Datasets:

hatakeyama-llm-team

/

PMC

like 0

Follow

Team Hatakeyama 25

Å b = 7.6499 (5) Å c = 28.164 (2) Å β = 91.208 (1)°V = 1363.55 (16) Å3 Z = 4 Kα radiationMo −1 μ = 5.92 mmT = 173 (2) K 0.27 × 0.19 × 0.10 mm Bruker APEXII CCD area-detector diffractometerSADABS; Sheldrick, 2004T min = 0.303, T max = 0.578Absorption correction: multi-scan (14025 measured reflections2793 independent reflectionsI > 2σ(I)2393 reflections with R int = 0.027 R[F 2 > 2σ(F 2)] = 0.025 wR(F 2) = 0.054 S = 1.08 2793 reflections165 parametersH-atom parameters constrainedmax = 0.42 e Å−3 Δρmin = −0.32 e Å−3 Δρ APEX2 (Bruker, 2006APEX2; data reduction: SAINT-Plus (Bruker, 2006SHELXS97 (Sheldrick, 1990SHELXTL (Sheldrick, 2003Mercury (Macrae et al., 2006publCIF (Westrip, 2008Data collection: 10.1107/S1600536807067645/pv2061sup1.cif Crystal structure: contains datablocks I, global. DOI: 10.1107/S1600536807067645/pv2061Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

Serial serum diphenylhydantoin and urinary 5-(p-hydroxphenyl)-5-phenylhydantoin concentrations were determined in 8 patients with malignant disease and 4 healthy volunteers on 2 separate occasions after an oral dose of diphenylhydantoin (500 mg). No significant difference was observed between metabolism before and 10 days after immunization with BCG or Corynebacterium parvum. Volunteers without intervening immunization similarly showed no difference.

Brain structure and dynamics are interdependent through processes such as activity-dependent neuroplasticity. In this study, we aim to theoretically examine this interdependence in a model of spontaneous cortical activity. To this end, we simulate spontaneous brain dynamics on structural connectivity networks, using coupled nonlinear maps. On slow time scales structural connectivity is gradually adjusted towards the resulting functional patterns via an unsupervised, activity-dependent rewiring rule. The present model has been previously shown to generate cortical-like, modular small-world structural topology from initially random connectivity. We provide further biophysical justification for this model and quantitatively characterize the relationship between structure, function and dynamics that accompanies the ensuing self-organization.We show that coupled chaotic dynamics generate ordered and modular functional patterns, even on a random underlying structural connectivity. Consequently, structural connectivity becomes more modular as it rewires towards these functional patterns. Functional networks reflect the underlying structural networks on slow time scales, but significantly less so on faster time scales. In spite of ordered functional topology, structural networks remain robustly interconnected – and therefore small-world – due to the presence of central, inter-modular hub nodes. The noisy dynamics of these hubs enable them to persist despite ongoing rewiring and despite their comparative absence in functional networks.Our results outline a theoretical mechanism by which brain dynamics may facilitate neuroanatomical self-organization. We find time scale dependent differences between structural and functional networks. These differences are likely to arise from the distinct dynamics of central structural nodes. Modular small-world network topology may represent a basic organizational principle of neuroanatomical connectivity across multiple spatial scales -6. SmallCortical structure and dynamics are highly interdependent. On relatively fast time scales, structure enables the emergence of complex dynamics . On slowThere hence exists a "symbiotic" relationship between structural brain connectivity and brain activity. Such a relationship is thought to be central to the emergence of complex neuroanatomical connectivity from a relatively unstructured neuropil ,18, and a priori and were subsequently treated as static, these studies did not address the influence of activity upon structure, as mediated through dynamically driven structural plasticity. Such an influence forms the core of our investigation.The relationship between structural and functional brain connectivity is gaining rapid interest. Recent studies have explored this relationship by simulating neuronal dynamics on large scale neuroanatomical connectivity networks. These studies found that the resulting functional patterns passively reflect the underlying structural connectivity on slow time scales -25, but Several models of complex network growth have been well established in the wider network community. These include the well known preferential attachment model , as wellThe nonlinear nature of neuronal dynamics providesThis intuition underlies the activity-dependent model of structural rewiring proposed by Gong and van Leeuwen and furtConsistent with the approach of Gong and van Leeuwen, the present study approximates neuronal dynamics using an ensemble of coupled chaotic unimodal maps. Such maps are well known to exhibit universal dynamical properties ,38. HencWe hence seek a detailed exploration of the nature of this structural self-organization. We observe that, as in Figure Our model consists of an ensemble of chaotic logistic maps, coupled via a directed binary structural connectivity network. The dynamics of these maps generated a series of functional connectivity networks on static structural networks. As the dynamics evolved, structural networks were gradually adjusted towards emergent synchrony patterns: periodically, a node was randomly chosen and its connections were rewired such that it gained a link to a node with which it was most synchronous, and lost a link to a neighbor with which it was least synchronous. We measured synchronization using the absolute difference (Euclidean distance) between individual unit states (see Methods). We began simulations from initially random structural connectivity and proceeded until asymptotic conditions, as characterized by globally invariant structural and functional clustering and closeness.Figure Figure A key difference between structural and functional connectivity is the robust presence of inter-modular links in structural networks, and a relative absence of these links in functional networks. Inter-modular links represent the crucial difference between a structural small-world and a functional lattice . Below, The degree distributions in both structural and functional networks do not evolve toward a scale-free, or broad-scale distribution . We hence evaluated structural evolution under a range of coupling strengths, and under periodic through to strongly chaotic dynamics. Figure μ ≤ 1.4), under weakly chaotic dynamics with strong coupling , or at the other extreme, under strongly chaotic dynamics with weak coupling . There also exists a small region of parameter space , under which the networks acquire ordered topologies.We evaluated the dependence of the model on parameters by systematically varying the coupling parameter metrics and averaged functional metrics extracted from fast time scale networks. The structure-function similarity in local clustering and the discrepancy in global closeness at the asymptotic state , and will necessarily generate ordered fast time scale functional connectivity, no matter how chaotic the dynamics. More importantly, however, functional networks constructed on a slower time scale likewise remain ordered Figures , 5, suggin vivo.On a random structural network, synchrony is likely to be stronger between nodes with chance higher connectivity. It is probable that early in neuroanatomical development, higher connectivity strongly correlates with spatial proximity. We find that such connectivity is subsequently reinforced by activity-dependent rewiring; a process which leads to the emergence of clustered structural modules. Therefore, in our simulations, functional networks emergent on random structural networks, anticipate the asymptotic modular connectivity. Our model illustrates a potential mechanism by which brain-like structural connectivity may emerge in an unsupervised way, without a global search for optimal connectivity. It is known that a global search is a hard combinatorial optimization problem in a sparse network , and is We find that slow time scale functional connectivity strongly reflects the underlying structural connectivity, in agreement with recent reports -25. FuncThe present theoretical approach may also be used to interpret functional connectivity findings from empirical studies, by validating structural connectivity patterns against DTI data, and validating functional connectivity patterns against EEG or MEG data and fMRI data . For example, a detailed classification of hubs in mammalian neuroanatomical networks has recently been performed , but theThe role of noise in neural systems is currently a subject of considerable interest . We heurWe also explored the influence of slower time scale dynamics on activity-dependent rewiring, by incorporating a memory function into the rewiring rule. Such a function may represent a gradual consolidation of memories in cortical tissue. However, the use of a memory function which linearly decays with time is putatively problematic, given that the resulting slow time scale networks neglect any itinerant dynamics and consequently fail to capture the richness of instantaneous functional states between pairs of nodes. In our simulations, n = 200 and l = 4000, corresponding to 10% connectedness. G may be also defined by a corresponding connectivity matrix A, in which a node i is said to neighbor node j , when there exists a directed connection from i to j, as represented by aij = 1; the lack of such a connection is denoted by aij = 0 . Let Ni represent the set of neighbors (neighborhood) of node i and let ni be the number of neighbors (degree) of i; correspondingly let the complement i.Formally, we represent structural connectivity with a directed binary graph N has a corresponding dynamical ensemble X; hence each node i has a corresponding dynamical unit xi. The dynamics of the unit state at discrete time t are governed by a commonly used quadratic logistic mapThe set of nodes μ governs the nature of the dynamics (0 ≤ μ ≤ 2). The neural ensemble is constructed through coupling these maps, aswhere the control parameter ε represents coupling strength (0 ≤ ε ≤ 1). Unit states were initially assigned random values (-1 ≤ xi (0) ≤ 1 for all xi ∈ X).where coupling is facilitated through in-connections and ε may be thought to represent the neuromodulatory influence of diffusively projecting brainstem monoamine neurons on the synaptic efficacy of corticocortical fibers [ni effectively rescales the coupling input, and may be thought to represent the mechanisms of homeostatic neuroplasticity [The coupling parameter l fibers . The parasticity . Such meμ varies the degree of nonlinearity (the curvature of the quadratic hump) in each node. Mathematically, μ acts as a simple one-dimensional bifurcation parameter for intra-node dynamics. Nonlinear effects in neural models, such as the neural mass model of Figure μ. Following Gong and van Leeuwen [μ = 1.7 and ε = 0.5, hence enabling chaotic dynamics and moderate coupling. Subsequently, we investigated the robustness of our results across a range of parameter values.The control parameter Leeuwen , we initxi - xj| accurately captures pair-wise synchronization.We used a rewiring rule which periodically modified the structural connectivity matrix towards emergent patterns of functional connectivity. For each structural network, the dynamics were iterated for 1000 iterations. Following this, a node was randomly chosen and its connections were rewired such that it gained a link to a node with which it was most synchronous, and lost a link to a neighbor with which it was least synchronous. If the most synchronous node was already a neighbor, a different node was chosen until one connection was successfully rewired. This rule exploits the fact that all nodes have identical parameter values so that the Euclidean distance |i ∈ N was deemed rewirable when there existed a non-neighbor k ∈ xi - xN|; that is, when i was not connected to a node with which it was most synchronous. For this i, a neighbor j ∈ Ni was chosen, such that j maximized j was the least synchronized neighbor of i. The connections were then rewired as aik = 1 and aij = 0. Rewiring alternated between in and out neighbors at consecutive steps.Formally, a node For each structural topology, "fast time scale functional networks" were extracted through computing inter-unit synchrony – measured as the Euclidean distance between instantaneous dynamical unit states. A strongest synchrony threshold was applied to convert the resulting synchrony matrices into binary networks, of the same connection density as the structural networks. For a given structural network, we extracted an ensemble of fast time scale functional networks and characterized their properties using network analysis methods. We then averaged the resulting metrics over time to obtain characteristic functional network metrics expressed on a given structural state. Hence we first extracted network metrics from fast time scale networks, and subsequently averaged these metrics. This contrasts with an alternative approach, whereby an ensemble of fast time scale networks is first averaged, and network metrics are subsequently extracted from the resulting "slow time scale networks". The two approaches are not commutative. We focused on the first approach, which emphasizes the average expression of spatiotemporal dynamics in functional connectivity, but also permits incorporating the effects of transient synchrony. Such itinerant effects are averaged out in the slow time scale functional networks.X as n × n symmetric synchronization matrices, where each entry corresponded to |xi - xj|. For a given structural network, one functional network was extracted at every tenth iteration of the dynamics, hence enabling an ensemble of 100 fast time scale functional networks for 1000 iterations. Each network was individually analyzed, and the obtained network metrics were averaged to represent the characteristic functional topology. In the initial random networks, all unit states rapidly synchronized, and the dynamics were hence iterated only while there existed a meaningful difference between states . Slow time scale functional networks were extracted by averaging 100 consecutive fast time scale functional networks.Formally, fast time scale functional networks were constructed from .We analyzed structural and functional connectivity properties using metrics of local and global network topology, as well as of individual node centrality. All computations were performed in Matlab , using double precision arithmetic. Our network analytic software is available to download from The clustering coefficient for an individual node, represents the likelihood that any two neighbors of that node will themselves be neighbors . For an We computed the directed clustering coefficient using the method of Fagiolo .Closeness represents the average distance from one node, to all other nodes in the network . We calcdij is the shortest path length between nodes i and j.where C/Crandom >> 1), but have approximately the same closeness as random networks (E/Erandom ≈ 1). Surrogate random networks were generated using the degree distribution preserving algorithm of Maslov and Sneppen [Small-world networks are defined as networks that are significantly more clustered than surrogate random networks which have dense intra-group connectivity, but only sparse inter-group connectivity. We subdivided the network into a set of modules f Newman , generalf Newman . The opteuv represents the proportion of all links in the network that connect nodes in module u to nodes in module v.where pi is defined asNode centrality was assessed with the participation coefficient . Particiηiu is the number of links between node i and nodes in module u. We calculated the participation coefficient for in-neighbors, in symmetry with in-neighbor coupling of the logistic maps.where Nodal rewirability was estimated for each structural network by comparing the network with a corresponding ensemble of functional networks, emergent on that structural connectivity.We characterized the temporal dynamics of individual units by computing their Lyapunov exponents and the fractal dimensions of their corresponding attractors. Taken together, these metrics indicate whether the dynamics are chaotic and low-dimensional , or alternatively, due to discordant inputs, are better characterized as high-dimensional and stochastic. Note that, given the deterministic nature of the logistic map, we use the term stochastic heuristically, to invoke the putative impact of multiple uncorrelated chaotic inputs via the coupling term.xi, denoted as λi, quantitatively determines the average stability of the orbit of the attractor of xi. The Lyapunov exponent was approximated asFormally, the Lyapunov exponent for an individual unit μ is the control parameter of the logistic map and T = 1000 denotes the number of iterations of the dynamics at each rewiring step.where xi, denoted as Di, estimates the dimension of the attractor of xi [The fractal (correlation) dimension for an individual unit or of xi . The fraC(r) is the average number of points in the attractor within a ball of radius r. Di was approximated by generating 1000 points of the orbit of xi and computing C(r) for 50 randomly chosen points, with 0.01 ≤ r ≤ 0.3. Plots of log(C(r)) versus log(r) were visually inspected to ensure the presence of a robust linear relationship.where MR, OS, CVL, MB designed research. MR, MB performed research. MR, MB analyzed the data. MR, OS, CVL, MB contributed reagents/materials/analysis tools. MR, MB wrote the paper. All authors read and approved the final manuscript.Evolution of degree in structural and functional networks. Minimum and maximum degree, along with the mean and standard deviations (dotted lines) for structural (black) and functional (blue) networks. Error bars represent the standard error of the mean, as estimated over 20 simulations.Click here for fileCorrelation between structural and functional network metrics. Temporal evolution of the correlation coefficient between structural and functional participation (A), betweenness (B) and degree (C) with illustrative scatter plots (insets) at specified time instants. Functional network metrics are derived by averaging the metrics of fast time scale networks. An alternative approach, emphasizing the instantaneous expression of functional connectivity (see text) results in significantly weaker correlations (solid lines). Error bars represent the standard error of the mean, as estimated over 20 simulations.Click here for fileCorrelation between degree and the likelihood of link gain or loss. Temporal evolution of the correlation coefficient between degree and link gain/loss likelihood for all nodes (A), and for central nodes only (B), defined as those nodes with participation of greater than 0.4. Error bars represent the standard error of the mean, as estimated over 20 simulations.Click here for fileRelationship between fast time scale and slow time scale functional connectivity. (A) Five consecutive iterations of spatiotemporal dynamics are shown in the top row, with the corresponding functional networks in the bottom row, ordered by the corresponding structural modular arrangement. Note the complex interplay of intra and inter-modular synchrony, reflecting a mix of segregative and integrative dynamics. (B) Dynamics and functional network obtained by calculating the correlation coefficient for the five iterations in A. The inter-modular synchrony is largely averaged at this slower time scale.Click here for fileCorrelation between participation and other structural network metrics. Temporal evolution of the correlation coefficient between participation, and betweenness centrality (A), clustering (B), degree (C), and the number of modules interconnected by a node (D). Scatter plots illustrate typical correlations at the asymptotic state. Error bars represent the standard error of the mean, as estimated over 20 simulations.Click here for file

Comparison of genomic and EST sequences reveals a greater genetic diversity within eukaryotes than prokaryotes and enables identification of taxon-specific sequences. Systematic comparisons between genomic sequence datasets have revealed a wide spectrum of sequence specificity from sequences that are highly conserved to those that are specific to individual species. Due to the limited number of fully sequenced eukaryotic genomes, analyses of this spectrum have largely focused on prokaryotes. Combining existing genomic datasets with the partial genomes of 193 eukaryotes derived from collections of expressed sequence tags, we performed a quantitative analysis of the sequence specificity spectrum to provide a global view of the origins and extent of sequence diversity across the three domains of life.Comparisons with prokaryotic datasets reveal a greater genetic diversity within eukaryotes that may be related to differences in modes of genetic inheritance. Mapping this diversity within a phylogenetic framework revealed that the majority of sequences are either highly conserved or specific to the species or taxon from which they derive. Between these two extremes, several evolutionary landmarks consisting of large numbers of sequences conserved within specific taxonomic groups were identified. For example, 8% of sequences derived from metazoan species are specific and conserved within the metazoan lineage. Many of these sequences likely mediate metazoan specific functions, such as cell-cell communication and differentiation.Through the use of partial genome datasets, this study provides a unique perspective of sequence conservation across the three domains of life. The provision of taxon restricted sequences should prove valuable for future computational and biochemical analyses aimed at understanding evolutionary and functional relationships. However, it should be noted that many ORFans may simply arise as a consequence of incomplete sampling of sequence space. Further exploration of this space through additional sequencing is, therefore, expected to reduce their incidence [Sequence space - the sum of all distinct protein and DNA sequences - is vast. A single copy of every possible 300 residue protein, for example, would fill several universes . In consncidence .While the exploration of this spectrum of sequence specificity is being usefully exploited to derive novel evolutionary and functional relationships, much of the focus has centered on sequences of prokaryotic origin. This is primarily due to the greater number of bacterial genomes that have been sequenced to date. However, the high incidence of lateral gene transfer (LGT) events in prokaryotes has resulted in the lack of a robustly defined phylogeny and, hence, studies of sequence diversity have largely focused on the identification and characterization of sequences at the two extremes of the spectrum -18. On tAside from fully sequenced genomes, a large amount of sequence data has been, and continues to be, generated within the context of survey sequencing projects. Metagenomics projects, such as those exploring sequence diversity in the human gut or niches within the ocean, are continuing to expand the known repertoire of protein families ,9,20. HoPrevious studies of bacterial genomes have shown that as new genome sequences become available, there is an almost constant increase in new coding sequences discovered ,28. Fromn = 400), comparable to the archaeal and eukaryotic datasets. At this time, however, the limited number of genomes available for Archaea and Eukarya negates our ability to predict with any confidence the future trends associated with these datasets. Furthermore, at least for eukaryotes, the OSDR may be skewed by the close evolutionary relationships of some of the genomes sampled , here defined as the percentage of distinct sequences associated with the last genome added to the existing dataset. From Figure Staphylococcus aureus are represented in our dataset) that could affect sequence discovery rates . Recalculations of sequence discovery rates using only a single representative (largest) for each bacterial species or only a single representative (largest) for each bacterial genus increased CSDR by 2.5% and 4.6%, respectively . Only 20% of eukaryotic sequences are conserved across all three domains , a much lower proportion than for both Archaea and Bacteria . Conversely, eukaryotes had the highest percentage of domain specific sequences . This variation could indicate species-specific expansions associated with one or more of these core genes. Using the COGENT database [Cryptosporidium parvum (derived from 16 sequences) to 28 for Saccharomyces cerevisiae and Homo sapiens .Although we might expect to find similar numbers of promiscuous sequences in each genome, there was considerable variation: from 15 in the nanoarchaeotan database , the 13,S. meliloti, 166 were associated with a single family of ABC transporters. The identification of 74 distinct families with an average of only about 20 families per genome indicates that the Markov clustering (MCL) process used by COGENT may be separating otherwise related sequences into distinct subfamilies on the basis of specialized sequence features. To investigate this further we examined the incidence of other non-promiscuous members of these 74 families and applied two dimensional clustering to group gene family profiles on the basis of membership of promiscuous sequences , ABC transporters , elongation factors (TR-000038), translation initiation factors (TR-000155) and GTP binding proteins (TR-000443). These groups may be indicative of a high level of sequence integrity associated with coupling nucleotide binding activity required for their respective functionalities.Of the families containing promiscuous sequences restricted to one or two domains, 17 are common to at least 50% of the eukaryotic species, 11 are common to at least 50% of Archaeal species, and 9 are common to at least 50% of the bacterial species. These families represent taxa specific subgroups. For example, there are two distinct families of aspartyl, glutaminyl and leucyl synthetases. One set is represented in Archaea and Eukarya, while the other is represented in Bacteria and Eukarya.The families containing promiscuous sequences from a limited number of genomes but many non-promiscuous sequences from many other sequences may indicate potential gene fusion events or incorrect gene models in which the promiscuous sequences are associated with additional sequence not found in the other members of the family.Escherichia coli reveal that the genes RBG2, RFC2, RIX7 and RFC3 do not have significant sequence similarity to any of the 59 promiscuous sequences identified in S. cerevisiae (data not shown).Most of the families containing examples of promiscuous (and non-promiscuous) sequences from only a limited number of genomes are representative of sequences that are related to others in the promiscuous sequence dataset but which the MCL algorithm has presumably assigned to different families on the basis of distinctive sequence features. Alternatively, promiscuous sequences in these families may possess sequence similarity to sequences outside the set of 13,055 'core' sequences. For example, BLAST analyses of promiscuous sequences derived from These analyses confirm that COGENT has grouped a number of promiscuous sequences into families on the basis of either domain or species-specific adaptations (groups 2 and 4). Interestingly, there are few examples of families containing promiscuous sequences that are representative of adaptations associated with intermediate taxonomic groups of bacteria . However, further investigations are required to determine if this is biologically meaningful or simply an artifact associated with the sequence clustering algorithm.Dividing the prokaryotic genomes into 13 distinct taxonomic groupings taxonomy resource ), compreWithin the three main proteobacterial divisions 2-3% of their sequences were common (found in at least one species from each of the three main divisions) and specific to proteobacteria . Furthermore, a greater fraction of Betaproteobacterial (6.8%) and Gamma/Delta/Epsilonproteobacterial (4.1%) sequences shared significant similarity with sequences from the other group, compared with the Alphaproteobacteria. Even considering the different sizes of the datasets, these results suggest a closer evolutionary relationship between these first two groups consistent with previous findings .Within Archaea, a large fraction of sequences was found to be common and specific to the various archaeal groups. For example, 8.6% of sequences associated with Crenarchaeota are specific and common across the Euryacheaota/Crenarchaeota lineage, while 24.3% of Nanoarchaeota genes share sequence similarity only with other Archaea. This suggests a common core of archaeal specific sequences and demonstrates the divergence between archaea and bacteria.Due to the lack of a robustly defined bacterial phylogeny, rather than attempt to map the remaining sequences common across deeper taxonomic groups, we analyzed the occurrence of sequences with similarity to sequences from one or more additional taxa Figure . The larDue to the limited number and lack of diversity associated with complete genomes, we chose to exploit the large number of partial genomes to perform a similar mapping of eukaryotic sequences within a phylogenetic framework. Partial genomes were divided into 20 distinct taxa and comprehensive BLAST analyses were again used to compare sequences within a phylogenetic framework of taxon- and species-specific sequences than the prokaryotic datasets. As might be expected, taxa with larger numbers of species contained the highest proportion of conserved taxon-specific sequences : plants ; ascomycetes and tylenchids . Comparisons between taxa revealed several branches that contain a relatively large proportion of common sequences. Within the nematodes, for example, 10.6% of the 29,666 spirurid sequences have similarity only to rhabditid and/or tylenchid sequences, while reciprocally, 7.4% of the 60,366 rhabditid and tylenchid sequences are also common only to spirurids (the difference in percentages is likely due to the different sizes of the respective datasets). Similarly, 6% of the 14,785 basidiomycete sequences and 3.6% of the 44,358 ascomycete sequences are specific to basidiomycetes and ascomycetes, while 5.4% of 46,420 tetrapod sequences and 8.2% of 28,971 teleost sequences are common and specific to tetrapods and teleosts. These sequences potentially represent core sets of essential nematode, fungi and vertebrate specific genes that arose relatively early in their respective lineages.Interestingly, despite comparable sequence and gene family discovery rates Table , the artMany sequences are also associated with deeper taxonomic splits within Eukarya. Of particular note, approximately 8% of metazoan sequences are common and specific to the protostomes and deuterostomes. These likely represent sequences involved in providing basic multicellular functionality . Additionally, 1.8% of metazoan sequences and 4.8% of fungal sequences are common to the fungi/metazoan divide. Again, these sequences may represent specific adaptations adopted by the early ancestors of the opistokonts. Since the root of the tree connecting protists, plants and fungi/metazoa has not been well defined, we analyzed each combination separately. Approximately 18-21% of eukaryotic sequences are common to each of the three major eukaryotic taxonomic groups. These sequences are expected to be involved in basic housekeeping functions, such as DNA processing and cellular metabolism.Comparisons with the prokaryotic datasets revealed that sequences furthest from the root of eukaryotes were less likely to share similarity with a prokaryotic sequence. For example, 58.8% of the 102,868 core eukaryotic sequences, 29.4% of the 5,573 Fungi-Metazoa specific sequences, and only 14.2% of the 15,486 Metazoa specific sequences shared similarity with a prokaryotic sequence. Furthermore, for the majority (135 of 193) of the species-specific datasets, less than 2% of their sequences had significant matches to a prokaryotic sequence. The incidence of a small fraction of these sequences sharing similarity with prokaryotic sequences may reflect a low incidence sequence acquisition through LGT .While the use of partial genomes offers a breadth and depth of sequence sampling unrivalled by full genomes, potential drawbacks of these datasets have been documented ,17,41. IThe sequence datasets reported here are provided as a community resource through interactive images available online . To demoRecently there has been considerable interest in exploring the generation and extent of genetic diversity ,5,20. DuA major driving force of sequence diversity is thought to involve the duplication of genes followed by their subsequent divergence ,12. The Focusing on eukaryotes, by mapping their sequences onto a phylogenetic framework, we identified a widely populated spectrum of sequence specificity. At one extreme approximately 20% of eukaryotic sequences are highly conserved and may represent ancestral eukaryotic genes under significant selective constraints. At the other extreme, from 40-60% of sequences are specific to individual or closely related species. Such sequences represent genes that are either under reduced selective constraints, provide newly acquired functionality or are With current ambiguities in the timing of divergence events , interprThe collation and comparison of EST based datasets from 193 species provides the first detailed analysis of sequence conservation across Eukarya and highlights significant differences from prokaryotes. In particular, we find that eukaryotes have a much higher incidence of novel sequences than prokaryotes, which may be related to the lower incidence of LGT events. Placing these sequences within a phylogenetic framework provides a detailed map of the origins and extent of sequence diversity. It further allows the identification of sequences specific and conserved to distinct taxonomic groups that are likely to be associated with novel taxon specific innovations. The provision of taxon specific sequences should thus prove valuable for additional computational and biochemical analyses aimed at understanding evolutionary and functional relationships.The predicted protein sequences of 198 complete genomes used in this study were obtained from the COGENT database . Sequenc-5). Previous studies have concluded that the choice of threshold does not significantly affect qualitative findings in these types of analyses [Given the scale of sequence similarity searches, BLAST providesanalyses ,17. We tC. elegans from Wormbase [Gene family predictions for the 198 complete genome datasets obtained from COGENT have previously been calculated through the use of the TribeMCL algorithm . In ordeWormbase database . All seqCGDR, current gene family discovery rate; CSDR, current sequence discovery rate; EST, expressed sequence tag; KEGG, Kyoto Encyclopedia of Genes and Genomes; LGT, lateral gene transfer; MCL, Markov clustering; Mya, millions of years; NCBI, National Center for Biotechnology Information; OGDR, overall gene family discovery rate; OSDR, overall sequence discovery rate.JP and JMP-A conceived and designed the experiments. JMP-A collated sequence datasets, designed and performed the cross-species and gene family analyses and helped draft the manuscript. JP undertook the functional characterization analyses, wrote the manuscript and supervised the project. Both authors read and approved the final manuscript.The following additional data are available with the online version of this paper. Additional data file Phylogenetic relationships of the taxonomic groups discussed in the main text.Click here for fileSpecies used in the study together with a detailed breakdown of the taxonomic relationships of their sequences.Click here for fileSpecies used in the study together with a detailed breakdown of the taxonomic relationships of their sequences.Click here for fileComparison of sequence similarity relationships between members of 16 highly conserved gene families for eukaryotes and bacteria.Click here for fileRates of sequence and gene family discovery in different sets of complete and partial genomes.Click here for fileRelationship between genome size and number of species-specific sequences.Click here for fileRelationship between sequence conservation and length.Click here for file

