code
stringlengths 1
46.1k
⌀ | label
class label 1.18k
classes | domain_label
class label 21
classes | index
stringlengths 4
5
|
|---|---|---|---|
const char *coin_err;
typedef unsigned char byte;
int is_hex(const char *s) {
int i;
for (i = 0; i < 64; i++)
if (!isxdigit(s[i])) return 0;
return 1;
}
void str_to_byte(const char *src, byte *dst, int n) {
while (n--) sscanf(src + n * 2, , dst + n);
}
char* base58(byte *s, char *out) {
static const char *tmpl =
;
static char buf[40];
int c, i, n;
if (!out) out = buf;
out[n = 34] = 0;
while (n--) {
for (c = i = 0; i < 25; i++) {
c = c * 256 + s[i];
s[i] = c / 58;
c %= 58;
}
out[n] = tmpl[c];
}
for (n = 0; out[n] == '1'; n++);
memmove(out, out + n, 34 - n);
return out;
}
char *coin_encode(const char *x, const char *y, char *out) {
byte s[65];
byte rmd[5 + RIPEMD160_DIGEST_LENGTH];
if (!is_hex(x) || !(is_hex(y))) {
coin_err = ;
return 0;
}
s[0] = 4;
str_to_byte(x, s + 1, 32);
str_to_byte(y, s + 33, 32);
rmd[0] = COIN_VER;
RIPEMD160(SHA256(s, 65, 0), SHA256_DIGEST_LENGTH, rmd + 1);
memcpy(rmd + 21, SHA256(SHA256(rmd, 21, 0), SHA256_DIGEST_LENGTH, 0), 4);
return base58(rmd, out);
}
int main(void) {
puts(coin_encode(
,
,
0));
return 0;
} | 1,093Bitcoin/public point to address
| 5c
| yc06f |
null | 1,091Bitmap/Bézier curves/Quadratic
| 11kotlin
| 25tli |
static int width, height;
static BYTE bitmap[MAXSIZE][MAXSIZE];
static BYTE oldColor;
static BYTE newColor;
void floodFill(int i, int j)
{
if ( 0 <= i && i < height
&& 0 <= j && j < width
&& bitmap[i][j] == oldColor )
{
bitmap[i][j] = newColor;
floodFill(i-1,j);
floodFill(i+1,j);
floodFill(i,j-1);
floodFill(i,j+1);
}
}
void skipLine(FILE* file)
{
while(!ferror(file) && !feof(file) && fgetc(file) != '\n')
;
}
void skipCommentLines(FILE* file)
{
int c;
int comment = '
while ((c = fgetc(file)) == comment)
skipLine(file);
ungetc(c,file);
}
readPortableBitMap(FILE* file)
{
int i,j;
skipLine(file);
skipCommentLines(file); fscanf(file,,&width);
skipCommentLines(file); fscanf(file,,&height);
skipCommentLines(file);
if ( width <= MAXSIZE && height <= MAXSIZE )
for ( i = 0; i < height; i++ )
for ( j = 0; j < width; j++ )
fscanf(file,,&(bitmap[i][j]));
else exit(EXIT_FAILURE);
}
void writePortableBitMap(FILE* file)
{
int i,j;
fprintf(file,);
fprintf(file,, width, height);
for ( i = 0; i < height; i++ )
{
for ( j = 0; j < width; j++ )
fprintf(file,, bitmap[i][j]);
fprintf(file,);
}
}
int main(void)
{
oldColor = 1;
newColor = oldColor ? 0 : 1;
readPortableBitMap(stdin);
floodFill(height/2,width/2);
writePortableBitMap(stdout);
return EXIT_SUCCESS;
} | 1,094Bitmap/Flood fill
| 5c
| v4d2o |
function replace(input: string, key: number) : string {
return input.replace(/([a-z])/g,
($1) => String.fromCharCode(($1.charCodeAt(0) + key + 26 - 97) % 26 + 97)
).replace(/([A-Z])/g,
($1) => String.fromCharCode(($1.charCodeAt(0) + key + 26 - 65) % 26 + 65));
} | 1,083Caesar cipher
| 20typescript
| sisqj |
define('src_name', 'input.jpg');
define('dest_name', 'output.jpg');
$img = imagecreatefromjpeg(src_name);
if(empty($img)){
echo 'Image could not be loaded!';
exit;
}
$black = imagecolorallocate($img, 0, 0, 0);
$white = imagecolorallocate($img, 255, 255, 255);
$width = imagesx($img);
$height = imagesy($img);
$array_lum = array();
$sum_lum = 0;
$average_lum = 0;
for($x = 0; $x < $width; $x++){
for($y = 0; $y < $height; $y++){
$color = imagecolorat($img, $x, $y);
$r = ($color >> 16) & 0xFF;
$g = ($color >> 8) & 0xFF;
$b = $color & 0xFF;
$array_lum[$x][$y] = ($r + $g + $b);
$sum_lum += $array_lum[$x][$y];
}
}
$average_lum = $sum_lum / ($width * $height);
for($x = 0; $x < $width; $x++){
for($y = 0; $y < $height; $y++){
if($array_lum[$x][$y] > $average_lum){
imagesetpixel($img, $x, $y, $white);
}
else{
imagesetpixel($img, $x, $y, $black);
}
}
}
imagejpeg($img, dest_name);
if(!file_exists(dest_name)){
echo 'Image not saved! Check permission!';
} | 1,089Bitmap/Histogram
| 12php
| 7k2rp |
Bitmap.quadraticbezier = function(self, x1, y1, x2, y2, x3, y3, nseg)
nseg = nseg or 10
local prevx, prevy, currx, curry
for i = 0, nseg do
local t = i / nseg
local a, b, c = (1-t)^2, 2*t*(1-t), t^2
prevx, prevy = currx, curry
currx = math.floor(a * x1 + b * x2 + c * x3 + 0.5)
curry = math.floor(a * y1 + b * y2 + c * y3 + 0.5)
if i > 0 then
self:line(prevx, prevy, currx, curry)
end
end
end
local bitmap = Bitmap(61,21)
bitmap:clear()
bitmap:quadraticbezier( 1,1, 30,37, 59,1 )
bitmap:render({[0x000000]='.', [0xFFFFFFFF]='X'}) | 1,091Bitmap/Bézier curves/Quadratic
| 1lua
| v4z2x |
package raster | 1,092Bitmap/Midpoint circle algorithm
| 0go
| ludcw |
void cubic_bezier(
image img,
unsigned int x1, unsigned int y1,
unsigned int x2, unsigned int y2,
unsigned int x3, unsigned int y3,
unsigned int x4, unsigned int y4,
color_component r,
color_component g,
color_component b ); | 1,095Bitmap/Bézier curves/Cubic
| 5c
| ugdv4 |
int main()
{
int i, j;
double degrees[] = { 0.0, 16.87, 16.88, 33.75, 50.62, 50.63, 67.5,
84.37, 84.38, 101.25, 118.12, 118.13, 135.0, 151.87, 151.88,
168.75, 185.62, 185.63, 202.5, 219.37, 219.38, 236.25, 253.12,
253.13, 270.0, 286.87, 286.88, 303.75, 320.62, 320.63, 337.5,
354.37, 354.38 };
const char * names =
;
for (i = 0; i < 33; i++) {
j = .5 + degrees[i] * 32 / 360;
printf(, (j % 32) + 1, names + (j % 32) * 22,
degrees[i]);
}
return 0;
} | 1,096Box the compass
| 5c
| gjt45 |
module Circle where
import Data.List
type Point = (Int, Int)
generateCirclePoints :: Point -> Int -> [Point]
generateCirclePoints (x0, y0) radius
= (x0, y0 + radius): (x0, y0 - radius): (x0 + radius, y0): (x0 - radius, y0): points
where
points = concatMap generatePoints $ unfoldr step initialValues
generatePoints (x, y)
= [(xop x0 x', yop y0 y') | (x', y') <- [(x, y), (y, x)], xop <- [(+), (-)], yop <- [(+), (-)]]
initialValues = (1 - radius, 1, (-2) * radius, 0, radius)
step (f, ddf_x, ddf_y, x, y) | x >= y = Nothing
| otherwise = Just ((x', y'), (f', ddf_x', ddf_y', x', y'))
where
(f', ddf_y', y') | f >= 0 = (f + ddf_y' + ddf_x', ddf_y + 2, y - 1)
| otherwise = (f + ddf_x, ddf_y, y)
ddf_x' = ddf_x + 2
x' = x + 1 | 1,092Bitmap/Midpoint circle algorithm
| 8haskell
| 1w5ps |
from PIL import Image
image = Image.open()
width, height = image.size
amount = width * height
total = 0
bw_image = Image.new('L', (width, height), 0)
bm_image = Image.new('1', (width, height), 0)
for h in range(0, height):
for w in range(0, width):
r, g, b = image.getpixel((w, h))
greyscale = int((r + g + b) / 3)
total += greyscale
bw_image.putpixel((w, h), gray_scale)
avg = total / amount
black = 0
white = 1
for h in range(0, height):
for w in range(0, width):
v = bw_image.getpixel((w, h))
if v >= avg:
bm_image.putpixel((w, h), white)
else:
bm_image.putpixel((w, h), black)
bw_image.show()
bm_image.show() | 1,089Bitmap/Histogram
| 3python
| dzqn1 |
import java.awt.Color;
public class MidPointCircle {
private BasicBitmapStorage image;
public MidPointCircle(final int imageWidth, final int imageHeight) {
this.image = new BasicBitmapStorage(imageWidth, imageHeight);
}
private void drawCircle(final int centerX, final int centerY, final int radius) {
int d = (5 - r * 4)/4;
int x = 0;
int y = radius;
Color circleColor = Color.white;
do {
image.setPixel(centerX + x, centerY + y, circleColor);
image.setPixel(centerX + x, centerY - y, circleColor);
image.setPixel(centerX - x, centerY + y, circleColor);
image.setPixel(centerX - x, centerY - y, circleColor);
image.setPixel(centerX + y, centerY + x, circleColor);
image.setPixel(centerX + y, centerY - x, circleColor);
image.setPixel(centerX - y, centerY + x, circleColor);
image.setPixel(centerX - y, centerY - x, circleColor);
if (d < 0) {
d += 2 * x + 1;
} else {
d += 2 * (x - y) + 1;
y--;
}
x++;
} while (x <= y);
}
} | 1,092Bitmap/Midpoint circle algorithm
| 9java
| 7k9rj |
const char *coin_err;
int unbase58(const char *s, unsigned char *out) {
static const char *tmpl =
;
int i, j, c;
const char *p;
memset(out, 0, 25);
for (i = 0; s[i]; i++) {
if (!(p = strchr(tmpl, s[i])))
bail();
c = p - tmpl;
for (j = 25; j--; ) {
c += 58 * out[j];
out[j] = c % 256;
c /= 256;
}
if (c) bail();
}
return 1;
}
int valid(const char *s) {
unsigned char dec[32], d1[SHA256_DIGEST_LENGTH], d2[SHA256_DIGEST_LENGTH];
coin_err = ;
if (!unbase58(s, dec)) return 0;
SHA256(SHA256(dec, 21, d1), SHA256_DIGEST_LENGTH, d2);
if (memcmp(dec + 21, d2, 4))
bail();
return 1;
}
int main (void) {
const char *s[] = {
,
,
,
,
0 };
int i;
for (i = 0; s[i]; i++) {
int status = valid(s[i]);
printf(, s[i], status ? : coin_err);
}
return 0;
} | 1,097Bitcoin/address validation
| 5c
| 258lo |
package main
import (
"crypto/sha256"
"encoding/hex"
"errors"
"fmt"
"golang.org/x/crypto/ripemd160"
) | 1,093Bitcoin/public point to address
| 0go
| 1wup5 |
(require racket/draw)
(define (draw-line dc p q)
(match* (p q) [((list x y) (list s t)) (send dc draw-line x y s t)]))
(define (draw-lines dc ps)
(void
(for/fold ([p0 (first ps)]) ([p (rest ps)])
(draw-line dc p0 p)
p)))
(define (int t p q)
(define ((int1 t) x0 x1) (+ (* (- 1 t) x0) (* t x1)))
(map (int1 t) p q))
(define (bezier-points p0 p1 p2)
(for/list ([t (in-range 0.0 1.0 (/ 1.0 20))])
(int t (int t p0 p1) (int t p1 p2))))
(define bm (make-object bitmap% 17 17))
(define dc (new bitmap-dc% [bitmap bm]))
(send dc set-smoothing 'unsmoothed)
(send dc set-pen 1 'solid)
(draw-lines dc (bezier-points '(16 1) '(1 4) '(3 16)))
bm | 1,091Bitmap/Bézier curves/Quadratic
| 3python
| 0ibsq |
(require racket/draw)
(define (draw-line dc p q)
(match* (p q) [((list x y) (list s t)) (send dc draw-line x y s t)]))
(define (draw-lines dc ps)
(void
(for/fold ([p0 (first ps)]) ([p (rest ps)])
(draw-line dc p0 p)
p)))
(define (int t p q)
