation by mhc - i and mhc - ii molecules . in particular , the cd8 dc subset in the skin - draining lymph nodes is targeted via the passive transport of antibodies . furthermore , injected anti - dec-205 antibodies also bind epidermal lcs and dermal dcs ( encompassing langerin and langerin dc ) . these cells migrate to the skin - draining lymph nodes , a process that is further enhanced by skin inflammation . however , the depletion of langerin cells in mice does not impair the elicited cd8 t cell immune response , raising the possibility that migrating dermal langerin dcs and cd8 dcs are sufficient to cross - prime cd8 t cells in the settings of dec-205 targeting . for instance , human modcs stained ex vivo with anti - dec-205 antibodies conjugated to the human immunodeficiency virus ( hiv ) gag protein p24 are strong inducers of cd8 t - cell proliferation and interferon- secretion . have genetically fused the single - chain fragment from a dec-205 antibody to the tumor antigen melanoma - associated antigen 3 . incubation of human modcs with this construct leads to increased secretion of il-2 by antigen - specific cd4 t cells compared with antigen - electroporated or peptide - pulsed modcs . others have shown that the delivery of the cancer testis antigen ny - eso-1 to human modcs via dec-205 results in strong stimulation of antigen - specific cd8 t cells compared with cells pulsed with unconjugated antigen . however , in this case no enhancement of cd4 t - cell activation was reported in response to dec-205 targeting . importantly , few studies have used cd141 and cd1c dcs , the human counterparts of mouse cd8 and cd8 dc , to investigate antigen presentation outcomes in response to dec-205 targeting . these two dc subsets internalize similar levels of anti - dec-205 antibodies ; however , delivering antigen to dec-205 on cd141 dcs , but not cd1c dcs , elicits higher antigen cross - presentation . altogether , these data demonstrate that , similar to mouse dcs , targeting antigens to dec-205 on specific human dc subsets enhances antigen presentation outcomes . a large body of evidence illustrates the effectiveness of dec-205 targeting in mice to prevent the development of infectious diseases or cancer . for instance , mice that are immunized with a single dose of ova - conjugated anti - dec-205 antibodies , together with an adjuvant , become resistant to subsequent infection by ova - expressing vaccinia virus , as evidenced by a reduction in virus titer and the absence of weight loss . furthermore , mice that are similarly immunized and subsequently challenged with ova - expressing tumor cells reject the tumors . interestingly , this immunization strategy is also protective even if the injection is done with mice that already possess tumors nodules . therefore , antigen - conjugated anti - dec-205 antibodies can be used both as a prophylactic and therapeutic vaccination strategy . in conclusion , delivering antigen to dec-205 , along with adjuvant , is a strategy of choice to elicit strong t- and b - cell immune responses with promising applications in vaccination . clec9a ( also known as dngr-1 ) is a c - type lectin - like receptor . in mice , its expression is restricted to dcs with high levels measured on cd8 dcs and lower levels on pdcs . in humans , clec9a is highly expressed by cd141 dcs , the human equivalents of the cd8 dcs , however , not by pdc . clec9a is a critical receptor for cross - presentation of dead cell - associated antigen by dc . this process relies on recognition of an actin - containing cytoskeletal structure that is exposed on apoptotic and necrotic cells when the cell membrane is ruptured . interestingly , several studies have exploited the natural function of clec9a in antigen presentation , using it as a target receptor for vaccine enhancement ( figure 2 ) . in vivo injection of anti - clec9a antibodies specifically labels cd8 dcs and pdcs . to determine whether clec9a was a promising receptor for dc targeting , ova was genetically conjugated to anti - clec9a antibodies and the resulting conjugates administrated to mice . at steady state , these conjugates induce the proliferation of ova - specific transgenic cd8 and cd4 t cells , showing that antigen targeted to clec9a is efficiently processed and presented by mhc - i and mhc - ii molecules . furthermore , sancho et al . have shown that delivering ova to dcs via clec9a in vivo , together with an adjuvant , leads to a cytotoxic t lymphocyte response that actively suppresses ova - expressing lung metastases . similar results are observed when the vaccine is administered prior or after tumor challenge , showing that targeting antigen to clec9a can be used as a vaccine for prophylaxis or immunotherapy . in another report , highlight that in vivo injection of anti - clec9a antibodies conjugated to an mhc - ii - binding ova peptide , together with an adjuvant , leads to robust cd4 t - cell priming . in this case , the nature of the adjuvant used dictates the polarization of effector cd4 t cells . for instance , poly i : c induces the differentiation of activated cd4 t cells into th1 , leading to a strong humoral response . in contrast , curdlan co - injection primes a th17 immune response . adjuvant - free immunization with anti - clec9a antibodies is reported to give rise to foxp3 t cells and to reduce antibody production , suggesting the induction of tolerance . however , in direct contrast to these data , other authors report that antigen delivery via clec9a enhances the humoral response even in the absence of adjuvant . mice injected with rat anti - clec9a antibodies conjugated to ova produce high - serum titers of anti - rat igg and anti - ova antibodies at steady state . furthermore , the use of myd88 trif mice , deficient in tlr signaling , does not impair this humoral response , ruling out possible endotoxin contamination of the anti - clec9a antibodies acting to compensate for the absence of adjuvant . have also measured the humoral response upon adjuvant - free injection of rat anti - clec9a antibodies conjugated to hapten nitrophenol ( np ) . in line with the previous data , high and prolonged levels of anti - rat igg and anti - np antibodies are detected in the serum , encompassing all igg isotypes . a strong anti - rat igg humoral response was also induced in non - human primates immunized with rat anti - clec9a antibodies only . the discrepancy between studies regarding the requirement of an adjuvant for the antibody response following clec9a targeting may originate in the type of injected antibody . injected a rat igg1 anti - clec9a antibody , whereas others have used a rat igg2a isotype that is inherently more immunogenic . in contrast , the adjuvant - free immunogenicity of the anti - clec9a antibodies can not be predicted from the targeted region of the receptor , the binding capacities to the target in vivo or the persistence of the targeting antibodies in the serum . the mechanism responsible for the potent humoral response induced by adjuvant - free clec9a targeting has been deciphered . targeting of np to clec9a induces transient formation of germinal centers , maturation of antibody affinity and generation of memory b cells that , altogether , characterizes a follicular response . in line with this data , mice immunized with ova - conjugated anti - clec9a antibodies in the absence of adjuvant produce high numbers of t - follicular helper cells ( tfh ) that promote antibody production . these cells are localized in the germinal centers and express the classical tfh markers , including chemokine ( c - x - c motif ) receptor 5 ( cxcr5 ) and programmed cell death protein-1 at the cell surface , the transcription factor b - cell lymphoma 6 ( bcl6 ) and the cytokine il-21 . furthermore , the cd4 t cells that persist long - term after antigen targeting to clec9a display high levels of cxcr5 and bcl6 typical of memory tfh . after a secondary challenge , these cells rapidly proliferate and differentiate into effector tfh . in conclusion , clec9a is a receptor that can be exploited to induce robust t- and b - cell immune responses in the settings of antibody - targeted vaccination . importantly , the elicited humoral response does not require adjuvant administration and involves a follicular response with tfh production . clec12a , like clec9a , is also a c - type lectin - like receptor that is highly expressed by mouse cd8 dcs and pdcs . lower expression levels are also found on mouse monocytes , macrophages and b cells . in human , the potential of clec12a as a target for antibody - based vaccination has been investigated . a strong humoral response is observed in mice immunized with ova - conjugated anti - clec12a antibodies , as evidenced by high titers of anti - rat igg and anti - ova antibodies . furthermore , targeting ova to clec12a induces the proliferation of ova - specific transgenic cd8 and cd4 t cells ; however , at a lower extent compared with antigen targeting to dec-205 or clec9a . however , unlike clec9a targeting , the b- and t - cell immune responses elicited by clec12a targeting requires the use of an adjuvant . yet , even with this reagent , targeting clec12a is inefficient at generating cytotoxic t cells . overall , these results show that delivering antigen to clec12a does not elicit robust b- and t - cell immune responses , thus limiting interest in its use in antibody - targeted vaccination . pioneering work has demonstrated the principle of dc targeting using antigen - conjugated antibodies specific to the c - type lectin receptor dec-205 ( figure 1 ) . in mice , dec-205 expression is predominant on thymic epithelial cells and dcs , including cd8 dcs , dermal dcs and lcs . in humans , dec-205 is expressed at high levels on mdcs and monocytes , at intermediate levels by b cells and at low levels on natural killer cells , t cells and pdcs . a major function of this endocytic receptor is suggested to involve binding dying cells for uptake and cross - presentation of debris - associated antigens by dcs . dec-205 also binds to the class b cpg oligonucleotide , a synthetic tlr-9 ligand , and enables its uptake . several reports have demonstrated that ex vivo targeting of mouse dcs , and more specifically cd8 dcs , with ovalbumin ( ova)-conjugated anti - dec-205 antibodies induces robust mhc - i cross - presentation to ova - specific cd8 t cells . furthermore , these conjugates elicit high ova presentation by mhc - ii molecules , and this process is enhanced following targeting of cd8 dcs , despite their low expression of dec205 , relative to cd8 dcs . in vivo , injection of ova - conjugated rat anti - dec205 antibodies into mice , in the presence of an adjuvant , also induces substantial proliferation and accumulation of ova - specific naive cd8 and cd4 t cells , leading to their differentiation into effector t cells . interestingly , this process is concomitant with prolonged antigen presentation by mhc - i , but not by mhc - ii molecules . injected mice also display a strong humoral response with high levels of anti - rat and anti - ova antibodies detected in the serum . using irradiated mice reconstituted with equal ratios of dec-205 and dec-205 bone marrow , we have shown that only targeted dcs , but not non - targeted dcs , are responsible for mhc - i and mhc - ii presentation in response to dec205 targeting in vivo . importantly , the administration of an adjuvant , along with antigen - conjugated anti - dec-205 antibodies , is a prerequisite to induce a robust t - cell immune response . in the absence of a dc maturation signal , the delivery of antigens to dec-205 in vivo is associated with t - cell tolerance . in this case , an initial expansion of antigen - specific cd8 and cd4 t cells occurs , but these cells do not differentiate into effector t cells and are ultimately deleted . furthermore , mice that are immunized in these settings become unresponsive to rechallenge with the same unconjugated antigen . interestingly , mahnke et al . have reported that dec-205 targeting under these conditions leads to the activation of cd25 regulatory t cells , again suggesting the induction of peripheral t - cell tolerance . for b - cell - mediated immunity induced by dec205 targeting , indeed , although in some studies a potent anti - rat humoral response is observed following adjuvant - free immunization with rat anti - dec205 antibodies , others report very poor antibody responses in mice immunized in a similar manner . this may be due to the specific antibody used for targeting given that in the absence of adjuvant , significant differences in the igg response to different anti - dec205 antibodies are observed . this suggests that targeting outcomes will be impacted by inherent properties of the targeting antibodies themselves . most vaccination strategies are based on intradermal or intramuscular inoculation of the antigen , raising the question of the fate of the antigen - conjugated anti - dec-205 antibodies injected via this route . a few hours after deposition under the skin , conjugates are detected at the surface of cd8 dcs in both lymph nodes and spleen , leading to systemic antigen presentation by mhc - i and mhc - ii molecules . in particular , the cd8 dc subset in the skin - draining lymph nodes is targeted via the passive transport of antibodies . furthermore , injected anti - dec-205 antibodies also bind epidermal lcs and dermal dcs ( encompassing langerin and langerin dc ) . these cells migrate to the skin - draining lymph nodes , a process that is further enhanced by skin inflammation . however , the depletion of langerin cells in mice does not impair the elicited cd8 t cell immune response , raising the possibility that migrating dermal langerin dcs and cd8 dcs are sufficient to cross - prime cd8 t cells in the settings of dec-205 targeting . for instance , human modcs stained ex vivo with anti - dec-205 antibodies conjugated to the human immunodeficiency virus ( hiv ) gag protein p24 are strong inducers of cd8 t - cell proliferation and interferon- secretion . have genetically fused the single - chain fragment from a dec-205 antibody to the tumor antigen melanoma - associated antigen 3 . incubation of human modcs with this construct leads to increased secretion of il-2 by antigen - specific cd4 t cells compared with antigen - electroporated or peptide - pulsed modcs . others have shown that the delivery of the cancer testis antigen ny - eso-1 to human modcs via dec-205 results in strong stimulation of antigen - specific cd8 t cells compared with cells pulsed with unconjugated antigen . however , in this case no enhancement of cd4 t - cell activation was reported in response to dec-205 targeting . importantly , few studies have used cd141 and cd1c dcs , the human counterparts of mouse cd8 and cd8 dc , to investigate antigen presentation outcomes in response to dec-205 targeting . these two dc subsets internalize similar levels of anti - dec-205 antibodies ; however , delivering antigen to dec-205 on cd141 dcs , but not cd1c dcs , elicits higher antigen cross - presentation . altogether , these data demonstrate that , similar to mouse dcs , targeting antigens to dec-205 on specific human dc subsets enhances antigen presentation outcomes . a large body of evidence illustrates the effectiveness of dec-205 targeting in mice to prevent the development of infectious diseases or cancer . for instance , mice that are immunized with a single dose of ova - conjugated anti - dec-205 antibodies , together with an adjuvant , become resistant to subsequent infection by ova - expressing vaccinia virus , as evidenced by a reduction in virus titer and the absence of weight loss . furthermore , mice that are similarly immunized and subsequently challenged with ova - expressing tumor cells reject the tumors . interestingly , this immunization strategy is also protective even if the injection is done with mice that already possess tumors nodules . therefore , antigen - conjugated anti - dec-205 antibodies can be used both as a prophylactic and therapeutic vaccination strategy . in conclusion , delivering antigen to dec-205 , along with adjuvant , is a strategy of choice to elicit strong t- and b - cell immune responses with promising applications in vaccination . clec9a ( also known as dngr-1 ) is a c - type lectin - like receptor . in mice , its expression is restricted to dcs with high levels measured on cd8 dcs and lower levels on pdcs . in humans , clec9a is highly expressed by cd141 dcs , the human equivalents of the cd8 dcs , however , not by pdc . clec9a is a critical receptor for cross - presentation of dead cell - associated antigen by dc . this process relies on recognition of an actin - containing cytoskeletal structure that is exposed on apoptotic and necrotic cells when the cell membrane is ruptured . interestingly , several studies have exploited the natural function of clec9a in antigen presentation , using it as a target receptor for vaccine enhancement ( figure 2 ) . in vivo injection of anti - clec9a antibodies specifically labels cd8 dcs and pdcs . to determine whether clec9a was a promising receptor for dc targeting , ova was genetically conjugated to anti - clec9a antibodies and the resulting conjugates administrated to mice . at steady state , these conjugates induce the proliferation of ova - specific transgenic cd8 and cd4 t cells , showing that antigen targeted to clec9a is efficiently processed and presented by mhc - i and mhc - ii molecules . have shown that delivering ova to dcs via clec9a in vivo , together with an adjuvant , leads to a cytotoxic t lymphocyte response that actively suppresses ova - expressing lung metastases . similar results are observed when the vaccine is administered prior or after tumor challenge , showing that targeting antigen to clec9a can be used as a vaccine for prophylaxis or immunotherapy . in another report , highlight that in vivo injection of anti - clec9a antibodies conjugated to an mhc - ii - binding ova peptide , together with an adjuvant , leads to robust cd4 t - cell priming . in this case , the nature of the adjuvant used dictates the polarization of effector cd4 t cells . for instance , poly i : c induces the differentiation of activated cd4 t cells into th1 , leading to a strong humoral response . in contrast , curdlan co - injection primes a th17 immune response . adjuvant - free immunization with anti - clec9a antibodies is reported to give rise to foxp3 t cells and to reduce antibody production , suggesting the induction of tolerance . however , in direct contrast to these data , other authors report that antigen delivery via clec9a enhances the humoral response even in the absence of adjuvant . mice injected with rat anti - clec9a antibodies conjugated to ova produce high - serum titers of anti - rat igg and anti - ova antibodies at steady state . furthermore , the use of myd88 trif mice , deficient in tlr signaling , does not impair this humoral response , ruling out possible endotoxin contamination of the anti - clec9a antibodies acting to compensate for the absence of adjuvant . have also measured the humoral response upon adjuvant - free injection of rat anti - clec9a antibodies conjugated to hapten nitrophenol ( np ) . in line with the previous data , high and prolonged levels of anti - rat igg and anti - np antibodies a strong anti - rat igg humoral response was also induced in non - human primates immunized with rat anti - clec9a antibodies only . the discrepancy between studies regarding the requirement of an adjuvant for the antibody response following clec9a targeting may originate in the type of injected antibody . injected a rat igg1 anti - clec9a antibody , whereas others have used a rat igg2a isotype that is inherently more immunogenic . in contrast , the adjuvant - free immunogenicity of the anti - clec9a antibodies can not be predicted from the targeted region of the receptor , the binding capacities to the target in vivo or the persistence of the targeting antibodies in the serum . the mechanism responsible for the potent humoral response induced by adjuvant - free clec9a targeting has been deciphered . targeting of np to clec9a induces transient formation of germinal centers , maturation of antibody affinity and generation of memory b cells that , altogether , characterizes a follicular response . in line with this data , mice immunized with ova - conjugated anti - clec9a antibodies in the absence of adjuvant produce high numbers of t - follicular helper cells ( tfh ) that promote antibody production . these cells are localized in the germinal centers and express the classical tfh markers , including chemokine ( c - x - c motif ) receptor 5 ( cxcr5 ) and programmed cell death protein-1 at the cell surface , the transcription factor b - cell lymphoma 6 ( bcl6 ) and the cytokine il-21 . furthermore , the cd4 t cells that persist long - term after antigen targeting to clec9a display high levels of cxcr5 and bcl6 typical of memory tfh . after a secondary challenge , these cells rapidly proliferate and differentiate into effector tfh . in conclusion , clec9a is a receptor that can be exploited to induce robust t- and b - cell immune responses in the settings of antibody - targeted vaccination . importantly , the elicited humoral response does not require adjuvant administration and involves a follicular response with tfh production . clec12a , like clec9a , is also a c - type lectin - like receptor that is highly expressed by mouse cd8 dcs and pdcs . lower expression levels are also found on mouse monocytes , macrophages and b cells . in human , the potential of clec12a as a target for antibody - based vaccination has been investigated . a strong humoral response is observed in mice immunized with ova - conjugated anti - clec12a antibodies , as evidenced by high titers of anti - rat igg and anti - ova antibodies . furthermore , targeting ova to clec12a induces the proliferation of ova - specific transgenic cd8 and cd4 t cells ; however , at a lower extent compared with antigen targeting to dec-205 or clec9a . however , unlike clec9a targeting , the b- and t - cell immune responses elicited by clec12a targeting requires the use of an adjuvant . yet , even with this reagent , targeting clec12a is inefficient at generating cytotoxic t cells . overall , these results show that delivering antigen to clec12a does not elicit robust b- and t - cell immune responses , thus limiting interest in its use in antibody - targeted vaccination . endocytic receptors expressed by dcs have differential levels of expression , internalization patterns and downstream trafficking routes , although only several of them elicit high t - cell immune responses in the setting of dc targeting . what parameters drive the ability of the receptors to exert this function ? to address this question , several studies have analyzed the intracellular trafficking of dc receptors and compared it with the antigen presentation outcomes when those receptors are targeted . intuitively , the amount of internalized antigen should correlate with antigen presentation levels , therefore highly internalized receptors should be privileged targets . have measured the uptake of antibodies specific for dec-205 , mannose receptor and cd40 into human cd1c and modcs . anti - mannose receptor antibody was more efficiently accumulated than anti - cd40 or anti - dec-205 antibodies , but cd40 was the best receptor to target to induce antigen cross - presentation . we have also analyzed the internalization parameters of different endocytic receptors expressed by mouse and human dcs , using a fluorescent dna - based - coupled probe . by conjugating this probe to antibodies specific for receptors of interest , we have quantitatively measured the amount of antigen delivered into the intracellular compartment via the targeted molecules . using this methodology , we observed that mature cd8 dcs internalize a lower antigen load via dec-205 or cd11c than via cd40 . in mature cd8 dc , dec-205 , cd11c and cd40 all deliver a small amount of antigen into the endocytic pathway . however , for both mouse mdc subsets , dec-205 was superior for mhc - i and mhc - ii antigen presentation relative to the antigen load . therefore , the antigen load internalized downstream of the targeted receptor does not influence the level of antigen presentation . it has also been proposed that the speed of antigen internalization influences processing of the targeted antigen for presentation . in particular , targeting a receptor that is slowly internalized may establish an antigen depot and preserve important mhc - i epitopes from enzymatic degradation , leading to prolonged cross - presentation . this is exemplified by cd40 that is slowly internalized in human cd1c dcs and modcs correlating with robust cd8 t - cell priming following targeting of this receptor . however for instance , despite being a good target for cross - presentation , dec-205 is rapidly lost from the cell surface of mouse mdcs and of human modcs , suggesting an increased , rather than decreased , speed of internalization . moreover , we have observed a rapid internalization of dec-205 , clec9a and cd40 in mouse mdcs , whereas cd11b and cd11c are endocytosed slowly . consistent with these data , the internalization of dec-205 in human cd141 and cd1c dcs is also fast , in contrast to cd11c that is endocytosed slowly . yet , targeting dec-205 over cd40 and cd11c is the more efficient route at eliciting cross - priming of cd8 t cells . in conclusion , the impact of the speed of targeted receptor internalization on the antigen presentation outcome remains controversial . the intracellular trafficking route accessed by antigen once inside the cell is a significant factor that will affect the level of antigen presentation . therefore , it has been proposed that receptor - targeted antigen that traffics to early endosomes with reduced proteolysis is more efficiently processed for mhc - i cross - presentation . in contrast , antigen that homes into late endosomes is actively degraded by lysosomal proteases and is more likely to give rise to epitopes for mhc - ii presentation . in line with this concept , internalized cd40 , mannose receptor , dc - sign and cd11c are observed in early endosomes of human dcs and all are efficient targets to elicit antigen cross - presentation . there is evidence that in some settings internalized dec-205 traffics to late endosomes and that antigen delivered via this route in human cd1c dcs and modcs is poorly cross - presented . this , however , contradicts the widely supported role for dec-205 as a strong receptor to target for cross - presentation . for instance , antigen delivered to early endosomes via cd40 is more efficiently presented on mhc - ii molecules than antigen delivered to lysosomes via dec-205 . furthermore , in cd141 dcs , antigen internalized via dec-205 also traffics to late endosomes , yet it is still efficiently cross - presented by this dc subset . thus , no clear correlation has been found between the intracellular trafficking of the targeted receptor and the effectiveness of antigen presentation . in conclusion , the amount of internalized receptors , the speed of internalization and the destination of the receptor into the intracellular compartment are not reliable criteria to predict the antigen presentation outcomes in the settings of dc targeting . recent advances in the understanding of the complexity of dc subsets and how they perform antigen presentation has provided a rationale for the design of novel vaccination strategies based on antigen - conjugated antibodies . dec-205 is a very promising target given the robust t - cell and b - cell immune responses elicited in mice upon antigen delivery to this receptor , together with adjuvant . targeting antigen to human dcs via dec-205 ex vivo also efficiently primes t cells . translating these findings into clinical applications is underway with several anti - dec-205 antibodies being currently tested as prophylactic or therapeutic vaccines ( https://clinicaltrials.gov ) . clec9a is another target of interest , in particular due to its ability to induce a strong antibody response . this humoral response involves the formation of germinal centers and the generation of tfh cells . interestingly , some of the anti - clec9a antibodies used are active without the need of an adjuvant . this property is of interest for future translation into human trials in order to prevent possible side effects associated with adjuvant use . understanding the rules that dictate dc targeting effectiveness is critical to the design of antibody - based vaccinations . however , currently no correlations can be drawn between antigen presentation outcomes and the intracellular trafficking of antigen delivered to dcs via specific receptors , including antigen load , speed of receptor internalization or the destination of internalized receptor in the endocytic pathway . attention should be paid to the targeted dc subset in order to elicit the desired antigen presentation outcome . this is particularly true for the cross - priming of cd8 t cells by delivering antigen to dc with higher cross - presentation capacities . other factors may have a role in the effectiveness of dc targeting , such as the inflammatory environment or the type of antibody used . therefore , more work is required to decipher the molecular and cellular processes that underpin effective dc targeting . this knowledge will likely help to identify novel successful targets for antibody - based vaccination .

chronic kidney disease ( ckd ) , which affects individuals worldwide , is now recognized as a major public health problem . interstitial fibrosis is regarded as the main pathway for ckd progression , which culminates in end - stage renal failure . despite the great effort invested in identifying therapies for ckd in addition , current treatment modalities and donor kidney availability are insufficient , further increasing the demand for newly available approaches to treat chronic nephropathy . over the last decade , stem cells are undifferentiated cells characterized by their self - renewal ability and the capacity for multiline age differentiation . stem cell - based therapies are potentially effective in many human diseases , including kidney disease , and they have been proven to be safe and effective in a wide range of immunomediated diseases . however , aside from hematopoietic stem cell transplantation for the treatment of hematological disorders and some dermal and corneal indications , all other approaches based on stem cells remain experimental . in spite of this , desperate patients who have no hope of a cure for their disease may be willing to risk stem cell - based therapies . the emerging field of regenerative medicine is progressing rapidly and is supported by many studies , including animal preclinical experiments . stem cell - based therapy may have the potential to be developed into a novel therapeutic approach to treating ckd . embryonic stem cells ( escs ) were initially derived from the inner cell mass of blastocysts of mouse embryos . these cells have the ability to differentiate into several cell types of the mesodermal , endodermal , and ectodermal lineages . therefore , they have the potential to be used as an effective tool for kidney regenerative therapy . it has been shown that mouse wnt4 transfected - escs can differentiate into tubule - like structures that express aquaporin-2 both in vitro and in vivo and the expression of aquaporin-2 was enhanced in the presence of hgf and activin a. steenhard et al . injected escs into day 1213 embryonic metanephroi and then placed them into a trans well organ culture . these escs differentiated into renal epithelial structures that resembled tubules with an efficiency approaching 50% . overall , escs are a valuable cellular source for investigating the mechanism of kidney regeneration , but there are still many limitations to regeneration therapy in the clinic . three - dimensional ( 3d ) microscale cellular niches ( microniches ) are optimal cell delivery and therapy vehicles based on biocompatible and biodegradable gelatin microcryogels ( gms ) . gms can be degraded in the presence of trypsin / ethylenediaminetetraacetic acid ( edta ) solution within 70 min . in addition , gms can not be detected 28 days after being injected a tan intramuscular site , suggesting good biocompatibility and biodegradation in vivo . the 3d microniches can be constituted by priming the seeded cells in the gms in vitro for accumulation of deposited ecm proteins , as well as for enhancing cell - cell interactions . the 3d cellular microniches result in microscale tissue - like ensembles , representing an optimal delivery strategy to facilitate cell protection from mechanical insults during injection and in vivo cell retention , engraftment and survival , and the ultimate therapeutic function at the lesion site . in this study , we overcame the difficulty inherent in using gms by allowing the omentum to wrap up escs - loaded gms fusing to a 5/6 nephrectomized kidney ( a model of ckd in rats ) . we reported that by doing so , the progression of ckd was slowed , which was likely due to the presence of escs and their secretory paracrine factors in the vicinity of the injured kidney . murine pluripotent escs ( c57bl6/erfp , life technologies , carlsbad , ca , usa ) have been well - characterized , and red fluorescent protein allowed tracking by fluorescence microscopy . these cells were maintained on gelatin - coated dishes in feeder - free ( mouse embryonic fibroblasts , mitotically inactivated using gamma - rays ) , serum - free medium that contained 50% neurobasal supplemented with n2/50% dmem / f12 supplemented with b27 , 10% bsa , 2 mmol / l glutamine , and 1% penicillin - streptomycin ( penicillin at 100 u / ml and streptomycin at 100 g / ml , ps ) ( life technologies , rockville , md , usa ) , 1% leukemia inhibitory factor , and -mercaptoethanol . to prepare the cells for use , the undifferentiated escs were dissociated using trypsin ( 0.05% trypsin / edta ) . then , they were suspended in esc growth medium . all cultures in this study were maintained at 37c in 5% co2 . male ( sprague dawley [ sd ] ) rats ( 220250 g ) were obtained from the experimental animal center of the academy of military medical sciences . the rats were housed at a constant room temperature with a 12-h light / dark cycle . all animal protocols were approved by the animal ethics committee of the chinese pla general hospital and military medical college . briefly , sd rats ( body weight 220250 g ) were laparotomized under general anesthesia and underwent right nephrectomy ( npx ) and surgical excision of the upper and lower poles of the left kidney ( 5/6 npx ) . this is a well - established model in rats that induces progressive ckd without causing systemic hypertension . we designed the pedicled greater omentum flap packing gms or cells on remnant renal tissue to facilitate its fusion to the injured kidney [ figure 1a1c ] . ( a ) the greater omentum is mainly composed of loose connective tissue , which has an abundant blood supply . ( b and c ) the pedicled great omentum wrapped the 5/6 nephrectomized renal tissue . the following groups were evaluated : sham , only removal of the renal capsule ; npx , 5/6 npx and simultaneous complete omentectomy to prevent omentum from fusing to the injured kidney ; npx + om ( omentum ) , 5/6 npx and pedicled greater omental direct packing on the remnant renal tissue ; npx + om + escs , 5/6 npx and pedicled greater omental packing of free escs on remnant renal tissue ; and npx + om + gms + escs , 5/6 npx and pedicled greater omentum packing of esc - loaded gms on remnant renal tissue . rats were euthanized at 12 weeks after inducing ckd . after euthanasia , depending on the experiment , the remnant kidney was either cleared of the fused omentum before further biochemical processing or the attached omentum was left intact with the kidney tissue for histologic examination . the harvested gms were from the department of biomedical engineering , school of medicine , tsinghua university . before loading the cells , the harvested and dried gms in the dish were sterilized by an ethylene oxide sterilization system that performed a 12-h degassing step under vacuum after 12 h of gas exposure ( an74j / anprolene ; anderson sterilization ) . escs were isolated and cultured in the esc growth medium according to a previously reported protocol . a 60 l esc suspension was subsequently pipetted onto 600 tightly packed gms and automatically absorbed to hydrate the porous structures and then maintained in a humidified chamber and incubated at 37c for 2 h to allow cell attachment . then after 2 d of culture , we used the pedicled greater omentum flap packing esc - loaded gms on the 5/6 nephrectomized renal section tissue . the viability and fluorescence of escs - loaded gms were assessed and imaged using a leica two - photon fluorescence confocal imaging tcs sp5 system ( leica microsystems , mannheim , germany ) from day 1 to day 7 in vitro . the rats were weighed weekly . on week 2 , 4 , 6 , and 12 , 24 h urine and blood samples were collected . to collect 24 h urine , the rats were placed in metabolism cages without food but with free access to water for 24 h. urine was collected in an antibiotic / antimycotic solution ( sigma , st . plasma creatinine and urea nitrogen were determined using commercial kits ( sarcosine oxidase - peroxidase - antiperoxidase ; zixing , shanghai , china ) . harvested kidneys were fixed in 4% formalin for 24 h and underwent routine dehydration and paraffin embedding . renal tissues were sectioned at 3-m thickness and stained with hematoxylin and eosin , periodic acid - schiff ( pas ) , and masson trichrome staining using standard methods . assessment of glomerulosclerosis and tubular injury was performed using the semiquantitative scale described by cao et al . in brief , glomeruli in each kidney tissue were visualized at a magnification of 400 and graded as follows : 0 , normal ; 1 + , mesangial expansion and slight glomerular damage involving < 25% of the glomerulus ; 2 + , mild sclerosis involving 2550% of the glomerulus ; 3 + , moderate sclerosis involving 5075% of the glomerulus ; and 4 + , severe sclerosis involving > 75% of the glomerulus . tubular injury was visualized at a magnification of 200 and graded as follows : 0 , normal ; 1 + , area of interstitial inflammation , fibrosis , and tubular dilation with cast formation ( lesion ) involving < 25% of the field ; 2 + , lesion involving 2550% of the field ; 3 + , lesion involving 50% 75% of the field ; and 4 + , lesion involving > 75% of the field . the overall glomerulosclerosis index and tubular injury score ( mean standard error of the mean [ sem ] ) were computed from the individual means of all of the rats in the group . multiple comparisons of parametric data were performed using one - way analysis of variance , followed by student newman student 's t - test was used to compare differences between means;a p < 0.05 indicated statistically significant difference . murine pluripotent escs ( c57bl6/erfp , life technologies , carlsbad , ca , usa ) have been well - characterized , and red fluorescent protein allowed tracking by fluorescence microscopy . these cells were maintained on gelatin - coated dishes in feeder - free ( mouse embryonic fibroblasts , mitotically inactivated using gamma - rays ) , serum - free medium that contained 50% neurobasal supplemented with n2/50% dmem / f12 supplemented with b27 , 10% bsa , 2 mmol / l glutamine , and 1% penicillin - streptomycin ( penicillin at 100 u / ml and streptomycin at 100 g / ml , ps ) ( life technologies , rockville , md , usa ) , 1% leukemia inhibitory factor , and -mercaptoethanol . to prepare the cells for use , the undifferentiated escs were dissociated using trypsin ( 0.05% trypsin / edta ) . then , they were suspended in esc growth medium . all cultures in this study were maintained at 37c in 5% co2 . male ( sprague dawley [ sd ] ) rats ( 220250 g ) were obtained from the experimental animal center of the academy of military medical sciences . the rats were housed at a constant room temperature with a 12-h light / dark cycle . all animal protocols were approved by the animal ethics committee of the chinese pla general hospital and military medical college . briefly , sd rats ( body weight 220250 g ) were laparotomized under general anesthesia and underwent right nephrectomy ( npx ) and surgical excision of the upper and lower poles of the left kidney ( 5/6 npx ) . this is a well - established model in rats that induces progressive ckd without causing systemic hypertension . we designed the pedicled greater omentum flap packing gms or cells on remnant renal tissue to facilitate its fusion to the injured kidney [ figure 1a1c ] . ( a ) the greater omentum is mainly composed of loose connective tissue , which has an abundant blood supply . ( b and c ) the pedicled great omentum wrapped the 5/6 nephrectomized renal tissue . the following groups were evaluated : sham , only removal of the renal capsule ; npx , 5/6 npx and simultaneous complete omentectomy to prevent omentum from fusing to the injured kidney ; npx + om ( omentum ) , 5/6 npx and pedicled greater omental direct packing on the remnant renal tissue ; npx + om + escs , 5/6 npx and pedicled greater omental packing of free escs on remnant renal tissue ; and npx + om + gms + escs , 5/6 npx and pedicled greater omentum packing of esc - loaded gms on remnant renal tissue . after euthanasia , depending on the experiment , the remnant kidney was either cleared of the fused omentum before further biochemical processing or the attached omentum was left intact with the kidney tissue for histologic examination . the harvested gms were from the department of biomedical engineering , school of medicine , tsinghua university . before loading the cells , the harvested and dried gms in the dish were sterilized by an ethylene oxide sterilization system that performed a 12-h degassing step under vacuum after 12 h of gas exposure ( an74j / anprolene ; anderson sterilization ) . escs were isolated and cultured in the esc growth medium according to a previously reported protocol . a 60 l esc suspension was subsequently pipetted onto 600 tightly packed gms and automatically absorbed to hydrate the porous structures and then maintained in a humidified chamber and incubated at 37c for 2 h to allow cell attachment . after 2 d of culture , we used the pedicled greater omentum flap packing esc - loaded gms on the 5/6 nephrectomized renal section tissue . the viability and fluorescence of escs - loaded gms were assessed and imaged using a leica two - photon fluorescence confocal imaging tcs sp5 system ( leica microsystems , mannheim , germany ) from day 1 to day 7 in vitro . the rats were weighed weekly . on week 2 , 4 , 6 , and 12 , 24 h urine and blood samples were collected . to collect 24 h urine , the rats were placed in metabolism cages without food but with free access to water for 24 h. urine was collected in an antibiotic / antimycotic solution ( sigma , st . plasma creatinine and urea nitrogen were determined using commercial kits ( sarcosine oxidase - peroxidase - antiperoxidase ; zixing , shanghai , china ) . harvested kidneys were fixed in 4% formalin for 24 h and underwent routine dehydration and paraffin embedding . renal tissues were sectioned at 3-m thickness and stained with hematoxylin and eosin , periodic acid - schiff ( pas ) , and masson trichrome staining using standard methods . assessment of glomerulosclerosis and tubular injury was performed using the semiquantitative scale described by cao et al . in brief , glomeruli in each kidney tissue were visualized at a magnification of 400 and graded as follows : 0 , normal ; 1 + , mesangial expansion and slight glomerular damage involving < 25% of the glomerulus ; 2 + , mild sclerosis involving 2550% of the glomerulus ; 3 + , moderate sclerosis involving 5075% of the glomerulus ; and 4 + , severe sclerosis involving > 75% of the glomerulus . tubular injury was visualized at a magnification of 200 and graded as follows : 0 , normal ; 1 + , area of interstitial inflammation , fibrosis , and tubular dilation with cast formation ( lesion ) involving < 25% of the field ; 2 + , lesion involving 2550% of the field ; 3 + , lesion involving 50% 75% of the field ; and 4 + , lesion involving > 75% of the field . the overall glomerulosclerosis index and tubular injury score ( mean standard error of the mean [ sem ] ) were computed from the individual means of all of the rats in the group . multiple comparisons of parametric data were performed using one - way analysis of variance , followed by student newman student 's t - test was used to compare differences between means;a p < 0.05 indicated statistically significant difference . escs could be automatically loaded into gms by simply pipetting the cells onto the surface of the collected gms . uniform cell distribution , good cell attachment , and viability were achieved from day 1 to 7 in vitro [ figure 2a2c ] . images of gelatin microcryogels autoloaded with embryonic stem cells . ( a ) embryonic stem cells persisted in gelatin microcryogels after 24 h. ( b ) embryonic stem cells persisted in gelatin microcryogels after 7 d. red fluorescent protein - labelled embryonic stem cells ( red ) and gelatin microcryogels ( green ) were detected in vitro using two - photon fluorescence confocal microscopy ( original magnification , 200 ) . except for the sham and npx groups , we observed fusion between the omentum and the two poles of the remnant left kidney [ figure 3a3c ] . compared with the npx rats , the npx + om + gms + escs rats showed plasma creatinine levels that were 40% ( 74.01 1.56 versus 122.98 23.30 ) lower at week 4 and 33% ( 83.86 8.61 versus 125.12 13.47 ) lower at week 12 [ figure 4a ] . in addition , plasma urea nitrogen levels in the npx + om + gms + escs rats were 20% ( 12.34 3.16 versus 15.46 5.08 ) lower than in the npx group at week 4 and 26% ( 15.25 2.09 versus 20.66 6.35 ) lower at week 12 [ figure 4b ] . plasma serum creatinine or urea nitrogen levels were not significantly different in the npx , npx + om and npx + om + escs groups . there was also no difference in average body weight , urine output , and urine proteinuria among other groups , except for the sham group . ( b ) omental attachment at the upper pole and lower pole of the remnant kidney 2 weeks after 5/6 nephrectomy . ( c ) the omentum remains tightly attached to the remnant kidney for up to 12 weeks . ( a ) plasma creatinine levels are significantly lower in the nephrectomy+om+gelatin microcryogels+embryonic stem cells rats ( by 3040% ) at weeks 4 and 12 after inducing chronic kidney disease than in the nephrectomy rats . ( b ) plasma urea nitrogen levels similarly are significantly lower in the nephrectomy+om+gelatin microcryogels+embryonic stem cells rats ( by 2026% ) at weeks 4 and 12 after inducing chronic kidney disease than in the nephrectomy rats . data are expressed as the mean standard error of the mean . * p < 0.05 compared with nephrectomy at the respective time points . npx : nephrectomy ; om : omentum ; escs : embryonic stem cells ; gms : gelatin microcryogels . histologically , the injured edges of the npx + om + gms + escs kidneys were demarcated by the omental tissue [ pas staining in figure 5b and trichrome staining in figure 6b ] . compared with the npx kidneys that showed greater scarring of the glomeruli and tubules at the injured edges [ figures 5a and 6a ] , the npx + om + gms + escs kidneys appeared to be better preserved [ figures 5b and 6b ] . injured edge of the kidney by periodic acid - schiff staining 2 weeks after subtotal nephrectomy . ( a ) nephrectomy kidneys show scarring of the tubules ( red arrows ) , as well as the glomeruli ( black arrows ) , at the injured edge . ( b ) in the nephrectomy+om+gelatin microcryogels+embryonic stem cells kidneys , the injured edge , including the glomeruli and tubules , appears to be better preserved than the nephrectomy kidneys . ( original magnification , 100 ) . injured edge of the kidney by trichrome staining to highlight fibrosis 2 weeks after subtotal nephrectomy . ( a ) nephrectomy kidneys show extensive scarring ( black color ) at the injured edge . ( b ) by contrast , the nephrectomy+om+gelatin microcryogels+embryonic stem cells kidneys showed much less scarring at the injured edge . a gradient of glomerular as well as tubular injury was observed in the npx + om + gms + escs kidneys . in the npx + om + gms + escs group , the glomerulosclerosis index was 62% ( 1.29 0.08 versus 3.42 0.15 ) lower in the section than in the npx group [ figure 7 ] . 0.07 versus 1.15 0.10 ) lower in the npx + om + gms + escs kidneys ; there were no significant changes between the npx , npx + om and npx + om + escs groups [ figure 8 ] . kidney histology showing different grades of glomerular damage observed at week 12 after inducing chronic kidney disease in rats ( periodic acid - schiff staining ) . ( a ) glomerulus with a score of 1+showing mesangial expansion and slight glomerular damage involving < 25% area of the glomerulus . ( b ) glomerulus with a score of 2+showing mild sclerosis involving 2550% area of the glomerulus . ( c ) glomerulus with a score of 3+showing moderate sclerosis involving 5075% area of the glomerulus . ( d ) glomerulus with a score of 4+showing severe sclerosis involving > 75% area of the glomerulus . ( e ) glomerulosclerosis index at week 12 in the different groups of the remnant kidney . data are expressed as the mean standard error of the mean . * p < 0.05 compared with nephrectomy . npx : nephrectomy ; om : omentum ; escs : embryonic stem cells ; gms : gelatin microcryogels . kidney histology showing different grades of tubular injury at week 12 after inducing chronic kidney disease in rats ( trichrome staining ) . ( a ) representative tubulointerstitial area showing a histology score of 1 + ( area of interstitial expansion , fibrosis , and tubular dilation involving < 25% area of the total field ) . representative tubulointerstitial area showing a histology score of 2 + ( lesion area between 25% and 50% of the total field ) . ( c ) representative tubulointerstitial area showing a histology score of 3 + ( lesions involving 5075% of the total field ) . ( d ) tubular injury index at week 12 in each group except the sham group . compared with nephrectomy , nephrectomy+om+gelatin microcryogels+embryonic stem cells rats showed 40% less tubulointerstitial injury . npx : nephrectomy ; om : omentum ; escs : embryonic stem cells ; gms : gelatin microcryogels . escs could be automatically loaded into gms by simply pipetting the cells onto the surface of the collected gms . uniform cell distribution , good cell attachment , and viability were achieved from day 1 to 7 in vitro [ figure 2a2c ] . images of gelatin microcryogels autoloaded with embryonic stem cells . ( a ) embryonic stem cells persisted in gelatin microcryogels after 24 h. ( b ) embryonic stem cells persisted in gelatin microcryogels after 7 d. red fluorescent protein - labelled embryonic stem cells ( red ) and gelatin microcryogels ( green ) were detected in vitro using two - photon fluorescence confocal microscopy ( original magnification , 200 ) . except for the sham and npx groups , we observed fusion between the omentum and the two poles of the remnant left kidney [ figure 3a3c ] . compared with the npx rats , the npx + om + gms + escs rats showed plasma creatinine levels that were 40% ( 74.01 1.56 versus 122.98 23.30 ) lower at week 4 and 33% ( 83.86 8.61 versus 125.12 13.47 ) lower at week 12 [ figure 4a ] . in addition , plasma urea nitrogen levels in the npx + om + gms + escs rats were 20% ( 12.34 3.16 versus 15.46 5.08 ) lower than in the npx group at week 4 and 26% ( 15.25 2.09 versus 20.66 6.35 ) lower at week 12 [ figure 4b ] . plasma serum creatinine or urea nitrogen levels were not significantly different in the npx , npx + om and npx + om + escs groups . there was also no difference in average body weight , urine output , and urine proteinuria among other groups , except for the sham group . ( b ) omental attachment at the upper pole and lower pole of the remnant kidney 2 weeks after 5/6 nephrectomy . ( c ) the omentum remains tightly attached to the remnant kidney for up to 12 weeks . ( a ) plasma creatinine levels are significantly lower in the nephrectomy+om+gelatin microcryogels+embryonic stem cells rats ( by 3040% ) at weeks 4 and 12 after inducing chronic kidney disease than in the nephrectomy rats . ( b ) plasma urea nitrogen levels similarly are significantly lower in the nephrectomy+om+gelatin microcryogels+embryonic stem cells rats ( by 2026% ) at weeks 4 and 12 after inducing chronic kidney disease than in the nephrectomy rats . data are expressed as the mean standard error of the mean . * p < 0.05 compared with nephrectomy at the respective time points . npx : nephrectomy ; om : omentum ; escs : embryonic stem cells ; gms : gelatin microcryogels . histologically , the injured edges of the npx + om + gms + escs kidneys were demarcated by the omental tissue [ pas staining in figure 5b and trichrome staining in figure 6b ] . compared with the npx kidneys that showed greater scarring of the glomeruli and tubules at the injured edges [ figures 5a and 6a ] , the npx + om + gms + escs kidneys appeared to be better preserved [ figures 5b and 6b ] . injured edge of the kidney by periodic acid - schiff staining 2 weeks after subtotal nephrectomy . ( a ) nephrectomy kidneys show scarring of the tubules ( red arrows ) , as well as the glomeruli ( black arrows ) , at the injured edge . ( b ) in the nephrectomy+om+gelatin microcryogels+embryonic stem cells kidneys , the injured edge , including the glomeruli and tubules , appears to be better preserved than the nephrectomy kidneys . ( original magnification , 100 ) . injured edge of the kidney by trichrome staining to highlight fibrosis 2 weeks after subtotal nephrectomy . ( a ) nephrectomy kidneys show extensive scarring ( black color ) at the injured edge . ( b ) by contrast , the nephrectomy+om+gelatin microcryogels+embryonic stem cells kidneys showed much less scarring at the injured edge . a gradient of glomerular as well as tubular injury was observed in the npx + om + gms + escs kidneys . in the npx + om + gms + escs group , the glomerulosclerosis index was 62% ( 1.29 0.08 versus 3.42 0.15 ) lower in the section than in the npx group [ figure 7 ] . similarly , the tubular injury index was 40% ( 0.68 0.07 versus 1.15 0.10 ) lower in the npx + om + gms + escs kidneys ; there were no significant changes between the npx , npx + om and npx + om + escs groups [ figure 8 ] . kidney histology showing different grades of glomerular damage observed at week 12 after inducing chronic kidney disease in rats ( periodic acid - schiff staining ) . ( a ) glomerulus with a score of 1+showing mesangial expansion and slight glomerular damage involving < 25% area of the glomerulus . ( b ) glomerulus with a score of 2+showing mild sclerosis involving 2550% area of the glomerulus . ( c ) glomerulus with a score of 3+showing moderate sclerosis involving 5075% area of the glomerulus . ( d ) glomerulus with a score of 4+showing severe sclerosis involving > 75% area of the glomerulus . ( e ) glomerulosclerosis index at week 12 in the different groups of the remnant kidney . compared with nephrectomy data are expressed as the mean standard error of the mean . * p < 0.05 compared with nephrectomy . npx : nephrectomy ; om : omentum ; escs : embryonic stem cells ; gms : gelatin microcryogels . kidney histology showing different grades of tubular injury at week 12 after inducing chronic kidney disease in rats ( trichrome staining ) . ( a ) representative tubulointerstitial area showing a histology score of 1 + ( area of interstitial expansion , fibrosis , and tubular dilation involving < 25% area of the total field ) . ( b ) representative tubulointerstitial area showing a histology score of 2 + ( lesion area between 25% and 50% of the total field ) . ( c ) representative tubulointerstitial area showing a histology score of 3 + ( lesions involving 5075% of the total field ) . ( d ) tubular injury index at week 12 in each group except the sham group . compared with nephrectomy , nephrectomy+om+gelatin microcryogels+embryonic stem cells rats showed 40% less tubulointerstitial injury . npx : nephrectomy ; om : omentum ; escs : embryonic stem cells ; gms : gelatin microcryogels . although adult stem cells have shown promise in treating aki , whether they can alleviate ckd has not been fully explored . one technical problem encountered in the experimental investigation of this issue is the fact that adult stem cells do not survive in the body for more than a few days after injection . therefore , stem cells will have to be injected every few days for several weeks to see an observable effect . gms provide an optimal cell delivery and therapy platform that equips the cells for better therapeutic functions in vitro . the primed gms constitute biomimetic 3d niches to accumulate ecms , which can increase esc viability , proliferation , and differentiation . in addition , the accumulated ecms through cell priming within the in vitro microniches may increase the paracrine secretions of bioactive factors from the escs , which promote angiogenesis at the lesion sites . after cells are delivered to the lesion site , another challenge is preventing the leakage of dispersed cells into surrounding tissues and maintaining cell viability and function . the greater omentum is mainly composed of loose connective tissue which has an abundant blood supply and lymph circulation . many collagen oblasts and capillaries can easily form ample collateral circulations and macrophages to eliminate inflammation and foreign substances , which allows a pedicled greater omentum flap to easily adhere to other tissues and may offer additional blood supply . in fact , the greater omentum is a natural patch that is widely used in many types of operations , such as plugging a lacerated wound in the liver , covering the wound surface after liver resection , and wrapping the stoma in a pancreaticojejunostomy . the pedicled greater omentum flap can transpose well - vascularized tissue with angiogenic and immunological properties to tissues without spontaneous healing capacities . we used the pedicled greater omentum flap to wrap the esc - loaded gms on the 5/6 nephrectomized kidney to prevent esc leakage and allow the escs to survive in the body for longer periods of time . we showed that escs could be automatically loaded into gms by simply pipetting the cells onto the surface of the collected gms . escs seeded within gms resultedin tissue - like ensembles with enriched extracellular matrices and enhanced cell - cell interactions . due to technical difficulties , we were unable to assess the survival of escs in vivo . we showed that pedicled omentum flaps packing esc - loaded gms on the 5/6 nephrectomized kidney improved residual renal function in the remnant kidney . after 4 weeks , 5/6 nephrectomized and omentectomized rats developed ckd , as demonstrated by elevated plasma creatinine / urea nitrogen levels . in contrast , the pedicled omentum flaps packing esc - loaded gms on the 5/6 nephrectomized kidney exhibited lower plasma creatinine / urea nitrogen levels . there was also reduced glomerulosclerosis and tubulointerstitial injury than in the specimens subjected to 5/6 npx without gms . in addition , the pedicled great omentum packing esc - loaded gms on the 5/6 nephrectomized kidneys showed fewer myofibroblastsin the interstitial area . garcia - gomez et al . showed that 6 weeks after 5/6 npx , fusing the polydextran gel particle activated omentum to the remnant kidney resulted in higher creatinine clearance and lower plasma creatinine / urea nitrogen levels . our results showed that the pedicled omentum packing esc - loaded gms on the 5/6 nephrectomized kidney exhibited significantly lower plasma creatinine / urea nitrogen levels at 4 weeks , which was an earlier time frame . this was possible because the injured tissue in the fusion zone may be more responsive to the growth factors from esc - loaded gms . to further understand the salutary effect of the pedicled omentum packing esc - loaded gms on the 5/6 nephrectomized kidney , we found that the fusion zone showed minimal fibrosis , good vascularization , and structural preservation of the parenchyma . in contrast , the injured edge of the 5/6 nephrectomized kidneys without gms showed extensive fibrosis and dedifferentiation of tubules . at the same time , the pathological results also showed that not all nephrons could be preserved . from our results regarding the differences in glomerular and tubular injury in the pedicled great omentum packing escs - loaded gms on the 5/6 nephrectomized kidneys , it appears that the pedicled great omentum packing escs may have been instrumental in slowing the progression of ckd , mostly by rescuing the nephrons in the injured kidney . it is possible that this may be due to rapid revascularization and hemostasis of the injured edge kidneys by the omentum . the omentum brings about tissue repair by readily vascularizing the injured organs with which it fuses . chou et al . suggest that rather than replacing the injured epithelial and endothelial cells , the major contribution of bone marrow - derived cells ( bmdcs ) to renal repair occurs through aparacrine mechanism . for example , in ischemic renal injury , bmdcs can initially ameliorate the injury either by directly inhibiting cellapoptosis or preventing inflammatory cell influx . during the repair phase , bmdcs secrete factors that promote tubular epithelial cell dedifferentiation andproliferation . on the basis of these results , we speculated that the recovery function in our model depended not only on the diffusible factors from escs but also on the proximity of the kidney parenchyma to the omentum . escs are pluripotent stem cells that can give rise to all cell lineages of the body under appropriate culture conditions . in particular , labeled escs microinjected into developing metanephros in organ culture were exclusively located in the cortical nephrogenic zone and differentiated into epithelial cells resembling renal tubules and , occasionally , into glomerular tufts . in addition , when injected in vivo into mice , escs integrated into proximal tubules of newborn mice and were detectable for 7 months without teratoma formation . in summary , slowing the progression of ckd by the pedicled great omentum flaps packing esc - loaded gms on the 5/6 nephrectomized kidneys supports the concept that escs have the potential to treat ckd . in addition , the gms - assisted cell therapy system holds great promise for achieving cell location , migration , and differentiation at the lesion site as a widely adopted platform technology . on the basis of our findings , we also believe that the omentum could help preserve the remnant kidney and that gms offer a widely applicable cell delivery platform technology to boost the healing power of cell regenerative therapy . the present study offers a new perspective in stem cell therapy and regenerative medicine in ckd in which escs could play a beneficial therapeutic role . this study was granted by the national high technology research and development program of china ( no . 2014cba02005 ) , chinese national natural sciences foundation ( no . 81470949 and 31170810 ) , the medical technology youth training project of pla ( no . this study was granted by the national high technology research and development program of china ( no . 2014cba02005 ) , chinese national natural sciences foundation ( no . 81470949 and 31170810 ) , the medical technology youth training project of pla ( no .