Streptococcus pneumoniae. The nasopharyngeal carriage prevalence of particular serotypes is relatively stable worldwide, but the host and bacterial factors that maintain these patterns are poorly understood. Given the possibility of serotype replacement following vaccination against seven clinically important serotypes, it is increasingly important to understand these factors. We hypothesized that the biochemical structure of the capsular polysaccharides could influence the degree of encapsulation of different serotypes, their susceptibility to killing by neutrophils, and ultimately their success during nasopharyngeal carriage. We sought to measure biological differences among capsular serotypes that may account for epidemiological patterns. Using an in vitro assay with both isogenic capsule-switch variants and clinical carriage isolates, we found an association between increased carriage prevalence and resistance to non-opsonic neutrophil-mediated killing, and serotypes that were resistant to neutrophil-mediated killing tended to be more heavily encapsulated, as determined by FITC-dextran exclusion. Next, we identified a link between polysaccharide structure and carriage prevalence. Significantly, non-vaccine serotypes that have become common in vaccinated populations tend to be those with fewer carbons per repeat unit and low energy expended per repeat unit, suggesting a novel biological principle to explain patterns of serotype replacement. More prevalent serotypes are more heavily encapsulated and more resistant to neutrophil-mediated killing, and these phenotypes are associated with the structure of the capsular polysaccharide, suggesting a direct relationship between polysaccharide biochemistry and the success of a serotype during nasopharyngeal carriage and potentially providing a method for predicting serotype replacement.There are 91 known capsular serotypes of Streptococcus pneumoniae, or pneumococcus, is an important pathogen worldwide and causes a wide range of diseases, mostly in young children and the elderly. There are 91 serotypes of pneumococcus, each of which produces a unique polysaccharide, called the capsule, that attaches to the bacterial surface and prevents it from being cleared by the host. The serotypes differ greatly in their prevalence in the human population. There is currently a vaccine, effective in infancy, which targets seven clinically important serotypes, but several types not covered by the vaccine are beginning to increase in carriage frequency. As a result, it is critical to understand why some serotypes are frequently carried in the human population while others are not. In this study, we find that the high-prevalence serotypes tend to be more heavily encapsulated and more resistant to killing by neutrophils. Significantly, we find that the biochemical properties of the different polysaccharides can be used to predict their carriage frequency both before and after introduction of the vaccine. These results provide a biologically plausible explanation for differences in prevalence between serotypes. Streptococcus pneumoniae, or pneumococcus, is an important pathogen worldwide and is a causative agent of pneumonia, meningitis and otitis media. There are 91 known pneumococcal serotypes, and each produces a biochemically distinct polysaccharide capsule that is in most cases covalently attached to the cell wall. Serotype affects nearly every aspect of pneumococcal pathogenesis and of nasopharyngeal carriage, which precedes disease and serves as the reservoir for transmission of the organism The polysaccharide-protein pneumococcal conjugate vaccine targets seven clinically relevant serotypes in young children. Currently, the vaccine is in widespread use, and while PCV7 has been largely successful at reducing the burden of invasive pneumococcal disease in the United States. in vitro are more virulent in vivoDuration of carriage, a determinant of prevalence, varies between serotypes Immune-mediated clearance from the nasopharynx involves both antibody-dependent and antibody-independent mechanisms of immunity Capsular polysaccharide quantity and degree of encapsulation could be influenced by a number of factors, and recent work has demonstrated that sugar metabolism could play a regulatory role First, we evaluated whether the production of a capsule affected susceptibility to opsonin-independent killing by human neutrophils. We tested an invasive type 6B clinical isolate, its unencapsulated isogenic derivative and the reconstituted strain with the type 6B capsule locus reinserted. The wild type and the reconstituted encapsulated strain were significantly more resistant to killing than the unencapsulated mutant . AdditioTo test whether highly prevalent serotypes are more resistant to neutrophil-mediated killing, we used a panel of TIGR4 capsule-switch variants that are isogenic except for the capsule locus. The more prevalent serotypes, such as 19F and 23F, were indeed most resistant to killing, while types that are rarely isolated from carriage, such as types 4 and 5, were more efficiently killed . Consistent with our hypothesis, while only 1% of the inoculum was type 19F, 90% of the colonies recovered from the nasal washes after 7 days were type 19F, indicating that type 19F colonizes mice significantly better than type 14 .Having found a relationship between prevalence and degree of encapsulation and resistance to neutrophil-mediated killing, we next wanted to evaluate bacterial factors that could influence these phenotypes. We hypothesized that the extent of encapsulation, and subsequently the epidemiologic properties of the serotype, could be constrained by the metabolic requirements for biosynthesis of different capsular polysaccharides. By examining published polysaccharide structures and biochemical pathways, we determined the number of carbons and the number of high-energy bonds that are required to generate one polysaccharide repeat unit. Consistent with the hypothesis, we found a significant association between these measures of metabolic cost and degree of encapsulation and a trend between metabolic cost and resistance to non-opsonic killing .Next, we evaluated the relationship between these correlates of polysaccharide structure and carriage prevalence. We began by assessing prevalence in populations not exposed to PCV7. Using carriage data pooled from three studies in the United Kingdom, the United States, and The Netherlands, we found a statistically significant inverse correlation between metabolic cost and serotype frequency among circulating types . These aFinally, we evaluated the relationship between polysaccharide structure and prevalence in a population exposed to PCV7, which has opened an ecological niche for serotypes not included in the vaccine. To date, no principle has been identified to predict which non-vaccine serotypes would become most common in vaccinated populations. We hypothesized that metabolic cost might provide such a principle to predict which non-vaccine serotypes would become most common in vaccinated populations. We compared the prevalence of serotypes in a post-vaccine carriage sample in Massachusetts in 2004 Our data suggest a novel biological explanation for serotype patterns of pneumococcal carriage. If clearance of pneumococcus from the nasopharynx depends on T-cell-mediated immunity It is possible, though, that innate immune effectors in addition to or instead of neutrophils could determine the serotype prevalence hierarchy. In particular, phagocytes other than neutrophils could play a role, and antimicrobial peptides in vitro, but it is possible that under in vivo conditions, polysaccharide production causes a competitive disadvantage for some serotypes. It is also possible that our measures of “metabolic cost” do not reflect the true cost to the bacteria since the organisms could respond to environmental pressures by changing their carbon and energy utilization.While interactions with the host likely play a large role in shaping serotype patterns, polysaccharide production itself could affect the fitness of the bacterium and thus its ability to compete with other serotypes during colonization. We did not observe any meaningful differences in growth rate between serotypes Our findings provide a simple method for ranking serotype prevalence. The currently available vaccine for infants targets seven clinically relevant serotypes, but alternative formulations, including 10- and 13-valent vaccines, are being explored for use in developing countries. Since the relationship between polysaccharide structure and serotype prevalence is observed in both vaccinated and unvaccinated populations, this could potentially be used as a tool for predicting patterns of serotype replacement in different settings.in vitro predictor of these epidemiologic traits –susceptibility to non-opsonic killing – is determined in large part by capsular type rather than bacterial genetic background; moreover, using multiple clinical isolates, we have shown that these in vitro properties of different serotypes are consistent across diverse genetic backgrounds. However, it is also clear from our data that these in vitro properties can vary within capsular serotypes, consistent with the possibility that noncapsular factors, such as bacterial adhesins, could affect the success of a strain during colonization and could subsequently influence patterns of serotype replacement. Certain clones have been particularly successful and have acquired multiple serotypes It has long been known that many characteristics of pneumococcal epidemiology were associated with serotype. Here, using two sets of pneumococci that are isogenic except for their capsular serotypes, we have shown that an The mechanistic explanation for the association between polysaccharide structure and degree of encapsulation remains to be elucidated. We evaluated a number of structural features including the number of particular monosaccharide units, number of N-acetylated sugars and number and proportion of hydrophobic residues. One possibility is that limited supplies of energy or carbon impose more stringent limits on the production of metabolically costly capsule subunits than on the production of less costly ones. Another possibility, not mutually exclusive, results from the fact that serotypes with less costly polysaccharide repeat units also tend to have a higher ratio of charged molecules per carbon. While capsular charge does not have a large direct effect on interactions with neutrophils, it can affect the 3-dimensional stability of the capsule and the degree of encapsulation of the bacteria It has previously been noted that there is an inverse correlation between carriage prevalence and invasiveness We have evaluated degree of encapsulation by measuring the zone of inhibition of FITC-Dextran by the capsule. While this method does not directly determine polysaccharide quantity, it does provide a physiologically relevant measure of capsule thickness, which could in turn affect accessibility of a number of surface structures that could be recognized by neutrophils and other immune effectors.These findings raise several additional questions that should be addressed in future studies. From the population-biological perspective, a key question is: if metabolically costly capsules reduce the ability of pneumococci to persist in the nasopharynx, how do these capsular types persist in the population in the face of competition from the metabolically less costly, more common types? One possibility is that these types occupy a distinct ecological niche. Such a niche could be a direct consequence of these strains' less pronounced capsule or could be created by the existence of serotype-specific immunity in some hosts, which may be most prevalent against the most common types, providing an advantage to the less common types to which fewer hosts are naïve in vitro and furthermore by biochemical properties of the capsules themselves. Previously, it had been observed that capsular types differ in their epidemiological properties In summary, these results suggest that the epidemiologic phenomena of serotype-specific prevalence in carriage and possibly serotype replacement can be explained, in substantial part, by bacterial characteristics measurable Blood was obtained from healthy volunteers according to a protocol approved by the Office of Human Research Administration at Harvard School of Public Health. Neutrophils were isolated using a Histopaque 10771, 11191 gradient according to the manufacturer's instructions and used immediately.WT is a type 6B invasive disease isolate cap- was constructed by replacement of the capsule biosynthesis locus with the Janus cassette, and 603cap-:6B was constructed by transforming 603cap- with genomic DNA from the parent strain, as described previously 2 unless otherwise noted. In some cases, strains were grown in a semi-defined minimal media Capsule-switch variants were constructed on the TIGR4 genetic background 3 CFU/mL in saline, and 10 µL of this suspension was spotted and allowed to dry at room temperature on trypticase soy agar with 5% defibrinated sheep blood (TSA II) (BD) with 10 replicates per plate. Twenty microliters of neutrophils (2×106 cells/mL) were then overlaid, allowed to dry, and incubated overnight at 37° with 5% CO2. Percent survival was calculated by comparing killing of each strain to a duplicate control plate with no neutrophils. All experiments were repeated on several days with different frozen lots of bacteria. The overall killing efficiency varied between experiments, so we normalized the data by dividing percent survival for each serotype by percent survival of type 9N to obtain relative survival. The mean relative survival from at least two independent experiments is presented unless otherwise stated. For experiments comparing susceptibility to killing of isogenic capsule switch variants and clinical isolates, the serogroup mean survival was used.Neutrophil surface killing assays were performed as described previously Bacteria were grown to mid-log phase, washed in Hanks balanced salt solution (HBSS) with 1% BSA, resuspended in FITC (0.5 mg/mL in HBSS/1%BSA) and incubated for 1 hour at 4°. The bacteria were then washed twice and frozen in HBSS/1%BSA with 10% glycerol. Staining was evaluated by flow cytometry to ensure equivalent staining between strains.8 CFU/mL. 50 µL of bacteria were added to each well, allowed to dry, and overlaid with 2.5×105 neutrophils in 50 µL. After 20 minutes, 1 mL ice cold HBSS/BSA was added to each well to harvest the neutrophils. This mixture was then washed twice and fixed with 1% formalin for 2 hours. Bacterial association with the neutrophils was assessed by flow cytometry using a MoFlo flow cytometer , and analysis was performed in Summit v4.3 (Dako). The average relative fluorescence from two independent experiments is presented.To evaluate bacterial association with human neutrophils, we developed a protocol based in part on Lee et al. The degree of encapsulation was determined by measuring the zone of exclusion of FITC-dextran , based on the method of Gates et al. Strains were grown in 10 mL semi-defined media with 10 mM of glucose or fructose to mid-log phase and centrifuged. The concentration was adjusted to OD620 = 0.6 in 1 mL, and the suspension was lysed with 0.1% deoxycholate for 30 minutes and incubated with 100 U mutanolysin overnight at 37° 6 CFU of strain TIGR4:14 and 3.5×104 CFU of strain TIGR4:19F. At one week post-inoculation, mice were euthanized by CO2 inhalation and tracheal washes were collected from the nostrils. Colonization density of each strain was determined by colony morphology and serotype was confirmed by latex agglutination . All animals were handled in strict accordance with good animal practice, and all animal work was approved by the Harvard Institutional Animal Care and Use Committee.5 week old C57/BL6J were inoculated intranasally as described previously www.biocyc.orgChemical structures of the capsular polysaccharide units were obtained from Kamerling Carriage prevalence data were obtained from Percent survival between strains was compared using either t-tests or ANOVA, as appropriate. Non-parametric Spearman correlation was used to evaluate the relationship between epidemiologic measures and resistance to neutrophil mediated killing or chemical composition of the capsule. For post-PCV7 correlations, serotypes targeted by the vaccine and those lacking structural information were ignored. Linear regression was used to evaluate the relationship between neutrophil-mediated killing of isogenic capsule switch variants and clinical carriage isolates. Analyses and graphing were performed in Graphpad Prism v5.0.Figure S1Relationship between carriage prevalence and resistance to neutrophil-mediated killing using isogenic capsule-switch variants constructed in strain 603.(0.03 MB PDF)Click here for additional data file.Figure S2Representative images of TIGR4:19F, TIGR4:5 suspended in India ink.(0.05 MB PDF)Click here for additional data file.Figure S3Growth of TIGR4 isogenic capsule-switch variants in fructose leads to increased susceptibility of heavily encapsulated serotypes to neutrophil-mediated killing compared to the same strains grown in glucose.(0.04 MB PDF)Click here for additional data file.Figure S4Relationship between serotype prevalence after vaccination in Massachusetts (2004) and A) degree of encapsulation , and B) survival from neutrophil-mediated killing .(0.04 MB PDF)Click here for additional data file.Table S1Number of carbons and high energy bonds required to generate one polysaccharide repeat unit. For calculations of energy/repeat unit, acetate and pyruvate were excluded because they are byproducts of central metabolism. For calculations of carbon/repeat unit, choline was also excluded since it is imported into the cell and does not affect carbon utilization. Non-whole numbers are due to non-stoichiometric acetylation or addition of choline.(0.05 MB PDF)Click here for additional data file.Table S2Clinical isolates used in this study. Within a serogroup, isolates of diverse multi-locus sequence types were chosen when available.(0.05 MB PDF)Click here for additional data file.

Genome sequencing projects generate massive amounts of sequence data but there are still many proteins whose functions remain unknown. The availability of large scale protein-protein interaction data sets makes it possible to develop new function prediction methods based on protein-protein interaction (PPI) networks. Although several existing methods combine multiple information resources, there is no study that integrates protein domain information and PPI networks to predict protein functions.The domain context similarity can be a useful index to predict protein function similarity. The prediction accuracy of our method in yeast is between 63%-67%, which outperforms the other methods in terms of ROC curves.This paper presents a novel protein function prediction method that combines protein domain composition information and PPI networks. Performance evaluations show that this method outperforms existing methods. Genome sequencing projects are generating massive amounts of sequence data, and the functional annotation of these sequences became one of the most challenging tasks, especially for the many proteins whose functions remain unknown. Traditional computational methods have utilized sequence features and machine learning algorithms to predict functions. In recent years, high-throughput technologies, such as yeast-two hybrid, have provided large scale protein-protein interaction data, making it possible to develop new function prediction methods based on protein-protein interaction (PPI) networks ,2.Existing protein function prediction methods based on PPI can be categorized into two classes: direct methods based only on the protein interactions and module-assisted methods . Direct Direct methods are based on the assumption that interacting proteins probably have identical or similar functions -7. This Vazquez et al assignedInstead of predicting individual protein functions, module-assisted methods first identify functional modules in PPI networks and then assign functions to the proteins according to functions of the module members. These methods are based on previous observations that a group of cellular components and their interactions usually can be attributed to a specific function ,12,13. TAlthough several existing methods have combined multiple information resources, such as gene expression information, gene regulatory networks and PPI networks, none of them have yet integrated protein domain information and PPI networks to predict protein functions. This paper presents a novel protein function prediction method that uses protein domain composition and PPI networks. This paper first demonstrates that proteins having similar functions are often in similar domain contexts in PPI networks and then develops the protein function prediction method based on this observation. The method gives satisfactory results compared to several existing methods.Yeast PPI network data was obtained from DIP database . 4,389 pThe domain annotation information was retrieved from the PFAM database ,21. The Domains are basic functional units in proteins. Cellular functions are accomplished by the cooperation of many domains in proteins. Therefore, the PPI network was decomposed into the domain level to investigate protein functions in terms of domain. Figure The domain context similarity (denoted as f) is defined as:Where M is the number of domain types in the PPI network. Given proteins A and B, SA and SB are the sets of domains included in A's neighbors and in B's neighbors. The number of domain types in SA is a, while the number of domain types in SB is b. The intersection of SA and SB is S, containing s types of domains. C(M:s) denotes combinatorial numbers. The larger f indicates a greater probability that A and B share similar functions.For each GO term, there is a positive data set composed of present proteins, and a negative data set including absent ones. For example, GO:0009277 is used to describe 107 yeast proteins, so these proteins were treated as positive samples. Since some GO terms contains only a few proteins and other GO terms are too general, only GO terms containing 10-200 proteins were considered.Given a protein P with unknown function, in order to examine its function with regard to each particular GO term, the domain context similarities, f, between P and each protein in both the positive and negative data sets were calculated. The function annotation of the protein with the highest f value was then assigned to P.The 7-fold cross validation, which has been widely implemented in previous researches ,24, was Four frequently used measurement indices, accuracy, precision, recall and Mathew correlation coefficient (MCC), were used to evaluate the prediction performance. The Mathew correlation coefficient (MCC) was calculated to assess the prediction performance when the numbers of proteins in the positive and negative data sets differed significantly. MCC ranges from -1 to 1, a larger MCC indicating better prediction performance. For data with positive predictions, the real positives are defined as true positives (TP), while others are defined as false positives (FP). For data with negative predictions, the real positives are defined as false negatives (FN), while the others are defined as true negatives (TN). Then, the measurement indices are defined as:-15. The distributions of the similarity for sets A and B are shown in Figures The relationships between protein function similarity and domain context similarity in the PPI network were investigated based on the measurement indices. First, 1000 pairs of proteins were randomly extracted from one GO term with the domain context similarity, f, then calculated for each pair (denoted as set A). Secondly, another 1000 random protein pairs were generated using pair of proteins from different GO terms. Their f values are also calculated (denoted as set B). The two sets of similarities were then compared to demonstrate the positive significant relationship between functional similarity and domain context similarity. The results showed that set A has a mean similarity, f, of 9.23 compared to 0.46 for set B. Kolmogorov-Smirnov test showed that set A is significantly higher than set B with a p-value less than 10The method was then used to predict protein functions in yeast. GO terms were divided into 4 groups according to the number of proteins in each GO term. GO terms containing less than 10 proteins were excluded due to the lack of a satisfactory number of proteins for accurate predictions. GO terms including more than 200 proteins were also eliminated because the function annotations in these GO terms are usually too general. The results are shown in Table The prediction accuracies are between 63%-67%. The results show that the method has satisfactory robustness for various numbers of proteins within one GO term. As number of proteins increases from 10-30 to 100-200, the accuracy only decreases slightly, by about 4%. The phenomenon that accuracies decrease as number of proteins in the GO term increases can be attributed to the fact that functional annotations in larger GO terms are not as specific as in smaller GO terms. Fuzzy, general annotation information may affect the prediction performance. Further investigation is required to explain this observation. Besides, the recall is higher than the precision, demonstrating that false positive predictions are more common than false negative predictions.This method was then compared with existing methods based on the ROC curves. The three previously developed methods included in comparison are MRF , NeighboA new prediction method for protein function based on protein-protein interaction and domain context was presented in this research. Domain context similarity in the protein-protein interaction network was defined and used as in index for prediction. The underling principle of this method was that proteins tend to interact with each other via domain-domain interaction. So the high quality domain-domain interaction information may improve the prediction accuracy. Riley at al developeThis research also suggests several future directions of research. First, domain context similarity measurements or prediction systems can be improved to reduce false positive predictions and boost accuracy. For example, the cutoff value for domain context similarity can be introduced to improve the accuracy and to deal with multiple function problems. Since the underlying rationale of this method is the domain-domain interaction, high-quality domain interactions can definitely contribute to the accuracy. As mentioned above, the newly developed domain interaction inferring method -28 can bThe availability of large scale protein-protein interaction data sets makes it possible to predict protein functions based on protein-protein interaction (PPI) networks. Several existing methods combine multiple information resources to predict protein functions. We present a novel protein function prediction method that combines protein domain composition information and PPI networks. Performance evaluations show that this method outperforms existing methods. The results are used to analyze the relationships between domain context similarity and protein function similarity, while this research may have potential future research directions.The authors declare that they have no competing interests.ZS, HC designed the study, collected study data, performed the analysis, prediction and cross validation and produced the first draft of the manuscript. KL provided assistance in the process of collecting data and revising the manuscript. ZS was involved in designing the study and revising the manuscript. All authors read and approved the final manuscript.

The prognostic role of epidermal growth factor receptor (EGFR) remains controversial in patients with lung cancer. Previous assays for EGFR have primarily been qualitative or, at best, semiquantitative. In the present study, using fresh-frozen tissue from 190 unselected lung cancer patients, quantification of EGFR (EGFR(ELISA)) using a recently developed enzyme-linked immunosorbent assay (ELISA) technique was compared with results (EGFR(IHC)) obtained using immunohistochemistry (IHC). Correlation between results obtained by the two different techniques was highly significant (r(s) = 0.63, P < 0.001, n = 190). This correlation improved even further (r(s) = 0.76) when sections were estimated using an IHC score that took into account percentage staining, intensity and relative tumour area. Furthermore, the relationship between clinicopathological features and prognosis was identical for the two methods. The expression of EGFR was highest in squamous cell carcinomas, but it was not correlated with other characteristics such as age, sex, histological grading, stage or prognosis. We conclude that evaluation of EGFR content using IHC and ELISA produces comparable results.

INK4A expression, unrelated to telomere status. Transduction to express bmi1, a repressor of the p16INK4A/p14ARF locus, conferred upon hESderK cells and keratinocytes a substantially extended lifespan. When exposed to transforming growth factor beta or to an incompletely processed form of Laminin-332, three lifespan-extended or immortalized hESderK lines that we studied became directionally hypermotile, a wound healing and invasion response previously characterized in keratinocytes. In organotypic culture, hESderK cells stratified and expressed involucrin and K10, as do epidermal keratinocytes in vivo. However, their growth requirements were less stringent than keratinocytes. We then extended the comparison to endoderm-derived, p63+/K14+ urothelial and tracheobronchial epithelial cells. Primary and immortalized lines of these cell types had growth requirements and hypermotility responses similar to keratinocytes and bmi1 expression facilitated their immortalization by engineering to express the catalytic subunit of telomerase (TERT). In organotypic culture, they stratified and exhibited squamous metaplasia, expressing involucrin and K10. Thus, hESderK cells proved to be distinct from all three normal p63+ cell types tested. These results indicate that hESderK cells cannot be identified conclusively as keratinocytes or even as ectodermal cells, but may represent an incomplete form of, or deviation from, normal p63+ lineage development.Human embryonic stem (hES) cells can generate cells expressing p63, K14, and involucrin, which have been proposed to be keratinocytes. Although these hES-derived, keratinocyte-like (hESderK) cells form epithelioid colonies when cultured in a fibroblast feeder system optimal for normal tissue-derived keratinocytes, they have a very short replicative lifespan unless engineered to express HPV16 E6E7. We report here that hESderK cells undergo senescence associated with p16 Since their initial cultivation and characterization , 2, humaThe keratinocyte is the cell type that forms stratified squamous epithelia, including the epidermis and corneal, esophageal, oropharyngeal, vaginal, and exocervical epithelia. These epithelia have distinctive cytokeratin expression patterns and suprabasal architecture –19 and acip1-dependent senescence mechanism triggered by progressive telomere erosion. However, keratinocyte lifespan typically is determined by the timing of derepression of the CDKN2A gene, encoding the cell cycle inhibitors p16INK4A and p14ARF. This event, referred to as “p16 senescence,” occurs abruptly and with ever increasing frequency during serial passage to 0.4 mM, and pen/strep. To generate healthy high-density cultures, cells were grown to ∼40% confluence in K-sfm, then refed daily with a 1:1 (vol:vol) mixture of K-sfm and “DF-K medium,” the latter consisting of a 1:1 (vol:vol) mixture of calcium-free, glutamine-free DMEM (Gibco) and Ham's F-12 (Gibco) + 0.2 ng/ml EGF + 25 μg/ml BPE + 1.5 mM L-glutamine + pen/strep.For some experiments, cells were cultured using the feeder/FAD system , 21, 52:escribed with 25 http://www.cambrex.com) and its derivatives were cultured in BEGM medium (Cambrex). R2F primary human fibroblasts and LP9 primary human mesothelial cells were grown in serum- and mitogen-supplemented media as described ); p63 ; and K10 (AE20) and K5 (AE14) .Murine monoclonal antibodies (MuMoAb) used were as follows: p16http://www.vectorlabs.com), as described [http://www.digitalinstruments.com).Cultured cells were fixed and permeabilized in 100% cold methanol, or fixed in fresh 4% paraformaldehyde and permeabilized with Triton X-100, and immunostained using avidin-biotin-complex (ABC) peroxidase and NovaRed substrate and stored at −20°C. Wells were precoated by incubating with 804G CM diluted one-third with 10% serum DMEM for 30 minutes at 37°C and rinsed 3× with phosphate-buffered saline (PBS) and once with K-sfm before plating cells in K-sfm. For some experiments, cells were plated on untreated dishes in K-sfm +0.3 ng/ml recombinant human TGFβ1 , added from a 1,000× concentrated solution in 4 mM HCl +0.1% BSA.Transforming growth factor beta (TGFβ)- and Lam-332′-induced hypermotility was visualized and quantitated as described . Conditi2+ K-sfm +TGFβ, in 10% formalin/PBS for 30 minutes and immunostained as described earlier with Laminin γ2 MuMoAb D4B5 (Chemicon). Fifteen to 20 fields were photographed using a 2× objective. Laminin-332 pads and tracks deposited by >100 cells were scored for length and width, as described [To measure directional hypermotility, wells plated with 700 cells were fixed 1 day after plating on Lam-332′-precoated dishes, or 2 days after plating in 0.1 mM Cahttp://www.roche-applied-science.com) and sonically disrupted. Thirty micrograms (Bio-Rad assay) of extract protein was separated by SDS-PAGE under reducing conditions in precast, 4%–20% gradient gels , electrotransferred to PVDF membranes (Millipore), and specific proteins detected by incubation with primary antibodies, peroxidase-conjugated secondary antibody , and ECL chemiluminescence reagent . Membranes were stripped of antibody using BlotFresh and reprobed with β-actin antibody as loading control.Proliferating cultures were trypsinized, PBS-rinsed, lysed in 20 mM Tris buffer (pH 7.3) +2% SDS +protease inhibitor cocktail cell population recovered from H9 hES teratomas by cultivation in semidefined keratinocyte media or with 3T3 feeder support could not be propagated beyond 10–15 PD [INK4A induction. In their final passage, all large, nondividing hESderK cells proved to be p16+ . As reveINK4A senescence mechanism and the hypermotility response was consistent with an identity as keratinocyte.We concluded from all the above experiments that expression of E6E7, bmi1, or bmi1+TERT did not substantially alter the morphology, growth, or marker protein expression of normal somatic keratinocytes. Therefore, the morphologic and growth requirement differences between hESderK cells and normal keratinocytes cannot be attributed to the methods used to extend lifespan or immortalize them. Despite these differences, the expression of p63, K14, involucrin, and Laminin-332 by hESderK cells and their possession of the p16We next compared the tissue-forming ability of hESderK cells to that of epidermal keratinocytes in organotypic culture. In these conditions, normal and E6E7-engineered keratinocytes and hESderK/E6E7 clone K cells formed stratified epithelia with a normal pattern of p63 expression . NeitherThe three hESderK lines all formed multilayered epithelia that differed morphologically, by absence of a stratum corneum-like layer, from the epithelia formed by strain N and its derivatives and by the ∼20 wk fetal epidermal keratinocyte line J4Ep. hESderK/E6E7 clK formed the thickest epithelium (even thicker than that formed by strain N or N/E6E7) and hESderK/bmi1 the thinnest, but the morphologic structures formed by the three hESderK lines were similar . hESderKINK4A/p14ARF-enforced senescence, such that TERT transduction did not result in immortalization but transduction to express bmi1 repressed p16 expression , comparing cultures grown to near confluence in the same feeder/FAD conditions to avoid the possibility that different culture medium formulations would influence protein expression. All cell types and their engineered versions retained expression of these markers . Urothel+ epithelial cell types other than keratinocytes can activate expression of involucrin during growth in conventional culture, even in conditions that promote rapid proliferation, and that they can display a squamous metaplastic, keratinized form of differentiation in standard organotypic culture conditions, which had been optimized originally for epidermal keratinocyte histogenesis. This precluded conclusive identification of hESderK cells as a keratinocyte or any specific somatic epithelial cell type.Finally, we examined the histogenic potential of urothelial and tracheobronchial cells . Both ce+/K14+ cells that can arise from hES cells. We and others [Our objective was to identify the p63d others –37 had cINK4A/p14ARF senescence mechanism, apparently identical to that of normal keratinocytes and other p63+ epithelial cell types but subject to induction sooner during serial culture than it is in normal epithelial cells. hESderK cells resembled a short lifespan primary keratinocyte line and the primary urothelial and tracheobronchial epithelial cell lines studied here, in that they were not immortalized by TERT expression alone. Transduction to express bmi1, which maintains the normal, repressed state of the p16INK4A/p14ARF locus [TERT to yield immortalized lines but, instead, made cells permissive for TERT immortalization. An advantage of using bmi1+TERT to immortalize epithelial cells is that, unlike E6E7 expression, or the coexpression of dominant-negative mutant p53, p16-resistant mutant cdk4, and TERT that we used previously [CDKN2A resulting in loss of or reduced p16/p14ARF expression [The very limited replicative potential of hESderK cells proved to be the consequence of a p16RF locus –49, greaRF locus , bmi1 exeviously , p53- anpression –25. Bmi1+ epithelial cells. p16 is neither expressed in normal epithelial tissues nor is necessary for their development [CDKN2A, fine-tuning it for normal repression and ability to be activated in appropriate circumstances, may not occur during the several week period in which hESderK cells form from hES cells in the experimental settings used to date. hESderK cells also do not have the same growth requirements as normal p63+ epithelial cells. Unless assisted by E6E7 expression, they did not grow as rapidly as normal p63+ cell types in the feeder/FAD or K-sfm systems and hESderK cells could to grow in serum-supplemented medium without fibroblast feeder cell support and without EGF. They neither form extensive cell-cell junctions nor did stratify in colony centers during growth in the feeder/FAD system, as do normal p63+ cell types. This suggests that p63+ cells derived experimentally from hES cells either did not have the time or did not have the proper environment to fully develop the growth and differentiation regulatory mechanisms of normal somatic epithelial cells.The mechanism triggering p16 expression and senescence appears to be much more sensitive to activation in hESderK cells than in normal somatic p63elopment , 29, 31 elopment , 31. In +, Laminin-332+ cell types.Research on p63 has focused on its role in epidermal development, differentiation, and proliferative potential , 42, 58 + epithelial cell types of endodermal origin, which normally either do not stratify or do not become cornified in vivo, express in culture the stratified squamous epithelial cornified envelope protein involucrin and the epidermoid differentiation-related keratin filament protein K10. The organotypic culture system widely used to evaluate epithelial differentiation was originally optimized to yield a well-differentiated epidermis from cultured epidermal keratinocytes [The morphology, growth requirements, and differentiation characteristics of urothelial and tracheobronchial epithelial cells in culture more closely resembled those of keratinocytes than of hESderK cells. We were most surprised by the similar histogenic behavior and involucrin and K10 expression of all these cell types in organotypic culture. Our results showed that p63inocytes , 12. We inocytes . Involucinocytes , indicatinocytes in cultuinocytes . Differeinocytes , 19, 51,+ cell types arising from hES cells and improve culture conditions to obtain completely developed, proliferative somatic epithelial cell types restricted to formation of a single tissue. Previous studies have focused on the H9 and H1 hES cell lines. It will be very important to examine the p63+ differentiation potential of other hES lines, because hES lines vary with respect to their abilities to develop into various lineages [+ epithelial development and it remains to be determined whether they are on the pathway to ectodermal or endodermal lineages. Exposure to certain types of fetal mesenchyme may provide specific direction and induce lineage maturation. The morphology and some of the growth characteristics of the hESderK cells are reminiscent of the XB2 murine teratoma-derived, keratinocyte-like cell line, the discovery and early experimentation of which [Important future goals of this research are to characterize p63lineages . The hESof which . The hESThe authors indicate no potential conflict of interest.