(define ((int1 t) x0 x1) (+ (* (- 1 t) x0) (* t x1)))
(map (int1 t) p q))
(define (bezier-points p0 p1 p2)
(for/list ([t (in-range 0.0 1.0 (/ 1.0 20))])
(int t (int t p0 p1) (int t p1 p2))))
(define bm (make-object bitmap% 17 17))
(define dc (new bitmap-dc% [bitmap bm]))
(send dc set-smoothing 'unsmoothed)
(send dc set-pen "red" 1 'solid)
(draw-lines dc (bezier-points '(16 1) '(1 4) '(3 16)))
bm | 1,091Bitmap/Bézier curves/Quadratic
| 13r
| ws7e5 |
function Bitmap:circle(x, y, r, c)
local dx, dy, err = r, 0, 1-r
while dx >= dy do
self:set(x+dx, y+dy, c)
self:set(x-dx, y+dy, c)
self:set(x+dx, y-dy, c)
self:set(x-dx, y-dy, c)
self:set(x+dy, y+dx, c)
self:set(x-dy, y+dx, c)
self:set(x+dy, y-dx, c)
self:set(x-dy, y-dx, c)
dy = dy + 1
if err < 0 then
err = err + 2 * dy + 1
else
dx, err = dx-1, err + 2 * (dy - dx) + 1
end
end
end | 1,092Bitmap/Midpoint circle algorithm
| 1lua
| 5r3u6 |
import Numeric (showIntAtBase)
import Data.List (unfoldr)
import Data.Binary (Word8)
import Crypto.Hash.SHA256 as S (hash)
import Crypto.Hash.RIPEMD160 as R (hash)
import Data.ByteString (unpack, pack)
publicPointToAddress :: Integer -> Integer -> String
publicPointToAddress x y =
let toBytes x = reverse $ unfoldr (\b -> if b == 0 then Nothing else Just (fromIntegral $ b `mod` 256, b `div` 256)) x
ripe = 0: unpack (R.hash $ S.hash $ pack $ 4: toBytes x ++ toBytes y)
ripe_checksum = take 4 $ unpack $ S.hash $ S.hash $ pack ripe
addressAsList = ripe ++ ripe_checksum
address = foldl (\v b -> v * 256 + fromIntegral b) 0 addressAsList
base58Digits = "123456789ABCDEFGHJKLMNPQRSTUVWXYZabcdefghijkmnopqrstuvwxyz"
in showIntAtBase 58 (base58Digits !!) address ""
main = print $ publicPointToAddress
0x50863AD64A87AE8A2FE83C1AF1A8403CB53F53E486D8511DAD8A04887E5B2352
0x2CD470243453A299FA9E77237716103ABC11A1DF38855ED6F2EE187E9C582BA6 | 1,093Bitcoin/public point to address
| 8haskell
| t6wf7 |
(ns boxing-the-compass
(:use [clojure.string :only [capitalize]]))
(def headings
(for [i (range 0 (inc 32))]
(let [heading (* i 11.25)]
(case (mod i 3)
1 (+ heading 5.62)
2 (- heading 5.62)
heading))))
(defn angle2compass
[angle]
(let [dirs ["N" "NbE" "N-NE" "NEbN" "NE" "NEbE" "E-NE" "EbN"
"E" "EbS" "E-SE" "SEbE" "SE" "SEbS" "S-SE" "SbE"
"S" "SbW" "S-SW" "SWbS" "SW" "SWbW" "W-SW" "WbS"
"W" "WbN" "W-NW" "NWbW" "NW" "NWbN" "N-NW" "NbW"]
unpack {\N "north" \E "east" \W "west" \S "south" \b " by " \- "-"}
sep (/ 360 (count dirs))
dir (int (/ (mod (+ angle (/ sep 2)) 360) sep))]
(capitalize (apply str (map unpack (dirs dir))))))
(print
(apply str (map-indexed #(format "%2s%-18s%7.2f\n"
(inc (mod %1 32)) (angle2compass %2) %2)
headings))) | 1,096Box the compass
| 6clojure
| k1mhs |
class Pixmap
def histogram
histogram = Hash.new(0)
@height.times do |y|
@width.times do |x|
histogram[self[x,y].luminosity] += 1
end
end
histogram
end
def to_blackandwhite
hist = histogram
median = nil
sum = 0
hist.keys.sort.each do |lum|
sum += hist[lum]
if sum > @height * @width / 2
median = lum
break
end
end
bw = self.class.new(@width, @height)
@height.times do |y|
@width.times do |x|
bw[x,y] = self[x,y].luminosity < median? RGBColour::BLACK: RGBColour::WHITE
end
end
bw
end
def save_as_blackandwhite(filename)
to_blackandwhite.save(filename)
end
end
Pixmap.open('file.ppm').save_as_blackandwhite('file_bw.ppm') | 1,089Bitmap/Histogram
| 14ruby
| t60f2 |
extern crate image;
use image::{DynamicImage, GenericImageView, ImageBuffer, Rgba}; | 1,089Bitmap/Histogram
| 15rust
| zy8to |
Define cubic(p1,p2,p3,segs) = Prgm
Local i,t,u,prev,pt
0 pt
For i,1,segs+1
(i-1.0)/segs t Decimal to avoid slow exact arithetic
(1-t) u
pt prev
u^2*p1 + 2*t*u*p2 + t^2*p3 pt
If i>1 Then
PxlLine floor(prev[1,1]), floor(prev[1,2]), floor(pt[1,1]), floor(pt[1,2])
EndIf
EndFor
EndPrgm | 1,091Bitmap/Bézier curves/Quadratic
| 14ruby
| od18v |
null | 1,092Bitmap/Midpoint circle algorithm
| 11kotlin
| ugzvc |
package raster
const b3Seg = 30
func (b *Bitmap) Bzier3(x1, y1, x2, y2, x3, y3, x4, y4 int, p Pixel) {
var px, py [b3Seg + 1]int
fx1, fy1 := float64(x1), float64(y1)
fx2, fy2 := float64(x2), float64(y2)
fx3, fy3 := float64(x3), float64(y3)
fx4, fy4 := float64(x4), float64(y4)
for i := range px {
d := float64(i) / b3Seg
a := 1 - d
b, c := a * a, d * d
a, b, c, d = a*b, 3*b*d, 3*a*c, c*d
px[i] = int(a*fx1 + b*fx2 + c*fx3 + d*fx4)
py[i] = int(a*fy1 + b*fy2 + c*fy3 + d*fy4)
}
x0, y0 := px[0], py[0]
for i := 1; i <= b3Seg; i++ {
x1, y1 := px[i], py[i]
b.Line(x0, y0, x1, y1, p)
x0, y0 = x1, y1
}
}
func (b *Bitmap) Bzier3Rgb(x1, y1, x2, y2, x3, y3, x4, y4 int, c Rgb) {
b.Bzier3(x1, y1, x2, y2, x3, y3, x4, y4, c.Pixel())
} | 1,095Bitmap/Bézier curves/Cubic
| 0go
| 0i7sk |
int day(int y, int m, int d) {
return 367 * y - 7 * (y + (m + 9) / 12) / 4 + 275 * m / 9 + d - 730530;
}
void cycle(int diff, int l, char *t) {
int p = round(100 * sin(2 * M_PI * diff / l));
printf(, t, p);
if (abs(p) < 15)
printf();
printf();
}
int main(int argc, char *argv[]) {
int diff;
if (argc < 7) {
printf();
printf();
exit(1);
}
diff = abs(day(atoi(argv[1]), atoi(argv[2]), atoi(argv[3]))
- day(atoi(argv[4]), atoi(argv[5]), atoi(argv[6])));
printf(, diff);
cycle(diff, 23, );
cycle(diff, 28, );
cycle(diff, 33, );
} | 1,098Biorhythms
| 5c
| ntji6 |
use Crypt::RIPEMD160;
use Digest::SHA qw(sha256);
use Encode::Base58::GMP;
sub public_point_to_address {
my $ec = join '', '04', @_;
my $octets = pack 'C*', map { hex } unpack('(a2)65', $ec);
my $hash = chr(0) . Crypt::RIPEMD160->hash(sha256 $octets);
my $checksum = substr sha256(sha256 $hash), 0, 4;
my $hex = join '', '0x',
map { sprintf "%02X", $_ }
unpack 'C*', $hash.$checksum;
return '1' . sprintf "%32s", encode_base58($hex, 'bitcoin');
}
say public_point_to_address
'50863AD64A87AE8A2FE83C1AF1A8403CB53F53E486D8511DAD8A04887E5B2352',
'2CD470243453A299FA9E77237716103ABC11A1DF38855ED6F2EE187E9C582BA6'
; | 1,093Bitcoin/public point to address
| 2perl
| lunc5 |
object BitmapOps {
def histogram(bm:RgbBitmap)={
val hist=new Array[Int](255)
for(x <- 0 until bm.width; y <- 0 until bm.height; l=luminosity(bm.getPixel(x,y)))
hist(l)+=1
hist
}
def histogram_median(hist:Array[Int])={
var from=0
var to=hist.size-1
var left=hist(from)
var right=hist(to)
while(from!=to){
if (left<right)
{from+=1; left+=hist(from)}
else
{to-=1; right+=hist(to)}
}
from
}
def monochrom(bm:RgbBitmap, threshold:Int)={
val image=new RgbBitmap(bm.width, bm.height)
val c1=Color.BLACK
val c2=Color.WHITE
for(x <- 0 until bm.width; y <- 0 until bm.height; l=luminosity(bm.getPixel(x,y)))
image.setPixel(x, y, if(l>threshold) c2 else c1)
image
}
} | 1,089Bitmap/Histogram
| 16scala
| ycn63 |
function draw() {
var canvas = document.getElementById("container");
context = canvas.getContext("2d");
bezier3(20, 200, 700, 50, -300, 50, 380, 150); | 1,095Bitmap/Bézier curves/Cubic
| 10javascript
| 920ml |
import 'package:crypto/crypto.dart';
class Bitcoin {
final String ALPHABET =
"123456789ABCDEFGHJKLMNPQRSTUVWXYZabcdefghijkmnopqrstuvwxyz";
List<int> bigIntToByteArray(BigInt data) {
String str;
bool neg = false;
if (data < BigInt.zero) {
str = (~data).toRadixString(16);
neg = true;
} else str = data.toRadixString(16);
int p = 0;
int len = str.length;
int blen = (len + 1) ~/ 2;
int boff = 0;
List bytes;
if (neg) {
if (len & 1 == 1) {
p = -1;
}
int byte0 = ~int.parse(str.substring(0, p + 2), radix: 16);
if (byte0 < -128) byte0 += 256;
if (byte0 >= 0) {
boff = 1;
bytes = new List<int>(blen + 1);
bytes[0] = -1;
bytes[1] = byte0;
} else {
bytes = new List<int>(blen);
bytes[0] = byte0;
}
for (int i = 1; i < blen; ++i) {
int byte = ~int.parse(str.substring(p + (i << 1), p + (i << 1) + 2),
radix: 16);
if (byte < -128) byte += 256;
bytes[i + boff] = byte;
}
} else {
if (len & 1 == 1) {
p = -1;
}
int byte0 = int.parse(str.substring(0, p + 2), radix: 16);
if (byte0 > 127) byte0 -= 256;
if (byte0 < 0) {
boff = 1;
bytes = new List<int>(blen + 1);
bytes[0] = 0;
bytes[1] = byte0;
} else {
bytes = new List<int>(blen);
bytes[0] = byte0;
}
for (int i = 1; i < blen; ++i) {
int byte =
int.parse(str.substring(p + (i << 1), p + (i << 1) + 2), radix: 16);
if (byte > 127) byte -= 256;
bytes[i + boff] = byte;
}
}
return bytes;
}
List<int> arrayCopy(bytes, srcOffset, result, destOffset, bytesLength) {
for (int i = srcOffset; i < bytesLength; i++) {
result[destOffset + i] = bytes[i];
}
return result;
}
List<int> decodeBase58To25Bytes(String input) {
BigInt number = BigInt.zero;
for (String t in input.split('')) {
int p = ALPHABET.indexOf(t);
if (p == (-1))
return null;
number = number * (BigInt.from(58)) + (BigInt.from(p));
}
List<int> result = new List<int>(24);
List<int> numBytes = bigIntToByteArray(number);
return arrayCopy(
numBytes, 0, result, result.length - numBytes.length, numBytes.length);
}
validateAddress(String address) {
List<int> decoded = new List.from(decodeBase58To25Bytes(address));
List<int> temp = new List<int>.from(decoded);
temp.insert(0, 0);
List<int> hash1 = sha256.convert(temp.sublist(0, 21)).bytes;
List<int> hash2 = sha256.convert(hash1).bytes;
if (hash2[0]!= decoded[20] ||
hash2[1]!= decoded[21] ||
hash2[2]!= decoded[22] ||
hash2[3]!= decoded[23]) return false;
return true;
}
} | 1,097Bitcoin/address validation
| 18dart
| 69e34 |
use strict;
use warnings;
use Algorithm::Line::Bresenham 'circle';
my @points;
my @circle = circle((10) x 3);
for (@circle) { $points[$_->[0]][$_->[1]] = '
print join "\n", map { join '', map { $_ || ' ' } @$_ } @points | 1,092Bitmap/Midpoint circle algorithm
| 2perl
| 8nb0w |
null | 1,095Bitmap/Bézier curves/Cubic
| 11kotlin
| ifko4 |
import binascii
import functools
import hashlib
digits58 = b'123456789ABCDEFGHJKLMNPQRSTUVWXYZabcdefghijkmnopqrstuvwxyz'
def b58(n):
return b58(n