anemia is a major health problem globally , which can cause a vicious impediment on quality of life , mortality , morbidity , and socioeconomic progress of a country . it affects more the developing than the developed countries.1 anemia is the most common hematologic abnormality among hiv - infected individuals ; this includes those who are taking antiretroviral treatment ( art ) and those who are art - nave.2 anemia among hiv patients can lead to impaired physical functioning , psychological distress , poor quality of life , accelerated disease progression , and shorter life expectancy.3 although anemia can occur at any stage of hiv infection , its severity is correlated with progression of the hiv disease stage.4 a study conducted in the very early years of hiv discovery had shown the overall prevalence of anemia to be about 28% among people with hiv infection in the pre - aids stage of the disease , whereas it could reach as high as 71% in the advanced or aids stage of the hiv disease.5 according to reports , the prevalence of anemia among adult hiv patients taking art ranges between 23% and 50% globally and 24% and 58% in africa.69 generally , the prevalence of anemia tends to be higher in art - nave patients compared to art users . in ethiopia , the prevalence of anemia among art - nave adult hiv patients was reported to reach up to 35%.10 a study done 3 years ago in the southwest part of ethiopia has shown the prevalence of anemia to be 29.9% and 16.2% among art - nave and art - experienced hiv patients , respectively.11 another study conducted 3 years ago in southern ethiopia has shown the prevalence of anemia among art - nave adult hiv patients to be 23.4% , and the prevalence after 6-month course of art was only 12%.12 various reports have identified different factors to have association with anemia among adult hiv patients including gender , residence , marital status , educational status , income , duration of art , type of art regimen , history of anti - tuberculosis ( tb ) drug treatment , presence of opportunistic infections ( ois ) , advanced stage of the hiv disease , cd4+t - lymphocyte count < 200 cells/l , white blood cell ( wbc ) count < 4,000 cells/l , and platelets count < 200,000 cells/l.7,1119 however , the reported magnitudes and associated factors are different from one geographic area to another and have shown different time trends as the interplay between the various socioeconomic , health , and nutritional conditions alter in sub - saharan country setting . therefore , this study was aimed at assessing the prevalence of anemia and its associated factors among adult hiv patients who were getting follow - up hiv care at debre - tabor hospital , northwest ethiopia . hospital - based quantitative cross - sectional study was conducted from april 1 to may 30 , 2015 , at debre - tabor hospital located in northwest ethiopia . the hospital is found in amhara regional state in the town called debre - tabor , which is 665 km northwest of the capital city addis ababa . the hospital has a catchment population of nearly 2.3 million people and is one of the hiv - care providing centers in the region . it has an average daily patient flow of 2030 adult hiv patients in the working hours of the hiv - care clinic of the hospital excluding emergency presentations on duty hours . the sample size was calculated based on single population proportion formula using a confidence interval ( ci ) of 95% and previous prevalence of anemia being 35% among art - nave hiv patients,10 n=(za2)2p(1p)d2 where , n = sample size , p = prevalence of anemia among art - nave hiv patients and d = assumed marginal error . finally , a minimum sample size of 385 was calculated after anticipating a 10% non - response rate . simple random sampling technique was used to recruit 385 patients charts from a total of 689 . the study populations were all adult hiv patients above the age of 18 years who were on hiv follow - up care at debre - tabor hospital during january 1 , 2010 to december 30 , 2014 , regardless of their art status . those adult patients with incomplete information for hemoglobin ( hb ) status on the chart , either at baseline or during follow - up ; pregnant women ; and women in the post - partum period the questionnaires were constructed with sociodemographic and economic characteristics ; hematological characteristics ; and disease stage , medication treatment , and co - morbidity status - related characteristics . a total of four health professionals , three art nurses as data collectors , and one public health officer as supervisor were recruited for the data collection process of this study . the 2011 world health organization ( who ) report on hb concentration level to diagnose anemia was used in the hospital.20 accordingly , anemia for males was defined as hb concentration < 13 g / dl ( 11.012.9 g / dl = mild ; 8.010.9 g / dl moderate , and < 8.0 g / dl = severe ) , whereas anemia for females was defined as hb < 12.0 ( 11.011.9 g / dl = mild , 8.010.9 g / dl = moderate , and < 8.0 g / dl = severe ) . the data collection tool was pre - tested without hb status determination on 5% of sample size charts of hiv / aids patients before the actual data collection period . all questionnaires were checked during the data collection period by the responsible supervisor on daily basis to check completeness , clarity , and consistency . before analysis , the data were cleaned thoroughly to check for errors during entry . data were entered into epidemiological information ( epi info ) , version 7.1 and analyzed using the statistical package for social sciences ( spss ) version 20 . descriptive statistics , including frequencies and proportions , was used to summarize the study variables . univariable and multivariable logistic regression was used for factors associated with hb status of the study subjects . those variables with a p - value of < 0.2 in the univariable analysis were exported to multivariable analysis to control the possible effect of confounders . the adjusted odds ratio ( aor ) at a 95% confidence interval and p - value of 0.05 was used to declare the statistical significance in the multivariable analysis . ethical clearance was obtained from the institutional review board of the institute of public health of university of gondar . permission letter for the next steps was secured from the debre - tabor hospital administrative body . written informed consent was obtained from participants , and the confidentiality of information obtained was maintained by coding and restricting access to the questionnaire . hospital - based quantitative cross - sectional study was conducted from april 1 to may 30 , 2015 , at debre - tabor hospital located in northwest ethiopia . the hospital is found in amhara regional state in the town called debre - tabor , which is 665 km northwest of the capital city addis ababa . the hospital has a catchment population of nearly 2.3 million people and is one of the hiv - care providing centers in the region . it has an average daily patient flow of 2030 adult hiv patients in the working hours of the hiv - care clinic of the hospital excluding emergency presentations on duty hours . the sample size was calculated based on single population proportion formula using a confidence interval ( ci ) of 95% and previous prevalence of anemia being 35% among art - nave hiv patients,10 n=(za2)2p(1p)d2 where , n = sample size , p = prevalence of anemia among art - nave hiv patients and d = assumed marginal error . finally , a minimum sample size of 385 was calculated after anticipating a 10% non - response rate . simple random sampling technique was used to recruit 385 patients charts from a total of 689 . the study populations were all adult hiv patients above the age of 18 years who were on hiv follow - up care at debre - tabor hospital during january 1 , 2010 to december 30 , 2014 , regardless of their art status . those adult patients with incomplete information for hemoglobin ( hb ) status on the chart , either at baseline or during follow - up ; pregnant women ; and women in the post - partum period the questionnaires were constructed with sociodemographic and economic characteristics ; hematological characteristics ; and disease stage , medication treatment , and co - morbidity status - related characteristics . a total of four health professionals , three art nurses as data collectors , and one public health officer as supervisor were recruited for the data collection process of this study . the 2011 world health organization ( who ) report on hb concentration level to diagnose anemia was used in the hospital.20 accordingly , anemia for males was defined as hb concentration < 13 g / dl ( 11.012.9 g / dl = mild ; 8.010.9 g / dl moderate , and < 8.0 g / dl = severe ) , whereas anemia for females was defined as hb < 12.0 ( 11.011.9 g / dl = mild , 8.010.9 g / dl = moderate , and < 8.0 g / dl = severe ) . the data collection tool was pre - tested without hb status determination on 5% of sample size charts of hiv / aids patients before the actual data collection period . all questionnaires were checked during the data collection period by the responsible supervisor on daily basis to check completeness , clarity , and consistency . before analysis , the data were cleaned thoroughly to check for errors during entry . data were entered into epidemiological information ( epi info ) , version 7.1 and analyzed using the statistical package for social sciences ( spss ) version 20 . descriptive statistics , including frequencies and proportions , was used to summarize the study variables . univariable and multivariable logistic regression was used for factors associated with hb status of the study subjects . those variables with a p - value of < 0.2 in the univariable analysis were exported to multivariable analysis to control the possible effect of confounders . the adjusted odds ratio ( aor ) at a 95% confidence interval and p - value of 0.05 was used to declare the statistical significance in the multivariable analysis . ethical clearance was obtained from the institutional review board of the institute of public health of university of gondar . permission letter for the next steps was secured from the debre - tabor hospital administrative body . written informed consent was obtained from participants , and the confidentiality of information obtained was maintained by coding and restricting access to the questionnaire . we did not include the planned sample of 385 patients charts due to incomplete documentations identified in some charts . therefore , a total of 377 patients chart were reviewed in this study out of which 237 ( 62.9% ) were from patients taking art and 140 ( 37.1% ) were art - nave . more than 60% of the study participants were female , and the mean age of the study subjects was 35.21 with a standard deviation ( sd ) of 9.27 years . three hundred and seventy - five ( 99.5% ) of the participants were amhara by ethnicity and 367 ( 97.3% ) were orthodox christian by religion . a total of 291 participants ( 77.2% ) were urban residents and 191 ( 50.5% ) were married ( table 1 ) . eighty - seven participants ( 23% ) were found to have anemia out of whom 61 were among the 112 art - nave patients making the prevalence of anemia in this group 54.5% . one hundred twenty - six ( 33.4% ) participants had a cd4 + t - lymphocyte count < 200 cells/l . seventy - six ( 20.2% ) study participants had a platelet count of < 200,000 cells/l . nearly three fourths of patients taking art were found to have a normal nutritional status ( table 2 ) . hundred and ninety - one ( 50.7% ) of the participants have had ois , and < 7% of the participants were found to be at the fourth stage of who s clinical disease classification . one hundred and twelve ( 29.7% ) of the study participants were taking zidovudine ( zdv ) containing art regimen . more than 90% of the study participants had no history of anti - tb treatment ( table 3 ) . in the bivariate logistic regression analysis , educational status , types of art regimen , history of treatment with anti - tb drugs , duration of art usage , history of oi , who ; zdv , zidovudine . stage of hiv disease , cd4 + t - lymphocyte count , wbc count and platelets count were significantly associated with anemia . in the multivariate binary logistic regression analysis , type of art regimen , art - usage status , history of treatment with anti - tb drugs , and cd4 + t - lymphocyte count remained to be significantly associated with anemia ( table 3 ) . being art - nave was found to be associated with anemia ( aor : 3.37 ; 95% ci : 1.59 , 7.14 ) . having treatment history with anti - tb drug was also found to be associated with anemia ( aor : 3.2 ; 95% ci : 1.19 , 8.67 ) . taking zdv - containing regimen was found to be associated with anemia ( aor : 2.1 ; 95% ci : 1.03 , 4.57 ) . having a recent cd4 + t - lymphocyte count of < 200 cells/l was also found to be associated with anemia ( aor : 2.1 ; 95% ci : 1.04 , 4.36 ) . our study has demonstrated a high overall prevalence ( 23% ) of anemia among hiv patients who are art - nave and taking art . this finding is concordant with a study done 3 years ago in the southwest ethiopia ( 23.1%);13 similar findings were reported from studies in india ( 23%)6 and ghana ( 24%).8 the prevalence was lower compared to the a study done 3 years ago from northwest ethiopia ( 35% ) ; however , that study included only art - nave hiv patients.10 another study also done 3 years ago in southern ethiopia reported the prevalence of anemia to be 23.4% among art - nave adult hiv patients and only 12% after 6-month course of art.12 studies in indonesia7 ( 49.6% ) , nigeria9 ( 57.5% ) , and uganda18 ( 47.8% ) have reported a much higher prevalence of anemia compared to our study . however , in addition to the sociodemographic differences , those reports reflected the prevalence of anemia among art - nave patients . in our study where two thirds of the participants were taking art , it is expected to get lower prevalence . various studies have pointed out multiple potential factors associated with anemia among hiv patients.7,1119 being art - nave was found to be associated with anemia in our study . this finding is in agreement with the reports from southern ethiopia,12,13 ghana,8 and south africa.11 this can be explained by the various direct and indirect effects of the effective art . one plausible explanation is the fact that art can suppress hiv , a virus which is known to directly affect the bone marrow ; therefore , by suppressing the viral load art could prevent anemia . the other explanation could be related to the indirect effect of art , which is expected to improve the immunity of hiv patients thereby decreasing the occurrence of multiple ois , which are identified to potentially cause anemia . type of art regimen , zdv - containing regimen , was also found to be associated with anemia among hiv patients in this study . this finding is in concordance with reports from addis ababa,15 cambodia,19 and iran.16 zidovudine ( zdv ) has long been identified to be a potential cause of anemia in hiv patients especially early in the art initiation and with low baseline hb.19 additionally , a history of treatment with anti - tb drugs was significantly associated with anemia in our study . a similar finding was reported from the study done in iraq.16 since tb is known to cause anemia through various mechanisms including anemia of chronic illness , bone marrow involvement , malnutrition and hemoptysis , the presence of tb treatment history could partly suggest susceptibility of those hiv patients for anemia from the tb . moreover , the anti - tb drugs such as isoniazid are identified to cause anemia . the cd4 + t - lymphocyte count , < 200 cells/l , was found to be associated with anemia . the possible explanation for this association includes the fact that hiv patients with low cd4 + t - lymphocyte count are known to be at risk of multiple ois , which are known to cause anemia , and the fact that such patients are also likely to have high hiv viral load which could lead to viral infiltration of the bone marrow subsequently causing anemia . since the causes and types of anemia in hiv patients are multi - factorial , we recognize the inability of this study to identify the specific types and specific causes of anemia as a limitation . anemia continues to be a major co - morbidity among adult hiv patients in ethiopia . adult hiv patients who are taking zdv - containing art , with a history of tb treatment , have low cd4+t - lymphocytes count and art - nave should be carefully screened and treated for anemia . we recommend further longitudinal studies to determine predictors of anemia in the setting and intervention programs to change the existing situation .

the poor survival statistics of epithelial ovarian cancer ( eoc ) are mentioned by way of introduction in almost all review literature pertaining to the disease . unfortunately , in the past forty years there have been only small improvements in overall ovarian cancer survival rates . specific challenges to the treatment of eoc include the problems of late detection , metastasis within the peritoneal cavity , drug resistance , and cancer recurrence even after initial response to treatment . up to 90% of eocs do not have an identified genetic component , and the development of specific and sensitive screening tools has proven elusive . a metabolic approach to the targeted treatment of eoc has the potential to address many of the issues that make this the most deadly gynecologic cancer . in recent years , it has been noticed that the influence of lifestyle , in particular the high - fat western diet , is associated with the multisite development of cancers . the state of chronic positive energy balance is linked to a cluster of conditions including impaired glucose regulation and insulin resistance , collectively called the metabolic syndrome . hyperglycemia is a distinguishing feature of over - nutrition and it is believed to be an independent risk factor for cancer development . to provide an idea of the clinical importance of hyperglycemia , it is estimated that the incidence of type two diabetes mellitus ( t2 dm ) , a common consequence of the syndrome , will double in many regions in the next fifteen years . however , the burden of t2 dm , where as many as one third of individuals are undiagnosed , almost certainly underestimates the true incidence of abnormal glucose homeostasis in the population . given the emerging association between hyperglycemia and cancer , it is conceivable that there will be an increase in the incidence of eoc in the near future . we hypothesize that hyperglycemia provides a nutrient - rich , growth signal - rich environment for epithelial ovarian cancer cells , where tumour formation and growth is encouraged by free radical - induced dna damage . we address possible cellular mechanisms by which a hyperglycemic environment may increase the rate of development of ovarian tumours , and discuss the implications for metabolically targeted eoc treatments . while significant associations have been reported between elevated glucose [ 4 , 5 ] , glycemic load , t2 dm [ 2 , 7 ] , and a number of cancers , there is little information to support the influence of preexisting hyperglycemia on eoc . however , much of the literature relating cancer and glucose abnormalities comes from clinical or epidemiological studies that were not originally designed to evaluate the effects of hyperglycemia on cancer development . this is a particular limitation when looking at eoc because of its relatively low population incidence . in addition , many of the studies used diabetic status or a single glucose measurement as a proxy for classifying glucose abnormalities , likely underestimating the true hyperglycemic population . the changing profile of insulin status over the course of t2 dm probably further obscured any associations and there was poor consideration of confounding variables such as insulin , obesity , medication , and time since diagnosis . the design of these population studies presumed that hyperglycemia was a direct and sufficient cause of ovarian cancer , when it may in fact be more important in the growth promotion of previously transformed cells . in this way , end - point analyses such as case - control or retrospective cohort studies a more useful consideration may be that of time to tumour development in patients with hyperglycemia . for example , in women already diagnosed with ovarian cancer , high glucose appears to be a poor prognostic factor . a further complication of these studies is that both hyperglycemia and eoc are notoriously quiet diseases in their early stages . this makes it very difficult from a population health standpoint to infer an association , or suggest causality , as the underlying pathologies of both diseases begin and may interact well before diagnosis . although population - based studies have not been supportive for a role of preexisting hyperglycemia in the development of ovarian cancer , recent basic science still suggests that eoc may be subject to the influence of high blood sugar . the rate of glucose uptake , which increases with increasing extracellular glucose , has been linked with tumour aggressiveness . eoc cells are also sensitive to complete glucose deprivation than nontransformed ovarian epithelial cells ; thus , they may also be very responsive to hyperglycemia . the impact of hyperinsulinemia on cancer has received much more research attention than the impact of hyperglycemia , although the two conditions are very closely related . insulin is mitogenic via its signaling through the insulin receptor and the insulin - like growth factor ( igf ) pathways and direct anabolic signaling which is mediated by changes in the insulin receptor ( ir ) population . expression of the ir is elevated in eoc , suggesting a tumour - promoting role in this cancer . however , we contend that the specific impact of hyperglycemia on eoc is also an important area of research as abnormalities in glucose metabolism typically underlie hyperinsulinemia . thus , although insulin has direct , isolated actions on tumour growth , changes in glucose metabolism predispose changes in insulin signaling . in addition , it is becoming clear that there are insulin - independent mechanisms of glucose action on cancer risk , particularly through energy - sensing pathways and glucotoxic damage . almost 80 years ago , dr . warburg observed that , compared to normal cells , cancer cells show a preference for glycolysis and lactate production over oxidative phosphorylation . because glycolysis is 18 times less efficient at producing atp , this glycolytic switch suggests that cancer cells have an inherently high need for glucose . furthermore , tumours are very active metabolically and require copious amounts of cellular fuel to meet growth demands . aerobic glycolysis has been successfully exploited in eoc diagnostics in which tumour visualization occurs through the detection of the differential uptake of glucose in cancer cells compared to normal cells . the use of fdg - pet ( 18-fluoro-2-deoxyglucose positron emission tomography ) demonstrates the association between tumour growth and energy availability . warburg 's initial observation was bolstered by evidence that tumours could induce host hypoglycemia in a tumour mass - dependent fashion [ 18 , 19 ] . in many tumour - bearing animals , there appeared to be host compensation for hypoglycemia at the level of the liver , with increased gluconeogenesis and glycogen mobilization . local hypoglycemia in the area around the tumour was particularly pronounced [ 18 , 20 ] . it was found that while tumours had the capacity to take up larger volumes of glucose in mildly hyperglycemic environments they were poor at compensating for low blood glucose by increasing glucose uptake [ 18 , 20 ] . an important role for the vasculature was identified in hyperglycemic conditions , as tumours were able to increase glucose uptake by increasing glucose transfer across the capillary walls . following these metabolic observations , a number of groups looked at the growth characteristics of tumours in hyperglycemic environments . it was reported widely that profound hypoinsulinemia usually caused by chemical destruction of pancreatic -cells consistently caused a decrease in tumour growth [ 19 , 21 , 22 ] . however , in diabetic animals , combined treatment of both antitumour and antihyperglycemia therapies gave the best tumour - reductive outcome . although they demonstrated a negative effect of hyperglycemia on tumour development , these early studies have a number of limitations . the alloxan used to induce diabetes was toxic and administered systemically , and so may have had effects outside the target endocrine cells within the pancreas . also , the studies that showed a decrease in tumour mass in the diabetic animals did not report the changes with respect to total animal mass , which is generally smaller in the diabetic animals . the studies also seem to make the assumption that all glucose taken up is immediately metabolized . however , it was noted independently by several groups that glucose uptake was too high to be fully explained by the amount of tumour growth [ 20 , 23 ] . these results suggest the possibility that cancer cells may be able to store fuel in times of high abundance . nigam et al . concluded that low glycogen was due to defective glycogen synthesis and reported low activities of key glyconeogenic enzymes phosphoglucomutase and glycogen synthetase as compared to normal tissues . the low tumour glycogen was also linked to abnormally high rates of glycogen breakdown by phosphorylase . a recent article looking at glycogen levels in human colorectal cancer , however , reported that tumour cells actually had higher glycogen content than normal tissue . the authors noted that there was less glycogen in poorly differentiated tumours compared to well - differentiated tumours , suggesting that low glycogen may be an indicator of a poor prognosis . they also found a very clear negative correlation between glycogen level and proliferation index . it seems likely that , given the high rate of fuel usage in a tumour , at normoglycemic levels , there would be little need for storage as most would be used immediately . this brings up an intriguing question : could hyperfueled conditions favour a storage phenotype in cancer cells ? this might explain the low growth rates of tumours in type one diabetic conditions . glycogen synthase kinase 3 ( gsk3 ) phosphorylates and inactivates glycogen synthase , preventing the formation of glycogen . high levels of gsk3 have been implicated in the progression of a number of cancers , including ovarian cancer . gsk3 affects tumour growth through many different mechanisms , including nf-b and wnt signaling activation . although it was not discussed in the literature reviewed here , gsk overexpression may be linked with glycogen storage and proliferation index . in summary , despite a number of investigations , carbohydrate metabolism by tumours we consider the possible effects of glucose on eoc development to be either permissive or contributing . permissive effects are those that alter the energy status of cells , allowing tumour cells greater access to fuel . contributing effects are those that directly damage protein or dna in some cancer - promoting way . persistent elevations in blood sugar occur once hypersecretion of insulin is no longer able to compensate for combined insulin resistance and high glucose levels . the failure of insulin to facilitate glucose entry into cells is evaluated on a continuum , meaning that patients may have significant pathological changes while being in a in fact , by time of diagnosis of t2 dm , hyperglycemia has already caused vascular complications in at least 20% of patients [ 3 , 27 ] . however , poor glycemic control is not solely due to impaired insulin signaling , as glucose has the ability to regulate its own clearance by mass action . glucose self - regulation is impaired in people with hyperglycemia , leading to a state of glucose resistance . chronic hyperglycemia downregulates enzymes responsible for glucose metabolism , including those of the energy - sensing amp - activated protein kinase ( ampk ) pathway . this results in fewer glucose transporters translocating to the cell surface , further impeding the cell 's ability to take up fuel . thus , the effects of glucose join insulin resistance in maintaining and exacerbating hyperglycemia . it is postulated that where there is energy available tumour cells will have a suitable soil to grow . the biological plausibility of this excess energy hypothesis has been supported by a number of in vitro studies : yamamoto et al . found that increasing glucose concentration in the culture media of mcf-7 breast cancer cells increased proliferation , mediated by an upregulation of cdk2 and cyclin d1 . in a line of choriocarcinoma cells , sustained hyperglycemia was found to stimulate the cell 's glucose transport system , increasing glucose uptake rates . in contrast , most nontransformed cells downregulate glucose transport in the presence of hyperglycemia . studies in human breast cancer xenografts also suggest that the amount of glucose metabolism is not determined by metabolic demand , but rather by substrate availability . together , these findings support the idea that the fuel availability in hyperglycemia may be permissive for cancer growth . in hyperglycemia - induced insulin resistance , the correlation between cancer risk and t2 dm suggests that where normal cells fail metabolically cancer cells excel . it is possible that in hyperglycemia cancer cells are inherently better at responding to the effects of insulin compared to insulin - resistant normal cells . in their 2004 paper , gatenby and gillies argue that mutations affecting substrate use can not be early events in carcinogenesis because they would offer no advantage when there are no constraints on fuel availability , which typically arise in a larger tumour mass . while this is true in a normal cellular environment , in hyperglycemia better access to the abundance of extracellular glucose , therefore , confers a selective growth advantage and could be an early marker of tumourigenic potential . if conditions such as dysglycemia and diabetes prove to be involved in eoc initiation as well as promotion , then we propose that the selective pressures of the energy status may be an early event in the formation of eoc tumours . cells that are best able to survive high glycemic conditions necessarily have a key characteristic of cancer cells , essentially obtaining self - sufficiency in growth signals . thus , cancers that arise in a hyperglycemic environment may represent an unregulated adaptive survival response . although there is currently no directly supportive data for this hypothesis , possible mechanisms for this relationship are described in the following sections . the consequences of chronic exposure to high glucose tend to be detrimental to cellular function and affect the physiology of the normal ovary . in fact , most long - term diabetic complications ( retinopathy , neuropathy , and nephropathy ) are consequences of hyperglycemia and can not be reversed despite glucose normalization . however , this damage might also provide a mutational advantage to some cells by altering cellular proteins or dna . cancer development is often thought of in terms of a series of hits . the conditions of the tumour microenvironment , many of them determined by an altered metabolic profile , have been shown to contribute to the genetic instability of cancer cells , providing the necessary hits for a more aggressive tumour . acidity , hypoxia , and formation of reactive oxygen species may all be enhanced in tumours in a hyperglycemic environment . in tumour cells , high glucose flux through the glycolytic pathway produces large quantities of lactate , resulting in tumour tissue with ph 0.5 units lower than normal tissue . cancerous cells adapt to this acidification , exhibiting maximal growth at the relatively low ph of about 6.8 . tumours also have a capacity , similar to working skeletal muscle , to share lactate between hypoxic and nonhypoxic cells , so it is not extruded as a waste product . despite these survival adaptations , tumour acidity has been shown to impair dna repair mechanisms and to upregulate angiogenic molecules such as vascular endothelial growth factor ( vegf ) and il-8 in order to enhance lactate clearance [ 43 , 44 ] . experimental evidence demonstrates that the acidic environment is supportive of tumourigenesis , increasing resistance to chemotherapy , mutation rate , and invasion capability . the acid - mediated tumour invasion hypothesis postulates that h ions from the tumour microenvironment diffuse down their concentration gradient into the surrounding normal tissue . because the normal cells can not survive the increase in acidity , the border of malignant tissue is progressively pushed forward . in fact , mathematical modeling has shown that tumour acid production alone can explain patterns of tumour growth . the effects of acidity are particularly important in a hyperglycemic environment because increased glucose flux through tumour cells has been shown to create a large increase in lactate production [ 33 , 49 ] . the characteristic microvascular damage caused by hyperglycemia may lead to periods of hypoxia , possibly through a nitric - oxide - mediated mechanism . the bioavailability of the vasodilator is decreased in diabetes as it is scavenged by superoxide radicals to form the highly reactive onoo molecule . transient hypoxia is thought to be one of the strongest pressures for cells to undergo transformation and is a central hypothesis explaining the glycolytic switch [ 13 , 53 ] . hypoxic conditions also increase the activity of hypoxia - inducible factor ( hif-1 ) and vegf , which are strongly associated with both tumour angiogenesis and eoc tumour aggressiveness [ 54 , 55 ] . levels of oxidative stress reflect the ability to balance production and elimination of highly reactive free radicals , which include the family of reactive oxygen species ( ros ) . oxidative stress is known to be higher in diabetic patients than in healthy individuals , and it is often cited as a unifying theory to explain tissue damage by hyperglycemia . because ros can also create dna damage through a number of mechanisms , it has similarly been proposed that carcinogenesis in general is caused by oxidative stress . this stress in ovarian epithelial cells specifically is thought to be a potential initiator of tumourigenesis . hyperglycemia also causes increased flux of glucose through the aldose - reductase ( polyol ) pathway , which has been postulated to increase sensitivity to oxidative stress by reducing regeneration of the antioxidant glutathione . while epidemiological studies evaluating antioxidant use in diabetes [ 52 , 61 ] and ovarian cancer have not been conclusive , preliminary results suggest that this therapeutic avenue is worth further exploration . a recent study of flavonoids with antioxidant effects found that they inhibited cell growth and vegf expression in ovarian cancer cells . much of the tissue damage and cellular dysfunction associated with hyperglycemia has been attributed to advanced glycation end products ( ages ) created by the nonenzymatic glycation of proteins . while age accumulation is a normal part of aging , it occurs at an accelerated rate in diabetes where progressive modifications can lead to irreversible cross - linking , impairing the actions of other molecules [ 64 , 65 ] . receptors for age ( rage ) mediate many more severe actions and potentiate the cellular response . rages are upregulated by presence of age ligands , and age - rage binding protects the ligands , allowing them to persist in the environment . age - rage interaction has been shown to stimulate tumour cell growth or invasiveness in pancreatic cancer , melanoma , and glioma , while blocking the rage inhibits tumour formation and metastasis [ 68 , 69 ] . the ovarian surface epithelium may be particularly susceptible to the effects of glycation damage because not only the tissue is well vascularized , but it is also in constant contact with peritoneal fluid , whose glucose content is reflective of blood glucose levels . mechanistically , age - rage signaling has been linked to induction of an inflammatory response in the vasculature , as well as an increase in matrix metalloproteinases ( mmps)-2 and -9 , and may , therefore , play a role in determining tumour invasiveness . because age - rage signaling seems to be part of the chronic rather than acute response , its contributions to the development of tumour formation are quite plausible . glucose reactivity in hyperglycemia can also lead to glucose autoxidation , generating hydroxide radicals , and contributing to the burden of oxidative stress . also , apart from rage signaling , glucose moieties on proteins can donate electrons to form hydrogen peroxide , directly activating nf-b [ 73 , 74 ] and contributing to an inflammatory response . there is evidence that changes to local tissue can enhance the possibility of tumour spread , possibly implicating glucose - induced damage to the peritoneal cavity as a permissive factor for ovarian tumour metastasis . glucose is a large , hydrophilic molecule that can not diffuse through the lipid bilayer of cells on its own , and thus requires specific transporter proteins . glucose enters cells by facilitated diffusion mainly through glucose transporters ( gluts ) , and the activation of glut genes is one of the earliest events in oncogenesis . because gluts have a role in glucose sensing and respond to extracellular glucose concentrations , these transporters may be very important in a hyperglycemic environment . glut1 in particular is highly expressed in ovarian cancer , where tumour status ( benign , borderline , or malignant ) is correlated with the level of glut1 expression . almost all invasive epithelial carcinomas are positive for glut1 , independent of stage , grade , or histological subtype [ 79 , 80 ] . antibodies to glut1 decrease proliferation , induce apoptosis in nonsmall cell lung cancer and breast cancer cell lines , and appear to synergize with a number of chemotherapeutics to enhance their apoptotic effects . very recently , another class of transporters , sodium / glucose cotransporters ( sglts ) , was shown to be associated with the epidermal growth factor receptor ( egfr ) in cancer cells . the authors of the study proposed that sglts may enhance tumourigenesis by making cells independent of the glucose concentration gradient , allowing them to take up fuel in any situation . this hypothesis is in line with the proposal made here that permissive effects of glucose are cancer causing : removing restrictions on fuel availability seems to enhance tumourigenesis . the egfr is particularly important in ovarian cancer ; it is normally expressed on ovarian surface epithelium and is often overexpressed in eoc . in both rats and humans , hyperglycemia has been shown to be a major cause of the systemic inflammatory response [ 99 , 100 ] . both oxidative stress and age - rage signaling are also implicated in promoting systemic inflammation in hyperglycemic environments . inflammation is thought to be associated with cancer development mechanistically because of rapid cell division , dna excision and repair , oxidative stress , and high concentrations of cytokines and prostaglandins ; all of which are promoters of mutagenesis . moreover , inflammation has been proposed as a unifying hypothesis for the development of eoc . the high concentrations of circulating growth - promoting and inflammatory cytokines as a result of hyperglycemia may mean that factors , which normally in an autocrine or paracrine fashion are instead coming from the systemic environment and exerting an endocrine effect , potentiate tumour growth . in support of this , animal knockout studies have shown that mmp production by the host may be more important in carcinogenesis than mmp production by tumour cells themselves . cytokines can affect eoc tumour growth by acting as growth factors , increasing angiogenesis , or an immunomodulatory pathway whereby they prevent cellular recognition and destruction of the tumour . a number of cytokines that are increased as part of systemic inflammation in diabetes also have tumour promoting effects in ovarian cancer . il-1 and tnf- are thought to increase production of il-6 , which promotes cell attachment and migration and also blocks apoptosis induced by cytotoxic agents . in addition , although tgf- normally inhibits epithelial cell proliferation , repeated exposure to high levels may attenuate the response of cancerous epithelial cells . the inflammatory hypothesis lends itself to testing with a variety of antiinflammatory drugs and indeed early studies show promise . a study evaluating human ovarian tumours in nude mice concluded that cyclooxygenase inhibitors limited tumour growth , in part through an antiangiogenic mechanism . epidemiologically , patients with chronic aspirin , nsaid , or acetaminophen use have been shown to have a reduced risk of eoc . however , as with antioxidant trials , these observational studies are still preliminary . recently , the inflammation associated with postovulatory follicle repair has received attention as a possible contributor to eoc promotion . the incessant ovulation hypothesis purports that the repeated damage and repair cycles associated with ovulation enhance the possibility for mutagenesis . incessant ovulation also increases the likelihood that inclusion cysts will form , trapping epithelial cells in the hormone - rich environment of the ovarian stroma [ 1 , 111 ] . if these trapped cells are inappropriately maintained , they are more likely to transform [ 111113 ] . wound healing in hyperglycemia is characteristically slow and almost certainly influenced by the effects of inflammation and damage from glycation . lowered nitric oxide bioavailability in combination with the tissue damage caused by hyperglycemia may be partly responsible . in one study age - rage blockade decreased expression of inflammatory cytokines and mmps resulting in normalization of wound closure in a genetic mouse model of diabetes . taken together , the mutagenic risk and the risk of entrapment in inclusion cysts from repeated ovulations , combined with impaired wound healing , might mean a greater risk for ovarian cancer development in a hyperglycemic environment . this idea provides a possible mechanism by which hyperglycemia may initiate cancer , in addition to playing a role in promotion of eoc from an unrelated transforming event . folkman , solid tumours must recruit new blood vessels in order to grow beyond 1 - 2 mm in size . most of the tumour vascularization occurs through angiogenesis , which is the development of new blood vessels from preexisting vasculature . the angiogenic process is regulated by a balance between pro- and anti - angiogenic factors and in ovarian cancer there is a concomitant overexpression of proangiogenic factors and an inhibition of anti - angiogenic molecules . there are numerous reports concluding that elevated glucose levels contribute to increased angiogenic processes . granulosa cell tumours of the ovary have been shown to have increased expression of members of both the glycolytic and angiogenic pathways . glucose directly increases expression of the potent proangiogenic factor vegf , which is thought to be the mechanism involved in the vascular complications associated with diabetes ( reviewed in ) . in a similar fashion to tumour cells , endothelial cells that comprise the tumour vasculature also increase their utilization of glucose . glucose transporter expression is increased in the hypoxic environment associated with most solid tumours , and glucose increases survival of both tumour epithelial and endothelial cells . because increased tumour vascularity is correlated with increased metastatic potential and tumour progression [ 121 , 122 ] unfortunately , inflammation may be self - promoting as increased tumour perfusion can act to further exacerbate the immune response . in addition to the direct effects of glucose , the effects of inflammation are likely mediated by vegf . inflammatory mediators upregulate vegf and vegf receptors , which are correlated with the clinical outcomes of ovarian cancer patients . for example , nf-b can promote angiogenesis by activating vegf and il-8 and may be central to inflammation - induced tumour growth and progression . the possible impact of hyperglycemia - related inflammation on cancer suggests that anti - angiogenic molecules such as thrombospondin-1 may be of great benefit in treating diabetic tumours . the relationship between angiogenesis , inflammation , and carcinogenesis is illustrated by the fact that a number of anti - angiogenic drugs that are promising in the treatment of cancer are also effective against chronic inflammatory diseases . because of the multitude of protumour effects of glucose , it is intuitive that glucose deprivation may be a potent antitumour treatment approach . from the literature , it is apparent that glucose is an important energy substrate , survival factor , and proangiogenic molecule . there are a number of antihyperglycemic treatments currently available for reducing serum blood glucose and these drugs may effectively inhibit glucose availability to the tumour . although the effects of antihyperglycemic drugs are well documented in diabetes , their effects in cancer are relatively unknown . preliminary reports show that these drugs may have multi - modal effects in slowing tumour growth . in an approach similar to that using anti - angiogenic drugs , the class of antihyperglycemic drugs such as metformin and rosiglitazone may reduce glucose availability to the tumour and essentially starve the tumour of nutrients . these drugs have also been shown to have direct effects on metabolic and signaling pathways that may be independent of glucose . metformin is in the biguanide class of antidiabetic drugs and decreases circulating glucose levels by suppressing hepatic production of glucose . metformin , by reducing insulin and glucose levels , reduced the size and increased latency of mammary adenocarcinomas in her-2/neu transgenic mice , demonstrating a potent antitumour effect . in vitro , metformin significantly inhibits the growth of epithelial ovarian cancer cells and may potentiate the effects of the common chemotherapy drug cisplatin . metformin may preferentially increase peripheral glucose uptake in skeletal muscle , as administration increases ampk activity in skeletal muscle and stimulates translocation of muscle glut-4 . this favoured packaging of glucose into skeletal muscle cells would decrease serum glucose levels and availability to the tumour cells resulting in nutrient depletion . stimulation of ampk by metformin also contributes to the reduced hepatocyte production of glucose . in fact , ampk activation is associated with an inhibition of tumourigenesis through apoptosis induction , decreased cell proliferation and may be a communal molecule utilized by metformin as well as a number of anti - tumour drugs that have been shown to have effects in eoc . c93 , resveratrol [ 13 , 136 ] , 2-deoxy - d - glucose , and aicar are targeted therapies that are effective in the treatment of ovarian cancer . interestingly , these molecules also cause the stimulation of ampk , indicating a common pathway intersection with metformin . although not yet investigated , there is a possibility that metformin may have a synergistic interaction with these molecules , in addition to its glucose deprivation effects . rosiglitazone is another antidiabetic agent in the thiazolidinedione class of drugs designed to reduce the hyperglycemia associated with this disease . rosiglitazone activates the peroxisome proliferator activated receptors ( ppar ) in target tissues , increasing insulin sensitivity and decreasing serum levels of glucose . as with metformin , rosiglitazone also stimulates increased expression of glut-4 causing glucose uptake in skeletal muscle . one of the mechanisms by which rosiglitazone may have a significant antitumour effect is through the inhibition of angiogenesis . rosiglitazone has been shown to inhibit vegf - induced angiogenesis and is suggested as a treatment option for vascular disorders associated with diabetes such as diabetic retinopathy , macular degeneration , and so forth . as vegf expression is significantly elevated in eoc and is responsible for some of the ovarian tumour vascularization ( reviewed in ) , rosiglitazone may have a bimodal anti - tumour effect by decreasing glucose availability and also by reducing tumour angiogenesis . simply by decreasing tumour vascularity an emerging view of cancer relies on an initiation - promotion paradigm that suggests a fundamental role of the tumour environment on cancer development . new data suggests that hyperglycemia may be a contributing factor to the onset and progression of eoc through a number of complex mechanisms ( summarized in figure 1 ) . we propose that hyperglycemia has important effects on both the progression and somatic evolution of epithelial ovarian cancer . altered glucose homeostasis is common in cancer patients , so antihyperglycemic therapies are applicable to even those who have normal blood sugar . although there are a number of cellular mechanisms through which hyperglycemia may effect the promotion or initiation of ovarian cancer , there is almost no in vivo experimental data exploring the link between hyperglycemia and eoc . further research in this area not only has applications in the development of cancer therapeutics , but also will provide new insights into eoc pathogenesis , early detection , and possible prevention .

the risk of developing coronary heart disease ( chd ) depends on several factors that are related to both lifestyle and genetics . recent genome - wide association studies have identified around 50 chromosomal loci that are robustly associated with chd . mega et al studied whether the developing of genetic risk score ( 27 genetic variants associated with chd ) will help in risk stratifying patients receiving statin therapy in both primary and secondary prevention . the investigators analyzed data from the following studies: the primary prevention population : the malmo diet and cancer study ( mdcs ) , jupiter , and ascot studies , where genetic samples were available from 27817 , 8749 and 6978 people consecutively. the secondary prevention population : care , and prove it - timi 22 , where genetic samples were available in 2878 and 1999 individuals consecutively.the genetic risk score was derived on the basis of 27 snps that were significantly associated with coronary artery disease at genome - wide level in previous analyses . each individual participant received a score equal to the sum of the numbers of risk alleles for each snp weighted by the log of the odds ratio reported with the snp in the original report . the primary prevention population : the malmo diet and cancer study ( mdcs ) , jupiter , and ascot studies , where genetic samples were available from 27817 , 8749 and 6978 people consecutively . the secondary prevention population : care , and prove it - timi 22 , where genetic samples were available in 2878 and 1999 individuals consecutively . the investigators used the cox proportional hazard models to assess the risk of coronary heart disease for each quintile of genetic risk , in which they used the first quintile as a reference group . additionally , the risk categories low [ quintile 1 ] , intermediate [ quintile 2 - 4 ] , and high [ quintile 5 ] and per 1 sd were calculated . these analyses were done on the participants in mdcs , and in the placebo or low - intensity statin treatment groups of the applicable trials . higher genetic risk scores were associated with a raised risk of coronary heart disease , independent of established clinical predictors . specifically , when evaluating participants in low , intermediate , and high genetic risk categories , a gradient of risk coronary heart disease was evident in the studies ( see table 1 ) . baseline ldl cholesterol and hdl cholesterol levels were similar across genetic risk score categories within each trial , as were the absolute and the percentage changes with statin therapy . analyses were done to investigate the clinical benefit of statin therapy across the genetic risk score . the relative risk reductions were 34% in low , 32% in the intermediate , and 50% in high genetic risk score categories in the primary prevention trials , and 3% in low , 28% in intermediate , and 47% in high genetic risk score categories in the secondary prevention trials . when the data were combined , the gradient of relative risk reductions with statin therapy across low , intermediate , and high genetic risk score categories were 13% , 29% , and 48% , respectively ( p value for trend = 0.02777 ) . similarly , in terms of the absolute risk reductions , a graded increase in the benefit of statin therapy across the genetic risk score categories was evident in both the primary and secondary prevention trials . correspondingly , the number needed to treat to reduce coronary heart disease events in 10 years with statin therapy in primary prevention differed depending on genetic risk score ; 66 for low genetic risk score , 42 for intermediate risk and 25 for those individuals with high risk score . the current study demonstrated that combining the 27- genetic variants that were individually associated with the risk of coronary heart disease into a risk score could identify people at increased risk of chd events , including incident chd in primary prevention populations and recurrent chd events in secondary prevention populations . furthermore , observation from the four statin trials suggests that individuals with a high genetic risk score have both a greater absolute and relative benefit from statins and the benefit is larger among high when compared to the intermediate risk group . the investigators outlined the limitations of the study including , first data from several studies were used in the analysis , and each data has its own criteria , treatment allocation , and duration of follow - up . second , the numbers needed to treat were calculated by extrapolation of the effect of statin therapy during a 10-year period , and treatment effect could vary overtime . third , these analyses were done within completed clinical trials , and the genetic risk score was not used specifically as an enrollment criterion , moreover the analyses were conducted in statin trials that yielded positive outcomes only . fourth , although the investigators focused on genetic variants that were associated with the risk of chd . finally , the gradient of the relative risk reduction across genetic risk score categories in the study was unexpected . in an accompanying editorial by schunkert and samani , they commented that the study by mega et al illustrates the expanding clinical use of genetic discoveries in chd , from identifying new therapeutic targets to prioritizing ( or de - prioritizing ) existing targets for medical intervention to now potentially providing a valuable algorithm for improved precision in prediction of event rates and responses to treatment . they did suggest that this genetic risk score will need further careful evaluation , including testing the genetic score in the context of scores that are presently recommended to see how this score modulates risk calibration and discrimination provided by those established scores . additionally , the cost - effectiveness of incorporating this genetic risk score assessment will need to be established . the genetic risk score identified individuals at increased risk of chd across primary and secondary prevention populations . furthermore , people with high - risk scores had the largest relative and absolute risk reductions with statin therapy .

autoimmune pancreatitis ( aip ) is a rare disease that closely mimics pancreatic cancer ( pc ) in its presentation . it is very important for clinicians to distinguish one from the other because their treatment and prognosis are vastly different . typical radiological imaging findings , in particular observation of diffusely or segmentally narrowed main pancreatic duct ( mpd ) with an irregular wall by endoscopic retrograde cholangiopancreatography ( ercp ) , are essential for making the diagnosis of aip . on the other hand , we report a rare case of a patient with focal mass - forming aip strongly suspected of being pc because of mpd obstruction on ercp . . we will continue to make an effort to distinguish between the two disorders to prevent unnecessary surgery . a previously healthy 79-year - old man with epigastric pain was admitted to another hospital . after examination , he was diagnosed as having acute pancreatitis due to a tumor of the pancreatic tail . after treatment for pancreatitis , he was referred to our hospital for further examination and treatment of the tumor . the patient 's blood chemistry data were within normal limits except for slightly elevated serum pancreatic amylase ( 264 serum gamma globulin and total igg were normal , but igg4 was elevated ( 256 mg / dl ) . dynamic ct imaging revealed an irregular mass measuring 40 23 mm in the tail of the pancreas . the tumor was not enhanced on the arterial phase and slightly enhanced on the portal phase ( fig . mri imaging showed that the intensity decreased in the t1-weighted images of the pancreas and increased in the t2-weighted images . endoscopic ultrasonography ( eus ) revealed a hypoechoic lesion detected in the tail of the pancreas . eus - guided fine needle aspiration ( eus - fna ) , however , did not reveal any cancer cells . 18-fluorodeoxyglucose positron emission tomography ( fdg - pet ) showed hot spots of fdg uptake at the site of the pancreatic mass . ercp revealed an obstruction of the mpd at the site of the tumor ( fig . 1dynamic abdominal ct scans in arterial phase showed a low - density mass ( arrow ) measuring 40 23 mm in the tail of the pancreas ( a ) . ercp showed an obstruction of the mpd ( arrow ) at the site of the pancreatic mass ( b ) dynamic abdominal ct scans in arterial phase showed a low - density mass ( arrow ) measuring 40 23 mm in the tail of the pancreas ( a ) . ercp showed an obstruction of the mpd ( arrow ) at the site of the pancreatic mass ( b ) gross inspection of the resected specimen revealed a diffusely enlarged and firm pancreas . histologically , it was remarkable for an intense mixed inflammatory cell infiltrate predominantly composed of lymphocytes and plasma cells , and centered on the pancreatic ducts . although diagnosis of aip has improved thanks to a growing awareness of the condition and proposed diagnostic criteria,1 there remains no practical strategy to differentiate pc from aip . one must distinguish between the two disorders to prevent unnecessary surgery or delayed initiation of corticosteroid therapy . however , about 35% of patients undergoing pancreatic resection for presumed pc in fact has aip.2 kamisawa et al.3 reported that 7 of 37 ( 18.9% ) aip patients had surgery because they were misdiagnosed as having pc or bile duct cancer . in particular , it is very difficult to differentiate between fmf aip and pc . chang et al.4 reported that 8 of 26 ( 31.8% ) aip patients were fmf aip who were frequently surgically treated because differentiating fmf aip from pc was so difficult . kamisawa et al.3 also reported that 6 of 17 ( 35.3% ) fmf aip patients were surgically treated ( resection ; 3 , bypass operation ; 3 ) because pc was suspected . to obtain images of the pancreatic duct , it is necessary to use ercp , and additionally direct images taken during the operation or of specimens . kamisawa et al.3 reported that the three ercp features required for aip diagnosis were ( 1 ) a > 3-cm - long narrowed main pancreatic duct ; ( 2 ) skip lesion of the mpd ; and ( 3 ) maximal upstream mpd diameter of < 5 mm . on the other hand , features highly suggestive of pc were a pancreatic low density mass , mpd obstruction , distal pancreatic atrophy , and metastases . there have been four reports of retrospective evaluation of ercp imaging in aip patient.3,57 the frequency of mpd obstruction on ercp in aip patients was 05.9% , whereas in pc patients , it was 3560% , but only three patients with mpd obstruction have been reported . although the measurement of serum igg4 level is useful for differentiating between the two diseases , 10% of pc patients also has elevated igg4.8 moreover , there are a few reports of aip patients with concomitant pc.9,10 eus - fna is frequently used to rule out pc . however , its accuracy for pc is not perfect ( about 7090% ) because some cases of pc are accompanied by chronic inflammation and fibrosis around the mass , so a negative biopsy does not rule out cancer . diagnosis of aip by eus - fna is difficult because the specimen is too small . taken together , we can not exclude the presence of pc in many cases . further improvement of diagnostic strategies , such as core biopsy techniques , or development of new immunohistological diagnostic criteria from results of cytologic and tissue specimen analyses are needed to avoid unnecessary surgery . in conclusion , we report an extremely rare case of fmf aip mimicking pc with mpd obstruction .