M. bovis BCG can partially protect C57BL/6 mice against a subsequent footpad challenge with M. ulcerans. Unfortunately, this cross-reactive protection is insufficient to completely control the infection. Although genes encoding Ag85A from M. bovis BCG and from M. ulcerans are highly conserved, minor sequence differences exist, and use of the specific gene of M. ulcerans could possibly result in a more potent vaccine. Here we report on a comparison of immunogenicity and protective efficacy in C57BL/6 mice of Ag85A from M. tuberculosis and M. ulcerans, administered as a plasmid DNA vaccine, as a recombinant protein vaccine in adjuvant or as a combined DNA prime-protein boost vaccine. All three vaccination formulations induced cross-reactive humoral and cell-mediated immune responses, although species-specific Th1 type T cell epitopes could be identified in both the NH2-terminal region and the COOH-terminal region of the antigens. This partial species-specificity was reflected in a higher—albeit not sustained—protective efficacy of the M. ulcerans than of the M. tuberculosis vaccine, particularly when administered using the DNA prime-protein boost protocol.Vaccination with plasmid DNA encoding Ag85A from Buruli ulcer (BU) is an infectious disease characterized by deep, ulcerating skin lesions, particularly on arms and legs, that are provoked by a toxin. BU is caused by a microbe belonging to the same family that also causes tuberculosis and leprosy. The disease is emerging as a serious health problem, especially in West Africa. Vaccines are considered to be the most cost-effective strategy to control and eventually eradicate an infectious disease. For the moment, however, there is no good vaccine against BU, and it is still not fully understood which immune defence mechanisms are needed to control the infection. The identification of microbial components that are involved in the immune control is an essential step in the development of an effective vaccine. In this paper, we describe the identification of one of these microbial components, i.e., antigen 85A, a protein involved in the integrity of the cell wall of the microbe. Our findings obtained in a mouse model now need to be extended to other experimental animals and later to humans. Combination with a vaccine targeting the toxin may be a way to strengthen the effectiveness of the vaccine. Mycobacterium ulcerans (M. ulcerans) occurring mostly in tropical and subtropical areas. Cases have been reported in several countries in West and Central Africa, in Central and South America, in Southeast Asia and in Australia. BU is emerging as a serious health problem, especially in West Africa, where it is the third leading cause of mycobacterial disease in immunocompetent people, after tuberculosis and leprosy. In some countries in Africa, thousands of cases occur annually and in these areas BU has supplanted leprosy to become the second most important human mycobacterial disease. The natural history of M. ulcerans infection and subsequent development of BU is not completely elucidated. M. ulcerans bacteria have been found in endemic areas in stagnant water or slowly moving water sources and in aquatic snails and carnivorous insects M. ulcerans has the particularity to produce a family of toxin molecules, the so-called mycolactone (ML), polyketides that can suppress the immune system and destroy skin, underlying tissue and bone, causing severe deformities in vitro TNF-α production by murine macrophages infected with M. ulcerans (4) and it strongly affects the maturation and the migratory properties of DC M. ulcerans has an initial intracellular infection stage but virulent ML producing strains induce apoptosis of the infected cells and can subsequently be found extracellularly Mycobacterium species produce mycolactone toxins M. ulcerans isolates from different geographical areas produce different types of mycolactone, i.e. mycolactone A/B, C, D, E and F Buruli ulcer (BU), also known as Bairnsdale ulcer, is an infectious, necrotizing skin disease caused by M. ulcerans infection remains unclear. In general, resistance to intracellular bacteria is primarily mediated by T cells with pivotal roles of Th1 type cytokines IFN-γ and TNF-α and this apparently is the case for M. ulcerans infection as well M. ulceranset al demonstrated higher expression of IL-12p35, IL-12p40, Il-15, IL-1β and TNF-α in patients from the former group and higher expression levels of IL-8 (human homologue of MIP-2) in the latter group et al have also confirmed that in ulcerative lesions without granuloma, there is increased expression of IL-10 and higher bacillary counts. The nature of immune protection against M. ulcerans infection may be useful for serodiagnosis of BU. In contrast to tuberculosis and leprosy, immunoglobulin IgG antibody production against M ulcerans can be found even in early stages of infection M. ulcerans culture filtrate proteins can be detected in sera from 85% of confirmed BD patients and only in a small proportion in sera from healthy family controls M. ulcerans homologue of the M. leprae 18-kDa small heat shock protein -that has no homologues in M. bovis and M. tuberculosis- can be used as serological marker for exposure to M. ulceransIt is not yet clear whether antibodies play a protective role against BU but the humoral immune response during M. bovis BCG vaccine, used for the prevention of tuberculosis, has been reported to offer a short-lived protection against the development of skin ulcers M. ulcerans antigens that induce a protective immune response are poorly defined. The complete genome sequence of M. ulcerans has recently been published and will hopefully help to advance research and identification of relevant genes M. ulcerans bacilli in vitro and in vivo, and is immunogenic for both B and T cells in mice. Nevertheless, vaccination of mice with plasmid DNA encoding Hsp65 from M. leprae, having 96% sequence identity with Hsp65 from M. ulcerans, limited only weakly the progression of experimental M. ulcerans infection in tail M. bovis BCG can partially protect B6 mice against footpad challenge with M. ulceransM. bovis BCG, M. tuberculosis and M. avium subsp. paratuberculosisM. tuberculosis is a family of three proteins, Ag85A, Ag85B and Ag85C, which are encoded by three distinct but highly paralogous genes and that display an enzymatic mycolyl-transferase activity, involved in cell wall synthesis M. ulcerans and reported that it shares 84.1% amino acid sequence identity and 91% conserved residues with the gene encoding Ag85A from M. tuberculosis M. ulcerans have recently been sequenced as well and – as for M. tuberculosis- were localized on different loci in the genome BU results in considerable morbidity. Because of the late detection of the disease, treatment is principally by excision of the lesion, sometimes necessitating skin grafting M. tuberculosis and from M. ulcerans. Vaccines were administered as plasmid DNA, purified protein in adjuvant or in a DNA prime-protein boost protocol. We and others have previously reported that DNA priming followed by protein boosting is an effective means to increase the potential of DNA vaccines Here, we report on a comparison of the immunogenicity and protective efficacy of vaccines encoding Ag85A from C57BL/6 mice were bred in the Animal Facilities of the IPH-Pasteur Institute Brussels, from breeding couples originally obtained from Bantin & Kingman (UK). Mice were 8–10 weeks old at the start of the experiments. Female mice were used for immune analysis and male mice for the protection studies. This study has been reviewed and approved by the local Animal Ethics Committee (file number 030212/05).M. ulcerans type 1 strain 04-855 from a Benin patient was isolated at the Institute for Tropical Medicine in Antwerp, Belgium. Bacteria grown on Löwenstein-Jensen medium were maintained and amplified in vivo in footpad of the mice. M. bovis BCG strain GL2 was grown for 2 weeks as a surface pellicle at 37°C on synthetic Sauton medium and homogenized by ball mill as described before Virulent M. tuberculosis in V1J.ns-tPA vector was prepared as described before M. ulcerans was amplified by PCR without its mycobacterial signal sequence using BglII restriction site containing primers and ligated into the same V1J.ns-tPA vector. The primers used were 5′-GGAAGATCTTGAGCGCTTGGTACTAGGC-3′ (forward) and 5′-GGAAGATCTTTTCGCGGCCGGGCCTGCCGGTGGA-3′ (reverse). In these plasmids the Ag 85A gene is expressed under the control of the promoter of IE1 antigen from cytomegalovirus, including intron A and it is preceded by the signal sequence of human tissue plasminogen activator.Plasmid DNA encoding the mature 32 kD Ag85A from M. tuberculosis was purified from recombinant E. coli as described before M. ulcerans was amplified by PCR from V1J.ns.tPA-85A vector. The primers used were 5′-CGCGGATCCGCGTTTTCGCGGCCGGGCCTGCCGTGGAA-3′ (forward) and 5′-CCCAAGCTTGGGCTAGGCGCCCTGGGTGTCACCG-3′ (reverse) with respectively BamHI and Hind III restriction sites. Ag85A gene was amplified without its mycobacterial signal sequence. Cloning in expression vector pQE-80L (QIAGEN), containing an NH2-terminal histidine-tag coding sequence, and purification were performed as described before E. coli DH5α cells. For expression, Top-10F' E. coli (Invitrogen) cells were transformed with plasmid encoding the 85A sequence. Recombinant protein was purified by immobilized metal affinity chromatography (IMAC) using gravity flow. The endotoxin level measured with the LAL kinetic chromogenic assay, was inferior to 10 EU/ml (endotoxin units per millilitre) or 0.03 EU/µg of purified protein .Hexa-histidine tagged Ag85A protein from M. tuberculosis were synthesized as 20-mers, with the exception of the 18-mer spanning aa 35–53 and the 21 mer-peptide spanning amino acids 275–295 M. ulcerans were synthesized as 20-mers. All peptides were purchased from Ansynth Service B.V., The Netherlands.Peptides spanning the entire mature 295 amino-acid Ag85A sequence of M. ulcerans or from M. tuberculosis (abbreviated as Ag85A-DNA Mu and Ag85A-DNA Mtb in the figures). For protein immunization, mice were injected three times subcutaneously (s.c) in the back with 10 µg of purified recombinant Ag85A (abbreviated as rec85A-Mu and rec85A-Mtb in the figures), emulsified in Gerbu adjuvant, i.e. water miscible, lipid cationic biodegradable nanoparticles, completed with immunomodulators and GMDP glycopeptide . For the DNA prime-protein boost, mice were immunized twice i.m. with Ag85A DNA from M. ulcerans or from M. tuberculosis and boosted s.c. with 20 µg of recombinant Ag85A protein respectively from M. ulcerans or M. tuberculosis in Gerbu adjuvant (abbreviated as Ag85A-DNA/recMu and Ag85A-DNA/recMtb in the figures). All mice received the two first injections at 3 week intervals and the third injection was given two months later. For BCG vaccination, mice were injected intravenously, in a lateral tail vein, at the time of the first DNA injection with 0.2 mg (corresponding to 106 CFU) of freshly prepared live M. bovis BCG In experiment 1, B6 mice were anesthesized by intraperitoneal injection of ketamine-xylazine and injected three times intramuscularly (i.m) in both quadriceps muscles with 2×50 µg of control V1J.ns-tPA (empty vector), V1J.ns-tPA-Ag85A DNA from M. ulcerans or from M. tuberculosis. For protein immunization, mice were injected three times subcutaneously (s.c) in the back with 10 µg of purified recombinant Ag85A from M. ulcerans or from M. tuberculosis, emulsified in monophosphoryl lipid A (MPL-A) from Salmonella enterica serovar Minnesota ) solubilized in triethanolamine. For the DNA prime-protein boost, mice were immunized twice i.m. with Ag85A DNA from M. ulcerans or from M. tuberculosis and boosted s.c. with 20 µg of purified recombinant Ag85A protein respectively from M. ulcerans or from M. tuberculosis in MPL-A.In experiment 2, B6 mice were injected intramuscularly (i.m) three times, at 3 weeks intervals, in both quadriceps with 2×50 µg of control V1Jns.tPA DNA or plasmid DNA encoding 85A from M. ulcerans 3 months (Exp1) or 6 weeks (Exp2) after the last vaccination. 105 acid fast bacilli (AFB), obtained by in vivo passage in footpad, were injected in the right footpad of the vaccinated mice. The number of bacilli injected, suspended in Dubos Broth Base medium (Difco), was determined by counting under a microscope after Ziehl Neelsen staining. Viability of the M. ulcerans inoculum was checked by plating on 7H11 Middlebrook agar, supplemented with oleic-acid-albumin-dextrose-catalase enrichment medium. Yellow colonies were counted after 8 weeks of incubation at 32°C. The number of Colony Forming Units corresponded to the number of AFB.Naïve and vaccinated B6 mice were infected with 6 WBC/ml) from four mice per group were cultivated at 37°C in a humidified CO2 incubator in round-bottom micro well plates individually or pooled (as indicated) and analyzed for Th1 type cytokine response to purified recombinant his-tagged Ag85A (5 µg/ml), and synthetic peptides from M. ulcerans or M. tuberculosis (10 µg/ml). Supernatants from at least three wells were pooled and stored frozen at −20°C. Cytokines were harvested after 24 h (IL-2) and 72 h (IFN-γ), when peak values of the respective cytokines can be measured.Vaccinated mice were sacrificed 3 weeks after the third immunization (Experiment 1). Spleens were removed aseptically and homogenized in a loosely fitting Dounce homogenizer. Leucocytes (4×10Interleukin-2 (IL-2) activity was determined in duplicate on 24 h culture supernatants using a bio-assay with IL-2 dependent CTLL-2 cells as described before Interferon-γ (IFN-γ) activity was quantified by sandwich ELISA using coating antibody R4-6A2 and biotinylated detection antibody XMG1.2 obtained from Pharmingen. The standard murine recombinant IFN-γ used was obtained from R&D. The sensitivity of the assay is 10 pg/ml.M. ulcerans specific total anti-Ag85A Igκ antibodies (Abs) were determined by direct enzyme-linked immunosorbant assay (ELISA) in sera from individual mice (four/group). The concentration of Ab was expressed by the optical density at a dilution of 1/100 of the sera. For isotype analysis, peroxidase-labeled rat anti-mouse immunoglobulin G1 (IgG1) and IgG2b were used. Isotype titers were expressed as dilution endpoints value higher than a cut-off OD value calculated from the OD value plus three standard deviations (SD) of the secondary antibody only Sera from immunized mice were collected by tail bleeding 3 weeks after the third vaccination. Levels of 2×20 with the 22 mm ocular diameter used) was counted on microscope slides after Ziehl-Neelsen staining. In experiment 2 (MPL-A adjuvant), protection was evaluated by monitoring foot pad swelling after M. ulcerans infection. The swelling was measured with a calibrated Oditest apparatus with a resolution of 0.01 mm as described previously In experiment 1 (Gerbu adjuvant), protection was evaluated by enumeration of Acid Fast Bacilli (AFB) nine weeks after footpad infection. Briefly, the skin and bones were removed from infected foot pad. Tissues were homogenized in a Dounce homogenizer and suspended in 2 ml of Dubos broth based medium containing glass bead. The number of AFB in 20 fields , ** (P<0.01) and * (P<0.05). For the comparison of survival curves, logrank test was used.in vitro stimulation with purified recombinant Ag85A from M. ulcerans or from M. tuberculosis. As expected from the 91% sequence similarity between both antigens, highly cross-reactive immune responses were observed, mice vaccinated with M. ulcerans vaccines recognizing the M. tuberculosis antigen and vice versa. Nevertheless, a certain level of species specificity was observed, particularly in the IL-2 responses. Confirming previous results obtained with a M. tuberculosis DNA vaccine M. ulcerans protein increased significantly Ag 85A specific IL-2 and IFN-γ responses.Spleen cells from mice vaccinated with the three different vaccine formulations produced significant levels of IL-2 and IFN-M. ulcerans in mice vaccinated with the M. ulcerans and M. tuberculosis vaccines or M. tuberculosis DNA (black bars). Spleen cells from B6 mice vaccinated with M.ulcerans-Ag85A DNA produced significant levels of IL-2 between Ag85A from of IL-2 and IFN- of IL-2 when stiM. tuberculosis peptides showed a reciprocal pattern . Responses against this M. tuberculosis peptide were even higher in M. ulcerans than in M. tuberculosis DNA vaccinated mice. IFN-γ responses against M. tuberculosis peptides spanning aa 121–140 and 141–160 were only observed in mice vaccinated with the M. tuberculosis DNA, whereas a cross-reactive immune responses was found against M. tuberculosis peptide spanning aa 81–100. A sequence comparison of identified immunodominant Th1 peptides of Ag85A from M. ulcerans and from M. tuberculosis, showing conserved and non-conserved amino acid changes is presented in Responses against pattern . Confirmted mice . It was 5 AFB of M. ulcerans in the footpad. Nine weeks later, when a significant swelling of the footpad appeared in the control mice vaccinated with empty vector, all animals were sacrificed and the number of AFB in the infected footpad was determined by Ziehl-Neelsen staining. As shown in M. ulcerans AFB was observed in mice previously immunized with all three types of vaccine. Vaccination with specific M. ulcerans antigen using the DNA prime-protein boost protocol with Gerbu adjuvant conferred the highest protection with an almost one-hundred fold reduction in number of AFB as compared to the control group. This protection was comparable in magnitude to the protection conferred by the BCG vaccine. Difference between the vaccinated groups was not significant .Mice were challenged three months after the third vaccination with 105 AFB of M. ulcerans 04-855 at 6 weeks after the last immunization. The evolution of footpad swelling is shown in M. ulcerans infection whereas in BCG vaccinated mice, footpad swelling was delayed for 7–8 weeks . Similar results were observed in mice vaccinated with DNA encoding Ag85A from M. tuberculosis . Median survival time in the M. ulcerans DNA primed- M. ulcerans protein boosted mice was 17 weeks. This protection was comparable to that conferred by BCG (p>0.05).In a second experiment, protective efficacy of the vaccines was determined by weekly monitoring appearance and size of footpad swelling and survival as previously reported –8 weeks . Vaccina 3 weeks . DNA priefficacy whereas 8 weeks . Surviva 8 weeks (p<0.0015 weeks) . Boostinotection . Footpad and intravenous BCG administration gave considerable protection against a small dose and a slight protection against a large dose of M. ulcerans given in the other footpad M. ulcerans but that a booster vaccination with the same BCG vaccine does not increase the protective effect et al reported another BCG vaccination trial against Buruli ulcer in Uganda giving similar short lived (one year) protection rates of about 50% Buruli ulcer belongs to the family of neglected tropical diseases M. ulcerans vaccine would certainly help to control this debilitating disease that affects particularly children. Unfortunately, the nature of the protective immune response and the precise antigens involved are not fully defined at the moment. Based on biopsy specimens, M. ulcerans was originally thought to reside exclusively as free extracellular bacilli, implying that humoral responses might be protective. However, Coutanceau et al recently demonstrated that the initial phase of M. ulcerans infection proceeds by internalization of bacilli by phagocytic cells and that the extracellular stage results from mycolactone inducing host cell death A more effective M. ulcerans. Protective efficacy was evaluated using two approaches, in one experiment by enumerating the number of AFB in the footpad at nine weeks after M. ulcerans challenge and in the other experiment by monitoring footpad swelling and long term survival of the mice. We have previously reported that footpad swelling is correlated with bacterial replication and can be used as an alternative read-out for protection against infection M. ulcerans antigen 85A was clearly the most effective, reducing about one hundred fold the bacterial number and offering a protection of comparable magnitude as the one induced by the BCG vaccine. Nevertheless, and as for the BCG vaccine, immune protection was not sterilizing and eventually all mice developed footpad swelling. We hypothesize that the vaccines reduced or delayed temporarily mycolactone production by the virulent type 1 strain 04-855 but that immunity was not strong enough to completely block the ML synthesis. Targeting ML production by specific antibodies or by interfering with its synthesis might help to overcome this problem. A study made by Fenner, in 1956 showed that the apparition of footpad swelling depends of the number of viable AFB in the inoculum, small doses of bacilli showing delayed appearance of footpad lesion 5 AFB in our studies, it is possible that more sustained protections could have been observed if we had administered a lower number of bacteria.In this study, we focused on a plasmid DNA vaccine encoding Ag85A from M. ulcerans Ag85A protein in Gerbu adjuvant induced comparable Th1 cytokine and antibody levels as the prime-boost DNA vaccination. This protein vaccine also induced considerable protection as indicated by significantly reduced number of AFB in the footpad at nine weeks after M. ulcerans challenge. We have previously shown that DNA vaccination induces a broader T cell repertoire (more protein epitopes recognized) than infection with tuberculosis The Gerbu adjuvant is less well known as immunomodulator than other adjuvants such as alumn or monosphoshoryl-lipd-A (MPL-A) b restricted Th1 T cell epitopes of antigen 85A from M. ulcerans and from M. tuberculosis revealed some extent of species specificity, both in the NH2-terminal and in the COOH-terminal half of the protein. In contrast to the response induced with DNA encoding M. tuberculosis Ag85A, which was preferentially directed against Ag85A peptide spanning aa 261–280, T cell response induced with DNA encoding the M. ulcerans protein was directed preferentially against peptide spanning aa 240–259. Remarkably, mice vaccinated with the M. tuberculosis DNA reacted more strongly to this peptide region of M. ulcerans than to the same region in M. tuberculosis . We have previously reported that B6 mice vaccinated with DNA encoding Ag85B from M. tuberculosis also react more strongly to 85B peptide spanning aa 244–260 than to peptide spanning aa 262–279 M. ulcerans is more similar to the Ag85B sequence of M. tuberculosis (only 1 aa (A–D) change in position 242) than to the Ag85A sequence of M. tuberculosis (4 aa changes). Interestingly, it was demonstrated by Yanagisawa et al that vaccination of B6 mice with killed M. tuberculosis triggered preferentially a vβ11+ CD4+ T cell response against the peptide spanning amino acids 240 to 254 of Ag85B M. ulcerans Ag85A241–260 region is more immunogenic than the corresponding M. tuberculosis Ag85A region and this may explain the better protective efficacy that we have observed with the species specific M. ulcerans vaccine.Analysis of the H-2M. ulcerans in mice. This is a promising vaccination approach that warrants further analysis. Combination with vaccines targeting mycolactone or with vaccines targeting enzymes involved in mycolactone synthesis may be a way to strengthen its protective efficacy.In conclusion, our results show that specific Ag85A-DNA priming followed by protein boosting is an effective way to induce robust Th1 type immune responses and strong protection against experimental footpad infection with

To assess the prevalence and patterns of cardiac abnormalities as detected by cardiac magnetic resonance imaging (MRI) in systemic sclerosis (SSc).Fifty-two consecutive patients with SSc underwent cardiac MRI to determine morphological, functional, perfusion at rest and delayed enhancement abnormalities.At least one abnormality on cardiac MRI was observed in 39/52 patients (75%). Increased myocardial signal intensity in T2 was observed in 6 patients (12%), thinning of left ventricle (LV) myocardium in 15 patients (29%) and pericardial effusion in 10 patients (19%). LV and right ventricle (RV) ejection fractions were altered in 12 patients (23%) and 11 patients (21%), respectively. LV diastolic dysfunction was found in 15/43 patients (35%). LV kinetic abnormalities were found in 16/52 patients (31%) and myocardial delayed contrast enhancement was detected in 11/52 patients (21%). No perfusion defects at rest were found. Patients with limited SSc had similar MRI abnormalities to patients with diffuse SSc. Seven of 40 patients (17%) without pulmonary arterial hypertension had RV dilatation.This study shows that MRI is a reliable and sensitive technique for diagnosing heart involvement in SSc and for analysing its mechanisms, including its inflammatory, microvascular and fibrotic components. Compared with echocardiography, MRI appears to provide additional information by visualising myocardial fibrosis and inflammation. RV dilatation appeared to be non-specific for pulmonary arterial hypertension but could also reflect myocardial involvement related to SSc. Further studies are needed to determine whether cardiac MRI abnormalities have an impact on the prognosis and treatment strategy. Heart involvement in systemic sclerosis (SSc) affects the prognosis of the disease when it is clinically evident.Fifty-two consecutive unselected patients followed up at the Reference Centre for Scleroderma in Lille, France and fulfilling the American College of Rheumatology criteria for the diagnosis of SScClinical assessment collected data on age at onset of the first symptom of SSc except Raynaud’s phenomenon, age at onset of Raynaud’s phenomenon and cutaneous extension graded according to the LeRoy classification.All patients underwent Doppler echocardiography by a senior cardiologist (PDG) within 1 month before or after MRI. PAH was suspected in patients with a peak velocity of tricuspid regurgitation (VTR) >2.5–3 m/s and unexplained dyspnoea, or with VTR >3 m/s and warranted confirmatory right heart catheterisation.None of the patients had any contraindications for a cardiac MRI, especially renal insufficiency, which has been involved in nephrogenic systemic fibrosis. The examination was performed on a 1.5 Tesla MR scan . After localisation of the four planes of the heart , a turbo spin-echo sequence balanced in T2 black blood in the SA of the heart was performed. A cine-balanced turbo fast echo sequence was performed in three axes . After a single injection of 0.1 mmol/kg meglumine gadoterate , perfusion at rest was assessed by an echo-double diffusion imaging sequence in the SA plane. After a second dose of 0.1 mmol/kg meglumine gadoterate, the delayed contrast enhancement sequence was performed in three cardiac axes . At the end of the examination a velocimetric sequence centred on the mitral valve was performed.et al.18The myocardium was studied in 17 segments according to the American Heart Association standardised myocardial segmentation.Delayed contrast enhancement was defined as an area fulfilling all of the following criteria: a signal intensity value >2 SD above the normal myocardium,2 or Fisher exact tests. Correlations between numerical parameters were evaluated using Pearson’s correlation. Statistical analyses were performed with SAS software Version 9.1 .All data are presented as mean (SD) or as frequencies (n (%)). Comparisons of means were performed with the non-parametric Wilcoxon test, comparisons of frequencies with the χThe clinical characteristics of the patients are shown in When we excluded mitral flow impairment which was not interpretable in all patients, cardiac MRI showed at least one abnormality in 39 of the 52 patients (75%). The main MRI abnormalities are shown in Increased signal intensity on T2-weighted sequences was found in 6 patients 12%, , always 2 and 11 patients (21%) with a mean (SD) RV indexed end-diastolic volume of 99 (32) ml/m2, respectively. The RV was hypertrophied in 2 patients (4%). A moderate pericardial effusion was observed in 10 patients (19%).LV and RV dilatation were found in 3 patients (6%) with a mean (SD) LV indexed end-diastolic volume of 109 (4) ml/mNo perfusion defect at rest was detected by visual analysis.Twelve of the 52 patients (23%) had an impaired LV ejection fraction (mean (SD) 48 (4)%) and 11 (21%) had an impaired RV ejection fraction (mean (SD) 34 (9)%) without evidence of overt cardiac failure in any patient. LV kinetic abnormalities were found in 16 patients (31%), mainly segmental LV hypokinesia (n = 14) and, more rarely, global LV hypokinesia (n = 2). The abnormalities predominated in segment 7 , segment 8 and segment 1 . Segmental LV dyskinesia was observed in 2 patients and RV dyskinesia was observed in 5 patients (10%).The transmitral flow was interpretable in 43 of the 52 patients (83%). An impaired LV relaxation pattern was found in 15 of the 43 patients (35%), a normal pattern in 21 patients (49%), a pseudonormal pattern in 6 patients (14%) and a restrictive pattern in 1 patient (2%).Myocardial delayed contrast enhancement was detected in 11 of the 52 patients (21%). Delayed contrast enhancement was mainly linear .A comparison of cardiac MRI findings between patients with limited cutaneous SSc and patients with diffuse cutaneous SSc is given in Concerning the duration of SSc before cardiac MRI, we found that the longer the disease duration from the first symptom of non-Raynaud’s phenomenon, the greater the number of cardiac segments presenting kinetic abnormalities and delayed contrast enhancement . With Raynaud’s phenomenon as the first sign of SSc, we found that the longer the disease duration, the greater the number of cardiac segments presenting kinetic abnormalities . No correlation was found with delayed contrast enhancement .The association between cardiac abnormalities and echocardiographic findings is shown in The main results of our study are as follows. First, the majority (75%) of patients with SSc had at least one abnormality on cardiac MRI which gives a higher sensitivity than echocardiography (48%). Second, cardiac MRI enabled us to analyse precisely the different patterns of heart involvement in SSc by differentiating morphological, functional, perfusion and delayed contrast enhancement abnormalities. Third, patients with limited cutaneous SSc had roughly the same MRI abnormalities as those with diffuse cutaneous SSc, and RV dilatation was not specific for PAH. The high frequency of heart abnormalities observed on cardiac MRI is consistent with necropsy studies which showed that approximately 80% of patients with SSc had histological lesions of heart involvement.et al,26Our study enabled us to distinguish the different patterns of heart involvement in SSc using MRI. Previous studies have shown that MRI can accurately detect myocardial fibrosis.et al,27Our study also showed that MRI LV and/or RV ejection fractions were altered in about one-fifth of patients according to the reference values of Maceira We did not find any perfusion defect on cardiac MRI in patients with SSc. This is consistent with the absence of increased coronary artery arteriosclerosis in SSc.28Interestingly, we found no significant differences in cardiac MRI abnormalities between patients with limited cutaneous SSc and those with diffuse cutaneous SSc. These results are consistent with a previous study in which heart symptoms were not found to be significantly different between the two subtypes.Up to 17% of the patients in our study without PAH had RV dilatation. It is noteworthy that all these patients underwent right heart catheterisation to rule out PAH. This is further evidence for the specific involvement of the RV in SSc, most probably related to myocardial fibrosis. PAH was rather mild in our study, which probably explains why some patients with PAH had no RV dilatation.With regard to the comparison of data provided by echocardiography and cardiac MRI, we found that cardiac MRI provides additional information. Some analyses were not possible by echocardiography, most notably delayed contrast enhancement, increased signal intensity and thinned myocardium. However, echocardiography is more useful in valvular heart diseases, especially in PAH screening with tricuspid gradient evaluation. The correlation between LV ejection fraction obtained by MRI and by echocardiography was not good, which has been reported previously.29Our study shows that patients with a longer disease duration had more kinetic abnormalities and delayed contrast enhancement, which is consistent with previous studies.We acknowledge that our study has some limitations. There was no histological confirmation of our imaging data since this procedure was judged to be too invasive to be incorporated into the study. We did not include a control group of healthy subjects, thus precluding any firm conclusions regarding the higher frequency of abnormalities. Results from a 3 Tesla MRI scan may have provided more detailed information on the extent of fibrosis and its morphology. We did not systematically measure B-type natriuretic peptide and troponin levels.Our study shows that MRI is an accurate and reliable technique for diagnosing heart involvement in SSc and for analysing precisely its mechanisms including inflammatory, microvascular and fibrotic components. As it is non-invasive, quantitative and highly sensitive, MRI appears to be the method of choice to determine the natural history of untreated patients or to monitor accurately the effects of treatment. Moreover, it could provide powerful prognostic factors in both groups. Compared with echocardiography, MRI appears to provide additional information by visualising myocardial fibrosis and inflammation. Finally, we have shown that RV dilatation is not specific for PAH and could correspond to a specific heart involvement in SSc. Further studies are required to determine whether cardiac MRI abnormalities have a significant clinical impact on the prognosis and treatment strategy.

In a randomized controlled trial of individuals who had taken organophosphorus insecticides, Michael Eddleston and colleagues find that there is no evidence that the addition of the antidote pralidoxime offers benefit over atropine and supportive care. Poisoning with organophosphorus (OP) insecticides is a major global public health problem, causing an estimated 200,000 deaths each year. Although the World Health Organization recommends use of pralidoxime, this antidote's effectiveness remains unclear. We aimed to determine whether the addition of pralidoxime chloride to atropine and supportive care offers benefit.p = 0.12). Incorporating the baseline amount of acetylcholinesterase already aged and plasma OP concentration into the analysis increased the HR for patients receiving pralidoxime compared to placebo, further decreasing the likelihood that pralidoxime is beneficial. The need for intubation was similar in both groups . To reduce confounding due to ingestion of different insecticides, we further analysed patients with confirmed chlorpyrifos or dimethoate poisoning alone, finding no evidence of benefit.We performed a double-blind randomised placebo-controlled trial of pralidoxime chloride versus saline in patients with organophosphorus insecticide self-poisoning. Mortality was the primary outcome; secondary outcomes included intubation, duration of intubation, and time to death. We measured baseline markers of exposure and pharmacodynamic markers of response to aid interpretation of clinical outcomes. Two hundred thirty-five patients were randomised to receive pralidoxime (121) or saline placebo (114). Pralidoxime produced substantial and moderate red cell acetylcholinesterase reactivation in patients poisoned by diethyl and dimethyl compounds, respectively. Mortality was nonsignificantly higher in patients receiving pralidoxime: 30/121 (24.8%) receiving pralidoxime died, compared with 18/114 (15.8%) receiving placebo to the body's muscle cells. At the end of the neurons, these impulses are converted into chemical messages (neurotransmitters), which cross the gap between neurons and muscle cells (the neuromuscular junction) and bind to proteins (receptors) on the muscle cells that pass on the brain's message. One important neurotransmitter is acetylcholine. This is used at neuromuscular junctions, in the part of the nervous system that controls breathing and other automatic vital functions, and in parts of the central nervous system. Normally, the enzyme acetylcholinesterase quickly breaks down acetylcholine after it has delivered its message, but organophosphates inhibit acetylcholinesterase and, as a result, disrupt the transmission of nerve impulses at nerve endings. Symptoms of organophosphate poisoning include excessive sweating, diarrhea, muscle weakness, and breathing problems. Most deaths from organophosphate poisoning are caused by respiratory failure.Treatment for organophosphorous insecticide poisoning includes resuscitation and assistance with breathing (intubation) if necessary and the rapid administration of atropine. This antidote binds to “muscarinic” acetylcholine receptors and blocks the effects of acetylcholine at this type of receptor. Atropine can only reverse some of the effects of organophosphate poisoning, however, because it does not block the activity of acetylcholine at its other receptors. Consequently, the World Health Organization (WHO) recommends that a second type of antidote called an oxime acetylcholinesterase reactivator be given after atropine. But, although the beneficial effects of atropine are clear, controversy surrounds the role of oximes in treating organophosphate poisoning. There is even some evidence that the oxime pralidoxime can be harmful. In this study, the researchers try to resolve this controversy by studying the effects of pralidoxime treatment on patients poisoned by organophosphorous insecticides in Sri Lanka in a randomized controlled trial (a study in which groups of patients are randomly chosen to receive different treatments).The researchers enrolled 235 adults who had been admitted to two Sri Lankan district hospitals with organophosphorous insecticide self-poisoning . The patients, all of whom had been given atropine, were randomized to receive either the WHO recommended regimen of pralidoxime or saline. The researchers determined how much and which pesticide each patient had been exposed to, measured the levels of pralidoxime and acetylcholinesterase activity in the patients' blood, and monitored the patients' progress during their hospital stay. Overall, 48 patients died—30 of the 121 patients who received pralidoxime and 18 of the 114 control patients. After adjusting for the baseline characteristics of the two treatment groups and for intubation at baseline, pralidoxime treatment increased the patients' risk of dying by two-thirds, although this increased risk of death was not statistically significant. In other words, this result does not prove that pralidoxime treatment was bad for the patients in this trial. However, in further analyses that adjusted for the ingestion of different insecticides, the baseline levels of insecticides in patients' blood, and other prespecified variables, pralidoxime treatment always increased the patients' risk of death.These findings provide no evidence that the WHO recommended regimen of pralidoxime improves survival after organophosphorous pesticide poisoning even though other results from the trial show that the treatment reactivated acetylcholinesterase. Indeed, although limited by the small number of patients enrolled into this study , these findings actually suggest that pralidoxime treatment may be harmful at least in self-poisoned patients. This suspicion now needs be confirmed in trials that more fully assess the risks/benefits of oximes and that explore the effects of different dosing regimens and/or different oximes.http://dx.doi.org/10.1371/journal.pmed.1000104.Please access these Web sites via the online version of this summary at insecticides (in English and Spanish)The US Environmental Protection Agency provides information about all aspects of exposure to pesticides and other environmental health concerns (in English and Spanish)Toxtown, an interactive site from the US National Library of Medicine provides information on US National Pesticide Information Center provides objective, science-based information about pesticides (in English and Spanish)The MedlinePlus also provides links to information on pesticides (in English and Spanish)Poisoning Prevention and Management see WHO's International Programme on Chemical Safety (IPCS)For more on organophosphatesWikiTox, a clinical toxicology teaching resource project, has detailed information on Organophosphorus (OP) insecticide poisoning is a major global clinical problem, killing an estimated 200,000 people each year OP compounds inhibit acetylcholinesterase (EC 3.1.1.7), resulting in overstimulation of cholinergic synapses Clinical experience in Asia with regimens of 1 g pralidoxime every 4–6 h for 1–3 d has lead to widespread doubt about its efficacy in treatment of OP insecticide poisoning We set up an RCT in two Sri Lankan district hospitals in 2004 to compare the WHO-recommended regimen of pralidoxime with placebo in OP insecticide poisoning.The RCT was conducted in Anuradhapura and Polonnaruwa district hospitals, Sri Lanka. Ethics approval was received from the Faculty of Medicine Ethics Committee, Colombo, and Oxfordshire Clinical Research Ethics Committee. Written informed consent was taken from each patient, or their relative (for patients unconscious or under the age of 16 y), in their own language.We approached all patients with OP insecticide self-poisoning admitted to adult wards who required atropine according to our protocol The primary aim was to determine whether pralidoxime chloride reduced all-cause mortality during hospital admission after OP self-poisoning compared with no pralidoxime. Secondary outcomes included intubation, time to intubation, time ventilated, and time to death.We performed prespecified subgroup analyses to determine whether any effect was consistent between patients poisoned with dimethyl versus diethyl organophosphorus insecticides, patients poisoned by the two most common pesticides . The random allocation sequence was generated by computer and incorporated into a programme written for recruitment, randomisation, and event recording. Stratified block randomisation was performed using: (i) chemical structure ; (ii) reported time between poisoning and recruitment ; (iii) status on admission , and (iv) allocation in a concurrent RCT of activated charcoal The allocation sequences were generated independently by the statistician and implemented by the programmer, neither of whom interacted with patients. Variable block sizes were used to allocate patients in equal numbers to each treatment group using Stata v. 7 software .Participants were recruited and randomised by a study doctor at the bedside using a dedicated handheld computer at each study hospital. Randomisation occurred after baseline data had been entered, and could not be altered by study doctors. The recruiting doctor could not predict allocation accurately before randomisation.Pralidoxime chloride was supplied by Pharmalab as a 6.25 g/250 ml preparation. The quality of each batch was checked independently (SGS Lanka Laboratories) by HPLC on arrival in Sri Lanka . All batches used for the study fulfilled USP standards.The study was double-blind. The pralidoxime and placebo were provided in batches of vials, identical except for a serial number starting with one of two letters: A or B, C or D, etc. At randomisation, the computer program specified a letter; vials with that letter were used for that patient. At intervals, the letter pairs were shifted to the next pair to reduce the risk of unblinding. Blood samples were subsequently assayed for pralidoxime; this showed that all patients received the correct allocation.Blood samples were taken from patients on recruitment and at intervals thereafter for assay of plasma butyrylcholinesterase and red cell acetylcholinesterase activity We calculated that to detect whether pralidoxime reduced the case fatality in symptomatic patients from 25% to 19% , a minimum of 750 patients was required in each arm. The trial was set up as a superiority trial.An independent data monitoring committee (IDMC) was established for this and the concurrent trial Demographic factors and clinical characteristics were summarised with counts (percentages) for categorical variables and median (interquartile range [IQR]) for continuous variables, as none were expected to be normally distributed. The main analysis was carried out on an intention-to-treat basis. For the primary outcome, death, and for secondary outcome postrandomisation intubations, we reported the number and proportion of patients experiencing an event.p-values) to establish the magnitude and direction of the treatment effect, adjusted for stratification factors, hospital, and intubation at baseline.For outcomes where time-to-event was recorded, we used the logrank test to compare the treatment groups, producing Kaplan-Meier curves to illustrate the comparison. In addition, we calculated incidence rates and performed Cox's regression to estimate hazard ratios (HRs) The statistical test of interaction was used to examine whether the treatment effects were consistent across poison subgroups and in those intubated/not intubated at baseline. A term representing the interaction was entered into the baseline statistical model and a Wald test performed to test for the presence of an interaction. Of note, however, the study size meant that we had limited power for analyzing interactions. An exploratory analysis using Cox's regression investigated the effects of potentially important prognostic factors such as percentage of aged acetylcholinesterase on admission and OP concentration on admission.The Chi-squared test was used to compare the proportions of patients dying in red cell acetylcholinesterase activity groups. Median red cell acetylcholinesterase activity in survivors and fatalities, and median length of time intubated in each group, were compared using the Mann-Whitney U test.Patients were enrolled from 26 May 2004 until 18 October 2006. Unfortunately, discussion of the results of an RCT A total of 1,150 patients with OP poisoning were assessed on admission; 653 were asymptomatic, 162 excluded for other reasons, and 100 refused consent . 235 symBaseline demographic and clinical characteristics are presented in We first assessed the regimen's pharmacokinetics/dynamics to ensure that it had been adequate. It produced a steady state plasma pralidoxime concentration of approximately 100 µmol/l . We founPralidoxime effectively reactivated red cell acetylcholinesterase inhibited by diethyl OP insecticides but only moderately reactivated dimethyl OP-inhibited enzyme . Diethylp = 0.05]). Adjustment for stratification variables, and for intubation at baseline, resulted in a revised estimated HR of 1.69 , suggesting no difference between groups.Overall mortality in the trial was 48/235 (20.4%). Case fatality was higher in patients receiving pralidoxime compared to placebo . Incorporating the baseline amount of acetylcholinesterase already aged and plasma OP concentration into the analysis increased the HR to 3.94 for patients receiving pralidoxime compared to placebo, further decreasing the likelihood that pralidoxime is beneficial.We measured the plasma concentration of insecticide on admission, as well as the percentage of acetylcholinesterase that was aged at baseline, since both should affect the efficacy of pralidoxime We also examined the effect of pralidoxime for poisoning with the two most common insecticides . No such difference was seen in patients receiving placebo at 1 h and 24 h . However, surprisingly, these data showed that survival was still high (84%–87%) in patients receiving placebo whose acetylcholinesterase activity remained very low at 1 and 24 h.We analysed whether death occurred after effective acetylcholinesterase reactivation, using an activity of >199 mU/µmol Hb as an approximate level likely to be compatible with normal synaptic function There was a significant difference in median post-treatment red cell acetyl-cholinesterase activity between survivors and fatalities in both arms . The medOnly two of the 30 deaths in the pralidoxime arm occurred after the drug infusion was stopped in patients poisoned by fat-soluble OPs, with subsequent reinhibition of red cell acetylcholinesterase. This suggests that an inadequate duration of pralidoxime therapy was not the cause of the majority of deaths.p = 0.47], adjusted 1.25 ). Incorporating baseline percentage aged acetylcholinesterase and plasma insecticide concentration into the statistical model increased the estimated HR to 1.80 .Eighty-six patients required intubation. Forty were intubated at baseline , while 5n = 45) versus 6.5 d . The picture was similar when we analysed only postrandomisation intubations: median period 3.5 d versus 8.0 d . Some of this difference is likely to be due to the greater number of deaths among intubated patients treated with pralidoxime (25/48 [52.1%]) than those receiving placebo (15/38 [39.5%]).Intubation occurred earlier in the pralidoxime arm . PatientA post-hoc exploratory analysis suggested that patients who received pralidoxime before intubation appeared to do worse than patients who received it after intubation at baseline .Patients were assessed at the end of the loading dose and at 12 h intervals for adverse effects p = 0.12) in patients receiving pralidoxime—is consistent with a broad range of effects: from a 12% reduction in mortality to a greater than 3-fold increase in mortality. However, the best estimate, i.e., the most likely effect from this trial, is a 69% increase in mortality due to the treatment. The results from other important outcomes in our trial, e.g. intubation, reinforce the finding of a lack of benefit for the treatment.This trial showed no benefit from the administration of the WHO's recommended regimen of pralidoxime chloride to patients with symptomatic OP insecticide poisoning. The primary outcome—the (adjusted) HR showing higher mortality resulted in even less favorable estimates of effect. Our study shows that the WHO-recommended dose of pralidoxime is most likely to be ineffective, and may be harmful.Any serious adverse effects occurring from pralidoxime were not clinically apparent. Case reports have suggested that pralidoxime causes cardiac dysrhythmias or respiratory arrest Three medium-sized RCTs of pralidoxime have previously been performed, two with pralidoxime chloride in Vellore The Baramati RCT and our study used pralidoxime regimens similar This trial overlapped in part with another RCT of activated charcoal One limitation of this study was the lack of facilities for monitoring of patients that might have allowed us to better describe the cause of death in each patient, whether due to complications of prehospital aspiration or respiratory arrest, cholinergic syndrome, or cardiorespiratory arrest independent of the above that would suggest direct adverse effects of the pralidoxime. The study was therefore unable to explain why no benefit was found from this dose of pralidoxime; however, such information would not alter its conclusion.A second limitation is that it was stopped early as a consequence of a loss of equipoise in recruiting clinicians after we became aware of the Baramati results. However, it has unique strengths, in particular baseline stratification of patients by insecticide and red cell acetylcholinesterase activity and ageing, as recommended by others Further interpretation of our results is not straightforward. We are faced with the perplexing fact that pralidoxime effectively reactivated diethyl-OP inhibited red cell acetylcholinesterase, but did not improve outcome. Might OPs have other detrimental effects that are not amenable to pralidoxime? The majority of the insecticides ingested were generic products formulated with xylene. It is possible that coformulants are responsible for a significant component of toxicity The evidence for pralidoxime effectiveness beyond the contradictory clinical trials is limited. Some evidence of effectiveness is claimed from animal studies, although species differences in acetylcholinesterase structure greatly affect OP binding and reversal by oximes A second possible explanation is that pralidoxime is worthwhile but the dose too high. Pralidoxime has a high in vitro effect on human acetylcholinesterase at around 100 µmol/l Another argument for a lower dose is that lesser degrees of reactivation may still be clinically useful. We have shown that red cell acetylcholinesterase activity in many survivors was less than 25% of normal, indicating that complete reactivation may be unnecessary. Aiming to achieve concentrations that achieve nearly full reactivation may lead to significant adverse effects.The third possible explanation to consider is that there was a benefit in some patients but too many patients derived no benefit; that a more selective use might be useful. We chose, on pragmatic grounds, to administer pralidoxime for a maximum of 7 d, presuming that this would be the maximum period of active acetylcholinesterase inhibition in most patients. Oxime administration was stopped when patients no longer required atropine, indicating the presence of sufficient active acetylcholinesterase at muscarinic synapses.However, retrospective analysis of red cell acetylcholinesterase activity indicates that many patients received pralidoxime at a time when no benefit was likely. This on its own does not provide an explanation for the adverse trend but could have been a contributing factor by increasing the time period for adverse effects from pralidoxime to manifest. Discontinuation or dose adjustment in response to rapid testing of the response to pralidoxime might have improved the overall risk/benefit ratio.Clinicians are now faced with a difficult situation. Should pralidoxime be given to patients with OP insecticide poisoning? Patients with relatively low-dose occupational poisoning by diethyl organophosphorus insecticides have been shown to clinically improve after low-dose pralidoxime administration Text S1Study protocol.(0.07 MB DOC)Click here for additional data file.Text S2CONSORT checklist.(0.05 MB DOC)Click here for additional data file.