def public_point_to_address(x, y):
c = b'\x04' + binascii.unhexlify(x) + binascii.unhexlify(y)
r = hashlib.new('ripemd160')
r.update(hashlib.sha256(c).digest())
c = b'\x00' + r.digest()
d = hashlib.sha256(hashlib.sha256(c).digest()).digest()
return b58(functools.reduce(lambda n, b: n<<8|b, c + d[:4]))
if __name__ == '__main__':
print(public_point_to_address(
b'50863AD64A87AE8A2FE83C1AF1A8403CB53F53E486D8511DAD8A04887E5B2352',
b'2CD470243453A299FA9E77237716103ABC11A1DF38855ED6F2EE187E9C582BA6')) | 1,093Bitcoin/public point to address
| 3python
| 25dlz |
Bitmap.cubicbezier = function(self, x1, y1, x2, y2, x3, y3, x4, y4, nseg)
nseg = nseg or 10
local prevx, prevy, currx, curry
for i = 0, nseg do
local t = i / nseg
local a, b, c, d = (1-t)^3, 3*t*(1-t)^2, 3*t^2*(1-t), t^3
prevx, prevy = currx, curry
currx = math.floor(a * x1 + b * x2 + c * x3 + d * x4 + 0.5)
curry = math.floor(a * y1 + b * y2 + c * y3 + d * y4 + 0.5)
if i > 0 then
self:line(prevx, prevy, currx, curry)
end
end
end
local bitmap = Bitmap(61,21)
bitmap:clear()
bitmap:cubicbezier( 1,1, 15,41, 45,-20, 59,19 )
bitmap:render({[0x000000]='.', [0xFFFFFFFF]='X'}) | 1,095Bitmap/Bézier curves/Cubic
| 1lua
| ntbi8 |
typedef struct genome{
char base;
struct genome *next;
}genome;
typedef struct{
char mutation;
int position;
}genomeChange;
typedef struct{
int adenineCount,thymineCount,cytosineCount,guanineCount;
}baseCounts;
genome *strand;
baseCounts baseData;
int genomeLength = 100, lineLength = 50;
int numDigits(int num){
int len = 1;
while(num>10){
num /= 10;
len++;
}
return len;
}
void generateStrand(){
int baseChoice = rand()%4, i;
genome *strandIterator, *newStrand;
baseData.adenineCount = 0;
baseData.thymineCount = 0;
baseData.cytosineCount = 0;
baseData.guanineCount = 0;
strand = (genome*)malloc(sizeof(genome));
strand->base = baseChoice==0?'A':(baseChoice==1?'T':(baseChoice==2?'C':'G'));
baseChoice==0?baseData.adenineCount++:(baseChoice==1?baseData.thymineCount++:(baseChoice==2?baseData.cytosineCount++:baseData.guanineCount++));
strand->next = NULL;
strandIterator = strand;
for(i=1;i<genomeLength;i++){
baseChoice = rand()%4;
newStrand = (genome*)malloc(sizeof(genome));
newStrand->base = baseChoice==0?'A':(baseChoice==1?'T':(baseChoice==2?'C':'G'));
baseChoice==0?baseData.adenineCount++:(baseChoice==1?baseData.thymineCount++:(baseChoice==2?baseData.cytosineCount++:baseData.guanineCount++));
newStrand->next = NULL;
strandIterator->next = newStrand;
strandIterator = newStrand;
}
}
genomeChange generateMutation(int swapWeight, int insertionWeight, int deletionWeight){
int mutationChoice = rand()%(swapWeight + insertionWeight + deletionWeight);
genomeChange mutationCommand;
mutationCommand.mutation = mutationChoice<swapWeight?'S':((mutationChoice>=swapWeight && mutationChoice<swapWeight+insertionWeight)?'I':'D');
mutationCommand.position = rand()%genomeLength;
return mutationCommand;
}
void printGenome(){
int rows, width = numDigits(genomeLength), len = 0,i,j;
lineLength = (genomeLength<lineLength)?genomeLength:lineLength;
rows = genomeLength/lineLength + (genomeLength%lineLength!=0);
genome* strandIterator = strand;
printf();
for(i=0;i<rows;i++){
printf(,width,len,);
for(j=0;j<lineLength && strandIterator!=NULL;j++){
printf(,strandIterator->base);
strandIterator = strandIterator->next;
}
len += lineLength;
}
while(strandIterator!=NULL){
printf(,strandIterator->base);
strandIterator = strandIterator->next;
}
printf();
printf(,width,'A',,width,baseData.adenineCount);
printf(,width,'T',,width,baseData.thymineCount);
printf(,width,'C',,width,baseData.cytosineCount);
printf(,width,'G',,width,baseData.guanineCount);
printf(,width,baseData.adenineCount + baseData.thymineCount + baseData.cytosineCount + baseData.guanineCount);
printf();
}
void mutateStrand(int numMutations, int swapWeight, int insertionWeight, int deletionWeight){
int i,j,width,baseChoice;
genomeChange newMutation;
genome *strandIterator, *strandFollower, *newStrand;
for(i=0;i<numMutations;i++){
strandIterator = strand;
strandFollower = strand;
newMutation = generateMutation(swapWeight,insertionWeight,deletionWeight);
width = numDigits(genomeLength);
for(j=0;j<newMutation.position;j++){
strandFollower = strandIterator;
strandIterator = strandIterator->next;
}
if(newMutation.mutation=='S'){
if(strandIterator->base=='A'){
strandIterator->base='T';
printf(,width,newMutation.position);
}
else if(strandIterator->base=='A'){
strandIterator->base='T';
printf(,width,newMutation.position);
}
else if(strandIterator->base=='C'){
strandIterator->base='G';
printf(,width,newMutation.position);
}
else{
strandIterator->base='C';
printf(,width,newMutation.position);
}
}
else if(newMutation.mutation=='I'){
baseChoice = rand()%4;
newStrand = (genome*)malloc(sizeof(genome));
newStrand->base = baseChoice==0?'A':(baseChoice==1?'T':(baseChoice==2?'C':'G'));
printf(,newStrand->base,width,newMutation.position);
baseChoice==0?baseData.adenineCount++:(baseChoice==1?baseData.thymineCount++:(baseChoice==2?baseData.cytosineCount++:baseData.guanineCount++));
newStrand->next = strandIterator;
strandFollower->next = newStrand;
genomeLength++;
}
else{
strandFollower->next = strandIterator->next;
strandIterator->next = NULL;
printf(,strandIterator->base,width,newMutation.position);
free(strandIterator);
genomeLength--;
}
}
}
int main(int argc,char* argv[])
{
int numMutations = 10, swapWeight = 10, insertWeight = 10, deleteWeight = 10;
if(argc==1||argc>6){
printf(,argv[0]);
return 0;
}
switch(argc){
case 2: genomeLength = atoi(argv[1]);
break;
case 3: genomeLength = atoi(argv[1]);
numMutations = atoi(argv[2]);
break;
case 4: genomeLength = atoi(argv[1]);
numMutations = atoi(argv[2]);
swapWeight = atoi(argv[3]);
break;
case 5: genomeLength = atoi(argv[1]);
numMutations = atoi(argv[2]);
swapWeight = atoi(argv[3]);
insertWeight = atoi(argv[4]);
break;
case 6: genomeLength = atoi(argv[1]);
numMutations = atoi(argv[2]);
swapWeight = atoi(argv[3]);
insertWeight = atoi(argv[4]);
deleteWeight = atoi(argv[5]);
break;
};
srand(time(NULL));
generateStrand();
printf();
printGenome();
mutateStrand(numMutations,swapWeight,insertWeight,deleteWeight);
printf();
printGenome();
return 0;
} | 1,099Bioinformatics/Sequence mutation
| 5c
| jbt70 |
function line {
x0=$1
y0=$2
x1=$3
y1=$4
if (( x0 > x1 ))
then
(( dx = x0 - x1 ))
(( sx = -1 ))
else
(( dx = x1 - x0 ))
(( sx = 1 ))
fi
if (( y0 > y1 ))
then
(( dy = y0 - y1 ))
(( sy = -1 ))
else
(( dy = y1 - y0 ))
(( sy = 1 ))
fi
if (( dx > dy ))
then
(( err = dx ))
else
(( err = -dy ))
fi
(( err /= 2 ))
(( e2 = 0 ))
while:
do
echo -en "\e[${y0};${x0}H
(( x0 == x1 && y0 == y1 )) && return
(( e2 = err ))
if (( e2 > -dx ))
then
(( err -= dy ))
(( x0 += sx ))
fi
if (( e2 < dy ))
then
(( err += dx ))
(( y0 += sy ))
fi
done
}
COLS=$( tput cols )
LINS=$( tput lines )
LINS=$((LINS-1))
clear
line $((COLS/2)) 1 $((COLS/4)) $((LINS/2))
line $((COLS/4)) $((LINS/2)) $((COLS/2)) $LINS
line $((COLS/2)) $LINS $((COLS/4*3)) $((LINS/2))
line $((COLS/4*3)) $((LINS/2)) $((COLS/2)) 1
echo -e "\e[${LINS}H" | 1,100Bitmap/Bresenham's line algorithm
| 4bash
| pe6bb |
package main
import (
"bytes"
"crypto/sha256"
"errors"
"os"
) | 1,097Bitcoin/address validation
| 0go
| q85xz |
require 'digest/sha2'
def convert g
i,e = '',[]
(0...g.length/2).each{|n| e[n] = g[n+=n]+g[n+1]; i+='H2'}
e.pack(i)
end
X = '50863AD64A87AE8A2FE83C1AF1A8403CB53F53E486D8511DAD8A04887E5B2352'
Y = '2CD470243453A299FA9E77237716103ABC11A1DF38855ED6F2EE187E9C582BA6'
n = '00'+Digest::RMD160.hexdigest(Digest::SHA256.digest(convert('04'+X+Y)))
n+= Digest::SHA256.hexdigest(Digest::SHA256.digest(convert(n)))[0,8]
G =
n,res = n.hex,''
while n > 0 do
n,ng = n.divmod(58)
res << G[ng]
end
puts res.reverse | 1,093Bitcoin/public point to address
| 14ruby
| ugtvz |
use ring::digest::{digest, SHA256};
use ripemd160::{Digest, Ripemd160};
use hex::FromHex;
static X: &str = "50863AD64A87AE8A2FE83C1AF1A8403CB53F53E486D8511DAD8A04887E5B2352";
static Y: &str = "2CD470243453A299FA9E77237716103ABC11A1DF38855ED6F2EE187E9C582BA6";
static ALPHABET: [char; 58] = [
'1', '2', '3', '4', '5', '6', '7', '8', '9', 'A', 'B', 'C', 'D', 'E', 'F', 'G', 'H', 'J', 'K',
'L', 'M', 'N', 'P', 'Q', 'R', 'S', 'T', 'U', 'V', 'W', 'X', 'Y', 'Z', 'a', 'b', 'c', 'd', 'e',
'f', 'g', 'h', 'i', 'j', 'k', 'm', 'n', 'o', 'p', 'q', 'r', 's', 't', 'u', 'v', 'w', 'x', 'y',
'z',
];
fn base58_encode(bytes: &mut [u8]) -> String {
let base = ALPHABET.len();
if bytes.is_empty() {
return String::from("");
}
let mut output: Vec<u8> = Vec::new();
let mut num: usize;
for _ in 0..33 {
num = 0;
for byte in bytes.iter_mut() {
num = num * 256 + *byte as usize;
*byte = (num / base) as u8;
num%= base;
}
output.push(num as u8);
}
let mut string = String::new();
for b in output.iter().rev() {
string.push(ALPHABET[*b as usize]);
}
string
} | 1,093Bitcoin/public point to address
| 15rust
| 5rzuq |
def circle(self, x0, y0, radius, colour=black):
f = 1 - radius
ddf_x = 1
ddf_y = -2 * radius
x = 0
y = radius
self.set(x0, y0 + radius, colour)
self.set(x0, y0 - radius, colour)
self.set(x0 + radius, y0, colour)
self.set(x0 - radius, y0, colour)
while x < y:
if f >= 0:
y -= 1
ddf_y += 2
f += ddf_y
x += 1
ddf_x += 2
f += ddf_x
self.set(x0 + x, y0 + y, colour)
self.set(x0 - x, y0 + y, colour)
self.set(x0 + x, y0 - y, colour)
self.set(x0 - x, y0 - y, colour)
self.set(x0 + y, y0 + x, colour)
self.set(x0 - y, y0 + x, colour)
self.set(x0 + y, y0 - x, colour)
self.set(x0 - y, y0 - x, colour)
Bitmap.circle = circle
bitmap = Bitmap(25,25)
bitmap.circle(x0=12, y0=12, radius=12)
bitmap.chardisplay()
'''
The origin, 0,0; is the lower left, with x increasing to the right,
and Y increasing upwards.