chronic subdural hematoma ( sdh ) is known to have a good prognosis after simple burr hole drainage , and thus , most neurosurgeons do not consider chronic sdh seriously . contralateral or bilateral development of an acute subdural hematoma immediately after removal of chronic sdh have been previously reported to be rare but devastating postoperative complications3,12 ) . however , massive intracerebral hemorrhage ( ich ) caused by coagulopathy after evacuation of a recurrent chronic sdh has not been previously reported . here , we report a rare case of fulminant ich after the evacuation of a chronic sdh and include a review of the literature . a 62-year - old man was admitted to our institute with a 3-week history of trivial head injury with complaints of mild headache and left side motor weakness . he was afebrile and results of blood tests , including erythrocyte sedimentation rate and c - reactive protein , were all within normal limits . he had taken low dose aspirin 100 mg per day for 4 years , but routine laboratory test results , which included platelet count , prothrombin time ( pt ) , activated partial thromboplastin time ( aptt ) and bleeding time were within normal limits . brain computed tomography ( ct ) scan depicted a hypodense lesion in the right frontotemporal ( f - t ) region , suggesting chronic sdh with midline shift ( fig . the hematoma was evacuated through one burr hole using a 5-l catheter under local anesthesia ; dark old blood was removed and no evidence of active bleeding was confirmed during the operation . after setting a simple closed system in the subdural space , the wound was closed layer by layer and the operation was completed in the usual manner . on the postoperative ct scan performed at the next day , we could find the resolution of hematoma without midline shifting ( fig . postoperatively , the headache was immediately relieved and the patient was able to ambulate independently without difficulty , after 5-l catheter removal . hematological investigation revealed prolongation of pt prolongation to 14.0 sec but other parameters including fibrinogen were all normal range after trephination surgery . however , 3 days after the operation , the patient 's level of consciousness gradually deteriorated to a drowsy state , and brain ct revealed recurrent sdh on rt . the hematoma was re - evacuated through one burr hole using a 5-l catheter under local anesthesia ; dark old blood was removed and no evidence of active bleeding was also confirmed . after setting a simple closed system in the subdural space , the wound was closed layer by layer and the operation was completed without any problem . after revision surgery , his mental status was recovered to alert and follow - up ct scan at following day after revision surgery revealed the resolution of hematoma without midline shifting ( fig . 4 ) . however , hematological investigation revealed prolongation of pt to 14.1 sec and a decline of fibrinogen to 81 mg / dl ( normal range > 150 mg / dl ) . as a result , cryoprecipitate , fresh frozen plasma , and platelet concentrates were transfused . however , 5 days after revision surgery , the patient 's level of consciousness deteriorated to semicomatose state . brain ct revealed inracerebral hemorrhage in right basal ganglia and with midline shifting ( fig . 5 ) . at this time , despite continuous replacement of coagulation factors , hematological investigation revealed disseminated intravascular coagulation ( dic ) ; pt prolongation ( 14.5 sec ) , decreased fibrinogen ( 27 mg / dl ) , elevated fibrin degradation product test ( 10.5 ml / ml ) and d - dimer ( 575 mg / dl ) . emergency decompressive surgery was planned , but his family refused the operation for profound neurological deficits and hematological laboratory results of dic . despite conservative treatment to lower intracranial pressure and normalize the hematological parameters , his condition deteriorated rapidly , culminating in multiple organ failure and cardiorespiratory arrest with dilated non - reactive pupils . evacuation of a chronic sdh by burr hole drainage using a 5 l - catheter is an effective and minimally invasive technique . although the prognosis of chronic sdh is relatively good , some unusual and devastating complications may occur , such as , subdural hematoma , infection , seizure , hydrocephalus , and failure of the brain to expand , however , postoperative ich is rare8,9,11 ) . intracranial hematoma after chronic sdh removal has been recently reported to be a rare but near devastating postoperative complication3,12 ) . however , most patients with this complication develop an ipsilateral acute subdural hematoma , and massive ich caused by coagulopathy after drainage of chronic sdh has not been previously reported . in our patient , laboratory tests for clotting profiles revealed aggravated dic at 8 days after trephination . dic , whether acute or chronic is usually associated with an underlying causative condition . some diseases and conditions can disrupt the body 's normal blood clotting system and lead to dic . they include sepsis , cancer and massive tissue injury ( surgery and trauma ) . in this case , mori and maeda10 ) reported the surgical results of 500 consecutive patients with chornic sdh treated by burr hole craniotomy with closed drainage system . in his study , three patients ( 0.6% ) died due to dic and he insisted coagulopathy was an ominous indicator of poor prognosis in patients with chronic sdh . the loss of equilibrium among the tightly regulated coagulation factors can lead either to hypercoagulable states with microthrombosis and ischemia or to hypocoagulable states with possible progression of hemorrhagic lesions after traumatic brain injury . kawakami et al.5 ) also reported marked reductions of factors ii , v , vii and x , and antithrombin iii , and an increase in fibrinopeptide a in hematomas compared with venous blood in 19 patients . these results strongly suggest that coagulation is excessively activated regulatory mechanisms for coagulation and fibrinolysis are depressed in chronic sdh . modesti et al.9 ) undertook a detailed clinical review of this entity , reporting a 5% incidence of intracerebral hematomas among 140 surgically treated patients with chronic extracerebral fluid collections . they noticed no initial abnormality in clotting profiles , including bleeding time , pt , aptt , and platelets , in their series , as was observed in our patient . the pathophysiologic mechanisms of intracranial hematomas occurring after evacuation of chronic extracerebral fluid collections are unclear . many pathological events may contribute to the development of an ich after the evacuation of a chronic subdural hematoma . for example , damage to the cerebral vasculature secondary to perioperative parenchymal shift , a sudden increase in blood flow combined with defective vascular autoregulation , and hemorrhage into a previously undetected contusion have been proposed to explain the occurrence of delayed intracranial hematomas or sdh1,2,7 ) . focal cerebral edema beneath the compressed surface of the brain due to impeded venous drainage , can reduce cerebral blood flow in the affected hemisphere . chronic dilatation of small arterial vessels and loss of carbon dioxide reactivity in the ischemic hemisphere could also contribute to the pathogenesis6 ) . as a matter of course , aggravated coagulopathy might exert a baneful influence on recurrence of chronic sdh and intracerebral hematoma . to avoid this catastrophic complication , gradual drainage under a closed system and the effort to prevent the coagulopathy are mandatory . some authors have proposed that twist drill holes with closed drainage provide the safest and most effective means in the presence of a chronic extracerebral fluid collection4 ) . this procedure is effective and provides complete decompression with gradual brain re - expansion , and can also ameliorate rapid dynamic intracranial changes . although delayed intracerebral hemorrhage after drainage of a chronic sdh is a rare complication , it can occur , as demonstrated by our case . it is not easy to predict the possibility of postoperative intracerebral hemorrhage , especially when initial coagulation parameters are normal , and thus , it is important to monitor the patients intensively after surgical evacuation of hematoma . although ich caused by coagulopathy following drainage of a recurrent chronic sdh is an unusual complication , the possibility of ich must be considered when neurologic status deteriorates . the effort to prevent coagulopathy and a slow drainage system appear to be mandatory to prevent this catastrophic complication .

periapical granuloma ( pg ) and periapical cyst ( pc ) are the most common inflammatory jaw lesions . they are usually initiated by the mixed microflora of infected root canals , which includes gram - positive and gram - negative bacteria . the invasion of bacteria or bacterial toxins into the periapical region involves initially non - specific inflammatory reactions and is followed by specific inflammatory reactions . in a non - specific inflammatory reaction , the innate immune system recognizes highly conserved pathogen - associated molecular patterns ( pamp ) from bacteria through a variety of pattern recognition receptors ( prr ) ; recognition triggers the inflammatory reaction . therefore , prr such as toll - like receptors ( tlr ) are essential for the innate immune response . tlr are type i transmembrane proteins that play a critical role in the early innate immune response by sensing microorganism ; 13 distinct tlr have been identified , 10 of which are characterized in humans . representative bacterial pamp are lipopolysaccharides ( lps ) from gram - negative bacteria , lipotheichoic acid from gram - positive bacteria and peptidoglycan ( pgn ) from either gram - positive or gram - negative bacteria . in humans , pamp recognition by tlr activates the inflammatory reaction , including up - regulation in immunocompetent cells of the genes encoding inflammatory cytokines . previous investigations have addressed tlr expression in periodontal and periapical disease . , in the latter , tlr2 and tlr4 involvement has been demonstrated at the onset of the experimentally induced furcation lesions of endodontic origin . furthermore , tlr2 and tlr4 up - regulation has been described in pg and pc from patients , demonstrating that their expression is associated with reactive periapical inflammation . yet , where periapical disease is concerned , such investigations have largely focused on tlr expression in immunocompetent cells , whereas their association with microbial pathogens and their expression in the epithelium of inflammatory periapical lesions ( pl ) have been neglected.tlr are also expressed in epithelial cells of other tissues including tumor cells . thus , even though inflammatory periapical disease is likely to be sustained by the immune system via reaction to bacterial antigens through tlr , tlr expression in the epithelium has not yet been reported . further investigation is thus required to elucidate some aspects concerning the proliferation of epithelial cell rests and the formation of apical cysts . accordingly , tlr4 expression was examined by immunohistochemistry in pg with proliferating epithelium and in radicular cysts with emphasis on the epithelial compartment . this cross - sectional study was performed using tissue blocks from surgical samples of inflammatory radicular cysts and pg archived in 2001 - 2012 . tissue blocks and data regarding patients and samples were obtained from the department of dentistry , federal university of bahia , brazil . inclusion criteria were sufficient material for immunohistochemistry and presence of epithelial cell rests of malassez ( erm ) in pg . exclusion criteria were evidence of previous endodontic treatment , refractory endodontic disease and specimens with sinus tract . to choose specimens meeting the inclusion and exclusion criteria , a serial section per block was stained with hematoxylin - eosin and microscopically evaluated . the study sample therefore consisted of 21 pc cysts and 10 pg from 31 patients ( 18 males and 13 females ) . the study was approved under ethical approval number 646.081 by the school of dentistry , federal university of bahia , brazil . four - micron serial sections from each case were cut from formalin - fixed , paraffin - embedded blocks of representative pg and pc areas . the other sections were mounted on poly - l - lysinecoated glass slides to be further processed for immunohistochemical reaction . ( santa cruz , ca , usa ) ; the dilution was established based on negative and positive controls ( 1/40 for tlr4 ) . immunohistochemistry was performed with a benchmark xt autostainer ( ventana medical systems , tucson , az , usa ) . the standard linked streptavidin - biotin horseradish peroxidase technique ( lsab - hrp ) with the iview dab detection kit ( ventana medical systems tucson , az , usa ) was used to detect staining . sections were counterstained with type - ii - gill s hematoxylin , dehydrated with ethanol and permanently coverslipped . a negative control was obtained in all cases by substituting the primary antibody with normal mouse serum . slides were examined under a light microscope ( olympus cx31 ; tokyo , japan ) at 400x magnification . immunoreactivity was assessed by two expert pathologists , who were blinded to the clinical - pathological data , and scored by a semi - quantitative scale ( extent score , es ) . cases were assigned to one of 4 categories : 0 ( 0 to < 5% immunostained cells ) , 1 ( 6% to < 40% immunostained cells , 2 ( 41% to < 70% immunostained cells ) or 3 ( > 71% immunostained cells ) . the percentage of positive cells was determined from the analysis of 100 cells in 10 random areas at 40x magnification . for each patient means and standard deviations were calculated for es in each sample ( table 1 ) . data were analyzed using the kruskal - wallis test , to compare es in the epithelial linings of pg , pc and dc . statistical analysis was conducted using spss ( spss release 16.0 , chicago , il , usa ) . this cross - sectional study was performed using tissue blocks from surgical samples of inflammatory radicular cysts and pg archived in 2001 - 2012 . tissue blocks and data regarding patients and samples were obtained from the department of dentistry , federal university of bahia , brazil . inclusion criteria were sufficient material for immunohistochemistry and presence of epithelial cell rests of malassez ( erm ) in pg . exclusion criteria were evidence of previous endodontic treatment , refractory endodontic disease and specimens with sinus tract . to choose specimens meeting the inclusion and exclusion criteria , a serial section per block was stained with hematoxylin - eosin and microscopically evaluated . the study sample therefore consisted of 21 pc cysts and 10 pg from 31 patients ( 18 males and 13 females ) . the study was approved under ethical approval number 646.081 by the school of dentistry , federal university of bahia , brazil . four - micron serial sections from each case were cut from formalin - fixed , paraffin - embedded blocks of representative pg and pc areas . the other sections were mounted on poly - l - lysinecoated glass slides to be further processed for immunohistochemical reaction . ( santa cruz , ca , usa ) ; the dilution was established based on negative and positive controls ( 1/40 for tlr4 ) . immunohistochemistry was performed with a benchmark xt autostainer ( ventana medical systems , tucson , az , usa ) . the standard linked streptavidin - biotin horseradish peroxidase technique ( lsab - hrp ) with the iview dab detection kit ( ventana medical systems tucson , az , usa ) was used to detect staining . sections were counterstained with type - ii - gill s hematoxylin , dehydrated with ethanol and permanently coverslipped . positive controls for immunohistochemistry consisted of tissue sections of oral squamous cell carcinoma . a negative control was obtained in all cases by substituting the primary antibody with normal mouse serum . slides were examined under a light microscope ( olympus cx31 ; tokyo , japan ) at 400x magnification . immunoreactivity was assessed by two expert pathologists , who were blinded to the clinical - pathological data , and scored by a semi - quantitative scale ( extent score , es ) . cases were assigned to one of 4 categories : 0 ( 0 to < 5% immunostained cells ) , 1 ( 6% to < 40% immunostained cells , 2 ( 41% to < 70% immunostained cells ) or 3 ( > 71% immunostained cells ) . the percentage of positive cells was determined from the analysis of 100 cells in 10 random areas at 40x magnification . for each patient means and standard deviations were calculated for es in each sample ( table 1 ) . data were analyzed using the kruskal - wallis test , to compare es in the epithelial linings of pg , pc and dc . statistical analysis was conducted using spss ( spss release 16.0 , chicago , il , usa ) . pg were characterized by a cell - rich granulation tissue and erm , which formed strands or islands of epithelium . pc exhibited fully developed cavities lined by stratified squamous epithelium with variable thickness and fibrous connective tissue walls . in all specimens inflammatory cell infiltrate density ranged from moderate to intense . tlr4 immunoreaction products were detected in the epithelium of all specimens , though with different percentages of immunostained cells . tlr4 immunolabeling in pg was seen in nearly all epithelial cells forming strands and islands , whereas in pc it was mostly in basal and parabasal layers of the cystic epithelial lining , but not all cells were immunolabeled ; indeed , areas showing immunostained cells interspersed with groups of unstained cells were frequently detected . the es was highest in pg ( 2.70.4 ) ; in pc it was 1.80.6 ( figure 1 ) . very few cells in control samples showed immunostaining ( es , 0.280.4 for dc ) . differences among groups were significant ; the es of pc and pg were significantly greater than the one of dc ( 0.001<p<0.01 ) . tlr are transmembrane proteins expressed on sentinel cells of the immune system such as macrophages and dendritic cells . they are also found in non - immune cells such as keratinocytes of skin and oral mucosa and gastrointestinal and female reproductive tract lining . on these lining epithelia tlr recently , it has become increasingly apparent that tlr also recognize damage / danger - associated molecular patterns ( damp ) , endogenous molecules released from damaged and dying cells . novel tlr functions in cell proliferation , cell survival and tissue repair have also recently been described . the growth rate or activity of inflammatory pl depends on the balance between cell proliferation and death ; therefore proliferation markers , besides apoptotic reactions , have been extensively investigated . these studies have suggested that regression of epithelial strands in pg and of the lining epithelium in apical cysts are most likely caused by programmed cell death . after non - surgical endodontic therapy the restricted - potential basal stem cells in the epithelial strands or lining epithelium of cysts stop proliferating due to a decline of inflammatory mediators , proinflammatory cytokines , and growth factors . furthermore , the terminally differentiated squamous cells in the epithelial strands and lining epithelium of a cyst will die of programmed cell death , similar to that of surface epithelial cells of the oral epithelium . tlr , which are also involved in epithelial cell proliferation , cell survival and tissue repair , could therefore be of interest to understand the pathobiology of periapical inflammatory disease . among tlr , tlr2 and tlr4 the presence of tlr2-expressing inflammatory cells described in pg and pc indicated that the disease is likely to be sustained by the immune system via reactions to bacterial antigens . the same conclusions have been drawn in the only tlr4 study , where tlr4 has been found to be constitutive and non - constitutively expressed in human epithelial cells ; no data are available about its expression in erm and the epithelium cyst lining of pc . the present study examined its expression in pl by immunohistochemistry focusing on the epithelial compartment . our findings demonstrated tlr4 overexpression both in pg and pc , although with differences related to the nature of the lesion . in fact , in pg all epithelial cells of strands , islands and trabeculae were strongly immunoreactive for tlr4 , whereas in pc only some areas of the basal and suprabasal layers of epithelium showed tlr4 immunostaining . this staining pattern is consistent with the known functions of tlr4 , since tlr4 could promote cell survival , proliferation and migration of epithelial strands and islands in erm , whereas in pc it could protect the lining epithelium from extensive apoptosis . this agrees with its overexpression in pg and its moderate expression in pc , where it may participate in maintaining the thickness of radicular cyst lining epithelium , which depends on the balance between cell proliferation and apoptosis . these findings go some way toward answering the intriguing question of why many epithelial strands or islands in pg and the lining epithelium of apical cysts regress after non - surgical endodontic therapy . tlr4 ligation leads to activation and translocation of the nuclear transcription factor- b ( nf- b ) from cytoplasm to the nucleus , where it induces the expression of a set of target genes . therefore , activated nf- b plays an important role in cell differentiation and proliferation , in response to a variety of physiological and pathological stimuli . activated nf- b has been described in some odontogenic lesions and among these in pc ; the tlr4 upregulation described in this study in pl epithelium could thus be a pathway of nf- b activation . based on our findings and on previous evidence linking pl to chronic inflammation via tlr - which would play a significant role in the recognition of endodontic pathogens and trigger adaptive immune responses against endodontic pathogens - it is reasonable to assume a key role for tlr4 in the pathobiology of the inflammatory processes related to periapical disease . in this very complex interplay of many bioactive molecules , the up- or downregulation of these bioactive molecules might be a key mechanism in the regulation of inflammatory . further work harnessing additional investigation methods is required to elucidate the possible contribution of tlr4 to inflammatory pl .

protein sequences are of utmost importance for studying the function and evolution of genes and genomes . evolutionary processes of mutation and selection have shaped the protein sequence space and became manifest in the protein sequences as well as their pair - wise and group - wise similarities . therefore , a rich collection of methods in computational biology relies on the analysis and comparison of protein sequences . many of these intensively used methods perform sequence similarity searches [ e.g. blast ( 1 ) ] or compare protein sequences against secondary databases of protein families [ e.g. interpro ( 2 ) ] . the fast increasing volume of publicly available protein sequences forges a computational dilemma for bioinformatics tasks that require repeated all - against - all calculations of sequence similarities or sequence features . such rather straightforward but technically challenging tasks among others are the annotation of genomes or the clustering of the protein sequence space into protein families . due to the exponential growth of the number of sequences and the quadratic complexity of the sequence similarity matrix , the computational demand of calculating an all - versus - all sequence matrix of all known proteins easily outgrows available computational resources . due to the subsequent growth of the secondary databases , a similar problem exists for the prediction of protein domains . as a consequence , any repeated ab initio recalculation of the similarity matrix is highly ineffective due to the recalculation of the vast majority of already known sequence similarity relations . however , as the number of recently added sequences is always small compared to the bulk of know sequences , repeated recalculations frequently performed in many sequence - based projects waste a remarkable amount of compute sources worldwide . the similarity matrix of proteins ( simap ) solves the computational dilemma described above by incrementally pre - calculating the sequence similarities forming the known protein sequence space ( 3 ) . the comparison of new sequences versus known ones returns symmetric scores that can be updated accordingly in the existing records . compared to other resources that pre - calculate sequence similarities [ e.g. ncbi blink ( 4 ) ] , the fasta ( 5 ) and smith waterman ( 6 ) based similarity calculation in simap is only restricted by a static and sensitive raw score threshold without limiting the maximal number of hits per sequence . hence the structure of the sequence similarity matrix is not influenced by the taxonomy and study biases that exist in the major protein sequence databases . when querying simap , e - values are calculated on - the - fly according to the selected databases and taxa . to complement the pair - wise sequence similarity matrix by position specific searches against known protein families , simap in addition pre - calculates sequence based features as e.g. interpro matches ( 2 ) . to maximize its coverage to provide an efficient alternative to blast or interproscan calculations , recent improvements in simap have addressed this requirement by further expanding the sequence space and including metagenomic sequences . further improvements have extended the functional annotation of the protein sequence space in simap by pre - calculated go annotations and improved the data access and query tools of simap . simap represents the known protein sequence space comprehensively and up - to - date . according to this goal , the simap database is synchronized once per month with the major protein sequence databases ( table 1 ) . the consideration of each of these databases in simap is justified by providing either unique protein sequences that are not found in other databases [ e.g. ensembl ( 7 ) ] , or unique protocols for data processing [ e.g. ncbi refseq ( 8) ] . the continuous and rapid growth of the sequence space demands for a sophisticated high - performance computing infrastructure to pre - calculate the sequence similarities of all new sequences and their sequence - based features immediately after the import of new sequences even in case of simap s incremental implementation . the simapboinc public resource computing project ( 9 ) steadily provides compute power beyond the current need and thus enables rapid updating of simap . table 1.number of protein entries and non - redundant sequences of the major protein sequence databases included in simap as of september 2009databaseprotein entriesnon - redundant sequencesncbi genbank16 146 01813 065 886ncbi refseq8 181 9106 681 186uniprot / trembl8 926 0167 586 794uniprot / swissprot495 880416 496pdb139 10641 445pedant5 480 4425 389 911ensembl1 094 4821 062 197 number of protein entries and non - redundant sequences of the major protein sequence databases included in simap as of september 2009 with the breakthrough of next generation sequencing methods and their application to environmental samples ( 10 ) , metagenomic sequences have indelibly expanded the protein sequence space to non - culturable organisms and environmental communities . however , the pioneering global ocean sampling ( gos ) project ( 11 ) so far remains the only metagenomic dataset of which protein sequences are represented in a major public sequence database [ ncbi genbank ( 4 ) ] . all other metagenomes are if at all deposited in distributed resources as the whole genome shutgun ( wgs ) section of ncbi genbank ( 4 ) or the img / m database ( 12 ) . no standardized protocol for gene calling and the annotation of protein - coding sequences has been established so far for these data collections . as the consistent annotation of metagenomes is indispensable for any downstream comparative analysis such as comparisons of taxonomic or functional profiles between different metagenomes , an extension of simap was implemented that extracts coding sequences from metagenomic sequencing reads , assembled contigs and scaffolds in a consistent way . this part of simap covering environmental sequence fragments is monthly synchronized with three major repositories of metagenomes ( table 2 ) . entirely redundant metagenomes are considered only once , whereas redundant representations of the same project differing in their total number of nucleotides ( e.g. the whale fall samples in img / m and genbank wgs ) are retained . similar to the methodology used by the gos project ( 13 ) , coding sequences are extracted from the nucleotide sequences in a multi - step procedure : all open reading frames ( orf ) exceeding a length of 90 nt are extracted from the nucleotide sequences of a metagenome , all - against - all protein sequence similarities between all orfs in a metagenome are calculated using the simap software ( 3 ) : first a fasta ( 5 ) similarity search against the low - complexity masked sequences down to the blosum50 ( 14 ) score of 80 is performed without restricting the number of hits , thereafter the alignments are re - calculated without low - complexity masking , orfs are weighted by the number and score of their sequence alignments ; shadow orfs are detected by their overlap with higher weighted orfs and removed using the methodology and parameters as in the gos project ( 13),remaining orfs having a length of at least 60 aa are imported into the main simap database , all - against - all protein sequence similarities between all orfs of a metagenome and all other protein sequences in simap are calculated as in step 2,again , shadow orfs are removed as in step 3 . table 2.number of metagenomic samples and extracted protein - coding sequences in simap as of september 2009databasemetagenomic samplesnon - redundant sequencescamera ( jcvi)546 031 109ncbi genbank / wgs section1304 244 008img / m ( jgi)652 833 359 all open reading frames ( orf ) exceeding a length of 90 nt are extracted from the nucleotide sequences of a metagenome , all - against - all protein sequence similarities between all orfs in a metagenome are calculated using the simap software ( 3 ) : first a fasta ( 5 ) similarity search against the low - complexity masked sequences down to the blosum50 ( 14 ) score of 80 is performed without restricting the number of hits , thereafter the alignments are re - calculated without low - complexity masking , orfs are weighted by the number and score of their sequence alignments ; shadow orfs are detected by their overlap with higher weighted orfs and removed using the methodology and parameters as in the gos project ( 13 ) , remaining orfs having a length of at least 60 aa are imported into the main simap database , all - against - all protein sequence similarities between all orfs of a metagenome and all other protein sequences in simap are calculated as in step 2 , again , shadow orfs are removed as in step 3 . number of metagenomic samples and extracted protein - coding sequences in simap as of september 2009 compared to the supervised gene prediction methods as used in other metagenomic resources , the procedure applied in simap is not biased towards any taxonomic group ( i.e. prokaryotes ) and only limited by the minimal length of open reading frames in step 1 and 4 . the parameters applied in this procedure ensure optimal sensitivity in detecting coding sequences both in single - exon and multi - exon genes . the derived metagenomic orfs have almost doubled the volume of the known protein sequence space and thus significantly added valuable information ( figure 1 ) . however , metagenomic sequences exhibit lower accuracy compared to completely sequenced genes and genomes , show fragmentation in case of multi - exon genes and lack knowledge of their taxonomic origin . therefore , metagenomic sequences can be excluded when retrieving data from simap according to the individual requirements of the user . figure 1.composition of the non - redundant protein sequence space in simap as of september 2009 . composition of the non - redundant protein sequence space in simap as of september 2009 . many computational methods to support the prediction of protein function are computationally expensive and therefore benefit from comprehensive pre - calculation and incremental updates as the basic design principles of simap . simap thus pre - calculates interpro domains and features ( 2 ) for all sequences including metagenomic orfs ( 15 ) . new releases of interpro are incorporated into simap as soon as they become available ; simap is regularly updated to the latest interpro version ( currently 22.0 ) . simap provides an ideal complete resource for the computation of secondary features such as the functional annotation of protein sequences based on information transfer from annotated proteins . blast2go may serve as an example that provides various annotation tools for the functional classification of proteins ( 16,17 ) . blast2go achieves the automatic functional annotation of dna or protein sequences employing the gene ontology vocabulary . we have adapted the blast2go suite to enable the retrieval of sequence similarities from the simap database instead of performing blast ( 1 ) searches . this step saves an enormous amount of compute - time compared to blast and allows annotating the complete protein sequence space of simap using a few pcs within a week . we have integrated the adapted blast2go program into the monthly update workflow of simap in order to keep the pre - calculated blast2go annotations complete and up - to - date ( table 3 ) . table 3.pre-calculated functional annotations in simap as of september 2009methodnumber of pre - calculated featuresinterproscan133 829 528targetp17 205 439signalp11 060 831tmhmm15 841 454phobius18 488 832blast2go190 801 556 pre - calculated functional annotations in simap as of september 2009 all data in simap are freely available . the continuously growing size of simap demands a sophisticated implementation of the database to provide versatile and rapid access to the data with respect to a broad spectrum of use cases . based on the established database and standard middleware components of simap , we have improved the performance and stability of simap through clustering of two independent database and application servers . each of the servers is ready to process more than 2 million complex queries per day . furthermore , we have improved the different data access facilities connecting simap to its users . the matches are starting points for retrieving homologous proteins based on sequence similarity or domain architecture . protein report pages integrate data from simap including interpro and go annotation as well as from external resources as the pedant database ( 18 ) . to facilitate clustering methods , all - against - all matrices of similarity scores can be downloaded for user - supplied groups of proteins . the simpat ( simap access tools ) allows easy access to the simap database using web - service functionality . these can be accessed via the url http://webclu.bio.wzw.tum.de/das/ and provide easy and rapid access to the proteins , sequence similarities , interpro matches and go annotations from simap . these data with the exception of the very huge similarity matrix itself can also be downloaded as flat files from the simap web portal . for research projects interested in parts of the similarity matrix , we provide project specific monthly dumps upon request . simap represents the known protein sequence space comprehensively and up - to - date . according to this goal , the simap database is synchronized once per month with the major protein sequence databases ( table 1 ) . the consideration of each of these databases in simap is justified by providing either unique protein sequences that are not found in other databases [ e.g. ensembl ( 7 ) ] , or unique protocols for data processing [ e.g. ncbi refseq ( 8) ] . the continuous and rapid growth of the sequence space demands for a sophisticated high - performance computing infrastructure to pre - calculate the sequence similarities of all new sequences and their sequence - based features immediately after the import of new sequences even in case of simap s incremental implementation . the simapboinc public resource computing project ( 9 ) steadily provides compute power beyond the current need and thus enables rapid updating of simap . table 1.number of protein entries and non - redundant sequences of the major protein sequence databases included in simap as of september 2009databaseprotein entriesnon - redundant sequencesncbi genbank16 146 01813 065 886ncbi refseq8 181 9106 681 186uniprot / trembl8 926 0167 586 794uniprot / swissprot495 880416 496pdb139 10641 445pedant5 480 4425 389 911ensembl1 094 4821 062 197 number of protein entries and non - redundant sequences of the major protein sequence databases included in simap as of september 2009 with the breakthrough of next generation sequencing methods and their application to environmental samples ( 10 ) , metagenomic sequences have indelibly expanded the protein sequence space to non - culturable organisms and environmental communities . however , the pioneering global ocean sampling ( gos ) project ( 11 ) so far remains the only metagenomic dataset of which protein sequences are represented in a major public sequence database [ ncbi genbank ( 4 ) ] . all other metagenomes are if at all deposited in distributed resources as the whole genome shutgun ( wgs ) section of ncbi genbank ( 4 ) or the img / m database ( 12 ) . no standardized protocol for gene calling and the annotation of protein - coding sequences has been established so far for these data collections . as the consistent annotation of metagenomes is indispensable for any downstream comparative analysis such as comparisons of taxonomic or functional profiles between different metagenomes , an extension of simap was implemented that extracts coding sequences from metagenomic sequencing reads , assembled contigs and scaffolds in a consistent way . this part of simap covering environmental sequence fragments is monthly synchronized with three major repositories of metagenomes ( table 2 ) . entirely redundant metagenomes are considered only once , whereas redundant representations of the same project differing in their total number of nucleotides ( e.g. the whale fall samples in img / m and genbank wgs ) are retained . similar to the methodology used by the gos project ( 13 ) , coding sequences are extracted from the nucleotide sequences in a multi - step procedure : all open reading frames ( orf ) exceeding a length of 90 nt are extracted from the nucleotide sequences of a metagenome , all - against - all protein sequence similarities between all orfs in a metagenome are calculated using the simap software ( 3 ) : first a fasta ( 5 ) similarity search against the low - complexity masked sequences down to the blosum50 ( 14 ) score of 80 is performed without restricting the number of hits , thereafter the alignments are re - calculated without low - complexity masking , orfs are weighted by the number and score of their sequence alignments ; shadow orfs are detected by their overlap with higher weighted orfs and removed using the methodology and parameters as in the gos project ( 13),remaining orfs having a length of at least 60 aa are imported into the main simap database , all - against - all protein sequence similarities between all orfs of a metagenome and all other protein sequences in simap are calculated as in step 2,again , shadow orfs are removed as in step 3 . table 2.number of metagenomic samples and extracted protein - coding sequences in simap as of september 2009databasemetagenomic samplesnon - redundant sequencescamera ( jcvi)546 031 109ncbi genbank / wgs section1304 244 008img / m ( jgi)652 833 359 all open reading frames ( orf ) exceeding a length of 90 nt are extracted from the nucleotide sequences of a metagenome , all - against - all protein sequence similarities between all orfs in a metagenome are calculated using the simap software ( 3 ) : first a fasta ( 5 ) similarity search against the low - complexity masked sequences down to the blosum50 ( 14 ) score of 80 is performed without restricting the number of hits , thereafter the alignments are re - calculated without low - complexity masking , orfs are weighted by the number and score of their sequence alignments ; shadow orfs are detected by their overlap with higher weighted orfs and removed using the methodology and parameters as in the gos project ( 13 ) , remaining orfs having a length of at least 60 aa are imported into the main simap database , all - against - all protein sequence similarities between all orfs of a metagenome and all other protein sequences in simap are calculated as in step 2 , again , shadow orfs are removed as in step 3 . number of metagenomic samples and extracted protein - coding sequences in simap as of september 2009 compared to the supervised gene prediction methods as used in other metagenomic resources , the procedure applied in simap is not biased towards any taxonomic group ( i.e. prokaryotes ) and only limited by the minimal length of open reading frames in step 1 and 4 . the parameters applied in this procedure ensure optimal sensitivity in detecting coding sequences both in single - exon and multi - exon genes . the derived metagenomic orfs have almost doubled the volume of the known protein sequence space and thus significantly added valuable information ( figure 1 ) . however , metagenomic sequences exhibit lower accuracy compared to completely sequenced genes and genomes , show fragmentation in case of multi - exon genes and lack knowledge of their taxonomic origin . therefore , metagenomic sequences can be excluded when retrieving data from simap according to the individual requirements of the user . figure 1.composition of the non - redundant protein sequence space in simap as of september 2009 . composition of the non - redundant protein sequence space in simap as of september 2009 . many computational methods to support the prediction of protein function are computationally expensive and therefore benefit from comprehensive pre - calculation and incremental updates as the basic design principles of simap . simap thus pre - calculates interpro domains and features ( 2 ) for all sequences including metagenomic orfs ( 15 ) . new releases of interpro are incorporated into simap as soon as they become available ; simap is regularly updated to the latest interpro version ( currently 22.0 ) . simap provides an ideal complete resource for the computation of secondary features such as the functional annotation of protein sequences based on information transfer from annotated proteins . blast2go may serve as an example that provides various annotation tools for the functional classification of proteins ( 16,17 ) . blast2go achieves the automatic functional annotation of dna or protein sequences employing the gene ontology vocabulary . we have adapted the blast2go suite to enable the retrieval of sequence similarities from the simap database instead of performing blast ( 1 ) searches . this step saves an enormous amount of compute - time compared to blast and allows annotating the complete protein sequence space of simap using a few pcs within a week . we have integrated the adapted blast2go program into the monthly update workflow of simap in order to keep the pre - calculated blast2go annotations complete and up - to - date ( table 3 ) . table 3.pre-calculated functional annotations in simap as of september 2009methodnumber of pre - calculated featuresinterproscan133 829 528targetp17 205 439signalp11 060 831tmhmm15 841 454phobius18 488 832blast2go190 801 556 pre - calculated functional annotations in simap as of september 2009 the continuously growing size of simap demands a sophisticated implementation of the database to provide versatile and rapid access to the data with respect to a broad spectrum of use cases . based on the established database and standard middleware components of simap , we have improved the performance and stability of simap through clustering of two independent database and application servers . each of the servers is ready to process more than 2 million complex queries per day . furthermore , we have improved the different data access facilities connecting simap to its users . the matches are starting points for retrieving homologous proteins based on sequence similarity or domain architecture . protein report pages integrate data from simap including interpro and go annotation as well as from external resources as the pedant database ( 18 ) . to facilitate clustering methods , all - against - all matrices of similarity scores can be downloaded for user - supplied groups of proteins . the simpat ( simap access tools ) allows easy access to the simap database using web - service functionality . these can be accessed via the url http://webclu.bio.wzw.tum.de/das/ and provide easy and rapid access to the proteins , sequence similarities , interpro matches and go annotations from simap . these data with the exception of the very huge similarity matrix itself can also be downloaded as flat files from the simap web portal . for research projects interested in parts of the similarity matrix , we provide project specific monthly dumps upon request . the simap database is a unique fundamental resource for computational biology that consequently puts the principle of incremental pre - calculation of sequence similarities and sequence based features into practice . simap as an exhaustive , up - to - date resource to inspect the sequence similarity of any known sequence enables of any type of systematic post - processing with respect to the functional or structural classification of proteins . the recent integration of metagenomic sequences into simap based on a consistent extraction of coding sequences has been beneficial to preserve the comprehensiveness of the sequence space representation in simap . at the same time it makes use of the sequence similarity matrix of simap to resolve overlaps and remove shadow orfs . simap represents to our knowledge the largest and most homogeneous resource for the annotation of coding sequences in metagenomes . it provides an ideal data repository and speed - up for tools as e.g. megan ( 19 ) that extract taxonomic and functional information from similarities between metagenomic orfs and known proteins in major sequence databases . the extended functional annotation of the sequence space through the pre - calculation of go annotations and the improved data access facilities have enhanced the potential of simap in assisting biologists in answering their individual research questions as well as facilitating downstream projects in computational biology at any scale . sun microsystems inc . ( funding a fully equipped x4500 data center server that is hosting parts of the simap database , through a sun academic excellence grant ) , european science foundation ( financial support for stefan gtz through the activity entitled frontiers of functional genomics ) . funding for open access charge : helmholtz zentrum mnchen , german research center for environmental health , neuherberg .