No effect is seen with non-tumorigenic cells. Tumor suppression assays reveal that the muscle-mediated tumor suppressor effects do not generate resistant clones but function through the down-regulation of the transcription factor MiTF, a master regulator of melanocyte development and a melanoma oncogene. Our findings point to skeletal muscle as a source of therapeutic agents in the treatment of metastatic cancers.Skeletal muscle is rarely a site of malignant metastasis; the molecular and cellular basis for this rarity is not understood. We report that myogenic cells exert pronounced effects upon co-culture with metastatic melanoma (B16-F10) or carcinoma (LLC1) cells including conversion to the myogenic lineage Understanding the cellular and molecular mechanisms leading to metastasis is of key importance for targeting metastatic cells since no efficient method to block metastasis exists The cellular and molecular mechanisms underlying the rarity of secondary metastasis in skeletal muscle have remained elusive. Several studies have linked muscle activity with inhibition of tumor growth in vitro and in vivo. In man, malignant melanoma accounts for only 4% of all dermatologic cancers but is responsible for 80% of skin cancer mortality because of its high metastatic rate . Several molecules implicated in melanoma tumorogenesis have been identified In this study, we make use of the highly metastatic murine melanoma B16F-10 In this study, we show that interactions between melanoma cells with either primary or established myogenic cell lines lead to specific changes in melanoma cell behavior, including inhibition of melanin pigment production. In addition, we observe that GFP labeled melanoma and Luis Lung carcinoma cells fuse to form myotubes when co-cultured with myoblasts. Injection of GFP-labeled melanoma cells into uninjured or regenerating skeletal muscle results in GFP positive myofibers indicating that these cells are recruited into muscle fibers. Serum free muscle-conditioned media exerts a cytostatic and cytotoxic effect upon metastatic cells but has little effect upon non-metastatic cells suggesting that muscle secreted factors are not general cell growth inhibitors. Surprisingly, tumor suppression assays fail to generate ‘muscle-resistant’ melanoma tumor cells such that cells subject to multiple rounds of selection remain sensitive to the growth suppression effects exerted by muscle, and is accompanied by down-regulation of the transcription factor MiTF. Furthermore, MiTF downregulation is dependent upon cell contact and myogenic cell density in the co-culture. These findings suggest a mechanism whereby skeletal muscle inhibits secondary metastasis by the secretion of factors as well as by cell-to-cell interactions that hijack metastatic cells, leading to myogenic conversion and reduced growth by acting through signaling mechanisms not normally involved in tumor suppression.5 B16-F10 melanoma cells into the tail vein or the peritoneum of C57/Bl6 syngeneic mice and analyzed for the presence of tumors 3 weeks after injection. The B16-F10 melanoma cell line produces melanin-expressing tumors allowing for easy identification of tumors in dissected tissues. Three weeks following tail vein injection of B16-F10 cells, we observed the presence of black pigmented growths in all organs examined including lung, liver, spleen, intestine, and heart muscle of one animal, consistent with the low incidence of skeletal muscle metastatic tumor invasion and growth.Previous studies have demonstrated that the B16-F10 cell line displays preferential distribution to the lung following tail vein injection nd bones . As for To follow melanoma tumor behavior at the cellular level, we generated GFP expressing B16-F10 cells (B16-GFP) and challenged them directly in culture with a variety of cell types including skeletal muscle cells. We co-cultured B16-GFP cells over a range of cell ratios ranging from 1∶1 to 1∶400 with fibroblasts (10T1/2), liver cells (BNL.CL2), and murine skeletal muscle (C2C12) cell lines. Due to the inherently high proliferative rate of melanoma cells, the optimal ratio of tumor cells to other cell lines was determined to be 1∶100 to allow for proper visualization of the two cell types at the end of the experiment. Once co-cultured cells were confluent, serum levels were decreased to induce myogenic differentiation . We note that even though DM was used to provoke myogenic differentiation, all combinations of cell types were subjected to the identical treatment allowing for a direct comparison of outcomes. Following 4–6 days in DM, B16-GFP differentiate into melanin producing cells. When B16-GFP are co-cultured with fibroblasts (10T1/2), we observe that the two cell types mix evenly and B16-The elongated morphology observed in melanoma cells co-cultured with myogenic cells suggested that B16 cells “fuse with myogenic cells and might” undergo myogenic conversion. We therefore examined the expression of skeletal muscle specific markers (MyoD and Myosin heavy chain (MF20)) in co-cultures of B16-GFP cells with either C2C12, or primary murine myoblasts using immunofluorescence. As shown in 3 B16-GFP cells into injured and non-injured Tibialis Anterior muscles of C57/Bl6 syngeneic mice. Mice were sacrificed at 2 and 3 weeks following B16-GFP injection and selected muscles from injected legs as well as lung, bone, spleen, liver, heart were collected, analyzed for the presence of tumors, and frozen for immunofluorescence analysis. Three weeks following B16-GFP injection, we detected small melanoma nodules that displayed well-defined boundaries and did not invade the surrounding muscles such as the gastrocnemius and the soleus (data not shown). No melanoma cells were detected in any of the organs examined . To identify melanoma cell fate, we analyzed injured and non-injured muscles 2 weeks following injection of B16-GFP cells. Muscle tissue is composed of multinucleate myofibers surrounded by a basal lamina (extra-cellular matrix), which delineate the fibers from the interstitium consisting of vessels and connective tissue To determine whether melanoma cells display a similar myogenic conversion in vivo, we injected 1×105 B16-GFP cells were injected into the femoral artery of C57/Bl6 syngeneic mice. To prevent significant circulation of cells to other organs, the femoral artery was clamped during and just after the injections as described in To assess whether metastatic cells can cross the vessel barrier into muscle tissue in vivo, 1×10C2C12) and from 10T1/2 fibroblast cultures (CM10T1/2). We tested conditioned media on B16 cells as well as C2C12 myoblasts and 10T1/2 fibroblasts and monitored cell morphology, number, and cell cycle status using propidium iodide uptake followed by FACs analysis. 10T1/2 fibroblasts grown in CM10T1/2 or CMC2C12 display robust growth and do not display overt changes in morphology (10T1/2 or CMC2C12 (10T1/2) 0,6% of the 10T1/2 fibroblasts were apoptotic versus 2,5% of apoptotic cells in cultures incubated in conditioned media from myogenic cells (CMC2C12) nor in cell cycle profile (10T1/2 (C2C12) for 3 days appear refractile and rounded (10T1/2 did not have any apoptotic effect on the Lewis-Lung carcinoma cells (Co-culture experiments with B16-GFP or LLC1-GFP and differentiating C2C12 cells gave rise to cultures which appeared to contain less tumor cells . It is wCMC2C12) . The perCMC2C12) . When B1 profile . There w in the number of B16 melanoma cells was observed during the first round of selection with CMC2C12 (S1), 71% for the second round (S2) and 62% for the third round (S3) or DMEM alone continue to proliferate and the number of cells increases on average by 23% and 29% or serum free DMEM (p = 0.006). In contrast, there was no significant difference in the proliferation rate of melanoma cell grown in serum free DMEM as compared to melanoma cells grown in CM10T1/2. Selected B16 melanoma cells transferred to serum containing growth media (GM) resume normal behavior, including melanin secretion, further confirming that the inhibitory effects exerted by muscle cells upon B16 cells is completely reversible.To assess whether metastatic cells acquire resistance to the muscle-mediated effects, we performed tumor suppression assays in which B16 cells were grown for prolonged periods in muscle conditioned media. Such assays typically result in the killing of most of the cells followed by the growth of resistant colonies. B16 cells were grown in the presence of CM) (C2C12 . By day ) and parental or selected B16-GFP were plated at a ratio of 1/400 allowing for a clonal distribution of the melanoma cells and the number of B16-GFP cells per colony was counted on day 4. High density of muscle cell cultures results in a sharp decrease in the number of parental B16-GFP cells. As shown in To analyze the contribution of cell-cell interactions to the muscle-mediated inhibitory effect upon metastatic cells, parental B16-GFP cells or B16-GFP that had undergone selection for 3 days in CMMiTF is a transcription factor required for melanocyte lineage survival and melanin production; MiTF is also implicated in melanoma progression and metastasis The rarity of secondary metatastasis in skeletal muscle has provoked a number of investigations and hypotheses for over 100 years. One simple explanation for the apparent resistance of skeletal muscle to secondary tumors was proposed by Ewing B16-F10 cells display two distinctive features in response to co-culturing with myogenic cells: the absence of melanin production and the acquisition of a myotube-like morphology. It was reported that the presence of cutaneous hypopigmentation favorably influences the prognosis and survival rate of patients with malignant melanoma Our observations suggest that the skeletal muscle microenvironment contributes to the partial loss of tumorigenicity through a phenotypic conversion into muscle. A similar reprogramming of multipotent melanoma cells was observed following their transplantation into embryonic neural crest The effect of muscle cells upon metastatic cells can be explained in part by the presence of diffusible signals secreted by muscle into the local milieu that act specifically on metastatic cells and not on non-metastatic cells. Muscle conditioned media exerts a specific apoptotic effect upon metastatic cells with pronounced melanoma cell death after 3 days, whereas no effect was observed upon non metastatic cells. Previous investigations have identified several muscle-produced factors capable of inhibiting metastatic growth including adenosine and unidentified low molecular weight factors acting through the A3 adenosine receptor While a single factor may underlie the muscle-mediated effects on metastatic cells that we report here, our data support a mechanism whereby muscle exerts 3 specific inhibitory effects upon metastatic cells which are 1) cellular recruitment into the myogenic lineage, 2) a paracrine-mediated cytostatic and 3) paracrine-mediated cytotoxic response. It is well established that prolonged exposure of tumor cells to cytostatic/cytotoxic stimuli lead to selection of genetically resistant clones All work with mice was carried out in adherence to French Government guidelines as well as those of the NIH and was approved by the Pierre et Marie Curie University.5 B16-F10-GFP or B16-F0-GFP cells were injected in 200 µl of PBS. Muscles and other organs were harvested 3 weeks after injection, analyzed for the presence of B16 melanoma cells and snap frozen in liquid nitrogen. Skeletal muscle regeneration was induced by a freeze-crush injury of the left tibialis anterior (TA), as previously described 3 cells in 30 µl PBS) were injected into the left injured and the right uninjured TA muscles. Control TA muscles were injected with PBS.Experiments were performed in 8 to 12 weeks old female C57BL/6J mice . For intravenous (tail vein), intra-arterial and intrC2C12 myoblasts, B16-F10 and B16-F0 melanoma cells, Luis Lung Carcinoma (LLC1), BNL CL.2 liver cells and 10T1/2 fibroblasts were grown in DMEM supplemented with 20% Fetal bovine serum (Hyclone) (GM). Primary mouse myoblasts were obtained by enzymatic digestion of 18 days old embryos hind limb muscles as previously described B16-F10 melanoma cells and Luis Lung Carcinoma (LLC1) were stably infected with a MoMuLV retroviral vector expressing the GFP protein under the control of the CMV promoter. Cells were sorted by Flow Cytometry to select for high GFP expression. For coculture experiments, B16-GFP or LLC1-GFP tumor cells were co-cultured with C2C12, 10T1/2, BNL CL.2, CHQ, at ratios of 1/5, 1/10, 1/5,1/100, 1/400, 1/500 (tumor cells/non-tumor cells) in GM. A ratio of 1/100 was used for all subsequent experiments. To induce myogenic differentiation, after 3 days in GM cells were switched to DMEM containing 2% (v/v) horse serum (GIBCO) for 5 to 9 days. Primary mouse myoblasts were co-cultured with B16-GFP tumor cells in a 1/500 ratio (tumor cells/myoblasts) for 3 days in GM, and switched to DM for 4 days. For colony growth experiments and MITF detection C2C12 or 10T1/2 cells were co-cultured with B16-GFP tumor cells at a 1/400 ratio (tumor cells/non-tumor cells) for 2 days in GM, and switched to DM for 2 days.Cells grown on 6,12 or 24 well plates and cryosections of mouse hind limb muscles were fixed in 4% paraformaldehyde and stained with antibodies against sarcomeric Myosin , MyoD (Santa Cruz), Laminin (Sigma), GFP (BD Pharmingen), and MiTF (Fisher Scientific). Antibody binding was visualized by using biotin-conjugated goat anti-mouse IgG followed by Cy3-conjugated streptavidin (Jackson Immunoresearch), and Alexa488 or Cy3 -conjugated conjugated goat anti-rabbit IgG (Molecular Probes). Nuclei were counterstained with DAPI (Sigma). Photomicrographs were obtained using a Leica inverted microscope (DMIL) a Leica confocal microscope (DM2500 TCS SPE) and a Leica DFC300FX camera. For detection of GFP+ myofibers, a narrow range of emission wavelength (511 to 532 nm) was used to avoid detection of autofluorescence 5′GAGGTTGTCAGCGAGGCTAC3′; mDesR: 5′CGATGACTTGAGCTGGGTTC3′ mMyoDF: 5′AGTGTCCTGCAGGCTCAAAC3′; mMyoDR: 5′TCT GCT CTT CCCTTCCCTCT3′.Cells were collected and RNA was extracted using RNeasy minikit (Qiagen). RT was performed using SuperScriptII Reverse Transcriptase (Invitrogen). Murine specific primers to detect Desmin and MyoD transcripts were designed and a PCR was performed. PCR conditions were 94°C for 4 min, followed by 30 cycles of 94°C for 1 min, 62°C for 1 min, and 72°C for 1 min. Primers sequences used were as following: mDesF:Melanin production was quantified by determining the number of green cells showing black pigments of 10 randomly chosen fields in 3 independent experiments.Myogenic conversion of B16-GFP and LLC1-GFP cells was quantified by determining the number of green myotubes expressing either MyoD or MF20, and expressing this as a percentage of the total number of myotubes per field (% of GFP+ myofibers). 10 randomly chosen fields in 3 independent experiments were analyzed.For colony growth experiments, the number of GFP positive cells/colony was counted in triplicates. A total of 30 to 60 colonies were analyzed per experimental condition.C2C12 or 10T1/2 cells grown to confluence in GM, were incubated in serum free DMEM (GIBCO) for 6,12,24,36 and 48 hours. At the end of the incubation period, the supernatant was collected, centrifuged, filtered through a 0.22 µm filter (Millipore), and frozen.C2C12 or CM10T1/2, washed with PBS, fixed with 1% paraformaldehyde and resuspended in PBS containing Propidium iodide , RNaseA and Triton X-100 . DNA content was analyzed by flow cytometry using a FACScan . The percentage of cells with sub-G0-G1 DNA content was counted as apoptotic cells. Values represent the mean (± SEM) from 3 independent experiments.Cells were cultured for 1 or 3 days in either CM2 in 60 cm Falcon culture dishes and grown in CMC2C12, CM10T1/2, or in DMEM for 4 days. Media was changed once on day 3. After shifting them to GM for 2 days, cells were trypsinized and submitted to a new round of selection as described above. The selection process was repeated 3 times. The number of surviving cells was determined at day 1, 3, and for each selection round by counting the cells in 5 randomly chosen fields from 3 independent experiments. Statistical analysis was performed with Prism software using Student's unpaired t-test.B16-F10-GFP cells were seeded in triplicates at a density of 12500 cells/cmText S1Parlakian, et al. Material and methods.(0.03 MB DOC)Click here for additional data file.Figure S1Parlakian, et al. LLC1 carcinoma cells cultured with skeletal muscle cells participate to the myogenic program. A) Photomicrographs of GFP expressing Lewis Lung carcinoma cells (LLC1-green) grown alone or in co-culture with myogenic cells (C2C12), fibroblasts (10T1/2), or liver cells (BNL.CL2). We note the elongated morphology of LLC1 carcinoma cells when co-cultured with C2C12. Scale bar  = 100 µm. B) Representative photomicrographs of GFP expressing LLC1 cells (green) grown and differentiated in co-culture with C2C12 mouse myogenic cell line. GFP labeled carcinoma cells fuse with the C2C12 cells forming chimeric green myotubes, which are positive for myosin heavy chain and the myogenic transcription factor MyoD (red). Nuclei were visualized by DAPI staining (blue). Scale bare =  15 µm.(4.35 MB TIF)Click here for additional data file.Figure S2Parlakian, et al. Apoptotic effect of the conditioned media from C2C12 muscle cells on LLC1 carcinoma cells. Phase contrast photomicrographs of LLC1 carcinoma cells cultured in serum free conditioned media from 10T1/2 fibroblasts (CM10T1/2) or in serum free conditioned media from muscle cells (CMC2C12) for 3 days. After 3 days in CMC2C12, LLC1 carcinoma cells are less numerous and appear rounded and clustered. Scale bar  = 50 µm.(0.49 MB TIF)Click here for additional data file.

The epidermal growth factor receptor (Egfr) with its numerous ligands has fundamental roles in development, cell differentiation and physiology. Dysfunction of the receptor-ligand system contributes to many human malignancies. Consistent with such various tasks, the Egfr gene family has expanded during vertebrate evolution as a consequence of several rounds of whole genome duplication. Of particular interest is the effect of the fish-specific whole genome duplication (FSGD) on the ligand-receptor system, as it has supplied this largest group of vertebrates with additional opportunities for sub- and/or neofunctionalization in this signaling system.egfr genes, egfra and egfrb, in all available teleost genomes. Surprisingly only one copy for each of the seven Egfr ligands could be identified in most fishes, with zebrafish hbegf being the only exception. Special focus was put on medaka, for which we more closely investigated all Egf receptors and Egfr ligands. The different expression patterns of egfra, egfrb and their ligands in medaka tissues and embryo stages suggest differences in role and function. Preferential co-expression of different subsets of Egfr ligands corroborates the possible subfunctionalization and specialization of the two receptors in adult tissues. Bioinformatic analyses of the ligand-receptor interface between Egfr and its ligands show a very weak evolutionary conservation within this region. Using in vitro analyses of medaka Egfra, we could show that this receptor is only activated by medaka ligands, but not by human EGF. Altogether, our data suggest a lineage-specific Egfr/Egfr ligand co-evolution.We identified the predicted components of the Egf receptor-ligand signaling system in teleost fishes . We found two duplicated Our data indicate that medaka Egfr signaling occurs via its two copies, Egfra and Egfrb, each of them being preferentially coexpressed with different subsets of Egfr ligands. This fish-specific occurrence of Egf receptor specialization offers unique opportunities to study the functions of different Egf receptor-ligand combinations and their biological outputs in vertebrates. Furthermore, our results strongly support the use of homologous ligands in future studies, as sufficient cross-specificity is very unlikely for this ligand/receptor system. Signaling by the epidermal growth factor receptor has fundamental roles in mammalian development, where it regulates diverse processes such as eyelid opening, tooth growth, wound healing, hair follicle and mammary gland development. On the cellular level, it controls key functions including cell division, differentiation, survival, motility and apoptosis ,3.Drosophila melanogaster and Caenorhabditis elegans has provided considerable advancement in understanding Egf receptor functions in development and physiology [Danio rerio) and the Japanese medaka (Oryzias latipes) - only few publications address Egfr function. In zebrafish, Egf receptor signaling was shown to regulate cardiovascular processes during development [in vitro [in vivo [The use of animal models such as ysiology -6. In veelopment . Furtherin vitro and in v[in vivo . Egf rec[in vivo , as dedu[in vivo .It is generally accepted that in addition to the two whole genome duplication events that occurred early in the vertebrate lineage ("R1" and "R2 duplication"), a later third whole genome duplication event, the so-called FSGD (fish-specific genome duplication or R3) occurred within the actinopterygian (ray-finned) fish lineage approximately 320-350 million years ago -14. MostIn the present study, we carried out phylogenetic and synteny analyses for a detailed insight into the evolution of Egf receptors and their ligands in teleost fishes.in vitro system to verify the functionality of medaka Egf receptor ligands in terms of receptor activation. To our knowledge, this is the first work encompassing a functional analysis of the fish Egf receptor-ligands system in this evolutionary context.Importantly, all previous studies in fish that included the application of Egf receptor ligands were performed using recombinant mammalian proteins ,17,18. TIn mammals, seven ligands bind and activate Egfr, namely epidermal growth factor (Egf), transforming growth factor alpha (Tgfa), amphiregulin (Areg), betacellulin (Btc), epiregulin (Ereg), heparin-binding EGF-like growth factor (Hbegf) and epigen (Epgn).Oryzias latipes), stickleback (Gasterosteus aculeatus), green spotted pufferfish (Tetraodon nigroviridis), torafugu (Takifugu rubripes) and zebrafish (Danio rerio) http://www.ensembl.org/ - as well as a platyfish (Xiphophorus maculatus) EST sequence database for Egf receptors and Egf receptor ligands. While we could identify two gene copies for the Egf receptor in all teleost species investigated, surprisingly only one gene copy for each of the seven Egfr ligands was isolated except for zebrafish that possesses two gene copies of the hbegf gene. A recent study by Kassahn et al. in five teleost fishes [Using BLASTn and tBLASTn searches, we thoroughly surveyed the teleost genome assemblies from medaka bootstrap consensus tree of the 138 bp nucleotide sequences encoding the mature part of the ligands is shown in Figure egf gene showed conserved synteny between and within tetrapods and teleosts has not been mapped to a particular chromosome. The large-scale analysis shows that the TGFA region on Hsa2 is syntenic to several chromosomes in the three teleost genomes but not to the tgfa containing ones [Additional file tgfa gene in the teleost ancestor. Nevertheless, the high bootstrap values of the teleost and tetrapod node ; the other, called hbegfb, is found on Dre21 (corresponding to Ola14). The macro-synteny analysis revealed that the region containing HBEGF on Hsa5 is highly syntenic to Dre14 and Dre21, Tni1 and Tni7, as well as Ola10 and Ola14 [Additional file g [hbegf gene was initially duplicated in the teleost ancestor during the FSGD event. While hbegfa and hbegfb were kept in zebrafish, only the hbegfa copy was maintained in medaka and pufferfish, and the hbegfb copy was lost. So far, the two zebrafish hbegf paralogs are the only known teleost Egfr ligand genes that were maintained in two copies after the fish specific genome duplication.The zebrafish is the only investigated teleost species that has two paralogs for l file g ,22. ThusEpgn, Ereg, Aregand Btc on human Hsa4 and mouse Mmu5 (data not shown).An interesting feature of the Egfr ligands is the clustering of the four remaining ligand genes, namely 5 Figure . This clEreg genes and epgn (Dre8) genes showed no conserved microsynteny with the medaka cluster (data not shown). However, there is conserved synteny between the teleost btc regions Figure .i [i was duplicated during the FSGD. After the FSGD, one of the cluster copies, which is now present on Ola9, has lost btc. In the zebrafish lineage, it broke further apart, separating areg and ereg genes. The other cluster then lost all genes but btc now found on Ola12, Tni4 and Dre21, respectively , Hsa4 (EGF and ligand gene cluster) and Hsa5 (HBEGF) are highly syntenic to each other as well as with Hsa10, which does not contain an EGFR ligand gene .It has been previously hypothesized that parts of chromosomes Hsa2, Hsa4, Hsa5 and Hsa10 are derived from the vertebrate protochromosome C2 and C3. The chrC0, which later became part of Hsa10, was lost secondarily. Protochromosome C1gave rise to Hsa4 [Egf, while the other gene underwent several tandem duplications, thereby generating the EGFR ligand gene cluster. The fact that the egf and cluster genes are not found on the same chromosome in teleosts may be due to the fission of protochromosome C1 in fish [According to our model Figure , the anc to Hsa4 . The Egf in fish .Epgn, Ereg, Aregand Btc dates back at least to a common bony vertebrate ancestor of fish and tetrapods. Unfortunately, the genome assemblies of elephant shark (cartilaginous vertebrates) and lamprey (jawless vertebrates) are still too fragmentary to get more insights into the timing of the Egfr ligand cluster establishment in vertebrates (data not shown). Since its establishment, the cluster linkage has then been kept in the tetrapod lineage but is absent in the teleost lineage due to the differential loss of gene duplicates after the FSGD (see above).Our model suggests that an original cluster consisting of C1 and C3, finally, became parts of Hsa5 and Hsa2 containing HBEGF and TGFA, respectively.Protochromosomes NRG1, NRG2, NRG3), in contrast, are also located in protochromosome C-derived regions and could have evolved along with the canonical Egfr ligands (data not shown).We note that other ligand genes with Egf domain, i.e. tomoregulins, neuregulins and others, may be related to the canonical seven Egfr ligands analyzed here ,28. Howee.g. ligand binding pockets, are usually under high selection pressure and therefore more conserved than other subdomains of the protein. We investigated here the variability of functional sites of tetrapod and teleost Egfr homologs, with a special focus on the receptor-ligand protein interface.To get a better insight into the evolutionary need of maintaining so many Egfr ligands, and, at least in fish, two copies of Egfr, we investigated the conservation of the functional domains of the receptor, including the receptor-ligand interface. It is generally assumed that functional and interaction sites The epidermal growth factor receptor is a transmembrane receptor tyrosine kinase . It compegfra and egfrb, with egfra being more similar to tetrapod Egfr. For our amino acid analysis, we omitted the domain located carboxy-terminally of the kinase domain since its length is highly divergent between the investigated species. Nevertheless, the alignment between human EGFR and medaka Egfra and Egfrb displayed in [Additional file For our evolutionary study we looked at the amino acid conservation for each domain of the EGF receptor between tetrapod and teleost species Table . All telExpectedly, the tyrosine-kinase domain displays the highest similarity between tetrapod Egfr and teleost Egfra have been resolved for human EGFR, revealing four subdomains in the extracellular part of the receptor ,34. SubdAltogether, this indicates that the Egfr extracellular part may have evolved differently compared to the rest of the protein between tetrapods and teleosts, and even among teleosts.http://consurf.tau.ac.il/[We were particularly interested in the evolutionary conservation of subdomains I and III, which compose the interface between receptor and ligand. To analyze this region in detail, we compared the human EGFR residues known to directly interact with EGF and TGFA ,34 with au.ac.il/. This toAs input, we supplied protein alignment and phylogenetic tree of human, mouse, rat and chicken Egfr and their medaka, platyfish, spotted green pufferfish, torafugu and stickleback Egfra and Egfrb co-orthologous proteins. The three-dimensional structure of the extracellular part of human EGFR in complex with TGFA was chosAmino acid substitution can either be classified as radical or conservative, whether it involves or not a major change in the amino acid physicochemical properties. Our analyses reveal that many amino acids located in the ligand-binding pocket are not conserved among vertebrates, and some even replaced with residues that induce a radical amino acid substitution. A similar picture emerged when comparing the Egfr ligands, namely tetrapod and teleost Egf and Tgfa [Additional file This lack of conservation suggests separate ways of receptor-ligand co-evolution in tetrapods and teleosts. It also implicates a possible subfunctionalization of the duplicated teleost receptors. To further investigate this hypothesis, we analyzed receptor and ligand expression exemplarily for teleosts in the medaka fish.egfra and egfrb transcripts are present from stage 8 (before mid-blastula transition) to the hatching stage, but with much lower levels of expression past the stage 16 (late gastrula stage) when compared to stage 8 [Additional file Both egfra is slightly expressed in embryos whereas egfrb was not detected [In platyfish, detected . Moreovedetected . In the detected for a retgfa and ereg appear to be maternally deposited into the medaka egg as well but are not detected in the embryo after the mid-blastula transition [Additional file tgfato later embryonic development. However, mutant mice for Tgfashow defects in hair follicles, eye development and decreased forebrain neural progenitor cell proliferation [egf, hbegf areg, epgn and btc [Additional file areg, with increasing levels of transcripts past stage 30, when for instance the blood vessel system develops. In mammals, Areg was shown to be the most potent mitogen for vascular smooth muscle cells [The Egfr ligand transcripts for feration ,39. Zygole cells .egfra mRNA, whereas egfrb was only weakly expressed cells, which are blastula-derived cells, displayed large amounts of d Figure . Only onf Figure . Low expc Figure and aregg Figure , but allIn summary, the specific expression pattern of the seven medaka EGFR ligands during embryogenesis suggest different functions, although the possibility for signaling redundancy by autocrine, paracrine and/or juxtacrine modes of action remains (for a review see ).egfra is expressed more strongly in spleen, kidney, and skin as well in stem cells, while egfrb is prominently expressed in gills, ovary and liver or melan-a cells stably transfected with human EGFR (melan-a HER). As shown by Western blot analysis, only melan-a HER cells displayed EGF-dependent phosphorylation of EGFR and the downstream signaling components Akt and Erk1/2 , melan-a cells that were stably transfected with medaka 2 Figure . In caser Figure .egfra cells and as donor cell line we transiently transfected human embryonic kidney (HEK) 293-T cells with expression vector constructs containing the cDNA of different medaka ligands . Expression of the different constructs was verified by PCR [Additional file egfra cells were then stimulated for 30 minutes with conditioned supernatants from the transfected 293-T cells and activation of receptor and downstream signaling pathways was assessed by Western blot analysis. As expected, melan-a WT cells did not display any activation of Egf receptor and its downstream signaling pathways in response to any of the conditioned supernatants staining of a protein with the size of medaka Egfra, that was only visible in cells expressing this receptor . In the search of Egf receptor ligands, only the mature Egf motif was used to perform the BLAST searches since this is the only conserved domain [Additional file The sequences of The nucleotide sequences of the Egf motif of the Egfr ligands from tetrapod and teleost species were retrieved from Ensembl and NCBI databases, loaded into BioEdit , translaEgf, Tgfa, Hbegf and the ligand cluster were performed using information from the genome browsers from human, mouse, chicken, zebrafish, Tetraodon and medaka from the Ensembl database http://www.ensembl.org/.Synteny analyses of Ciona genome as outgroup gave similar results. The results were then compared to previously published synteny regions [The Synteny Database ,21 was u regions ,22 to inCarbio strain was used in this study. The origin of the medaka stem cell and fibroblast cell lines has previously been published previously [All animal studies have been approved by the author's Institutional Review Board . Fishes were kept under standard conditions in the aquarium facility of the Biozentrum at the University of Würzburg. The medaka eviously . Embryoneviously .ef1a1) using the 2-DDCT method [RNA extraction from different medaka tissues and cell lines was done using Total RNA Isolation Reagent as recommended by the manufacturer. For analysis of gene expression, standard PCR for control of gene expression or real-time PCR for the expression pattern analyses was done. For the embryonic medaka stages study, a pool of 10 embryos per stage was prepared and the early morula stage, stage 8, was chosen as expression reference. Given that Egfr signaling is observed in the CNS, a feature conserved from invertebrates to vertebrates, we took medaka adult brain as a reference organ for the adult tissues. cDNA was prepared from total RNA from a pool of 6 adult fish brains, eyes, gills, hearts, ovaries, testes, spleens, kidneys, livers, skins, fins, muscles, as well as medaka stem cells line using the RevertAid kit with random hexamer primers . PCR primers were designed using Primer3 software . A list T method .http://consurf.tau.ac.il/[ConSurf au.ac.il/, an autoau.ac.il/. In thisau.ac.il/.Using this tool, we could display the patches of low or highly conserved residues that are important for ligand binding. Confidence intervals were generated and high and low values of each interval were assigned color grades according to the 1-9 coloring scheme. If the interval in a specific position spans 4 or more color grades, the score is considered as unreliable and the position is colored light yellow in the graph. The positions indicated in the figure refer to the positions of the human mature EGFR protein.egfra, egf, areg and hbegf, we searched the medaka genome database http://www.ensembl.org/Oryzias_latipes/index.html by tBLASTN and BLASTn comparison [egfra), ultracontig115 (egf), chromosome 9 (areg), and chromosome 10 (hbegf).To isolate medaka mparison . We idenegfra, egf, areg and hbegf were amplified from cDNA prepared from pooled medaka tissues at standard PCR conditions using Triple Master Taq polymerase proof-reading Taq polymerase (primer sequences available on request). The PCR products were inserted directly by TA cloning into the pCR2.1 vector , and individual clones were sequenced using CEQ DCTS dye terminator cycle sequencing kit and run on a CEQ 2000XL DNA sequencing system (Beckman-Coulter).The deduced mRNAs of the different genes were predicted by using GeneScan analysis . The codXba I and SnaBI restriction sites were inserted at the 5' and the 3' termini of medaka egfra, respectively, in order to ligate the gene into the XbaI and SnaBI digested PCS2+ expression vector to create the construct pCS2+-Ola-egfra.egf, areg and hbegf, EcoRI and XbaI restriction sites were inserted at the 5' and 3' termini of medaka egf, EcoRI and XhoI were inserted at the 5' and 3' termini of medaka areg and ClaI and XbaI were inserted at the 5' and 3' termini of medaka hbegf to insert them in the corresponding digested pCS2+ vector. Expression of medaka egfra, egf, areg and hbegf by the different cell lines was assessed by RT-PCR [Additional file To generate the different pCS2+ expression constructs for medaka Egfr expression [egfra construct using Fugene transfection reagent (Roche). HEK 293T cells (human embryonic kidney fibroblasts with SV40 T-antigen) were grown in DMEM supplemented with 10% FCS, 1% glutamine and antibiotics. Expression constructs pCS2+-Ola-egf, pCS2+-Ola-areg and pCS2+-Ola-hbegf were transiently transfected into HEK 293T cells by the calcium-phosphate method [egfra in melan-a cells and medaka egf, areg and hbegf RNA in 293T cells was checked by reverse-transcription PCR analysis.Mouse wild-type melanocytes (melan-a WT) , lackingpression ,58, weree method . ExpressFor the stimulation assays, cells were incubated either with human EGF (100 ng/ml) or with the 293T cells overnight conditioned supernatants for 30 minutes at 37°C.2, 1 mmol/L EGTA, 10% glycerol, 1% Triton X-100, 10 μg/mL aprotinin, 10 μg/mL leupeptin, 200 μmol/L Na3VO4, 1 mmol/L phenylmethylsulfonyl fluoride (PMSF), and 100 mmol/L NaF. 50 μg of protein lysate was separated by SDS-PAGE and analyzed by Western blotting onto nitrocellulose. Membranes were blocked for 60 minutes with TBS (10 mmol/L Tris-HCl (pH 7.9) and 150 mmol/L NaCl), 0.1% Tween-20, and 5% bovine serum albumin (BSA) and were incubated overnight at 4°C with the first antibody. Monoclonal antiphosphotyrosine P-Tyr (PY20) was from BD Biosciences . Phospho-ERK 1/2 (Thr202/Tyr204) and rabbit polyclonal Akt antibodies were purchased from Cell Signaling Technology . Rabbit polyclonal anti-phospho Akt (Ser473) was obtained from New England Biolabs and rabbit polyclonal anti-Erk2 (c-14) from Santa Cruz Biotechnology . The secondary antibodies were conjugated with horseradish peroxidase and were directed against mouse or rabbit (Bio-Rad).Cells were trypsinized, rinsed twice with PBS and lyzed in 50 mmol/L HEPES (pH 7.5), 150 mmol/L NaCl, 1.5 mmol/L MgClEgfr and Egfr ligand genes, the synteny analyses, the study of Egfr subdomains and Egfr extracellular part evolutionary conservation, the expression analyses, the cloning and sequencing of medaka egfra, areg, egf and hbegf, the functional experimentations and wrote the manuscript. IB did the phylogenetic analysis, the large-scale synteny examination, the study of vertebrate EGFR ligand evolution and wrote the manuscript. RBW generated and provided the Xiphophorus maculatus sequences for tgfα, hbegf, btc, ereg and epgn. MS produced and supplied the fish material. SM and MS both designed the study and helped draft the manuscript. All authors read and approved the final manuscript.JAGCL performed the computational search for tetrapod and teleost Supplemental figure S1. Structure and amino acid sequence alignment for tetrapod and teleost Egfr. A) Overall Egfr structure comprising the amino-terminus (NH2), the extracellular domain (ECD), the transmembrane domain (TM), the intracellular juxtamembrane domaine (JM), the intracellular tyrosine kinase domaine (TK) and the carboxy-terminus (COOH). B) Alignment was generated in ClustalX. The color bars indicate the different subdomains of the Egfr protein: subdomain I in green, subdomain II in blue, subdomain III in magenta, subdomain IV in orange, transmembrane domain in yellow, intracellular juxtamembrane in grey and tyrosine kinase in red.Click here for fileSupplemental figure S2. Amino acid sequence alignment for tetrapod and teleost Egfr ligands. Alignment was generated in ClustalX [ClustalX . Only thClick here for fileSupplemental figure S3. Phylogeny of EGFR ligand genes. Original Maximum Likelihood tree based on the 138 bp of the Egf domain using the GTR+G+I substitution model. Bootstrap values for Maximum Likelihood and Neighbor Joining methods are shown. The tree was rooted on the branch leading to Egf sequences. Only bootstrap values above 50% are shown. Monophyly is supported for Egf, Hbegf, Tgfa and Ereg genes, but many other nodes remain poorly supported. Dre, Danio rerio; Gac, Gasterosteus aculeatus; Gga, Gallus gallus; Hsa, Homo sapiens; Mmu, Mus musculus; Ola (red), Oryzias latipes; Ssa, Salmo salar; Tni, Tetraodon nigroviridis; Tru, Takifugu rubripes; Xma, Xiphophorus maculatus [Additional file Click here for fileSupplemental figures S4 to S7. Synteny Database [EGF (S4), TGFA(S5), HBEGF(S6) and the ligand cluster (S7) regions.Database dot plotClick here for fileSupplemental figure S8. Structure and amino acid sequences alignment for human and medaka Egfr. A) Overall Egfr structure comprising the amino-terminus (NH2), the extracellular domain (ECD), the transmembrane domain (TM), the intracellular juxtamembrane domaine (JM), the intracellular tyrosine kinase domaine (TK) and the carboxy-terminus (COOH). B) Alignment was generated in ClustalX. The color bars indicate the different subdomains of the Egfr protein: subdomain I in green, subdomain II in blue, subdomain III in magenta, subdomain IV in orange, transmembrane domain in yellow, intracellular juxtamembrane in grey and tyrosine kinase in red. Major phosphorylation sites in the carboxy terminal tail are indicated by asterisks (*).Click here for fileSupplemental table S1. Amino acid similarity between tetrapod and teleost Egf receptor extracellular subdomains. Similarity percentages between human (Hsa), mouse (Mmu), chicken (Gga), medaka (Ola), platyfish (Xma), zebrafish (Dre), green-spotted pufferfish (Tni), fugu (Tru) and three-spined stickleback (Gac) Egfr extracellular subdomains I, II, III and IV.Click here for fileSupplemental figure S9. ConSurf evolutionary conservation analysis of the Egfr ligand binding pocket residues between tetrapods and teleosts. A) Overall strucure of extracellular subdomains I and III of Egfr in complex with Tgfa, 3 interface sites are outlined. B) View of site 1 interface. C) View of sites 2 and 3 interfaces. Non-conserved residues are colored in turquoise whereas conserved residues are coloured in pink and maroon. Yellow color indicates amino acids for which data were not sufficient to calculate reliable conservation values. D) Table displaying the residues of the ligand binding pocket in human EGFR and medaka Egfra and Egfrb. Bold font indicates amino acid changes in either medaka Egfra or Egfrb compared to human EGFR. Amino acid substitutions that also involve an important change in the amino acid physicochemical properties are quoted by a (R) for radical amino acid substitution. Some of the residues shown to directly interact with Egf [e.g. for His409, Phe412, Val417, and Ile438.with Egf or with with Egf (D) suchwith Egf . For exaClick here for fileSupplemental figure S10. Expression of Egf receptors and their ligands in medaka embryo. A) Expression of egfra, egfrb, B) egf, C) tgfa, D) hbegf, E)epgn , F)ereg, G)areg and H) btc in medaka embryo stages 8, 24, 27-28, 30, 37-38 and 39. Values for each gene were normalized to expression levels of elongation factor 1 alpha 1 (ef1a1) using the 2-DDCT method [T method . Data arClick here for fileegfra, egf, areg and hbegfexpression in melan-a and 293T cellsSupplemental figure S11. PCR analysis of medaka . A) Expression of medaka egfra in melan-a WT and melan-a Ola-egfracells. B) Expression of medaka egf, areg and hbegf in 293T cells transiently transfected with the expression vector alone (vector), medaka egf (egf), medaka areg (areg) or medaka hbegf (hbegf).Click here for fileSupplemental tables S2 to S4. S2) List of all species used in this analysis. S3) Accession numbers of all genes used in this analysis. S4) List of primers used for quantitative real-time PCR analyses.Click here for file