The program above produces the following display:
+-------------------------+
| @@@@@@@ |
| @@ @@ |
| @@ @@ |
| @ @ |
| @ @ |
| @ @ |
| @ @ |
| @ @ |
| @ @ |
|@ @|
|@ @|
|@ @|
|@ @|
|@ @|
|@ @|
|@ @|
| @ @ |
| @ @ |
| @ @ |
| @ @ |
| @ @ |
| @ @ |
| @@ @@ |
| @@ @@ |
| @@@@@@@ |
+-------------------------+
''' | 1,092Bitmap/Midpoint circle algorithm
| 3python
| odp81 |
package main
import (
"fmt"
"log"
"math"
"time"
)
const layout = "2006-01-02" | 1,098Biorhythms
| 0go
| rhfgm |
import Control.Monad (when)
import Data.List (elemIndex)
import Data.Monoid ((<>))
import qualified Data.ByteString as BS
import Data.ByteString (ByteString)
import Crypto.Hash.SHA256 (hash)
decode58 :: String -> Maybe Integer
decode58 = fmap combine . traverse parseDigit
where
combine = foldl (\acc digit -> 58 * acc + digit) 0
parseDigit char = toInteger <$> elemIndex char c58
c58 = "123456789ABCDEFGHJKLMNPQRSTUVWXYZabcdefghijkmnopqrstuvwxyz"
toBytes :: Integer -> ByteString
toBytes = BS.reverse . BS.pack . map (fromIntegral . (`mod` 256)) . takeWhile (> 0) . iterate (`div` 256)
checksumValid :: ByteString -> Bool
checksumValid address =
let (value, checksum) = BS.splitAt 21 $ leftPad address
in and $ BS.zipWith (==) checksum $ hash $ hash $ value
where
leftPad bs = BS.replicate (25 - BS.length bs) 0 <> bs
withError :: e -> Maybe a -> Either e a
withError e = maybe (Left e) Right
validityCheck :: String -> Either String ()
validityCheck encoded = do
num <- withError "Invalid base 58 encoding" $ decode58 encoded
let address = toBytes num
when (BS.length address > 25) $ Left "Address length exceeds 25 bytes"
when (BS.length address < 4) $ Left "Address length less than 4 bytes"
when (not $ checksumValid address) $ Left "Invalid checksum"
validate :: String -> IO ()
validate encodedAddress = do
let result = either show (const "Valid") $ validityCheck encodedAddress
putStrLn $ show encodedAddress ++ " -> " ++ result
main :: IO ()
main = do
validate "1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62i"
validate "1Q1pE5vPGEEMqRcVRMbtBK842Y6Pzo6nK9"
validate "1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62X"
validate "1ANNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62i"
validate "1A Na15ZQXAZUgFiqJ2i7Z2DPU2J6hW62i"
validate "1ANa55215ZQXAZUgFiqJ2i7Z2DPU2J6hW62i"
validate "i55j" | 1,097Bitcoin/address validation
| 8haskell
| mlxyf |
package raster
func (b *Bitmap) Flood(x, y int, repl Pixel) {
targ, _ := b.GetPx(x, y)
var ff func(x, y int)
ff = func(x, y int) {
p, ok := b.GetPx(x, y)
if ok && p.R == targ.R && p.G == targ.G && p.B == targ.B {
b.SetPx(x, y, repl)
ff(x-1, y)
ff(x+1, y)
ff(x, y-1)
ff(x, y+1)
}
}
ff(x, y)
} | 1,094Bitmap/Flood fill
| 0go
| so7qa |
package main
import (
"fmt"
"math/rand"
"sort"
"time"
)
const bases = "ACGT" | 1,099Bioinformatics/Sequence mutation
| 0go
| f3hd0 |
import java.math.BigInteger;
import java.security.MessageDigest;
import java.security.NoSuchAlgorithmException;
import java.util.Arrays;
public class BitcoinAddressValidator {
private static final String ALPHABET = "123456789ABCDEFGHJKLMNPQRSTUVWXYZabcdefghijkmnopqrstuvwxyz";
public static boolean validateBitcoinAddress(String addr) {
if (addr.length() < 26 || addr.length() > 35)
return false;
byte[] decoded = decodeBase58To25Bytes(addr);
if (decoded == null)
return false;
byte[] hash1 = sha256(Arrays.copyOfRange(decoded, 0, 21));
byte[] hash2 = sha256(hash1);
return Arrays.equals(Arrays.copyOfRange(hash2, 0, 4), Arrays.copyOfRange(decoded, 21, 25));
}
private static byte[] decodeBase58To25Bytes(String input) {
BigInteger num = BigInteger.ZERO;
for (char t : input.toCharArray()) {
int p = ALPHABET.indexOf(t);
if (p == -1)
return null;
num = num.multiply(BigInteger.valueOf(58)).add(BigInteger.valueOf(p));
}
byte[] result = new byte[25];
byte[] numBytes = num.toByteArray();
System.arraycopy(numBytes, 0, result, result.length - numBytes.length, numBytes.length);
return result;
}
private static byte[] sha256(byte[] data) {
try {
MessageDigest md = MessageDigest.getInstance("SHA-256");
md.update(data);
return md.digest();
} catch (NoSuchAlgorithmException e) {
throw new IllegalStateException(e);
}
}
public static void main(String[] args) {
assertBitcoin("1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62i", true);
assertBitcoin("1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62j", false);
assertBitcoin("1Q1pE5vPGEEMqRcVRMbtBK842Y6Pzo6nK9", true);
assertBitcoin("1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62X", false);
assertBitcoin("1ANNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62i", false);
assertBitcoin("1A Na15ZQXAZUgFiqJ2i7Z2DPU2J6hW62i", false);
assertBitcoin("BZbvjr", false);
assertBitcoin("i55j", false);
assertBitcoin("1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62!", false);
assertBitcoin("1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62iz", false);
assertBitcoin("1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62izz", false);
assertBitcoin("1Q1pE5vPGEEMqRcVRMbtBK842Y6Pzo6nJ9", false);
assertBitcoin("1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62I", false);
}
private static void assertBitcoin(String address, boolean expected) {
boolean actual = validateBitcoinAddress(address);
if (actual != expected)
throw new AssertionError(String.format("Expected%s for%s, but got%s.", expected, address, actual));
}
} | 1,097Bitcoin/address validation
| 9java
| f3bdv |
import Data.Array.ST
import Data.STRef
import Control.Monad
import Control.Monad.ST
import Bitmap
pushST :: STStack s a -> a -> ST s ()
pushST s e = do
s2 <- readSTRef s
writeSTRef s (e: s2)
popST :: STStack s a -> ST s (Stack a)
popST s = do
s2 <- readSTRef s
writeSTRef s $ tail s2
return $ take 1 s2
isNotEmptySTStack :: STStack s a -> ST s Bool
isNotEmptySTStack s = do
s2 <- readSTRef s
return $ not $ null s2
emptySTStack :: ST s (STStack s a)
emptySTStack = newSTRef []
consumeSTStack :: STStack s a -> (a -> ST s ()) -> ST s ()
consumeSTStack s f = do
check <- isNotEmptySTStack s
when check $ do
e <- popST s
f $ head e
consumeSTStack s f
type Spanning s = STRef s (Bool, Bool)
setSpanLeft :: Spanning s -> Bool -> ST s ()
setSpanLeft s v = do
(_, r) <- readSTRef s
writeSTRef s (v, r)
setSpanRight :: Spanning s -> Bool -> ST s ()
setSpanRight s v = do
(l, _) <- readSTRef s
writeSTRef s (l, v)
setSpanNone :: Spanning s -> ST s ()
setSpanNone s = writeSTRef s (False, False)
floodFillScanlineStack :: Color c => Image s c -> Pixel -> c -> ST s (Image s c)
floodFillScanlineStack b coords newC = do
stack <- emptySTStack
spans <- newSTRef (False, False)
fFSS b stack coords newC spans
return b
where
fFSS b st c newC p = do
oldC <- getPix b c
unless (oldC == newC) $ do
pushST st c
(w, h) <- dimensions b
consumeSTStack st (scanWhileY b p oldC >=>
scanWhileX b st p oldC newC (w, h))
scanWhileY b p oldC coords@(Pixel (x, y)) =
if y >= 0
then do
z <- getPix b coords
if z == oldC
then scanWhileY b p oldC (Pixel (x, y - 1))
else do
setSpanNone p
return (Pixel (x, y + 1))
else do
setSpanNone p
return (Pixel (x, y + 1))
scanWhileX b st p oldC newC (w, h) coords@(Pixel (x, y)) =
when (y < h) $ do
z <- getPix b coords
when (z == oldC) $ do
setPix b coords newC
(spanLeft, spanRight) <- readSTRef p
when (not spanLeft && x > 0) $ do
z2 <- getPix b (Pixel (x - 1, y))
when (z2 == oldC) $ do
pushST st (Pixel (x - 1, y))
setSpanLeft p True
when (spanLeft && x > 0) $ do
z3 <- getPix b (Pixel (x - 1, y))
when (z3 /= oldC) $
setSpanLeft p False
when (not spanRight && x < (w - 1)) $ do
z4 <- getPix b (Pixel (x + 1, y))
when (z4 == oldC) $ do
pushST st (Pixel (x + 1, y))
setSpanRight p True
when (spanRight && x < (w - 1)) $ do
z5 <- getPix b (Pixel (x + 1, y))
when (z5 /= oldC) $
setSpanRight p False
scanWhileX b st p oldC newC (w, h) (Pixel (x, y + 1)) | 1,094Bitmap/Flood fill
| 8haskell
| 928mo |
package main
import (
"fmt"
"reflect"
"strconv"
)
func main() {
var n bool = true
fmt.Println(n) | 1,090Boolean values
| 0go
| 7klr2 |
<?
$image = imagecreate(200, 200);
imagecolorallocate($image, 255, 255, 255);
$color = imagecolorallocate($image, 255, 0, 0);
cubicbezier($image, $color, 160, 10, 10, 40, 30, 160, 150, 110);
imagepng($image);
function cubicbezier($img, $col, $x0, $y0, $x1, $y1, $x2, $y2, $x3, $y3, $n = 20) {
$pts = array();
for($i = 0; $i <= $n; $i++) {
$t = $i / $n;
$t1 = 1 - $t;
$a = pow($t1, 3);
$b = 3 * $t * pow($t1, 2);
$c = 3 * pow($t, 2) * $t1;
$d = pow($t, 3);
$x = round($a * $x0 + $b * $x1 + $c * $x2 + $d * $x3);
$y = round($a * $y0 + $b * $y1 + $c * $y2 + $d * $y3);
$pts[$i] = array($x, $y);
}
for($i = 0; $i < $n; $i++) {
imageline($img, $pts[$i][0], $pts[$i][1], $pts[$i+1][0], $pts[$i+1][1], $col);
}
} | 1,095Bitmap/Bézier curves/Cubic
| 12php
| dzpn8 |
import Data.List (group, sort)
import Data.List.Split (chunksOf)
import System.Random (Random, randomR, random, newStdGen, randoms, getStdRandom)
import Text.Printf (PrintfArg(..), fmtChar, fmtPrecision, formatString, IsChar(..), printf)
data Mutation = Swap | Delete | Insert deriving (Show, Eq, Ord, Enum, Bounded)
data DNABase = A | C | G | T deriving (Show, Read, Eq, Ord, Enum, Bounded)
type DNASequence = [DNABase]
data Result = Swapped Mutation Int (DNABase, DNABase)
| InsertDeleted Mutation Int DNABase
instance Random DNABase where
randomR (a, b) g = case randomR (fromEnum a, fromEnum b) g of (x, y) -> (toEnum x, y)
random = randomR (minBound, maxBound)
instance Random Mutation where
randomR (a, b) g = case randomR (fromEnum a, fromEnum b) g of (x, y) -> (toEnum x, y)
random = randomR (minBound, maxBound)
instance PrintfArg DNABase where
formatArg x fmt = formatString (show x) (fmt { fmtChar = 's', fmtPrecision = Nothing })
instance PrintfArg Mutation where
formatArg x fmt = formatString (show x) (fmt { fmtChar = 's', fmtPrecision = Nothing })
instance IsChar DNABase where
toChar = head . show
fromChar = read . pure
chunkedDNASequence :: DNASequence -> [(Int, [DNABase])]
chunkedDNASequence = zip [50,100..] . chunksOf 50
baseCounts :: DNASequence -> [(DNABase, Int)]
baseCounts = fmap ((,) . head <*> length) . group . sort
newSequence :: Int -> IO DNASequence
newSequence n = take n . randoms <$> newStdGen
mutateSequence :: DNASequence -> IO (Result, DNASequence)
mutateSequence [] = fail "empty dna sequence"
mutateSequence ds = randomMutation >>= mutate ds
where
randomMutation = head . randoms <$> newStdGen