the national institutes of health considers pacific islanders to be an underserved and disadvantaged ethnic subgroup . chamorros , micronesians , tongans , and samoans are the four main groups within the pacific islander populations . the chamorro community is made up of people indigenous to the mariana islands , with guam and saipan being home to the top two largest populations . in 2003 , the leading causes of death for asian americans and pacific islander ( aapi ) were : cancer ( 26.2% ) , diseases of the heart ( 25.3% ) , and cerebrovascular disease ( 9.0% ) . among all us ethnic groups from 1999 to 2003 , aapi women had the lowest age - adjusted overall cancer incidence and mortality rates ; however , breast cancer is the most common cancer for pacific islander women and for chamorro women living in guam . with cancer as a leading cause of morbidity and mortality , intervention efforts are hampered by the limited cancer - related data available to guide the creation of tailored cancer control programs [ 612 ] . there are few published studies focused on predictors of cancer screening targeted for the individual communities within the pacific islander subgroups [ 1315 ] . of the published studies , most focus on the chamorro community in guam , on noncancer health problems , or are outdated [ 9 , 1629 ] . with san diego , california being home to the largest urban population of chamorros outside of guam [ 4 , 7 , 20 ] , the authors were specifically interested in identifying data related to health promotion practices and cancer screening that could be applied to improving the health of that community [ 9 , 12 , 30 ] . the san diego chapter of the national cancer institute - funded pacific islander cancer control network s ( piccn ) board of directors hypothesized that chamorro women would be models of optimal health practices . they based their assumption on the fact that many chamorro families had access to health care through the military and , as military families , they were more likely to have a positive orientation to following directives . furthermore , since english literacy is high among chamorros , health literacy would also likely be high and thereby contribute to better - than - average health knowledge and practices . the leaders of the piccn invited faculty at ucsd to assist them in evaluating the accuracy of their assumptions . additionally , since only limited research has been conducted with chamorro women , this study was also designed to explore predictors of cancer screening . chamorro women would be models of optimal health practices.sociodemographic characteristics , baseline knowledge , and health care variables would significantly predict the likelihood of recent cancer screening . sociodemographic characteristics , baseline knowledge , and health care variables would significantly predict the likelihood of recent cancer screening . piccn board members set up meetings with each of the 11 chamorro community leaders / members at their monthly meetings to raise awareness of the importance of this community campus partnership project and to ask for their cooperation in promoting the community members involvement . the recently updated chamorro directory international ( a telephone directory composed exclusively of those who have self - identified as members of the chamorro community1 ) was used to identify chamorros living in san diego . all san diego entries in the directory were entered into a database and randomly contacted using a computer - generated call list . if a female answered the phone , she was invited to complete the survey if she was at least 21 years of age and reported herself to be of chamorro descent . if a male answered the phone , he was asked to pass the phone call to any female in the household who met the above qualifications . using an institutional review board - approved oral consent protocol , bilingual female university students placed calls throughout the day and evening , 7 days a week , to ensure a diverse sample with minimal selection bias . once an eligible woman was reached , surveyors followed a telephone script to assure that the health - related survey data would be gathered consistently . potential participants were given the option of conversing in chamorro . to reach the sample goal of 250 chamorro women , the surveyors attempted to reach 1,144 of the 1,245 women in the database . of the 894 other women for whom up to 10 call attempts were made , two participants provided incomplete data , 421 attempts failed due to the phone being disconnected , a wrong number , or the person moved . of the remainder , 179 were not interested in participating , 70 resulted in no answer , 34 had no eligible woman available to take the call , and the remainder either offered other reasons ( n = 20 ) or no reason . participants ages ranged from 21 to 91 years old ( m = 40.4 , sd = 13.0 , n = 243 ) . the majority ( 67.6% n = 169 ) reported being born in the mariana islands , with 30.4% ( n = 76 ) in the us mainland and 2.0% ( n = 5 ) elsewhere . for women who were not born in the us mainland , they reported moving to the mainland at 19 years of age on average ( sd = 13.0 , n = 172 ) . nearly all women ( 83.2% , n = 208 ) reported living in the continental united states for most of their lives , while the remainder reported living in guam most of their lives ( 14.4% , n = 36 ) and the rest ( 2.4% ) had spent most of their lives elsewhere . none of the participants availed themselves of the option of conversing in chamorro , preferring to use english . over half had completed at least some college ( 53.8% , n = 133 ; table 1 ) . participants were most likely to report a health care provider as the number 1 source of health information compared to other sources ( table 2 ) . table 1sample demographicscharacteristicwomen 21 + ( n = 250 ) , % ( n)women 40 + ( n = 180 ) , % ( n)insurance yes93.1 ( 230)95.0 ( 171 ) no6.9 ( 17)5.0 ( 9 ) total100.0 ( 247)100.0 ( 180)education high school or lower46.2 ( 114)50.0 ( 90 ) some college or higher53.8 ( 133)50.0 ( 90 ) total100.0 ( 247)100.0 ( 180)place of birth mainland us30.4 ( 76)25.6 ( 46 ) mariana islands67.6 ( 169)72.8 ( 131 ) other2.0 ( 5)2.6 ( 3 ) total100.0 ( 250)100.0 ( 180)what country have you spent most of your life ? mainland us83.2 ( 208)83.9 ( 151 ) guam14.4 ( 36)12.8 ( 23 ) other2.4 ( 6)3.3 ( 6 ) total100.0 ( 250)100.0 ( 180)incomplete data are due to participant nonresponse . percentages may not add to 100% due to roundingtable 2sample health - related characteristicscharacteristicwomen 21 + ( n = 250 ) , % ( n)women 40 + ( n = 180 ) , % ( n)do you have enough breast cancer knowledge ? yes60.0 ( 150)63.9 ( 115 ) no , do nt know40.0 ( 100)36.1 ( 65 ) total100.0 ( 250)100.0 ( 180)do you have prostate cancer knowledge ? yes28.8 ( 72)32.2 ( 58 ) no71.2 ( 178)67.8 ( 122 ) total100.0 ( 250)100.0 ( 180)do you have enough cervical cancer knowledge ? yes36.4 ( 91)35.6 ( 64 ) no , do nt know63.6 ( 159)64.4 ( 116 ) total100.0 ( 250)100.0 ( 180)time since last full health exam less than 2 years78.8 ( 171)79.9 ( 127 ) two or more years21.2 ( 46)20.1 ( 32 ) total100.0 ( 217)100.0 ( 159)time since last cbe less than 2 years77.5 ( 165)74 ( 114 ) two or more years22.5 ( 48)26.0 ( 40 ) total100.0 ( 213)100.0 ( 154)time since last pap exam less than 2 years78.9 ( 168)74.8 ( 113 ) two or more years21.1 ( 45)25.2 ( 38 ) total100.0 ( 213)100.0 ( 151)reported number 1 source of health care information health care provider ( doctor , nurse , doctor s office)35.3 ( 88)35.0 ( 63 ) audio - visual media ( television , news , radio)20.5 ( 51)23.9 ( 43 ) print media ( pamphlet , brochure , books , magazines)14.8 ( 37)15.6 ( 28 ) internet10.4 ( 26)9.4 ( 17 ) family10.0 ( 25)8.3 ( 15 ) self4.4 ( 11)4.4 ( 8) social club , friends , work3.2 ( 8)2.2 ( 4 ) other1.4 ( 3)1.1 ( 2 ) total100.0 ( 249)100.0 ( 180)reported number 1 health risk affecting chamorro women diabetes33.5 ( 83)32.0 ( 57 ) cancer33.1 ( 82)35.4 ( 63 ) cerebrovascular disease ( including stroke and high blood pressure)15.7 ( 39)13.5 ( 24 ) heart disease13.7 ( 34)14.0 ( 25 ) other4.0 ( 10)5.1 ( 9 ) total100.0 ( 248)100.0 ( 178)incomplete data are due to participant nonresponse . percentages may not add to 100% due to rounding incomplete data are due to participant nonresponse . percentages may not add to 100% due to rounding sample health - related characteristics incomplete data are due to participant nonresponse . percentages may not add to 100% due to rounding logistic regression models were used to examine the relationship between all explanatory variables and the two outcomes of interest : a pap exam in the preceding 2 years for women 21 years and older and a clinical breast examination ( cbe ) in the preceding 2 years for women 40 years and older . ( for this study , women were not asked about their most recent mammogram . ) a time frame of 2 years was selected as a reasonable window for defining recent screening behaviors given the fact that screening guidelines vary [ 31 , 32 ] and studies generally report recent breast and cervical cancer screening in the previous 2 years [ 3336 ] . explanatory variables were : recent physicians visit in the preceding 2 years , health insurance , education , age , place of birth ( us mainland or mariana islands ) , self - reported adequacy of cervical and breast cancer knowledge , and perceived health risks among chamorro women ( e.g. , cancer , diabetes , heart disease , and cerebrovascular disease ) [ 9 , 12 , 18 , 30 ] . separate logistic regression models were run for each screening modality ( e.g. , for recent pap exam and recent cbe ) . simple logistic regression models were run to determine the unadjusted odds ratios ( or ) for each independent variable . multivariate logistic regression models were run including significant unadjusted independent variables to determine the adjusted or . piccn board members set up meetings with each of the 11 chamorro community leaders / members at their monthly meetings to raise awareness of the importance of this community campus partnership project and to ask for their cooperation in promoting the community members involvement . the recently updated chamorro directory international ( a telephone directory composed exclusively of those who have self - identified as members of the chamorro community1 ) was used to identify chamorros living in san diego . all san diego entries in the directory were entered into a database and randomly contacted using a computer - generated call list . if a female answered the phone , she was invited to complete the survey if she was at least 21 years of age and reported herself to be of chamorro descent . if a male answered the phone , he was asked to pass the phone call to any female in the household who met the above qualifications . using an institutional review board - approved oral consent protocol , bilingual female university students placed calls throughout the day and evening , 7 days a week , to ensure a diverse sample with minimal selection bias . once an eligible woman was reached , surveyors followed a telephone script to assure that the health - related survey data would be gathered consistently . potential participants were given the option of conversing in chamorro . to reach the sample goal of 250 chamorro women , the surveyors attempted to reach 1,144 of the 1,245 women in the database . of the 894 other women for whom up to 10 call attempts were made , two participants provided incomplete data , 421 attempts failed due to the phone being disconnected , a wrong number , or the person moved . of the remainder , 179 were not interested in participating , 70 resulted in no answer , 34 had no eligible woman available to take the call , and the remainder either offered other reasons ( n = 20 ) or no reason . participants ages ranged from 21 to 91 years old ( m = 40.4 , sd = 13.0 , n = 243 ) . the majority ( 67.6% n = 169 ) reported being born in the mariana islands , with 30.4% ( n = 76 ) in the us mainland and 2.0% ( n = 5 ) elsewhere . for women who were not born in the us mainland , they reported moving to the mainland at 19 years of age on average ( sd = 13.0 , n = 172 ) . nearly all women ( 83.2% , n = 208 ) reported living in the continental united states for most of their lives , while the remainder reported living in guam most of their lives ( 14.4% , n = 36 ) and the rest ( 2.4% ) had spent most of their lives elsewhere . none of the participants availed themselves of the option of conversing in chamorro , preferring to use english . over half had completed at least some college ( 53.8% , n = 133 ; table 1 ) . participants were most likely to report a health care provider as the number 1 source of health information compared to other sources ( table 2 ) . table 1sample demographicscharacteristicwomen 21 + ( n = 250 ) , % ( n)women 40 + ( n = 180 ) , % ( n)insurance yes93.1 ( 230)95.0 ( 171 ) no6.9 ( 17)5.0 ( 9 ) total100.0 ( 247)100.0 ( 180)education high school or lower46.2 ( 114)50.0 ( 90 ) some college or higher53.8 ( 133)50.0 ( 90 ) total100.0 ( 247)100.0 ( 180)place of birth mainland us30.4 ( 76)25.6 ( 46 ) mariana islands67.6 ( 169)72.8 ( 131 ) other2.0 ( 5)2.6 ( 3 ) total100.0 ( 250)100.0 ( 180)what country have you spent most of your life ? mainland us83.2 ( 208)83.9 ( 151 ) guam14.4 ( 36)12.8 ( 23 ) other2.4 ( 6)3.3 ( 6 ) total100.0 ( 250)100.0 ( 180)incomplete data are due to participant nonresponse . percentages may not add to 100% due to roundingtable 2sample health - related characteristicscharacteristicwomen 21 + ( n = 250 ) , % ( n)women 40 + ( n = 180 ) , % ( n)do you have enough breast cancer knowledge ? yes60.0 ( 150)63.9 ( 115 ) no , do nt know40.0 ( 100)36.1 ( 65 ) total100.0 ( 250)100.0 ( 180)do you have prostate cancer knowledge ? yes28.8 ( 72)32.2 ( 58 ) no71.2 ( 178)67.8 ( 122 ) total100.0 ( 250)100.0 ( 180)do you have enough cervical cancer knowledge ? yes36.4 ( 91)35.6 ( 64 ) no , do nt know63.6 ( 159)64.4 ( 116 ) total100.0 ( 250)100.0 ( 180)time since last full health exam less than 2 years78.8 ( 171)79.9 ( 127 ) two or more years21.2 ( 46)20.1 ( 32 ) total100.0 ( 217)100.0 ( 159)time since last cbe less than 2 years77.5 ( 165)74 ( 114 ) two or more years22.5 ( 48)26.0 ( 40 ) total100.0 ( 213)100.0 ( 154)time since last pap exam less than 2 years78.9 ( 168)74.8 ( 113 ) two or more years21.1 ( 45)25.2 ( 38 ) total100.0 ( 213)100.0 ( 151)reported number 1 source of health care information health care provider ( doctor , nurse , doctor s office)35.3 ( 88)35.0 ( 63 ) audio - visual media ( television , news , radio)20.5 ( 51)23.9 ( 43 ) print media ( pamphlet , brochure , books , magazines)14.8 ( 37)15.6 ( 28 ) internet10.4 ( 26)9.4 ( 17 ) family10.0 ( 25)8.3 ( 15 ) self4.4 ( 11)4.4 ( 8) social club , friends , work3.2 ( 8)2.2 ( 4 ) other1.4 ( 3)1.1 ( 2 ) total100.0 ( 249)100.0 ( 180)reported number 1 health risk affecting chamorro women diabetes33.5 ( 83)32.0 ( 57 ) cancer33.1 ( 82)35.4 ( 63 ) cerebrovascular disease ( including stroke and high blood pressure)15.7 ( 39)13.5 ( 24 ) heart disease13.7 ( 34)14.0 ( 25 ) other4.0 ( 10)5.1 ( 9 ) total100.0 ( 248)100.0 ( 178)incomplete data are due to participant nonresponse . percentages may not add to 100% due to rounding incomplete data are due to participant nonresponse . percentages may not add to 100% due to rounding sample health - related characteristics incomplete data are due to participant nonresponse . logistic regression models were used to examine the relationship between all explanatory variables and the two outcomes of interest : a pap exam in the preceding 2 years for women 21 years and older and a clinical breast examination ( cbe ) in the preceding 2 years for women 40 years and older . ( for this study , women were not asked about their most recent mammogram . ) a time frame of 2 years was selected as a reasonable window for defining recent screening behaviors given the fact that screening guidelines vary [ 31 , 32 ] and studies generally report recent breast and cervical cancer screening in the previous 2 years [ 3336 ] . explanatory variables were : recent physicians visit in the preceding 2 years , health insurance , education , age , place of birth ( us mainland or mariana islands ) , self - reported adequacy of cervical and breast cancer knowledge , and perceived health risks among chamorro women ( e.g. , cancer , diabetes , heart disease , and cerebrovascular disease ) [ 9 , 12 , 18 , 30 ] . separate logistic regression models were run for each screening modality ( e.g. , for recent pap exam and recent cbe ) . simple logistic regression models were run to determine the unadjusted odds ratios ( or ) for each independent variable . multivariate logistic regression models were run including significant unadjusted independent variables to determine the adjusted or . hypothesis # 1 was proven true women s likelihood of having health insurance and rates of pap exams were consistently higher than the average in california and the nation.most of the sample ( 93.1% , n = 230 ) reported having health insurance , and this was at a rate that was higher than national and state percentages . in 2004 , 84.3% of the nation had health insurance and , from 2002 to 2004 , 81.6% of californians had health insurance .many of the sample s chamorro women ( 78.9% , n = 168 ) reported having had a pap exam within the previous 2 years,2 with 92.6% ( n = 199 ) in the previous 3 years . in 2004 , 85.9% of the women nationally and 84.8% of california women had a pap exam in the previous 3 years ( http://www.cdc.gov/brfss/index.htm).depending on the screening guidelines used for cbe , 42.9% ( n = 66 ) of the chamorro women 40 years and older had a cbe in the past year and 74% ( n = 144 ) had a cbe in the past 2 years ( see table 2 ) . equivalent state and national data were not available for cbe.when asked to list the most commonly occurring diseases among chamorro women , they listed the correct diseases for the aapi community , although not in the exact order of magnitude . study participants listed : diabetes ( 33.5% , n = 83 ) ; cancer ( 33.1% , n = 82 ) ; cerebrovascular disease ( 15.7% , n = 39 ) ; heart disease ( 13.7% , n = 34 ) ; and other ( 4.0% , n = 10 ; table 2 ) . in 2003 , the leading causes of death for the aapi community were cancer ( 26.2% ) , diseases of the heart ( 25.3% ) , cerebrovascular disease ( 9.0% ) , and accidents / unintentional injuries ( 4.9% ) . hypothesis # 2 was partially supported adjusting for all other variables , a recent full exam significantly predicted the likelihood of recent cbe and pap exam.table 3 displays the results from the simple logistic regression analyses revealing unadjusted or and corresponding 95% confidence intervals ( 95% ci ) for both recent pap exam and recent cbe models . having a recent full exam in the previous 2 years ( or = 28.191 ) , being born in the us mainland ( or = 2.596 ) , self - reported adequacy of cervical cancer knowledge ( or = 2.153 ) , and breast cancer knowledge ( or = 2.370 ) were significant independent predictors of having had a recent pap exam . increasing age ( or = 0.950 ) was inversely related to having had a pap exam . table 3unadjusted orrecent pap exam 21 + ( in the previous 2 years)recent cbe 40 + ( in the previous 2 years)or95% cinor95% cinrecent full exam28.191 * 11.47169.28219616.406 * 6.21743.295145health insurance1.2600.3864.1122121.4590.3476.131154education1.0560.5442.0482120.9420.4571.941154age ( years)0.950 * 0.9230.9782090.9710.9341.009154place of birth2.596 * 1.1335.9502081.0830.6241.882154cervical cancer knowledge2.153 * 1.0214.5392131.7590.8133.804154breast cancer knowledge2.37 * 1.2154.6242132.221 * 1.0594.659154perceived health risk cancer1.3630.6532.8432111.0000.4612.168152 diabetes0.6600.3361.2962112.3930.9675.920152 heart disease1.7310.5685.2742111.2370.4263.596152 cerebrovascular disease1.1010.4472.7162110.4830.1831.274152missing values are due to participant nonresponse . reference categories are no for all categorical variables except place of birth [ 1 = us mainland , 0 = mariana islands ( reference category)]95% ci 95% confidence interval*p < 0.05approaching significancehaving a recent full exam in the previous 2 years ( or = 16.406 ) and self - reported adequacy of breast cancer knowledge ( or = 2.221 ) were significant independent predictors of having had a recent cbe for women 40 years and older.table 4 displays the results from the multivariate logistic regression analyses revealing the adjusted or and corresponding 95% ci for both recent pap exam and recent cbe models . adjusting for all other variables in the model ( place of birth , perceived cervical cancer knowledge , and perceived breast cancer knowledge ) , having a recent full exam in the previous 2 years ( or = 42.703 ) was a significant predictor of having a recent pap exam and increasing age ( or = 0.929 ) continued to be inversely related to the likelihood of having had a recent pap exam . adjusting for the other variable in the model ( breast cancer knowledge ) , having a recent full exam in the previous 2 years ( or = 15.344 ) was a significant predictor of having had a recent cbe exam for women 40 years and older . thus , after adjusting for all other variables , having had a recent full exam was the most significant predictor of likelihood of recent breast and cervical cancer screening . table 4adjusted oror95% cirecent pap exam 21 + ( in the previous 2 years ; n = 187 ) recent full exam42.703 * 13.637133.715 age ( years)0.929 * 0.8850.977 place of birth2.140.6576.973 cervical cancer knowledge0.9150.2783.009 breast cancer knowledge1.7320.5785.189recent cbe 40 + ( in the previous 2 years ; n = 143 ) recent full exam15.344 * 5.75140.939 breast cancer knowledge1.4340.5703.608missing data are due to participant nonresponse . reference categories are no for all categorical variables except place of birth [ 1=us mainland , 0=mariana islands ( reference category)]95% ci 95% confidence interval*p < 0.05 missing values are due to participant nonresponse . reference categories are no for all categorical variables except place of birth [ 1 = us mainland , 0 = mariana islands ( reference category ) ] 95% ci 95% confidence interval approaching significance missing data are due to participant nonresponse . reference categories are no for all categorical variables except place of birth [ 1=us mainland , 0=mariana islands ( reference category ) ] 95% ci 95% confidence interval results showed that , after adjusting for covariates , having had a recent full exam was the strongest predictor of a recent pap exam for women 21 years and older and recent cbe for women 40 years and over . while being younger predicted the likelihood of having had a pap exam , cervical cancer is a concern for women of all ages . while there were relatively high rates of cervical screening compared to state and national averages , the annual cbe rate was still only 42.9% and 74% for the past 2 years , offering another area in which cancer educators and primary care providers could be focusing on increasing screening rates . for health educators and health care providers , no other independent variable was more predictive of adherence to cbe and pap exam guidelines than undergoing an annual examination . the encouragement to have an annual physical examination thus appears to be the single most important message health educators need to convey . the foot - in - the - door theory [ 38 , 39 ] has potential applications here . once a woman has committed to undergoing an annual exam , she may be likely to be more receptive to other recommendations for screening , and this may be particularly so for these chamorro women who report that their health care provider is their leading source of health care information . thus equally important , the clinicians must be vigilant in assuring that , when women do come for their annual exams , they are offered the full panel of recommended screening guidelines . since the annual exam is so highly correlated with adherence to screening guidelines , those health care providers who have systems that remind women that it is time for their annual examination will be simultaneously increasing adherence to screening guidelines . this finding raises concern for the well being of those women who do not have a regular physician or those who do not routinely see any doctor . they may be the most at - risk group for late - stage cancer detection . studies have addressed the potential value of offering cancer screening recommendations in the emergency department and urgent care clinics , places that may be particularly important for those women without regular contact with a health care provider [ 4043 ] . limitations of this study were the narrow geographic area from which the study participants were recruited and the participants high rates of health insurance coverage and levels of education that may have positively biased this sample s cancer screening behaviors in comparison to chamorros living in other parts of the country . however , the 250 women who participated in this study represent a relatively large sample size given the size of the mainland chamorro population and when compared to previous studies and this may offer some compensation . of the chamorro women in the continental united states , previous sample sizes range from 128 to 404 chamorro women ( i.e. , [ 4 , 5 , 9 , 12 , 18 , 30 , 44 ] ) . a strength of this study was the community campus partnership that prompted this study and that the study s questions arose from the community itself . as a result , the piccn s board members actively promoted study participation throughout san diego s chamorro community . the community took pride in updating and expanding their directory , and ultimately , creating a research tool of considerable value in making a community needs assessment . as a result , it proved useful in identifying and recruiting a diverse sample of chamorros , an otherwise difficult task to accomplish in such a close - knit , yet hard - to - reach community . in spite of these strengths additional studies are required to further investigate the causal role of access to health care ( e.g. , quality and type of health insurance ) and cultural health beliefs in relation to cancer screening and rescreening among chamorro women living in the mainland united states .

for a lot of patients who are seeking facial rejuvenation , injectable filling agents show great promise to improve somebody s appearance without surgery . according to the american society of aesthetic plastic surgery , it has been recently reported that more than 5 million procedures have been performed using cosmetic injectable compounds , and more than 85% of all dermal filler procedures have been based on a hyaluronic acid - derived filler.1 hyaluronic acid is a nonsulfated , naturally occurring glycosaminoglycan with a structure consisting of alternately repeating d - glucuronic acid and n - acetylglucosamine units found in several tissues , with the highest concentration occurring in humans in the extracellular matrix of soft connective tissue.2 in the hands of experienced physicians , hyaluronic acid can be safely used as a filler , although complications , such as bruising and necrosis , may occur and need to be managed promptly.3,4 although the procedures can be generally considered simple and safe , it is important that , because of the widespread clinical use of hyaluronic acid - based fillers , physicians performing these procedures consider the possible consequences and are prepared for their management . 5 for example , prior to facial rejuvenation procedures , further , even if the risk of bacterial biofilm development on the injected filling agent and virulence are rare , these potential complications must be taken into consideration.6 this report describes a rare case of bacterial biofilm formation on hyaluronic acid filler deeply injected into the cheeks , probably spread from improper endodontic treatment of tooth 16 ( first molar ) . hyaluronic acid has been extensively studied in relation to markers of inflammation , oxidative stress , and immune system because it has applications not only in aesthetic medicine , but also in other clinical fields , including ophthalmology , traumatology , urology , and nanomedicine.7 especially with regard to the latter , hyaluronic acid has been used for drug delivery and therefore it has become of key importance to understand its relationship to pathogens and to study its effect on inflammatory mediators , the immune system , and markers of oxidative stress . for instance , hyaluronic acid has been used to transport chemotherapeutic drugs.8 it has been shown to be useful when administered intraperitoneally for improving the effects of paclitaxel in gastric cancer.9 furthermore , an experimental study of hyaluronic acid - conjugated butyric acid has showed rapid cellular uptake in a human breast carcinoma cell line.10 another example of the use of hyaluronic acid , to target cells and tissues delivering peptides , comes from a study using hybrid nanoparticles containing hyaluronic acid and iron oxide which showed high efficiency due to highly specific targeting of cd44 , a hyaluronic acid binding receptor found on the surface of tumor cells and inflammatory cells.11 in the field of ocular drug delivery , hyaluronic acid has been used to modify chitosan nanoparticles , indicating that it might enhance their mucoadhesiveness and efficiency.12 with regard to the effect of hyaluronic acid on inflammatory mediators , immune cells , and oxidative stress , it has been observed that hyaluronic acid produces a low - grade inflammatory response when it stimulates peripheral blood mononuclear cells.13 the same study also showed a slight increase in the production of interferon- and higher expression of cd25 , cd69 , and cd71 in phytohemagglutinin - stimulated peripheral blood mononuclear cells from patients who underwent hyaluronic acid filler injections and displayed adverse effects . as far as oxidative stress is concerned , another study investigated the role of chitotriosidase , ykl-40 ( a member of the chitinase - like proteins ) , and myeloperoxidase in inflammatory adverse reactions related to dermal fillers in 169 users in order to understand their relationship with the development of clinical symptoms.14 this study showed : ( 1 ) a significant rise in circulating myeloperoxidase protein levels associated with more severe adverse reactions in dermal filler users in the absence of infection which was linked to an increased inflammatory interaction , augmented adhesion of circulating leukocytes to vascular endothelial cells and endothelial dysfunction ; ( 2 ) elevated plasma chitotriosidase activity in the majority of dermal filler users , particularly those with adverse reactions , underscoring a greater activity of monocytes / macrophages in these patients ; ( 3 ) an increase in plasma ykl-40 expression in dermal filler users with or without clinical adverse reactions ; ( 4 ) a significant increase in plasma fluorescent lipid peroxidation products ( an indirect measurement of macromolecular peroxidation ) in dermal filler users with and without adverse reactions ; ( 5 ) a significant increase in concentrations of advanced oxidation protein products ( a marker of oxidative damage to proteins ) that were similarly increased in filler users with and without adverse reactions , as compared with controls.14 with regard to the relationship between hyaluronic acid and pathogens , we have recently reported an analysis of the interactions between hyaluronic acid and viruses , bacteria , and fungal species . for instance , hyaluronic acid inhibits coxsackievirus b5 ( coxb5 ) , mumps virus ( mv ) and influenza virus strain wsn33 ( a / h1n1 ) , herpes simplex virus type 1 and porcine parvovirus ( ppv ) , while it exerts no activity against adenovirus-5 ( adv-5 ) , human herpes virus-6 ( hhv-6 ) , and porcine reproductive and respiratory syndrome virus ( prrsv).15 in terms of bacterial and fungal species , staphylococci , enterococci , streptococcus mutans , two escherichia coli strains , pseudomonas aeruginosa , candida glabrata , and candida parapsilosis exhibit hyaluronic acid dose - dependent growth inhibition , while e. coli atcc 13768 and candida albicans do not exhibit any effect , and streptococcus sanguinis is favored by high hyaluronic acid dose.16 in summary , hyaluronic acid produces changes in the immune system , inflammatory mediators , and markers of oxidative stress , and may interact with pathogens . this evidence should be taken into account when performing hyaluronic acid - based delivery of drugs and medical procedures in clinical practice . a 37-year - old woman required correction of flattened cheeks as a result of aging . after discussing a variety of treatment options with the patient the procedure was performed at our aesthetic clinic ( academy of face sculpturing , warsaw , poland ) . the patient was in excellent health and her endodontic condition was good , as assessed by objective examination . no chronic diseases were reported , and she did not report taking any medicines . the patient had had an orthodontic appliance installed several months prior to the procedure without any reported problems . a lidocaine - prilocaine anesthetic cream was applied to the external cheek area prior to the procedure . a total of 1 ml of hyaluronic acid ( restylane subq ; q - med , poland ) was injected into each cheek via a 23-gauge needle introduced at the apex of the zygomatic arch directed towards her orbicularis oculi and zygomaticus muscles . treatment also included administration of 1 ml of hyaluronic acid ( restylane ; q - med ) into both her nasolabial folds and 1 ml of hyaluronic acid ( restylane lipp ; q - med ) into her lips in the area of the vermillion border and orbicularis oris muscles in order to improve their appearance . three months later , the patient returned to the clinic because of a firm swelling , approximately 2 cm in diameter , in the area of the left zygomatic arch . antibiotic therapy was started ( clindamycin 300 mg , four times per day ) along with prednisone ( encorton 20 mg , once a day ) . the inflammatory process caused an increase in swelling , resulting in accumulation of an unknown fluid which was mobile and ballotable with increased tension in her skin ( figure 1 ) . laboratory blood tests ( table 1 ) showed results consistent with acute inflammation of bacterial etiology , and no signs of an allergic reaction were present ( table 1 ) . intraoral incision and drainage of a cheek abscess was performed , with intraoral drains placed to allow drainage of abundant purulent discharge . the pus was sent for microbiological tests ( with clinical material analysis and microbiological identification of aerobic bacteria , anaerobic bacteria , and yeast - like fungi performed in accordance with standard laboratory procedures recommended by the clinical and laboratory standards institute ) . biochemical identification of microorganisms and antimicrobial susceptibility tests were performed using the vitek 2 system ( biomerieux , basingstoke , hampshire , uk ) . computerized tomography and dental pantomography ( kodak 9000 c 3d ) were performed and indicated possible spreading of bacterial process from improper endodontic treatment of tooth 16 ( figure 2 ) . antibiotic treatment was changed to amoxicillin 875 mg and clavulanic acid 125 mg twice a day , along with metronidazole 500 mg three times a day . extraction of tooth 16 was performed 11 days after insertion of drains into the abscess . at the same time , a small aggregation of pus located in the same general area was incised and evacuated . biochemical identification of microorganisms and antimicrobial susceptibility tests , performed using the vitek 2 system , were also performed . microbiological testing indicated the presence of strains of enterococcus faecalis , lactococcus lactis cremoris , and streptococcus mitis . extraction of the tooth that had caused the inflammatory infection , along with the evacuation of the abscess and concomitant antibiotic therapy , resulted in a complete reversal of the pathological process ( figure 3 ) . two months later , 2 ml of hyaluronic acid ( princess volume , leobendorf , austria ) was injected into the patient s left cheek ( figure 4 ) . no further complications were observed in the year following hyaluronic acid augmentation into her left cheek . according to the literature , hyaluronic acid - based filler injections can be considered safe , but complications may develop as it has been previously reported . this report highlights the need to carry out careful dental restoration before any aesthetic treatment of the face . it is likely that biofilm can form on all materials that are administered , despite the depth of injection . since hyaluronic acid is retained within the body for only a short period of time because of the action of hyaluronidase ( the tissue half - life of hyaluronic acid ranges from hours to days ) , the biofilm rapidly biodegrades along with hyaluronic acid.17 therefore , this complication should be considered solely with extended - duration hyaluronic acid material . to avoid such complications in the future , a study of the nature of biofilm specifically created on hyaluronic acid should be performed . the injection of fillers can increase the risk of bacterial infections because of improper or inadequate disinfection of the skin , presence of potential pathogens , such as the patients own microflora , eg , propionibacterium acnes , staphylococcus epidermidis , and mycobacteria , decreased immunity , and poor injection technique . all implanted materials induce the normal body reaction to foreign compounds , but the strength of the reaction varies . 18 macrophages , lymphocytes , plasma cells , and foreign body giant cells are usually found.19 bacteria , introduced during hyaluronic acid implantation , can cause untoward reactions mainly attributable to bacterial biofilm formation . in the case of bacteria within biofilm , the resistance of these bacteria to antibiotics is 1000 times greater and treatment of untoward reactions requires a larger dose of antibiotics.18 side effects are quite rare , but occur 0.1%0.5% of the time , depending on the type of fillers utilized . these reactions can occur immediately , several weeks , months , or even years after injection of the filler . a sterile abscess that may have formed as part of a foreign body reaction caused by introduction of hyaluronic acid into the cheek or it may have resulted from an abscess of the infected tooth . abscesses of this type have been reported after administration of hyaluronic acid in aesthetic procedures and in treatment of urinary stress incontinence.2022 the reason for this reaction is not known , but an allergic origin or a foreign body reaction can be hypothesized.23,24 undoubtedly , the physicochemical properties of the preparation and the injection technique may have a decisive impact on the occurrence of such complications . with regard to hyaluronic acid , we must consider actual particle size , shape , hydrophobicity , degree of purification , depth and site of administration , and even the diameter of the needle.18,25 allergies can not be triggered , because the hyaluronic acid currently in use is not of animal origin , but it is derived from bacteria . furthermore , in our case , the abscess occurred unilaterally and hyaluronic acid preparation was administered in both cheeks . some researchers believe that reported cases of sterile abscesses , when dealing with a bacterial infection and sterile cultures , stem from the fact that bacteria can be found on the surface of a foreign body ( in this case , the particles of the preparation ) in the form of biofilm . within the liquid mass of the abscess there can be so few bacteria that they are virtually undetectable by conventional microbiological method.26 a sensitive method for the detection of bacteria is known as fluorescent in situ hybridization which utilizes universal probes , such as peptide nucleic acids and fluorochrome - labelled specific dna sequences found in all bacteria and specific only to bacteria . common bacteria forming biofilms are not potentially pathogenic and the presence of biofilm does not produce acute symptoms ; it can be slow and asymptomatic for months or years , and may activate and exacerbate only in special cases , such as an injury . the second possibility is that our case was one of maxillary osteomyelitis . in patients without filling material , a cheek abscess is usually an odontogenic infection . in our patient , this possibility , exists primarily because of the pantogram indicating an inflammatory process in the region of the tooth . however , the negative cultures tend to negate this possibility even if the patient had received clindamycin prior to the collection of cultures , and this could explain the negative test results . the causes of periodontal infection are mainly anaerobic flora , and clindamycin is particularly active against anaerobes . from the small reservoir of pus under the tooth , e. faecalis can cause inflammation , especially in combination with other microorganisms , and is intrinsically resistant to clindamycin used in empirical therapy and could be responsible for biofilm and further abscess formation . the infectious nature of this abscess was indicated by test results showing elevated levels of leukocytes , neutrophils , d - dimers , and fibrinogen . with the available test results , it is difficult to determine the primary cause of the described complications . most likely it was a tooth that was not completely restored to a healthy state endodontically . however , it is quite possible that the cheek abscess would not have formed if the filler had not been injected . the filler acted as a substrate for bacterial biofilm formation which favored the development of the abscess . it is worth mentioning that the filler was injected into both cheeks , but the problem appeared only on the side of the infected tooth . in order to better diagnose this type of complication better , there should have been microbiological samples of the purulent matter prior to administration of any antibiotics . we want to emphasize that the present case report , based on the present diagnostic medical standard , did not prevent biofilm development . therefore , we propose the introduction of fluorescent in situ hybridization into clinical practice when we are facing a probable biofilm - related infection due to its high reliability . this procedure would allow us to detect biofilm and start antibiotic therapy promptly , allowing its immediate resolution . furthermore , based on the present case report , we suggest that a pantomogram , which is an easy and cost - effective test , should be performed before a cosmetic procedure involving a hyaluronic acid injection . due to the widespread use of hyaluronic acid , not only in aesthetic medicine , but also in an effort to achieve more efficient drug delivery , it is of vital importance to determine how biofilm may form when hyaluronic acid - based fillers are used . therefore , it is important to analyze this and other case reports , as well as undertake larger clinical studies to determine if hyaluronic acid is involved in the formation of biofilm . it is also possible that , in the near future , studies focusing on changes in the hyaluronic acid molecule may help to limit the complications associated with hyaluronic acid injection , making hyaluronic acid - based procedures safer .

a 35 year old woman presented with lower abdominal pain , vaginal bleeding , and dyspareunia . during gynecological diagnostic laparoscopy , a pelvic floor hernia was suspected , and a general surgical evaluation was sought . at a subsequent laparoscopy , the diagnosis of a left direct inguinal and a right obturator hernia was made . at follow - up at one and six weeks postoperatively , the patient 's complaints of pain had completely resolved . the usual presenting signs and symptoms are non - specific . without conclusive historical or physical findings , this entity , once diagnosed laparoscopically , can be repaired simultaneously via laparoscopic mesh technique . obturator hernia is an anterior pelvic floor hernia which occurs through the obturator canal , adjacent to the obturator vessels and nerve . obturator hernias are acquired lesions that are thought to result from progressive laxity of the pelvic floor which may be associated with multiparity , increasing age and chronically elevated intra - abdominal pressure . reported incidence of obturator hernia ranges from 0.05% to 0.07% of all hernias , making them the most common of all the rare pelvic floor hernias . previous authors have characterized the typical obturator hernia patient as an emaciated , dehydrated , multiparous female . although we may define characteristics of susceptible patients , symptoms of obturator hernia are often vague , making the preoperative diagnosis challenging . symptoms may include abdominal pain , vomiting , howship - romberg sign , recurrent bouts of intestinal obstruction , or a palpable upper thigh mass . for diagnosis and treatment , some authors advocate early use of laparotomy while others prefer preoperative non - invasive diagnostic methods such as ct5 , or contrast radiographs . we present a case of a relatively young woman with an atypically symptomatic obturator hernia diagnosed and repaired laparoscopically . a 35 year old , 72 kg , female presented to her gynecologist with a one year history of lower abdominal pain , dyspareunia , and vaginal bleeding after intercourse . hysteroscopy , fractional dilation and curettage ( d&c ) , and diagnostic laparoscopy were planned . anterior and posterior cul - de - sacs were clear , and both ovaries were normal . photographs of the pelvic floor were taken because of a suspicion of possible disruption in the continuity of the peritoneum . when the images were subsequently reviewed by the general surgeon , bilateral pelvic hernias without incarceration were identified . two additional 12 mm trocars were placed on either side of the abdomen at the umbilical level . the left direct inguinal hernia was treated by simple sac ligation utilizing 2 - 0 vicryl endo loops . the repair of the obturator defect was performed by incising the peritoneum of the anterior abdominal wall above the inguinal ligament , then medially to the right umbilical ligament , and laterally to the right inferior epigastric vessels . the peritoned flap was further developed down to the most caudal aspect of the obturator hernia . the skeletonized obturator defect was then closed by application of two pieces of 3 by 5 inch polypropylene mesh over the right obturator , femoral and inguinal areas . the mesh was stapled to the abdominal wall and cooper 's ligament , with care taken to avoid the epigastric vessels . the peritoneum was then closed over the mesh with staples . the abdominal wall fascial defects were closed with # 1 pds suture using an endoclose device . there were no complications ; the patient recovered uneventfully and was discharged on post - operative day one . at follow - up at one and six months , the patient 's symptoms had completely resolved . obturator hernias account for 1.4% ( 17 of 1178 ) of all hernias of the abdominopelvic wall . to date , approximately 743 cases of obturator hernia have been reported in the english language literature , eight of which were repaired laparoscopically . the majority of patients are between 70 and 90 years old at presentation - exceptionally , a patient as young as 32 days old has been reported . the female pelvis is wider and the obturator canal opening is more triangular with a greater transverse diameter , perhaps providing less resistance to herniation . it is postulated that with severe weight loss there is a decrease in the protective preperitoneal fat from the obturator canal . similarly , conditions associated with increased intra - abdominal pressure ( e.g. , chronic constipation , pulmonary disease , and ascites ) may also thin the preperitoneal fat and predispose patients to all types of hernias . pregnancy and chronic illness also predispose patients to hernia formation by increasing intra - abdominal pressure and relaxing the peritoneum . there are four classic features of an obturator hernia : ( 1 ) a palpable mass in the groin with the patient supine , and the thigh flexed , adducted and rotated laterally ; ( 2 ) intestinal obstruction ; ( 3 ) previous attacks of bowel obstruction resolving spontaneously ; ( 4 ) the howship - romberg sign . the howship - romberg sign is medial thigh and hip pain exacerbated by adduction and medial rotation of the thigh and relieved by thigh flexion . the characteristic clinical profile of previously reported patients is that of an elderly , emaciated woman with concomitant medical illness , but without previous abdominal surgery , presenting with intestinal obstruction . our patient was young , of average weight , and had two prior pregnancies ( although one for twins ) . she had no abnormalities detected on physical examination , nor episodes of bowel obstruction , but had pain with intercourse as her most prominent symptom . although there is no consensus of opinion , previous authors have recommended the abdominal approach to suspected obturator hernias because one can establish the diagnosis , obtain adequate exposure , protect the obturator vessels , and identify and resect compromised bowel when necessary . an abdominal approach through a lower mid - line incision is most favored , although the inguinal approach and the cheatle - henry retropubic approach may also be used . we believe that a laparoscopic approach for suspected obturator hernia is superior to described open techniques . because variable symptomatology makes its preoperative diagnosis difficult , laparoscopy offers a relatively noninvasive method to identify and treat obturator hernias . no special skills are required beyond those now commonly in use for laparoscopic repair of inguinal hernias , and recovery should be shorter than after laparotomy . controversies regarding costs and operative time are analogous to those regarding groin hernias and will be ongoing . appropriate patient selection , sound surgical judgment , and adherence to established principles of laparoscopic repair of the pelvic floor are essential to success .

answer : this is langer 's axillary arch , or axillopectoral muscle , an anatomical variation encountered in the axilla , usually occult in standard imaging assessment , and represents a muscular bundle that originates from the latissimus dorsi , traverses the axilla in front of the axillary neurovascular bundle and finally merges with pectoralis major . it can lead to different symptoms , including neurovascular compression syndrome , lymphoedema and shoulder instability . it has a reported frequency of 412% within the general population ; however , this figure is predominantly based on results from cadaveric studies . the reported incidence in clinical studies surgeons must be aware of such anatomical variations when it comes to breast reconstruction using latissimus dorsi flaps , and when nodal clearance of the axilla is needed .

carbamazepine , a first line antiepileptic belonging to the iminostilbene group , contributes to 46.9% of antiepileptic drug overdose in the united kingdom . we report the occurrence of recurrent and protracted hypoglycemia in the setting of carbamazepine overdose . a 20-year - old pregnant woman at 26-weeks of gestation , on anti - epileptic therapy with carbamazepine presented with a history of consumption of 4000 mg ( 200 mg 20 tablets ) of carbamazepine . following gastric lavage at a local hospital , she was transferred to our hospital 4-hours after ingestion . at presentation glasgow coma score ( gcs ) was 3/15 , pulse rate was 138/min , blood pressure 110/70 mmhg and respiratory rate 25/min . multi - dose activated charcoal therapy ( 50 grams every 6 hours ) was administered . she was shifted to the intensive care unit ( icu ) for ventilation and monitoring . serum carbamazepine level was > 20 g / ml ( therapeutic level 6 - 12 g / ml ) . six hours into admission she developed circulatory shock requiring fluid resuscitation and low dose vasopressors . empiric antibiotic therapy was initiated , which was subsequently discontinued in view of negative cultures , low procalcitonin ( 0.34 ) and absence of a definite focus of infection . on the third day , several episodes of hypoglycemia were observed [ figure 1 ] which was managed initially with bolus doses of 50% dextrose for each episode and subsequently with an infusion of 25% dextrose . the infusion was given for 60 hours following which there were no further episodes of hypoglycemia . other causes of hypoglycemia including drugs , renal or hepatic failure and sepsis were ruled out . serum carbamazepine level on the third day was still elevated ( 17.3 g / ml ) and decreased to sub therapeutic range by the seventh day ( 2.97 g / ml ) . serial blood glucose levels after carbamazepine overdose by day 7 , she was extubated and vasoactive agents were weaned . carbamazepine a drug used for the treatment of trigeminal neuralgia and epilepsy acts by preventing repeated firing of the neurons by prolonging the inactive state of the sodium channels . it is highly protein bound ( 75% ) and is metabolized in liver by cyp 3a4 . it is an inducer of cyp 3a4 and this auto - induction requires up - scaling of doses in chronic use . carbamazepine may produce rash and photosensitivity but serious idiosyncratic reactions such as drug - induced lupus and agranulocytosis are relatively rare . acute hypernatremia , a rare complication of overdose is due to inappropriate anti - diuretic hormone secretion . our patient had neurotoxicity and cardiotoxicity as evidenced by depressed sensorium and prolonged circulatory shock with tachycardia . recurrent and protracted hypoglycemia , which our patient manifested , has not been reported following overdose . although valproic acid can cause hyperinsulinemia , there is no evidence that carbamazepine impacts insulin levels . thus possible mechanisms for hypoglycemia include increased insulin secretion , decreased gluconeogenesis , increased glucose utilization and storage or decreased glucagon release . increased fetal glucose demand may have contributed to hypoglycemia ; the absence of hypoglycemic episodes following recovery from the overdose however suggests other mechanism ( s ) for hypoglycemia . measurement of plasma insulin levels may have helped in ascertaining the mechanism of hypoglycemia , however this was not done for our patient . clinicians need to be aware of this complication and monitor blood glucose in those who present with toxicity .

the myocardial sympathetic nervous system is activated in patients with chronic heart failure ( chf ) and has been shown to be associated with increased mortality . cardiac sympathetic innervation can be scintigraphically visualized by i - metaiodobenzylguanidine ( i - mibg ) , a radiolabelled analog of noradrenalin and has been shown to be a powerful prognostic marker in patients with chf [ 1 , 2 ] . in addition to i - mibg there are many other prognostic markers in patients with chf . estimates of renal function , for example , as measured by creatinine clearance and glomerular filtration rate ( gfr ) , have been associated with mortality and morbidity in chf [ 35 ] . interestingly in patients with chronic renal failure myocardial washout of i - mibg , as a measure of increased myocardial sympathetic activity , has been shown to be increased . however , there is limited data on a direct comparison of the respective prognostic predictive value of sympathetic hyperactivity and renal dysfunction . major clinical trials aimed to assess the prognostic value of i - mibg have often excluded patients with substantial renal failure , further limiting the amount of prognostic information comparing these two variables . furthermore , there are complex interactions between sympathetic regulation of renal function and cardiac function . for example increased sympathetic activity reduces the renal filtration fraction [ 8 , 9 ] and a reduced gfr is associated with a reduced blood clearance of i - mibg . in a recent study it was shown that differences in the rate of renal excretion did not contribute to variability in the mediastinal and myocardial i - mibg uptake . however , whether this reduced blood clearance of i - mibg has any impact on the semiquantitative myocardial parameters is unknown . therefore , the purpose of this study was twofold : ( 1 ) to explore if estimates of renal function could explain variability of i - mibg assessed myocardial sympathetic activity and ( 2 ) to compare the prognostic value of estimates of renal function and myocardial i - mibg assessed myocardial sympathetic activity in patients with chf . the study was designed to reevaluate the results of i - mibg imaging studies and renal function in patients with chf prior to 1 november , 2006 in relation to cardiac events . requirements for inclusion of subjects in this retrospective study were availability of the original digital i - mibg image files ; availability of serum creatinine measurements within 1 month before i - mibg scintigraphy . between january 1 , 1996 and october 31 , 2006 , 39 chf patients visiting the outpatient heart failure clinic met these requirements . renal function was estimated using the serum creatinine - based cockcroft - gault equation ( estimated creatinine clearance : e - cc ) and the abbreviated mdrd equation ( estimated glomerular filtration rate : e - gfr ) [ 12 , 13 ] . chf severity was clinically evaluated according to the new york heart association ( nyha ) classification at the time of imaging . the census date for follow - up was set at the 1 november , 2008 ( at least 24 months follow - up ) . the mean follow - up after i - mibg scintigraphy was 60.1 37.2 months ( range 1149 months ) . reference levels for creatinine were 75110 mol / l for men and 6595 mol / renal function was determined by e - cc using the cockcroft - gault equation and expressed as ml / min : ( 1)e - cc=(140[age(years)])[weight ( kg)][serum creatinine ( mol / l ) ] (1.04 for femals and 1.23 for males ) . the e - gfr was calculated using the abbreviated mdrd equation : ( 2)e - gfr=32788[serum creatinine ( mol / l)]1.154 [age(years)]0.203[0.742 for females ] [1.212 for blacks ] , e - gfr was expressed per 1.73 m of body surface area ( ml / min/1.73 m ) . according to the guidelines for identification , management and referral of adults with chronic kidney disease , patients were stratified to an impaired kidney function ( e - cc or e - gfr < 60 ml / min(/1.73 m ) ) and those with a normal e - cc or e - gfr ( i.e. , 60 ml / min/1.73 m ) . patients underwent myocardial scintigraphy to determine i - mibg uptake reflecting neural norepinephrine reuptake and retention . to block thyroid uptake of free i , all patients received 100 mg potassium iodide orally , one hour prior to the injection of i - mibg . after a subsequent resting period of at least 30 minutes , patients were injected intravenously with approximately 185 mbq ( 5 mci ) of i - mibg ( ge healthcare , eindhoven , the netherlands ) . fifteen minutes ( early imaging ) and 4 h ( delayed imaging ) after mibg administration , a 10-min planar anterior image of the thorax was acquired using a dual - head gamma - camera ( e - cam , siemens , hoffman estate , illinois , usa ) . a 20% energy window was centred on the 159 kev photon peak of i. images were acquired using a medium energy collimator and stored in 128128 matrix . an experienced nuclear medicine technologist processed all planar images on a workstation ( hermes medical solutions , stockholm , sweden ) . the analysis of the myocardial scintigraphy data was performed blind to clinical status and estimates of renal function . i - mibg myocardial activity was measured using a manually drawn region of interest ( roi ) around the lv . the positioning of the fixed mediastinal roi was standardized in relation to the lung apex , the lower boundary of the upper mediastinum , and the midline between the lungs . to evaluate i - mibg myocardial uptake , the heart / mediastinum ( h / m ) ratio was calculated from the early ( early h / m ) and delayed images ( late h / m ) . myocardial i - mibg washout ( wo ) was defined as the percentage of change in activity from the early and delayed images : ( 3){(early h / mlate h / m)early h / m}100% . the primary outcome was defined as cardiac death during follow - up ( aggregated from : death due to acute pulmonary oedema , progressive heart failure , myocardial infarction , or ventricular arrhythmia ) . the secondary outcome was defined as potentially lethal ventricular arrhythmias during follow - up : documented episode of spontaneous sustained ventricular tachycardia ( > 30 s ) ventricular tachyarrhythmia , resuscitated cardiac arrest , or appropriate icd discharge ( antitachycardia pacing or defibrillation ) . long - term follow - up data were obtained from at least one of three sources : visit to the outpatient clinic ; review of the patient 's hospital records ; personal communication with the patient 's physician . the cardiologist was blinded for both the estimates of renal function and the i - mibg scintigraphic data . linear regression was used to examine the relationship between the estimates of renal function ( e - cc and e - gfr ) and the i - mibg scintigraphic data ( i.e. , early h / m , late h / m and washout ) . the overall goodness of fit was expressed as the adjusted r. the f - test was used to assess whether the model explained a significant proportion of the variability . a significant adjusted r would indicate that variation in the scintigraphically determined parameters could be explained by a percentage ( adjusted r ) of change in estimates of renal function . multivariate cox proportional hazard regression analysis was used to investigate the relation between survival and the following parameters : age , gender , several chf variables , estimates of renal function and the i - mibg scintigraphic data . first , several chf variables ( left ventricular ejection fraction ( lvef ) , nyha class , qrs duration ) and i - mibg semiquantitative myocardial parameters ( i.e. , early h / m , late h / m and myocardial washout ) were entered into the model according a stepwise forward likelihood ratio - based method . secondly , the possible additional value of renal function ( e - cc and e - gfr ) was determined . these data were added to the first model according the enter method ( forced addition to the model ) . chi - square , cox proportional hazard regression coefficient ( coefficient b ) , and exponent ( exponent b ) were used to describe the model and relative contribution of the parameters to the model . exponent b is the predicted change in hazard for a unit increase in the predictor ( i.e. , hazard ratio ) . a p value < 0.05 was considered to indicate statistical significance . all statistical analyses were performed with spss ( spss for windows , version 16.0 , spss inc , chicago , il , usa ) . thirty - nine patients with chf were included in this study ; all patients had stable chf . twenty - three patients ( 59% ) had ischemia - related chf and sixteen patients had nonischemic chf . patients with ischemia - related chf had a lower lvef compared to those with nonischemic chf ( p = 0.034 ) . the majority was male ( 62% ) with a mean age of 64.4 10.5 years . at baseline 94.9% of patients were treated with loop diuretics , 82.1% were on angiotensin converting enzyme ( ace ) inhibitor or angiotensin receptor blocker ( arb ) , and 46.2% were on beta - blockers . the mean early h / m ratio was 1.61 0.46 , the mean late h / m was 1.43 0.38 and the mean washout was 10.1 10.4% ( table 2 ) . there was no difference in the i - mibg semiquantitative parameters or in the e - cc and e - gfr between ischemic and nonischemic related chf . there were 17 patients with an impaired renal function based on e - cc ( 39.5 10.5 ml / min , range 1756 ml / min ) and 23 with an impaired renal function based on e - gfr ( 42.0 11.3 ml / min/1.73 m , range 1759 ml / min/1.73 m ) . patients with a decreased e - cc or a decreased e - gfr did not differ in i - mibg semiquantitative parameters compared with patients with a normal e - cc or normal e - gfr ( table 3 ) . the variability in any of the i - mibg semiquantitative parameters could not be explained by either e - cc or e - gfr ( table 4 ) . estimates of renal function could at best explain approximately 3% of the variability of the i - mibg semiquantitative parameters ( p = 0.851 ) . during follow - up 6 of the 39 ( 15.4% ) patients had a cardiac death ; mean interval after i - mibg scintigraphy to cardiac death was 22 months with a range from 4 to 54 months . the cardiac deaths were more likely to have a nonischemic aetiology of heart failure ( p = 0.022 ) . there was a statistically not significant trend towards lower e - cc and e - gfr values for patients with cardiac death compared to survivors ( e - cc 53.4 20.9 versus 67.8 34.5 , p = 0.375 ; e - gfr 49.1 15.7 versus 62.0 26.6 , p = 0.259 , resp . ) . cox proportional hazard regression analysis showed that late h / m was the only independent predictor for cardiac death ( chi - square 3.2 , coefficient b : 4.095 ; standard error : 2.063 ; hazard ratio : 0.17 , 95% ci : 0.0000.950 ) . forced addition of estimates of renal function did not significantly change the chi - square of the model ( figure 1(a ) ) . nine patients developed potentially lethal ventricular arrhythmia : 5 had sustained ventricular tachycardia , 1 patient was resuscitated from a cardiac arrest , and 3 patients had an appropriate icd discharge ( i.e. , antitachycardia pacing ) . cox proportional hazard regression analysis showed that qrs duration was the only independent predictor for a potentially lethal ventricular arrhythmia ( chi - square 8.5 , coefficient b : 0.028 ; standard error : 0.010 ; hazard ratio : 1.028 , 95% ci : 1.0211.049 ) . forced addition of estimates of renal function did not significantly change the chi - square of the model ( figure 1(b ) ) . none of the i - mibg semiquantitative parameters was predictive for a potentially lethal ventricular arrhythmia . semi - quantitative i - mibg myocardial parameters are independent of estimates of renal function . in addition , cardiac sympathetic innervation assessed by i - mibg scintigraphy seems to be superior to renal function in the prediction of prognosis in chf patients . in subjects with a normal kidney function , intravenous administrated i - mibg is almost exclusively excreted via the kidneys within 24 hours after injection with approximately 35% of administered i - mibg already excreted by 6 hours [ 17 , 18 ] . as a reduced gfr is associated with a reduced blood clearance of i - mibg , the excretion of i - mibg is not only dependent on filtration but also by tubular secretion . in short kidney function is essential for the clearance of i - mibg and may therefore influence scintigraphic outcome . however , the results of our study show that the variability in the semiquantitative i - mibg myocardial parameters can not be explained by estimates of renal function . therefore within the time frame of i - mibg cardiac imaging ( up to 4 hours after injection ) , the semiquantitative i - mibg myocardial parameters are independent of renal function . these findings are in line with a recent publication showing that differences in the rate of renal excretion did not contribute to variability mediastinal and myocardial between early and late planar i - mibg images . this is eminent for clinical practice as renal dysfunction is often present in chf patients [ 19 , 20 ] . renal dysfunction is not often present in patients with chf ; the serum creatinine - based estimates of renal function have been shown to be independently related to mortality [ 2125 ] . in addition the sympathetic nervous system is one of the neurohormonal compensation mechanisms that plays an important role in the pathogenesis of chf . activation of this cardiac sympathetic system causes downregulation and desensitization of cardiac beta - adrenoreceptors and modification in the postsynaptic signal transduction which contributes to arrhythmia development , progression of heart failure , and ultimately cardiac death . our results confirm previous findings that increased cardiac sympathetic activity assessed by i - mibg scintigraphy is related to mortality [ 1 , 2 , 26 ] . however , there is limited data on a direct comparison of the respective prognostic predictive value of sympathetic innervation and renal dysfunction . to our knowledge only furuhashi and moroi studied this specific subject . in patients with chf and a preserved gfr ( 60 ml / min/1.73 m ) cox proportional hazard regression analysis showed that late h / m ratio was the only independent predictor of cardiac death . however , the study lacked statistical power to perform cox proportional hazard regression analysis in the patient group with an impaired renal function ( gfr < 60 ml / min/1.73 m ) . the lack of additional prognostic value of renal function in our study might be explained by several different but probably interacting factors . first , the aetiology of chf differs between different studies . in studies with a larger number of patients with ischemia - related cardiomyopathy our patient cohort was not large enough to allow for adequate subgroup analysis and therefore concomitant peripheral vascular disease remains a theoretical explanation for the found discrepancies . secondly , the differences between our results and the findings of others may be related to the prevalence of reduced kidney function . however , even in patients with increased serum creatinine levels ( > 2.5 mg / dl or > 220 mol / l , approximately 3% of the study population ) , opasich et al . were not able to identify renal function as a prognostic indicator . approximately 47% of our study population had at least a moderate impairment of renal function ( i.e. , e - cc or e - gfr < 60 ml / min ( /1.73 m ) ) . prevalence of renal dysfunction does therefore not explain the absence of renal function as a prognostic indicator . the main limitation of this study is the small number of patients collected over an extended period of time when therapeutic guidelines were changing . this is reflected by the fact that the majority of included patients is relatively undertreated according to the current guidelines [ 28 , 29 ] . furthermore the mortality rate seems to be relatively low ( i.e. , 15% ) . however , the mortality rate is in line with the mortality rate as reported by other publications . furuhashi and moroi reported a mortality rate of 11% during a mean follow - up period of 33.7 months and the cardiac mortality rate of the admire - hf study ( 6% during a median follow - up period of 17 months ) . the extrapolation of the prognostic predictive value of our study is probably influenced by these factors . however , it remains that the aforementioned factors have no impact on the finding that semiquantitative i - mibg myocardial parameters are independent of estimates of renal function . semi - quantitative i - mibg myocardial parameters are independent of estimates of renal function . although the findings on the prognostic predictive value of this study should be considered as preliminary , the observations suggest that cardiac sympathetic innervation assessed by i - mibg scintigraphy is superior in the prediction of prognosis in patients with chf to estimates of renal ( dys)function . this finding might be clinically relevant as creatinine clearance is less costly to assess than i - mibg .