Using data from the population-based Prescription Database of North Jutland County and the Danish Cancer Registry, we compared cancer incidence among 29 470 individuals prescribed low-dose aspirin at maximum doses of 150 mg with expected incidence based on county-specific cancer rates, during a 9-year study period. We observed 2381 cancer cases compared with 2187 expected, yielding a standardised incidence ratio (SIR) of 1.09 , 1.05–1.13). No apparent risk reductions were found for cancers of the colon or rectum , or for other site-specific cancers. Increased SIRs were observed for kidney cancer and brain cancer , although the excess in the latter was confined to the first year of follow-up. Stratification by number of prescriptions and duration of follow-up revealed no apparent trends. The SIR for colorectal cancer was close to unity among persons with 10 or more prescriptions who were followed for at least 5 years. Our results do not support a major protective effect of low-dose aspirin on the development of colorectal or other cancers. The observed excesses of kidney and brain cancers are not likely to be causally related to the use of low-dose aspirin. Epidemiologic and experimental evidence strongly suggests that use of aspirin and other nonsteroidal anti-inflammatory drugs (NSAIDs) reduces the risk for colorectal cancer reportedOnly limited data are available on what dose and duration of treatment with aspirin and other NSAIDs are necessary to reduce the risks for colorectal and, potentially, other cancers. Some studies have evaluated the association between regular use of low-dose aspirin and colorectal cancer risk , but theThe study was conducted within the population of North Jutland, a county with nearly 500 000 inhabitants, representing approximately 9% of the total Danish population. Through a computerised accounting system maintained by Danish pharmacies, the tax-supported health insurance programme in Denmark refunds part of the costs of most drugs, including some over-the-counter medications, if prescribed by physicians. In North Jutland, this accounting system also provides prescription data to the Pharmacoepidemiologic Prescription Database , tablet Through the Prescription Database, we identified 32 794 individuals prescribed low-dose aspirin between 1 January 1989 and 31 December 1995. These prescriptions were identified by the ATC codes for aspirin (B01AC06 and N02BA01) in tablet sizes of 75, 100 or 150 mg. All preparations of aspirin are available over-the-counter in Denmark, but low-dose aspirin, which is used almost exclusively for secondary prevention of cardiovascular disease, is generally prescribed by physicians, being reimbursable by 50% through the national health insurance programme. In Denmark, the recommended dose of low-dose aspirin for secondary prevention of cardiovascular disease is 75–150 mg once daily, and the preparation is mainly prescribed in packets for 3-month use (n=617); (ii) an invalid civil registry number (n=15); (iii) death prior to or at the date of prescription (n=19); or (iv) parent (of patient) registered as customer (n=17). After these exclusions, 32 126 (98.0%) persons were left for subsequent record linkage.Overall, 668 (2.0%) of the identified persons prescribed low-dose aspirin were excluded because of (i) residency outside the county of North Jutland at the date of prescription were excluded, leaving a final study cohort of 29 470 (89.9%) individuals.Information on cancer occurrence was obtained by linkage to the Danish Cancer Registry, which has recorded incident cases of cancer on a nationwide basis since 1943 (n=1962), date of death (n=8493), or 31 December 1997 (n=19 015), whichever occurred first. Information on date of death was obtained through linkage to the National Mortality Files and 14 412 women (49%) are presented in Table 1vs 1.1 in women) and non-Hodgkin's lymphoma in men vs 0.9 in women).Overall, we observed 2381 cancer cases compared with 2187 expected, yielding a SIR of 1.09 among persons below 70 years at cohort entry and 1.06 among older persons (data not shown). Similarly, for specific cancer sites, including colorectal cancer and kidney cancer, the SIR estimates did not differ substantially between these two age groups.Table 3The overall increased SIR for brain cancer was entirely due to an excess in the first year of follow-up among persons receiving one prescription or 2–4 prescriptions (data not shown). For the remaining sites of interest, including cancers of the lung, breast, prostate, bladder, and ovary, stratification by number of prescriptions and years of follow-up revealed no consistent trends (data not shown).In this population-based cohort study, we found little evidence of a reduced risk for colorectal or other cancers among nearly 30 000 individuals receiving prescriptions for low-dose aspirin. There was a slight decreasing trend in risks for colorectal and stomach cancers with increasing number of prescriptions and length of follow-up, however, the SIRs for both cancers were close to unity among persons with 10 or more prescriptions who were followed for at least 5 years.Our results are consistent with those of two previous studies reporting on colorectal cancer risk among users of low-dose aspirin. In the only randomised clinical trial of aspirin and cancer risk published to date , based oThe strengths of our study are the population-based design, the continuously updated data on aspirin use based on a prescription database covering all pharmacies in a Danish county, the relatively large number of outcomes, and the complete follow-up obtained by use of the unique civil registry number and computerised linkage to the Danish Cancer Registry. The Cancer Registry covers the entire population of Denmark and has been shown to have accurate and virtually complete ascertainment of cancer cases . The excess risk was confined exclusively to the first year of follow-up among patients who received only a few prescriptions for low-dose aspirin. Some patients with brain tumours may have received anti-thrombotic treatment with low-dose aspirin prior to diagnosis, because they presented with symptoms resembling thrombotic cerebral diseases, for example, transient ischaemic attacks.The duration of exposure to aspirin necessary to prevent colorectal or other cancers has not been firmly established. In one study, a protective effect at doses of at least 300 mg daily became evident after only 6 months of continuous treatment , but othIn summary, patients prescribed low-dose aspirin at doses of maximum 150 mg were not at a substantially reduced risk for colorectal or other cancers. The available evidence so far does not support a major protective effect of low-dose aspirin on the development of colorectal or other cancers. Further studies are needed to establish what dose and duration of treatment by aspirin and other NSAIDs are necessary to prevent colorectal and possibly other cancers.

Vandetanib is a once-daily oral inhibitor of VEGFR, EGFR and RET signaling pathways. In patients with advanced colorectal cancer and liver metastases, the effect of vandetanib on tumor vasculature was assessed using dynamic contrast-enhanced magnetic resonance imaging (DCE-MRI).60 and Ktrans) was used to quantify the primary endpoints of tumor perfusion and vascular permeability. An exploratory assessment of tumor oxygenation was performed using MRI/T2*. All MRI parameters were measured at baseline (twice) and on days 2, 8, 29 and 57.Eligible patients received vandetanib 100 or 300 mg/day. DCE-MRI . Baseline measurements of iAUC60 and Ktrans were reproducible, with low intrapatient coefficients of variation . Estimates of mean % changes from baseline were -3.4% (100 mg) and -4.6% (300 mg) for iAUC60, and -4.6% (100 mg) and -2.7% (300 mg) for Ktrans; these changes were not significantly different between doses. The exploratory T2* measurement showed a significant increase at 300 mg versus 100 mg (P = 0.006). Both doses of vandetanib were generally well tolerated; common toxicities were fatigue, rash and diarrhea (majority CTC grade 1 or 2). The pharmacokinetic profile of vandetanib was similar to that observed previously. There were no RECIST-defined objective responses; five patients experienced stable disease ≥8 weeks.Twenty-two patients received vandetanib ; D4200C00050 (AstraZeneca) Vascular endothelial growth factor (VEGF) has a pivotal role in tumor angiogenesis, which is required for the growth of most solid tumors and the formation of metastases. The VEGF signaling pathway is a validated therapeutic target in several solid tumors, including advanced colorectal cancer , non-smatrans). Although iAUC and Ktrans are incompletely validated endpoints that are sensitive to changes in a number of hemodynamic parameters, including blood flow, blood volume, vessel permeability and vessel surface area ) . The iAUA preliminary assessment of efficacy was measured by objective response rate and progression-free survival (PFS) based on Response Evaluation Criteria in Solid Tumors (RECIST). RECIST assessments were performed by contrast-enhanced computed tomography (CT) at baseline, day 57 and every 8 weeks thereafter. Subjects who had not progressed or died at the time of analysis were censored at the time of their latest assessment.Adverse events were reviewed at each scheduled visit and graded according to the National Cancer Institute Common Terminology Criteria for Adverse Events (CTCAE) version 3. The possible relationship of an adverse event to study treatment was assessed by the investigator. Twelve-lead ECGs were performed during screening, pretreatment (day 1), days 8, 15, 29, 57 and every 3 months thereafter. Criteria for prolongation of the QTc interval were clearly defined in the protocol. Patients who continued to receive vandetanib beyond day 57 were anticipated to attend follow-up visits every 4-6 weeks.To evaluate the pharmacokinetics in this patient population, blood samples collected pre-dose on day 1, pre-dose and 4-8 h post-dose on days 8, 15 and 29, and pre-dose and at 4, 6, 8 and 24 hours post-dose on days 2 and 57 were used to determine the plasma concentrations of vandetanib. The binding of vandetanib to plasma proteins was also determined. Plasma concentrations of vandetanib and the concentrations in plasma ultra-filtrate were determined using reverse-phase liquid chromatography and detection by tandem mass spectrometry. Blood samples collected during screening and pre-dose on days 1, 2, 8, 15, 29 and 57, and at withdrawal were used to determine levels of VEGF, EGFR, sVEGFR-2, tunica interna endothelial cell kinase (Tie2), basic fibroblast growth factor (bFGF), Angiopoietin-1 (Ang1) and Ang2. VEGF and bFGF were measured in EDTA-plasma samples and the remaining markers measured in serum as described previously [e transformed variables, with baseline as a covariate, dose and visit as fixed effects, and subjects as a random effect. Comparisons were performed to provide the least squares estimates and corresponding 95% CIs at each visit. Results are reported as the mean percentage change and associated 95% CI from baseline by dose. The proportion of patients with a >40% reduction post-baseline for Ktrans and iAUC60 has been summarized for each dose level; the >40% threshold was predefined and has been used previously for detection of anti-vascular activity by DCE-MRI [P values were calculated for dose comparison of percentage decreases from baseline in Ktrans, iAUC60 and LCDCE-MRI. The effect of vasoactive agents on T2*, and whether this produces an increase or a decrease of T2*, depends on the balance between any change of blood volume and blood flow coupled with any change in oxygen utilization [P value was calculated for T2*. Population pharmacokinetic and pharmacokinetic-pharmacodynamic modeling was conducted using NONMEM software [The effect of vandetanib on MRI parameters was assessed using repeated measures analysis of variance (ANOVA) model fitted to log DCE-MRI . One-sidlization . Since tsoftware ,27.From 15 August 2006, 22 patients were enrolled in two centers in Germany and received study treatment; 10 patients were randomized to the vandetanib 100 mg group and 12 patients to the vandetanib 300 mg group . While differences were identified between the two baseline measurements for both parameters, Bland-Altman plot analyses supported the definition of baseline as the average of the two baseline measurements . Analysis of the mean change in T2* from baseline revealed a dose effect; the increase in T2* in the 300 mg cohort was significantly different from the small decrease observed in the 100 mg cohort (two-sided DCE-MRI) was recorded in the pre-contrast DCE-MRI scan. Analysis of the LDDCE-MRI data from days 2, 8, 29 and 57 showed mean increases from baseline in both cohorts. These increases were less pronounced in the 300 mg cohort, with evidence of a significant dose effect and the maximum concentration (Cmax) increased in a dose proportional manner, with gmean AUC0-24 of 1370 ng/mL·h (100 mg) and 4913 ng/mL·h (300 mg), and gmean Cmax of 72.7 ng/mL (100 mg) and 268.5 ng/mL (300 mg). The gmean accumulation at steady state was 4.3-fold in the 300 mg group and 6.12-fold for the one evaluable patient in the 100 mg dose group. Determination of Cmin throughout the study period showed that steady-state exposure was achieved from day 15 onwards . There was no suggestion of a dose effect. No consistent time- or dose-related changes from baseline were observed for the other markers evaluated .There were no RECIST-defined objective responses as assessed by contrast-enhanced CT. Among the 21 evaluable patients, five patients in the 300 mg group had a best response of stable disease ≥8 weeks and the remaining 16 patients experienced progressive disease. One patient in the 300 mg group had no post-baseline measurements and was therefore not evaluable. A waterfall plot of the best percentage change from baseline in the size of target lesions is presented in Fig. n = 5), diarrhea, fatigue, acne, dry skin and hypertension (n = 3). Four of these adverse events were CTCAE grade 3 : allergic dermatitis, fatigue, photosensitivity reaction and hypertension (100 mg). No grade 4 events were reported. Adverse events that were considered by the investigator to be related to study treatment were mostly manageable by dose reductions or interruptions. Two patients in the 300 mg group experienced adverse events that led to discontinuation of treatment: allergic dermatitis and photosensitivity reaction (both grade 3) in one patient and QTc prolongation (grade 2) in another. Nine deaths occurred during this study before data cut-off and all were as a result of disease progression. Clinical laboratory evaluations did not show any clinically relevant changes in any clinical chemistry, hematology and urinalysis parameter. There was also no consistent trend in mean blood pressure values, although increases in systolic and/or diastolic blood pressure were observed during treatment, particularly in patients with a history of hypertension or patients who were borderline hypertensive at study entry. These increases in blood pressure were considered by the investigator to be related to vandetanib.Both vandetanib doses were generally well tolerated. The most frequently reported adverse events, irrespective of causality, were fatigue, diarrhea, dry mouth and nausea Table . More ad60 and Ktrans did not show any statistically significant changes from baseline for either treatment group. Therefore, the study did not support the hypothesis that vandetanib has effects on tumor vasculature, as defined by changes in gadolinium uptake measured by iAUC60 and Ktrans. The safety and pharmacokinetic profiles of vandetanib were similar to those observed in previous phase I studies [This randomized, open-label study used DCE-MRI to investigate the effect of once-daily oral dosing with vandetanib (100 mg or 300 mg) on tumor perfusion and vascular permeability in 22 patients with advanced colorectal cancer and liver metastases. The primary DCE-MRI variables of iAUC studies ,16. Bothtrans in patients with advanced cancer [in vitro [in vivo. Moreover, in the present study, both vandetanib doses achieved steady-state plasma drug levels that were several-fold greater than the IC50 for inhibition of VEGF-dependent proliferation of human umbilical vein endothelial cells (29 ng/mL) [There are several possible explanations for the absence of detectable changes in gadolinium uptake and tumor shrinkage with vandetanib in this setting. Although variations in institutional DCE-MRI protocols and different patient populations do not permit direct comparison, studies of other VEGFR-2 tyrosine kinase inhibitors have demonstrated reductions in iAUC/Kd cancer -10. Therd cancer and in md cancer ,19; the in vitro suggests9 ng/mL) . An antial cells ng/mL [2trans [A second explanation may be that vandetanib is not active against the tumor vasculature in this particular disease setting. Indeed, the antitumor effects of vandetanib in this group of patients with colorectal cancer were modest compared with its single-agent activity in NSCLC or medultrans .As discussed above, vandetanib has additional activity versus EGFR and the adverse event profile of vandetanib in this and previous studies ,36,37 istrans and iAUC60. More complex DCE-MRI approaches such as the St Lawrence and Lee model [It is also possible that vandetanib treatment may induce hemodynamic changes, such as normalization/remodeling of the tumor vasculature as hypothesized by Jain , that woee model , which iee model . Howeveree model ,43. In tee model . As suchPopulation pharmacokinetic-pharmacodynamic analyses showed no correlation between vandetanib exposure and any of the pharmacodynamic parameters analyzed. Given the long half-life of vandetanib, it may take up to 4 weeks for vandetanib to reach steady state ; in the 60 and Ktrans provided no evidence that vandetanib modulated gadolinium uptake within the tumor vasculature of patients with advanced colorectal cancer and liver metastases. As discussed, these findings from a small open-label study of only 24 patients should be interpreted with caution, particularly since vandetanib has previously demonstrated evidence of antitumor activity in phase II studies in advanced NSCLC and medullary thyroid cancer that is consistent with inhibition of VEGFR activity. Vandetanib is one of a number of VEGF signaling inhibitors in clinical development and each has a different pharmacological profile [60 and Ktrans. Vandetanib continues to be investigated in a range of other tumor types, including colorectal cancer and phase III programs in advanced NSCLC and medullary thyroid cancer.In the present study, DCE-MRI assessments of iAUC profile . We raisTPM, JT, ADK and AJR are all full-time employees of AstraZeneca. The authors declare no other competing interests.All authors contributed to the design of the study or manuscript writing, and have read and approved the final manuscript.

It is generally considered that most cancers arise following the accumulation of several genetic events and that as a consequence its incidence increases with age. We report a cytogenetic subgroup of acute myeloid leukaemia whose incidence is independent of age. This observation indicates that acute myeloid leukaemia can develop via multiple pathways, and underlines the importance of cytogenetics in understanding this disease.British Journal of Cancer (2002) 86, 1061–1063. DOI: 10.1038/sj/bjc/6600195www.bjcancer.comCancer Research UK© 2002 Cytogenetically-defined subtypes of acute myeloid leukaemia (AML) have distinct pathological and clinical features. In addition, many chromosomal abnormalities are important indicators of prognosis and are used to determine treatment strategies . UnfortuWe, and others, have reported distinct age distribution profiles for AML patients with certain chromosomal abnormalities . In ordede novo AML recruited to a population-based case–control study of acute leukaemia by dividing the number of cases in each cytogenetic group by the number of person-years at risk. As AML is a rare disease the number of cases were not subtracted from the total.de novo AML 593 (76%) had a cytogenetic result, while 34 (4%) failed and 152 (20%) were not tested. Overall, the incidence of de novo AML increased with age – rising from <10 per million among those aged 16–29 years to >40 per million among those aged 60–69 years ) is constant with age supports these findings (

Blunt Traumatic Pericardial Rupture (BTPR) with resulting cardiac herniation following chest trauma is an unusual and often fatal condition. Although there has been a multitude of case reports of this condition in past literature, the recurring theme is that of a missed injury. Its occurrence in severe blunt trauma is in the order of 0.4%. It is an injury that frequently results in pre/early hospital death and diagnosis at autopsy, probably owing to a combination of diagnostic difficulties, lack of familiarity and associated polytrauma. Of the patients who survive to hospital attendance, the mortality rate is in the order of 57-64%.We present two survivors of BTPR and cardiac herniation, one with a delayed penetrating cardiac injury secondary to rib fractures. With these two cases and literature review, we hope to provide a greater awareness of this injuryBTPR and cardiac herniation is a complex and often fatal injury that usually presents under the umbrella of polytrauma. Clinicians must maintain a high index of suspicion for BTPR but, even then, the diagnosis is fraught with difficulty. In blunt chest trauma, patients should be considered high risk for BTPR when presenting with:Cardiovascular instability with no obvious causeProminent or displaced cardiac silhouette and asymmetrical large volume pneumopericardiumHerniation could even be considered the 5th H of reversible causes of blunt traumatic PEA arrest.Potentially, with increasing awareness of the injury and improved use and availability of imaging modalities, the survival rates will improve and cardiac Cardiac herniation is a significant and potentially fatal complication of BTPR. This is by no means a new problem ,2 and itHere, we present two interesting cases of both left and right pleuropericardial ruptures and cardiac herniation. Despite the delay in initial diagnosis, both patients survived, though with varying degrees of disability secondary to related traumatic injuries. The second patient is one of the few reported cases of cardiac herniation and a delayed penetrating cardiac injury secondary to rib fractures.The common issue echoed throughout our experience and those of others is that of missed or delayed diagnosis. With these cases and literature review we hope to provide further awareness of this injury and clues which can be sought from the clinical presentation and investigations to aid diagnosis.A 21-year-old male was admitted to a district general hospital accident and emergency department following a moderate speed motorbike accident with the predominant vector of force through the chest and head. Initially when seen by the local ambulance service he was noted to be GCS 15/15, have a high Alveolar-arterial gradient but was cardiovascularly stable. Of note, he could not move or feel his legs.Management in the district general accident and emergency department followed standard Advanced Trauma Life Support (ATLS) practices. Chest radiograph showed pulmonary contusions on the left but nothing else of significance. He became increasingly agitated and hypoxic and was intubated prior to transfer for computed tomography (CT) scan.Head CT scans showed an interventricular haemorrhage. Spinal images showed T8/T9 fracture/dislocation with a normal cervical CT. Initial chest CT scans were reported as showing dextracardia and bilateral pneumothoraces; on the left side, the pneumothorax was reported as a possible tension pneumothorax. The possibility of a pneumopericardium was later attributed to an anterior pneumothorax. Abdominal and pelvis CT scans were essentially normal.As time progressed, persistent hypotension developed despite bilateral tube thoracostomies, fluid challenges and inotropes. The initial working diagnosis of spinal shock was made and a referral was made for further management and neurosurgical intervention for stabilisation of the T8-9 fracture/dislocation.2 of 1.0 with PaO2 around 10 kPa and requiring high dose norepinephrine and epinephrine to sustain his mean arterial pressure. He was re-trauma called at this stage and plain radiographs were obtained to further ascertain and clarify his injuries was noted with a cardiac herniation through the defect. The heart was noted to be large and dilated. The heart was relocated and the pericardium repaired with interrupted non-absorbable sutures. An intracranial pressure (ICP) bolt was also inserted for monitoring and further management of his traumatic brain injury.There was an almost immediate reduction in inotrope requirement and the patient was transferred to ICU. His post-op care was complicated by a chest infection and frequent episodes of fast atrial fibrillation secondary to a myocardial contusion, requiring DC cardioversion. He was discharged from ICU after 14 days. Although he was left with a permanent disability from his T8/T9 fracture dislocation, he recovered a good cognitive neurological status and arm strength. With no ongoing cardiovascular problems, he is currently awaiting transfer to a rehabilitation centre.The second case is that of a 45-year-old male brought into our regional trauma centre by air ambulance. He was the driver in a road traffic collision in which the force vector came through the passenger/left side of the car; unfortunately, the passenger was pronounced life extinct on the scene. On scene, the patient was agitated, moving all limbs and complaining of difficulty in breathing. As a result, he underwent tracheal intubation with drug assistance, bilateral thoracostomies, 750 ml crystalloid and application of a pelvic splint and usual spinal precautions.On arrival in the department, the initial concern was that of multiple rib fractures, left-sided flail and a large amount of surgical emphysema. Bilateral tube thoracostomies were inserted with 300 mls of blood from the left tube; ventilation/oxygenation improved adequately. Of note, cardiac pulsations were felt when there was a finger sweep of the left pleural cavity.The chest radiograph showed pneumopericardium, extensive surgical emphysema and improvement in the left-sided haemopneumothorax/right-sided pneumothorax Figure . The evoFollowing a joint review of the CT scans and the now-stable patient, no surgical intervention was felt to be needed. The patient had an ICP bolt inserted and was taken to the ICU for further resuscitation and stabilisation.Sixteen hours post-injury on the ICU, the blood output from the left basal tube thoracostomy started to climb, finally reaching 600 ml/Hr. This was associated with a transfusion requirement, haemodynamic compromise and climbing lactates. At this point, the patient was taken to theatre for a thoracotomy to establish the cause of a likely complex chest bleed.The following injuries were found and repaired through a left anterior lateral thoracotomy: left-sided longitudinal rupture of the pericardium and cardiac herniation; left ventricular laceration secondary to overlying rib fractures; multiple lung lacerations; and multiple flail ribs. Following insertion of a pericardial and further tube thoracostomies (on suction), the patient was transferred back to ICU for further care.An eighteen day ICU admission followed, the main issues being that of recurrent atrial flutter and a slow respiratory wean. The respiratory wean was protracted as a result of adult respiratory distress syndrome caused by the primary polytrauma and ventilator-acquired pneumonia.Over 6 weeks after his initial accident, the patient was discharged home and, all things considered, was doing well in follow up clinic one month later.Cardiac herniation can occur when there is a significant defect within the pericardial sac. Pericardial tears may involve either the superior/left/right pleuropericardium or the diaphragmatic pericardium. The defect can allow cardiac luxation and, in the case of diaphragmatic pericardial tear, herniation of abdominal contents into the pericardial sac. Clarke et al, one of the largest reviews to date, included a review of 132 cases plus 10 further cases of their own . Of thesAs seen with our own experience and those of others there is often a delay in diagnosis of BTPR and cardiac herniation, which is a real concern given that, once recognised, the treatment is simple and effective .The most common mechanism for BTPR are those involved in road traffic collisions and sudden decelerations; particularly those involving a vector of injury from the left side of the chest . The fol• Cardiac - contusions and dysrrthmias (28%). The delayed penetrating cardiac injury as a result of rib fractures, as witnessed in the second case is one of the only reported cases of its kind.• Chest - multiple rib fractures, haemopneumothoraces and pulmonary contusions almost universally seen.• Neurological - particularly thoracic spine fractures and spinal cord injuries as well as traumatic brain injuries (32%).• Abdominal injuries (27%).• Pelvic and long bone fracture indicative of a high velocity/energy impact (49%).Given the severity of associated injuries patients usually require invasive ventilation early on. However, if the patient is conscious, they may report symptoms of palpitations, shortness of breath and chest pain as well as angina type pains as a result of coronary obstruction following herniation ,11.The main clinical signs, which may be subtle but should be sought, are:• Signs similar to that of tamponade; in particular that of hypotension, pulsus paradoxus and raised jugular venous pressure (JVP) ,12. This• Fluctuating haemodynamic parameters, sometimes to the extent of sudden cardiac arrest (often as a result of change in patient's position) should evoke a high index of suspicion of BTPR .• Tachycardia and dysrrthymias may also be seen , such as• Displaced and heaving apex beat ,8,12.• A splashing murmur "bruit de Moulin" as a result of the heart moving in a haemopneumopericardium ,10,12.Identifying these symptoms and signs in a noisy and stressful trauma environment may well prove difficult. However, there is a multitude of investigations available to most hospitals that can assist in the diagnosis:Electrocardiogram - may show a tachycardia as well as dysrrthymias particularly those of atrial origin. Also present could be an electrical axis deviation associated with the cardiac herniation and rotation [• rotation ,8,12 androtation ,10. IschChest radiograph - as a readily available imaging modality, it is a useful screening tool for BTPR and cardiac herniation. Given the very real chance of the chest x-ray being completely normal, serial films may also be of use to identify any evolving pathology [• athology . Findingathology ,8,10,13.athology .Transthoracic/oesophageal echocardiography and Focused Assessment with Sonography for Trauma - TTE/TOE have been used with varying reports of success but the sensitivity for diagnosing even large pericardial defects is thought to be low [• o be low ,15. WithComputed Tomography (CT) - along with its increasing availability and use in the multiply injured trauma patients, CT is also more sensitive for identifying cardiac axis changes and pericardial discontinuity than plain radiographs [• iographs ,15.▪ Characteristic changes for a pericardial rupture include ,14,15:▪ Focal pericardial dimpling and discontinuity▪ Pneumopericardium▪ Interposition of lung between: aorta and pulmonary artery; or heart and diaphragm; or right atrium and right ventricular outflow tract▪ Characteristic changes for a cardiac herniation include ,15:▪ "Empty pericardial sac" sign, air outlining the empty pleuropericardium as a result of cardiac luxution into the hemithorax.▪ "Collar" sign is the result of compression of the cardiac contour as a result of constriction by the pericardial band caused by the defect.▪ Associated signs include dilated inferior vena cava (IVC), reflux of contrast into IVC and deformed ventricular silhouette, as well as, secondary signs of tamponade periportal lymphoedema, pericholecystic fluid and ascites.Magnetic Resonance Imaging (MRI) - In haemodynamically stable patients with a suspected BTPR where other imaging modalities have been suggestive but inconclusive, cardiac MRI has been used to clarify its presence [▪ presence .Once BTPR and cardiac herniation has been diagnosed, treatment is simple and effective. It has even been suggested that, as it is such a rapidly reversible cause of sudden cardiac arrest, there may be a role for post-arrest emergency thoracotomy for select patient groups with blunt chest trauma and positional cardiovascular instability .Video-assisted thoracoscopy has been suggested by some, for the assessment and management of stable patients where there is a lack of diagnostic clarity . Small pBTPR and cardiac herniation is a complex and often fatal injury that usually presents under the umbrella of multisystem trauma. The majority of patients will be non-salvageable; where, despite best efforts, the severity of the initial injury results in death prior to arrival in hospital. In the polytrauma patients with severe blunt chest injuries who survive to hospital arrival, the clinician must maintain a high index of suspicion for BTPR. Even with a high index of suspicion, the diagnosis is still fraught with difficulty. However, patients with blunt chest trauma and any of the following signs are exceptionally high risk for BTPR and the need for an urgent operative intervention should be considered:• Cardiovascular instability with no obvious cause. This instability may be labile and mimic cardiac tamponade, particularly with changes in patient position. A bedside TTE in this setting is a vital tool for exclusion of differential pathology.• A prominent, possibly displaced cardiac silhouette and asymmetrical large volume pneumopericardium. These signs may show varying degrees of prominence on the plain chest radiograph, if there is uncertainty and the patient's condition allows, a chest CT should be sought as it has been shown to better delineate the injuries. In situations where the patient has a good haemodynamic status and, despite CT, there remains a diagnostic uncertainty, cardiac MR should be considered.Herniation could even possibly be considered the 5th 'H' of reversible causes of blunt traumatic PEA arrest.Personal experience and a review of past literature show that, in the majority of cases, it is still an injury diagnosed at autopsy or thoracotomy. Potentially, with increasing awareness of the injury and improved use and availability of imaging modalities, the survival rates will improve and cardiac The authors declare that they have no competing interests.All authors were present at the conception of the project. PBS and RG prepared the draft and all authors were involved in revising the final manuscript. All authors have read and approved the final manuscript.Written informed consent was obtained from the patient for publication of this case report and accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal.