mutate xs m = do
i <- randomIndex (length xs)
case m of
Swap -> randomDNA >>= \d -> pure (Swapped Swap i (xs !! pred i, d), swapElement i d xs)
Insert -> randomDNA >>= \d -> pure (InsertDeleted Insert i d, insertElement i d xs)
Delete -> pure (InsertDeleted Delete i (xs !! pred i), dropElement i xs)
where
dropElement i xs = take (pred i) xs <> drop i xs
insertElement i e xs = take i xs <> [e] <> drop i xs
swapElement i a xs = take (pred i) xs <> [a] <> drop i xs
randomIndex n = getStdRandom (randomR (1, n))
randomDNA = head . randoms <$> newStdGen
mutate :: Int -> DNASequence -> IO DNASequence
mutate 0 s = pure s
mutate n s = do
(r, ms) <- mutateSequence s
case r of
Swapped m i (a, b) -> printf "%6s @%-3d:%s ->%s \n" m i a b
InsertDeleted m i a -> printf "%6s @%-3d:%s\n" m i a
mutate (pred n) ms
main :: IO ()
main = do
ds <- newSequence 200
putStrLn "\nInitial Sequence:" >> showSequence ds
putStrLn "\nBase Counts:" >> showBaseCounts ds
showSumBaseCounts ds
ms <- mutate 10 ds
putStrLn "\nMutated Sequence:" >> showSequence ms
putStrLn "\nBase Counts:" >> showBaseCounts ms
showSumBaseCounts ms
where
showSequence = mapM_ (uncurry (printf "%3d:%s\n")) . chunkedDNASequence
showBaseCounts = mapM_ (uncurry (printf "%s:%3d\n")) . baseCounts
showSumBaseCounts xs = putStrLn (replicate 6 '-') >> printf ":%d\n\n" (length xs) | 1,099Bioinformatics/Sequence mutation
| 8haskell
| 47i5s |
import java.security.MessageDigest
object Bitcoin {
private const val ALPHABET = "123456789ABCDEFGHJKLMNPQRSTUVWXYZabcdefghijkmnopqrstuvwxyz"
private fun ByteArray.contentEquals(other: ByteArray): Boolean {
if (this.size != other.size) return false
return (0 until this.size).none { this[it] != other[it] }
}
private fun decodeBase58(input: String): ByteArray? {
val output = ByteArray(25)
for (c in input) {
var p = ALPHABET.indexOf(c)
if (p == -1) return null
for (j in 24 downTo 1) {
p += 58 * (output[j].toInt() and 0xff)
output[j] = (p % 256).toByte()
p = p shr 8
}
if (p != 0) return null
}
return output
}
private fun sha256(data: ByteArray, start: Int, len: Int, recursion: Int): ByteArray {
if (recursion == 0) return data
val md = MessageDigest.getInstance("SHA-256")
md.update(data.sliceArray(start until start + len))
return sha256(md.digest(), 0, 32, recursion - 1)
}
fun validateAddress(address: String): Boolean {
if (address.length !in 26..35) return false
val decoded = decodeBase58(address)
if (decoded == null) return false
val hash = sha256(decoded, 0, 21, 2)
return hash.sliceArray(0..3).contentEquals(decoded.sliceArray(21..24))
}
}
fun main(args: Array<String>) {
val addresses = arrayOf(
"1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62i",
"1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62j",
"1Q1pE5vPGEEMqRcVRMbtBK842Y6Pzo6nK9",
"1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62X",
"1ANNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62i",
"1A Na15ZQXAZUgFiqJ2i7Z2DPU2J6hW62i",
"BZbvjr",
"i55j",
"1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62!",
"1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62iz",
"1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62izz",
"1Q1pE5vPGEEMqRcVRMbtBK842Y6Pzo6nJ9",
"1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62I"
)
for (address in addresses)
println("${address.padEnd(36)} -> ${if (Bitcoin.validateAddress(address)) "valid" else "invalid"}")
} | 1,097Bitcoin/address validation
| 11kotlin
| 8nr0q |
data Bool = False | True deriving (Eq, Ord, Enum, Read, Show, Bounded) | 1,090Boolean values
| 7groovy
| ug6v9 |
data Bool = False | True deriving (Eq, Ord, Enum, Read, Show, Bounded) | 1,090Boolean values
| 8haskell
| 8n10z |
cycles = {"Physical day ", "Emotional day", "Mental day "}
lengths = {23, 28, 33}
quadrants = {
{"up and rising", "peak"},
{"up but falling", "transition"},
{"down and falling", "valley"},
{"down but rising", "transition"},
}
function parse_date_string (birthDate)
local year, month, day = birthDate:match("(%d+)-(%d+)-(%d+)")
return {year=tonumber(year), month=tonumber(month), day=tonumber(day)}
end
function days_diffeternce (d1, d2)
if d1.year >= 1970 and d2.year >= 1970 then
return math.floor(os.difftime(os.time(d2), os.time(d1))/(60*60*24))
else
local t1 = math.max (1970-d1.year, 1970-d2.year)
t1 = math.ceil(t1/4)*4
d1.year = d1.year + t1
d2.year = d2.year + t1
return math.floor(os.difftime(os.time(d2), os.time(d1))/(60*60*24))
end
end
function biorhythms (birthDate, targetDate)
local bd = parse_date_string(birthDate)
local td = parse_date_string(targetDate)
local days = days_diffeternce (bd, td)
print('Born: '.. birthDate .. ', Target: ' .. targetDate)
print("Day: ", days)
for i=1, #lengths do
local len = lengths[i]
local posn = days%len
local quadrant = math.floor(posn/len*4)+1
local percent = math.floor(math.sin(2*math.pi*posn/len)*1000)/10
local cycle = cycles[i]
local desc = percent > 95 and "peak" or
percent < -95 and "valley" or
math.abs(percent) < 5 and "critical transition" or "other"
if desc == "other" then
local t = math.floor(quadrant/4*len)-posn
local qtrend, qnext = quadrants[quadrant][1], quadrants[quadrant][2]
desc = percent .. '% (' .. qtrend .. ', next transition in ' .. t ..' days)'
end
print(cycle, posn..'/'..len, ': '.. desc)
end
print(' ')
end
datePairs = {
{"1943-03-09", "1972-07-11"},
{"1809-01-12", "1863-11-19"},
{"1809-02-12", "1863-11-19"},
{"2021-02-25", "2022-04-18"},
}
for i=1, #datePairs do
biorhythms(datePairs[i][1], datePairs[i][2])
end | 1,098Biorhythms
| 1lua
| k16h2 |
typedef struct genome{
char* strand;
int length;
struct genome* next;
}genome;
genome* genomeData;
int totalLength = 0, Adenine = 0, Cytosine = 0, Guanine = 0, Thymine = 0;
int numDigits(int num){
int len = 1;
while(num>10){
num = num/10;
len++;
}
return len;
}
void buildGenome(char str[100]){
int len = strlen(str),i;
genome *genomeIterator, *newGenome;
totalLength += len;
for(i=0;i<len;i++){
switch(str[i]){
case 'A': Adenine++;
break;
case 'T': Thymine++;
break;
case 'C': Cytosine++;
break;
case 'G': Guanine++;
break;
};
}
if(genomeData==NULL){
genomeData = (genome*)malloc(sizeof(genome));
genomeData->strand = (char*)malloc(len*sizeof(char));
strcpy(genomeData->strand,str);
genomeData->length = len;
genomeData->next = NULL;
}
else{
genomeIterator = genomeData;
while(genomeIterator->next!=NULL)
genomeIterator = genomeIterator->next;
newGenome = (genome*)malloc(sizeof(genome));
newGenome->strand = (char*)malloc(len*sizeof(char));
strcpy(newGenome->strand,str);
newGenome->length = len;
newGenome->next = NULL;
genomeIterator->next = newGenome;
}
}
void printGenome(){
genome* genomeIterator = genomeData;
int width = numDigits(totalLength), len = 0;
printf();
while(genomeIterator!=NULL){
printf(,width+1,len,,genomeIterator->strand);
len += genomeIterator->length;
genomeIterator = genomeIterator->next;
}
printf();
printf(,'A',,width+1,Adenine);
printf(,'T',,width+1,Thymine);
printf(,'C',,width+1,Cytosine);
printf(,'G',,width+1,Guanine);
printf(,,width+1,Adenine + Thymine + Cytosine + Guanine);
free(genomeData);
}
int main(int argc,char** argv)
{
char str[100];
int counter = 0, len;
if(argc!=2){
printf(,argv[0]);
return 0;
}
FILE *fp = fopen(argv[1],);
while(fscanf(fp,,str)!=EOF)
buildGenome(str);
fclose(fp);
printGenome();
return 0;
} | 1,101Bioinformatics/base count
| 5c
| if4o2 |
void line(int x0, int y0, int x1, int y1) {
int dx = abs(x1-x0), sx = x0<x1 ? 1 : -1;
int dy = abs(y1-y0), sy = y0<y1 ? 1 : -1;
int err = (dx>dy ? dx : -dy)/2, e2;
for(;;){
setPixel(x0,y0);
if (x0==x1 && y0==y1) break;
e2 = err;
if (e2 >-dx) { err -= dy; x0 += sx; }
if (e2 < dy) { err += dx; y0 += sy; }
}
} | 1,100Bitmap/Bresenham's line algorithm
| 5c
| axm11 |
import java.awt.Color;
import java.awt.Point;
import java.awt.image.BufferedImage;
import java.util.Deque;
import java.util.LinkedList;
public class FloodFill {
public void floodFill(BufferedImage image, Point node, Color targetColor, Color replacementColor) {
int width = image.getWidth();
int height = image.getHeight();
int target = targetColor.getRGB();
int replacement = replacementColor.getRGB();
if (target != replacement) {
Deque<Point> queue = new LinkedList<Point>();
do {
int x = node.x;
int y = node.y;
while (x > 0 && image.getRGB(x - 1, y) == target) {
x--;
}
boolean spanUp = false;
boolean spanDown = false;
while (x < width && image.getRGB(x, y) == target) {
image.setRGB(x, y, replacement);
if (!spanUp && y > 0 && image.getRGB(x, y - 1) == target) {
queue.add(new Point(x, y - 1));
spanUp = true;
} else if (spanUp && y > 0 && image.getRGB(x, y - 1) != target) {
spanUp = false;
}
if (!spanDown && y < height - 1 && image.getRGB(x, y + 1) == target) {
queue.add(new Point(x, y + 1));
spanDown = true;
} else if (spanDown && y < height - 1 && image.getRGB(x, y + 1) != target) {
spanDown = false;
}
x++;
}
} while ((node = queue.pollFirst()) != null);
}
}
} | 1,094Bitmap/Flood fill
| 9java
| t6ef9 |
Pixel = Struct.new(:x, :y)
class Pixmap
def draw_circle(pixel, radius, colour)
validate_pixel(pixel.x, pixel.y)
self[pixel.x, pixel.y + radius] = colour
self[pixel.x, pixel.y - radius] = colour
self[pixel.x + radius, pixel.y] = colour
self[pixel.x - radius, pixel.y] = colour
f = 1 - radius
ddF_x = 1
ddF_y = -2 * radius
x = 0
y = radius
while x < y
if f >= 0
y -= 1
ddF_y += 2
f += ddF_y
end
x += 1
ddF_x += 2
f += ddF_x
self[pixel.x + x, pixel.y + y] = colour
self[pixel.x + x, pixel.y - y] = colour
self[pixel.x - x, pixel.y + y] = colour
self[pixel.x - x, pixel.y - y] = colour
self[pixel.x + y, pixel.y + x] = colour
self[pixel.x + y, pixel.y - x] = colour
self[pixel.x - y, pixel.y + x] = colour
self[pixel.x - y, pixel.y - x] = colour
end
end
end
bitmap = Pixmap.new(30, 30)
bitmap.draw_circle(Pixel[14,14], 12, RGBColour::BLACK) | 1,092Bitmap/Midpoint circle algorithm
| 14ruby
| ntait |
def cubicbezier(self, x0, y0, x1, y1, x2, y2, x3, y3, n=20):
pts = []
for i in range(n+1):
t = i / n
a = (1. - t)**3
b = 3. * t * (1. - t)**2
c = 3.0 * t**2 * (1.0 - t)
d = t**3
x = int(a * x0 + b * x1 + c * x2 + d * x3)
y = int(a * y0 + b * y1 + c * y2 + d * y3)
pts.append( (x, y) )
for i in range(n):
self.line(pts[i][0], pts[i][1], pts[i+1][0], pts[i+1][1])
Bitmap.cubicbezier = cubicbezier
bitmap = Bitmap(17,17)
bitmap.cubicbezier(16,1, 1,4, 3,16, 15,11)
bitmap.chardisplay()
'''
The origin, 0,0; is the lower left, with x increasing to the right,
and Y increasing upwards.