the occurence in the kidney and other locations is uncommon [ 3 , 4 ] . most of the reported cases are histologically benign ; there are fewer cases of malignant fibrous tumors . malignant solitary fibrous tumor is a rare neoplasm , which includes therapeutic and prognostic specialties . an 84-year - old woman was admitted to our hospital complaining about a 2-month history of abdominal pain and constipation . despite symptomatology , she referred with a big abdominal diameter that had increased in the last 2 years . abdominal ultrasonography and a ct scan showed a large mass arising from the left kidney , occupying the left abdomen and a part of the right abdomen without metastases ( fig . the patient underwent left radical nephrectomy and resection of peritoneal implantations , which were observed during surgery ( fig . neither chemotherapy nor radiation therapy was carried out , as decided by an urologist , a pathologist and an oncologist . she suffered an early local recurrence with ascites , abdominal pain and peritoneal implantations , as was shown by a ct scan . because of the patient 's advanced age , we opted for a moderate treatment , and she died 3 months after surgery . the gross specimen included a large tumor of 30.7 22.6 18.5 cm overall dimension and 5,050 g weight ; it was well circumscribed and lobulated . the cut section revealed white - brown whirled - appearing tissue , with macroscopic necrosis and hemorrhagic areas . microscopic examination revealed a mesenchymal neoplasm with hyper- and hypocellular areas consisting of spindle cells with elongate , stellate , dense or vesicular nuclei with inconspicuous nucleoli . the cells were arranged in short fascicles , storiform with hemangiopericytoma - like patterns and occasionally separated by strip - like bands of collagen . areas of myxoid stroma were detected as well as focal sheet - like hyalinization and areas of high cellularity showing crowded overlapping nuclei , pleomorphism , nuclear atypia and numerous mitotic figures ( 7 mitoses/10 high - power fields ) . immunohistochemically , the cells were positive for cd34 , cd99 , bcl2 , vimentin and smooth muscle actin , while negative for desmin and hbm45 ( fig . other locations , including the kidney , are extremely rare but existing [ 3 , 5 ] . most of these neoplasms are found in adults , but pediatric cases are also reported . generally , fibrous tumor is a slow - growing neoplasm and its most common location in the kidney is the renal capsule . clinically , some cases , including the present one , can appear as palpable abdominal mass or intestinal obstruction and begin as abdominal pain or gross hematuria . a ct scan is not able to distinguish between carcinomas or sarcomas , and diagnosis is frequently made postoperatively . our patient did not consult a doctor despite an increased abdominal perimeter , which was probably the reason why the diagnosis could only be made so late . malignant solitary fibrous tumor is usually solitary , varies in size and appears in different cystic areas , with hemorrhage or necrosis present . microscopically , it is characterized by both hyper- and hypocellularity , and mitotic activity is between 410/10 high - power fields . in addition , bcl2 , cd99 and vimentin are frequently expressed ; however , keratin , actin , s100 , c - kit and cd31 are usually negative . habitually , solitary fibrous tumor is benign . nevertheless , there are 14 malignant cases reported . indications for malignancy are hypercellularity , cellular pleomorphism and a mitotic rate of more than 4 high - power fields . a differential diagnosis must be made between other mesenchymal tumors such as leiomyoma or leiomyosarcoma , sarcomatoid renal tumor and transitional cell carcinoma [ 3 , 7 ] . there is no standard treatment for malignant solitary fibrous tumor because its occurrence is rare . radical surgery is considered the first choice of treatment . for incomplete resection , poor prognosis some authors suggest radiotherapy or adjuvant chemotherapy , although poor outcomes have been reported for these treatments [ 3 , 4 , 8 ] . in our case , we decided not to opt for adjuvant treatment because the patient was elderly and the literature reports poor outcomes . when local recurrence occurred , it was too late for treatment . in conclusion , the diagnosis must be established as soon as possible ; metastasis in patients with a delayed diagnosis leads to poor prognosis and worse surveillance . fibrous kidney tumor is rare , and we need more patients to include in trials for adjuvant therapy .

certain endoscopic lesions will require to be marked in order to be found at a later stage , either during surgery or at posterior endoscopies . some techniques are available for that purpose , such as radiological tests , the placement of clips , intraoperative endoscopy , or tattooing . the latter is widely used , as different substances can be applied and has a low complication rate in general [ 1 - 3 ] . most of the complications that have been reported in the literature are described in the colon . we present a case of a patient with gastric bleeding secondary to a laceration following tattooing with purified carbon . the patient was a 68-year - old male with a past medical history of diabetes , hypertension , dyslipidemia and ischemic heart disease , for which he required the placement of three stents 2 years before the current episode . the patient was under gastroenterology follow - up for a mucosal lesion in the gastric antrum , 1.3 20 mm in size , detected at a gastroscopy . an endoscopic ultrasonography ( eus ) therefore , the patient underwent an endoscopic mucosectomy and histopathology was consistent with an inflammatory fibroid polyp . nine months later , a second mucosectomy was performed due to the recurrence of the polyp , presenting the same histological findings . one year after that , the lesion recurred for the third time , and decision was made to treat the lesion surgically . a total of 4 ml of sterile solution of highly purified carbon particles was injected into the submucosa sorrounding the lesion at several different spots ( upper and lower quadrants proximal to the polyp 0.5 - 1 ml per injection ) . during the injection , the patient was discharged , but presented to the emergency room ( er ) 4 h later with sudden epigastric pain and hematemesis . on arrival , the patient was hemodinamically stable and on examination , the epigastric area was tender , but without evidence of peritoneal irritation . laboratory workup results were as follows : leukocytes 7.450 10/l ( neutrophils 82% ) , hemoglobin 13.5 g / dl , platelets 148,000/l and a prothrombin time 14.2 s. an urgent gastroscopy was performed , revealing a submucosal extension of the dye from the antrum towards the gastric body . in that area , a deep laceration in the gastric wall was found , measuring several centimeters and oozing blood ( fig . 1 ) . several injections of a diluted solution of adrenaline ( 1:10,000 ) were performed to stop the bleeding . however , given the size of the laceration , it could not be closed with hemoclips . an emergency computed tomography ( ct ) scan was also performed to exclude gastric perforation . the ct scan revealed thickening of the stomach wall , compatible with an intramural hematoma and related inflammatory response , but no pneumoperitoneum , free fluid , or collections were seen . over the 7-day admission , the patient evolved favorably , with no recurrence of bleeding and oral diet could be restarted with no further complications . three months later , the patient underwent surgical resection of the fibroid polyp , wich was located by intraoperative gastroscopy . since palpation is not possible , small lesions , such as polyps , vascular lesions , or diverticula , may go unnoticed [ 1 , 2 ] . to facilitate localization , different techniques are used , such as radiological tests , intraoperative endoscopy , clips or tattooing . tattooing as a method of marking the base of a polyp was first described in 1958 . the use of this technique to locate colonic lesions during surgery was first described in 1975 . ever since , different tattooing agents have been tested , such as indocyanine green , methylene blue , indigo carmine , india ink , or solutions of highly purified carbon particles ( spot ) . the latter two are the most commonly used today because they remain visible 3 - 12 months after tattooing in 68 - 88% of patients [ 6 , 7 ] . other agents such as indocyanine green , are visible for only 3 - 8 days [ 8 , 9 ] , while methylene blue remains for 7 days . if the surgery is performed outside of these time frames , it is possible that the marker will not be identifiable . as a result , various case series have proven the safety and efficacy of these agents to mark lesions in the gastrointestinal tract . none of them reported complications ( table 1 ) [ 1 , 7 - 9 , 11 - 19 ] . most of the avalilable studies involve the colon , but there are also some studies showing safety and efficacy of tattooing techniques in other parts of the gastrointestinal tract , such as the esophagus and the stomach [ 15 , 16 , 20 - 22 ] . however , india ink needs to be diluted and sterilized before use , unlike highly purified carbon particles , which are dispensed ready - to - use . highly purified carbon has proven to be safe and effective , with a low rate of complications [ 17 - 19 ] and in many cases , it is preferred over india ink . the number of complications from tattooing with india ink or highly purified carbon is relatively small , but not rare . most complications are secondary to transmural injections spreading the dye to the submucosa , peritoneum , or pericolic adipose tissue [ 25 - 29 ] . nevertheless , there have been reports of intracavitary and abdominal wall abscesses [ 30 - 32 ] , focal peritonitis [ 33 , 34 ] , hematoma , inflammatory pseudotumor formation [ 36 , 37 ] , idiopathic inflammatory bowel disease , simulated intestinal infarction , intestinal perforation , and mesenteric air embolism . a compilation of the aforementioned complications is shown in table 2 [ 25 - 41 ] . most of the complications reported in the literature refer to the colon and the small intestine . the patient underwent multiple prior mucosal resections , and the subsequent wall fibrosis could have been the cause of the complication . despite the fact that inflammatory fibroid polyps tend to have dilated and abnormal vessels , tattooing is usually performed on the surrounding healthy gastric wall , so it does not seem probable that the laceration could have been a consequence of vascular disruption by the needle , although it can not be completely excluded as a cause . purified carbon is not a biologically inert substance , and given the location and characteristics of the laceration , a chemical reaction with the compounds in the dye could have also played a role . in conclusion , endoscopic tattooing is a very useful tool for the surgical localization of digestive tract lesions . india ink has been used for several decades with a good safety profile and the commercial availability of ready - to - use sterile preparations ( spot ) has led to a wider use of endoscopic tattooing . however , the long - term safety and efficacy data for these compound are limited . one posibility could be extra - enteric bacterial inoculation through the injection needle , but if we consider that carbon particles are not biologically inert , development of chemical reactions producing damage can not be ruled out . further evaluation is needed to compare the different known agents used in such injections , as well as comparison with other marking techniques now in use , such as clips or radiological tests . rljm , cri , fbe and ccr provided conceptual and technical guidance for all aspects of the project . dsa , rfm , mfe , mve and gamr contributed in the clinical and technical aspects of the study .

pain is a protective mechanism which has adaptive value , and the inability to experience pain has been linked to early mortality from accidental injuries or damage to joints.1,2 however , pain in the postoperative setting is an unwanted side effect of surgery directed to improve morbidity or mortality . the potential benefits of optimal postoperative pain control include : improved cardiac , respiratory , and gastrointestinal functions ; fewer thromboembolic complications ; improved arterial graft survival ; fewer septic complications ; reduced chronic post surgical pain ; reduced mortality in high - risk patients ; and reduced health care costs.3 opioids have been the cornerstone of relief for perioperative pain ; however , opioids have numerous side effects including nausea , vomiting , respiratory depression , prolonged ileus , itching , tolerance , and development of opiate induced hyperalgesia.4,5 increasingly , multimodal analgesia is used to reduce perioperative opiate requirements , thus potentially reducing opioid side effects and improving the quality of analgesia.6,7 local anesthetics are increasingly used perioperatively via different routes as part of a multimodal regimen.8 the use of bolus injection of local anesthetics is limited by duration of post operative pain relief with the average duration of block via interscalene injection being 8 to 12 hours with either bupivacaine 0.5% or ropivacaine 0.5% or 0.75%.9 local anesthetic infusions via catheters are used to increase the duration of postoperative analgesia;10 however , placement and maintenance of perineural catheters involves additional training11 in addition to the added cost of pumps.12 complications due to perineural catheters are infrequent but can be life threatening , and these complications can include infection , septicemia , intravascular placement , or intravascular catheter migration.13 the development of new , long acting local anesthetics , like liposomal bupivacaine is potentially important in the management of perioperative pain . this article will review liposomal bupivacaine as a potential addition to the clinician s analgesic armamentarium . unilamellar liposomes consist of a single lipid bilayer surrounding the aqueous core , whereas multilamellar liposomes consist of concentric lipid layers . multivesicular liposomes ( mvl ) , however , consist of nonconcentric lipid bilayers . the nonconcentric nature of mvl confers characteristic drug release patterns from the aqueous core that are different from the unilamellar and multilamellar liposomes , leading to increased stability and longer duration of drug release . the release of drug from the mvl requires only a breach in the external layer , and release of a drug from internal vesicles leads to redistribution of the drug within the particle without release . the multivesicular structure also ensures that the vesicles rearrange themselves without release of drug by internal fusion and division.14,15 these vesicles can encapsulate water soluble drugs in their core , and lipid soluble drugs within the membrane . they are used in the systemic delivery of antifungals , antineoplastics , and antibiotics.16,17 currently available liposomal bupivacaine consists of vesicles of bupivacaine loaded in the aqueous chambers using depofoam technology ( pacira pharmaceuticals inc , san diego , ca ) . each particle is composed of a honeycomb like structure of numerous internal aqueous chambers containing encapsulated bupivacaine18,19 ( figures 1 and 2 ) . bupivacaine is an amide local anesthetic , which acts by inactivating voltage - dependent sodium channels . it has a pka of 8.1 so only 15% is present in uncharged form at tissue ph . the uncharged fraction of bupivacaine travels across the cell membrane of the nerve , and once charged binds to the inner side of sodium channels , inactivating them.20 the release of bupivacaine from its binding site is slow , which leads to a longer duration of action than lidocaine.21 richard et al18 compared mvl bupivacaine in doses of 9 , 18 , and 30 mg / kg with 9 mg / kg of plain bupivacaine injected by wound infiltration in rabbits . they found the cmax to be dose dependent , being 107 27.6 , 222 28.3 , and 307 148 ng / ml for the three doses of mvl bupivacaine , respectively . however , the cmax was much lower than plain bupivacaine ( 620 89.9 ng / ml ) . the plasma bupivacaine concentration in the group receiving plain bupivacaine peaked quickly compared to the mvl bupivacaine group : 1 0 h compared to 12.5 8.06 , 7.0 11.3 , and 30.3 22.5 hours for the three doses of mvl bupivacaine , respectively . plasma bupivacaine concentrations were detectable in most animals ( dogs ) who received mvl bupivacaine 9 mg / kg over a 96-hour study period . in the pharmacokinetic study of human volunteers , davidson et al22 compared subcutaneous injection of 20 ml of 2% liposomal bupivacaine versus 20 ml of 0.5% plain bupivacaine . they found no difference in the cmax between the two groups ( 0.87 0.45 versus 0.83 0.34 in plain and liposomal groups , respectively ) despite a 4-fold increase in bupivacaine dose and a 9.8-fold increase in the terminal half - life displayed by the liposomal bupivacaine group ( 131 58 versus 1294 860 min in plain and liposomal groups , respectively ) . the tmax increased seven - fold in the liposomal bupivacaine group compared to the group administered plain bupivacaine , which was attributable to the slow release of liposomal bupivacaine . the attributes of slow release leading to prolonged tmax and long t leading to prolonged detectable plasma concentration of liposomal bupivacaine have been confirmed in a subsequent phase ii , multicenter clinical trial conducted by langford et al.23 bupivacaine is metabolized mainly in the liver by glucuronide conjugation and hepatic n - dealkylation into pipecolylxylidine . a small amount of bupivacaine is excreted unchanged in urine.24 in a pharmacokinetic study of liposomal bupivacaine in patients with moderate hepatic impairment , onel et al25 found that although bupivacaine and pipecolylxylidine concentrations were higher in patients with moderate hepatic impairment than in patients with normal hepatic function , the concentration time plots were similar in both groups , and the differences were small enough not to warrant dose adjustments as per food and drug administration ( fda ) guidelines . liposomal bupivacaine has been fda approved for single dose wound infiltration in postoperative pain relief among patients undergoing hemorrhoidectomy and bunionectomy.26 gorfine et al27 conducted a multicenter , randomized , double blind , placebo - controlled trial in patients undergoing hemorrhoidectomy . at the end of surgery , patients were randomized to receive either 300 mg ( 30 ml ) extended release mvl bupivacaine or placebo ( 30 ml of 0.9% sodium chloride ) in 5 ml increments via wound infiltration . intraoperative use of all analgesics or local anesthetics , except fentanyl , was prohibited unless needed for the treatment of adverse effects . patients remained at the study center for 72 hours , and were administered postsurgical analgesia in response to breakthrough pain consisting of morphine sulfate as needed . the primary outcome measure consisted of a cumulative pain score in the first 72 hours as reflected in the auc072 ( area under the curve ) numerical rating score ( nrs ) of pain intensity . secondary efficacy measures consisted of assessing the proportion of patients who received no opioid rescue medications , total amount of opioid rescue medications consumed , time to first postsurgical use of rescue medications , and the patient s rating of satisfaction with postsurgical analgesia . the researchers found the pain scores to be markedly lower in the bupivacaine extended release group compared to those receiving the placebo with a least mean square ( se ) auc ranging from 0 to 72 hours of 141.8 ( 10.7 ) in the mvl bupivacaine group versus 202.5 ( 10.7 ) in the placebo group ( p < 0.0001 ) . in the bupivacaine extended release group , 59% of patients were opioid free at 12 hours , and 28% were opioid free at 72 hours when compared to 14% and 10% in the placebo group , respectively ( p < 0.0008 through 72 hours ) . in addition , the mean total amount of opioid consumed was lower in the mvl bupivacaine group ( 22.3 mg vs 29.1 mg , p 0.0006 ) , and the median time to first opioid use was longer ( 14.3 hours vs 1.2 hours with p < 0.0001 ) and was associated with greater patient satisfaction with postoperative analgesia ( 95% vs 73% , p = 0.0007 ) when compared to placebo . golf et al28 conducted a multicenter , parallel group , placebo controlled , randomized , double blind study in which they compared extended release mvl bupivacaine to placebo in patients undergoing bunionectomy . the patients underwent primary first metatarsal bunionectomy under midazolam and/or propofol sedation with mayo block with up to 25 ml of 2% lidocaine with epinephrine . within 30 minutes after injection of lidocaine , the patients received either a single dose of 120 mg ( 8 ml ) extended release bupivacaine or placebo ( 8 ml 0.9% sodium chloride ) by local infiltration . rescue analgesia consisted of 5 mg oxycodone/325 mg acetaminophen tablets up to a maximum of 12 tablets per day with a single dose of intravenous ketorolac 1530 mg as a second rescue . secondary outcome measures consisted of : the proportion of patients who received no rescue pain medications ; auc of nrs pain scores through 36 , 48 , 60 , and 72 hours ; the proportion of patients who were pain free during the observation period ; the time to first rescue medication use ; and total oxycodone / acetaminophen consumption through 24 , 36 , 48 , 60 , and 72 hours . the researchers found markedly reduced pain intensity scores at 24 and 36 hours post injection in the mvl bupivacaine group compared to placebo ( p = 0.0005 and p = 0.0229 at 24 and 36 hours ) with no difference at 48 hours ( p = 0.1316 ) . the percentage of patients who were pain free showed a statistically significant difference at 2 , 4 , 8 , and 48 hours only in the mvl bupivacaine group ( p < 0.05 ) , with more patients in the mvl bupivacaine group not receiving any rescue pain medication through 24 hours only ( p < 0.05 ) . the time to first opioid use was longer ( 7.2 hours vs 4.3 hours , p < 0.0001 ) , and fewer mean total number of oxycodone / acetaminophen tablets were used through 24 hours ( 3.8 vs 4.7 tablets , p = 0.0077 ) in the mvl bupivacaine group compared to the placebo group . smoot et al29 conducted a randomized , multicenter , double blind , parallel group , active control study comparing mvl bupivacaine 300 mg to bupivacaine hcl 100 mg ( bupivacaine 0.5% with epinephrine 1:200,000 ) in patients undergoing bilateral cosmetic submuscular breast augmentation . at the end of the surgical procedure , the patients received either 300 mg of mvl bupivacaine or 100 mg of bupivacaine hcl ( with epinephrine ) on each side , injected locally at the breast implant pockets at the end of surgery . postoperatively , the patients received 1000 mg of acetaminophen three times daily with rescue analgesia ( oxycodone ) for breakthrough pain through 96 hours . secondary outcomes consisted of cumulative pain scores at time points other than 72 hours , proportion of patients not requiring rescue analgesia , total amount of rescue opioid medication consumed , and integrated rank assessment through multiple time points . the mean cumulative pain score ( numeric rating score with activity through 72 hours ) was not significantly different in the two groups ( 441.5 in the mvl bupivacaine group vs 468.2 in the bupivacaine hcl group , p = 0.3999 ) . the nrs pain score with activity mean ( se ) was markedly lower in the mvl bupivacaine group at 8 and 12 hours [ 4.9 ( 0.41 ) and 5.6 ( 0.40 ) ] compared with the bupivacaine hcl group [ 6.7 ( 0.40 ) and 6.9 ( 0.37 ) , p = 0.0016 and 0.0143 , respectively ] . the difference in mean ( se ) pain scores at rest was also lower in the mvl bupivacaine group at 8 hours only compared to the bupivacaine hcl group [ 3.5 ( 0.35 ) vs 5.0 ( 0.34 ) respectively ( p = 0.027 ) ] . the total amount of postsurgical rescue opioid medication used at 24 and 48 hours was also lower in the mvl bupivacaine group compared to the bupivacaine hcl group ( p = 0.0211 and 0.0459 , respectively ) . bramlett et al30 performed a randomized , double blind study comparing wound infiltration of mvl bupivacaine to bupivacaine hcl for postsurgical analgesia in total knee arthroplasty . they compared 150 mg of bupivacaine hcl ( with 1:200,000 epinephrine ) to mvl bupivacaine in doses of 133 mg , 266 mg , 399 mg , and 532 mg . the patients were between 1875 years old and were classified as american society of anesthesiologists physical status 13 patients undergoing unilateral knee replacement under general anesthesia . for 24 hours prior to surgery , all patients received 1000 mg of acetaminophen three times daily . the study medications were diluted in 60 ml of 0.9% saline and were injected via local infiltration in the deep tissues , the capsulotomy incision , and the subcutaneous tissues intraoperatively . postoperatively , patients received a single dose of a nonsteroidal anti - inflammatory drug parentally with oral acetaminophen . for rescue analgesia , patient - controlled intravenous morphine was used until patients could be switched to oral oxycodone 510 mg every 46 hours once oral intake was established . the primary outcome measure was auc of nrs pain scores with activity ( nrs - a ) through day 4 . secondary outcome measures consisted of : auc of nrs - a through time points other than day 4 ; auc of nrs pain scores at rest ( nrs - r ) ; nrs - r and nrs - a scores at each assessed time point ; total consumption of opioid rescue medications ; total consumption of opioid medications ; time to resumption of daily activities ; and provider s satisfaction with postoperative analgesia on day 8 . there was no difference between the groups for the primary outcome measure of the mean auc of nrs pain scores with activity . the mean ( sd ) scores were 20.4 ( 3.9 ) in the bupivacaine hcl group versus 19.1 ( 4.4 ) , 18.8 ( 5.3 ) , 19.5 ( 5.3 ) , and 20.7 ( 5.4 ) , in the mvl bupivacaine 532 mg , 399 mg , 266 mg , and 133 mg groups , respectively . there was no detectable difference in the groups with regard to mean numeric rating scale pain scores , total consumption of rescue opioids , or the time to resumption of work or normal daily activities ( table 1 ) . boogaerts et al31 compared 0.5% bupivacaine ( with 1:200,000 epinephrine ) with 0.5% liposomal bupivacaine ( a multilamellar formulation different from the clinically available multivesicular depofoam ) administered epidurally for the management of postsurgical pain . the patients were classified as american society of anesthesiologists physical status 2 and 3 undergoing major abdominal surgery . the epidural catheter was inserted with a test dose of bupivacaine ( 0.5% 3 ml ) with epinephrine 1:200,000 given at the time of insertion . postoperatively , when patients experienced pain after complete recovery of motor function , they received a 10 ml bolus of either liposomal bupivacaine 0.5% or 10 ml of plain bupivacaine 0.5% ( with 1:200,000 epinephrine ) . the researchers found no detectable difference in the time of onset of analgesia ( 13.75 1.25 min in the plain bupivacaine group versus 13.92 1.58 min in the liposomal bupivacaine group ) , though the duration of analgesia increased significantly in the liposomal bupivacaine group ( 6.25 1.13 hours in the liposomal bupivacaine group versus 3.2 0.4 hours in the plain bupivacaine group , p < 0.05 ) . in a subset of patients who underwent abdominal aortic surgery , the duration of analgesia was 10.6 1.4 hours in the liposomal bupivacaine group versus 2.42 0.35 hours in the plain bupivacaine group ( p < 0.001 ) . there was no motor block in the liposomal bupivacaine group though intraoperative surgical anesthesia was not observed with the liposomal bupivacaine group . the lack of surgical block was thought to be due to alterations in the pharmacodynamics of the drug preventing the necessary amount of free bupivacaine available at the site of action , thus producing only postsurgical analgesia . there are no studies evaluating the epidural use of depofoam bupivacaine to assess whether the lack of surgical analgesia is seen with the depofoam formulation as well . the most common life threatening side effects involve the cardiovascular and central nervous systems.32,33 bupivacaine is more cardiotoxic than lidocaine , and it produces its toxicity by producing cardiac conduction block.34 animal studies have shown that bupivacaine uncouples oxidative phosphorylation , may induce apoptosis in muscle cells , and may cause schwann cell damage . the damage to schwann cells happens in both a time as well as a concentration dependent fashion.35 the myotoxicity of bupivacaine is well described and may be related to ca - induced apoptosis of muscle cells . the myotoxicity of bupivacaine is most pronounced after retrobulbar and peribulbar blocks with an overall incidence of anesthesia - related diplopia reported to be 0.25%.36,37 although the diplopia may resolve spontaneously , it may require surgical correction.38 the most common side effects of mvl bupivacaine in clinical trials included nausea , vomiting , constipation , pyrexia , dizziness , and headache.28,30 bergese et al39 compared the cardiac safety of mvl bupivacaine in four doses ( 150 , 300 , 450 , or 600 mg ) to bupivacaine hcl with epinephrine injected via wound infiltration intraoperatively in patients undergoing total knee arthroplasty . they found no significant differences in change from baseline in qrs or qtc duration in the two groups , nor did the two groups differ in mean change from baseline heart rate and pr interval . naseem et al40 examined the effect of four doses of mvl bupivacaine ( 300 , 450 , 600 , and 750 mg ) injected subcutaneously on the qtc interval in healthy volunteers . none of the participants receiving mvl bupivacaine had a maximum qtc interval greater than 500 ms , and there were no changes in qtc of greater than 60 ms at any measured time point . in a 2-year follow up study assessing the effect of mvl bupivacaine on the integrity of breast implants after augmentation mammoplasty , minowitz et al41 found no negative impact of intraoperative use of mvl bupivacaine on the integrity of breast implants . pinto et al42 studied the effect of multilamellar liposomal local anesthetics on the inhibition of platelet aggregation in response to adenosine diphosphate . they found that encapsulation of local anesthetics into liposomes increased the inhibitory effect of local anesthetics ; however , the clinical impact ( if any ) of this finding remains to be seen in larger trials . in an animal studies by richard et al18,19 evaluating the safety and efficacy of mvl bupivacaine compared to plain bupivacaine and saline , the authors did find granulomatous inflammation in the mvl bupivacaine group , which was considered to be a normal reaction to liposomes ; however , there was no effect on wound healing . mvl bupivacaine did not alter wound healing or wound scarring when used for postsurgical analgesia after total knee arthroplasty in humans.30 depofoam should not be coadministered with any other local anesthetic as it may increase the release of bupivacaine from the liposomes . it should not be allowed to come in contact with antiseptics like chlorhexidine or povidine iodine as they may disrupt the lipid layers leading to uncontrolled release of bupivacaine.43 depofoam - encapsulated bupivacaine is a new formulation of bupivacaine that provides slow sustained release of bupivacaine from multivesicular liposomes . compared to placebo , it has been shown to produce prolonged analgesia with an opioid sparing effect , although more adequately powered trials are needed to assess its efficacy and duration of analgesia compared to standard local anesthetic solutions . at present , it is approved by the fda for use via local infiltration after bunionectomy and hemorrhoidectomy . it has not been shown to be more toxic compared to plain bupivacaine , and it does not have markedly different cardiac effects than plain bupivacaine . it appears safe for use in patients with moderate hepatic impairment and does not warrant dose adjustment in that group.25 it has not been evaluated for use via intrathecal , epidural , or perineural administration or in pediatric and pregnant patients.43 more multicenter trials are needed to evaluate its efficacy and safety in these populations . if its safety and efficacy are established for epidural , intrathecal , and perineural use , it holds a potentially valuable place in the analgesic arsenal for use against postoperative pain and may substantially reduce the cost and complications associated with catheter and local anesthetic infusion pumps . in addition , the opioid sparing effects of mvl bupivacaine are valuable in potentially reducing opioid - related side effects . this in turn may reduce unwanted hospital admissions related to postoperative pain or opioid side effects . in summary , the current literature studying mvl bupivacaine has , in general , demonstrated prolonged analgesia and reduced opioid side effects compared to placebo . however , its increased analgesic efficacy ( and cost effectiveness ) compared to plain bupivacaine in various clinical settings needs to be evaluated in adequately powered clinical trials . at present

the jages cohort was established in 2010 to investigate factors associated with subjective and objective health among noninstitutionalized individuals 65 years or older . we used the 2013 wave of jages , where self - reported questionnaires were mailed to 195,290 community - dwelling individuals 65 years or older . of those , 138,294 individuals responded to the survey ( response rate , 70.8% ) . aside from basic questions , there were five modules of the survey covering different topics module a : nursing care , medical care , and lifestyles ; module b : oral hygiene , optimism , subjective health ; module c : social capital , history of abuse ; module d : subjective quality of life , sleep , cognitive function ; module e : physical activity . we excluded 5968 subjects ( men , 2202 ; women , 3766 ) with missing information on subjective health status , frequency of laughing , depression ( the short form of geriatric depression scale [ gds ] ) , number of opportunities of laughing , sex , or age . our outcome variable was poor self - rated health , assessed by the standard single - item question how would you rate your present health status ? ( responses : very good , good , bad , very bad ) ; very bad and bad were categorized as poor subjective health . we analyzed three types of variables related to laughter : frequency of laughing , number of opportunities for laughter , and laughing during interpersonal interactions . respondents were asked to check up to eight different opportunities for laughing : during conversations with friends , conversations with a partner , conversations with children and grandchildren , watching tv and videos , listening to the radio , watching comic storytellings and plays , reading comics and magazines , and other . three possible responses were given for laughing during interpersonal interactions : conversations with friends , conversations with a partner , and conversations with children and grandchildren . we controlled for age , sex , marital status , education , occupation , equivalized household income , depressive symptoms , and social participation . for the evaluation of depressive moods , the 15-item gds ( gds-15 ) was used . the gds-15 is a 15-item questionnaire , with a score range from 1 to 15 . higher scores indicate more depressive symptomatology . following previous studies , we used 5 as the cutoff score for indicating moderate to severe psychological distress ( wongpakaran et al . , 2013 ) . for the evaluation of depressive moods , we measured frequency of social participations by summing up the number of opportunities per year one participated in social activities and groups . we divided them into four quartiles and used the first quartile as the reference category . poisson regression model was used to calculate the prevalence ratio ( pr ) for poor subjective health by frequency of laughing . in model 1 , depressive symptoms was added as a potential confounder . in model 3 , demographic variables ( age , sex , marital status ) were added to the variables in model 2 . in model 4 , socioeconomic variables ( education , occupation , and equivalized household income ) were added to the variables in model 3 . in the final model 5 , social participation ( frequency of social participation per year ) was added to the variables in model 4 . in models 6 to 10 , we repeated the same sequence of analyses as models 1 to 5 , except we switched number of opportunities for laughter with number of opportunities for laughter during interpersonal interactions as a covariate . r 3.1.0 was used for statistical analysis , with a two - tailed significance level set at 5% . the jages cohort was established in 2010 to investigate factors associated with subjective and objective health among noninstitutionalized individuals 65 years or older . we used the 2013 wave of jages , where self - reported questionnaires were mailed to 195,290 community - dwelling individuals 65 years or older . of those , 138,294 individuals responded to the survey ( response rate , 70.8% ) . aside from basic questions , there were five modules of the survey covering different topics module a : nursing care , medical care , and lifestyles ; module b : oral hygiene , optimism , subjective health ; module c : social capital , history of abuse ; module d : subjective quality of life , sleep , cognitive function ; module e : physical activity . we excluded 5968 subjects ( men , 2202 ; women , 3766 ) with missing information on subjective health status , frequency of laughing , depression ( the short form of geriatric depression scale [ gds ] ) , number of opportunities of laughing , sex , or age . our outcome variable was poor self - rated health , assessed by the standard single - item question how would you rate your present health status ? ( responses : very good , good , bad , very bad ) ; very bad and bad were categorized as poor subjective health . we analyzed three types of variables related to laughter : frequency of laughing , number of opportunities for laughter , and laughing during interpersonal interactions . respondents were asked to check up to eight different opportunities for laughing : during conversations with friends , conversations with a partner , conversations with children and grandchildren , watching tv and videos , listening to the radio , watching comic storytellings and plays , reading comics and magazines , and other . three possible responses were given for laughing during interpersonal interactions : conversations with friends , conversations with a partner , and conversations with children and grandchildren . we controlled for age , sex , marital status , education , occupation , equivalized household income , depressive symptoms , and social participation . for the evaluation of depressive moods , the 15-item gds ( gds-15 ) was used . the gds-15 is a 15-item questionnaire , with a score range from 1 to 15 . , we used 5 as the cutoff score for indicating moderate to severe psychological distress ( wongpakaran et al . , 2013 ) . for the evaluation of depressive moods , we measured frequency of social participations by summing up the number of opportunities per year one participated in social activities and groups . we divided them into four quartiles and used the first quartile as the reference category . poisson regression model was used to calculate the prevalence ratio ( pr ) for poor subjective health by frequency of laughing . in model 1 , we controlled for the number of opportunities for laughter . in model 2 , depressive symptoms was added as a potential confounder . in model 3 , demographic variables ( age , sex , marital status ) were added to the variables in model 2 . in model 4 , socioeconomic variables ( education , occupation , and equivalized household income ) were added to the variables in model 3 . in the final model 5 , social participation ( frequency of social participation per year ) 6 to 10 , we repeated the same sequence of analyses as models 1 to 5 , except we switched number of opportunities for laughter with number of opportunities for laughter during interpersonal interactions as a covariate . r 3.1.0 was used for statistical analysis , with a two - tailed significance level set at 5% . women tend to laugh more frequently as well as to report a higher number of opportunities for laughter , compared with men . the prevalence of poor subjective health and depression according to participants ' characteristics are shown in table 2 . we paid particular attention to statistically controlling for depressive symptoms , given the possibility that absence of laughter could be a symptom of depression . characteristics of the subjects by sex prevalence of poor subjective health and depression by participants ' characteristics the results of poisson regression models linking laughter and poor subjective health are shown in tables 3 and 4 . subjective health was associated with occupation , marital status , and household income in men . for women , in model 1 , we found an association between frequency of laughter and poor self - rated health . the pr comparing the bottom to top category of frequency was 3.80 ( 95% confidence interval [ ci ] , 3.244.46 ) . with the successive addition of covariates ( across models 25 , as well as from models 610 ) , nonetheless , even in the fully adjusted models ( models 5 and 10 ) , we found significant associations between frequency of laughter and self - rated health . for women , in model 5 , the prs of poor self - rated health were 1.78 ( 1.482.15 ) for laughing never or almost never and 1.39 ( 1.171.66 ) for none to one opportunity of laughing . pr and ci for poor subjective health in men pr and ci for poor subjective health in women in a subanalysis , we did the same analysis , except we switched subjective health with depression as the objective variable . there were stronger relationships between laughing and depression in both men and women . for women , in model 4 , where we controlled all the covariates , the purpose of the present study was to investigate the effects of laughter on self - rated health after carefully controlling for potential confounders . the results of the study showed that frequency of laughing is significantly related to subjective health . although some categories of laughter were not significant in men , the results still suggested a protective effect of laughter , both in terms of frequency as well as number of different occasions for laughter . statistical adjustment for depression , sociodemographic factors , and nonetheless , our findings suggest that encouraging laughter may be a potential avenue for health promotion . the relationship between laughter and subjective health may be underpinned by at least four distinct mechanisms ( martin , 2002 ) . first , laughter may have direct psycho - neuro - immunological benefits such as lowering markers of inflammation . second , laughter may be a marker of positive emotions , which can promote resilience against disease ( kubzansky , 2011 ) . third , laughing can buffer the effects of stress ( berk et al . , 1989 ) . finally , people who laugh often can make a good impression on others and make others more likely to help them , for example , by providing them with social support . the simple frequency of laughter seems to be more predictive of subjective health than the number of different occasions / contexts for laughter . this finding is consistent with previous studies that have found that laughing frequently is related to emotional well - being and life satisfaction ( hasan and hasan , 2009 ) . according to schimmack et al . ( 2002 ) , life satisfaction is correlated with emotional well - being , and the association is stronger in individualistic societies . the current study shows that there are stronger relationships between laughter and subjective health in older people . alpass and neville ( 2003 ) reported in their study that the most significant predictor of depression in older men was loneliness and that age - related losses ( such as decline in mobility ) may weaken their ability to maintain relationships with others . the current study also shows that women laugh more frequently than men do and laughter is more strongly related to subjective health among women . these findings suggest that laughter is especially important for old people and women . however , the present study had limitations . first and foremost , we are unable to establish a causal relationship between laughter and poor subjective health owing to the cross - sectional nature of the data . longitudinal analyses of our cohort data will clarify how laughing can prevent poor subjective health . in addition , we can not completely exclude the possibility of reverse causation , even though the study controlled for depression and other covariates . the perceived frequency of laughter may be at variance from the actual frequency , but we lacked objective data on laughing frequency . there are many types of laughing , for example , smiling is an indication of fondness and appeasement , whereas laughter expresses playfulness ( hooff , 1972 ) , and duchenne laughter is coming from positive emotion , whereas non - duchenne laughter is fake laughter ( gervais and wilson , 2005 ) . further studies are needed to examine these differences among various types of laughter . there is missing information for 882 subjects with missing in subjective health status , 1306 in laughter , and 4692 in depression . it may be plausible that less healthy people are more likely not to report their health status , possibly making the association between laughter and health underestimated . although previous research has indicated that laughter can improve the biomarkers of immune function ( bennett and lengacher , 2009 ; donkor et al . , martin ( 2002 ) even reported that many studies regarding the health benefits of humor and laughter are less conclusive than commonly believed . however , donkor et al . ( 2014 ) showed that health - related quality of life among stroke survivors was significantly related to laughter , and this is consistent with our subanalysis . , laughter may lower the risk of poor subjective health of older people , and this effect was observed even after adjusting for depression , socioeconomic status , and social participation . the mechanisms and determinants of laughter warrant further study to use laughter effectively to improve the physical and psychological health of old people .

a variety of test methods are discussed for the diagnosis of proximal tooth surfaces . adjuncts such as bitewing radiography and fiber - optic transillumination provide an improvement to unaided vision . unaided visual diagnosis had detected fewer than 50% of caries lesions on occlusal surfaces and even fewer on proximal surfaces . it is not possible to detect only with unaided visual examination in interproximal caries lesions ; radiographs help for proximal caries diagnosis and detection of their lesion depth [ 2 , 3 ] . the combination of visual inspection and bitewing radiographic images is accepted as a standard procedure in proximal caries diagnosis . however , the deeper the radiolucency penetrates enamel and dentine , the higher the probability of cavitation . due to difficulties in proximal caries detection , recently , the new methods of magnifying visual aids such as intraoral camera , magnification loops , and operating microscope are used for caries diagnosis , restorative treatment decisions , root resection , and retrograde canal preparation [ 7 , 8 ] . previous studies [ 9 , 10 ] had investigated the efficiency of operating microscope for occlusal caries diagnosis , but there is insufficient publication [ 5 , 11 ] about usage of this device for proximal caries detection in dental literature . the purpose of this study was to evaluate the efficiency of operating microscope compared with unaided visual examination , conventional and digital intraoral radiography for proximal caries detection by means of receiver operating characteristic ( roc ) curve analysis . the study was based on 48 extracted human posterior permanent teeth , 24 molars and 24 premolars stored in a 5% buffered formalin solution . no specimens exhibited any restoration on the proximal surfaces . organic and inorganic debris were removed by an excavator and then the teeth were cleaned by pumice and water slurry . the models were fixed in a phantom head which was adjusted to a dental unit during the sessions of unaided visual examination and operating microscope assessment . the proximal surfaces coronal to the cementoenamel - junction of the teeth were assessed by two specialists of oral diagnosis and radiology and one specialist of restorative dentistry of at least 10 years of experience independently . to avoid observer fatigue , the models were examined under a dental unit light , by using a dental mirror ( size 5 ) and the air water syringe of the dental unit without any magnification for unaided visual examination . the clinicians evaluated the extent of the carious lesions in the proximal surfaces of the teeth according to a 5-point rating scale ( table 1 ) . then the teeth were examined using an operating microscope 16x magnification ( moller - wedel , dento 300 , wedel , germany ) according to the same scale . the observers assessed the teeth adjusting the height of the operating stool at a 12 o'clock position . the position of operating microscope was not changed to eliminate the position errors during the examinations . after unaided visual and operating microscope examinations were completed , the teeth were mounted in dental stone models 3 in a row ( either 2 premolars and 1 molar or 1 premolar and 2 molars ) with proximal surfaces in contact . conventional bitewing radiographs of the teeth were obtained using a specially designed holder to provide standardized bitewing projection geometry in the buccolingual direction , tangential to the proximal surfaces . the object to film distance was approximately 0.5 cm and the source - to - image receptor distance was 32 cm . size 2 insight ( eastman kodak company , paris , france ) films with an exposure time of 0.16 seconds and ccx intraoral unit ( trophy , instrumentarium , tuusula , finland ) with focal spot of size 0.8 mm , operating at 70 kvp and 8 ma , with 2.5 mm of aluminum - equivalent filtration were used . one centimeter of soft tissue equivalent material was used to simulate scatter radiation and beam attenuation from facial tissues . all film radiographs were developed in automatic film processor ( velopex , extra - x , medivance instruments ltd . , london , uk , and nw107a ) with freshly prepared solutions in the same day . the ccd - based system to be evaluated was the radiovisiography ( rvg , 2000 model , trophy radiologie , paris , france ) . digital images were obtained with 32 cm sensor to focal spot distance with an exposure time of 0.08 seconds under the same standardized conditions and were stored using the rvg image management software . the film radiographs were assessed using a masked light box and a 2x magnification x - viewer ( luminosa , csn industrie , cinisello balsamo , italy ) by three clinicians independently in a quiet room with subdued ambient lighting . images from the digital system were displayed on a 17-inch monitor in the same ambient lighting . the observers indicated their decision separately for each interproximal side of the teeth by masking other side with the use of a black cartoon . they assessed the extent of the carious lesions according to a 5-point rating scale ( table 1 ) . the proximal surfaces were first colored with a solution of propylene glycol with added basic fucsin ( 0.5% ) for 10 seconds and rinsed in tap water . then , the teeth were hemisectioned perpendicularly to the proximal surfaces from their santral fossas by a diamond disc under water - cooling . two sections were obtained , each section was examined under stereomicroscope ( olympus sz 60 , tokyo , japan ) with a 10x magnification . two observers not participating in the study both experienced in histological examination and being blinded to the radiographic appearance of the surfaces evaluated the sections by consensus according to a 5-point confidence scale ( table 1 ) . one way variance of analysis ( anova ) and pairwise comparisons ( scheffe test ) were performed for comparison of observers . the diagnostic accuracies of the four diagnostic systems were assessed from the area under the roc curve ( az ) . the rating scales were dichotomized as presence or absence of caries during the analysis . score 0 in both radiographic and histological scales was detected as absence of caries and the others were detected as presence of caries . histological examination of the teeth confirmed that 61 ( 63.54% ) of the proximal surfaces were caries free , whereas 35 ( 36.46% ) of proximal surfaces determined caries lesions of different depths . the numbers of proximal surfaces for each score according to the histological examination are shown in table 2 . statistically significant difference was found between three observers at 99% confidence interval ( p < .01 ) according to anova . no statistically significant difference was found between 1st and 2nd observers ( p < .05 ) and there was statistically significant difference between both 1st and 3rd observers and 2nd and 3rd observers ( p < the first roc curve ( figure 1 ) is illustrated by considering assessments of 1st observer due to no statistically significant difference between 1st and 2nd observers and the second roc curve ( figure 2 ) is illustrated for 3rd observer . areas under the roc curve ( az ) and standard errors are shown in table 4 and analysis of az values are shown in table 5 . for both 1st and 3rd observers , no statistically significant difference was found between operating microscope - unaided visual examination and film radiography ( insight)-rvg in 95% confidence interval according to pairwise comparison ( p < .05 ) . there was a statistically significant difference between operating microscope - film radiography , operating microscope - rvg , unaided visual examination - film radiography , unaided visual examination- rvg in 95% confidence interval according to pairwise comparison ( p < .05 ) for both 1st and 3rd observers . the efficiency of operating microscope was compared with unaided visual examination , film and digital intraoral radiography for proximal caries detection according to roc analysis in this study . recently , many researchers have advocated the use of roc analysis to assess diagnostic methods for the detection of dental caries . validity of roc analysis can be assessed by increasing the number of tooth surfaces , increasing the rating scale , and uniform distribution of caries depths . in this study , the sample was relatively large , 5-point rating scale was used , and the distribution of caries depths was not uniform . area under the roc curve ( az value ) gives useful information to measure accuracy of a diagnostic system . the az values of unaided visual examination and operating microscope were equal and lower than the radiographic methods . interobserver reliability is an important factor for this aim . on the other hand , training and experience of observers may affect intra- and interobserver agreements . syriopoulos et al . emphasized that diagnosis of the radiologists was significantly closer to actual lesion depth than that of general practitioners . two of the observers were the specialists of oral diagnosis and radiology , the other observer was a specialist of restorative dentistry of at least 10 years of experience in this study . no statistically significant difference was found between the two specialists of oral diagnosis and radiology for all diagnostic systems ( p < .05 ) , but there was a statistically significant difference between the specialist of restorative dentistry and the specialists of oral diagnosis and radiology ( p < .05 ) . the az values were found to be 0.800 , 0.793 , and 0.650 for film radiography , rvg , and both unaided visual examination and operating microscope , respectively , according to assessments of 1st observer . the az values were found to be 0.773 , 0.760 , 0.533 for film radiography , rvg , and both unaided visual examination and operating microscope , respectively , according to assessments of 3rd observer in this study . the az values of 1st observer were higher than 3rd observer for all diagnostic methods . this condition may be due to the fact that the specialists of oral diagnosis and radiology were more experienced than other specialists about diagnostic and radiographic methods . due to difficulty of proximal caries diagnosis with only visual examination , the combination of visual inspection and bitewing radiographic images is accepted as a standard procedure in proximal caries detection [ 5 , 19 ] . machiulskiene et al . reported that the clinical examination alone detected about 60% of the total number of proximal cavitated dentin lesions , and bitewing examination detected about 90% of these lesions . but they emphasized that the clinical examination is a more effective method in noncavitated enamel lesions . in this study , the radiographic methods were better than clinical examinations for proximal caries diagnosis in conformity with previous studies [ 19 , 21 ] . . the operator should be careful and not change the position as far as possible . it was reported that the ideal operator zones are in the 7 to 12 o'clock positions for right - handed operators , and 5 to 12 o'clock for left ones . the researchers studied at 12 o'clock position and not changed the position of operating microscope during the examinations in this study . currently , magnifying visual aids such as magnification eyeglasses , stereo microscope , and also digital imaging with magnification are used in proximal caries detection in some studies and they reported that these methods are effective . however , haak et al . reported that prism loupe or surgical microscope does not improve the ability to diagnose proximal caries . in this study , the efficiency of operating microscope was evaluated by comparing with unaided visual examination , film and digital intraoral radiography for proximal caries detection according to roc analysis . no statistically significant difference was found between operating microscope and unaided visual examination ( p < .05 ) , and there was a statistically significant difference between operating microscope and both two radiographic systems ( p < .05 ) . in conclusion , the efficiency of operating microscope was found statistically equal with unaided visual examination and lower than film and digital intraoral radiography according to roc analysis . because the operating microscope is expensive and requires equipment and operator experience , according to the results of this in vitro study it can be said that use of this device would not improve to make an accurate diagnosis of proximal caries lesions . however , the accuracies of diagnostic methods with magnifying visual aids should be investigated and clinical usefulness of these methods in dental practice should be discussed in vitro and in vivo with several studies in which the numbers of samples are larger and rating scales are increased by comparing conventional methods for proximal caries detection .