Much of the research studies have shown that occupational stress is one of the strong determinant factors of coronary heart diseases among people in general. However, exploring the extent to which the type or nature of ailments and its subsequent risk factors have an effect on the onset of mental health will help evolve suitable preventive measures. The present study attempts to explore the status of mental health and occupational stress with respect to 2 categories of patients: Those who are suffering from cardiac problems and those suffering from noncardiac health problems.Occupational Stress Questionnaire and Mental Health Questionnaire were administered to both cardiac and noncardiac patients. The cardiac group consisted of 40 patients who were being treated at the cardiology department of a reputed hospital, and noncardiac group (40 patients) consisted of outpatients of the same hospital being treated for noncardiac problems like knee pain, headache, etc. Responses to these self-reported questionnaires were subjected to statistical analysis to find out the difference between cardiac and noncardiac groups.The results revealed that cardiac patients tend to have lower levels of mental health than noncardiac patients. Similarly, cardiac patients were reported to have higher levels of stress due to role ambiguity, powerlessness, intrinsic impoverishment and unprofitability.The implications of the study were implementation of interventions to improve the internal strength of cardiac patients to overcome various aspects of occupational stress. Modern age is said to be the age of stress, which affects the global functioning of the individual human being, especially due to the demands of his working environment. Hence the present study tried to understand stress and mental health in relation to coronary heart disease.stress has many dimensions according to the situation that imposes various demands on the individual, of which the work environment plays a major role. Acute, or short-term, stress causes an immediate reaction in the body. If the threat or demand passes quickly, the body generally returns to normal. However, with prolonged stress, many health problems can develop. Some of the early symptoms of stress-related problems include physical symptoms such as headaches, stomach problems, eating disorders, sleep disturbances, fatigue, muscle aches and pains, chronic mild illnesses; and psychological and behavioral symptoms such as anxiety, irritability, low morale, depression, alcohol and drug use, feeling powerless, isolation from co-workers. If exposure to stressors continues for a longer period of time, the individual may experience chronic health problems relating to physical conditions like high blood pressure, heart disease, stroke, spastic colon, impaired immune system, dysfunction, diabetes, asthma, musculoskeletal disorders; and psychological and behavioral problems like serious depression, suicidal behavior, domestic violence, alcohol abuse, substance abuse and burnout.Stress can generally be defined as the reaction of individuals to demands (stressors) imposed upon them that refer to situations where the well-being of individuals is detrimentally affected by their failure to cope with the demands of their environment . The term et al., 2003). Thus the concept of stress can best be understood by saying that some environmental variables (stressors) when interpreted by the individual (cognitive interpretation) may lead to stress .Nowadays, any individual’s work situation is highly demanding. Either he has to improve his career strength as and when required by the occupational demands or has to quit/maintain a low profile. The competitive era demands more from the individual employee than his actual ability. When the demand exceeds the capacity to fulfill it, the concerned person feels that the excessive demand is a burden, which is generally called occupational stress. The stress affects both the body and the mind either positively as motivation in its smallest amount or negatively as a burden in its highest amount of pressure that the individual cannot shoulder. In turn, that leads to physical and psychological problems. Occupational stress, hence, is found to be a mental and physical condition that calls in a detrimental effect on the individual’s productivity, effectiveness, personal health and quality of work . Main components of this work-stress process are potential sources of stress (stressors), factors of individual differences (moderators/mediators) and consequences of stress (strain). Stressors are objective events; stress is the subjective aspect have identified some of the major stressors among executive personnel: (1) organizational practices , (2) job/task features , (3) organizational culture/climate , (4) interpersonal relationships and (5) employee’s personal characteristics . Burke (1988) and Lu et al. (2003) classified job stressors into 6 categories: Physical environment, role stressors, organizational structure and job characteristics, relationships with others, career development and work-family conflict. Copper et al. (1988) and Lu et al. (2003) are of the opinion that there are 6 sources of stress at work: Factors intrinsic to the job, management role, relationship with others, career and achievement, organizational structure and climate, and home/work interface. Other researchers opine that stressors and either exogenous or endogenous pressures [HREF1]. Studies on the impact of occupational stress found that acute and chronic stresses are major risk factors for the development and progression of coronary artery disease , and job strain is found to be associated with coronary heart disease and hypertension risk in a number of occupations . Elevations in systolic and diastolic blood pressures were found to be affected by the occupational stress due to exposure to psychosocial work . In a study, Panagiotakos et al. (2003) proved the levels of occupational stress are positively associated with the risk of developing acute coronary syndromes, after systematically controlling for age, gender and region, and also high in the presence of, and the presence of smoking, hypertension, hypercholesterolemia, diabetes mellitus, physical activity status, educational and financial status and nutritional habits. Their study also observed that the presence of occupational stress seemed to affect more significantly males than females, smokers than nonsmokers, hypertensives than normo-tensives and high alcohol consumers compared to low alcohol consumers.Occupational stressors have been researched widely and extensively during the past three or four decades. Hurrell To find out whether there exist any differences between cardiac patients with coronary heart disease (CHD) and noncardiac patients with general illness with respect to mental health.To find out whether there exist any differences between cardiac patients with coronary heart disease and noncardiac patients with general illness with respect to occupational stress.Based on the objectives, the hypothesis that there will not be any significant difference between cardiac patients with CHD and noncardiac patients with respect to their occupational stress and mental health was formulated for statistical verification.The present study attempts to explore the status of mental health and occupational stress with respect to 2 categories of patients: Those who are suffering from cardiac problems and those who are suffering from noncardiac health problems. Occupational Stress Index and Mental Health Questionnaire were administered to both cardiac and noncardiac patients. The cardiac group consisted of 40 patients who were being treated at the cardiology department of a reputed hospital, and the noncardiac group consisted of 40 outpatients of the same hospital being treated for noncardiac problems like knee pain, headache, etc.The patients of both groups were working as officers in state government departments located in Coimbatore city. Their ages ranged from 43 to 56 years, with more than 20 years of experience in the same department.The scale developed by Srivastava and Singh (1984) was used to measure the extent of job-related stress that patients of both categories perceived as arising from various constituents and conditions of their jobs. The items on the scale relate to most of the relevant components of a government official’s daily official work that can potentially cause stress. The authors explain that the instrument may be conveniently administered to employees of all levels working in various organizations. However, it is more suitable for employees working at the supervisory level and above. This scale has been found to have high reliability and has proved its validity through experiments; therefore, it was used for this study.This index examines 12 particular dimensions:Role overload: Role overload covers job situations like workload, staff insufficiency, lack of time, personal problems, job dissatisfaction, etc.Role ambiguity: Role ambiguity is characterized by vague and insufficient information related to job role, vague and poor planning of job, vague expectations by colleagues and supervisors, etc.Role conflict: Contradictory instructions from higher officers, interference of officials into the working conditions, vague instructions and insufficient facilities regarding new assignments, contradiction between office instructions and formal working procedures, difficulty in implementing new procedures and policies, etc., are included in this dimension.Group and political pressures: This dimension covers the difficulty to adjust with the political and group pressures and formal rules and instructions, compulsion to perform unwillingly, maintenance of group conformity, violation of formal procedures and policies, etc.Responsibility for persons: This dimension covers such aspects as the thrust of responsibility of other persons, the responsibility of other employees’ future, responsibility for the progress of organization, etc.Under-participation: This dimension covers job areas such as the position of the person in the organization — that with high or low power; the acceptance of suggestions made by other persons, etc.Powerlessness: This dimension covers areas such as acceptance of decisions taken by the person among employees, acceptance of suggestions regarding training programs of employees, lack of coordination of interest and opinion in making appointments for important posts, etc.Poor peer relationships: The area covered under this dimension refers to poor interpersonal relationships with colleagues, colleagues’ attempt to defame and malign the employee as unsuccessful, colleagues’ lack of cooperation in solving administrative and industrial problems, lack of cooperation and team spirit of employees of the organization, etc.Intrinsic impoverishment: Monotonous nature of assignments, opportunity to utilize abilities and experience independently, opportunity to develop aptitude and proficiency, place of suggestion in problem solving, etc., are included in this area.Low status: This dimension covers respect received by an employee from others, the role of nature of the job in enhancing social status, due significance given by higher authorities to the post and work, etc.Strenuous working conditions: This dimension covers tense circumstances in which work has to be done, risky and complicated assignments, unsatisfactory working conditions from the point of view of welfare and convenience, etc.Unprofitability: Low salary, absence of rewards, lack of motivation, etc., are included here.et al., 1992; Harding, 1980; Mari and Williams, 1985, 1986b; WHO,1994).This questionnaire was developed by the FilaBavi technical committee, which comprised of Swedish and Vietnamese epidemiologists, doctors and public health experts. This has been used to collect information about illness events and use of health services for executives. The questionnaire was tested among the respondents at different stages during a pilot study and then revised to be more appropriate to the local language and to common illness patterns. The English SRQ-20 was developed by the World Health Organization (WHO) as an instrument to screen for psychiatric disturbances. It consists of 20 questions which have to be answered by “Yes” or “No” depending on the presence or not of symptoms. Each question may score 0 or 1. It means that one can get a maximum score of 20. The SRQ-20 has been found to be reliable, valid and adaptable to screen for mental disorders in many countries, especially in the developing world . Cardiac patients were found to have lower levels of mental health as compared to noncardiac patients .t value = 4.028, P < 05), powerlessness , intrinsic impoverishment and unprofitability . Hence occupational stress of cardiac patients was found to be stemming from the vagueness of their job, too much of planning of the job, higher expectations by colleagues and supervisors, acceptance of poor decisions taken by other employees, acceptance of improper suggestions regarding training programs of employees, lack of coordination of interest and opinion in making appointments for important posts, monotonous nature of assignments, lack of opportunity to utilize abilities and experience independently, limited opportunity to develop aptitude and proficiency; and finally low salary, absence of rewards, lack of motivation also could be attributable for their stress.t value = 5.45,P < 05), under-participation and strenuous working conditions . Noncardiac patients, who were suffering from noncardiac illnesses, were also found to be having stress due to job situations like excessive workload, staff insufficiency, lack of time, personal problems, job dissatisfaction, low-power position of the person in the organization, acceptance of improper suggestions made by other persons, tense circumstances in which work had to be done, risky and complicated assignments, unsatisfactory working conditions from the point of view of welfare and convenience.The results also showed that noncardiac patients had higher levels of occupational stress due to role overload . Ensuring proper work environment, particularly providing very clear expectations of what a person is required to do at work, assigning adequate power to discharge duties, allocating tasks which utilize maximum internal strengths, enhancing perceived effort-profitability linkage at work will reduce the stress levels of employees sizably, and subsequently the occurrences of CHD can be prevented to the maximum extent. As these stressors are more critical and more likely to affect CHD, due care must be taken periodically by rendering remedial measures suitably, giving them the utmost priority.Based on the findings, it is evident that associations between certain key dimensions of stressors and CHD were stronger among the executives. This is consistent with the findings that more robust work stress-CHD associations have been found in studies employing professional younger groups of executives as compared to those employing nonprofessional older cohorts (Theorell Patients with CHD are more likely to have lower levels of mental health, perhaps due to the impact of stressors, as compared to noncardiac patients. Adopting appropriate changes in their work behavior and life style will lead to better mental health and enhanced quality of life.

II complex, [Cu2(C8H7O2)4(C9H7N)2], the two Cu cations are bridged by four carboxyl­ate groups of the phenyl­acetate anions; each Cu cation is further coordinated by an isoquinoline ligand to complete the distorted CuO4N square-pyramidal geometry. The Cu cation is displaced by 0.2092 (8) Å from the basal plane formed by the four O atoms. Within the dinuclear mol­ecule, the Cu⋯Cu separation is 2.6453 (6) Å. Although a parallel, overlapped arrangement of isoquinoline ligands exists in the crystal structure; the longer face-to-face distance of 3.667 (5) Å suggests there is no π–π stacking between isoquinoline ring systems.In the title centrosymmetric binuclear Cu DOI: 10.1107/S1600536809048697/ng2685Isup2.hklStructure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF reportAdditional supplementary materials:

Similar protocols evaluated by visual scoring of tumour load at 40 days after inoculation supported these findings, although no quantitative assessment of treatment-induced growth delay could be made by this method. This study shows that in vivo imaging of luciferase-transfected tumour cells is a useful tool to investigate the dynamics of disseminated tumour growth and efficacy of anticancer treatment in orthotopic models of peritoneal cancer in rats. It offers an attractive alternative to invasive methods, and requires fewer animals for measuring tumour response to therapy.Animal tumour models using orthotopic tumours for the evaluation of cancer therapies are of greater clinical relevance than subcutaneous models, but they also pose greater difficulties for measuring tumour size and quantifying response to treatment. In this study, we used noninvasive bioluminescence imaging to monitor the intraperitoneal growth of luciferase-transfected CC531 colorectal cells in adult WAG/RIJ rats. The bioluminescence signal correlated well with post-mortem assessment of tumour load by visual inspection of the peritoneal cavity at specific follow-up times. Using bioluminescence imaging, we were able to monitor peritoneal tumour growth sequentially in time and to calculate a tumour growth rate for each animal; this is not possible with invasive methods of evaluating tumour load. Bioluminescence imaging of rats treated with a single dose of cisplatin (4 mg kg Hyperthermic Intraoperative Peritoneal Chemotherapy (HIPEC), followed by systemic chemotherapy. The aim with HIPEC is to achieve high local drug concentrations in direct contact with small peritoneal tumour deposits, with mild hyperthermia used to increase drug penetration. This technique was pioneered by Locally disseminated peritoneal surface malignancy is a major problem in the management of abdominal cancers. In all, 10% of patients with primary colorectal cancer initially present with peritoneal seeding and 25–35% of patients who underwent seemingly curative surgery will later develop peritoneal metastases . Once peUntil now, the most commonly used method to determine tumour load in the abdominal cavity of animals is to kill the animals and score the size and number of tumours at various times after treatment camera, minutes after the administration of the substrate. Bioluminescence imaging has been used successfully for monitoring tumour growth in mice for quantitative assessment of anticancer therapies directed against disseminated peritoneal colorectal cancer. We report on the noninvasive, −1) and streptomycin (100 U ml−1). These cells give rise to disseminated peritoneal tumour nodules after i.p. injection in syngeneic WAG/RIJ rats , were used in this study. All protocols were approved by the local Animal Experimentation Committee and carried out in compliance with national guidelines for the care and use of research animals.6) and treated at 10 days after tumour cell inoculation, by which time small (1–2 mm) peritoneal tumours were established at 1 or more peritoneal sites. Treatment groups consisted of a single i.p. bolus injection of cisplatin or a 90 min intraperitoneal perfusion at 40 or 37°C with or without cisplatin (200 ml at 8 μg ml−1). Previous studies in rats had demonstrated that approximately 30–35% of the cisplatin administered during such a 90 min peritoneal perfusion was absorbed systemically (−1), but higher perfusate concentrations were associated with renal toxicity and were poorly tolerated. Animals were killed and the intraperitoneal tumour load was determined at 40 days after inoculation. Tumour load was scored according to a point scale indicating large (>5 mm: 3 points), moderate (1–5 mm: 2 points), small (<1 mm: 1 point) or no tumour (0 points) in seven abdominal regions . These scores were added to give the total peritoneal tumour load (maximum score 21 arbitrary units).Rats were inoculated i.p. with CC531 cells and Dormicum . Prior to perfusion, animals were injected i.v. with 42 mg kg−1 gelofusin to increase the resistance of the veins to the pressure of the peritoneal perfusion fluid, as described previously (μg ml−1) at the start of the timed perfusion. At the end of the 90 min perfusion, the perfusate was aspirated and the wound was closed.Rats were anaesthetised by i.m. injection of a mixture of Hypnorm (fentanyl: 0.15 mg kgCC531 cells were cotransfected with the firefly luciferase gene (pGL3) in combination with a vector for puromycin resistance (pHA262pur) or for green fluorescent protein (GFP) and neomycin resistance, using lipofectin reagent or electroporation, respectively. Molar ratios of 10 : 1 were used for luciferase : selection plasmids.5 per six-well plate. A total of 1 μg vector DNA was then added to 100 μl Optimem medium and incubated for 30 min at room temperature before mixing with 100 μl lipofectin solution (2–20 μl in 100 ml Optimem) and incubating for an additional 15 min. Plated cells were washed and 0.2 ml of the DNA/lipofectin mixture and 1.8 ml serum-free DMEM were added prior to overnight incubation at 37°C. Transfection medium was then replaced by fresh DMEM, containing 10% FCS, antibiotics and puromycin (5 μg ml−1). The resulting colonies were harvested and cultured independently to select for the highest luciferase activity.At 24 h before transfection with lipofectin, cells were seeded at a density of 2 × 10μl of HEPES-buffered mannitol buffer. Luciferase and GFP plasmid (10 μg) were added to the cell suspension and incubated for 5 min at room temperature prior to electroporation at 350 V. Cells were then incubated at 37°C for 48 h before selection by incubation with 800 μg ml−1 neomycin .Electroporation transfections were carried out using a Genepulser equipped with an RF module (Bio-rad). A total of 4 million cells were suspended in 950 5 luciferase-transfected cells in 100 μl lysis buffer. Protein concentration was measured using pyrogallol total protein reagent according to the manufacturer's instructions. Luciferin substrate (50 μl) was added to 5 μl aliquots of cell lysates to determine the luciferase enzyme activity, using a Top Count Luminescence Counter . Each lysate was measured twice and luciferase activity, corrected for protein content, was expressed as relative light units (RLUs).Luciferase activity was measured using the Dual Luciferase Assay kit . Cell suspensions were made with approximately 106 CC531-luc cells to monitor the dynamics of peritoneal tumour growth.All animals were imaged using a cooled CCD camera , coupled to the LivingImage acquisition and analysis software (Xenogen Corp.). To determine the detection limits of CC531-luc cells in rats, an increasing number of tumour cells was initially inoculated within the abdominal wall, immediately followed by the injection of luciferin and imaging of photon emission after 10 min. On the basis of this result, images were subsequently made at various time points after i.p. inoculation of 2 × 10D-luciferin (Xenogen) was dissolved at 15 mg ml−1 in sterile PBS and stored at −20°C. Animals were anaesthetised with hypnorm and Dormicum (midazolam: 2.5 mg kg−1) prior to injection with luciferin . Peritoneal light emission was measured over an integration time of 1 min, and images were acquired using Ivis and LivingImage software. Signal intensity was quantified as the total counts measured over the region of interest.Before imaging, the abdomen of the rats was shaved to minimise photon scattering and signal quenching. n=5) was followed sequentially at weekly intervals from 1 to 5 weeks after inoculation and then killed for visual inspection of peritoneal tumour load. Separate groups of rats (n=5 or 6 per time point) were imaged at 1, 2, 3 or 4 weeks immediately prior to post-mortem evaluation by visual inspection. Peritoneal luciferase activity was correlated with the distribution and size of tumours determined using the scoring system described.One group of rats , saline only or no treatment (n=5–7 per group). Luciferase activity was imaged weekly (for a maximum of 11 weeks) to determine the effect of the treatment on tumour growth. Animals were killed when the peritoneal RLU count was >2000 × 103.The time taken for peritoneal RLU signal to increase by 1000 counts above the starting value (on days 8–10 after inoculation) was calculated for each rat; this was termed ‘tumour regrowth time’.Rats were inoculated with 2 × 10CC531 cells grew intraperitoneally in WAG/RIJ rats and induced superficial tumours at several sites in the abdominal cavity, including omentum, mesentery, pelvis and subhepatic and subdiaphragmatic area. However, there was a large variation in tumour load within each group of animals killed at different times after inoculation or intra-abdominal perfusion at 37 or 40°C , 10 days after inoculation with CC531 cells. The tumour load was assessed post-mortem at 40 days after inoculation . There was no reduction in tumour load after normothermic or hyperthermic perfusion with cisplatin, relative to perfuate-only controls (P>0.5). The i.p. bolus cisplatin treatment protocol was subsequently selected for evaluating the usefulness of bioluminescence imaging to detect tumour response to therapy.Separate groups of rats were treated with cisplatin given either as an i.p. bolus injection (4 mg kgin vitro luciferase activity detected in CC351 transfected cells was 4.2 × 105 counts mg−1 protein after lipofectin transfection (CC531-luc1) and 2.9 × 103 counts mg−1 after electoporation (CC531-luc2). There was no difference in the in vitro growth of CC531 parental cells and CC531-luc1 or -luc2 cells, indicating that the transfection procedure had no effect on the in vitro growth ability (data not shown). These two cell lines were used for further in vivo studies.The highest 1 and CC531-luc2 produced tumours in immune suppressed nude mice when injected subcutaneously or i.p. However, only the electroporation- transfected CC531-luc2 cells grew in immune competent WAG/RIJ rats. The detection limit for CC531-luc2 cells, imaged immediately after injection in the rat abdominal wall, was 105 cells.Both the transfected cell lines CC531-luc2 cells; that is, earlier than after i.p. inoculation of rats with the parental CC531 cells. This reflects the change in protocol to inject 2 × 106 transfected cells compared with 1 × 106 parental cells. However, there was no significant difference in the in vivo growth rates of CC531-luc2 cells compared with the parental cells; the mean tumour loads increased from about 5 to 12 arbitrary units over a 4-week period between bioluminescence imaging and tumour load for individual rats , or for untreated rats . There was no significant difference between the untreated control group and the group given i.p. saline . Previous studies demonstrated that peritoneal perfusion with 15 μg ml−1 cisplatin (at 37 or 40°C) was required to give the same tumour concentration as an i.p. bolus injection of 4 mg kg−1 compared to lipofectin transfection. These CC531-luc2 cells did grow in the peritoneal cavity of the WAG/RIJ rats and no significant differences between growth rates of parental and transfected cells were seen. The high level of transfected gene expression in CC531-luc1 cells could have been responsible for their inability to form tumours in immunocompetent rats. It has been previously reported that expression of high levels of a transfected gene, for example, GFP, in mouse BM185 leukaemia cells resulted in a drastic reduction in disease development in immunocompetent mice, whereas in immunodeficient Nu/Nu mice the disease developed rapidly with regard to both the extent and distribution of tumour, despite the multiple tumour foci at variable depth in the peritoneal cavity. Small tumours within the liver mass could not be easily detected by bioluminescence.Using in vivo bioluminescence, has already been reported in mice was followed by subsequent regrowth of tumours. This could be detected well before the appearance of the common end points of weight loss, palpable tumours or death. A significant effect of cisplatin treatment on tumour growth, determined by Despite the advantages and convenience of bioluminescence imaging for monitoring tumour growth, there are some disadvantages. Firstly, light transmission is attenuated by tissue; therefore the deeper the tumours lie within the body, the greater the signal attenuation. This means that tumour load from deeper parts of the body will be relatively under-represented in the integrated images. It also means that small tumours that are shielded by bulky, pigmented organs may well be missed. Light–coloured organs, like prostate and mammary tissue or lungs, will tend to scatter rather than absorb the light, so the bioluminescence signal from tumour cells within such organs should be much less attenuated.1-transformed cells to grow in immunocompetent rats. Ideally, one would like to use clones expressing very high levels of the reporter gene, since this will enhance detection sensitivity. However, high expression levels of the transfected gene are also the most likely to introduce unwanted phenotypic changes, for example, immunogenicity and altered growth rates. In reality, a compromise between high luciferase expression and no, or minimal, changes in tumour cell behaviour will probably need to be sought. In any case, each transfected cell line should be checked for altered tumour growth before use in evaluating treatment responses.A second disadvantage of bioluminescence detection is that this procedure involves transfection of the parental cell line. The resulting clones do not always behave in exactly the same way as the parental cells, as was demonstrated by the inability of CC531-lucAlternative noninvasive techniques, such as PET, might overcome some of the limitations of bioluminescence detection of orthotropic tumour growth. However, this is a very expensive technique and it is not widely available for preclinical animal studies. PET may also be associated with its own problems, since the radioisotopes used tend to accumulate in excretion organs , which could interfere with the detection of small tumours in the peritoneal cavity. A direct comparison of these techniques would be interesting, but is outside the scope of the present study.in vivo bioluminescence imaging of tumour cells enables a rapid, noninvasive measurement of tumour load before, during and after treatment of rats with disseminated peritoneal disease. Using this technique, our understanding of in vivo tumour development and response to current and novel treatments can be increased.In summary, we showed that

Normal pregnancy corresponds to a procoagulant state. Acute myocardial infarction during pregnancy is rare, yet considering the low non-pregnant risk score of childbearing women it is still surprisingly frequent. We report a case of postpartum recurrent non-ST elevation myocardial infarction in a 40-year-old caucasian woman with essential thrombocythaemia in the presence of a positive JAK-2 mutation and an elevated anti-cardiolipin IgM antibody titer. In the majority of cases of myocardial infarction in pregnancy or in the peripartal period, atherosclerosis, a thrombus or coronary artery dissection is observed. The combination of essential thrombocythaemia and elevated anti-cardiolipin IgM antibody titer in the presence of several cardiovascular risk factors seems to be causative in our case. In conclusion, with the continuing trend of childbearing at older ages, rare or unlikely conditions leading to severe events such as myocardial infarction must be considered in pregnant women. Essential thrombocythaemia (ET) is a chronic myeloproliferative disorder characterized by a sustained elevated platelet count with a tendency to both thrombosis and hemorrhage ,2. In ETPregnancy is an acquired risk factor for thromboembolism associated with increased coagulation and decreased fibrinolysis . HemodynPregnancy-related complications in patients with ET remains a challenge as platelet count has not been shown to represent a risk factor for pregnancy complications, nor the use of aspirin has been demonstrated to influence pregnancy outcome . We descth week monotherapy with 50 mg metoprolol was started due to postpartal hypertension.A 40-year-old caucasian woman, gravida 3 para 2, developed postpartal arterial hypertension. Her first pregnancy, three years earlier, had been complicated by an early spontaneous abortion at gestational week 7. In the following pregnancy, one year later, while on prophylactic low-molecular weight heparin due to the previous miscarriage, a cesarean section was performed at gestational week 32 due to intrauterine fetal growth restriction (IUGR), infant birthweight 810 g, 1-, 5-, and 10-min Apgar scores of 7, 9 and 10, respectively; umbilical cord arterial blood pH: 7.00. During the present pregnancy, low-dose aspirin was given from gestational week 13 to week 37 due to IUGR in the former pregnancy. Shortly after an uneventful elective cesarean section performed in the 39The patient had the same partner since the first pregnancy and no history of spontaneous bleeding, thrombosis nor had she been diagnosed to have elevated platelet counts requiring treatment. During the present pregnancy platelet counts were initially elevated but continuously decreased from 598 G/L to 346 G/L at the time of caesarean delivery.2). No medication or illicit drugs were taken. The patient was breastfeeding.Risk factors for coronary heart or thromboembolic diseases, including smoking, hyperlipidemia, diabetes mellitus or atrial fibrillation were absent except for a positive family history of coronary artery disease and overweight . With the clinical and laboratory findings suggesting anterior wall myocardial infarction, the patient was started on aspirin, intravenous heparin and nitroglycerin, and a coronary angiography was performed -mutation, a matching bone marrow finding without evidence for iron deficiency or infection. Potential hereditary risk factors for thrombophilia , factor XIII, and PAI-1) were excluded. Cytogenetics for BCR-ABL, t, were negative. IgM anticardiolipin antibodies were transiently elevated and ANA was 1:160 with negative anti-dsDNA and anti-Histone antibodies.Oral hydroxyurea was added to aspirin, but had to be discontinued due to severe alopecia. In response to alternate treatment with low dose peg-interferon α-2a, platelet count normalized. At the one-year follow-up, the patient presented with normal blood pressure and remained in remission for hematological and cardiac disease while remaining on aspirin.Pregnancy is not commonly considered a risk factor for acute myocardial infarction, however pregnancy increase the risk of acute myocardial infarction 3- to 4-fold ,15. ManyCardiac function and hormonal milieu are unfavorably altered in pregnancy whereas cardiac output is increased in the presence of elevated levels of estrogen and progesterone ,13. The Superimposed hypertension, as in the reported case may further damage blood vessels already weakened by hemodynamic stress and hormonal alterations. Overall, an increasing prevalence of cardiovascular risk factors with advanced maternal age contributes to pregnancy-associated complications ,19. MoreIn a recent retrospective review of 228 reported cases of pregnancy-related acute myocardial infarction, morphology of the coronary arteries was present in 164 cases. Atherosclerosis with or without intracoronary thrombus was found in 70 cases (43%), and definite or probable coronary thrombus without evidence of atherosclerotic disease was present in 22 (13%). Coronary artery dissection was verified in 24%, spasms and embolus in 2% and 1% respectively. Normal coronary arteries were found in 20% [Published studies on ET pregnancies report live birth rates of 50-70% and spontaneous abortion rates of 25-50% ,24. In aDespite the fact that a decrease in platelet count during pregnancies is well documented, pregnancies in ET patients frequently end in early spontaneous abortions, during the first trimester . Their oOur patient's history of previous early spontaneous abortion, IUGR and the presence of anticardiolipin antibodies suggest the possibility of an incomplete antiphospholipid antibody syndrome, which represent the most common acquired thrombophilia of pregnancy and has been associated with myocardial infarction ,29.Antiphospholipid antibody syndromes may also be associated with autoimmune diseases such as systemic lupus erythematosus, which can cause pericarditis and myocarditis . In the Our patient had experienced a severe migraine attack which has also been found to be a risk factor for myocardial infarction during pregnancy . The posDespite the fact that ET-pregnancies carried to term are rarely complicated by thrombohemorrhagic events our patient had experienced recurrent postpartal ACS in the presence of essential thrombocytosis and elevated antio-cardiolipin IgM antibodies. Since patients with ET seems to have an increased prevalence of antiphospholipid antibodies which may be associated with thrombosis it is noThere are several recommendations that womET: essential thrombocythaemia; AMI: acute myocardial infarction; ACS: acute coranary syndrome; LAD: left anterior descending; MTHFR: methylenetetrahydrofolate reductase; CK: creatine kinase.Written informed consent was obtained from the patient for publication of this case report and accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal.The authors declare that they have no competing interests.SA, MGM, RL, DS, made substantial contributions to patient care and to the preparation of the manuscript. IS and VL contributed to the manuscript preparation. All authors read and approved the final manuscript.Appendix 1.Diagnostic approach of suspected acute myocardial infarction (AMI) in pregnant womenSymptoms mimicking myocardial ischemia may also be present during healthy pregnanciesST-segment depression may also be present due induction of anesthesia for cesarean section and may persist after elective cesarean sectionTroponin I levels: is the most sensitive marker for AMI. The majority of healthy pregnant women remain below the upper limit of normal Troponin I levels after delivery.Creatine kinase/CK-MB: can be significantly elevated up to 24 h after delivery in healthy pregnant womenSafe and accurate for evaluating wall-motion abnormalitiesSubmaximal protocol evaluation with fetal monitoring for the diagnosis of myocardial ischemia or risk stratification following AMIBoth modalities may add further information with overall small or none fetal exposure to radiationPossible increased risk of coronary dissection and great risk of fetal exposure to radiationBoth the cardiologist and obstetrician should establish the treatment plan