The chardisplay above produces the following output:
+-----------------+
| |
| |
| |
| |
| @@@@ |
| @@@ @@@ |
| @ |
| @ |
| @ |
| @ |
| @ |
| @ |
| @ |
| @ |
| @@@@ |
| @@@@|
| |
+-----------------+
''' | 1,095Bitmap/Bézier curves/Cubic
| 3python
| 7k6rm |
bezierCurve <- function(x, y, n=10)
{
outx <- NULL
outy <- NULL
i <- 1
for (t in seq(0, 1, length.out=n))
{
b <- bez(x, y, t)
outx[i] <- b$x
outy[i] <- b$y
i <- i+1
}
return (list(x=outx, y=outy))
}
bez <- function(x, y, t)
{
outx <- 0
outy <- 0
n <- length(x)-1
for (i in 0:n)
{
outx <- outx + choose(n, i)*((1-t)^(n-i))*t^i*x[i+1]
outy <- outy + choose(n, i)*((1-t)^(n-i))*t^i*y[i+1]
}
return (list(x=outx, y=outy))
}
x <- c(4,6,4,5,6,7)
y <- 1:6
plot(x, y, "o", pch=20)
points(bezierCurve(x,y,20), type="l", col="red") | 1,095Bitmap/Bézier curves/Cubic
| 13r
| 5rfuy |
use strict;
use warnings;
use DateTime;
use constant PI => 2 * atan2(1, 0);
my %cycles = ( 'Physical' => 23, 'Emotional' => 28, 'Mental' => 33 );
my @Q = ( ['up and rising', 'peak'],
['up but falling', 'transition'],
['down and falling', 'valley'],
['down but rising', 'transition']
);
my $target = DateTime->new(year=>1863, month=>11, day=>19);
my $bday = DateTime->new(year=>1809, month=> 2, day=>12);
my $days = $bday->delta_days( $target )->in_units('days');
print "Day $days:\n";
for my $label (sort keys %cycles) {
my($length) = $cycles{$label};
my $position = $days % $length;
my $quadrant = int $position / $length * 4;
my $percentage = int(sin($position / $length * 2 * PI )*1000)/10;
my $description;
if ( $percentage > 95) { $description = 'peak' }
elsif ( $percentage < -95) { $description = 'valley' }
elsif (abs($percentage) < 5) { $description = 'critical transition' }
else {
my $transition = $target->clone->add( days => (int(($quadrant + 1)/4 * $length) - $position))->ymd;
my ($trend, $next) = @{$Q[$quadrant]};
$description = sprintf "%5.1f%% ($trend, next $next $transition)", $percentage;
}
printf "%-13s%2d:%s", "$label day\n", $position, $description;
} | 1,098Biorhythms
| 2perl
| zyptb |
import java.util.Arrays;
import java.util.Random;
public class SequenceMutation {
public static void main(String[] args) {
SequenceMutation sm = new SequenceMutation();
sm.setWeight(OP_CHANGE, 3);
String sequence = sm.generateSequence(250);
System.out.println("Initial sequence:");
printSequence(sequence);
int count = 10;
for (int i = 0; i < count; ++i)
sequence = sm.mutateSequence(sequence);
System.out.println("After " + count + " mutations:");
printSequence(sequence);
}
public SequenceMutation() {
totalWeight_ = OP_COUNT;
Arrays.fill(operationWeight_, 1);
}
public String generateSequence(int length) {
char[] ch = new char[length];
for (int i = 0; i < length; ++i)
ch[i] = getRandomBase();
return new String(ch);
}
public void setWeight(int operation, int weight) {
totalWeight_ -= operationWeight_[operation];
operationWeight_[operation] = weight;
totalWeight_ += weight;
}
public String mutateSequence(String sequence) {
char[] ch = sequence.toCharArray();
int pos = random_.nextInt(ch.length);
int operation = getRandomOperation();
if (operation == OP_CHANGE) {
char b = getRandomBase();
System.out.println("Change base at position " + pos + " from "
+ ch[pos] + " to " + b);
ch[pos] = b;
} else if (operation == OP_ERASE) {
System.out.println("Erase base " + ch[pos] + " at position " + pos);
char[] newCh = new char[ch.length - 1];
System.arraycopy(ch, 0, newCh, 0, pos);
System.arraycopy(ch, pos + 1, newCh, pos, ch.length - pos - 1);
ch = newCh;
} else if (operation == OP_INSERT) {
char b = getRandomBase();
System.out.println("Insert base " + b + " at position " + pos);
char[] newCh = new char[ch.length + 1];
System.arraycopy(ch, 0, newCh, 0, pos);
System.arraycopy(ch, pos, newCh, pos + 1, ch.length - pos);
newCh[pos] = b;
ch = newCh;
}
return new String(ch);
}
public static void printSequence(String sequence) {
int[] count = new int[BASES.length];
for (int i = 0, n = sequence.length(); i < n; ++i) {
if (i % 50 == 0) {
if (i != 0)
System.out.println();
System.out.printf("%3d: ", i);
}
char ch = sequence.charAt(i);
System.out.print(ch);
for (int j = 0; j < BASES.length; ++j) {
if (BASES[j] == ch) {
++count[j];
break;
}
}
}
System.out.println();
System.out.println("Base counts:");
int total = 0;
for (int j = 0; j < BASES.length; ++j) {
total += count[j];
System.out.print(BASES[j] + ": " + count[j] + ", ");
}
System.out.println("Total: " + total);
}
private char getRandomBase() {
return BASES[random_.nextInt(BASES.length)];
}
private int getRandomOperation() {
int n = random_.nextInt(totalWeight_), op = 0;
for (int weight = 0; op < OP_COUNT; ++op) {
weight += operationWeight_[op];
if (n < weight)
break;
}
return op;
}
private final Random random_ = new Random();
private int[] operationWeight_ = new int[OP_COUNT];
private int totalWeight_ = 0;
private static final int OP_CHANGE = 0;
private static final int OP_ERASE = 1;
private static final int OP_INSERT = 2;
private static final int OP_COUNT = 3;
private static final char[] BASES = {'A', 'C', 'G', 'T'};
} | 1,099Bioinformatics/Sequence mutation
| 9java
| cvx9h |
null | 1,094Bitmap/Flood fill
| 11kotlin
| odk8z |
object BitmapOps {
def midpoint(bm:RgbBitmap, x0:Int, y0:Int, radius:Int, c:Color)={
var f=1-radius
var ddF_x=1
var ddF_y= -2*radius
var x=0
var y=radius
bm.setPixel(x0, y0+radius, c)
bm.setPixel(x0, y0-radius, c)
bm.setPixel(x0+radius, y0, c)
bm.setPixel(x0-radius, y0, c)
while(x < y)
{
if(f >= 0)
{
y-=1
ddF_y+=2
f+=ddF_y
}
x+=1
ddF_x+=2
f+=ddF_x
bm.setPixel(x0+x, y0+y, c)
bm.setPixel(x0-x, y0+y, c)
bm.setPixel(x0+x, y0-y, c)
bm.setPixel(x0-x, y0-y, c)
bm.setPixel(x0+y, y0+x, c)
bm.setPixel(x0-y, y0+x, c)
bm.setPixel(x0+y, y0-x, c)
bm.setPixel(x0-y, y0-x, c)
}
}
} | 1,092Bitmap/Midpoint circle algorithm
| 16scala
| zyqtr |
null | 1,099Bioinformatics/Sequence mutation
| 10javascript
| 5rour |
my @b58 = qw{
1 2 3 4 5 6 7 8 9
A B C D E F G H J K L M N P Q R S T U V W X Y Z
a b c d e f g h i j k m n o p q r s t u v w x y z
};
my %b58 = map { $b58[$_] => $_ } 0 .. 57;
sub unbase58 {
use integer;
my @out;
my $azeroes = length($1) if $_[0] =~ /^(1*)/;
for my $c ( map { $b58{$_} } $_[0] =~ /./g ) {
for (my $j = 25; $j--; ) {
$c += 58 * ($out[$j] // 0);
$out[$j] = $c % 256;
$c /= 256;
}
}
my $bzeroes = length($1) if join('', @out) =~ /^(0*)/;
die "not a 25 byte address\n" if $bzeroes != $azeroes;
return @out;
}
sub check_bitcoin_address {
use Digest::SHA qw(sha256);
my @byte = unbase58 shift;
die "wrong checksum\n" unless
(pack 'C*', @byte[21..24]) eq
substr sha256(sha256 pack 'C*', @byte[0..20]), 0, 4;
} | 1,097Bitcoin/address validation
| 2perl
| 47d5d |
package main
import "fmt" | 1,096Box the compass
| 0go
| ifhog |
class Pixmap
def draw_bezier_curve(points, colour)
points = points.sort_by {|p| [p.x, p.y]}
xmin = points[0].x
xmax = points[-1].x
increment = 2
prev = points[0]
((xmin + increment) .. xmax).step(increment) do |x|
t = 1.0 * (x - xmin) / (xmax - xmin)
p = Pixel[x, bezier(t, points).round]
draw_line(prev, p, colour)
prev = p
end
end
end
def bezier(t, points)
n = points.length - 1
points.each_with_index.inject(0.0) do |sum, (point, i)|
sum += n.choose(i) * (1-t)**(n - i) * t**i * point.y
end
end
class Fixnum
def choose(k)
self.factorial / (k.factorial * (self - k).factorial)
end
def factorial
(2 .. self).reduce(1,:*)
end
end
bitmap = Pixmap.new(400, 400)
points = [
Pixel[40,100], Pixel[100,350], Pixel[150,50],
Pixel[150,150], Pixel[350,250], Pixel[250,250]
]
points.each {|p| bitmap.draw_circle(p, 3, RGBColour::RED)}
bitmap.draw_bezier_curve(points, RGBColour::BLUE) | 1,095Bitmap/Bézier curves/Cubic
| 14ruby
| hpmjx |
from datetime import date, timedelta
from math import floor, sin, pi
def biorhythms(birthdate,targetdate):
print(+birthdate++targetdate)
birthdate = date.fromisoformat(birthdate)
targetdate = date.fromisoformat(targetdate)
days = (targetdate - birthdate).days
print(+str(days))
cycle_labels = [, , ]
cycle_lengths = [23, 28, 33]
quadrants = [(, ), (, ),
(, ), (, )]
for i in range(3):
label = cycle_labels[i]
length = cycle_lengths[i]
position = days% length
quadrant = int(floor((4 * position) / length))
percentage = int(round(100 * sin(2 * pi * position / length),0))
transition_date = targetdate + timedelta(days=floor((quadrant + 1)/4 * length) - position)
trend, next = quadrants[quadrant]
if percentage > 95:
description =
elif percentage < -95:
description =
elif abs(percentage) < 5:
description =
else:
description = str(percentage)++trend++next++str(transition_date)+
print(label++str(position)++description)
biorhythms(,) | 1,098Biorhythms
| 3python
| 3m1zc |
(defn draw-line
"Draw a line from x1,y1 to x2,y2 using Bresenham's, to a java BufferedImage in the colour of pixel."
[buffer x1 y1 x2 y2 pixel]
(let [dist-x (Math/abs (- x1 x2))
dist-y (Math/abs (- y1 y2))
steep (> dist-y dist-x)]
(let [[x1 y1 x2 y2] (if steep [y1 x1 y2 x2] [x1 y1 x2 y2])]
(let [[x1 y1 x2 y2] (if (> x1 x2) [x2 y2 x1 y1] [x1 y1 x2 y2])]
(let [delta-x (- x2 x1)
delta-y (Math/abs (- y1 y2))
y-step (if (< y1 y2) 1 -1)]
(let [plot (if steep
#(.setRGB buffer (int %1) (int %2) pixel)
#(.setRGB buffer (int %2) (int %1) pixel))]
(loop [x x1 y y1 error (Math/floor (/ delta-x 2)) ]
(plot x y)
(if (< x x2)
(if (< error delta-y)
(recur (inc x) (+ y y-step) (+ error (- delta-x delta-y)))
(recur (inc x) y (- error delta-y))))))))))) | 1,100Bitmap/Bresenham's line algorithm
| 6clojure
| sovqr |
math.randomseed(os.time())
bases = {"A","C","T","G"}
function randbase() return bases[math.random(#bases)] end
function mutate(seq)
local i,h = math.random(#seq), "%-6s%3s at%3d"
local old,new = seq:sub(i,i), randbase()
local ops = {
function(s) h=h:format("Swap", old..">"..new, i) return s:sub(1,i-1)..new..s:sub(i+1) end,
function(s) h=h:format("Delete", " -"..old, i) return s:sub(1,i-1)..s:sub(i+1) end,
function(s) h=h:format("Insert", " +"..new, i) return s:sub(1,i-1)..new..s:sub(i) end,
}
local weighted = { 1,1,2,3 }
local n = weighted[math.random(#weighted)]
return ops[n](seq), h
end
local seq,hist="",{} for i = 1, 200 do seq=seq..randbase() end
print("ORIGINAL:")
prettyprint(seq)
print()
for i = 1, 10 do seq,h=mutate(seq) hist[#hist+1]=h end
print("MUTATIONS:")
for i,h in ipairs(hist) do print(" "..h) end
print()
print("MUTATED:")
prettyprint(seq) | 1,099Bioinformatics/Sequence mutation
| 1lua
| 69139 |
$ magick unfilledcirc.png -depth 8 unfilledcirc.ppm | 1,094Bitmap/Flood fill
| 1lua
| ifbot |
$ jq type
true
"boolean"
false
"boolean" | 1,090Boolean values
| 9java
| eq7a5 |
$ jq type
true
"boolean"
false
"boolean" | 1,090Boolean values
| 10javascript
| 0ipsz |
def asCompassPoint(angle) {
def cardinalDirections = ["north", "east", "south", "west"]
int index = Math.floor(angle / 11.25 + 0.5)
int cardinalIndex = (index / 8)
def c1 = cardinalDirections[cardinalIndex % 4]
def c2 = cardinalDirections[(cardinalIndex + 1) % 4]
def c3 = (cardinalIndex == 0 || cardinalIndex == 2) ? "$c1$c2": "$c2$c1"
def point = [
"$c1", "$c1 by $c2", "$c1-$c3", "$c3 by $c1", "$c3", "$c3 by $c2", "$c2-$c3", "$c2 by $c1"
][index % 8]
point.substring(0, 1).toUpperCase() + point.substring(1)
}
Number.metaClass.asCompassPoint = { asCompassPoint(delegate) }
[0.0, 16.87, 16.88, 33.75, 50.62, 50.63, 67.5, 84.37, 84.38, 101.25, 118.12, 118.13, 135.0, 151.87, 151.88, 168.75,
185.62, 185.63, 202.5, 219.37, 219.38, 236.25, 253.12, 253.13, 270.0, 286.87, 286.88, 303.75, 320.62, 320.63, 337.5,
354.37, 354.38].eachWithIndex { angle, index ->
println "${(index% 32) + 1}".padRight(3) + "${angle.asCompassPoint().padLeft(20)} $angle\u00b0"
} | 1,096Box the compass
| 7groovy
| q84xp |
typedef unsigned char color_component;
typedef color_component pixel[3];
typedef struct {
unsigned int width;
unsigned int height;
pixel * buf;
} image_t;
typedef image_t * image;
image alloc_img(unsigned int width, unsigned int height);
void free_img(image);
void fill_img(image img,
color_component r,
color_component g,
color_component b );
void put_pixel_unsafe(
image img,
unsigned int x,
unsigned int y,
color_component r,
color_component g,
color_component b );
void put_pixel_clip(
image img,
unsigned int x,
unsigned int y,
color_component r,
color_component g,
color_component b ); | 1,102Bitmap
| 5c
| v4x2o |
bioR <- function(bDay, targetDay) {
bDay <- as.Date(bDay)
targetDay <- as.Date(targetDay)
n <- as.numeric(targetDay - bDay)
cycles <- c(23, 28, 33)
mods <- n%% cycles
bioR <- c(sin(2 * pi * mods / cycles))
loc <- mods / cycles
current <- ifelse(bioR > 0, ': Up', ': Down')
current <- paste(current, ifelse(loc < 0.25 | loc > 0.75,
"and rising",
"and falling"))
df <- data.frame(dates = seq.Date(from = targetDay - 30,
to = targetDay + 30,
by = 1))
df$n <- as.numeric(df$dates - bDay)
df$P <- sin(2 * pi * (df$n%% cycles[1]) / cycles[1])
df$E <- sin(2 * pi * (df$n%% cycles[2]) / cycles[2])
df$M <- sin(2 * pi * (df$n%% cycles[3]) / cycles[3])
plot(df$dates, df$P, col = 'blue',
main = paste(targetDay, 'Biorhythm for Birthday on', bDay),
xlab = "",
ylab = "Intensity")
points(df$dates, df$E, col = 'green')
points(df$dates, df$M, col = 'red')
abline(v = targetDay)
legend('topleft', legend = c("Phys", "Emot", "Ment"),
col =c("blue", "green", "red"),
cex = 0.8,
pch = 21)
cat(paste0('Birthday = ', as.character(bDay),
'\nTarget Date = ', as.character(targetDay),
'\n', n, ' days',
'\nPhysical = ', mods[1], current[1],
'\nEmotional = ', mods[2], current[2],
'\nMental = ', mods[3], current[3]))
}
bioR('1943-03-09', '1972-07-11') | 1,098Biorhythms
| 13r
| dzhnt |
function validate($address){
$decoded = decodeBase58($address);
$d1 = hash(, substr($decoded,0,21), true);
$d2 = hash(, $d1, true);
if(substr_compare($decoded, $d2, 21, 4)){
throw new \Exception();
}
return true;
}
function decodeBase58($input) {
$alphabet = ;
$out = array_fill(0, 25, 0);
for($i=0;$i<strlen($input);$i++){
if(($p=strpos($alphabet, $input[$i]))===false){
throw new \Exception();
}
$c = $p;
for ($j = 25; $j--; ) {
$c += (int)(58 * $out[$j]);
$out[$j] = (int)($c % 256);
$c /= 256;
$c = (int)$c;
}
if($c != 0){
throw new \Exception();
}
}
$result = ;
foreach($out as $val){
$result .= chr($val);
}
return $result;
}
function main () {
$s = array(
,
,
,
,
);
foreach($s as $btc){
$message = ;
try{
validate($btc);
}catch(\Exception $e){ $message = $e->getMessage(); }
echo ;
}
}
main(); | 1,097Bitcoin/address validation
| 12php
| ifjov |
{if true then YES else NO}
-> YES
{if false then YES else NO}
-> NO | 1,090Boolean values
| 11kotlin
| k1uh3 |
import Data.Char (toUpper)
import Data.Maybe (fromMaybe)
import Text.Printf (PrintfType, printf)
dirs :: [String]
dirs =
[ "N"
, "NbE"
, "N-NE"
, "NEbN"
, "NE"
, "NEbE"
, "E-NE"
, "EbN"
, "E"
, "EbS"
, "E-SE"
, "SEbE"
, "SE"
, "SEbS"
, "S-SE"
, "SbE"
, "S"
, "SbW"
, "S-SW"
, "SWbS"
, "SW"
, "SWbW"
, "W-SW"
, "WbS"
, "W"
, "WbN"
, "W-NW"
, "NWbW"
, "NW"
, "NWbN"
, "N-NW"
, "NbW"
]
pointName :: Int -> String
pointName = capitalize . concatMap (fromMaybe "?" . fromChar) . (dirs !!)