the status of muscle can be characterized by using measures of its strength and mass1 . of various methods for measuring muscle mass , the european working group on sarcopenia in older people ( ewgsop ) has recommended dual - energy x - ray absorptiometry ( dxa ) , bioimpedance analysis ( bia ) , and anthropometry for clinical use1 . both bia and anthropometry , on the other hand , can be used with older adults in almost any setting . bia has been validated against dxa ; however , it requires that a small electric current be passed through the body , and is affected by hydration status and the presence of metal implants2 . the chief anthropometric measures used for identifying loss of muscle mass are mid - arm circumference and maximum calf circumference . these circumferences are not specific to muscle ; however , they do incorporate muscle and are predictive of mortality3 , 4 . calf circumference has been shown to correlate strongly with appendicular muscle mass and fat - free mass4 , 5 , and has been used in lieu of bia when bia testing was contraindicated or not possible6 . changes in calf circumferences have been noted among patients undergoing surgery for gastrointestinal cancer9 . these findings regarding circumferential measures notwithstanding , the ewgsop concluded that there are relatively few studies validating anthropometric measures in older and obese people1 . the purpose of this study , therefore , was to determine how well circumferential measures of the limbs reflect muscle mass . specifically , we sought to describe the relationship in older women , between mid - arm circumference , maximum calf circumference , and muscle mass as determined by using bia . this was an observational , cross - sectional study conducted during a 2-day period in may 2013 . it was approved by the ethics committee of the faculty of physical education and sport of charles university in prague , czech republic . the participants were a convenience sample of 38 ambulatory female residents of the senior centre in blansko , czech republic . their inclusion was dependent on their being ambulatory and providing written informed consent . they ranged in age from 72 to 98 years ( mean 83 years , sd 6.2 years ) . care was taken to maintain full contact between the tape and the limb without compressing the underlying soft tissue . mid - arm circumference was measured midway between the acromion and elbow crease while each participant was seated with her relaxed arm supported in a horizontal position . the location of the maximum calf circumference was ascertained and measured while each participant was in a supine position , with her relaxed leg slightly elevated from the surface on which she was lying . the bia ( bia 2000-m ; data input , hofheim , germany ) was conducted by using a tetrapolar electrode configuration ( i.e. , one on the dorsum of each hand and dorsum of each foot ) while the participants were supine . on the basis of the electrical resistance measured and on the participants height , female sex , and age , the skeletal muscle mass index was calculated by using the equation of janssen et al10 . all statistical analyses were conducted with the statistical package for the social sciences ( spss 20.0 ) , systat , or medcalc . after calculating basic descriptive statistics , the relationship between the circumferential measures and bia - determined muscle mass index was examined by using pearson correlations , cronbach s alpha , and factor analysis . table 1table 1.descriptive statistics for the study variablesvariablemean ( sd)rangeheight ( cm)155.5 ( 7.1)141.0169.0body mass ( kg)71.1 ( 12.1)51.3101.5body mass index ( kg / m)29.5 ( 5.3)19.948.3mid - arm circumference : left ( cm)29.4 ( 3.7)21.539.0mid - arm circumference : right ( cm)29.8 ( 3.3)23.039.0calf circumference : left ( cm)36.4 ( 4.6)26.543.0calf circumference : right ( cm)36.5 ( 4.7)26.544.2muscle mass index ( kg / m)6.4 ( 0.9)4.68.9 provides summary statistics for the relevant variables from 38 participants in the study . table 2table 2.pearson correlations ( 95% confidence interval ) between muscle mass variables*variableleft armright arm left calf right calf right arm 0.955(0.9140.976)left calf0.7570.764(0.5760.867)(0.5890.871)right calf0.7450.7490.968(0.5590.860)(0.5640.862)(0.9390.984)muscle mass index0.4800.5460.6280.580(0.1890.693)(0.2740.737)(0.3860.789)(0.3190.759)*all are significant at p 0.002 shows the correlation between the circumferential measures and muscle mass determined by using bia . all circumferential measures were highly correlated with one another ( r = 0.7450.968 ) . the highest correlations were between homonymous measurements ( i.e. , left and right mid - arm [ r = 0.955 ] or left and right calf [ r = 0.968 ] ) . all circumferential measures correlated significantly but modestly with muscle mass index ( r = 0.4800.628 ) . the cronbach s alpha for all of the circumferential and the muscle mass measure was 0.905 . it explained 78.0% of the variance in the components that had loadings ranging from 0.710 ( muscle mass ) to 0.940 ( left calf circumference ) . given the prevalence and consequences of muscle loss among older adults , clinicians need simple , portable , and inexpensive options for quantifying loss of muscle . circumferential measurements of the arm and calf are two such measures3 , 6 , 8 . their adequacy , however , is dependent on their ability to accurately reflect muscle mass . therefore , the degree to which circumferential measures were related to one another and to the muscle mass index derived by using bia was investigated in this study . the circumferential measures were certainly related to one another supporting their convergent validity and possibly obviating the need to measure both mid - arm and calf circumference bilaterally . the circumferential measures were also related to the muscle mass index , the correlation of calf circumference with muscle mass index in this study ( r = 0.628 and 0.580 ) being relatively comparable to the correlation reported between calf circumference and skeletal muscle index determined by using dxa by kawakami et al.5 ( r = 0.69 ) and rolland et al . ( r = 0.63)7 . on the basis of the magnitude of the correlations and their confidence intervals in this study , no specific circumferential measure could be considered superior to another for indicating muscle mass as indicated by bia . notably , circumferential measurements explained far less than half of the variance in the muscle mass index . perhaps the correlation between limb circumference and muscle mass index would be higher if the circumferential measures were adjusted for edema and subcutaneous fat . proposed that upper - limb circumference may be a better measure than calf circumference because of fluid retention in the lower limbs3 . the use of skin - fold measures to adjust for subcutaneous fat of the arm has been described by moratani and devries11 and others . when used as indicators of muscle loss or malnutrition calf circumferences < 31 cm8 or <33 cm5 have been proposed to be indicative of sarcopenia . small limb circumferences may be due , in part , to a loss of bone diameter or a reduction in subcutaneous and intramuscular fat , but are unlikely to exist unless muscle mass is also diminished . in cases in which limb circumferences are small , support for low muscle mass as a cause might be found in the concurrent presence of visible atrophy elsewhere ( e.g. , intrinsics of the shoulder and hand ) , a low bmi , and decreased voluntary or evoked muscle force production . future research could focus on the relationship of limb circumference measures with these conditions and in other populations .

squamous cell carcinoma ( scc ) is by far the most important and common malignant mucosal neoplasm to affect the head and neck region . occasionally , variants of scc may be encountered , which includes verrucous , exophytic or papillary , spindle cell ( sarcomatoid ) , basaloid and adenosquamous types that make up in aggregate for about 10 - 15% of all sccs . spindle cell carcinoma ( spcc ) also called lane tumor is an uncommon poorly differentiated type of scc comprising up to 3% of scc . spcc has been referred to by a variety of names such as pseudosarcoma , carcinosarcoma and pleomorphic carcinoma , which reflects the divergent interpretations of the sarcomatoid component as reactive or neoplastic and mesenchymal or epithelial . there is a profound male to female predilection ( 11:1 ) and generally occurs in individuals in their seventh decade of life . according to ellis , the frequent sites of occurrence of spcc are the lower lip , tongue and alveolar ridge . this report describes a rare presentation of spcc of the gingiva with a low metastatic potential contrary to the aggressive nature of the tumor . a 46-year - old male patient reported to the department of periodontology , faculty of dental sciences , sri ramachandra university , chennai , india with an intraoral swelling in relation to the lower left first and second premolars for the past 8 months associated with a dull pain . he gave a history of smoking cigarettes ( 2 packets / day ) for the past 30 years and keeping the tobacco quid on the left side of the vestibular area , but had stopped the habit because of burning sensation . on clinical examination , a single sessile erythematous swelling with a fungating whitish mass in the center was seen [ figure 1 ] . on palpation , it was firm in consistency measuring about 1.5 cm ( apicocoronally ) and 2.0 cm ( mesiodistally ) extending from the mesial aspect of tooth 34 to the mesial aspect of tooth 36 . both the premolars exhibited grade 1 mobility with tenderness on vertical percussion and no attachment loss . initial appearance of the lesion with a fungating whitish mass on the surface patient was counseled regarding the cessation of the smoking habit . scaling was performed on the first visit and selective grinding of the opposing cusp in occlusion was carried out . at the recall visit , the surface necrosis had disappeared ( which could have probably been due to withdrawal of tobacco quid usage ) . complete hemogram , intraoral periapical radiograph and orthopantomograph were taken . except for an increase in the eosinophil count , no significant alterations were evident in the radiographs [ figure 2 ] . based on the clinical findings , orthopantomograph revealing no hard tissue abnormalities an incisional biopsy of the growth was performed under local anesthesia . the tissue specimen was immediately transferred into 10% buffered formalin solution , sent for routine histopathological examination and were further subjected to immunohistochemical ( ihc ) analysis . histologically , the tumor showed an ulcerated parakeratotic stratified squamous epithelium [ figure 3 ] with a focus of epithelial pearl formation [ figure 4 ] . the underlying connective tissue stroma revealed richly cellular pleomorphic spindle cells arranged in fascicles resembling a herring bone pattern characteristic of a fibrosarcoma [ figure 5 ] . ihc analysis revealed spindle shaped cells that showed positive reactions for cytokeratin [ figure 6 ] and vimentin [ figure 7 ] but negative for cd34 [ figure 8 ] . positive membrane immunoreactivity was observed in the basal cell layer and connective tissue stroma with a relatively increased lymphatic network complexity as compared with the tumor free zone [ figure 9 ] . photomicrograph of spindle cell carcinoma showing stratified squamous epithelium with surface ulcerations , granulation tissue and mixed inflammatory cells ( h and e , 10 ) photomicrograph showing epithelial pearl formation ( arrow ) ( h and e , 40 ) photomicrograph of spindle cell carcinoma showing richly cellular pleomorphic , hyperchromatic spindle cells arranged in fascicles depicting a herring bone pattern ( arrow ) ( h and e , 10 ) spindle shaped tumor cell component immunostained with anti - human cytokeratin antibody showing positive immunostaining for cytokeratin ( 40 ) spindle shaped tumor cell component immunostained with anti - human vimentin antibody showing positive immunostaining for vimentin ( 40 ) this component shows negative immunostaining of spindle cells for cd34 and positive immunostaining of endothelial cells ( 40 ) positive expression of podoplanin in the spindle cells and increased lymphatic network complexity ( 40 ) a whole body plain and contrast computed tomography ( ct ) view was performed . ct view of mandible with contrast revealed a 17.8 mm 4.7 mm sized soft - tissue density lesion in the buccal aspect of the body of the mandible on the left side with no evidence of bony erosion [ figure 10 ] . few sub centimeter sized lymph nodes were present in the left submandibular [ figure 11 ] and bilateral deep cervical ( level ii ) regions [ figure 12 ] . computed tomography view of mandible with contrast depicting a soft tissue density lesion in the buccal aspect of the body of the mandible on the left side ( arrow ) computed tomography view of the mandible with contrast depicting few sub centimeter sized lymph nodes in the left submandibular region ( arrow ) computed tomography view of the mandible with contrast depicting few sub centimeter sized lymph nodes in the bilateral deep cervical region ( arrows ) patient was referred to an oncologist . following chemotherapy , the patient was subjected to surgical management that involved a segmental resection of the mandible with supraomohyoid neck dissection followed by radiation therapy . spcc is a rare type of scc that most often involves the larynx and gingiva is a rare site for its occurrence . in the present case , the placement of the tobacco quid in that region could have contributed to this unusual site predilection since the activity of the carcinogens is generated through deoxyribonucleic acid adducts . scc most commonly affects men than women , usually in the middle or later decades of life , ( although any age can be affected ) . in accordance clinical presentation of oral spcc can vary from an exophytic polypoid mass with an ulcerated surface to a frankly infiltrative ulcer , occurring mainly in the alveolar ridge . in this case , spcc presented clinically as a polypoid growth with surface necrosis involving an unusual location , i.e. , the mandibular gingiva . although there are various risk factors such as age , genetic , viruses , environment and occupation , which can influence the occurrence of spcc , four predominant factors , which are considered to predispose for the development of spcc are alcohol abuse , poor oral health , previous irradiation to the area of the tumor and the most important risk factor being tobacco in various forms such as cigarette , cigar , pipe and smokeless tobacco . spcc is considered to be basically aggressive in nature because the incidence of metastases was found to be 36% and the 2-year survival rate was 55% in tumors involving the oral cavity . our present case indeed was unique since the tumor was slowly progressive over 8 months duration with no signs of distant metastases contrary to the reported aggressive nature of conventional spcc . in spcc the most sensitive and reliable epithelial marker cytokeratin was used for demonstration of the epithelial phenotype . positive cytokeratin and vimentin expression was seen , but the tumor cells were negative for cd34 ( only the endothelial cells showed a positive reaction ) eliminating the possibility of any vascular malignant tumors . podoplanin , a molecule expressed in malignant cells was used to determine for any lymphatic invasion . to the best our knowledge , this is one of the first cases to have employed a lymphatic marker for spcc of the gingiva . to conclude , spcc can occur on the gingiva and since exposure to these tumors is infrequent for clinicians , it is imperative to reiterate that all patients have an early diagnostic biopsy before the definitive therapy for a better prognosis and thereby reducing morbidity and mortality .

non - small cell lung cancer ( nsclc ) is the major cause of cancer - related deaths worldwide.1 platinum - based combination chemotherapy , which has represented the only therapeutic option for patients with advanced nsclc until a few years ago , has yielded a limited outcome improvement with a median overall survival ( os ) < 12 months and a 5-year survival rate < 1% . treatment of selected patients with advanced nsclc has been revolutionised by the discovery and subsequent targeting of the epidermal growth factor receptor ( egfr ) pathway . egfr is a member of the her family , which also includes her2 ( erbb2 ) , her3 ( erbb3 ) , her4 ( erbb4 ) . when the egfr extracellular domain binds to its ligands , such as epidermal growth factor ( egf ) and transforming growth factor- ( tgf- ) , it forms dimers with other egfr or other her family members and undergoes autophosphorylation at the key tyrosine residues , thus activating several downstream signalling pathways such as protein kinase b ( akt / pkb ) and mitogen - activated protein kinases ( mapk ) , which regulate multiple cellular processes , including proliferation , survival and apoptosis . the constitutive activation of egfr signalling , caused by gene mutations or by gene amplification or both , has been demonstrated to have close connection with the initiation , progression and poor prognosis of nsclc . the two most common egfr - activating mutations are small in - frame deletions in exon 19 ( particularly e746-a750del ) and amino acid substitution in exon 21 ( leucine to arginine at codon 858 ( l858r ) ) , which collectively account for > 90% of known activating egfr mutations.2 3 these two alterations are the best - characterised mutations conferring sensitivity to egfr - tyrosine kinase inhibitor ( egfr - tki ) therapy , resulting in higher response rates ( rr ) ( up to 70% ) and longer median survival ( up to 2430 months ) than those observed in patients with wild - type ( wt ) egfr . the higher sensitivity of these mutations relays in an increased affinity of the atp - binding pocket for egfr - tkis as compared with wt egfr . thus , mutations in egfr play a role as both biomarkers and rational targets for targeted therapy . first - generation egfr - tkis , gefitinib and erlotinib , were designed to reversibly combine with the atp - binding sites , thus blocking egfr - induced activation of downstream signalling , whereas the second - generation egfr - tkis , such as afatinib and dacomitinib , are irreversible inhibitors with greater affinity for the egfr kinase domain also inhibiting other members of the egfr family ( erbb2 , erbb3 and erbb4 ) . eight randomised controlled phase iii trials ( table 1 ) have demonstrated that first - generation or second - generation egfr - tkis represent the best first - line treatment option in patients with advanced nsclc whose tumours harbour egfr mutations , when compared with chemotherapy , because they significantly improved the rr and progression - free survival ( pfs).411 the lack of os improvement is due to treatment crossover at progression , although a pooled analysis of two studies with afatinib demonstrated an os improvement in those patients harbouring the exon 19 deletion.12 phase iii studies of egfr - tki as first - line treatment of patients with egfr mutated nsclc egfr - tki , epidermal growth factor receptor tyrosine kinase inhibitor ; nsclc , non - small cell lung cancer ; os , overall survival ; pfs , progression - free survival ; rr , response rate . however , most patients with egfr - mutant nsclc and treated with egfr - tkis develop resistance within 914 months . consequently , it is critical to establish mechanisms by which drug resistance occurs and to apply that knowledge to the development of further generation drugs or of combination strategies to overcome resistance . different mechanisms of acquired resistance to first - generation egfr - tkis have been reported ( figure 1).13 the major mechanism of acquired resistance to first - generation egfr - tkis is the occurrence of secondary egfr kinase domain mutation in exon 20 , the t790 m substitution , which accounts for about half of the cases . other abnormalities in tumour cells that may contribute to resistance to anti - egfr agents include constitutive activation of transducers downstream to egfr , overexpression of other cell surface receptors , perturbation of the apoptotic machinery or phenotypic transformation ( table 2 ) . clinical definition27 and subtyping28 of acquired resistance to egfr - tkis in lung cancer previously received treatment with a single - agent egfr - tki ( eg , gefitinib or erlotinib ) either of the following : a tumour that harbours an egfr mutation known to be associated with drug sensitivity ( ie , g719x , exon 19 deletion , l858r , l861q)objective clinical benefit from treatment with an egfr - tki as defined by either : documented partial or complete response ( recist or who)significant and durable ( 6 months ) clinical benefit ( stable disease as defined by recist or who ) after initiation of gefitinib or erlotinib a tumour that harbours an egfr mutation known to be associated with drug sensitivity ( ie , g719x , exon 19 deletion , l858r , l861q ) objective clinical benefit from treatment with an egfr - tki as defined by either : documented partial or complete response ( recist or who)significant and durable ( 6 months ) clinical benefit ( stable disease as defined by recist or who ) after initiation of gefitinib or erlotinib documented partial or complete response ( recist or who ) significant and durable ( 6 months ) clinical benefit ( stable disease as defined by recist or who ) after initiation of gefitinib or erlotinib systemic progression of disease ( recist or who ) while on continuous treatment with gefitinib or erlotinib within the past 30 days no intervening systemic therapy between cessation of gefitinib or erlotinib and initiation of new therapy cns , central nervous system ; egfr , epidermal growth factor receptor ; nsclc , non - small cell lung cancer ; pd , progression disease ; recist , response evaluation criteria in solid tumors ; tki , tyrosine kinase inhibitor . known mechanisms are secondary resistance mutations occurring in the atp - binding domain ( such as t790 m and c797s ) , mutation or amplification of bypass signallings ( such as axl , hh , erbb2 , cripto , etc ) , activating mutations in the downstream pathways ( pi3k , akt , mek , raf ) , low levels of mrna or polymorphisms of the pro - apoptotic protein bim , induction of a transcription programme for emt and phenotypical changes , or induction of elevated tumour pd - l1 levels . egfr , epidermal growth factor receptor ; emt , epithelial - to - mesenchymal transition ; mrna , messenger rna ; pd-1 , programmed death receptor-1 ; pd - l1 , programmed death ligand-1 ; tki , tyrosine kinase inhibitor . a recent breakthrough in the treatment of egfr t790 m mutant cancers occurred with the development of mutant selective pyrimidine - based third - generation egfr - tkis , which irreversibly block t790 m mutant egfr.812 the third - generation egfr - tkis include the wz4002 , co-1686 , azd9291 and hm61713 inhibitors , which have demonstrated tumour responses in > 50% of patients with the egfr t790 m mutation.812 these agents are designed to specifically inhibit mutant egfr ( ie , 19del - egfr , l858r - egfr and/or t790m+egfr ) , sparing the wt receptor.1418 therefore , since they have reduced affinity for wt egfr , the patients will not suffer from the however , it is fully anticipated that resistance will also occur to this class of egfr inhibitors . it is now clear that egfr - tkis are superior to chemotherapy in egfr - mutated nsclc ; thus , patients will be treated with multiple lines of egfr - targeted therapies with increasing frequency , although the definition of what constitutes the optimum treatment after disease progression is not yet clear and several different treatment strategies are considered . additionally , the choice of the best egfr - tki in the first - line setting is still an object of debate and results from currently recruiting clinical studies will help to define the best algorithm of treatment . in this review , we will analyse the most significant and recently reported mechanisms of resistance to egfr - targeted therapies . we need to distinguish between primary resistance , referring to patients who experience an immediate inefficacy of egfr - tkis , and secondary or acquired resistance , which is usually defined as progression of the disease after a period of clinical benefit . however , despite the clear scholastic differentiation between these two mechanisms , the reality is quite different ; some of the mechanisms , such as the coexpression of other erbb receptors or the constitutive activation of other downstream pathways , are unlikely to be located in one of the two types of resistance . we analysed several publications investigating egfr - tkis resistance mechanisms in nsclc models and patients published in peer - reviewed scientific journals and listed in pubmed since the discovery of egfr - activating mutations in 2004 until the most recent publications . we also searched for relevant abstracts of oral and poster presentations submitted to the american society of clinical oncology and european society for medical oncology from 2010 to 2015 . egfr mutations and resistance. articles or abstracts published in a language other than english were excluded . although mechanisms of intrinsic resistance are not fully understood , several cases on non - response to egfr - tkis have been described in the presence of non - classical sensitising egfr mutations and rarely in classical egfr mutations ( deletion in exon 19 and l858r ) . the most common mutations found in the egfr gene among patients with nsclc involve point mutations in exon 18 , insertions or deletions ( indels ) in exon 19 ( 44% of all egfr - activating mutations ) , insertions / duplications and point mutations in exon 20 and point mutations in exon 21 ( 41% of all egfr - activating mutations ) . these mutations result in destabilisation of the equilibrium between the active and inactive states of egfr kinase activity.19 20 intrinsic resistance is often the consequence of the presence of a non - sensitive egfr mutation . the most important and frequent drug - resistant egfr mutations are represented by an exon 20 insertion , whose frequency ranges from 1% to 10% of the total number of egfr mutations . exon 20 insertions add residues at the n - lobe of egfr ( m766 to c775 ) and their preferential location is the c - helix ( a767 to c775 ) . this region is essential in orienting the kinase into a state that controls atp and egfr - tki binding and may indeed regulate the kinase domain conformation into an active position.19 the majority of exon 20 insertion mutations present a reduced affinity for egfr - tkis , although some insertion mutations have demonstrated prolonged periods of disease control with reversible egfr - tkis suggesting at least intermediate sensitivity , such as the insertion egfr - a763_y764insfqea , which is highly sensitive to egfr - tkis in vitro.20 21 although the t790 m mutation is the most common mechanism of acquired resistance to first - generation egfr - tkis , rarely has it been identified in tumours before exposure to egfr - tkis concurrently with other more common sensitising mutations.20 this gatekeeper t790 m point mutation increases the affinity of egfr for atp and consequently attenuates the binding efficacy of egfr - tkis . the reported frequency of baseline egfr t790 m mutations varies widely in the literature as a consequence of the detection method used and the population tested . the clinical implication of the baseline egfr t790 m mutation varies among published studies , although it is commonly associated with poor clinical outcomes in patients treated with egfr - tkis.22 the impact on responsiveness to egfr - tki therapy of the pre - existing t790 m mutation may depend on the proportion of pretreatment egfr t790m - mutant alleles within a tumour that may range from a small subclone to one clonally dominant . a distinct egfr mutation is represented by the variant iii ( viii ) in - frame deletion of exons 27 in the extracellular domain that prevents egfrviii from binding egf and other ligands . the constitutive signalling by egfrviii and the resistance to egfr - targeted therapy are thought to be the consequence of structural changes in the egfr protein that could affect the intracellular domain conformation and the atp pocket.23 it is present in 5% of analysed human lung squamous cell carcinoma ( scc ) and has been associated with tki resistance in vitro . indeed , gefitinib can reduce egfrviii phosphorylation after several days of treatment , but it does not influence cell growth.24 intrinsic resistance may also be the consequence of concurrent molecular or genetic alterations that could potentially decrease the sensitivity of patients with sensitising egfr mutations to egfr - tkis treatment . one example is represented by the ability of tumours to evade tki - induced apoptosis as a consequence of deletion polymorphisms or low - to - intermediate levels of messenger rna ( mrna ) of the proapoptotic bcl-2 family member , bim , that is a critical mediator of egfr - tkis - induced apoptosis in egfr - mutant nsclc.25 patients harbouring bim deletion polymorphisms23 or patients with low - to - intermediate levels of bim mrna18 are associated with reduced clinical efficacy when treated with egfr - tkis.25 another example is represented by high basal levels of cripto1 , also known as teratocarcinoma - derived growth factor 1 ( tdgf1 ) , which is a glycosylphosphatidylinositol - linked cell membrane - anchored protein that belongs to the egf - cfc family , and is able to reduce sensitivity to egfr - tkis through activation of both zeb1 and src , thus promoting epithelial - to - mesenchymal transition ( emt ) and stimulation of akt and mek signalling , respectively.26 secondary or acquired resistance typically occurs after prolonged treatment , and several molecular mechanisms have been suggested to contribute to the resistance phenotype . the entity of progression differs among cases in terms of the extent and/or sites of progressive disease and treatment options may vary widely based on the type of progression . in 2010 , jackman et al27 proposed a clinical definition of acquired resistance to egfr - tkis in patients with nsclc . these criteria aimed to benefit both practising oncologists and research undertaken in patients who had acquired resistance from first - line egfr - tkis , but needed further clinical validation . gandara et al28 proposed a clinical subtyping of acquired resistance to egfr - directed tki therapy in patients with nsclc according to a progression disease ( pd ) occurring as ( 1 ) central nervous system ( cns ) sanctuary pd , ( 2 ) oligo - pd and ( 3 ) systemic pd . although the optimal therapeutic strategy for patients experiencing acquisition of resistance during treatment with egfr - tkis is not yet defined , this classification actually helps physicians in the management according to progression patterns . for patients with slowly progressing lesions and with lesions smaller than pretreatment and progression , as documented by response evaluation criteria in solid tumors ( recist ) , and without the worsening of systemic symptoms and/or signs , the continuation of the present egfr - tki can be suggested . similarly , for patients with cns pd or oligo - pd , some data have shown that local therapy ( eg , surgery , radiotherapy or both ) to the site of progression might be appropriate , with continuation of egfr - tki treatment thereafter.28 since egfr antagonists interfere with the activation of several intracellular pathways that control cell proliferation , survival , apoptosis , metastatic capability , invasion and angiogenesis , the molecular mechanisms of acquired resistance can be due to several processes . the comprehensive analysis of resistance mechanisms in patients at progression on egfr - tkis by repeated tumour biopsy has led to the definition of a mechanism of resistance which has been defined in around 6070% of cases and classified in one of the following categories : insurgence of secondary mutations in the egfr gene.phenotypic transformation.activation of alternative pathways . the most common secondary mutation responsible for acquisition of resistance occurs in exon 20 ( t790m).1418 the presence of the t790 m mutation was observed in approximately 50% of the cases in which biopsy was obtained at the time of relapse following gefitinib or erlotinib treatment in patients with the exon 19 deletion or the l858r egfr mutation . the crystallographic structure of the egfr protein and its kinase domain shows that this mutation involves a substitution of the threonine residue , located in the hydrophobic atp - binding pocket of the catalytic domain , where it forms a critical hydrogen bond with the drug with a large methionine residue , thus resulting in a steric conflict with the drugs . additionally , the t790 m mutation alters the affinity of egfr to atp , rendering atp as the favoured substrate compared with atp - competitive egfr - tkis.29 interestingly , patients whose tumours harbour the t790 m mutation might experience a more indolent natural history and more favourable prognosis than do patients whose tumours do not harbour the t790 m mutation.30 however , even patients with acquired resistance to gefitinib , erlotinib and afatinib with the t790 m mutation can potentially have a rapid clinical decline and short survival . although the occurrence of the t790 m mutation at acquisition of resistance is consolidated information , little is known about how resistant clones evolve during drug therapy . a recent work by hata et al31 studied the development of resistance caused by the egfr t790 m gatekeeper mutation and tried to answer the question of whether resistance depends on selection of pre - existing clones or on acquisition of validated genetic resistance mechanisms after a period of drug tolerance . by the monitoring of the development of large numbers of resistant clones in parallel , authors were able to identify patterns characterised by pre - existing drug - resistant egfrt790m - positive clones as well as the de novo acquisition of the egfrt790 m mutation within initially egfrt790m - negative drug - tolerant cells . the evolution from drug - tolerant cells to resistant ones seems to impact the biology of the resistant clone ; epigenetic hallmarks of the drug - tolerant state coexist with a diminished apoptotic response to third - generation egfr inhibitors that target egfrt790 m . however , treatment with navitoclax , an inhibitor of the antiapoptotic factors bcl - xl and bcl-2 , restored sensitivity.31 these findings provide important evidence that drug - resistant cancer cells bearing the identical clinically relevant genetic resistance mechanism can both pre - exist or evolve from drug - tolerant cells , suggesting that cancer cells that survive initial therapy may serve as an important reservoir from which acquired resistance can emerge in the clinic . rare egfr point mutations ( < 10% of patients ) that result in resistance include asp761tyr,39 thr854ala,40 and leu747ser . the mechanism ( or mechanisms ) similar to early - generation egfr inhibitors , insurgence of secondary mutation has been described as a mechanism of acquired resistance also to third - generation tkis.32 33 the first report of an acquired egfr mutation after therapy with third - generation egfr - tki was identified in a lung cancer sample from a patient experiencing resistance to azd9291.32 the egfr c797s is a tertiary substitution mutation at the binding site , changing cysteine 797 into serine ( egfr c797s ) , which is essential for the covalent bond with the drugs , and therefore confers cross - resistance to all third - generation inhibitors . subsequent studies have described several mechanisms of acquired resistance to azd9291 and co1686 in vitro and in the clinical setting . in a study analysing cell - free dna of 15 patients with resistance to azd9291 by next - generation sequencing ( ngs ) , distinct egfr genotypes before and after azd9291 treatment were defined : acquired c797s together with a t790 m mutation ( 40% ) , t790 m mutation without a c797s mutation ( 33% ) and loss of the t790 m mutation without a c797s mutation ( 27%).33 in these models , the tumour growth is still dependent on egfr signalling and under the strong selective pressure of egfr - tkis , the tumour developed secondary and tertiary mutations in the egfr gene ( t790 m and c797s , respectively).33 whether these tertiary mutations derive from the expansion of a pre - existing clone is still an object of investigation . repeated bioptic sampling from patients with egfr - mutant nsclcs have shown a rare but consistent observation of histological transformation from adenocarcinoma to small cell lung cancer ( sclc).34 this plasticity to switch histologies raises the possibility of a shared cell of origin between adenocarcinoma and sclc . probably , sclc cells originate from the minor pre - existent cells under the selection pressure of egfr - tkis , or transdifferentiate from the adenocarcinoma cells , or arise from the multipotent stem cells . in particular , there is preclinical evidence that type ii alveolar cells have the potential to differentiate into sclc after the targeted disruption of tp53 and rb1.35 genomic sequencing of egfr from both the baseline and repeated biopsy samples shows that a transformed sclc tumour sample retained the original egfr - activating mutation , suggesting that these were not de novo clones , but rather a transformed phenotype of pre - existing cancer cells . however , patients with adenocarcinoma - sclc transformation presented mixed responses to egfr inhibitors , despite the persistency of the activating mutation , probably due to the loss of egfr expression at the protein level.34 another aspect , more common , in the context of phenotypical transformation is the emt , which is a process characterised by a loss of polarity and cell cell contacts by the epithelial cell layers , which undergo a dramatic remodelling of their cytoskeleton.36 along with a loss of epithelial cell adhesion and alterations in their cytoskeletal component , cells undergoing emt acquire expression of mesenchymal components . a main feature of emt is the loss of e - cadherin expression37 and the upregulation of mesenchymal proteins such as vimentin , fibronectin and n - cadherin . in the tarceva responses in conjunction with paclitaxel and carboplatin ( tribute ) trial,38 among patients receiving erlotinib and chemotherapy , time to progression was longer for those with e - cadherin - positive staining.39 emt plays an important role in multiple physiological and pathological processes of human biology by regulating the transcription of genes involved in embryonic development , inflammatory response , tissue regeneration , organ fibrosis , tumour invasion and metastasis . in the context of an emt , axl upregulation appears as a novel mechanism of acquired egfr - tki resistance in egfr - mutant nsclcs . recently , an integrated analysis in human egfr - mutant nsclc models and in a large clinical cohorts of paired nsclc specimens from egfr - tki - treated patients demonstrated an upregulation of axl tyrosine kinase receptor or of its ligand , gas6 , in resistant samples . pharmacological inhibition of axl significantly decreased the proliferative and invasive abilities of cancer cells and increased their chemosenstivity through inhibition of akt and mapk pathways . therefore , an emt - associated transcriptional programme involving upregulation of vimentin may , in part , drive axl overexpression in egfr - mutant lung cancer cells with acquired egfr - tki resistance.40 another pathway recently identified in the emt setting and responsible for acquisition of resistance to first - generation egfr - tkis is the hedgehog ( hh ) pathway,41 whose activation has been implicated in tumourigenesis , metastatisation and progression along with cancer stem - like cell maintenance and treatment resistance in several types of human cancer . more deeply , gene amplification of the hh receptor , smo , concomitantly with met activation , has been recently identified , for the first time , as a novel mechanism of acquired resistance to egfr - tki in egfr - mutant nsclc cells . hh - mediated acquisition of egfr - tki resistance was concomitant with the mesenchymal shift of egfr - mutated nsclc cells , which displayed higher invasive and metastatic abilities . these preclinical results are in agreement with the results of a cohort of patients with egfr - mutant nsclc that were treated with egfr - tkis.42 gianikopoulos et al demonstrated the presence of smo gene amplification in tumour biopsies that were taken at the clinical occurrence of resistance to egfr - tkis in 2 of the 16 patients . in both cases , the combined inhibition of both smo and met exerted a significant antiproliferative and proapoptotic effect concomitantly with the loss of mesenchymal features in preclinical models of acquired resistance to egfr - tkis in egfr - mutated nsclc cells , suggesting new combination strategies at the occurrence of resistance . consistently with these results , bai et al43 found that the hh signalling pathway was inappropriately activated in egfr - tki - resistant nsclc cells , accompanied by emt induction and atp - binding cassette subfamily g member 2 ( abcg2 ) overexpression . the combined inhibition of hh and egfr pathways markedly inhibited tumourigenesis and proliferation , reverted mesenchymal phenotype by restoring e - cadherin expression and downregulated snail and abcg2 in egfr - tki - resistant cells . these findings confirmed that upregulation of hh signalling resulted in egfr - tki resistance , by emt induction , and inhibition of hh signalling increased sensitivity to egfr - tki.43 activation of alternative pathways represents the second most common resistance mechanism to egfr - tkis . in particular , amplification of the met oncogene , described for the first time in 2007,44 accounts for 520% of acquired resistance causes . met is a transmembrane tyrosine kinase receptor that , once activated by its ligand , the hepatocyte growth factor ( hgf , also known as the scatter factor ) , promotes the activation of the downstream akt pathway , which is the key signalling pathway for cell proliferation , survival and antiapoptosis . uncontrolled activation of met is oncogenic and facilitates the invasive and metastatic behaviour of egfr - tki resistant cells.44 met overactivation in most egfr - tki acquired resistant tumours occurs via increased transcription and expression of met protein while met gene amplification is detected in 22% of cases . in addition , over 20 oncogenic mutations have been identified in met and the majority of them were found to be germline mutations . the most frequent mutations in nsclc are in the semaphorin domain ( affecting hgf binding ) , the juxtamembrane domain ( affecting the actin cytoskeleton , cell motility and migration ) and the tk domain ( activating met even in the absence of hgf ) . the overexpressed met receptor leads to a persistent erbb3-akt signalling by maintaining erbb phosphorylation despite the presence of the egfr blockade . erbb3 is a tyrosine kinase receptor of the erbb family , which can form homodimers or heterodimers with erbb2 to transduce growth signals . overexpression of the hgf has also been shown to induce resistance to egfr - tkis . the efficacy of met signalling inhibitors , tkis or monoclonal antibodies against the receptor or the ligand , is still an object of investigation as the most informative method to define met amplification is not established yet.45 similarly , while amplification of the erbb2 gene is a rare event in untreated adenocarcinoma ( 1% of the cases ) , it has been responsible for acquisition of resistance in 12% of cases.46 moreover , erbb2 mutations also occurred in about 2% of patients with nsclc , more frequently in never smokers with adenocarcinoma histology , oriental ethnicity and female gender ; they are located in exon 20 , encoding for the kinase domain of the erbb2 protein . different from the other family members , erbb2 has strong kinase activity but has no identified ligand - binding domain . the dependence of erbb2 activation on the transphosphorylation of egfr determines the strong inhibition by egfr - tkis on the wt erbb2 . however , when erbb2 mutates in the kinase domain , it becomes egfr - independent and induces resistance to egfr - tkis . previous studies have postulated conflicting data on the role of egfr heterodimers in mediating sensitivity to egfr - tkis in egfr - mutant lung cancer : immunoprecipitation studies suggest that mutant egfrs , especially the l858r / t790 m variant , have a propensity to heterodimerise with erbb2 , which allows for evasion of cbl - mediated ubiquitinylation and the subsequent lysosomal degradation.47 therefore , a hypothesis still to demonstrate , might be that mutant cancer cells can become resistant either by acquiring the t790 m mutation which enhances erbb2 heterodimerisation in the absence of erbb2 amplification , or by acquiring erbb2 amplification in the absence of a second - site mutation . both amplifications of met and erbb2 have been described as mechanisms of acquired resistance to the third - generation inhibitor azd9291 , concomitantly with the loss of t790m.48 another alternative pathway involved in egfr - tki resistance is the insulin - like growth factor 1 receptor ( igf-1r ) , whose activation has been detected in multiple gefitinib or erlotinib resistant lung cancer lines.49 the interplay between the igf-1r and egfr pathways seems to be not completely understood . a known mechanism is that igf-1r could be activated by heterodimerisation with egfr after erlotinib treatment49 transmitting extracellular survival signals to downstream mediators such as akt and mapk . co - treatment of igf-1r inhibitors such as -ir3 , ag1024 or r1507 with egf - tkis - enhanced tki - induced growth inhibition and apoptosis , offering a potential new approach to overcome the resistance of egfr - tkis in nsclc.50 activation of other cell receptors such as fgfr1,2,351 or of cell signalling pathways such as braf ( val600glu , gly469ala ) mutation ( 1%)52 and pik3ca mutation ( 5%)34 , that play a key role in promoting the proliferation , survival , drug resistance of cancer cells , have been described . in particular , akt activation can be tied to akt gene mutation , mutations and amplifications of pik3ca ( the gene encoding the main catalytic subunit of pi3k ) as well as loss or reduced expression of pten . preclinical data confirmed that p110 e545k , a pik3ca oncogenic mutation , resulted in dramatically suppressed sensitivity to gefitinib.53 early translational studies demonstrated that a mutant egfr receptor drives expression of programmed death ligand-1 ( pd - l1 ) and that blockade of the programmed death receptor-1 ( pd-1 ) improved survival of mice with egfr - mutant tumours.54 therefore , another potential strategy is the use of immune checkpoint inhibitors such as pd-1 pathway inhibitors . indeed , preliminary results of a study investigating the combination of nivolumab ( anti - pd-1 monoclonal antibody ) and erlotinib reported an overall reposnse rate ( orr ) of 19% with the majority of responders having previously progressed while receiving erlotinib.55 nivolumab has been recently approved by the food and drug administration ( fda ) for the treatment of patients with squamous nsclc after failure of chemotherapy . further investigations of nivolumab as monotherapy or in combination with egfr - tki in patients with nsclc and egfr mutations will provide further insight into the role of immunotherapy ( nct02323126 ) . the most common secondary mutation responsible for acquisition of resistance occurs in exon 20 ( t790m).1418 the presence of the t790 m mutation was observed in approximately 50% of the cases in which biopsy was obtained at the time of relapse following gefitinib or erlotinib treatment in patients with the exon 19 deletion or the l858r egfr mutation . the crystallographic structure of the egfr protein and its kinase domain shows that this mutation involves a substitution of the threonine residue , located in the hydrophobic atp - binding pocket of the catalytic domain , where it forms a critical hydrogen bond with the drug with a large methionine residue , thus resulting in a steric conflict with the drugs . additionally , the t790 m mutation alters the affinity of egfr to atp , rendering atp as the favoured substrate compared with atp - competitive egfr - tkis.29 interestingly , patients whose tumours harbour the t790 m mutation might experience a more indolent natural history and more favourable prognosis than do patients whose tumours do not harbour the t790 m mutation.30 however , even patients with acquired resistance to gefitinib , erlotinib and afatinib with the t790 m mutation can potentially have a rapid clinical decline and short survival . although the occurrence of the t790 m mutation at acquisition of resistance is consolidated information , little is known about how resistant clones evolve during drug therapy . a recent work by hata et al31 studied the development of resistance caused by the egfr t790 m gatekeeper mutation and tried to answer the question of whether resistance depends on selection of pre - existing clones or on acquisition of validated genetic resistance mechanisms after a period of drug tolerance . by the monitoring of the development of large numbers of resistant clones in parallel , authors were able to identify patterns characterised by pre - existing drug - resistant egfrt790m - positive clones as well as the de novo acquisition of the egfrt790 m mutation within initially egfrt790m - negative drug - tolerant cells . the evolution from drug - tolerant cells to resistant ones seems to impact the biology of the resistant clone ; epigenetic hallmarks of the drug - tolerant state coexist with a diminished apoptotic response to third - generation egfr inhibitors that target egfrt790 m . however , treatment with navitoclax , an inhibitor of the antiapoptotic factors bcl - xl and bcl-2 , restored sensitivity.31 these findings provide important evidence that drug - resistant cancer cells bearing the identical clinically relevant genetic resistance mechanism can both pre - exist or evolve from drug - tolerant cells , suggesting that cancer cells that survive initial therapy may serve as an important reservoir from which acquired resistance can emerge in the clinic . rare egfr point mutations ( < 10% of patients ) that result in resistance include asp761tyr,39 thr854ala,40 and leu747ser . the mechanism ( or mechanisms ) underlying resistance conferred by these mutations is still unclear . similar to early - generation egfr inhibitors , insurgence of secondary mutation has been described as a mechanism of acquired resistance also to third - generation tkis.32 33 the first report of an acquired egfr mutation after therapy with third - generation egfr - tki was identified in a lung cancer sample from a patient experiencing resistance to azd9291.32 the egfr c797s is a tertiary substitution mutation at the binding site , changing cysteine 797 into serine ( egfr c797s ) , which is essential for the covalent bond with the drugs , and therefore confers cross - resistance to all third - generation inhibitors . subsequent studies have described several mechanisms of acquired resistance to azd9291 and co1686 in vitro and in the clinical setting . in a study analysing cell - free dna of 15 patients with resistance to azd9291 by next - generation sequencing ( ngs ) , distinct egfr genotypes before and after azd9291 treatment were defined : acquired c797s together with a t790 m mutation ( 40% ) , t790 m mutation without a c797s mutation ( 33% ) and loss of the t790 m mutation without a c797s mutation ( 27%).33 in these models , the tumour growth is still dependent on egfr signalling and under the strong selective pressure of egfr - tkis , the tumour developed secondary and tertiary mutations in the egfr gene ( t790 m and c797s , respectively).33 whether these tertiary mutations derive from the expansion of a pre - existing clone is still an object of investigation . repeated bioptic sampling from patients with egfr - mutant nsclcs have shown a rare but consistent observation of histological transformation from adenocarcinoma to small cell lung cancer ( sclc).34 this plasticity to switch histologies raises the possibility of a shared cell of origin between adenocarcinoma and sclc . probably , sclc cells originate from the minor pre - existent cells under the selection pressure of egfr - tkis , or transdifferentiate from the adenocarcinoma cells , or arise from the multipotent stem cells . in particular , there is preclinical evidence that type ii alveolar cells have the potential to differentiate into sclc after the targeted disruption of tp53 and rb1.35 genomic sequencing of egfr from both the baseline and repeated biopsy samples shows that a transformed sclc tumour sample retained the original egfr - activating mutation , suggesting that these were not de novo clones , but rather a transformed phenotype of pre - existing cancer cells . however , patients with adenocarcinoma - sclc transformation presented mixed responses to egfr inhibitors , despite the persistency of the activating mutation , probably due to the loss of egfr expression at the protein level.34 another aspect , more common , in the context of phenotypical transformation is the emt , which is a process characterised by a loss of polarity and cell cell contacts by the epithelial cell layers , which undergo a dramatic remodelling of their cytoskeleton.36 along with a loss of epithelial cell adhesion and alterations in their cytoskeletal component , cells undergoing emt acquire expression of mesenchymal components . a main feature of emt is the loss of e - cadherin expression37 and the upregulation of mesenchymal proteins such as vimentin , fibronectin and n - cadherin . in the tarceva responses in conjunction with paclitaxel and carboplatin ( tribute ) trial,38 among patients receiving erlotinib and chemotherapy , time to progression was longer for those with e - cadherin - positive staining.39 emt plays an important role in multiple physiological and pathological processes of human biology by regulating the transcription of genes involved in embryonic development , inflammatory response , tissue regeneration , organ fibrosis , tumour invasion and metastasis . in the context of an emt , axl upregulation appears as a novel mechanism of acquired egfr - tki resistance in egfr - mutant nsclcs . recently , an integrated analysis in human egfr - mutant nsclc models and in a large clinical cohorts of paired nsclc specimens from egfr - tki - treated patients demonstrated an upregulation of axl tyrosine kinase receptor or of its ligand , gas6 , in resistant samples . pharmacological inhibition of axl significantly decreased the proliferative and invasive abilities of cancer cells and increased their chemosenstivity through inhibition of akt and mapk pathways . therefore , an emt - associated transcriptional programme involving upregulation of vimentin may , in part , drive axl overexpression in egfr - mutant lung cancer cells with acquired egfr - tki resistance.40 another pathway recently identified in the emt setting and responsible for acquisition of resistance to first - generation egfr - tkis is the hedgehog ( hh ) pathway,41 whose activation has been implicated in tumourigenesis , metastatisation and progression along with cancer stem - like cell maintenance and treatment resistance in several types of human cancer . more deeply , gene amplification of the hh receptor , smo , concomitantly with met activation , has been recently identified , for the first time , as a novel mechanism of acquired resistance to egfr - tki in egfr - mutant nsclc cells . hh - mediated acquisition of egfr - tki resistance was concomitant with the mesenchymal shift of egfr - mutated nsclc cells , which displayed higher invasive and metastatic abilities . these preclinical results are in agreement with the results of a cohort of patients with egfr - mutant nsclc that were treated with egfr - tkis.42 gianikopoulos et al demonstrated the presence of smo gene amplification in tumour biopsies that were taken at the clinical occurrence of resistance to egfr - tkis in 2 of the 16 patients . in both cases , the combined inhibition of both smo and met exerted a significant antiproliferative and proapoptotic effect concomitantly with the loss of mesenchymal features in preclinical models of acquired resistance to egfr - tkis in egfr - mutated nsclc cells , suggesting new combination strategies at the occurrence of resistance . consistently with these results , bai et al43 found that the hh signalling pathway was inappropriately activated in egfr - tki - resistant nsclc cells , accompanied by emt induction and atp - binding cassette subfamily g member 2 ( abcg2 ) overexpression . the combined inhibition of hh and egfr pathways markedly inhibited tumourigenesis and proliferation , reverted mesenchymal phenotype by restoring e - cadherin expression and downregulated snail and abcg2 in egfr - tki - resistant cells . these findings confirmed that upregulation of hh signalling resulted in egfr - tki resistance , by emt induction , and inhibition of hh signalling increased sensitivity to egfr - tki.43 activation of alternative pathways represents the second most common resistance mechanism to egfr - tkis . in particular , amplification of the met oncogene , described for the first time in 2007,44 accounts for 520% of acquired resistance causes . met is a transmembrane tyrosine kinase receptor that , once activated by its ligand , the hepatocyte growth factor ( hgf , also known as the scatter factor ) , promotes the activation of the downstream akt pathway , which is the key signalling pathway for cell proliferation , survival and antiapoptosis . uncontrolled activation of met is oncogenic and facilitates the invasive and metastatic behaviour of egfr - tki resistant cells.44 met overactivation in most egfr - tki acquired resistant tumours occurs via increased transcription and expression of met protein while met gene amplification is detected in 22% of cases . in addition , over 20 oncogenic mutations have been identified in met and the majority of them were found to be germline mutations . the most frequent mutations in nsclc are in the semaphorin domain ( affecting hgf binding ) , the juxtamembrane domain ( affecting the actin cytoskeleton , cell motility and migration ) and the tk domain ( activating met even in the absence of hgf ) . the overexpressed met receptor leads to a persistent erbb3-akt signalling by maintaining erbb phosphorylation despite the presence of the egfr blockade . erbb3 is a tyrosine kinase receptor of the erbb family , which can form homodimers or heterodimers with erbb2 to transduce growth signals . overexpression of the hgf has also been shown to induce resistance to egfr - tkis . the efficacy of met signalling inhibitors , tkis or monoclonal antibodies against the receptor or the ligand , is still an object of investigation as the most informative method to define met amplification is not established yet.45 similarly , while amplification of the erbb2 gene is a rare event in untreated adenocarcinoma ( 1% of the cases ) , it has been responsible for acquisition of resistance in 12% of cases.46 moreover , erbb2 mutations also occurred in about 2% of patients with nsclc , more frequently in never smokers with adenocarcinoma histology , oriental ethnicity and female gender ; they are located in exon 20 , encoding for the kinase domain of the erbb2 protein . different from the other family members , erbb2 has strong kinase activity but has no identified ligand - binding domain . the dependence of erbb2 activation on the transphosphorylation of egfr determines the strong inhibition by egfr - tkis on the wt erbb2 . however , when erbb2 mutates in the kinase domain , it becomes egfr - independent and induces resistance to egfr - tkis . previous studies have postulated conflicting data on the role of egfr heterodimers in mediating sensitivity to egfr - tkis in egfr - mutant lung cancer : immunoprecipitation studies suggest that mutant egfrs , especially the l858r / t790 m variant , have a propensity to heterodimerise with erbb2 , which allows for evasion of cbl - mediated ubiquitinylation and the subsequent lysosomal degradation.47 therefore , a hypothesis still to demonstrate , might be that mutant cancer cells can become resistant either by acquiring the t790 m mutation which enhances erbb2 heterodimerisation in the absence of erbb2 amplification , or by acquiring erbb2 amplification in the absence of a second - site mutation . both amplifications of met and erbb2 have been described as mechanisms of acquired resistance to the third - generation inhibitor azd9291 , concomitantly with the loss of t790m.48 another alternative pathway involved in egfr - tki resistance is the insulin - like growth factor 1 receptor ( igf-1r ) , whose activation has been detected in multiple gefitinib or erlotinib resistant lung cancer lines.49 the interplay between the igf-1r and egfr pathways seems to be not completely understood . a known mechanism is that igf-1r could be activated by heterodimerisation with egfr after erlotinib treatment49 transmitting extracellular survival signals to downstream mediators such as akt and mapk . co - treatment of igf-1r inhibitors such as -ir3 , ag1024 or r1507 with egf - tkis - enhanced tki - induced growth inhibition and apoptosis , offering a potential new approach to overcome the resistance of egfr - tkis in nsclc.50 activation of other cell receptors such as fgfr1,2,351 or of cell signalling pathways such as braf ( val600glu , gly469ala ) mutation ( 1%)52 and pik3ca mutation ( 5%)34 , that play a key role in promoting the proliferation , survival , drug resistance of cancer cells , have been described . in particular , akt activation can be tied to akt gene mutation , mutations and amplifications of pik3ca ( the gene encoding the main catalytic subunit of pi3k ) as well as loss or reduced expression of pten . preclinical data confirmed that p110 e545k , a pik3ca oncogenic mutation , resulted in dramatically suppressed sensitivity to gefitinib.53 early translational studies demonstrated that a mutant egfr receptor drives expression of programmed death ligand-1 ( pd - l1 ) and that blockade of the programmed death receptor-1 ( pd-1 ) improved survival of mice with egfr - mutant tumours.54 therefore , another potential strategy is the use of immune checkpoint inhibitors such as pd-1 pathway inhibitors . indeed , preliminary results of a study investigating the combination of nivolumab ( anti - pd-1 monoclonal antibody ) and erlotinib reported an overall reposnse rate ( orr ) of 19% with the majority of responders having previously progressed while receiving erlotinib.55 nivolumab has been recently approved by the food and drug administration ( fda ) for the treatment of patients with squamous nsclc after failure of chemotherapy . further investigations of nivolumab as monotherapy or in combination with egfr - tki in patients with nsclc and egfr mutations will provide further insight into the role of immunotherapy ( nct02323126 ) . heterogeneous tumours , such as nsclc , are composed of multiple subclones and under selection pressures , such as the egfr inhibition , clones with either intrinsic or acquired resistance can be selected and drive disease progression . the analysis of multiple biopsies from the same tumour during the time and treatments reveal the evolutionary trajectory of these subclones , where clonal mutations present in all tumour regions , and eventually persisting during treatments , such as activating egfr mutations , occur early in tumourigenesis representing the most recent common ancestor ( truncal events on the evolutionary tree ) , whereas subclonal mutations present in only a subset of regions , or cells within a single biopsy , occur later in tumourigenesis ( branched events on the evolutionary tree ) and can be lost after specific therapies ( such as the t790 m mutation ) . further studies on the mechanisms by which subclonal alterations have an impact on tumour biology and phenotype and influence progression suggest challenges for predictive and prognostic implications . however , serial tumour sampling to monitor clonal evolution poses practical challenges and is currently not standard practice . an alternative approach may be the use of liquid biopsies , whereby circulating cell - free tumour dna ( cfdna ) or circulating tumour cells ( ctcs ) are analysed in the peripheral blood of patients with cancer . liquid biopsies have the potential to inform early detection of cancer , to detect minimal residual disease , to mirror the heterogeneity of tumour and track evolution of resistant disease and therefore detect early relapse . since introduction of third generation egfr tkis requires monitoring the occurrence of t790 m mutation for the pianification of treatment at resistance , this noninvasive approach will be useful for the clinical practice treatment at resistance.53 56 of interest , cfdna has also applied to explore novel mechanism of acquired resistance to third - generation egfr - tki . identification of the c797s mutation in patients with lung cancer , whose tumours had developed resistance to azd9291 , was identified by thress et al57 using ngs in cfdna samples . thus , sequencing analysis of cfdna after the initiation of egfr - tki , either early generation or third generation , can ultimately provide information in the dynamic mutation profile . since deeper knowledge on the subclonal composition of nsclc will be obtained , different treatment approaches can be considered . adoptive therapy concept has been proposed by gatenby et al,58 whereby treatment - sensitive cells are initially targeted , resulting in the likely expansion of treatment - resistant cells that are subsequently targeted having predicted beforehand their likely mechanism of resistance . another possible strategy in order to maximise the survival benefit from first - line treatment in patients with nsclc and egfr mutations and delay the occurrence of resistance is an upfront egfr - tki - based combination therapy , including combinations of egfr inhibitors with various targeted agents , chemotherapy or even immunotherapy . in any case , to obtain meaningful results , careful selection of patients and design of randomised clinical trials is of primary importance .