Only recently has mechanobiology allowed us to gain a better understanding of the fundamental role of in vitro mechanical stimuli in maintaining the phenotype of tendinous tissue. This review analyzes the techniques used so far for in vitro regeneration of tendinous tissue.Tissue engineering is a multidisciplinary field that involves the application of the principles and methods of engineering and life sciences towards i) the fundamental understanding of structure-function relationships in normal and pathological mammalian tissues and ii) the development of biological substitutes that restore, maintain or improve tissue function. The goal of tissue engineering is to surpass the limitations of conventional treatments based on organ transplantation and biomaterial implantation. The field of tendon tissue engineering is relatively unexplored due to the difficulty in Tendons are soft connective tissues, which connect muscle to bone and form a musculo-tendinous unit, whose primary function is to transmit tensile loads generated by muscles to move and stabilize joints. The biomechanical properties of tendons can be attributed to the highly defined organization of their extracellular matrix (ECM). ECM of tendons is primarily composed of collagen I, and is organized in a hierarchy of bundles that are aligned in a parallel manner in a proteoglycan matrix. Tendon injuries produce considerable morbidity, and the disability that they cause may last for several months despite what is considered appropriate management. The basic cell biology of tendons is still not fully understood, and the management of tendon injury poses a considerable challenge for clinicians. After an injury, the healing process in tendons results in the formation of a fibrotic scar. The structural, organizational, and mechanical properties of this healed tissue are insufficient as tendons possess a limited capacity to regenerate.2Adhesion formation after intrasynovial tendon injury poses a major clinical problem. Disruption of the synovial sheath at the time of the injury or surgery allows granulation tissue and fibroblasts from the surrounding tissue to invade the repair site. Exogenous cells predominate over endogenous tenocytes, allowing the surrounding tissue to attach to the repair site, resulting in adhesion formation. Despite remodeling, the biochemical and mechanical properties of healed tendon tissue never match those of intact tendon. In a study of transected ovine Achilles tendons that had spontaneously healed, the rupture force was found to be only 56.7% of the normal force after twelve months. One possible reason for this is the absence of mechanical loading during the period of immobilization.2 It is w1in vitro preservation of tenocyte phenotype, and only recently has mechanobiology allowed a better understanding of the fundamental role of in vitro mechanical stimuli in maintaining the phenotype of tendinous tissues. Tendon tissue engineering requires a scaffold that functions as a temporary structure to support initial tissue growth. Scaffolds can improve tendogenesis allowing cell proliferation, ECM production and finally, organizing the matrix into functional tendon tissue. Moreover, tendon regeneration could be stimulated through approaches such as the use of growth factors and gene therapy, as well as by in vitro mechanical forces. This review analyzes the techniques used so far for the in vitro regeneration of tendinous tissues, and discusses strategies for the improvement of the same.For this reason, obtaining tendinous tissue through tissue engineering approaches becomes a clinical necessity. Tissue engineering is a multidisciplinary field that involves the application of the principles and methods of engineering and life sciences towards i) the fundamental understanding of structure-function relationships in normal and pathological mammalian tissues and ii) the development of biological substitutes that restore, maintain or improve tissue function. The goal of tissue engineering is to surpass the limitations of conventional treatments based on organ transplantation and biomaterial implantation. It has the potential to produce a supply of immunologically tolerant, ‘artificial’ organs and tissue substitutes that can grow within the patient. This should lead to a permanent solution to the damage caused to the organ or tissue without the need for supplementary therapies, thus making it a cost-effective, long-term treatment. Tissue engineering uses different biomaterials, carrier cells and/or bioactive factors to stimulate tissue regeneration. Nowadays, there are many tissue engineering approaches. The earliest clinical application of human cells in tissue engineering (in 1980) was for skin tissue using fibroblasts, and keratinocytes, on a scaffold. During the last 30 years, many innovative approaches have been proposed to reconstruct different tissues: skin, bone, and cartilage. The field of tendon tissue engineering is relatively unexplored due to the difficulty in Recreating a scaffold appropriate for tendon tissue engineering is difficult because of the particular micro-architecture, both of collagen fibres and of ECM molecules. It is clear that the resistance and elasticity of tissues depend on these parameters due to which, competent scaffolding materials are needed. Biomaterials should protect the cells and new tissue from strong forces, while allowing graded exposure to loading at later points in time. This will allow the tissue to develop more naturally and function more efficiently. There ar68111821in vivo.[424in vivo study showed that fibroblast-seeded collagen scaffolds were viable for at least eight weeks after reimplantation into donor rabbits.[in vitro application of tension during its development. Knitted Dacron scaffolds seeded with canine fibroblast cells demonstrated a more uniform and abundant encapsulation with connective tissue than unseeded scaffolds.[in vivo mechanical strength to the level of functional ligaments or tendons. Fibres of collagen or degradable polymers of PLGA and PLA can be crosslinked, woven, or braided to increase the mechanical strength of the resulting tissue-engineered tendons and ligaments.[32in vitro studies, and fibroblast-seeded collagen fiber scaffolds have shown promising results in implantation studies.[3242In vitro data demonstrate that the silk matrix provides sufficient support for the attachment, proliferation, and differentiation of human Mesenchymal Stem Cells (MSCs). The fibrous scaffold was covered with a uniform cell sheet and cell-associated extracellular matrix after 21 days with few changes in the tensile strength of the fibre matrix. In an in vivo approach, a surgically created gap Medial collateral ligament (MCL) injury in rabbits was healed by using porcine small intestinal submucosa as a collagen scaffold.[Usually, a 3D scaffold housing a specific cell type has to be able to be directed to form tendon/ligament tissue. As compared to 2D culture, 3D culture offers the advantage of more closely recreating the spatial organization of native tissue. There arin vivo.24 Fibrobin vivo. and thesin vivo.–30 Fibro vivo.42432 An in rabbits.34 In anocaffolds. These enaments.32 Fibrobla studies.3241 Silkscaffold.6 cells/mL).[in vivo and in vitro studies have showed the role of MSCs obtained from different human tissues (mainly bone marrow and adipose tissues) in tendon engineering.[49Multiple cell types have been seeded within scaffolds in an effort to stimulate cell-mediated tissue regeneration. The most common cell types employed are fibroblasts, tenocytes and mesenchymal stem cells/marrow stromal cells (MSCs). The mainells/mL).–48 Severineering.4950 MSCseering.49 and theieering.49in vitro tendon engineering using a collagen type I gel influenced by cyclic stretching. Tendon substitutes were created by dispersing human mesenchymal stem cells in a collagen type I gel, followed by polymerization in glass cylinders with defined measurements.[et al.[in vitro growth characteristics, senescence and collagen production, as well as the viability of reseeded constructs.[in vitro viability of tendon constructs after reseeding and after in vivo implantation in a clinically relevant model of rabbit flexor tendon grafting. Results showed that epitenon tenocytes, tendon sheath cells, bone marrow and adipo-derived stem cells have similar growth characteristics and can be used to successfully reseed acellularized tendon grafts.[in vivo and showed viability after six weeks following implantation.[in vivo tendon matrix remodeling. In conclusion, these results suggest that ASCs have a practical advantage when compared with epitenon tenocytes and sheath fibroblasts, given that it is easier to harvest large amounts of fat tissue.Kall and colleagues from Hanurements. A bioreaurements. Biomechas.[et al. comparednstructs. They alsn grafts. Construcantation. The mostantation. As confiIn vitro cell proliferation and differentiation require an intake of ions and nutrients from the culture medium. However, to obtain specific phenotype expression and proper cell differentiation, several biochemical factors such as cytokines and growth factors, must be added to the culture medium.[55555555555555555555e medium.54 The mae medium.5556 Manyum.55555558 To ove.55555555 It has aIn vivo and ex vivo gene transfer techniques have been used as well, as a result of which, sustained gene expression seems to last for about six weeks, possibly long enough for clinical applications.[7076Ex vivo gene transduction is possibly more efficient, but the techniques must be optimized. Gene therapy can also alter the healing environment of tendons in animal models of tendon repair. Adenoviral transduction of focal adhesion kinase (FAK) into partially lacerated chicken flexor tendons resulted in an expected increase in adhesion formation and a twofold increase in the work required for flexion compared with the results in control groups.[70P = 0.001). While tendon healing was not improved in this study, the results did demonstrate that the healing environment and conditions could be manipulated.[70707070Gene therapy delivers genetic material (DNA) to cells, allowing the modification of cellular function by means of viral or nonviral vectors or direct gene transfer. Gene the70ations.707677 Ex vgroups.70 These diulated.70 Bone morated.707080 BMP-12ed.707070 Transfer.70707070–88In vitro tissue development may include the application of mechanical loading to precondition the engineered tissue for the in vivo mechanical environment. Mechanical stress plays a significant role in modulating cell behavior and has driven the development of mechanical bioreactors for tissue engineering applications.[Studies in developmental biology and wound healing have revealed many of the biological events and signals involved in tendon cells and tissue morphogenesis.–90 It isications.–92 Tendoet al.[in vitro cyclic strain allows an increased production of TGF-β, FGF and PDGF by human tendon fibroblasts.[in vivo tendon healing by preventing differentiation of tenocytes into fibroblasts. Other experiments have demonstrated the beneficial effects of motion and mechanical loading on tenocyte function.[Experiments have confirmed cell growth and function would be controlled locally through physical distortion of the associated cells or through changes in cytoskeletal tension. Moreover, experimental studies have demonstrated that cultured cells can be switched between different fates including growth, differentiation, apoptosis, directional motility or different stem cell lineages, by modulating cell shape.–93 Kesslet al.94 demonsroblasts.95 Cyclicroblasts.96 Expresroblasts.97 We havroblasts. and 2. Tfunction.98 Repetifunction.98 Even ffunction.99In animal experiments, mechanical stretching has improved the tensile strength, elastic stiffness, weight and cross-sectional area of tendons.100101 Th1007070ex vivo models.[Clinical studies have shown the benefit of early mobilization following tendon repair, and several postoperative mobilization protocols have been advocated.104–108 To models. DurationTechnological improvements in the field of tissue engineering are leading to new potential developments in the approaches being used to treat tendon injuries. An integration of mesenchymal stem cells, growth factors, mechanical stimuli (bioreactor) and bioresorbable polymers can provide a solution for the treatment of difficult tendon injuries.in vitro and in vivo results, several objectives still remain unaccomplished for complete tendon regeneration: i) there is no scaffold able to simultaneously respond to major requirements like biocompatibility, biofunctionality, mechanical properties and processability; ii) cell culture procedures to be performed on scaffolds are not yet satisfactory, often resulting in a low rate of cellular adhesion and of ECM deposition; iii), there is currently a significant gap between in vitro results and in vivo application of tissue-engineered tendon tissue. Moreover, our knowledge is still limited in the field of growth factor and gene therapy for tendon regeneration, being based only on empirical observations rather than on a thorough understanding of the underlying mechanisms and pathways.[in vivo in response to the cell/growth factor/polymer composites, is effective and functional as a regenerated tissue.Despite preliminary pathways. Future r

Paenibacillus larvae. Newly-eclosed bee larvae, in the second stage of their life cycle, are susceptible to this infection, but become progressively more resistant with age. We used this host-pathogen system to probe not only the role of the immune system in responding to a highly evolved infection, but also what other mechanisms might be employed in response to infection.There is a major paradox in our understanding of honey bee immunity: the high population density in a bee colony implies a high rate of disease transmission among individuals, yet bees are predicted to express only two-thirds as many immunity genes as solitary insects, e.g., mosquito or fruit fly. This suggests that the immune response in bees is subdued in favor of social immunity, yet some specific immune factors are up-regulated in response to infection. To explore the response to infection more broadly, we employ mass spectrometry-based proteomics in a quantitative analysis of honey bee larvae infected with the bacterium Using quantitative proteomics, we compared the hemolymph (insect blood) of five-day old healthy and infected honey bee larvae and found a strong up-regulation of some metabolic enzymes and chaperones, while royal jelly (food) and energy storage proteins were down-regulated. We also observed increased levels of the immune factors prophenoloxidase (proPO), lysozyme and the antimicrobial peptide hymenoptaecin. Furthermore, mass spectrometry evidence suggests that healthy larvae have significant levels of catalytically inactive proPO in the hemolymph that is proteolytically activated upon infection. Phenoloxidase (PO) enzyme activity was undetectable in one or two-day-old larvae and increased dramatically thereafter, paralleling very closely the age-related ability of larvae to resist infection.We propose a model for the host response to infection where energy stores and metabolic enzymes are regulated in concert with direct defensive measures, such as the massive enhancement of PO activity. Apis mellifera, face a number of niche-specific pathogens such as the endospore-forming bacterium Paenibacillus larvae, the causative agent of American Foulbrood (AFB) , hymenoptaecin [GI:58585174], apidaecin 22 [GI:58585226], and defensin [GI:58585176]. We observed a 13-fold increase of lysozyme in PL-Lab infections (p < 0.01) and a 16-fold increase of hymenoptaecin Fig but therThe melanization cascade, which leads to the encapsulation of infectious agents, is one of the most important defensive mechanisms of insect innate immunity. One of the central steps in this mechanism is the cleavage of proPO to PO, the active form of the monooxygenase. The PO enzyme, which is activated by proteolytic action, catalyses a key step in the synthesis of melanin and plays a crucial role in melanotic encapsulation of invaders . We obseP. larvae. Recent data from our group suggests that proPO levels correlate positively with age [Although PO is well-known for its activity against pathogens, there is little indication so far that its expression level affects the outcome of infection by with age , but we with age , used towith age , should with age . To detewith age . The meaP. larvae infection? Cell-free hemolymph was extracted from healthy larvae one to five days after eclosion and tested for PO activity and, indeed, there was no detectable activity in the first two days of development, with some activity detected in day three and substantial activity thereafter gel electrophoresis study of larval hemolymph [The most obvious class of proteins expected to increase in response to infection are those involved in the innate immune response. Lysozyme's primary known function is to degrade the peptidoglycan shell of Gram-positive bacteria and is tzyme GI:1762174 thicinalis . The AMPicinalis ,29; manyzyme GI:1762174 th reports . Conspiczyme GI:1762174 themolymph .The consistent up-regulation of proPO in both infection methods is in agreement with the well-characterized antimicrobial activity of this enzyme. The ability of larvae to employ melanization as a defense mechanism has been questioned because the proPO levels are low compared to adults, to the point of being undetectable on a stained 1D gel . In our e.g., lipids) would necessitate a wide variety of tools in order to monitor energy usage, immune factor production and metabolic flux all at the same time. By monitoring all these aspects simultaneously, our data clearly demonstrate that host defense against bacterial challenge is a concerted response involving proteins that kill the microbes directly, as well as metabolic and cell/protein repair enzymes that indirectly support this defensive effort. By using proteomics techniques on this unique model organism where immunity and protein energy flux are tightly coupled, we have been able to build a more comprehensive picture of the insect innate immune response.The larval stage of a honey bee represents a unique system for applying proteomics to probe host-pathogen interactions. Unlike most other systems, proteins in larvae not only play major roles in immune defense but also constitute one of their primary stores of energy. Studying such a response in most other systems with more conventional energy reserves (P. larvae (courtesy of Jay Evans), and 3) phosphate-buffered saline (PBS).All infection experiments were conducted at Beaverlodge, AB, Canada during July and August of 2005. Three five-frame nucleus colonies ('nucs') were prepared with three frames of bees and open brood and with newly-mated sister queens. In each nuc, 100 by 100 mm patches of first instar larvae were selected and sprayed with 20 mL of one of the following: 1) a 6.0E+06 spores/mL suspension of spores isolated from naturally occurring AFB 'scale' collected in 2004 , 2) a 4.4E+06 spores/mL suspension of spores from NRRL B-3650 (PL-Lab), a virulent laboratory strain of 1H2O) and heavy (C2H2O) isotopologs of formaldehyde prior to analysis by liquid chromatography-tandem mass spectrometry (LC-MS/MS) using a linear trapping quadrupole-OrbitrapXL exactly as described [Four days after infection larvae (estimated to be in late fourth or fifth instar) within each marked square were extracted using soft forceps and bled as described . Hemolymescribed .http://www.analyse-it.com/), with peptides as data points to assess whether the expression level of each protein was significantly changed by infection at 95% and 99% confidence [n+ ions were selected for analysis. The same test was used on peptides quantified in both infection methods to assess whether the two methods yielded the same effects on protein expression. Experimentally or bioinformatically-inferred evidence of protein functions and names discussed throughout this report is provided in Additional File Raw data processing to arrive at peptide ion volume ratios was performed exactly as described . Data fonfidence . For proWe collected honey bee larvae and estimated their age in days by size. Animals at each age were pooled to collect at least 8 μL of hemolymph per replicate for three replicates – the number of larvae required varied from approximately 150 for the very young larvae, and 2–5 for the oldest larvae tested (five days old); 18 fourth to fifth instar larvae were pooled and used for the fractionation experiment and processed as described for larvae in . ProteinHemolymph was desalted using a mini Zeba column (Pierce) according to the manufacturer's instructions. Of the 75 μL total volume, 25 μL was reserved for MS analysis. The remainder was applied to a mini strong anion exchange column (Pierce), and washed with 100 μL of Assay Buffer between step-elutions of a 10-step sodium chloride gradient prepared in Assay Buffer: 0.04, 0.08, 0.12, 0.16, 0.20, 0.24, 0.28, 0.32, 0.36, 0.40, 0.50, 1.0, 2.0 M. Protein concentrations of all the fractions, including the flow-through and desalted hemolymph, were estimated by absorbance at 280 nm. Fractions eluted from 0.28 M or higher salt had negligible amounts of protein and were not further analyzed. The protein concentration of the other fractions was equalized using Assay Buffer. For each fraction we then measured the PO activity using an enzyme assay (see below) and levels of each protein relative to the 0.16 M NaCl fraction. At least 2 peptides of PO were used for calculating the average PO level in each fraction. In cases where peptide ratios were above 50-fold and likely beyond the linear dynamic range of the ratio measurements, the high ratios were arbitrarily given the same value as the next highest ratio value below 50-fold.520/ΔT). For larval aging experiments, instead of the rate, the maximum A520 value was recorded after the highest level was reached in approximately 40 min.Conducted as described , substraAPM and SFP designed and performed the colony infection experiments. APM and LJF collected the hemolymph samples in Beaverlodge. QWTC and LJF designed the proteomic analyses and wrote all the scripts used in the data analysis. QWTC performed all the proteomic, biochemical and bioinformatic analyses. QWTC and LJF wrote the initial version of the manuscript.This file contains the list of proteins considered identified by mass spectrometry-based sequencing and the peptide sequences of each protein. Protein accession numbers preceded by "999" are proteins that have been falsely discovered by matches reversed peptide sequences.Click here for fileThis file contains the list of quantified peptides and their relative expression values.Click here for fileThis file contains the list of proteins, their median averaged values based on peptide relative expression.Click here for fileThis file contains the list of proteins discussed in the paper with direct mention of their known or putative function, and the evidence or resource for this information.Click here for file

This tapeworm disease is changing from one of rural populations to one of urban populations worldwide. Diphyllobothrium nihonkaiense has been increasing in urban areas of Japan and in European countries. D. nihonkaiense is morphologically similar to but genetically distinct from D. latum and exploits anadromous wild Pacific salmon as its second intermediate host. Clinical signs in humans include diarrhea and discharge of the strobila, which can be as long as 12 m. The natural life history and the geographic range of the tapeworm remain to be elucidated, but recent studies have indicated that the brown bear in the northern territories of the Pacific coast region is its natural final host. A recent surge of clinical cases highlights a change in the epidemiologic trend of this tapeworm disease from one of rural populations to a disease of urban populations worldwide who eat seafood as part of a healthy diet.The incidence of human infection with the broad tapeworm Diphyllobothrium latum and D. nihonkaiense are exotic parasites that grow as long as 12 meters in the small intestine. By the mid-19th century, infection with the Japanese broad tapeworm was known to be contracted by eating salmon , O. gorbuscha , and O. keta , which migrate across the northern Pacific Ocean to the Sea of Okhotsk and the Bering Sea and the Department of Infectious Diseases of the Tokyo Metropolitan Bokutoh Hospital (BH) in Tokyo. MZ is the sole institute specializing in research and diagnosis of parasitic diseases in Kyoto city (population 1.4 million). BH is one of the major public hospitals in metropolitan Tokyo.cox1 and/or nad3 genes were also analyzed from most (42) patient specimens obtained since 2004; results confirmed the identification of D. nihonkaiense. Molecularly confirmed D. latum, from humans or fish, has not been reported in Japan.From 1988 through 2008, a total of 149 cases of diphyllobothriasis have been recorded: 95 at MZ and 54 at BH. Diphyllobothriasis nihonkaiense was diagnosed by morphologic appearance and taxonomic characteristics of the strobila (body of the mature tapeworm) passed in feces of a person who had a history of eating salmon or a habit of eating sushi or sashimi, which are normally composed of sea fish, often salmon. DNA sequences of the tapeworm D. nihonkaiense infection is equally as prevalent in Japan as D. latum is in some European countries ; patients reported that the strobila tore somewhere along its length when they tried to pull it out. The patients also frequently reported abdominal pain or discomfort and several episodes of diarrhea before passing the strobila, but few complained of substantial weight loss. Of the 149 patients, 73 were treated at MZ, BH, or affiliated institutions. Treatment with anthelminthics showed that 69 (95%) of 73 patients were infected with 1 tapeworm, 2 were infected with 2 tapeworms, and 2 were infected with 3 tapeworms. The tapeworms obtained measured 50–1,200 cm (average 334 cm). The length of the strobila was not associated with the age or sex of the patient, suggesting that all age groups and both sexes are equally susceptible to this tapeworm.The signs and symptoms caused by D. latum was found in 2 of 43 patients examined. Mild eosinophilia (absolute count >600/μL) was also found in 4 of 37 patients examined. A causal relationship between the anemia or eosinophilia and diphyllobothriasis nihonkaiense for these patients was not determined because neither the type of anemia nor the outcome of anemia or eosinophilia after treatment was examined.Pernicious anemia has been reported in some patients infected with cox1 and nad3 genes, they also showed that all plerocercoids recovered were identified as D. nihonkaiense and that 26 chum salmon caught during autumn lacked such infection. This finding implies that wild salmon caught in spring and early summer pose a higher risk for human infection than autumn-caught salmon, consistent with the observation that the incidence of human infection peaks in early summer and occasionally in coho salmon (O. kisutch). A major difference between D. ursi and D. nihonkaiense (D. klebanovskii) is their plerocercoid stage: plerocercoids of D. ursi encyst on stomach serosa of salmon (D. nihonkaiense (D. klebanovskii) have been found mainly in the body musculature of chum, masu, and pink salmon have been implicated as the source of D. latum infection (D. nihonkaiense tapeworm perpetuates its natural life cycle successfully between salmon and its final host animals in northern territories of the Pacific Ocean; however, its definite natural life cycle remains to be elucidated. Freezing and storing at –20 °C for 7 days or –35 °C until solid and storing at –35 °C for 15 hours is sufficient to kill parasites, although these conditions may not be suitable for freezing particularly large fish, e.g., those thicker than 6 inches (The epidemiology of diphyllobothriasis nihonkaiense has changed drastically from rural to urban areas because of the rapid expansion of the transport system for fresh and frozen fish to meet a demand for seafood in healthy diets. The uninterrupted occurrence of diphyllobothriasis nihonkaiense in urban areas implies that the It seems that the general public in Japan is only vaguely aware of the possible risk for parasitic diseases associated with eating sushi and sashimi made from marine fish. Although some information on this health risk is provided through means such as health education programs open to the public or television programs, the emphasis is generally on the risk for anisakiasis, one of the most prevalent parasitic diseases among Japanese. Persons are generally underinformed, especially about the risk of diphyllobothriasis from eating raw salmon. Moreover, people like sushi and sashimi made of never-frozen fish far better than that made from frozen fish. Consumers and retailers should be made aware of the risk for tapeworm infection posed by eating raw or undercooked wild salmon.

Yersinia pestis is the causative agent of pneumonic plague; recently, we and others reported that during the first 24-36 hours after pulmonary infection with Y. pestis pro-inflammatory cytokine expression is undetectable in lung tissues.delta yopH mutant results in an early pro-inflammatory response in the lungs characterized by an increase in the pro-inflammatory cytokines Tumor Necrosis Factor-alpha and Interleukin one-beta 24 hours post-infection. CO92 delta yopH colonizes the lung but does not disseminate to the liver or spleen and is cleared from the host within 72 hours post-infection. This is different from what is observed in a wild-type CO92 infection, where pro-inflammatory cytokine expression and immune cell infiltration into the lungs is not detectable until 36-48 h post-infection. CO92 rapidly disseminates to the liver and spleen resulting in high bacterial burdens in these tissues ultimately cumulating in death 72-94 h post-infection. Mice deficient in TNF-alpha are more susceptible to CO92 delta yopH infection with 40% of the mice succumbing to infection.Here, we report that, intranasal infection of mice with CO92 Altogether, our results suggest that YopH can inhibit an early pro-inflammatory response in the lungs of mice and that this is an important step in the pathogenesis of infection. Yersinia pestis is a Gram-negative bacterium with a zoonotic life cycle that occasionally results in human infections leading to plague [o plague . Plague o plague . The leso plague -3.Y. pestis in an effort to understand the interactions of Y. pestis with its host [Yersinia and much work has been done to understand the molecular mechanisms underlying the virulence factors involved in this process [We and others have begun to analyze the immune response to primary pneumonic plague using wild-type strains of its host ,5early dits host . Our preits host . Modulat process -8.Yersinia outer proteins (Yops) and are transported from the bacterial cytosol through the TTSS into the cytoplasm of a host cell to facilitate infection. All six of the effector Yops have been studied, and at least one function has been assigned to each based on in vitro studies. Several are involved in manipulating the host cytoskeleton ; these yops interfere with the Rho family of GTPases and other host proteins involved in the regulation of the cytoskeleton, and are therefore important in the modulation of phagocytosis [The 70 Kb virulence plasmid (pCD-1), which is essential for virulence, contains all of the machinery and effector proteins for a type-three secretion system (TTSS) ,8. The socytosis ,10. Otheocytosis .Yersinia pseudotuberculosis [YopH is a protein tyrosine phosphatase, which is known to interact with p130cas and FAK to impair invasion of epithelial cells by rculosis ,13. YopHrculosis . Distincrculosis . The PI3rculosis .ΔyopH is severely attenuated in both an intranasal and subcutaneous models of Y. pestis infection, which makes CO92ΔyopH a very good live-attenuated vaccine strain [ΔyopH to provide significant protection against virulent challenge suggests that a robust protective immune response is generated during primary infection with this strain. However, the role of YopH in the pathogenesis of plague pneumonia or its impact on the immune response in the lung has not been examined. In this study we test the impact of the CO92ΔyopH mutant on both the virulence and inflammatory response using a mouse model of primary pneumonic plague.Numerous studies have determined that mutations in YopH severely impact the virulence of the yersiniae -19. Recee strain . The abiΔyopH was determined and the survival curves analyzed by log-rank analysis. Mice infected IN with ~107 CFU CO92ΔyopH appeared normal at all time points post infection and showed no outward signs of disease whereas animals infected with ~104 CFU CO92 were severely debilitated two days post-infection and succumbed to disease by day 4 post-infection CO92ΔyopH is avirulent in CD1 mice.The survival of CD1 mice after IN infection with CO92 or CO92ΔyopH mutant complemented with a wild type copy of the yopH gene to secrete YopH in vitro. As shown in Figure ΔyopH mutant complemented with yopH secretes similar levels of YopH into the culture supernatant as CO92. Due to the YopH cleavage products in secreted protein preparations, we also evaluated the levels of YopH in whole cell extracts after induction. Similar levels of YopH were detected in the whole cell extracts and were consistent with the secreted protein profile . All of the mice infected with wild-type CO92 were dead by 72 hours post-infection making collection of data at 72 h and beyond impossible for this group. Our results suggest that CO92ΔyopH is able to persist in the lungs through 48 h post-infection Figure . These dΔyopH could be partially due to a strong inflammatory response to the presence of the bacterium. Further, due to the delayed arrival of neutrophils during plague pneumonia, we suspected that TNF-α and IL-1β might be involved [ΔyopH. Mice were infected with 2×104 CFU of either Y. pestis CO92 or CO92ΔyopH and sacrificed 24 or 48 hours post-infection. BAL was performed on these mice, and then ELISA analyzed the BALF for the concentration of TNF-α and IL-1β. Mice infected with CO92ΔyopH elicited a robust pro-inflammatory cytokine response at 24 h post-infection, characterized by 349 ± 43 pg/ml of TNF-α and 461 ± 35 pg/ml of IL-1β in the BALF of these mice 24 h post-infection (p = 0.001 in comparison to CO92). By 48 h post-infection the levels of both cytokines had decreased but remained significant with concentrations of TNF-α = 45 ± 12 pg/ml, and IL-1β = 104 ± 12 pg/ml , 40% of the mice succumbed to infection within 5 days and control mice B6129SF2/J) with CO92129SF2/J ΔyopH infection presents a significantly different picture: 1) there is little bacterial replication in the lungs CO92ion Fig. &4B sugg4 CFU of CO92 or CO92ΔyopH. Twenty-four and 48 h post-infection lungs were harvested, fixed, embedded in paraffin, and stained with hematoxylin and eosin. Tissues were examined for inflammatory changes as we have described previously [ΔyopH for 24 h leads to wide spread vacuolization of the bronchial epithelium .To evaluate any differences in histopathology, CD1 mice were infected IN with 2 × 10eviously -25. ConsΔyopH infection remains very different than that observed during a CO92 infection. The wild-type infection is characterized by large areas of pulmonary consolidation (not shown), a robust inflammatory response composed of mostly of PMNs is completely attenuated. This is an intriguing finding suggesting that small molecule inhibitors of the YopH phosphatase activity might be useful therapeutics for the treatment of plague.The attenuation of CO92ΔyopH, we examined the host response to pulmonary infection by testing for differences in pro-inflammatory cytokines expression and lung histopathology. We hypothesized that there could be a host component that contributed to the attenuation of the CO92ΔyopHmutant. It has been observed by us and others that infection with Y. pestis CO92 leads to a delayed inflammatory response, which results in very high bacterial loads in the lungs, liver and spleen, ultimately leading to the death of the host [Y. pestis would provide protection for the host.In addition to evaluating the virulence of CO92the host ,5,26. WeY. pestis with an early pro-inflammatory response, namely, an increase in TNF-α and IL-1β in the BALF at 24 h post-infection, which diminishes in magnitude by 48 h post-infection. This is different than what is observed with CO92 infection, where an inflammatory response is not observed until 48 h post-infection [ΔyopH is different than the kinetics of CO92 intranasal infection. First, CO92ΔyopH is able to persist in the lungs of infected mice, although the bacterial burdens observed are significantly lower than those of CO92 at both at 24 h and 48 h post-infection. It appears that the CO92ΔyopH is unable to propagate in the lungs of the host, as demonstrated by the fact that the amount of bacteria detected in the lungs remains approximately the same at 24 h and 48 h post-infection. These data are similar to what is observed with a pulmonary infection with the Y. pseudotuberculosis yopH mutant [ΔyopH is unable to disseminate from the site of infection to either the liver or spleen at 24 h, 48 h, 72 h, or 96 h post-infection. In contrast, infection with wild-type CO92 results in dissemination and high bacterial burdens in the liver and spleen at 48 h post-infection, and the majority of the animals are dead by 72 h post-infection [ΔyopH is cleared from the host by 72 h post-infection being undetectable in the lung, liver, or spleen of mice 72 h and 96 h post-infection (data not shown). In light of these data, we hypothesize that the early pro-inflammatory response observed during infection with CO92ΔyopH is key in allowing the host to adequately control the bacteria and prevent a fulminate infection.In the absence of YopH, the host responds to the presence of H mutant . AdditioΔyopH at both 24 h and 48 h post-infection. The lung histopathology of these two infections is strikingly different and provides some insight into the dissimilar courses that these infections follow. At 24 hours post-infection with wild-type Y. pestis, there are only subtle changes in the lung tissue with very little tissue damage. Infection with CO92ΔyopH at this same time post-infection leads to widespread vacuolization of bronchial epithelium and infiltration of inflammatory cells. It is unclear what leads to the vacuolization, but it is possible that the cyto-toxic effects of YopE and YopO are amplified in the yopH mutant [ΔyopH infection, at 48 h post-infection, about 50% of mice exhibit large lesions with PMNs, but strikingly, no bacteria are observed. This provides further evidence that an early inflammatory response to infection with CO92ΔyopH might be protective, and contribute to the clearance of Y. pestis prior to outgrowth and dissemination of the bacteria.Additional evidence for this conclusion lies in the differences observed in the histopathology of lungs from mice infected with either wild type CO92 or CO92H mutant ,8,27. AfY. pestis does not cause severe disease. For example, Y. pestis modifies its LOS when growing at 37°C, using a tetra-acylated lipid A, which only weakly induces a pro-inflammatory response in the host. At 21-27°C, Y. pseudotuberculosis produces a hexa-acylated lipid A, the form of lipid A which is able to elicit potent inflammatory responses from the host [Y. pestis to produce the more potent hexa-acylated lipid A at 37°C, they found that mice did not develop bubonic plague when infected subcutaneously even at doses approaching 106 mean lethal doses [Y. pestis and that by avoiding this response through LPS modification, Y. pestis is able to cause disease in the host [Y. pestis infection showed that when mice were latently infected with gamma-herpes virus there is a significant increase in activated circulating macrophages and the severity of subsequent infection with fully virulent Y. pestis was decreased compared to mice which were mock infected with virus [Other investigators recently observed that when innate immunity and specifically inflammatory immune responses are intact, infection with the host . The tetthe host . When Moal doses . These dthe host . A seconth virus . ConsistYersinia sp. Given that YopH is a potent protein tyrosine phosphatase, it is well suited to disrupting host signal transduction pathways. It is interesting to note that the majority of evidence obtained studying the enteropathogenic Yersinia suggests that YopH acts to diminish integrin signaling following invasin binding [Y. enterocolitica and Y. pseudotuberculosis are predominantly extracellular pathogens. In contrast, Y. pestis CO92 does not express invasin [Y. pestis pathogenesis.YopH is a complex virulence factor that impacts many aspects of the pathogenesis of binding ,17,31,32 invasin , and is Y. pestis within the mammalian host and that YopH contributes to the virulence of the organism by preventing an early pro-inflammatory response at the site of infection; thereby allowing the bacteria to rapidly replicate in the organs of infected mice, overwhelming and killing the host. YopH directly impacts these key aspects of the pathogenesis of plague pneumonia. However, given the number of potential host-pathways that could be targeted by YopH, it is likely that this virulence factor impacts multiple aspects of Y. pestis pathogenesis.We hypothesize that the anti-host activities of YopH are beneficial to the survival of Yersinia have evolved numerous mechanisms to survive in their hosts and many of the proteins that support survival in the host are virulence factors. Many of the most potent virulence factors are encoded on the 70 Kb virulence plasmid pCD-1 and several of them have been shown to be critical for causing disease. Amongst the essential plasmid-encoded virulence factors is YopH a protein tyrosine phosphatase that has been shown to be critical for the inhibition of invasion by the enteropathogenic yersiniae. Interestingly, Y. pestis is a facultative intracellular pathogen that does not express the Inv protein suggesting that Y. pestis YopH plays additional roles in the pathogenesis of this pathogen.Pathogenic yopH leads to severe attenuation of virulence in mouse models of primary plague pneumonia. In this study, our data suggests that YopH inhibits the production of IL-1β and TNF-α during the first 24 hours post-infection. The inhibition of IL-1β and TNF-α is a critical step in the pathogenesis of infection because mice deficient in these molecules are partially sensitive to infection with the yopH mutant. Further, the YopH phosphatase activity is essential for virulence because mice infected with the CO92ΔyopH strain complemented with a wild type copy of the yopH gene succumb to infection with kinetics similar to CO92 infection but complementation with the yopH-C403A gene restores complete attenuation. Altogether our data suggests that YopH plays an important role in the subversion of innate immunity during plague pneumonia.A mutation in Yersinia pestis CO92, a biovar Orientalis strain recently isolated from a case of pneumonic plague, was obtained from the Select Agent Distribution Activity (SADA), Centers for Disease Control and Prevention (CDC), Fort Collins, CO. The strain was confirmed to contain the pigmentation (pgm) locus phenotypically by producing red colonies on Congo red plates and by polymerase chain reaction (PCR). The presence of the low calcium response virulence plasmid (Lcr) was confirmed by PCR of the lcrV, yopH, and yopJ genes. Virulence in mice was confirmed as described below. The yopH deletion mutant was created in Y. pestis strain CO92 using the suicide vector pSR47s [yopH mutation was complemented by cloning the CO92 yopH gene and 247bp of 5' UTR into the pCR2.1 plasmid creating pAMC-1. Complemented strains were shown to produce equivalent amounts of YopH after in vitro induction of TTS as described [r pSR47s , a derivr pSR47s , as descr pSR47s . The yopescribed . The Yopescribed . YopH watm1Gkl/J stock #003008) and controls (B6129SF2/J stock #101045) were obtained from Jackson Laboratory and used at 6 weeks of age. Fully virulent Yersinia pestis strain CO92 or CO92ΔyopH was grown for 20 hours at 28°C in Heart Infusion broth supplemented with 0.2% xylose. Cultures were then harvested and washed once with sterile PBS, then diluted in endotoxin-free PBS to approximately 106 bacteria/mL. Bacterial concentrations were verified by enumerating colony forming units (CFU) on Congo red plates. Mice were anesthetized by intraperitoneal injection of 0.5 mL Avertin and then intranasally infected with 20 uL of inoculums (10 uL/nare). Intradermal infections were performed by injection of the appropriate dilution of culture in 50 μl volume into the left ear using an insulin syringe as described [ΔyopH, mice were inoculated with up to 2×107 CFU/mouse, and survival was monitored daily over a period of 10-14 days depending on experimental design. All experiments using Y. pestis were performed at Biosafety Level 3, in accordance with approved Institutional Biosafety Committee and Institutional Animal Care and Use Committee protocols.Six to eight-week old female out-bred CD1 mice were used for most studies and processed as we have previously described ,18. TNF-escribed . Actual Y. pestis CO92 or CO92ΔyopH was determined as previously described [The bacterial burden in target organs of mice infected with either escribed . BrieflyΔyopH and then every third day until the end of the experiment. Control animals received an equivalent concentration of isotype-matched irrelevant rat or hamster IgG respectively. Mice were then monitored daily for survival. Data represents experiments with 10 mice per group.IL-1β and TNF-α were depleted by antibody-mediated ablation as we described previously . BrieflyMice were euthanized and a 1 cm longitudinal incision was made to expose the trachea. Bronchoalveolar lavage (BAL) was performed by catheterizing the trachea using 18 gauge catheters . Each mouse was lavaged with three 1 mL aliquots of PBS with protease inhibitors . BAL fluids (BALF) were placed immediately on ice, filtered with a 0.2 μm syringe filter , and stored at -80°C for future analysis. The results are representative of two independent experiments with four to six animals per bacterial strain and time point.BALF samples or tissue culture supernatants were diluted as appropriate and used in ELISA assays for mouse TNFα and IL-1β following the manufacturers instructions. Eight to twelve samples per data point were used in the assays; each sample was assayed in duplicate.Following IN infection, the lungs were harvested at the indicated times and their gross appearance was evaluated at necropsy. At least ten animals per data point were examined. Tissues were fixed in 10 ml of 10% neutral buffered formalin (NBF). Formalin-fixed tissues were then embedded in paraffin and 3-4 μm sections were cut and placed on slides. The tissue sections were then stained with hematoxylin and eosin (H&E). Tissues were examined from at least eight mice per time point and evaluated in blind fashion for inflammatory cell infiltration, bacterial colonization, and presence of inflammatory exudates in airways, edema, necrosis, hemorrhage, and fibrin. Images were captured digitally on a Zeiss Axioscope 2 microscope equipped with a digital camera. Images were processed using the Axiovision V.4 suite of software .t test or Mann-Whitney non-parametric test as indicated using GraphPad In-Stat3 (GraphPad Software). Survival data was analyzed by log-rank analysis where possible. A value for p < 0.05 was considered significant.All results were expressed as the mean ± SEM. Statistical differences were determined using either a two-tailed Student's Designed experiments, performed experiments, interpreted results and wrote the manuscript: AMC, SSB, and PHD. All authors have read and approve of the final version of this manuscript.