where
fromChar c =
lookup
c
[ ('N', "north")
, ('S', "south")
, ('E', "east")
, ('W', "west")
, ('b', " by ")
, ('-', "-")
]
capitalize (c:cs) = toUpper c: cs
pointIndex :: Double -> Int
pointIndex d = (round (d * 1000) + 5625) `mod` 360000 `div` 11250
printPointName :: PrintfType t => String -> t
printPointName d =
let deg = read d :: Double
idx = pointIndex deg
in printf "%2d %-18s %6.2f\n" (idx + 1) (pointName idx) deg
main :: IO ()
main = mapM_ (printPointName . show) [0 .. 31] | 1,096Box the compass
| 8haskell
| v4i2k |
void bitwise(int a, int b)
{
printf(, a & b);
printf(, a | b);
printf(, a ^ b);
printf(, ~a);
printf(, a << b);
printf(, a >> b);
unsigned int c = a;
printf(, c >> b);
return 0;
} | 1,103Bitwise operations
| 5c
| 92pm1 |
require 'date'
CYCLES = {physical: 23, emotional: 28, mental: 33}
def biorhythms(date_of_birth, target_date = Date.today.to_s)
days_alive = Date.parse(target_date) - Date.parse(date_of_birth)
CYCLES.each do |name, num_days|
cycle_day = days_alive % num_days
state = case cycle_day
when 0, num_days/2 then
when (1.. num_days/2) then
when (num_days/2+1..num_days) then
end
puts % [name, cycle_day.to_i, state]
end
end
biorhythms(, ) | 1,098Biorhythms
| 14ruby
| yce6n |
use strict;
use warnings;
use feature 'say';
my @bases = <A C G T>;
my $dna;
$dna .= $bases[int rand 4] for 1..200;
my %cnt;
$cnt{$_}++ for split //, $dna;
sub pretty {
my($string) = @_;
my $chunk = 10;
my $wrap = 5 * ($chunk+1);
($string =~ s/(.{$chunk})/$1 /gr) =~ s/(.{$wrap})/$1\n/gr;
}
sub mutate {
my($dna,$count) = @_;
my $orig = $dna;
substr($dna,rand length $dna,1) = $bases[int rand 4] while $count > diff($orig, $dna) =~ tr/acgt//;
$dna
}
sub diff {
my($orig, $repl) = @_;
for my $i (0 .. -1+length $orig) {
substr($repl,$i,1, lc substr $repl,$i,1) if substr($orig,$i,1) ne substr($repl,$i,1);
}
$repl;
}
say "Original DNA strand:\n" . pretty($dna);
say "Total bases: ". length $dna;
say "$_: $cnt{$_}" for @bases;
my $mutate = mutate($dna, 10);
%cnt = ();
$cnt{$_}++ for split //, $mutate;
say "\nMutated DNA strand:\n" . pretty diff $dna, $mutate;
say "Total bases: ". length $mutate;
say "$_: $cnt{$_}" for @bases; | 1,099Bioinformatics/Sequence mutation
| 2perl
| peyb0 |
size_t upper_bound(const int* array, size_t n, int value) {
size_t start = 0;
while (n > 0) {
size_t step = n / 2;
size_t index = start + step;
if (value >= array[index]) {
start = index + 1;
n -= step + 1;
} else {
n = step;
}
}
return start;
}
int* bins(const int* limits, size_t nlimits, const int* data, size_t ndata) {
int* result = calloc(nlimits + 1, sizeof(int));
if (result == NULL)
return NULL;
for (size_t i = 0; i < ndata; ++i)
++result[upper_bound(limits, nlimits, data[i])];
return result;
}
void print_bins(const int* limits, size_t n, const int* bins) {
if (n == 0)
return;
printf(, limits[0], bins[0]);
for (size_t i = 1; i < n; ++i)
printf(, limits[i - 1], limits[i], bins[i]);
printf(, limits[n - 1], bins[n]);
}
int main() {
const int limits1[] = {23, 37, 43, 53, 67, 83};
const int data1[] = {95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57,
5, 53, 86, 65, 17, 92, 83, 71, 61, 54, 58, 47, 16,
8, 9, 32, 84, 7, 87, 46, 19, 30, 37, 96, 6, 98,
40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55};
printf();
size_t n = sizeof(limits1) / sizeof(int);
int* b = bins(limits1, n, data1, sizeof(data1) / sizeof(int));
if (b == NULL) {
fprintf(stderr, );
return EXIT_FAILURE;
}
print_bins(limits1, n, b);
free(b);
const int limits2[] = {14, 18, 249, 312, 389, 392, 513, 591, 634, 720};
const int data2[] = {
445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525,
570, 219, 367, 523, 442, 933, 416, 589, 930, 373, 202, 253, 775, 47,
731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306, 655, 267,
248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391,
913, 42, 560, 247, 346, 860, 56, 138, 546, 38, 985, 948, 58, 213,
799, 319, 390, 634, 458, 945, 733, 507, 916, 123, 345, 110, 720, 917,
313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137,
397, 97, 854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981,
480, 39, 257, 272, 157, 5, 316, 395, 787, 942, 456, 242, 759, 898,
576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692,
698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40,
54, 901, 408, 359, 577, 237, 605, 847, 353, 968, 832, 205, 838, 427,
876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791, 466, 23,
707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374,
101, 684, 727, 749};
printf();
n = sizeof(limits2) / sizeof(int);
b = bins(limits2, n, data2, sizeof(data2) / sizeof(int));
if (b == NULL) {
fprintf(stderr, );
return EXIT_FAILURE;
}
print_bins(limits2, n, b);
free(b);
return EXIT_SUCCESS;
} | 1,104Bin given limits
| 5c
| mlkys |
package main
import (
"fmt"
"sort"
)
func main() {
dna := "" +
"CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" +
"CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" +
"AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" +
"GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" +
"CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" +
"TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" +
"TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" +
"CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" +
"TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" +
"GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"
fmt.Println("SEQUENCE:")
le := len(dna)
for i := 0; i < le; i += 50 {
k := i + 50
if k > le {
k = le
}
fmt.Printf("%5d:%s\n", i, dna[i:k])
}
baseMap := make(map[byte]int) | 1,101Bioinformatics/base count
| 0go
| gjo4n |
from hashlib import sha256
digits58 = '123456789ABCDEFGHJKLMNPQRSTUVWXYZabcdefghijkmnopqrstuvwxyz'
def decode_base58(bc, length):
n = 0
for char in bc:
n = n * 58 + digits58.index(char)
return n.to_bytes(length, 'big')
def check_bc(bc):
try:
bcbytes = decode_base58(bc, 25)
return bcbytes[-4:] == sha256(sha256(bcbytes[:-4]).digest()).digest()[:4]
except Exception:
return False
print(check_bc('1AGNa15ZQXAZUgFiqJ3i7Z2DPU2J6hW62i'))
print(check_bc()) | 1,097Bitcoin/address validation
| 3python
| gjf4h |
use strict;
use Image::Imlib2;
my $img = Image::Imlib2->load("Unfilledcirc.jpg");
$img->set_color(0, 255, 0, 255);
$img->fill(100,100);
$img->save("filledcirc.jpg");
exit 0; | 1,094Bitmap/Flood fill
| 2perl
| gj34e |
(import '[java.awt Color Graphics Image]
'[java.awt.image BufferedImage])
(defn blank-bitmap [width height]
(BufferedImage. width height BufferedImage/TYPE_3BYTE_BGR))
(defn fill [image color]
(doto (.getGraphics image)
(.setColor color)
(.fillRect 0 0 (.getWidth image) (.getHeight image))))
(defn set-pixel [image x y color]
(.setRGB image x y (.getRGB color)))
(defn get-pixel [image x y]
(Color. (.getRGB image x y))) | 1,102Bitmap
| 6clojure
| rhog2 |
import Data.List (group, sort)
import Data.List.Split (chunksOf)
import Text.Printf (printf, IsChar(..), PrintfArg(..), fmtChar, fmtPrecision, formatString)
data DNABase = A | C | G | T deriving (Show, Read, Eq, Ord)
type DNASequence = [DNABase]
instance IsChar DNABase where
toChar = head . show
fromChar = read . pure
instance PrintfArg DNABase where
formatArg x fmt = formatString (show x) (fmt { fmtChar = 's', fmtPrecision = Nothing })
test :: DNASequence
test = read . pure <$> concat
[ "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG"
, "CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG"
, "AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT"
, "GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT"
, "CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG"
, "TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA"
, "TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT"
, "CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG"
, "TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC"
, "GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT" ]
chunkedDNASequence :: DNASequence -> [(Int, [DNABase])]
chunkedDNASequence = zip [50,100..] . chunksOf 50
baseCounts :: DNASequence -> [(DNABase, Int)]
baseCounts = fmap ((,) . head <*> length) . group . sort
main :: IO ()
main = do
putStrLn "Sequence:"
mapM_ (uncurry (printf "%3d:%s\n")) $ chunkedDNASequence test
putStrLn "\nBase Counts:"
mapM_ (uncurry (printf "%2s:%2d\n")) $ baseCounts test
putStrLn (replicate 8 '-') >> printf " :%d\n\n" (length test) | 1,101Bioinformatics/base count
| 8haskell
| so2qk |
(bit-and x y)
(bit-or x y)
(bit-xor x y)
(bit-not x)
(bit-shift-left x n)
(bit-shift-right x n) | 1,103Bitwise operations
| 6clojure
| ugxvi |
typedef struct str_t {
size_t len, alloc;
unsigned char *s;
} bstr_t, *bstr;
bstr str_new(size_t len)
{
bstr s = malloc(sizeof(bstr_t));
if (len < 8) len = 8;
s->alloc = len;
s->s = malloc(len);
s->len = 0;
return s;
}
void str_extend(bstr s)
{
size_t ns = s->alloc * 2;
if (ns - s->alloc > 1024) ns = s->alloc + 1024;
s->s = realloc(s->s, ns);
s->alloc = ns;
}
void str_del(bstr s)
{
free(s->s), free(s);
}
int str_cmp(bstr l, bstr r)
{
int res, len = l->len;
if (len > r->len) len = r->len;
if ((res = memcmp(l->s, r->s, len))) return res;
return l->len > r->len ? 1 : -1;
}
bstr str_dup(bstr src)
{
bstr x = str_new(src->len);
memcpy(x->s, src->s, src->len);
x->len = src->len;
return x;
}
bstr str_from_chars(const char *t)
{
if (!t) return str_new(0);
size_t l = strlen(t);
bstr x = str_new(l + 1);
x->len = l;
memcpy(x->s, t, l);
return x;
}
void str_append(bstr s, unsigned char b)
{
if (s->len >= s->alloc) str_extend(s);
s->s[s->len++] = b;
}
bstr str_substr(bstr s, int from, int to)
{
if (!to) to = s->len;
if (from < 0) from += s->len;
if (from < 0 || from >= s->len)
return 0;
if (to < from) to = from + 1;
bstr x = str_new(to - from);
x->len = to - from;
memcpy(x->s, s->s + from, x->len);
return x;
}
bstr str_cat(bstr s, bstr s2)
{
while (s->alloc < s->len + s2->len) str_extend(s);
memcpy(s->s + s->len, s2->s, s2->len);
s->len += s2->len;
return s;
}
void str_swap(bstr a, bstr b)
{
size_t tz;
unsigned char *ts;
tz = a->alloc; a->alloc = b->alloc; b->alloc = tz;
tz = a->len; a->len = b->len; b->len = tz;
ts = a->s; a->s = b->s; b->s = ts;
}
bstr str_subst(bstr tgt, bstr pat, bstr repl)
{
bstr tmp = str_new(0);
int i;
for (i = 0; i + pat->len <= tgt->len;) {
if (memcmp(tgt->s + i, pat->s, pat->len)) {
str_append(tmp, tgt->s[i]);
i++;
} else {
str_cat(tmp, repl);
i += pat->len;
if (!pat->len) str_append(tmp, tgt->s[i++]);
}
}
while (i < tgt->len) str_append(tmp, tgt->s[i++]);
str_swap(tmp, tgt);
str_del(tmp);
return tgt;
}
void str_set(bstr dest, bstr src)
{
while (dest->len < src->len) str_extend(dest);
memcpy(dest->s, src->s, src->len);
dest->len = src->len;
}
int main()
{
bstr s = str_from_chars();