community structure is influenced by many factors , including genetics , diet , and xenobiotic and antibiotic use ( 4 , 5 , 9 , 15 ) . the gut microbiome , in particular , plays an important role in metabolism , immune development , and endocrine and neurological signaling ( 10 , 16 ) . dysbiotic gut communities have been associated with a host of human diseases including obesity , inflammatory bowel disease , type i and type ii diabetes , autism , multiple sclerosis , and malnutrition ( 3 , 16 ) . fecal material transplant may also transmit clinical phenotypes in some cases : one report suggested a donor transmitted a risk for obesity to her human recipient along with her stool , while trans - species transmission of obesity is well established ( 1 , 17 ) . human microbiome work has primarily focused on case - control studies of a few dozen to a few hundred individuals . budget restrictions and strict disease focus by funding agencies often limit the size and scope of investigation . although studies supported by traditional mechanisms have led to considerable advances , there are also major pitfalls with the traditional approach . trends in community structure are often shared between studies , but the individual taxa driving these trends often are not . for example , studies have found correlations between obesity and both an increase and a decrease in methanobrevibacter smithii ( 19 ) . meta - analysis can ameliorate inconsistencies due to data analysis , although it can not correct for differences due to sample handling or the characteristics of the control and clinical groups ( 14 ) . the problem is compounded by the absence of effective , mathematically justified ways to quantify effect size or the signal - to - noise landscape in the microbiome . microbiomes have been small compared with cohorts used for other types of studies , such as genome - wide association studies . the human microbiome project ( hmp ) focused on 252 healthy professional students in their twenties and thirties living in two regions of the united states ( 11 ) . the hmp contributed valuable information about the microbiome , including the variation in taxonomic abundance in healthy adults and the lack of a core healthy microbiome . however , the hmp did not answer all the open questions about the healthy microbiome . for instance , the cohort was not well suited to describe how the microbial communities change between age groups or what a healthy microbiome looks like relative to dietary or lifestyle choices . public participation in microbiome research , through crowdsourcing and crowdfunding , may provide some potential solutions to these problems . both models transform science into a public , participatory area , rather than a practice for experts in semi - isolation . crowdfunding involves the public in science by asking for a monetary investment in a project . lay people can determine what they consider worthy or unworthy of funding , whether it be comparative studies of the cat microbiome ( https://fundrazr.com/campaigns/410ac4/ab/f4vyf9 ? ) or a qualitative survey of the best burritos in san francisco ( https://experiment.com/projects/qualitative-survey-of-burritos-in-san-francisco ) . this typically involves the contribution of observational data , such as bird sightings or flu symptoms , in projects like flu near you ( https://flunearyou.org ) , but may also involve crowdsourced data collection , modeled by the personal genome project ( www.personalgenomes.org ) , or even crowdsourcing data analysis , through platforms like the online games foldit ( https://fold.it/portal/ ) and eterna ( http://eterna.cmu.edu/web/ ) . crowdsourcing may open opportunities to access populations , areas , or information that is difficult for a finite group of researchers to access . it also offers opportunities in exploratory science : the wealth of data allows for a degree of exploration that can be more difficult in traditionally sourced studies , where participant recruitment is more focused . the american gut project ( www.americangut.org ) is a crowdfunded , crowdsourced microbiome project run through the university of california at san diego , which was initiated as a collaboration between the earth microbiome project and the human food project . participants provide a physical sample ( fecal , oral , skin , pet , or environmental ) , answer a survey about their health , lifestyle , and diet , and a make a monetary contribution that covers the cost of microbial dna sequencing . we have used american gut to draw conclusions about factors that affect participant health in the human microbiome ( debelius , mcdonald , et al . , we present three stages that have been important for aggregating the american gut results and presenting usable data . there is an added complexity in disseminating research to the general public , because complex concepts must be translated into messages that can be readily digested by individuals without specific domain knowledge . the inherent difficulty is magnified in participatory science , as there is a continual interaction with members of the general public . the challenge of communication can be broken down into three major areas critical to crowdfunding : participant recruitment and retention , data collection ( both sample and metadata collection and quality ) , and data dissemination . the first area , recruitment and retention , is a crowdsourced project s initial and primary interaction . at the outset , members of the public are unlikely to be interested in your project if they are unable to understand why you are doing the project in the first place . they also want to know how they benefit by participating . in the case of the american gut project , one of our goals was to provide an avenue through which members of the general public could engage in cutting - edge research and , in turn , learn about the organisms that inhabit their bodies . participatory science can be self - selecting , and this may create a biased cohort , rather than a true representation of the population . gut microbiome research , for example , may be more likely to attract individuals with diagnosed gastrointestinal conditions , such as inflammatory bowel disease ( ibd ) . in the american gut , we see a six - fold enrichment in participants with ibd compared with the us population as a whole ( debelius , mcdonald et al . sponsors have also contributed funds to provide kits for participants in other populations of interest , including children with autism spectrum disorder . these sub - studies may lead to an understanding of compositional patterns associated with these specific populations . the role of the internet in participatory science can not be discounted , meaning that participation is likely linked to internet access ( 6 ) . coupling crowdfunding to crowdsourcing may limit the participant population to those able afford the cost . the financial burden may also create self - selection , even for those with the available disposable income . many of the early american gut participants were individuals who emphasized the importance of diet in health , and therefore tended toward more extreme dietary choices . these implicit biases in the population may be hard to identify , and harder to correct ( although they are less important for the original goal of the project in terms of identifying the diversity of types of microbiome out there in the wild ) . decoupling crowdsourcing and crowdfunding , at least for some cohorts , may help ameliorate some biases in data . mismanagement of the participant base can be a major reason projects fail ( 7 ) . the help burden stems not just from the number of questions coming in , but the number of personnel hours necessary to answer these questions . given the nature of crowdfunding , the rate at which a project will grow is not known in advance , which makes scoping personnel effort difficult and risky ( e.g. , if the project fails ) . in microbiome research , participants and backers may choose to engage in a project in which the research personally benefits them . for the american gut project , despite all our efforts at dispelling the notion that the data generated have current medical value , we still frequently receive questions along the lines of i have condition x. given my microbiome , what do you recommend i do ? once participants are recruited , the next major hurdle is collecting their data . in microbiome studies , this typically involves a physical sample , or set of physical samples , and information about the participant and sample . the unfortunate reality is that people are bad at following instructions ( for example , we anticipate that few of the readers of this article read their cell phone manual cover to cover ) . explicit , succinct , and engaging instructions are vital to minimize variability in how instructions are followed . to this end , the american gut project took two approaches . the first is an eye - catching quick instructions sheet that gives a rundown of the necessary steps . in addition , detailed instructions are provided , including video examples on the website . during the course of the project so far , it has been necessary to revise the instructions , based on feedback from participants , and address obvious issues with sample collection . notably , we discovered that the amount of fecal matter to send in was ambiguous , leading us to provide graphic examples of good and bad samples . as we refined the instructions , we encountered fewer questions , and higher quality samples were returned . the human microbiome is contextually dependent , making it impossible to understand a microbiome community without information about its host ( 12 , 18 ) . therefore , participant and sample metadata ( i.e. , contextual information ) are also an important consideration in participatory microbiome research . the goal of metadata collection is to maximize the amount of accurate , usable data that can be collected for every sample . although it is possible to analyze a few dozen free response fields for a small number of samples , it is prohibitive to analyze large numbers of free - response fields for large numbers of samples . free response fields are also more likely to contain human error : in the american gut dataset , individuals have reported chicken as their most common carbohydrate , which would be surprising if true ( standard nutritional data for chicken breast report zero carbohydrates ) . questions with controlled vocabulary , such as multiple - choice questions or fields limited to accept bounded numeric responses , can help improve accuracy . it may also be important to consider the level of detail that is possible to record in a survey . another is the decision of whether or not to pursue information about a specific medical condition . the american gut has addressed these issues with triggered response questions , condition - specific surveys , and the option to follow up with participants . metadata errors are inevitable whether in self - reported data or well - funded clinical studies ( 2 ) . there are two major considerations with error reporting : how the errors are identified and the way the errors are corrected or removed . participants who reported birth dates prior to the start of the twentieth century were identified as obvious errors . there are also profound differences between adult microbial communities based on body site , which can help when participants forget which sample was collected on which swab ( 11 ) . however , other errors can be more difficult to identify . in certain american gut analyses , we noticed that alcohol had a larger effect than antibiotic use , and that infants ( birth to three years of age ) had microbiomes that were more diverse than older children ; a contrast with previous publications ( 20 ) . when we examined the infant data further , we identified several individuals with age listed as less than three years of age but self - reported height over four feet and reported drinking more than once a week , leading us to question the age data . in a large dataset , it can be useful to remove clearly erroneous information , especially if the correct answer is difficult to determine . age values that are likely incorrect , given the rest of the contextual information , are therefore removed from analysis within the american gut data . mislabeled body sites can be corrected , even against a high background mislabeling rate , using a supervised learning technique , due to the strength of the association between body site and community structure ( 13 ) . the same associations may be true for other parameters as we continue to collect data . data dissemination and communication is a final step in the scientific process . in a traditional scientific model , this has taken the form of publication in grant reports , scientific journals , and the deposition of data to repositories . participatory science opens questions about data ownership , dissemination , and communication . rather than delivering results to a grant committee of peers , scientists instead must communicate results to a wider community . when the project focuses on characterizing human biology , it may be challenging to balance providing novel results with avoiding presenting information that could be interpreted as a medical diagnosis . in crowdfunded projects , regular updates showing progress are important to continued investment and re - investment ( 7 ) ; for a scientific project , this can mean everything from a blog with regular updates to a public release of data and analyses techniques . large datasets present opportunities for exploration , new technique development , and technique refinement . providing the dataset to a collaborator network collaborations that play on the strengths and expertise of each group can accelerate the rate of discovery . making the full dataset available through open access mechanisms early in the analysis process is one of the simplest ways to disseminate data to multiple collaborators at a variety of institutions . institutional review board ( irb ) protocols must make it clear how participants de - identified data can and will be used . participants de - identified microbial dna sequence data and per - sample and per - individual metadata will be made publicly available if that is a goal of the project . releasing data into repositories without monitoring may make dissemination easier , but it can also mean that after participants withdraw , their data can not be retracted . additionally , extensive care has to be taken to avoid compromising the anonymity of the participants . such steps include separating clearly identifying participant data from survey information ; limiting access to raw survey answers ; and removing identifying information from publicly available survey results , even inadvertently identifying information . to this end , the surveyed data must be validated against possible identification threats ; for example , a combination of date of birth and zip code could provide an attacker with the identified personal information of a participant . the first area , recruitment and retention , is a crowdsourced project s initial and primary interaction . at the outset , members of the public are unlikely to be interested in your project if they are unable to understand why you are doing the project in the first place . they also want to know how they benefit by participating . in the case of the american gut project , one of our goals was to provide an avenue through which members of the general public could engage in cutting - edge research and , in turn , learn about the organisms that inhabit their bodies . participatory science can be self - selecting , and this may create a biased cohort , rather than a true representation of the population . gut microbiome research , for example , may be more likely to attract individuals with diagnosed gastrointestinal conditions , such as inflammatory bowel disease ( ibd ) . in the american gut , we see a six - fold enrichment in participants with ibd compared with the us population as a whole ( debelius , mcdonald et al . sponsors have also contributed funds to provide kits for participants in other populations of interest , including children with autism spectrum disorder . these sub - studies may lead to an understanding of compositional patterns associated with these specific populations . the role of the internet in participatory science can not be discounted , meaning that participation is likely linked to internet access ( 6 ) . coupling crowdfunding to crowdsourcing may limit the participant population to those able afford the cost . the financial burden may also create self - selection , even for those with the available disposable income . many of the early american gut participants were individuals who emphasized the importance of diet in health , and therefore tended toward more extreme dietary choices . these implicit biases in the population may be hard to identify , and harder to correct ( although they are less important for the original goal of the project in terms of identifying the diversity of types of microbiome out there in the wild ) . decoupling crowdsourcing and crowdfunding , at least for some cohorts , may help ameliorate some biases in data . mismanagement of the participant base can be a major reason projects fail ( 7 ) . the help burden stems not just from the number of questions coming in , but the number of personnel hours necessary to answer these questions . given the nature of crowdfunding , the rate at which a project will grow is not known in advance , which makes scoping personnel effort difficult and risky ( e.g. , if the project fails ) . in microbiome research , participants and backers may choose to engage in a project in which the research personally benefits them . for the american gut project , despite all our efforts at dispelling the notion that the data generated have current medical value , we still frequently receive questions along the lines of i have condition x. given my microbiome , what do you recommend i do ? once participants are recruited , the next major hurdle is collecting their data . in microbiome studies , this typically involves a physical sample , or set of physical samples , and information about the participant and sample . the unfortunate reality is that people are bad at following instructions ( for example , we anticipate that few of the readers of this article read their cell phone manual cover to cover ) . explicit , succinct , and engaging instructions are vital to minimize variability in how instructions are followed . to this end , the american gut project took two approaches . the first is an eye - catching quick instructions sheet that gives a rundown of the necessary steps . in addition , detailed instructions are provided , including video examples on the website . during the course of the project so far , it has been necessary to revise the instructions , based on feedback from participants , and address obvious issues with sample collection . notably , we discovered that the amount of fecal matter to send in was ambiguous , leading us to provide graphic examples of good and bad samples . as we refined the instructions , we encountered fewer questions , and higher quality samples were returned . the human microbiome is contextually dependent , making it impossible to understand a microbiome community without information about its host ( 12 , 18 ) . therefore , participant and sample metadata ( i.e. , contextual information ) are also an important consideration in participatory microbiome research . the goal of metadata collection is to maximize the amount of accurate , usable data that can be collected for every sample . although it is possible to analyze a few dozen free response fields for a small number of samples , it is prohibitive to analyze large numbers of free - response fields for large numbers of samples . free response fields are also more likely to contain human error : in the american gut dataset , individuals have reported chicken as their most common carbohydrate , which would be surprising if true ( standard nutritional data for chicken breast report zero carbohydrates ) . questions with controlled vocabulary , such as multiple - choice questions or fields limited to accept bounded numeric responses , can help improve accuracy . it may also be important to consider the level of detail that is possible to record in a survey . another is the decision of whether or not to pursue information about a specific medical condition . the american gut has addressed these issues with triggered response questions , condition - specific surveys , and the option to follow up with participants . metadata errors are inevitable whether in self - reported data or well - funded clinical studies ( 2 ) . there are two major considerations with error reporting : how the errors are identified and the way the errors are corrected or removed . participants who reported birth dates prior to the start of the twentieth century were identified as obvious errors . there are also profound differences between adult microbial communities based on body site , which can help when participants forget which sample was collected on which swab ( 11 ) . however , other errors can be more difficult to identify . in certain american gut analyses , we noticed that alcohol had a larger effect than antibiotic use , and that infants ( birth to three years of age ) had microbiomes that were more diverse than older children ; a contrast with previous publications ( 20 ) . when we examined the infant data further , we identified several individuals with age listed as less than three years of age but self - reported height over four feet and reported drinking more than once a week , leading us to question the age data . in a large dataset , it can be useful to remove clearly erroneous information , especially if the correct answer is difficult to determine . age values that are likely incorrect , given the rest of the contextual information , are therefore removed from analysis within the american gut data . mislabeled body sites can be corrected , even against a high background mislabeling rate , using a supervised learning technique , due to the strength of the association between body site and community structure ( 13 ) . the same associations may be true for other parameters as we continue to collect data . data dissemination and communication is a final step in the scientific process . in a traditional scientific model , this has taken the form of publication in grant reports , scientific journals , and the deposition of data to repositories . participatory science opens questions about data ownership , dissemination , and communication . rather than delivering results to a grant committee of peers , scientists instead must communicate results to a wider community . when the project focuses on characterizing human biology , it may be challenging to balance providing novel results with avoiding presenting information that could be interpreted as a medical diagnosis . in crowdfunded projects , regular updates showing progress are important to continued investment and re - investment ( 7 ) ; for a scientific project , this can mean everything from a blog with regular updates to a public release of data and analyses techniques . large datasets present opportunities for exploration , new technique development , and technique refinement . providing the dataset to a collaborator network early on fosters opportunities for new analyses and directions . collaborations that play on the strengths and expertise of each group can accelerate the rate of discovery . making the full dataset available through open access mechanisms early in the analysis process is one of the simplest ways to disseminate data to multiple collaborators at a variety of institutions . institutional review board ( irb ) protocols must make it clear how participants de - identified data can and will be used . participants de - identified microbial dna sequence data and per - sample and per - individual metadata will be made publicly available if that is a goal of the project . releasing data into repositories without monitoring may make dissemination easier , but it can also mean that after participants withdraw , their data can not be retracted . additionally , extensive care has to be taken to avoid compromising the anonymity of the participants . such steps include separating clearly identifying participant data from survey information ; limiting access to raw survey answers ; and removing identifying information from publicly available survey results , even inadvertently identifying information . to this end , the surveyed data must be validated against possible identification threats ; for example , a combination of date of birth and zip code could provide an attacker with the identified personal information of a participant . crowdfunding and crowdsourcing , while powerful ways to fund projects , recruit participants , and raise public awareness and interest , are novel approaches and have their own pitfalls . the nature of a crowdfunded project requires different approaches from traditional study designs and considerations , especially with respect to public relations and communication . defining the intention and standing of communication of the project expectations , what participants can expect to receive , and progress of the project and of the participants specific samples , especially if there is a waiting period between financial contribution and tangible results , can not be overlooked . the topic of the crowdfunded research project is almost certainly expected to draw in a specific subset of the population , leading to potentially biased sampling . the financial aspect of participation may exclude an additional subset due to inability to afford participation ( although this can be ameliorated by supplementing crowdfunding by philanthropic contributions and/or foundation support ) . additionally , considerations of how to reduce and respond to errors in the data must be considered . data dissemination , in the form of individualized results , and sharing analysis tasks can also benefit or hinder projects . in summary , while it is unlikely to replace grant funding from government and private agencies , it may act as an additional mechanism for answering questions that are difficult to explore through traditional means .

without effective tobacco control measures , it is estimated that by the year 2030 , the annual global death toll will reach 8 million . with current smoking patterns , approximately 500 million people alive today will eventually be killed by tobacco use . currently , there are an estimated 1.3 billion smokers in the world . most smokers indicate interest in quitting , three out of four smokers say they want to quit . one of the core responsibilities of the health system should be to treat tobacco dependence . this treatment includes different methods such as simple medical consultation , medication , and telephone counseling . the cost of these methods differs and would not have the same effect on different smokers . it should be noted that treatments need to be tailored and delivered appropriately for individuals according to their age , gender , interest , needs and also cultural and local conditions . this intervention is relatively cost - effective because it is a part of available services , which people rarely use . such interventions are very effective because they are provided by health care providers who are respected by most people and with whom smokers tend to have good interactions . in addition to medical advice and telephone consultation for quitting , an effective method can also include medication . medication includes various forms of nicotine replacement therapy ( nrt ) such as patches , gum , lozenges , and nasal spray and also prescription drugs such as bupropion and varenicline . after 10 years of the first educational intervention for quitting smoking and one or two complementary programs in the iran health system network , and in some attached centers ( including group therapy and free 15 mg nicotine patch ) the same interventions are still being implemented with little documentation of effectiveness . therefore , different treatments including more recent treatments need to be studied and assessed and the most appropriate ones selected and developed at the country health system level . this should include among other factors demands on human resources and availability and cost of medication services . it is important for us to know how these treatments were viewed by patients . in undertaking this assessment , it is important to include patient selection on the methods they have experienced . the aim was to study and assess patients selection of different quit smoking methods provided in tobacco cessation services centers in iran in order to identify those that could be as one of the most appropriate for the country health system . this cross - sectional and descriptive study was conducted in smoking cessation services centers in iran in 20122013 . in each iran 's province , there is a university under the supervision of ministry of health and medical education . therefore , primary health care services are provided by universities of medical sciences and national tobacco control programs provided by these universities , and there is a person to coordinate these activities in the affiliated centers all across the provinces . there were approximately 5060 smoking quit centers , which are working under the supervision of health centers in primary health care system , but many of these were not active in presenting tobacco cessation services . 13 active centers in 7 cities were selected ( whether public or private ) with the goal of obtaining a representative sample size of 1066 subjects by using the following formula : in a randomly selected day based on first - come , first - serve basis and agreement to join the study , smokers at all active quit centers throughout the country completed the questionnaire . the researchers visited the centers during june 2012 and asked a randomly selected sample of smokers ( minimum 10 from each center ) to complete an anonymous , self - administered questionnaire during their visit to the center . the contents of the primarily structured questionnaire were designed by the first author based on review of the relevant literature and the authors preliminary research . its psychometric properties were evaluated in terms of face and content validity through a panel discussion with seven tobacco control experts in iran who had experience in tobacco cessation programs . the reliability coefficient ( cronbach alpha ) for the questionnaire was assessed through test - retest on a sample of 15 patients ( = 0.88 ) . the questionnaire contained 10 questions ( 3 scores each ) regarding the quality , cost , effect , side - effects and the results of quitting methods using a 5-point liker - type scale from 1 to 3 to have maximum 30 for each . for maximum coverage the centers of seven cities in different geographic regions such as tehran , isfahan , shiraz , mashhad , tabriz , hamedan and sari were selected ( these centers were identified through necessary coordination with the deputy for health and curative affairs in each province ) . prior to distribution of the questionnaire , the purpose and nature of the study were explained to the relevant authorities in each center and also to the randomly selected participants and informed consent was obtained in order to inform the participants regarding the aim of study , feel free to join the study , and other ethical and confidential issues . all survey responses were entered into a data set and double keyed to ensure accurate data entry . percentages , frequencies , mean , t - test and variance analysis were computed for all study variables . analyses were conducted using spss 16.00 statistical software ( spss inc . , chicago , il , usa ) . in this study , a total of 1063 out of 1384 smokers returned completed the survey questionnaire ( response rate was 77% ) . most respondents were from tehran with 473 cases , using all methods , while in other cities some methods were not accessible or the patients did not use them . the most frequently used methods were nrt and combination methods ( nrt and counseling ) with 228 and 163 cases , respectively . the least used methods were hypnotism ( n = 8) and the quit and win method ( n = 17 ) [ table 1 ] . frequency distribution of study sample by methods and cities in iran in 2012 - 2013 the mean score of all used methods in our study was 16.8 4.6 ( minimum 10maximum 26 ) . the methods which received the maximum scores were combined methods , willpower and champix with means of 21.4 , 20.4 and 18.4 , respectively . the minimum scores were assigned to e - cigarettes , hypnotism and education with means of 12.8 , 11 and 10.8 , respectively [ table 2 ] . prevalence and score obtained for each quit smoking method based on patients ' opinion and according to their priority there were significant differences in mean scores based on different cities and in the mean scores of different methods [ table 3 ] . the cities of hamadan and sari gained the maximum scores ( p < 0.000 ) and combined methods , personal , champix and quitlines gained the maximum scores ( p < 0.000 ) . invariance analysis on mean scores of different methods , there were significant differences among methods , and combined treatment , personal , champix and telephone consultation gained the maximum scores ( p < 0.000 ) [ table 4 ] . analysis of variance of mean scores for patients opinions on quit smoking methods in different cities of iran , 2012 analysis of variance of mean score provided through patients opinion towards different methods of quit smoking in iran , 2012 there were no significant differences in patients mean scores of according to their gender ( p = 0.19 ) [ tables 5 and 6 ] . patients mean scores according to their gender in iran , 2012 t - test for equality of means score obtained from patients opinion regarding different quit methods according to their gender in iran , 2012 in this study , the selection and opinions of the smokers toward different quitting methods revealed that the combination therapy , personal , champix and telephone consultation were viewed as the most effective methods in the country . it is important to know the patients opinions in order to up to date our services at the country level for enhanced success . among these four preferred methods , the combination therapy treatment was the first priority , and we assume that this could be due to its availability free of charge and also its group therapy approach . this method also has been recommended in prior studies . for personal methods that were rated as a second priority , we considered that this may be due to the fact that the use of personal methods demonstrates the high motivation of smokers to quit smoking . other studies have not confirmed this idea , however , and it may be considered as a starting point for further complementary studies . use of champix has been implemented once ( free of charge ) and revealed a good result . telephone consultation was identified as a fourth priority , and this could also be due to its accessibility at the country level . these seventeen treatment methods for quit smoking can be divided into three groups as follows : group with high priority : combination therapy , willpower , champix , telephone consultation , nrt , nonnicotine medication.group with medium priority : acupuncture , zyban , some medications ( such as anti - depression drugs ) , some methods without medication ( for example counseling and watching movies ) , quit and win , behavioral treatment.group with low priority : learning material , interactive voice response , e - cigarettes , hypnotism , and education . group with high priority : combination therapy , willpower , champix , telephone consultation , nrt , nonnicotine medication . group with medium priority : acupuncture , zyban , some medications ( such as anti - depression drugs ) , some methods without medication ( for example counseling and watching movies ) , quit and win , behavioral treatment . group with low priority : learning material , interactive voice response , e - cigarettes , hypnotism , and education . it was observed that there are significant differences in mean scores for quitting methods among the seven cities [ table 3 ] . we had assumed that these methods would receive higher scores in tehran compared to other cities ( due to long - term experience and the availability of the centers ) . however , contrary to our expectations , the highest scores were reported in sari and hamadan city . further research should be done to investigate this result . according to the variance analysis conducted to compare methods ( and despite the fact that there were significant differences between the methods ) ; four quit methods , including combination therapy , willpower , and champix were identified as best . there were no significant differences among the remaining six quit methods [ table 4 ] . this table indicates that one appropriate method may be selected from among the methods in each group based on present conditions , including patients and physicians preference and satisfaction . there also was no significant difference between women and men in this study , in contrast to gilpin and pierce 's findings . this study demonstrated that patients prefer to use combination therapy individually ( not group therapy ) and this issue should be considered for the supplementary further study . the results of this study are important because few studies have assessed real world responses of patients who used different smoking treatment methods . thus , one potential follow - up from this study could be a training program for health care providers on effective methods to treat smokers . for example , acupuncture has not been proven effective as a tobacco treatment method , yet it was reported as a medium priority treatment by the participants . an important limitation of this study is the cross - sectional nature of the data . another important limitation was inability of health policy makers to make necessary final decision for tobacco control program based of the result of this study and future studies should focus on the quality , such as cost - effectiveness , time , and side effects of each cessation method . this study also reflects the international discussion that has occurred regarding the role of formal treatment relative to self - quitting since participants reported that both willpower and medications like varenicline were most effective for helping them quit smoking . willpower can be considered an indicator of motivation , and our experience is that those who are most motivated to quit might be the most successful ones . and when that motivation is coupled with an effective medication , the chances of being successful increase even more . thus , the results of this study reflect the wisdom our patients because they recognize that smoking treatment requires more than just taking a medication , but it also reflects the need to train more healthcare workers to assure they help their patients with the most effective methods . patients opinions revealed that combination therapy , willpower , champix and telephone consultation are the most effective quit methods in the country and that quit centers will have more patients successfully quit smoking using these methods .

atra receptors ( rars ) , and and 9-cis retinoic acid receptors , and ( rxrs ) are encoded by three different genes and are members of the nuclear receptor superfamily . they function as ligand - inducible transcription factors in the form of rar / rxr heterodimers . rar is activated by atra and binding of this ligand induces receptor conformational changes that switch on transcription of genes containing ra response elements ( rares ) by favoring coactivator tethering to regulated promoters . this protein complex assembly at regulated promoters induces chromatin remodeling and increased binding of rna polymerase ii to these promoters , thereby inducing a variety of biological effects ( reviewed in ) . while a detailed understanding of the ligand - dependent activation of rars has been achieved by structural and functional studies , little is known about factors regulating the activity of the unliganded receptor . we therefore undertook a 2-hybrid screen in yeast using an af2-inactivated hrar as a bait , thus unable to respond transcriptionally to ligand , to identify proteins potentially able to regulate rar functions in a ligand - independent manner . among the identified proteins , the human promyelocytic leukemia zinc finger ( plzf ) protein is a 673 amino acid ( aa ) transcriptional repressor belonging to a large protein family characterized by a 120 aa n - terminal bric - - brac , tramtrack , brad complex ( btb)/poxvirus zinc finger ( poz ) domain . proteins containing this btb / poz domain are associated to multiple functions such as development , embryogenesis and chromatin remodeling . the btb / poz domain allows protein homodimerization and is involved in the recruitment of transcriptional corepressor complexes ( ncor ) harboring histone deacetylases ( hdac ) activity . in addition , this multimeric ncor complex has been shown to provide a docking site for eight - twenty one ( eto ) , a non - dna binding transcriptional repressor fused to the transcriptional activator aml1 in acute myelogenous leukemia . another structural feature of plzf is its c - terminal dna binding domain made of nine c2h2 kruppel - like zinc fingers that binds the consensus sequence gtacagttscau . the first two zinc fingers are dispensable for dna binding , although other domains of the protein seem to contribute to the dna binding specificity by restricting the dna binding repertoire of plzf . finally , a proline - rich and an acidic domains are found in the central part of the molecule ( see also figure 1 for more details ) . structure and properties of the bait rar mutant and of one of the identified preys , plzf . a ) schematic representation of the nuclear receptor rar and structural localization of the two mutations k262a and k244a . these mutations weaken the interaction with the corepressor smrt and abolish the interaction with the coactivator src-1 , as visualized by gst pull - down assays ( insert ) . b ) structure of the transcription factor plzf identified by the two - hybrid screening of an ovary cdna library with plex12-rar k244a - k262a used as a bait . however , its localization to nuclear bodies , which are nuclear structures associated to a central , transcriptional regulatory role , as well as its down regulation upon myeloid cell differentiation hint at a crucial role in cell growth control . indeed , genetic ablation of the plzf gene in mice led to aberrant limb modeling resulting from deregulated cell proliferation and apoptosis , and also suggested that plzf is , like all trans retinoic acid ( atra ) , a critical regulator of the linear expression of the hox gene cluster . another strong argument for the biological importance of plzf is the association of the chromosomal translocation t(11;17 ) to a rare variant of acute promyelocytic leukemia ( apl ) , which fuses the plzf protein to retinoic acid receptor " ( rar , [ 15 - 17 ] ) . the plzf - rar fusion protein maintains most of the dna and dimerization properties of both moieties , and plzf - rar binds to retinoic acid response elements ( rares ) as a heterodimeric partner of rxr , interfering with rar functions by exerting a dominant negative effect . the resistance of t(11;17 ) apl to pharmacological doses of atra contrasts with the sensitivity of the more common t(15;17 ) apl , which is characterized by a fusion between the promyelocytic leukemia transcription factor pml and the rar proteins . thus the highly stable , targeted recruitment of ncors and hdacs to plzf - rar , mostly through the btb / poz domain , is likely to underlie the pathogenesis of the t(11;17 ) apl and renders it refractory to atra chemotherapy , although additional factors are involved in the t(11;17)-induced leukemogenesis . interestingly , the pml protein acts either as a corepressor or a coactivator in a dna - binding independent manner . pml gene inactivation leads to a strongly decreased transcriptional activation of the p21 gene and to impaired myeloid differentiation in response to retinoid stimulation . consistent with its role of coactivator , it has been shown to be integrated in the drip complex and to interact with cbp . thus , quite intriguingly , pml and rar have a functional relationship during transcriptional regulatory processes , and are chromosomal translocation partners . in this paper , we describe the physical interaction of plzf with rar and explore the functional consequences of this interaction on retinoid - regulated transcription . in a search for proteins that could interact with the unliganded , transcriptionally inactive rar , we set up a yeast two hybrid screen using a mutated receptor ( figure 1a ) . mutations were designed on the basis of the three - dimensional structure of the rar ligand binding domain ( lbd ) . it defines k262 as establishing salt bridges with e412 and e415 of the rar activating function 2 ( af2 ) activating domain ( ad ) upon agonist binding . mutation of k262 and of the neighboring k244 into alanine residues ( rar 2 k ) prevents the ligand - induced folding of rar af2 , impedes coactivator recruitment , weakens corepressor interaction ( figure 1a ) and inactivates the transcriptional activity of rar . a human ovary cdna library was screened for interaction with rar 2 k and twelve positive clones were isolated and further characterized by dna sequencing . a blast search indicated that we isolated , among these clones , a cdna encoding amino acids 389 to 658 of human promyelocytic leukemia zinc finger protein ( plzf , figure 1b ) , thus encompassing the first three n - terminal zinc fingers ( zf ) of the plzf dna - binding domain . although plzf has been reported to interact specifically with lexa consensus binding sequences , the two n - terminal zf are dispensable for this activity . we therefore carried out in - vitro protein interaction assays ( figure 2 ) using the three plzf nt - zf fused to glutathione - s - transferase ( gst - plzf 3zf ) to determine its ability to bind to full length rar , rar 2 k , or various deletion mutants of this receptor [ af1 : rar af1 ( aas 188 ) ; lbd : rar lbd ( aas 152462 ) ; rar)403 ( aas 1 to 403 ) ] . as a control for specificity , we used rxr , a nuclear receptor displaying strong sequence homologies with rar in the dna binding domain , but harboring significant sequence divergence in both the af1 and af2 regions . as expected , plzf 3zf interacted with rar in a ligand - independent manner , as well as with the af2-inactivated rar 2 k mutant . thus ligand - induced structural transitions do not affect plzf / rar interactions and are not conditioned by af2-ad positioning , as confirmed by the interaction of rar)403 with plzf ( figure 2 ) . the isolated rar af1 domain did not retain a strong affinity for plzf 3zf , however , a weak but reproducible interaction was detected with the lbd moiety of the receptor . rxr did not bind to plzf 3zf , suggesting that some degree of specificity may be achieved in the plzf / nuclear receptors interaction . reciprocal protein interaction assays were then carried out using wild type rar or rar 2 k , and functional domains of human plzf ( figure 3 ) . full length plzf interacted with wild type rar and rar 2 k in a ligand - independent manner , suggesting that intra molecular interactions do not affect plzf affinity for rar. the dna binding domain of plzf , comprising 9 c2h2 zinc fingers , interacted significantly with wild type rar and rar 2 k , demonstrating that this domain is necessary and sufficient to promote the physical association of rar with plzf . none of the other isolated structural domains ( btb / poz , acidic or proline - rich ) demonstrated detectable binding to rar or to rar 2 k. interaction of rar with the first three n - terminal zinc fingers of the dna - binding domain of plzf . a ) bacterially expressed gst - plzf 3zf fusion protein was used to generate an affinity matrix with which ( panel b ) s - labeled full length rar , rar 2 k , isolated functional domains ( rar af1 , rar af2 ) or rar deleted of its af2-ad and the domain f ( rar 403 ) were incubated in the absence or presence of 1 m atra . receptors bound to plzf 3zf resin were then resolved by sds - polyacrylamide gel electrophoresis and quantified by autoradiography using the imagequant software ( molecular dynamics , inc . ) . full length plzf and isolated domains of plzf ( btb / poz , acidic , intermediary , proline - rich , zn fingers ) were synthesized and labeled by in - vitro coupled transcription / translation and then incubated either with a gst - rar or with rar k244a - k262a - sepharose matrix in the absence or presence of 1 m atra . we further assayed the ability of plzf and plzf 3zf to interfere with the transcriptional activity of rar ( figure 4a ) . hela cells were transfected with a chimeric retinoid - responsive reporter gene insensitive to endogenous receptors , a derivative of rxr able to bind to glucocorticoid response elements ( gre ) and rar . adding increasing amounts of plzf 3zf efficiently repressed the retinoid - induced activity of rar , and full length plzf exhibited a similar property , albeit to a lesser extent ( figure 4a ) . overexpression of -galactosidase did not alter the responsiveness of the system , suggesting that the observed effect is specific for plzf and its derivatives . a likely explanation for this functional interference would be that plzf interaction prevents rar-lignad interaction . we excluded this possibility by carrying out ligand binding experiments which showed no interference of plzf with the ligand binding activity of rar ( figure 7 , see additional file 1 ) . plzf interferes with the transcriptional activity of rar and of er , gr and vdr . a ) transcriptional activation of rar is decreased upon overexpression of plzf 3zf or of full length plzf . hela cells were transiently transfected with the p(grare)tkluc reporter gene , the psg5-rar and the psg5-rxgr expression vectors together with increasing amounts of pcmv - plzf 3zf or psg5-plzf expression vectors as indicated . cells were treated with 1 m atra and luciferase activity was assayed 16 h later as described under " experimental procedures " . . of at least three individual experiments , with the basal level of luciferase activity arbitrarily set to 1 . hela cells were transiently transfected with the luciferase reporter genes p(ere)3tkluc , pvdretkluc or pcf3tkluc and the psg5-er , psg5-vdr and psg5-rxr or prsv - gr expression vectors respectively . cells were treated with 1 m estradiol ( e2 ) , 0.1 m dexamethasone ( dex ) , or 1 m vitamin d3 ( vit d3 ) respectively . the transcriptional activity of er , gr and vdr was thus evaluated in conditions analogous to those described above . as for rar , increasing amounts of plzf 3zf repressed the ligand induced activity of er , gr and to a lesser extent that of vdr ( figure 4b ) . this ligand activity was similarly decreased when full length plzf is added for vdr and gr . er turned out to be less sensitive to full length - plzf mediated inhibition , which was only detectable at high doses of transfected expression vector ( figure 4b ) . as a control , overexpression of -galactosidase did not alter the responsiveness of the system ( figure 4a ) , suggesting that the observed effect is specific for plzf and its derivatives . we then wanted to establish whether this transcriptional inhibition was correlated or not to a physical interaction between these proteins . in vitro gst pull - down assays using gst - plzf 3zf and s radiolabelled gr or er were performed . as shown in figure 5 , plzf 3zf interacted significantly with er and gr in a ligand independent manner . as previously reported , we observed that vdr interacted with plzf ( data not shown ) . these results thus demonstrate that plzf interacts physically with others nuclear receptors and can interfere with their transcriptional activity , although there is not a strict relationship between dimerization in - vitro and transcriptional inhibition . rar , er and gr were synthesized and labeled by in - vitro coupled transcription / translation and then incubated with a gst - plzf 3zf - sepharose matrix in the absence or presence of ligand , which were 1 m atra , 1 m e2 and 0.1 m dex as indicated . plzf interference with the rxr:rar heterodimer transcriptional activity suggested that one plausible mechanism for the observed inhibition is a plzf - triggered decrease of rar dimerization with rxr. to test this hypothesis , we first used a mammalian two - hybrid assay ( figure 6a ) which reflects the ability of rars to interact with rxrs . hela cells were transfected with a gal4 responsive gene , the rar gene fused to the vp16 activation domain gene and the rxr gene fused to the gal4 dna binding domain gene as described before . in the presence of am580 , a selective agonist of rar , we observed a stronger luciferase activity in our system , reflecting a more stable interaction between rar and rxr. adding increasing amounts of plzf 3zf , as well as full length plzf reduced the luciferase activity ( figure 6a ) , suggesting that plzf interferes with the dimerization of rar with rxr. overexpression of the lacz gene did not alter the responsiveness of the system , suggesting that the observed effect is specific for plzf . we then tested the ability of plzf to prevent rxr : rar dimer formation by in vitro protein interaction assays by using a gst - rar fusion protein and radiolabeled rxr. as shown in figure 6b , rar and rxr interacted constitutively , however , this interaction was potentiated in the presence of 1 m atra . adding increasing amounts of in vitro translated plzf protein inhibited both the ligand - independent and the ligand - dependent dimerization between rar and rxr , whereas similar amounts of control protein ( luciferase ) did not alter the interaction between rar and rxr. thus the dimerization of rar with rxr is specifically inhibited by plzf in a dose - dependent manner , and the inhibition occurs irrespective of the presence of the ligand . in this respect , we also observed that the ligand - dependent dimerization occured in the presence of ttnpb and am580 , two synthetic retinoids . moreover , the complexation of rar to ro41 - 5253 , a synthetic antagonist , did not modify the plzf - mediated inhibition of rxr - rar dimerization , strongly suggesting that plzf binding to rar is not affected by ligand - induced structural transitions ( figure 7 , see additional file 1 ) . plzf decreases the dimerization of rar with rxr. a ) plzf decreases the interaction of rar with rxr in intact cells . hela cells were transiently transfected with the uas - tkluc reporter gene , the pcmv - gal4-rxr and the pcmv - vp16-rar expression vectors and the psg5-plzf or the pcmv - plzf 3zf as indicated . cells were treated with 0.1 m of the rar-selective ligand am580 , and luciferase activity was assayed 16 h later as described in figure 4 . rxr was synthesized in vitro as a s - labeled protein , by coupled transcription / translation , in rabbit reticulocyte lysate and was incubated with increasing amounts of plzf or of control protein ( luciferase ) as non - labeled proteins . protein mixes were then incubated with a gst - rar-sepharose affinity matrix with 1 m atra or not . in a search for proteins that could interact with the unliganded , transcriptionally inactive rar , we set up a yeast two hybrid screen using a mutated receptor ( figure 1a ) . mutations were designed on the basis of the three - dimensional structure of the rar ligand binding domain ( lbd ) . it defines k262 as establishing salt bridges with e412 and e415 of the rar activating function 2 ( af2 ) activating domain ( ad ) upon agonist binding . mutation of k262 and of the neighboring k244 into alanine residues ( rar 2 k ) prevents the ligand - induced folding of rar af2 , impedes coactivator recruitment , weakens corepressor interaction ( figure 1a ) and inactivates the transcriptional activity of rar . a human ovary cdna library was screened for interaction with rar 2 k and twelve positive clones were isolated and further characterized by dna sequencing . a blast search indicated that we isolated , among these clones , a cdna encoding amino acids 389 to 658 of human promyelocytic leukemia zinc finger protein ( plzf , figure 1b ) , thus encompassing the first three n - terminal zinc fingers ( zf ) of the plzf dna - binding domain . although plzf has been reported to interact specifically with lexa consensus binding sequences , the two n - terminal zf are dispensable for this activity . we therefore carried out in - vitro protein interaction assays ( figure 2 ) using the three plzf nt - zf fused to glutathione - s - transferase ( gst - plzf 3zf ) to determine its ability to bind to full length rar , rar 2 k , or various deletion mutants of this receptor [ af1 : rar af1 ( aas 188 ) ; lbd : rar lbd ( aas 152462 ) ; rar)403 ( aas 1 to 403 ) ] . as a control for specificity , we used rxr , a nuclear receptor displaying strong sequence homologies with rar in the dna binding domain , but harboring significant sequence divergence in both the af1 and af2 regions . as expected , plzf 3zf interacted with rar in a ligand - independent manner , as well as with the af2-inactivated rar 2 k mutant . thus ligand - induced structural transitions do not affect plzf / rar interactions and are not conditioned by af2-ad positioning , as confirmed by the interaction of rar)403 with plzf ( figure 2 ) . the isolated rar af1 domain did not retain a strong affinity for plzf 3zf , however , a weak but reproducible interaction was detected with the lbd moiety of the receptor . rxr did not bind to plzf 3zf , suggesting that some degree of specificity may be achieved in the plzf / nuclear receptors interaction . reciprocal protein interaction assays were then carried out using wild type rar or rar 2 k , and functional domains of human plzf ( figure 3 ) . full length plzf interacted with wild type rar and rar 2 k in a ligand - independent manner , suggesting that intra molecular interactions do not affect plzf affinity for rar. the dna binding domain of plzf , comprising 9 c2h2 zinc fingers , interacted significantly with wild type rar and rar 2 k , demonstrating that this domain is necessary and sufficient to promote the physical association of rar with plzf . none of the other isolated structural domains ( btb / poz , acidic or proline - rich ) demonstrated detectable binding to rar or to rar 2 k. interaction of rar with the first three n - terminal zinc fingers of the dna - binding domain of plzf . a ) bacterially expressed gst - plzf 3zf fusion protein was used to generate an affinity matrix with which ( panel b ) s - labeled full length rar , rar 2 k , isolated functional domains ( rar af1 , rar af2 ) or rar deleted of its af2-ad and the domain f ( rar 403 ) were incubated in the absence or presence of 1 m atra . receptors bound to plzf 3zf resin were then resolved by sds - polyacrylamide gel electrophoresis and quantified by autoradiography using the imagequant software ( molecular dynamics , inc . ) . full length plzf and isolated domains of plzf ( btb / poz , acidic , intermediary , proline - rich , zn fingers ) were synthesized and labeled by in - vitro coupled transcription / translation and then incubated either with a gst - rar or with rar k244a - k262a - sepharose matrix in the absence or presence of 1 m atra . we further assayed the ability of plzf and plzf 3zf to interfere with the transcriptional activity of rar ( figure 4a ) . hela cells were transfected with a chimeric retinoid - responsive reporter gene insensitive to endogenous receptors , a derivative of rxr able to bind to glucocorticoid response elements ( gre ) and rar . adding increasing amounts of plzf 3zf efficiently repressed the retinoid - induced activity of rar , and full length plzf exhibited a similar property , albeit to a lesser extent ( figure 4a ) . overexpression of -galactosidase did not alter the responsiveness of the system , suggesting that the observed effect is specific for plzf and its derivatives . a likely explanation for this functional interference would be that plzf interaction prevents rar-lignad interaction . we excluded this possibility by carrying out ligand binding experiments which showed no interference of plzf with the ligand binding activity of rar ( figure 7 , see additional file 1 ) . plzf interferes with the transcriptional activity of rar and of er , gr and vdr . a ) transcriptional activation of rar is decreased upon overexpression of plzf 3zf or of full length plzf . hela cells were transiently transfected with the p(grare)tkluc reporter gene , the psg5-rar and the psg5-rxgr expression vectors together with increasing amounts of pcmv - plzf 3zf or psg5-plzf expression vectors as indicated . cells were treated with 1 m atra and luciferase activity was assayed 16 h later as described under " experimental procedures " . . of at least three individual experiments , with the basal level of luciferase activity arbitrarily set to 1 . hela cells were transiently transfected with the luciferase reporter genes p(ere)3tkluc , pvdretkluc or pcf3tkluc and the psg5-er , psg5-vdr and psg5-rxr or prsv - gr expression vectors respectively . cells were treated with 1 m estradiol ( e2 ) , 0.1 m dexamethasone ( dex ) , or 1 m vitamin d3 ( vit d3 ) respectively . the transcriptional activity of er , gr and vdr was thus evaluated in conditions analogous to those described above . as for rar , increasing amounts of plzf 3zf repressed the ligand induced activity of er , gr and to a lesser extent that of vdr ( figure 4b ) . this ligand activity was similarly decreased when full length plzf is added for vdr and gr . er turned out to be less sensitive to full length - plzf mediated inhibition , which was only detectable at high doses of transfected expression vector ( figure 4b ) . as a control , overexpression of -galactosidase did not alter the responsiveness of the system ( figure 4a ) , suggesting that the observed effect is specific for plzf and its derivatives . we then wanted to establish whether this transcriptional inhibition was correlated or not to a physical interaction between these proteins . in vitro gst pull - down assays using gst - plzf 3zf and s radiolabelled gr or er were performed . as shown in figure 5 , plzf 3zf interacted significantly with er and gr in a ligand independent manner . as previously reported , we observed that vdr interacted with plzf ( data not shown ) . these results thus demonstrate that plzf interacts physically with others nuclear receptors and can interfere with their transcriptional activity , although there is not a strict relationship between dimerization in - vitro and transcriptional inhibition . rar , er and gr were synthesized and labeled by in - vitro coupled transcription / translation and then incubated with a gst - plzf 3zf - sepharose matrix in the absence or presence of ligand , which were 1 m atra , 1 m e2 and 0.1 m dex as indicated . plzf interference with the rxr:rar heterodimer transcriptional activity suggested that one plausible mechanism for the observed inhibition is a plzf - triggered decrease of rar dimerization with rxr. to test this hypothesis , we first used a mammalian two - hybrid assay ( figure 6a ) which reflects the ability of rars to interact with rxrs . hela cells were transfected with a gal4 responsive gene , the rar gene fused to the vp16 activation domain gene and the rxr gene fused to the gal4 dna binding domain gene as described before . in the presence of am580 , a selective agonist of rar , we observed a stronger luciferase activity in our system , reflecting a more stable interaction between rar and rxr. adding increasing amounts of plzf 3zf , as well as full length plzf reduced the luciferase activity ( figure 6a ) , suggesting that plzf interferes with the dimerization of rar with rxr. overexpression of the lacz gene did not alter the responsiveness of the system , suggesting that the observed effect is specific for plzf . we then tested the ability of plzf to prevent rxr : rar dimer formation by in vitro protein interaction assays by using a gst - rar fusion protein and radiolabeled rxr. as shown in figure 6b , rar and rxr interacted constitutively , however , this interaction was potentiated in the presence of 1 m atra . adding increasing amounts of in vitro translated plzf protein inhibited both the ligand - independent and the ligand - dependent dimerization between rar and rxr , whereas similar amounts of control protein ( luciferase ) did not alter the interaction between rar and rxr. thus the dimerization of rar with rxr is specifically inhibited by plzf in a dose - dependent manner , and the inhibition occurs irrespective of the presence of the ligand . in this respect , we also observed that the ligand - dependent dimerization occured in the presence of ttnpb and am580 , two synthetic retinoids . moreover , the complexation of rar to ro41 - 5253 , a synthetic antagonist , did not modify the plzf - mediated inhibition of rxr - rar dimerization , strongly suggesting that plzf binding to rar is not affected by ligand - induced structural transitions ( figure 7 , see additional file 1 ) . plzf decreases the dimerization of rar with rxr. a ) plzf decreases the interaction of rar with rxr in intact cells . hela cells were transiently transfected with the uas - tkluc reporter gene , the pcmv - gal4-rxr and the pcmv - vp16-rar expression vectors and the psg5-plzf or the pcmv - plzf 3zf as indicated . cells were treated with 0.1 m of the rar-selective ligand am580 , and luciferase activity was assayed 16 h later as described in figure 4 . rxr was synthesized in vitro as a s - labeled protein , by coupled transcription / translation , in rabbit reticulocyte lysate and was incubated with increasing amounts of plzf or of control protein ( luciferase ) as non - labeled proteins . protein mixes were then incubated with a gst - rar-sepharose affinity matrix with 1 m atra or not . in this report we show that plzf engages functional interaction with several nuclear receptors , acting as a general repressor of their ligand - induced transcriptional activity as assayed by transient transfection experiments . a more detailed analysis of the plzf - rar interaction showed that this functional interaction stems from a direct , physical interaction of rar with plzf . we also noted that bcl6 , a transcriptional repressor sharing structural and functional similarities with plzf , also interacted with rar ( data not shown ) . alignment of plzf and bcl-6 sequences did not however reveal significant homologies that could represent a conserved motif of interaction . while the domain of plzf required for the interaction with rar maps , and is limited to , the 3 n - terminal zinc fingers , the structural integrity of rar seems to be required for a strong interaction , although the isolated ligand binding domain is able to interact significantly with plzf . the af2 activation domain ( helix h12 ) is not required for this interaction , as shown by the interaction observed with the hrar af2 and the hrar 2 k mutants . furthermore , plzf exerted a similar effect when a mutation preventing the association of corepressors to rar was introduced . thus , our data instead suggest that plzf interferes with the rxr - rar dimerization process , and not with the ligand binding activity of rar , based on experiments carried out in intact cells or in an acellular system . this is in contrast with a previous report showing that plzf inhibits the vdr transcriptional activity by forming a complex with the vdr - rxr dimer , the formation of which requiring the dna binding domain of vdr and the btb / poz domain of plzf . in this case , increased recruitment of corepressors to the vdr - rxr complex through the btb / poz domain is unlikely to be the mechanism of repression , since histone deacetylase inhibitors such as trichostatin a ( tsa ) did not perturb the observed inhibition . similarly , we observed that the addition of tsa or sodium butyrate did not alter the outcome of plzf overexpression on the rxr - rar dimer transcriptional activity , ruling out a possible inhibition through increased corepressor binding to the rxr - rar complex . recently , ward and collaborators reported that rar was unable to bind to plzf in gst pull down experiments and to interfere with rar - mediated transcriptional activation in the lymphoma cell line u937 . while the activity of plzf may be conditioned by cell - specific factors , it is not clear why in - vitro protein - protein interaction assays did not reveal such an interaction . we showed that domains involved in the plzf - rar interactions are clearly distinct from these involved in plzf - vdr interaction , and it is likely that subtle differences in the experimental procedures make a direct comparison very difficult . alternative splicing of the plzf pre mrna species generates potentially several proteins deleted from the btb / poz domain . we also noted that the isolated 3zf molecule was a better inhibitor of the rxr - rar response when carrying out dose - response assays , and that the interaction of full length plzf with rar is weak when compared to other known interacting proteins such as coactivators and corepressors . although we have not evaluated the respective half - lives of each plzf species , it is interesting to note that p19 cells express only the spliced form corresponding to the truncated protein , and that the full length transcript appears upon atra treatment . the ratio of spliced transcripts to full length transcripts also varies in a tissue - specific manner , suggesting that the degree of interference of plzf with the rar - rxr pathway may vary similarly , although this point remains speculative at this stage . plzf mrna expression is regulated both spatially and temporally in the developping central nervous system , suggesting that it may exert some control on the retinoid pathway . indeed , a high level of plzf expression indicates rhombomeric boundaries and this up regulation is observed concomitantly to a down regulation of other markers of segmentation , and most notably hox genes and krox-20 , which are known to be regulated by retinoic acid and to play a crucial role in hindbrain anterioposterior patterning ( reviewed in ) . polyethyleneimine ( exgen 500 ) was obtained from euromedex ( souffelweyersheim , france ) , and [ s]methionine from amersham ( les ulis , france ) . the yeast expression plasmid plex12-rark244a - k262a was generated by insertion of the rark244a - k262a cdna between the bgl2 andxba1 sites of plex10 , a lexa dbd fusion vector . licht , while p(grare)3tkluc , psg5-rxgr , psg5-hrar , psg5-rar aht , psg5-rar k244a - k262a , psg5-rar af1 , psg5-rar af2 and psg5-rar)403 were described elsewhere . the uas - tk - luc reporter gene was a gift from v. k. chatterjee and contains two 17 mer uas gal4 response elements upstream of the tk promoter . the pgst fusion plasmids ( pgst - plzf 3zf , pgst - poz , pgst - acidic , pgst - x , pgst - pro , pgst - zn ) and the expression vector pcmv - plzf 3zf were engineered using the gateway cloning technology kit ( invitrogen life technologies , carlsbad , ca ) . all constructs were checked by automatic sequencing . an ovary cdna library ( in pact2 vector , clontech ) was screened using the l40a yeast strain transformed with the plex10-rark244a - k262a vector , essentially as described in . hela tet - on cells were cultured as monolayer in dulbecco 's minimal essential medium supplemented with 10% fetal calf serum . cells were treated for 16 h with atra or am580 at a final concentration of 10 m and 10 m respectively as indicated . the luciferase assay was performed with the bright - glo luciferase assay system from promega ( charbonnires , france ) . gst fusion proteins ( x - gst ) were adsorbed on glutathione ( gsh)-sepharose beads as previously described . s - labeled proteins were synthesized with the quick t7 tnt kit ( promega ) . 5 l of each reaction were diluted in 150 l of gst binding buffer ( 20 mm tris - hcl , ph7.4 , 100 mm kcl , 0.05% np40 , 1 mm dtt , 20% glycerol , 1 mg / ml bsa ) and agitated slowly on a rotating wheel for 2 h at 4c , in the presence or not of ligand , with 40 l of a 50% x - gst - sepharose slurry . unbound material was removed by three successive washes of sepharose beads with 200 l of gst wash buffer ( 20 mm tris - hcl , ph7.4 , 100 mm kcl , 0.1% np40 , 1 mm dtt , 20% glycerol ) . resin - bound proteins were then resolved by 10% sodium dodecyl sulfate - polyacrylamide gel electrophoresis and quantified with a storm 860 phosphorimager ( molecular dynamics ) . values were averaged from at least three independent experiments carried out with two different bacterial extracts . calculations were carried out using the prism software ( graphpad inc . , san diego , ca ) . polyethyleneimine ( exgen 500 ) was obtained from euromedex ( souffelweyersheim , france ) , and [ s]methionine from amersham ( les ulis , france ) . the yeast expression plasmid plex12-rark244a - k262a was generated by insertion of the rark244a - k262a cdna between the bgl2 andxba1 sites of plex10 , a lexa dbd fusion vector . licht , while p(grare)3tkluc , psg5-rxgr , psg5-hrar , psg5-rar aht , psg5-rar k244a - k262a , psg5-rar af1 , psg5-rar af2 and psg5-rar)403 were described elsewhere . the uas - tk - luc reporter gene was a gift from v. k. chatterjee and contains two 17 mer uas gal4 response elements upstream of the tk promoter . the pgst fusion plasmids ( pgst - plzf 3zf , pgst - poz , pgst - acidic , pgst - x , pgst - pro , pgst - zn ) and the expression vector pcmv - plzf 3zf were engineered using the gateway cloning technology kit ( invitrogen life technologies , carlsbad , ca ) . an ovary cdna library ( in pact2 vector , clontech ) was screened using the l40a yeast strain transformed with the plex10-rark244a - k262a vector , essentially as described in . hela tet - on cells were cultured as monolayer in dulbecco 's minimal essential medium supplemented with 10% fetal calf serum . cells were treated for 16 h with atra or am580 at a final concentration of 10 m and 10 m respectively as indicated . the luciferase assay was performed with the bright - glo luciferase assay system from promega ( charbonnires , france ) . gst fusion proteins ( x - gst ) were adsorbed on glutathione ( gsh)-sepharose beads as previously described . s - labeled proteins were synthesized with the quick t7 tnt kit ( promega ) . 5 l of each reaction were diluted in 150 l of gst binding buffer ( 20 mm tris - hcl , ph7.4 , 100 mm kcl , 0.05% np40 , 1 mm dtt , 20% glycerol , 1 mg / ml bsa ) and agitated slowly on a rotating wheel for 2 h at 4c , in the presence or not of ligand , with 40 l of a 50% x - gst - sepharose slurry . unbound material was removed by three successive washes of sepharose beads with 200 l of gst wash buffer ( 20 mm tris - hcl , ph7.4 , 100 mm kcl , 0.1% np40 , 1 mm dtt , 20% glycerol ) . resin - bound proteins were then resolved by 10% sodium dodecyl sulfate - polyacrylamide gel electrophoresis and quantified with a storm 860 phosphorimager ( molecular dynamics ) . values were averaged from at least three independent experiments carried out with two different bacterial extracts . calculations were carried out using the prism software ( graphpad inc . , san diego , ca ) . plzf and ligand interaction with rar. a ) plzf decreases the dimerization of rar with rxr in a ligand structure - independent manner . rxr - rar interaction was tested by gst pulldown assays as in figure 6b in the presence of rar agonists ( atra , cd367 , am580 ) or of an antagonist ( ro41 - 5253 ) . b ) the interaction of plzf with rar does not alter rar ligand binding affinity . ligand binding assays were carried out as follows : the gst - rar was expressed as described in the materials and methods section . plzf or a control protein were synthesized with the quick t7 tnt kit ( promega ) with unlabeled methionine . gst - rar was incubated on a rotating wheel for 2 h at 4c with increased amounts of plzf or of control protein in the presence of 20 nm [ h ] atra ( 50 ci / mmol , perkinelmer ) , and with or without 1 m unlabeled atra to assess non specific binding . 20 l of 50% sepharose - gsh were then added and incubated on a rotating wheel for 1 h at 4c . unbound material was removed by three successive washes of sepharose beads with 200 l of ice - cold 1 pbs . the amount of [ h ] bound to the matrix was determined by liquid scintillation counting . they demonstrate that the ligand binding activity of rar is not altered in the presence of either plzf or a control protein ( luciferase ) . we are grateful to drs d. leprince and s. deltour ( institut de biologie de lille ) for initial advice about the yeast two - hybrid system . p.m. is supported by a fellowship from the ministre de la recherche et des nouvelles technologies . we acknowledge suggestions and discussions of drs c. rachez , b. lefebvre and p. sacchetti . this work was supported by grants from inserm and ligue nationale contre le cancer .