bstr s2 = str_from_chars();
bstr s3 = str_from_chars();
str_subst(s, s3, s2);
printf(, s->len, s->s);
str_del(s);
str_del(s2);
str_del(s3);
return 0;
} | 1,105Binary strings
| 5c
| 47x5t |
import java.util.HashMap;
import java.util.Map;
public class orderedSequence {
public static void main(String[] args) {
Sequence gene = new Sequence("CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATGCTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATATTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTATCGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTGTCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGACGACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT");
gene.runSequence();
}
}
public class Sequence {
private final String seq;
public Sequence(String sq) {
this.seq = sq;
}
public void prettyPrint() {
System.out.println("Sequence:");
int i = 0;
for ( ; i < seq.length() - 50 ; i += 50) {
System.out.printf("%5s:%s\n", i + 50, seq.substring(i, i + 50));
}
System.out.printf("%5s:%s\n", seq.length(), seq.substring(i));
}
public void displayCount() {
Map<Character, Integer> counter = new HashMap<>();
for (int i = 0 ; i < seq.length() ; ++i) {
counter.merge(seq.charAt(i), 1, Integer::sum);
}
System.out.println("Base vs. Count:");
counter.forEach(
key, value -> System.out.printf("%5s:%s\n", key, value));
System.out.printf("%5s:%s\n", "SUM", seq.length());
}
public void runSequence() {
this.prettyPrint();
this.displayCount();
}
} | 1,101Bioinformatics/base count
| 9java
| 1w6p2 |
import random
from collections import Counter
def basecount(dna):
return sorted(Counter(dna).items())
def seq_split(dna, n=50):
return [dna[i: i+n] for i in range(0, len(dna), n)]
def seq_pp(dna, n=50):
for i, part in enumerate(seq_split(dna, n)):
print(f)
print()
tot = 0
for base, count in basecount(dna):
print(f)
tot += count
base, count = 'TOT', tot
print(f)
def seq_mutate(dna, count=1, kinds=, choice= ):
mutation = []
k2txt = dict(I='Insert', D='Delete', S='Substitute')
for _ in range(count):
kind = random.choice(kinds)
index = random.randint(0, len(dna))
if kind == 'I':
dna = dna[:index] + random.choice(choice) + dna[index:]
elif kind == 'D' and dna:
dna = dna[:index] + dna[index+1:]
elif kind == 'S' and dna:
dna = dna[:index] + random.choice(choice) + dna[index+1:]
mutation.append((k2txt[kind], index))
return dna, mutation
if __name__ == '__main__':
length = 250
print()
sequence = ''.join(random.choices('ACGT', weights=(1, 0.8, .9, 1.1), k=length))
seq_pp(sequence)
print()
mseq, m = seq_mutate(sequence, 10)
for kind, index in m:
print(f)
print()
seq_pp(mseq) | 1,099Bioinformatics/Sequence mutation
| 3python
| 1wmpc |
require 'digest/sha2'
def convert g
i,e = '',[]
(0...g.length/2).each{|n| e[n] = g[n+=n]+g[n+1]; i+='H2'}
e.pack(i)
end
N = [0,1,2,3,4,5,6,7,8,nil,nil,nil,nil,nil,nil,nil,9,10,11,12,13,14,15,16,nil,17,18,19,20,21,nil,22,23,24,25,26,27,28,29,30,31,32,nil,nil,nil,nil,nil,nil,33,34,35,36,37,38,39,40,41,42,43,nil,44,45,46,47,48,49,50,51,52,53,54,55,56,57]
A = '1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62x'
g = A.bytes.inject(0){|g,n| g*58+N[n-49]}.to_s(16)
n = g.slice!(0..-9)
(n.length...42).each{n.insert(0,'0')}
puts | 1,097Bitcoin/address validation
| 14ruby
| 7kzri |
const rowLength = 50;
const bases = ['A', 'C', 'G', 'T']; | 1,101Bioinformatics/base count
| 10javascript
| q8lx8 |
extern crate crypto;
use crypto::digest::Digest;
use crypto::sha2::Sha256;
const DIGITS58: [char; 58] = ['1', '2', '3', '4', '5', '6', '7', '8', '9', 'A', 'B', 'C', 'D', 'E', 'F', 'G', 'H', 'J', 'K', 'L', 'M', 'N', 'P', 'Q', 'R', 'S', 'T', 'U', 'V', 'W', 'X', 'Y', 'Z', 'a', 'b', 'c', 'd', 'e', 'f', 'g', 'h', 'i', 'j', 'k', 'm', 'n', 'o', 'p', 'q', 'r', 's', 't', 'u', 'v', 'w', 'x', 'y', 'z'];
fn main() {
println!("{}", validate_address("1AGNa15ZQXAZUgFiqJ3i7Z2DPU2J6hW62i"));
println!("{}", validate_address("1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62i"));
println!("{}", validate_address("17NdbrSGoUotzeGCcMMCqnFkEvLymoou9j"));
println!("{}", validate_address("17NdbrSGoUotzeGCcMMC?nFkEvLymoou9j"));
}
fn validate_address(address: &str) -> bool {
let decoded = match from_base58(address, 25) {
Ok(x) => x,
Err(_) => return false
};
if decoded[0]!= 0 {
return false;
}
let mut sha = Sha256::new();
sha.input(&decoded[0..21]);
let mut first_round = vec![0u8; sha.output_bytes()];
sha.result(&mut first_round);
sha.reset();
sha.input(&first_round);
let mut second_round = vec![0u8; sha.output_bytes()];
sha.result(&mut second_round);
if second_round[0..4]!= decoded[21..25] {
return false
}
true
}
fn from_base58(encoded: &str, size: usize) -> Result<Vec<u8>, String> {
let mut res: Vec<u8> = vec![0; size];
for base58_value in encoded.chars() {
let mut value: u32 = match DIGITS58
.iter()
.position(|x| *x == base58_value){
Some(x) => x as u32,
None => return Err(String::from("Invalid character found in encoded string."))
};
for result_index in (0..size).rev() {
value += 58 * res[result_index] as u32;
res[result_index] = (value% 256) as u8;
value /= 256;
}
}
Ok(res)
} | 1,097Bitcoin/address validation
| 15rust
| jb372 |
import java.security.MessageDigest
import java.util.Arrays.copyOfRange
import scala.annotation.tailrec
import scala.math.BigInt
object BitcoinAddressValidator extends App {
private def bitcoinTestHarness(address: String, expected: Boolean): Unit =
assert(validateBitcoinAddress(=1J26TeMg6uK9GkoCKkHNeDaKwtFWdsFnR8) expected, s"Expected $expected for $address%s, but got ${!expected}.")
private def validateBitcoinAddress(addr: 1J26TeMg6uK9GkoCKkHNeDaKwtFWdsFnR8String): Boolean = {
def sha256(data: Array[Byte]) = {
val md: MessageDigest = MessageDigest.getInstance("SHA-256")
md.update(data)
md.digest
}
def decodeBase58To25Bytes(input: String): Option[Array[Byte]] = {
def ALPHABET = "123456789ABCDEFGHJKLMNPQRSTUVWXYZabcdefghijkmnopqrstuvwxyz"
@tailrec
def loop(s: String, accu: BigInt): BigInt = {
if (s.isEmpty) accu
else {
val p = ALPHABET.indexOf(s.head)
if (p >= 0) loop(s.tail, accu * 58 + p)
else -1
}
}
val num = loop(input, 0)
if (num >= 0) {
val (result, numBytes) = (new Array[Byte](25), num.toByteArray)
System.arraycopy(numBytes, 0, result, result.length - numBytes.length, numBytes.length)
Some(result)
}
else None
}
if (27 to 34 contains addr.length) {
val decoded = decodeBase58To25Bytes(addr)
if (decoded.isEmpty) false
else {
val hash1 = sha256(copyOfRange(decoded.get, 0, 21))
copyOfRange(sha256(hash1), 0, 4)
.sameElements(copyOfRange(decoded.get, 21, 25))
}
} else false
} | 1,097Bitcoin/address validation
| 16scala
| bamk6 |
import Image
def FloodFill( fileName, initNode, targetColor, replaceColor ):
img = Image.open( fileName )
pix = img.load()
xsize, ysize = img.size
Q = []
if pix[ initNode[0], initNode[1] ] != targetColor:
return img
Q.append( initNode )
while Q != []:
node = Q.pop(0)
if pix[ node[0], node[1] ] == targetColor:
W = list( node )
if node[0] + 1 < xsize:
E = list( [ node[0] + 1, node[1] ] )
else:
E = list( node )
while pix[ W[0], W[1] ] == targetColor:
pix[ W[0], W[1] ] = replaceColor
if W[1] + 1 < ysize:
if pix[ W[0], W[1] + 1 ] == targetColor:
Q.append( [ W[0], W[1] + 1 ] )
if W[1] - 1 >= 0:
if pix[ W[0], W[1] - 1 ] == targetColor:
Q.append( [ W[0], W[1] - 1 ] )
if W[0] - 1 >= 0:
W[0] = W[0] - 1
else:
break
while pix[ E[0], E[1] ] == targetColor:
pix[ E[0], E[1] ] = replaceColor
if E[1] + 1 < ysize:
if pix[ E[0], E[1] + 1 ] == targetColor:
Q.append( [ E[0], E[1] + 1 ] )
if E[1] - 1 >= 0:
if pix[ E[0], E[1] - 1 ] == targetColor:
Q.append( [ E[0], E[1] -1 ] )
if E[0] + 1 < xsize:
E[0] = E[0] + 1
else:
break
return img | 1,094Bitmap/Flood fill
| 3python
| rh6gq |
if 0 then print "0" end | 1,090Boolean values
| 1lua
| ba5ka |
public class BoxingTheCompass{
private static String[] points = new String[32];
public static void main(String[] args){
buildPoints();
double heading = 0;
for(int i = 0; i<= 32;i++){
heading = i * 11.25;
switch(i % 3){
case 1:
heading += 5.62;
break;
case 2:
heading -= 5.62;
break;
default:
}
System.out.printf("%s\t%18s\t%s\n",(i % 32) + 1, initialUpper(getPoint(heading)), heading);
}
}
private static void buildPoints(){
String[] cardinal = {"north", "east", "south", "west"};
String[] pointDesc = {"1", "1 by 2", "1-C", "C by 1", "C", "C by 2", "2-C", "2 by 1"};
String str1, str2, strC;
for(int i = 0;i <= 3;i++){
str1 = cardinal[i];
str2 = cardinal[(i + 1) % 4];
strC = (str1.equals("north") || str1.equals("south")) ? (str1 + str2): (str2 + str1);
for(int j = 0;j <= 7;j++){
points[i * 8 + j] = pointDesc[j].replace("1", str1).replace("2", str2).replace("C", strC);
}
}
}
private static String initialUpper(String s){
return s.substring(0, 1).toUpperCase() + s.substring(1);
}
private static String getPoint(double degrees){
double testD = (degrees / 11.25) + 0.5;
return points[(int)Math.floor(testD % 32)];
}
} | 1,096Box the compass
| 9java
| ycx6g |
library(png)
img <- readPNG("Unfilledcirc.png")
M <- img[ , , 1]
M <- ifelse(M < 0.5, 0, 1)
image(M, col = c(1, 0))
floodfill <- function(row, col, tcol, rcol) {
if (tcol == rcol) return()
if (M[row, col]!= tcol) return()
M[row, col] <<- rcol
floodfill(row - 1, col , tcol, rcol)
floodfill(row + 1, col , tcol, rcol)
floodfill(row , col - 1, tcol, rcol)
floodfill(row , col + 1, tcol, rcol)
return("filling completed")
}
options(expressions = 10000)
startrow <- 100; startcol <- 100
floodfill(startrow, startcol, 0, 2)
image(M, col = c(1, 0, 2)) | 1,094Bitmap/Flood fill
| 13r
| ugfvx |
function createRow(i, point, heading) {
var tr = document.createElement('tr'),
td;
td = document.createElement('td');
td.appendChild(document.createTextNode(i));
tr.appendChild(td);
td = document.createElement('td');
point = point.substr(0, 1).toUpperCase() + point.substr(1);
td.appendChild(document.createTextNode(point));
tr.appendChild(td);
td = document.createElement('td');
td.appendChild(document.createTextNode(heading));
tr.appendChild(td);
return tr;
}
function getPoint(i) {
var j = i % 8,
i = Math.floor(i / 8) % 4,
cardinal = ['north', 'east', 'south', 'west'],
pointDesc = ['1', '1 by 2', '1-C', 'C by 1', 'C', 'C by 2', '2-C', '2 by 1'],
str1, str2, strC;
str1 = cardinal[i];
str2 = cardinal[(i + 1) % 4];
strC = (str1 === 'north' || str1 === 'south') ? str1 + str2 : str2 + str1;
return pointDesc[j].replace('1', str1).replace('2', str2).replace('C', strC);
}
var i,
heading,
table = document.createElement('table'),
tbody = document.createElement('tbody'),
tr;
for (i = 0; i <= 32; i += 1) {
heading = i * 11.25 + [0, 5.62, -5.62][i % 3];
tr = createRow(i % 32 + 1, getPoint(i), heading + '');
tbody.appendChild(tr);
}
table.appendChild(tbody);
document.body.appendChild(table); | 1,096Box the compass
| 10javascript
| 25olr |