fluoride release ability of glass ionomer cements is well documented.[15 ] anti - caries property is established by increasing enamel resistance to demineralization and enhancing remineralization of the early carious lesion . the majority of fluoride released from glass ionomers occur within first day after the restoration , which may be attributed to high instability and erosion of glass ionomers during the early setting period . after this it is thought that , this fluoride release drop over time restricts the ability of the materials to inhibit secondary caries around restorations . it is because , the low doses of fluoride released may not be at levels which are required for preventive effects . so , the potential for fluoride recharge by a dentifrice or mouth wash is suggested to be more important than fluoride release alone . the exposure of dental materials to topical fluoride creates a fluoride recharge potential in vitro.[1318 ] the ability of a restoration to act as a fluoride reservoir is mainly dependent on the kind and permeability of filling material , the frequency of fluoride exposure and the kind and concentration of fluoride agent . a number of new gic materials have been introduced which claim to have improved therapeutic properties . the aim of this study was to assess and compare the recharge pattern of six conventional and new aged glass ionomer cements following exposure to a fluoride mouth wash or toothpaste containing sodium fluoride ( naf ) over different exposure times ( 2 , 20 , 60 min ) . six glass - ionomer cements were investigated in this study including fuji vii , fuji ix , fuji ix extra ( gc corporation , tokyo , japan ) , riva pink protect , riva bleach protect ( sdi , australia ) and ketac fil ( 3 m , espe , usa ) . the fluoride - containing agents used were toothpaste ( colgate total 1000 ppm f ) and mouth wash ( mouth rinse 220 ppm f , colgate ) . cylindrical cavities ( 4 mm diameter and 4 mm depth ) were prepared in acrylic resin blocks using a drill press ( morgon , taiwan ) . two shallow retentive points were made at the opposite sides of the holes with round bur . the diameter and depth were measured using an electronic digital caliper ( dentagauge 2 , erskine dental , private box 448 , 13428 maxella ave , marina dell rey ca 90292 usa ) . the materials were mixed according to manufacturer 's instructions and placed in the prepared cavities . the specimens were covered by a mylar strip and glass slides were allowed to set at room temperature for 10 min . prior to testing , the specimens were stored in a 95% relative humidity environment at 37c for 24 h. each specimen of each material ( n=15 ) was immersed in 1 ml of deionized water in polyethylene vials and incubated in an incubator ( lindner and may , australia ) at 37c . after 24 h , the containers were thoroughly shaken and the samples were removed , rinsed , dried and then reimmersed into a new vial containing 1 ml of deionized water . all samples were immersed in 500 ml of distilled water and on days 24 , 31 , 38 , 45 , 52 and 59 changing of water was performed . on day 60 samples were placed into new individual vials containing 1 ml of deionized water and the amount of fluoride released was measured after 24 h. this amount of fluoride release measurement on day 60 was considered as the base measurement of fluoride release after exhaustion of the materials . then the 15 samples of each material were divided into three groups of five each . the first group used for treatment with fluoride agent ( mouth rinse 220 ppm , colgate ) , the second group for treatment with toothpaste ( colgate total ) and the third group with no treatment as control . the specimens for recharging with mouth rinse were immersed in the mouth rinse ( 1 ml ) for 2 min and then were placed in vials containing 1 ml of deionized water for 24 h. then the specimens were removed , dried and again were placed in 1 ml of mouth rinse for 2 min and then again were placed in 1 ml of dieonized water for 24 h. the treatment was repeated for one week . fluoride measurements were made every 24 h. in the second and third weeks , the same procedure was followed by 20 min and 1 h immersion times . in the fourth week , no treatment was applied . in the case of specimens for recharging with toothpaste , the specimens were exposed to 1 ml of toothpaste for 2 min , 20 min and 1 h for three consecutive weeks and then no treatment was perfomed . the specimens were wiped out by tissue before immersing in deionized water in each consequent step . in the control group , deionized water was changed in 24 h intervals and daily fluoride measurements were made . fluoride measurements were made using a fluoride ion selective electrode ( ion - check 45 , radiometer analytical , usa ) . the instrument was calibrated according to manufacturer 's instructions using six standard fluoride solutions containing 0.20 , 1.00 , 2.00 , 10.00 , 20.00 and 100 ppm f , respectively . to provide constant background ionic strength , decomplex fluoride , and adjust the solution ph before measurement , 0.1 ml of tisab iii ( total ionic strength adjustment buffer ) ( orion research incorporated , usa ) was added to each solution . the final results were reported as fluoride release rate ( g / cm / day ) by taking into account the surface area and solution volume of each specimen using the following equation , where 0.1256 cm is the surface area of the material tested . gf / cm = ppm f ( gf / ml ) ml ( volume of medium at unit time ) 5755 oberlin drive , # 10 san diego , ca 92121 usa ) was used for statistical analyses . one - way analysis of variance ( anova ) and repeated measures anova and tukey - kramer post test were performed to compare the amount of fluoride release of different materials in different days and also for the comparison of the change of fluoride release over time respectively . data collected on first day and the day before the last day of each treatment i.e. days 7 , 14 , 21 and 28 were compared . cylindrical cavities ( 4 mm diameter and 4 mm depth ) were prepared in acrylic resin blocks using a drill press ( morgon , taiwan ) . two shallow retentive points were made at the opposite sides of the holes with round bur . the diameter and depth were measured using an electronic digital caliper ( dentagauge 2 , erskine dental , private box 448 , 13428 maxella ave , marina dell rey ca 90292 usa ) . the materials were mixed according to manufacturer 's instructions and placed in the prepared cavities . the specimens were covered by a mylar strip and glass slides were allowed to set at room temperature for 10 min . prior to testing , the specimens were stored in a 95% relative humidity environment at 37c for 24 h. each specimen of each material ( n=15 ) was immersed in 1 ml of deionized water in polyethylene vials and incubated in an incubator ( lindner and may , australia ) at 37c . after 24 h , the containers were thoroughly shaken and the samples were removed , rinsed , dried and then reimmersed into a new vial containing 1 ml of deionized water . all samples were immersed in 500 ml of distilled water and on days 24 , 31 , 38 , 45 , 52 and 59 changing of water was performed . on day 60 samples were placed into new individual vials containing 1 ml of deionized water and the amount of fluoride released was measured after 24 h. this amount of fluoride release measurement on day 60 was considered as the base measurement of fluoride release after exhaustion of the materials . then the 15 samples of each material were divided into three groups of five each . the first group used for treatment with fluoride agent ( mouth rinse 220 ppm , colgate ) , the second group for treatment with toothpaste ( colgate total ) and the third group with no treatment as control . the specimens for recharging with mouth rinse were immersed in the mouth rinse ( 1 ml ) for 2 min and then were placed in vials containing 1 ml of deionized water for 24 h. then the specimens were removed , dried and again were placed in 1 ml of mouth rinse for 2 min and then again were placed in 1 ml of dieonized water for 24 h. the treatment was repeated for one week . fluoride measurements were made every 24 h. in the second and third weeks , the same procedure was followed by 20 min and 1 h immersion times . in the fourth week , no treatment was applied . in the case of specimens for recharging with toothpaste , the specimens were exposed to 1 ml of toothpaste for 2 min , 20 min and 1 h for three consecutive weeks and then no treatment was perfomed . the specimens were wiped out by tissue before immersing in deionized water in each consequent step . in the control group , deionized water was changed in 24 h intervals and daily fluoride measurements were made . fluoride measurements were made using a fluoride ion selective electrode ( ion - check 45 , radiometer analytical , usa ) . the instrument was calibrated according to manufacturer 's instructions using six standard fluoride solutions containing 0.20 , 1.00 , 2.00 , 10.00 , 20.00 and 100 ppm f , respectively . to provide constant background ionic strength , decomplex fluoride , and adjust the solution ph before measurement , 0.1 ml of tisab iii ( total ionic strength adjustment buffer ) ( orion research incorporated , usa ) was added to each solution . the final results were reported as fluoride release rate ( g / cm / day ) by taking into account the surface area and solution volume of each specimen using the following equation , where 0.1256 cm is the surface area of the material tested . gf / cm = ppm f ( gf / ml ) ml ( volume of medium at unit time ) 1/0.1256 cm 5755 oberlin drive , # 10 san diego , ca 92121 usa ) was used for statistical analyses . one - way analysis of variance ( anova ) and repeated measures anova and tukey - kramer post test were performed to compare the amount of fluoride release of different materials in different days and also for the comparison of the change of fluoride release over time respectively . data collected on first day and the day before the last day of each treatment i.e. days 7 , 14 , 21 and 28 were compared . the mean and standard deviation of fluoride released from six glass ionomer cements tested with different treatments are shown in table 1 . mean and standard deviation ( sd ) of fluoride release from the six dental materials studied with different treatments the pattern of fluoride release from different materials after recharging with toothpaste and mouth wash over time and also control are shown in figures 16 . comparison of the pattern of fluoride released from six restoratives in different treatment groups are shown in figures 79 . in comparison to control groups , all materials recharged with toothpaste showed higher level of recharge . the pattern of uptake and release of fluoride for all the materials for each treatment were nearly the same . the recharge capability of the materials increased slightly during first week with 2 min treatment time . pattern of fluoride release from fuji vii after recharging with toothpaste and mouth wash pattern of fluoride release from fuji ix after recharging with toothpaste and mouth wash pattern of fluoride release from riva pink after recharging with toothpaste and mouth wash pattern of fluoride release from riva bleach after recharging with toothpaste and mouth wash pattern of fluoride release from ketac fil after recharging with toothpaste and mouth wash pattern of fluoride release from fuji ix extra after recharging with toothpaste and mouth wash pattern of fluoride release from six restoratives after recharging with toothpaste pattern of fluoride release from six restoratives after recharging with mouth wash pattern of fluoride release from six restoratives without treatment ( control ) the amount of recharge and consequent fluoride release were substantially increased to 7.7 - 20.1 and 5.43 - 9.25 g / cm for toothpaste and mouth wash respectively on day 2 and increased slightly up to 7.61 - 17.3 and 4.24 - 10.5 g / cm on day seven for toothpaste and mouth wash treatments respectively . in the second week with changing the treatment time to 20 min , the fluoride recharge and subsequent fluoride release again were sharply increased up to 25.1 - 42.8 g / cm on day 9 and slightly increased up to day 14 ( 36.9 - 48.3 g / cm ) for toothpaste treatment . for mouth wash treatment , the fluoride release after recharging for 20 min increased slightly up to 7 - 13.8 g / cm on day 9 and slightly increased up to day 14 ( 7.55 - 15.1 g / cm ) . after 1 h treatment ( third week ) , a substantial increase of recharge observed for toothpaste treatment while this was slight for mouth wash treatment groups . in the fourth week that no treatment was applied , the fluoride release sharply declined to base line levels after two days and with some fluctuations remained steady during the week for both toothpaste and mouth wash treatment groups . in control groups , the amount of fluoride release remained at base line levels with some fluctuations . on day 1 , the differences of fluoride release from different treatment groups of different materials except for fuji ix extra were not significant ( p>0.05 ) . in the case of fuji ix extra , the differences between mouth wash and toothpaste groups were significant ( p<0.05 ) but their differences with the control group were not significant ( p>0.05 ) . on day 7 , the differences observed among different treatment groups were significant ( p<0.05-p<0.001 ) for all materials except for fuji vii ( toothpaste versus mouth wash ) and fuji ix extra ( mouth wash versus control ) . on day 14 , the differences observed among different groups were significant ( p<0.05-p<0.001 ) for all materials except for rvia pink ( mouth wash versus control ) . on day 21 , the difference observed among different treatment groups were significant for all the materials ( p<0.05-p<0.001 ) . on day 28 , the difference observed among different groups were significant ( p<0.05-p<0.001 ) except for riva pink ( toothpaste versus mouth wash ) , riva bleach , ketac fil and fuji ix extra ( mouth wash versus control ) . the differences observed between day 1 and day 7 for different materials treated with toothpaste were significant for fuji ix , ketac fil and fuji ix extra while for mouth wash the differences for fuji vii , fuji ix and riva pink were significant . in the case of controls , the differences for fuji ix , riva bleach and ketac fil were significant . the differences observed between day 7 and day 14 for different materials treated with toothpaste were significant for all materials as well as for mouth wash it was the same except for riva bleach . in the case of controls the differences observed between day 14 and 21 for different materials treated with toothpaste were significant for all materials while it was the same for mouth wash except for riva pink . in the case of controls , the differences observed between day 21 and 28 for different materials treated with toothpaste and mouth wash were significant for all materials . in the case of controls , the differences were not significant ( p>0.05 ) except for fuji ix and riva pink . the differences observed between day 1 and 28 for different materials treated with toothpaste were not significant ( p>0.05 ) for all materials while it was the same for mouth wash except for fuji vii and riva pink . in the case of controls , the significant differences among different materials with different treatments in different time intervals ( day 1 , 7 , 14 , 21 and 28 ) are shown in table 2 . significant differences of mean of different materials with different treatments in different time intervals ( days ) the pattern of recharge for the conventional glass ionomers after a sharp rise followed by a rapid decline and then gradual prolonged release which are similar to those reported in other studies[2124 ] except for the data reported by rao et al . , indicating no significant rechargability for fuji vii for up to 30 days after exposure to a 1000 ppm fluorinated dentifrice . the exposure did not have any effects on the underlying fluoride release from the cements and the release rates returned to base line within two days after stopping of application of fluoride . it is suggested that fluoride uptake may be more of a surface rather than a bulk diffusion effect and that reexposure of fluoride will enhance fluoride release . it has also been indicated that first exposure modifies cement , making it more susceptible to external fluoride and the possible disruption of the cement matrix on the first exposure and thus opening pathways for fluoride uptake on the second exposure . the results of continuous recharging and release in current experiment and the significant increase of fluoride uptake and release by increasing of exposure time indicate that other factors such as the time of exposure may also be involved . mousavinasab and meyers ( 2009 ) also observed higher fluoride release after recharging of glass ionomers with tooth paste . higher fluoride release after tooth paste application compared to mouth wash was attributed to the retaining of the sticky tooth paste in the superficial pores of the glass ionomers tested . in the current study , compared to mouth wash , higher rechargability was also observed when tooth paste was applied . with increasing of exposure time , the rechargability was increased . as the same methodology was used after immersing of the glass ionomers in the tooth paste at all time intervals , it seems the exposure time and the nature of tooth paste specially containing higher amount of fluoride influence the recharge pattern of glass ionomers with tooth paste rather than its sticky nature . this suggests , if possible , the use of higher concentrations of fluoride in mouth wash or more regular application to brushing with tooth paste . if high fluoride uptake and release is expected for prevention of caries in a long period of time , a time tabled schedule of application of fluoride - containing materials could help to achieve high fluoride release . as the mechanism suggested for the increase in the uptake of fluoride may cause disruption of the cement matrix , the application of this procedure may affect the mechanical properties of the materials ; therefore , further investigations on this effect should be considered .

therapeutic applications that engage the mirror system , including action observation training ( aot ) , motor imagery , and imitation , have been suggested to help improve objective programming during stroke rehabilitation1 . aot includes understanding the movement , imitation learning , motor learning , and cognitive - action processing2,3,4 such as motor memory formation by providing distinct and concrete standard motions , which enable clear motor imagery5 to engage the motor neural network in the same manner as motor execution and action observation6 . aot increases excitability of the primary motor cortex involved in cognitive processing , which is related to kinesthetic memory formation , motor learning , imitation learning , and understanding the purpose of the movement7 . however , it can be difficult for subjects to imagine the entire process while an exact motor representation of the task is being performed8 . the mu rhythm that synchronizes motor observation , motor imagery , and motor execution is generally activated within a frequency of 813 hz through the sensory motor cortex9 , which is related to increased excitability of the primary motor cortex . mu desynchronization , on the other hand , is related to the premotor cortex mirror neuron system10 . these specific neurophysiologic signs are activated when observing or imagining the moving and stopping of oneself or others11 . cerebral function and metabolism are strongly associated with cerebral blood flow ( cbf ) , since an increase in the metabolic demand in the brain leads to an increase in blood flow12 . recently , transcranial doppler ( tcd ) ultrasonography has been increasingly employed as a non - invasive , inexpensive , safe , and portable technique for measuring cerebrovascular function . it permits continuous and bilateral recording of cerebral blood flow velocity ( cbfv ) through the major intracranial vessels14 , 15 . it is also relatively resistant to movement artifacts and has good test - retest reliability16 . tcd can be performed easily , and has become an important alternative for quantifying cbf changes that accompany cerebral activity in the circulation of the human brain17 , and for evaluating changes in cbfv at rest and during performance of cognitive tasks14 , 18 . given that the contribution of cerebrovascular function to cognition is important , the purpose of this study was to investigate the effects of aot on cerebral hemodynamic changes , including cbfv , in healthy subjects . fifteen healthy subjects without any pre - existing neurologic or orthopedic disorder were included in this study . general characteristics of the subjects were as follows : mean age , 58.0 12.05 years ; mean height , 166.33 5.62 cm ; and mean weight , 63.93 8.01 kg . the objective of the study and its requirements were explained to all subjects , who signed a written informed consent form before participating in the experiment . this study was approved by the ethics committee of our institution ( komcirb-2013 - 50 ) . aot tasks consisting of 18 different vital actions for daily living , which gradually increased in difficulty and complexity were presented . each task was 10 s long , for a total task clip time of 3 min . the participants observed and performed the 18 tasks with their own hands . during the 3-min task clip , the subjects sat comfortably in a chair with their arms placed on a table , and were asked to carefully observe 18 different video sequences of functional movements that were required in their daily lives . each sequence became increasingly difficult ( starting with turning a faucet , and then performing more complex movements such as tightening shoelaces ) . all participants had a 5-min rest period before imitating the motor activities and undergoing functional transcranial doppler ( ftcd ) ultrasonography . tcd ultrasonography was conducted before and after aot using the pmd-150 system ( medasonics , usa ) , with the subjects lying supine on a bed , in place with a head frame , in a quiet laboratory . a 2-mhz probe was used to measure the systolic peak velocity ( vs ) with a pulse repetition frequency of 212 khz , depth setting of 16150 mm , burst width of 612 /s , power value of 10100 mw / cm , and scale setting of 040 cm / s for the low range , and 0320 cm / s for the high range . vs was evaluated in the middle cerebral artery ( mca ) , anterior cerebral artery ( aca ) , and posterior cerebral artery ( pca ) . a transtemporal approach using a 2-mhz probe attached to a headpiece was used for tcd mapping of the cerebral artery to locate each blood vessel based on the flow direction , depth , and mapping display . mean flow velocity ( vm ) in the mca , aca , and pca in cm / s was determined by dividing the maximum and minimum tcd frequencies . the shapiro - wilk test was used to determine the distributions of the general properties and outcome measures of the subjects . the paired t test was used to compare cerebral hemodynamics before aot and after aot within each group , whereas the independent t test was performed to compare the right and left sides . vs in the right mca ( rmca ) and left mca ( lmca ) was significantly increased after aot compared with that before aot . vm in the rmca and lmca was also significantly increased after aot compared with that before aot . vs in the right aca ( raca ) and left aca ( laca ) was significantly increased after aot compared with that before aot . vm in the raca and laca was also significantly increased after aot compared with that before aot . vs in the right pca ( rpca ) and left pca ( lpca ) was significantly increased after aot compared with that before aot . vm in the rpca and lpca was also significantly increased after aot compared with that before aot . in a comparison of the mca , aca , and pca using the independent t - test , there were no significant differences in vs and vm between the right and left sides ( table 1table 1.comparison of cerebral hemodynamic changes ( n=15)mcaacapcartltrtltrtltvsrest99.528.597.728.074.614.985.526.335.94.037.04.1ao103.328.8101.327.776.915.589.529.038.03.938.35.5vmrest67.317.766.716.850.411.158.017.225.32.526.13.9ao70.716.869.516.452.010.960.918.326.32.926.83.8 m ( sd ) , vs : systolic peak velocity , vm : mean flow velocity , ao : action observation , mca : middle cerebral artery , aca : anterior cerebral artery , pca : posterior cerebral artery , p<0.05 from rest , p<0.01 from rest , p<0.001 from rest ) . m ( sd ) , vs : systolic peak velocity , vm : mean flow velocity , ao : action observation , mca : middle cerebral artery , aca : anterior cerebral artery , pca : posterior cerebral artery , p<0.05 from rest , p<0.01 from rest , p<0.001 from rest this study demonstrated the effects of aot on cerebral hemodynamics , including vs and vm , in the mca , aca , and pca of healthy subjects . an increase in cbf is important to satisfy the metabolic demands of the cerebral nerve cell during brain activity19 , and an increase in brain metabolism can be referred to as an increase in blood flow in the internal carotid artery and mca19 , 20 . we observed significant increases in cbfv and cerebral blood flow volume ( cbfvol ) in the mca , aca , and pca after aot compared with those before aot in these healthy subjects . these findings indicate that aot has a positive influence in terms of an increase in cbfv and cbfvol , since the brain requires more blood to meet the metabolic demand . measurement of blood flow velocity in the main arteries using ftcd has been accepted in a variety of studies for analyzing brain activities during the performance of cognitive tasks14 , 18 . previous studies have investigated the relationship between cerebral hemodynamic changes and the performance of mental tasks using ftdc , and have suggested that ftdc , as a noninvasive device , can provide quantitative and qualitative measures of psychological parameters18 . aot is a rehabilitation method based on mirror neurons and exercise observed motion after action observation . faster recovery of motor function is possible by observing the movement before it is performed , since observation activates the mirror neurons21 . koch23 reported that during active exercise of the arm , vs in the mca was increased . thus , active exercise plays a great role in increasing the blood flow in the brain . in sato s study regarding motion observation , it was revealed that an increase in mca blood flow also increased the afferent input of muscle spindles and joint receptors , activating a wide cerebral area , including the supplementary motor area , after transferring to the somatosensory area of the cerebrum through the thalamus , which controls general movement . activation of this area indicates that the mirror neuron system is activated , which involves the same brain function involved in performing the motion in reality24 . this study confirmed that aot can contribute to cerebral hemodynamic changes and enhance cerebral metabolism , since it increased vs and vm . therefore , exercise after action observation is expected to be more effective for motor learning , since it activates the mirror neurons that cause a motor reaction in the same manner as actual exercise . the frontal lobe and frontal supplementary motor area are activated in the early stage of motor learning followed by the parietal lobe . this study demonstrated that aot increased vs and vm in the aca , which is similar to the results of kim s study25 . as explained above , in the process of motor observation , the mirror neuron system of the frontal and parietal lobes is activated , which leads to understanding of the motion and ability to perform the action . thus , it plays a role not only in accepting the external visual stimulation but also in understanding the external stimulation and in motor reaction planning as part of the information processing stage . this study investigated whether aot affects vs and vm of cbf in healthy subjects . considering that aot increased vs and vm , patients new circumstances or activities may contribute to the positive effects of cognitive neurorehabilitation based on the performance of motor tasks . future studies using observational training programs in stroke survivors should be conducted to further clarify the effects of aot .

the intestinal crypt has become the archetypal model for quantitative understanding of adult stem cell dynamics and regulation . intestinal crypts are finger - like invaginations of the intestinal mucosa lined by a monolayer of epithelial cells . genetic lineage - tracing experiments in mice have shown that stem cell self - renewal can be characterized by the dynamics of a single population of equipotent intestinal stem cells located at the crypt base , which divide frequently to produce the specialized cell progeny that occupy the upper portion of the crypt ( barker et al . , 2007 ; sangiorgi and capecchi , 2008 ) . quantitative analysis has revealed that the stem cells are in continual neutral competition with each another to retain a privileged position within the crypt base niche ; on average , each stem cell division results in loss and replacement of an individual stem cell lineage ( kozar et al . , 2013 ; lopez - garcia et al . , 2010 ; consequently , it has remained uncertain if and how the biology of the human intestinal crypt is mirrored by its murine counterpart . a low level of crypt fission ( the bifurcation of a crypt to produce two daughter crypts ) is observed in the adult intestine ( cheng et al . wong et al . , 2002 ) , and the healing response following epithelial damage increases the proportion of crypts in fission ( cheng et al . , 1986a , 1986b ; miyoshi et al . , 2012 ; park et al . , 1995 ; totafurno et al . , 1987 ) . quantitative analysis of genetic lineage - tracing studies in mice revealed the low basal rate of crypt fission in the normal murine colon is increased 30-fold by oncogenic kras mutation ( snippert et al . , 2014 ) . moreover , it is the fission of a transformed crypt , rather than the aberrant growth of cells per se , that drives the initial growth of colorectal adenomas ( preston et al . , 2003 ; despite the central importance of crypt fission in the initiation of colon cancer , the evolutionary dynamics of the human intestinal crypt population remain obscure . here , we have measured the clonal evolution of stem cell populations within the human colon by using naturally occurring somatic mtdna mutations to trace clonal lineages ; this methodology circumvents the need to externally label cells in order to trace their progeny . our analysis exploits the stereotypic architecture of the intestinal crypt to resolve the temporal dynamics of clone evolution . to trace clonal lineages in the human intestine , we performed enzyme - histochemistry for the activity of cytochrome c oxidase ( cco ) . infrequent stochastic loss of cco activity ( cco ) is observed in the human intestine and is attributed to an underlying somatic mitochondrial dna ( mtdna ) mutation ( taylor et al . , 2003 ) . mtdna sequencing confirms that adjacent cco cells in the intestine are clonally derived ( fellous et al . , 2009 ; cco activity was assessed in en face serial sections of colonic mucosa ( n = 9 patients ; table s1 ) . within each specimen there were crypts that contained only cco - proficient ( cco+ ) cells , only cco cells , and a mixture of cco and cco+ cells ( partially - mutated ) ( figure 1 ) . we reconstructed the cellular composition of partially mutated crypts using serial sections and biaqim ( http://www.deconvolve.net/bialith/baqifeatures.htm ) image - processing software ( figure 1a ) . ; graham et al . , 2011 ; humphries and wright , 2008 ) , cco cells typically formed contiguous ribbons along the length of the crypt that were confirmed as de novo clonal populations ( figure 1b ) . in some cases , the width of these ribbons varied considerably along the crypt length ( figures 1a , 1d , and figure s1 ; movies s1 and s2 ) . the intestinal crypt acts as a conveyor belt : cells are produced at the crypt base and migrate upward along the crypt axis before being shed into the lumen days later ( wright and alison , 1984 ) . therefore , we reasoned that the wiggles in the width of the cco ribbon along the crypt axis represented a temporal record of the dynamic evolution of the cco stem cell population at the crypt base ( figure 1c ) . in other words , the cco ribbon records the clonal evolution of functioning stem cells at the crypt base , but we note that there may be many more cells within the crypt that have the potential to function as a stem cell . specifically , we supposed that symmetric division of a cco stem cell that resulted in the replacement of a neighboring cco+ stem cell with a cco stem cell ( expansion of the cco clone ) would increase the ribbon width , whereas replacement of a cco stem cell by a cco+ stem cell ( loss ) would decrease the ribbon width . to verify this concept in a situation where the ground - truth was known , we analyzed ribbon evolution in an established computational model of the colonic crypt ( van leeuwen et al . , 2009 ; see the supplemental experimental procedures ) and verified that the changes in the ribbon width along the crypt axis reflected the temporal dynamics of cell division at the crypt base ( figures s1a s1c ) . to quantify stem cell dynamics in vivo , we measured the deviation in ribbon width ( figure 1d ) between successive en face serial sections in partially mutated normal crypts ( n = 11 ) from three patients with sporadic colorectal cancer . deviations were quantified by changes in the proportion of blue to brown staining cells between successive sections ( using both manual and automated measurements ; figures s1d and s1e ) and expressed in terms of cell numbers ( figure s2 and table s1 ) . the distribution of the deviations was approximately symmetric around zero ( skewness = 0.3 ; ks - test p = 1 ; figure 2a ) , indicating that the expansions and contractions of the ribbon widths were balanced , and therefore implying that the clonal evolution of the crypt base stem cells constituted a neutral drift type process . consistent with neutral drift dynamics , we observed cco populations located only in the lower portion of the crypt ( a cco clone ) , ribbons disconnected from the crypt base ( clone extinction ) , and examples of clone fixation where all cells become cco ( figures 1d and s1f ) . led by analogous studies of intestinal stem cell neutral drift dynamics in transgenic mice ( kozar et al . , 2013 ; 2010 ) , we expected that the temporal evolution of the number of functioning stem cells in the cco clone would follow a one - dimensional random walk , and consequently that the temporal evolution in cco ribbon width along the crypt axis would be described by a simple one - dimensional diffusion process ( see the supplemental experimental procedures ) . we note that this simple model describes the stem cell dynamics with a degree of detail appropriate to our data , and has equivalent scaling behavior to the more complex model previously used to understand cellular dynamics at the crypt base ( ritsma et al . , in particular , if a cco clone has a total of n(t ) functional stem cells at time t , the mean - square change in cell number is predicted to vary linearly with time as n(t + t ) applied to the measured clonal imprint on the crypt , this translates to a mean - square change in ribbon width of:w(m+mz)w(m)m2=2f2vmz , where defines the ratio of the functional stem cell number at the crypt base to the number of cells in a circumferential crypt section , = 12 m is the section thickness , is the average cell migration rate along the crypt axis , and mz indexes the z - stack coordinate of the serial sections . the experimental data confirmed the predicted linear relationship for m(mz ) ( pearson s r = 1 ; p < 0.001 ; figure 2b ) . additional quantitative analysis showed agreement of the distribution of ribbon widths along the crypt axis with the predicted time - dependence ( figure 2c , see the supplemental experimental procedures ) . altogether , these results show that the stem cells in human colon also follow a process of one - dimensional neutral drift dynamics . from these results , we then sought to estimate the functional stem cell loss / replacement rate . from the analysis of bromodeoxyuridine incorporation data ( potten et al . , 1992 ; see the supplemental experimental procedures and figure s2a ) , we could infer an average migration speed of around 4 m / hour in the lower half of the crypt ( where most of our histological sections were collected ) , consistent with previous pulse - chase labeling studies using tritiated thymidine incorporation ( lipkin et al . , 1963 ) . however , to determine the ratio , , we require an estimate of the functional stem cell number , n. previous studies of mouse intestine have determined an average of n = 5 , far smaller than the number of lgr5 + crypt base columnar cells ( kozar et al . , 2013 ) . here , noting that the functional stem cell loss / replacement rate must be bound by the cell division rate at the crypt base ( e.g. , we require 1 per cell division ) , which is estimated to be around once per 23 days for human colon ( potten et al . , 1992 ) , we can deduce a minimum ratio of around = 5 . with an average of 23 ( 95% quantile 630 ) cells per crypt circumference ( figures s2b s2d ) , a figure similar to that found in mouse colon , this is consistent with a maximum functional stem cell number of around n = 6 , approximately a factor of two smaller than the average number of cells at the crypt base ( mean = 10 cells ; 95% quantile 615 ; table 1 and figures s2e s2 g ) . because we expect some of the functional stem cell divisions to result in asymmetric fate outcome , it is likely that this figure represents a small overestimate . apc is the critical tumor suppressor gene in the colon ( lamlum et al . , 2000 ) , and loss of normal apc function is suggested to alter stem cell dynamics ( kim et al . , 2004 ; vermeulen et al . , 2013 ) . to quantify the effect of apc mutation on stem cell dynamics in the human colon , we examined the temporal evolution of cco clones in partially cco - deficient but nondysplastic crypts from patients with familial adenomatous polyposis ( fap ) , and attenuated - fap ( afap ) . these patients have a germline loss - of - function mutation in the apc gene ( miyoshi et al . , 1992a ) , and adenoma growth is initiated when the remaining wild - type allele is lost or mutated ( miyoshi et al . , 1992b ) . in both nondysplastic fap and afap crypts ( apc , n = 22 crypts from six patients ) and dysplastic crypts from adenomas ( apc , n = 10 crypts from two patients ) , analysis of the balance of expansion versus contraction events in cco ribbons ( figure 2a ) indicated the stem cells underwent neutral evolution ( apc fap skewness = 0.41 ks - test , p = 0.9 ; afap skewness = 0.76 p = 0.7 ; apc skewness = 0.08 , p = 0.3 ) . the linear dependence of the mean - square displacement , m(mz ) , for both apc crypts and apc adenomatous crypts ( figure 2b ) confirmed neutral drift continued to occur within the stem cell compartment of apc - mutant crypts . as with normal crypts , there was good agreement of the distribution of ribbon widths along the crypt axis with the predicted time - dependence ( figure s2h ) . taking the functional stem cell number to scale in proportion to the number of cells at the crypt base and the circumference of the crypt ( figures s2b s2 g ) ; i.e. , assuming that the ratio remains fixed , we found that the apparent increase in the speed of clone dispersion around the crypt circumference is approximately accounted for by the measured decrease in the cell migration speed along the crypt axis in both fap and afap patients ( table 1 ) , leading to loss / replacement rates comparable to those of normal tissue . in contrast , the measured increase in the dispersion of the clonal ribbons around the crypt circumference in adenomas is not compensated by the reduction in the migration speed , and translated to an acceleration of the loss / replacement rate by a factor of approximately two . this proportionate increase was consistent with the assessment of the pattern of cpg island methylation at a neutral locus , which showed decreased within - crypt methylation pattern diversity in adenomatous versus afap / fap crypts , in line with an increased stem cell loss / replacement rate in adenomas ( figures s3a and s3b ) . faster stem cell replacement leads to the suppression of methylation pattern diversity , because the methylation pattern borne by the dominant clone will be more rapidly propagated , and hence methylation pattern diversity that arises because of de novo methylation changes in different stem cells is suppressed . furthermore , the increase in the rate of stem cell loss / replacement was in line with previous measurements showing disruption of mitotic spindle orientation in adenomas compared to normal colon ( quyn et al . , 2010 ) . wholly mutant cco crypts are often found in clonal patches consisting of two or more cco crypts ( figure 3a ) , and the mean patch size increases with age ( greaves et al . , 2006 ) , suggesting that crypt fission occurs at a baseline rate throughout life . to estimate the crypt fission rate , we counted the patch size distribution of cco crypts in normal epithelium from resection specimens from 20 patients aged between 42 and 85 years who underwent resection for colorectal cancer ( ncrypts = 136,899 crypts assessed ; ncco = 5,313 ) . we supposed that patch evolution followed a simple birth process defined by the crypt fission rate ( snippert et al . , 2014 ; see the supplemental experimental procedures ) , and fitted the predicted patch size distribution to that observed for each patient using a maximum likelihood approach ( figure 3b ) . the estimated crypt fission rate varied significantly between patients with a mean of wt = 0.028 ( = 0.007 ) , indicating an average crypt cycle length of 36 years ( figure 3c ) . this is significantly longer than the previous heuristic estimate of 918 years ( totafurno et al . , 1987 ) . apc has been suggested to play a critical role in crypt fission regulation ( wasan et al . , 1998 ) . to quantitatively assess the impact of apc disruption , we counted cco patch size distributions in the nondysplastic colons of six patients with either fap or afap ( ncrypts = 40,839 ; ncco = 1,411 ) and also within dysplastic adenomas in these patients ( n = 36 adenomas ; ncrypts = 1,174 ; ncco = 138 ) . in nondysplastic fap and afap colon , the mean estimated crypt fission rate was afap = 0.028 ( = 0.004 ) , and fap = 0.034 ( = 0.007 ) , which was slightly higher but comparable with normal colon . to estimate the crypt fission rate within adenomas required an independent estimate of adenoma age ( supplemental experimental procedures and figure s3d ) . by showing that the distribution of adenoma sizes was consistent with boundary - driven expansion , we could infer the median value of the ratio/adeno = 0.005 ( = 0.05 ) , where defined the rate at which adenomatous crypts became cco - deficient ( figure 3d ) . if is comparable between normal and adenomatous crypts ( = 0.001 cryptyear ; figure s3e ) , then this corresponds to an order of magnitude increase in the fission rate within adenomas and is consistent with the previously reported increased numbers of crypts in adenomas ( wasan et al . we note that there is a large degree of variability between adenomas in the estimated value of adeno , and that we exclusively analyzed very small adenomas that could potentially be growing more slowly than their larger and more advanced counterparts . correspondingly , assessment of methylation pattern diversity showed lower diversity among clonally related adenomatous crypts as compared to clonally related afap / fap crypts ( figures s3a and s3c ) . lineage tracing studies using transgenic mouse models have provided significant insight into the dynamics of murine intestinal stem cells , but the significance of these findings for the human intestine has remained in question . here we have shown that the combination of naturally occurring somatic mutations coupled with the unique anatomy of the intestinal crypt provides a platform from which the evolutionary record of the human intestinal stem cell compartment can be inferred . we have shown that the clonal evolution of human intestinal stem cells is a neutral process that mimics that observed in the murine crypt , and also inferred that human crypts house a similarly small number of functional stem cells to their murine counterparts ( kozar et al . , 2013 ) , despite the total number of cells being 10-fold greater in human crypts . loss of normal apc function is usually the cause of neoplasia in the colon ( lamlum et al . , 2000 ) ; our data from neoplastic crypts imply that the tumor - suppressive mechanism of apc is a consequence of its direct role in regulating stem cell dynamics . we have measured a low basal rate of crypt fission occurring throughout life in the adult human colon ; similarly to the murine small bowel ( li et al . , 1994 ) , human colonic crypts typically divide at most once or twice during a lifetime . loss of apc function causes an order - of - magnitude increase in the crypt fission rate and demonstrates a critical role for apc in regulating growth . we note that aberrant crypt fission underpins intestinal neoplasia , and as such , crypts are the units of selection in the intestine . thus , by measuring the crypt fission rate , we measured a fundamental evolutionary parameter of the human colon , which facilitates quantification of the age and rate of growth of neoplastic lesions . finally , we note that our methods represent a general toolkit to quantify in vivo human stem cell dynamics in any tissue with a stereotypic architecture centered around a stem cell niche . consequently , our methodology is directly applicable for understanding the origins and evolution of epithelial disease such as barrett 's esophagus and intestinal metaplasia in the stomach . normal colon tissue samples were collected at university college hospital , london , under multicenter ethical approval ( 07/q1604/17 and 11/lo/1613 ) . fap tissue was collected at the academic medical centre , amsterdam , in accordance with national ethics guidelines on tissue procurement ( local protocol 12 - 543 ) . tissue preparation and assessment of cco activity and mtdna sequencing ( taylor et al . , 2003 ) , construction of crypt maps ( fellous et al . , 2009 ) , and analysis of methylation patterns ( graham et al . , 2011 ) was performed as previously described . assessment of the number of cells at the crypt base was performed on 3 m hematoxylin - and - eosin stained sections , and ki67 expression assessed on serial sections with the novocastra rabbit polyclonal antibody ( dilution 1:400 ) . briefly , computational analysis of the crypt was performed in the chaste simulation framework ( fletcher et al . , 2012 ; van leeuwen et al . , 2009 ) , and mathematical analysis was based on a refinement of the previously described model of neutral drift processes in intestinal crypts ( lopez - garcia et al . , 2010 ;