Recent genome-wide association studies (GWASs) have reported several genetic variants to be reproducibly associated with type 2 diabetes. Additional variants have also been detected from a metaanalysis of three GWASs, performed in populations of European ancestry. In the present study, we evaluated the influence of 17 genetic variants from 15 candidate loci, identified in type 2 diabetes GWASs and the metaanalysis, in a Han Chinese cohort.CDKN2A/B, CDKAL1, TCF7L2, TCF2, MC4R, and PPARG showed a nominal association with type 2 diabetes (P≤0.05), of whom the three first would stand correction for multiple testing: CDKN2A/B rs10811661, OR: 1.26 (1.12–1.43) P = 1.8*10−4; CDKAL1 rs10946398, OR: 1.23 (1.09–1.39); P = 7.1*10−4, and TCF7L2 rs7903146, OR: 1.61 (1.19–2.18) P = 2.3 * 10−3. Only nominal phenotype associations were observed, notably for rs8050136 in FTO and fasting plasma glucose (P = 0.002), postprandial plasma glucose (P = 0.002), and fasting C-peptide levels (P = 0.006) in the diabetic patients, and with BMI in controls (P = 0.033).Selected type 2 diabetes–associated genetic variants were genotyped in 1,165 type 2 diabetic patients and 1,136 normoglycemic control individuals of Southern Han Chinese ancestry. The OR for risk of developing type 2 diabetes was calculated using a logistic regression model adjusted for age, sex, and BMI. Genotype-phenotype associations were tested using a multivariate linear regression model. Genetic variants in CDKN2A/B, CDKAL1 and TCF7L2, and type 2 diabetes in a Han Chinese cohort, indicating these genes as strong candidates conferring susceptibility to type 2 diabetes across different ethnicities.We have identified significant association between variants in Type 2 diabetes is a complex polygenic disorder characterized by the presence of insulin resistance and pancreatic beta cell dysfunction. Interactions between environmental and genetic factors are involved in the onset and development of the disease. The prevalence of type 2 diabetes is increasing rapidly worldwide and China will be one of the countries hit hardest, with the diabetic population more than doubling in the next 20 years PPARG, KCNJ11 and TCF7L2SLC30A8, HHEX, CDKN2A/B, IGF2BP2, GCKR, FTO, and CDKAL1) at which common variants influence risk of type 2 diabetes in Europeans Many genetic variants have been associated with type 2 diabetes, but from a long list of candidate genes only three have unambiguously been associated with the disease: TCF2 was associated with increased risk of prostate cancer but reduced risk of type 2 diabetes in individuals of European, African and Asian descent JAZF1, CDC123/CAMK1D, TSPAN8/LGR5, THADA, ADAMTS9, and NOTCH2) that were associated with type 2 diabetes MC4R gene (rs17782313) was associated with increased obesity risk and insulin resistance Intriguingly, another study in 2007 showed that a variant in TCF7L2, SLC30A8, HHEX, CDKAL1, CDKN2A/B and IGF2BP2) might be implicated in beta cell function GCKR, encoding glucokinase regulatory protein, and FTO, the fat mass and obesity associated gene, were associated with serum triglyceride and BMI respectively Most of the genes associated with type 2 diabetes were found to associate with type 2 diabetes in Chinese Most of the populations analyzed in the GWASs were of European ancestry and the contributions of these genetic variants in other ethnic groups are less clear. Nevertheless, some variants associated with risk of type 2 diabetes identified by GWASs in Europeans have been replicated in Asians. However, due to the ethnic differences in risk allele frequencies, the impact of these genes varies between these two ethnic groups To obtain a global view of the role of these SNPs in the pathogenesis of type 2 diabetes worldwide, it is important to test associations between candidate SNPs and type 2 diabetes in various ethnic groups. In the present study we therefore evaluated the influence of 17 type 2 diabetes associated SNPs in 15 candidate loci in a Han Chinese population. As some variants are known to affect the risk of type 2 diabetes through obesity, and others have shown the strongest association with related metabolic traits, we also investigated the genetic impact on BMI, glucose levels, C-peptide, and triglycerides.All studied individuals were of Southern Han Chinese ancestry residing in the Shanghai metropolitan area. 1165 type 2 diabetic patients were recruited from the Endocrinology and Metabolism outpatient clinics at Fudan University Huashan Hospital in Shanghai, China. Type 2 diabetes mellitus was diagnosed according to 1999 WHO criteria NOTCH2, THADA and WFS1 were not included as they have a MAF <0.05 in Chinese as reported by the HapMap project, which would limit the power to detect an association. Two of the TCF7L2 polymorphisms (rs290487 and rs7903146) were genotyped using TaqMan allelic discrimination assays . All other SNPs were genotyped using iPLEX and detected by matrix-assisted laser desorption/ionisation-time of flight mass spectrometry. All analyzed SNPs are presented in SLC30A8), which failed genotyping although applying two different methods. The genotype frequencies were all in Hardy-Weinberg equilibrium (P>0.05) and 96 samples (4%) were run in duplicates with a 100% concordance rate.Genomic DNA was extracted from peripheral blood leukocytes using the conventional phenol/chloroform method. SNP selection was based on published type 2 diabetes GWAS data and a meta-analysis of those, as summarized in the The OR for risk of developing type 2 diabetes was calculated using logistic regression, assuming an additive genetic model, adjusted for age (age of diagnosis for cases and age at participation for controls), sex and BMI. Power to detect an association was calculated for each SNP using the Genetic Power Calculator The clinical characteristics of participating individuals are presented in CDKN2A/B, CDKAL1, TCF7L2, TCF2, MC4R and PPARG showed a nominal association with type 2 diabetes (P≤0.05), of whom the three first would stand correction for multiple testing: rs10811661, OR: 1.26 (1.12–1.43) P = 1.8*10−4; rs10946398, OR: 1.23 (1.09–1.39); P = 7.1*10−4 and rs7903146, OR: 1.61 (1.19–2.18) P = 2.3*10−3 P = 0.066 and rs17782313, OR: 1.20 (1.04–1.39); P = 0.015).17 SNPs were analyzed for association with type 2 diabetes in the studied Han Chinese individuals. Genotype and allele frequencies are shown in 2.3*10−3 . As bothA allele of rs8050136 (FTO) showed nominal associations with fasting plasma glucose (P = 0.002), postprandial plasma glucose (P = 0.002) and the fasting C-peptide levels (P = 0.006) in the cases. There was no association between this SNP and BMI in the diabetic cases, but an association was found between the FTO SNP and BMI in the non-diabetic controls and when combining all individuals (P = 0.033 and 0.031 respectively). Additionally, the risk C allele of rs10946398 (CDKAL1) suggest an increase in fasting plasma glucose in normoglycemic controls (P = 0.016) and a nominal association was also observed between the A allele of rs11196218 (TCF7L2) and a decrease in C-peptide in the cases suggesting that some of the variants associated with type 2 diabetes in Europeans are also associated with the disease in Asians. In addition, we have previously reported an association for MTNR1B and type 2 diabetes in this cohort In the present study, we analyzed 17 SNPs in a type 2 diabetes case-control cohort comprising 2301 Han Chinese individuals. The majority of the investigated SNPs have previously been identified conferring risk of type 2 diabetes, but these studies were mainly performed in Europeans. We replicated previous findings of associations for three SNPs in this Chinese population in Chinese. The OR in our study is similar to the one reported in Europeans (OR: 1.20) CDKAL1 . Our results support previous findings that these variants in CDKN2A/B and CDKAL1 individually contribute to the risk of type 2 diabetes in the Han Chinese population GWASs have recently described novel type 2 diabetes susceptibility loci, including several previously unknown genomic regions, such as TCF7L2 polymorphism rs7903146 is the strongest single genetic variant associated with type 2 diabetes P = 2.3*10−3). The inability to detect this association in the previous Chinese studies may be due to insufficient power. Notably, we could not replicate two other susceptibility SNPs in TCF7L2 (rs11196218 and rs290487), previously reported to be associated with type 2 diabetes in Chinese studies TCF7L2 on susceptibility to the disease. Since the risk allele frequency of rs7903146 is lower in Chinese compared with i.e. Europeans, the genetic contribution of this polymorphism to type 2 diabetes on a population level is relatively small. Interestingly, two recent case-control studies independently reported significant associations between rs7903146 and type 2 diabetes in the Japanese The JAZF1, CDC123/CAMK1D, TSPAN8/LGR5 and ADAMTS9 and type 2 diabetes, since the meta-analysis required more than 9000 samples for an 80% power None of the other investigated SNPs showed significant association with type 2 diabetes in our cohort. This may be explained by different environmental risk profiles between Europeans and Asians, body composition and genetic backgrounds, or that we have insufficient power with current sample size to replicate some of these previously reported risk variants. Moreover, our study is the first to investigate the SNPs identified by a meta-analysis of three GWASs FTO showed the strongest association with metabolic traits. There was a trend towards elevated levels of fasting plasma glucose and 2 h postprandial glucose in the diabetic A-allele carriers, as well as a decreased level of fasting C-peptide in the same group. In this study, we also confirmed a nominal association between rs8050136 and BMI in non-diabetic controls. The association between FTO and obesity has been shown to indirectly modulate risk of type 2 diabetes in Europeans FTO (rs8050136) and obesity or BMI in Asians FTO also affects BMI in Asians.Of all the analyzed SNPs, CDKN2A/B, CDKAL1 and TCF7L2 and type 2 diabetes in a Han Chinese population. Our results indicate that these genes are strong candidates conferring susceptibility to type 2 diabetes across different ethnicities. However, more comprehensive studies in larger populations of different ethnic backgrounds are needed to clarify the molecular mechanisms and underlying genetic architecture of type 2 diabetes.In summary, we have identified significant associations between variants in Table S1Effect of studied genetic variants on metabolic quantitative traits in type 2 diabetic cases and normoglycemic controls.(0.28 MB DOC)Click here for additional data file.

Phagocytosis was estimated by the in vitro uptake of 14C-labelled Pseudomonas aeruginosa and glucose oxidation was evaluated by 14CO2 production from 1-14C-glucose. AM were harvested by lung lavage from rats prior to and at 7 and 21 days following i.v. tumour-cell challenge. Macroscopic lung tumour nodules were not observed by 7 days after tumour challenge. However, 3 weeks after tumour challenge, tumour nodules were clearly identifiable on the surfaces of the lungs. One week after the i.v. tumour challenge a marked increase in the number of AM was evident. The in vitro phagocytosis of 14C-labelled Pseudomonas aeruginosa was unaltered at that time, but became progressively depressed thereafter. Three weeks after tumour challenge, this decrease in phagocytic activity was evident when cells were incubated in normal serum, and was furtheri ntensified by serum obtained from tumour-bearing animals. Glucose oxidation by AM in either the resting condition or during bacterial phagocytosis was clearly decreased at both 1 and 3 weeks following i.v. tumour challenge. These findings indicate that the growth of pulmonary metastases is associated with a depression of alveolar macrophage bacterial phagocytic capacity, perturbations in serum opsonic activity and distinct alterations in macrophage energy metabolism. The metabolic dysfunction may impair pulmonary macrophage host defences against lung tumour growth.Alveolar macrophage (AM) phagocytic activity and glucose metabolism were evaluated during lung tumour growth in adult rats challenged i.v. with 10

Arabidopsis thaliana and rice indicate that these adjustments are mediated by large changes in the transcriptome. Here we compared transcriptional responses to light in different species of the Solanaceae to investigate common as well as species-specific changes in gene expression.Plants use different light signals to adjust their growth and development to the prevailing environmental conditions. Studies in the model species Nicotiana tabacum Maryland Mammoth (MM), which flowers only under SD, with those of Nicotiana sylvestris, which flowers only under LD conditions. Finally, we identified genes regulated by red compared to far-red light treatments that promote germination in tomato.cDNA microarrays were used to identify genes regulated by a transition from long days (LD) to short days (SD) in the leaves of potato and tobacco plants, and by phytochrome B (phyB), the photoreceptor that represses tuberization under LD in potato. We also compared transcriptional responses to photoperiod in Nicotiana species with contrasting photoperiodic responses was also regulated by photoperiod and phyB in potato, and is a candidate gene to act as a general regulator of photoperiodic responses. Finally, GIGANTEA, a gene that controls flowering time in Arabidopsis thaliana and rice, was regulated by photoperiod in the leaves of potato and tobacco and by red compared to far-light treatments that promote germination in tomato seeds, suggesting that a conserved light signaling cascade acts across developmental contexts and species.Most of the genes up-regulated in LD were associated with photosynthesis, the synthesis of protective pigments and the maintenance of redox homeostasis, probably contributing to the acclimatization to seasonal changes in irradiance. Some of the photoperiodically regulated genes were the same in potato and tobacco. Others were different but belonged to similar functional categories, suggesting that conserved as well as convergent evolutionary processes are responsible for physiological adjustments to seasonal changes in the Solanaceae. A β-ZIP transcription factor whose expression correlated with the floral transition in Arabidopsis thaliana have revealed that large changes in transcriptome accompany the morphological and physiological shifts that occur during the de-etiolation process initiated when dark-grown seedlings are transferred to light [Arabidopsis thaliana plants experiences modifications of the transcriptome induced by the exposure of seedlings grown under SD typical of winter to LD that induce flowering during warmer seasons [Plant growth and development are shaped by light signals provided by the environment. Seed germination, de-etiolation of aerial tissues, the architecture of the adult plant body and the production of organs involved in sexual or vegetative reproduction are controlled by light signals . The degto light ,3. Largeto light . The ape seasons . These l seasons ).Arabidopsis thaliana, others have recently reported global transcriptional responses to light in monocot species. These studies are allowing us to understand species-specific light-regulated processes, such as photoperiodic effects on floret development in wheat [Arabidopsis thaliana [In addition to the studies conducted in the model eudicot in wheat . They arthaliana .Functional as well as evolutionary studies can also benefit from the comparison of transcriptional responses across closely-related species . The SolSolanum tuberosum spp. Andígena, which tuberize only under SD, were grown in growth chambers under non-inductive LD conditions. 55 and 41 days after sowing, half of the plants were transferred to inductive SD conditions for 1 or 15 days, respectively, whilst the rest of the plants were kept as controls under LD. Transgenic potato plants with reduced phyB levels obtained through antisense technology [Plants of line 10) were alsNicotiana tabacum cv Hicks that flower at the same time irrespective of photoperiod and the isogenic line Nicotiana tabacum MM, which flowers only under SD .A similar experimental protocol was used with plants of Nicotiana sylvestris plants, which flower only under LD, were grown under non-inductive SD conditions. 55 and 41 days after sowing, half of the plants were transferred to inductive LD conditions for 1 or 15 days respectively. In all cases we harvested only the leaves, the organ in which day-length perception takes place and photoperiodic responses are initiated.-2 s-1, 22°C. LD conditions were 16 hours of light/8 hours of darkness, 80 μmol m-2 s-1, 22°C.SD in the experiments described above consisted of 8 hours of light/16 hours of darkness, 160 μmol m-2s-1), to standardize initial conditions, eliminating possible maternal effects on the state of phytochromes at the beginning of the experiments [-2s-1), and were harvested in liquid nitrogen 3, 6 and 9 hours after the beginning of the R and FR light pulses. R, compared to FR treatment, was effective in promoting germination (data not shown).Tomato seeds were imbibed for 16 hours at 20°C under continuous FR or (WT/α-PHYB) ratio was: 1) significantly different from 0 , and 2)Nicotiana biotypes evaluated) was performed with the log2 (LD/SD) ratios of the species. We considered a gene to be differentially affected by photoperiod if the t-test or the ANOVA gave a p-value ≤ 0.05 and a q-value ≤ 0.1, the gene was considered to be regulated by photoperiod (see criteria above) in at least one of the species and, for the comparison between potato and tobacco, there was a difference of at least 1 unit (two fold) between the log2 LD/SD ratios. As mentioned above, data from plants exposed for 1 or 15 days to a change in photoperiodic conditions were pooled for the analysis.To identify genes differentially regulated by photoperiod between species, a t-test (potato vs tobacco) or an ANOVA the p-value was ≤ 0.05 in the one sample t-test and 2) there was at least a 1.5 fold change in expression. Data from seeds harvested 3, 6 or 9 hours after the beginning of light treatments were pooled for the analysis of the effect of R compared to FR on gene expression.One μg of DNAseI treated total RNA was used for the RT reaction with ImProm-II Reverse Transcriptase (Promega). Amplification of genomic DNA was undetectable in non-retro-transcribed controls. PCR products were detected in DNA blots using standard methodology in the exponential range of amplification. Primer sequences will be provided upon request.Potato plants of the subspecies Andígena only tuberize under SD conditions . To inveMost of the genes that were up or down-regulated when the plants were transferred from LD to SD for 15 days, already showed up or down-regulation after the first day in SD and represses flowering under LD in rice (a SD plant) [GIGANTEA in potato was higher under LD compared to SD, and higher in wild type plants compared to transgenic plants with reduced phyB levels when both genotypes are grown under LD . The expD Figure . This obGibberellins accumulate under LD in potato and inhibit the tuberization process . Here weGIGANTEA and ENT-KAURENOIC ACID OXIDASE genes was higher in plants grown under LD compared to SD. The expression of GIGANTEA and, to a lesser extent, the expression of an ENT-KAURENOIC ACID OXIDASE gene was also higher in wild type plants than in plants with reduced phyB levels. Finally, the expression of a PR1b gene was higher in wild-type plants than in α-PHYB plants, but was not affected by photoperiod, as observed in the microarray data and oxidative stress and the opposite occurs for many genes associated with the photosynthetic process and cell-wall modifying enzymes Figure .Nicotiana species and cultivars exhibit different floral responses to photoperiod. Nicotiana tabacum cv Hicks flower at the same time under LD and SD conditions, Nicotiana tabacum cv Hicks MM flower only under SD, whilst Nicotiana sylvestris flower only under LD [Nicotiana biotypes described above, when the plants were transferred from non-inductive to inductive conditions. Using ANOVA we found 52 genes for which the photoperiodic regulation of expression was significantly different among biotypes and showed at least a two fold change in expression in one of them and under SD in Nicotiana sylvestris (a LD plant), suggesting that they might act as repressors of the floral transition in these plants . These differences in expression could result from direct effects of light on gene expression, and/or from interactions between light and the circadian clock (e.g. from effects of light on the amplitude and/or phase of circadian rhythms in gene expression). An evaluation of gene expression data spanning a complete day would be required to investigate the above options in more detail.Arabidopsis thaliana, showing that the endogenous system that measures day-length interacts strongly with redox regulatory mechanism [Many genes associated with the photosythetic apparatus and the synthesis of protective pigments were down-regulated under SD compared to LD conditions. Genes associated with redox metabolism were also down-regulated in SD compared to LD. All the above indicates that a major part of the transcriptional changes taking place during the transition from LD to SD is associated with a reduction in the synthesis of proteins that cooperate to convert solar into chemical energy, as well as in pigments and redox regulating enzymes needed to protect plants from the damaging effects of excess of radiant energy that plants receive under LD. These results are in agreement with a recent study conducted in echanism . The latechanism .Arabidopsis thaliana in response to extended darkness and sugar starvation[Physcomitrella patens mutant lacking two AMP-activated kinases only grows well under continuous light but is unable to grow under light-dark cycles [Another interesting observation from our microarray dataset was that genes associated with aminoacid catabolism were up-regulated under SD compared to LD in potato plants. Up-regulation of this gene class has already been reported to occur in tarvation. Our resk cycles . TherefoThe comparison of transcriptomic responses to changes in photoperiod in potato and tobacco offered an interesting opportunity to explore the evolutionary origins of light regulated responses in the Solanaceae. It is generally believed that similar phenotypes in closely related species are the consequence of conserved evolutionary processes. Indeed, several genes associated with redox homeostasis, sugar metabolism and the photosynthetic process were similarly regulated by photoperiod in potato and tobacco, suggesting an ancient evolutionary origin for the regulation of those metabolic and physiological processes. However, a common adaptive response to a similar environmental challenge can also arise through convergent evolutionary processes involving different molecular mechanisms. One of the most common responses of plants to the excess of light to which they are exposed during the LD of the summer is the accumulation of protective pigments derived from the phenylpropanoid biosynthetic pathway. Here we show that several of the genes associated with the phenylpropanoid biosynthetic pathway that were regulated by photoperiod differed between tobacco and potato plants. For example, the expression of a gene encoding a phenylalanine ammonia-lyase enzyme was strongly regulated by photoperiod in tobacco but not in potato. The converse occurred for a gene encoding a flavonoid 3'-hydroxylase enzyme , rather than with the actual photoperiodic condition under which the plants are growing. An example of such gene is FT, whose mRNA increases in the leaves of the long-day Arabidopsis thaliana plants under LD conditions, whilst the mRNA of an FT orthologue increases under SD in the leaves of the short-day rice plants [FLOWERING PROMOTING FACTOR 1 gene from tobacco, whose overexpression accelerates flowering in Nicotiana species with contrasting photoperiodic response types [Nicotiana tabacum MM during growth under SD, as well as in the apices of the LD plant Nicotiana sylvestris, when the later is grown under LD [Changes in photoperiod regulate flowering time in many species . Most ofe plants . Anotherse types . Furtherunder LD .Nicotiana tabacum MM and in the LD plant Nicotiana sylvestris, when the plants were moved from non-inductive to inductive conditions for the floral transition. This approach allowed us to identify four genes whose expression was anti-correlated with the floral induction process. One of the genes identified encodes a β-ZIP transcription factor. In Nicotiana tabacum MM, the expression of this gene was higher under LD compared to SD, and in Nicotiana sylvestris its expression was higher under SD compared to LD. Thus, this gene is likely to encode a repressor of the floral transition. In principle, a transcription factor repressing the floral transition could operate promoting the expression of a floral inhibitor or repressing that of a floral promoter. Transmission of flower-promoting materials through grafting experiments have been demonstrated for both Nicotiana tabacum MM and Nicotiana sylvestris, whilst transmition of flower-inhibiting substances have only been observed for Nicotiana sylvestris [Nicotiana species.Here we compared global changes in gene expression in the SD plant lvestris . The latNicotiana species may also be candidates to control tuberization in potato. Interestingly, we found that the expression of the β-ZIP transcription factor decreased in the leaves of potato plants that were transferred from LD to SD and was also higher in WT plants compared to transgenic plants with reduced phyB levels. Thus this gene is a good candidate to act not only as a flowering time regulator but as general regulator of photoperiodic responses in the Solanaceae. Reverse genetic approaches are under way to evaluate the role of this β-ZIP transcription factor in the photoperiodic control of plant development.Physiological as well as molecular evidence indicates that the factors mediating the photoperiodic regulation of flowering and tuberization may be similar or identical ,46. If tArabidopsis thaliana and rice, whilst others are proposed to play regulatory roles in light signaling for the first time in this work. Thus, the use of a comparative functional genomic approach appears to be a useful tool to enhance our understanding of the evolutionary mechanisms underlying adaptation of plants to changes in the light environment, as well as to identify signaling regulators.The use of cDNA microarrays allowed us to identify hundreds of genes that were regulated by light in different species of the Solanaceae. Many genes were regulated by photoperiod in potato, and a few of those were also regulated by phyB (the main photoperiodic photoreceptor controlling tuberization), making them good candidates to act as developmental regulators. The comparison of photoperiodically regulated genes between potato and tobacco revealed conserved, but also species-specific responses, showing that adaptations to changes in the light environment have evolved multiple times and represent a mixture of ancient as well as recent evolutionary processes. Finally, we found a few genes regulated by light across developmental contexts and species. Some of these are homologues of genes previously found to play critical roles in light signaling in The authors declare that they have no competing interests.MJY and JJC developed the experimental design. MR and HOG conducted the experiments. MR, HOG, JAC, JJC and MJY analyzed the data. MR, JJC and MJY drafted the manuscript. All authors read and approved the final manuscript.Correlative analysis of the effect of 1 or 15 SD on gene expression in potato plants. XY graph comparing the expression ratios (log2LD/SD) of potato plants transferred from LD to SD conditions for 1 (x-axis) or 15 (y-axis) days.Click here for fileEffect of photoperiod on gene expression in potato. Table of genes whose expression was considered to be significantly affected by photoperiod in potato plants.Click here for fileEffect of phyB on gene expression in potato. Table of genes whose expression was considered to be significantly affected by phyB in potato plants.Click here for fileOverlapping effects of photoperiod and phyB on gene expression in potato. Table of genes whose expression was considered to be significantly affected by photoperiod and phyB in potato plants.Click here for fileNicotiana tabacum MM.Effect of photoperiod on gene expression in Table of genes whose expression was considered to be significantly affected by photoperiod in Nicotiana tabacum MM.Click here for fileContrasting regulation of gene expression by photoperiod in potato and tobacco. Table of genes whose expression was considered to be differentially affected by photoperiod between potato and tobacco plants.Click here for fileNicotiana biotypes.Genes differentially regulated by photoperiod among Table of genes whose expression was considered to be differentially affected by photoperiod among Nicotiana biotypes with contrasting photoperiodic regulation of flowering time.Click here for fileEffect of phytochrome on gene expression in tomato seeds. Table of genes whose expression was considered to be significantly affected by red compared to far-red light in tomato seeds.Click here for fileNicotiana tabacum MM.Contrasting response to photoperiod in potato and Expression data corresponding to genes of the phenylpropanoid biosynthetic pathway that showed differential responses to photoperiod between potato and tobacco.Click here for file

Thyroid malignancy is an uncommon tumor of the pediatric population. Patients can present with asymptomatic thyroid nodule and it requires thorough work up to rule out the malignancy. Radiological and pathological procedures are a standard part of the management. A 10-year-old girl had asymptomatic thyroid nodule; the cytological examination and the frozen section and final histology of the nodule was different each time. The girl had to undergo total thyroidectomy on the basis of histology of the nodule which was well differentiated papillary carcinoma of thyroid and is under regular follow-up for last two years on thyroid supplementation. Differentiated thyroid carcinoma is rare during childhood and adolescence. It constA 10-year-old girl presented with a single swelling in the front part of neck of six months duration. The swelling was painless and progressive and at the time of examination was 2 × 2 cm on the left side of neck and was moving with deglutition. She had no other complaints and her personal and family history was noncontributory.Apart from normal systemic findings and routine investigations, ultrasound of the swelling revealed a mixed solid and cystic swelling of 3 × 2 cm in the left lobe of the thyroid. Nuclear thyroid scan showed cold nodule . ComputeFine needle biopsy of the swelling was reported as benign hyper plastic thyroid nodule. Her serum calcitonin level was normal. Left hemithyroidectomy was done. Frozen section examination of the nodule was reported as benign hyper plastic thyroid nodule, surprisingly, however, the final histology report was of a differentiated nodular papillary thyroid carcinoma in the excised thyroid nodule and rest of the lobe and isthmus were normal .Hence, total thyroidectomy with preservation of the parathyroid was performed after seven days. There was no evidence of any malignant transformation in the rest of the gland on histopathology. Patient was started on thyroid supplementation after her thyroid scan was negative for any residual thyroid tissue after six weeks of surgery. Patient is under regular follow-up since last two years without any symptoms.Probably no other organ malignancy has greater variation of biologic behavior than pediatric thyroid malignancy.2 Given t1225The role of RET proto oncogene mutation has been well proven in the pathogenesis of this malignancy and with multiple endocrine neoplasia syndrome (MEN). When theComputerized tomography (CT) scan of the neck is useful to detect lesion less than 1 cm, to know the status of the nodes, to differentiate simple or complex nodular lesion. It also cannot define malignant or benign condition very reliably.Needle biopsy of the thyroid nodule has been recommended for the diagnostic purpose. However, the problem of not getting the proper tissue sample and high incidence of false results limits its finality. Best dia95For larger lesion and follicular and medullary carcinoma, syndromic association (MEN) and capsular involvement and positive neck nodes total thyroidectomy with neck dissection is necessary followed by radioactive iodine therapy.–6 In our

Cannulation of the subclavian vein has its inherent risks. Post procedure chest radiograph is one of the investigations done to rule out immediate complications. Unless the clinician is aware as to what to look for in the radiograph, some of the dangerous complications can be overlooked. Accidental subclavian artery cannulation is identifi ed immediately by color and jet of the blood. Also the position of the catheter tip has to be confi rmed by obtaining the arterial pressure tracing using a pressure transducer. Non availability of Doppler ultrasound and pressure transducer are limiting factors for immediate confi rmation of proper catheter placement. Also, in patients with severe hypotension and reduced oxygen content of blood, accidental arterial puncture may not show the characteristic bright red pulsatile back fl ow of arterial blood. In these situations radiography can be used as a diagnostic tool to rule out subclavian artery cannulation. Subclavian vein cannulation is a commonly performed procedure in critical care units for several reasons like good venous access, hemodynamic monitoring, parenteral nutrition, etc.Even though it is a relatively simple procedure in well trained hands, it is not without complications which can sometimes be devastating. Many times the complications are immediately recognized and steps are taken to rectify them. When central venous catheters are inserted without ultrasound guidance or when pressure transducers are not available immediately to confirm the pressure tracings, it requires a great degree of suspicion and ability to pick up subtle findings on a radiograph to minimize the consequences of unidentified complications. We prese2 85%.A 28 year female patient was admitted with fever of five days duration and difficulty to breathe since one day. On physical examination, she was in respiratory distress, requiring oxygen supplementation. Her heart rate was 120 beats/ min, radial pulse was feeble, blood pressure 80/40 mmHg, respiratory rate 30/min, and SpOMultiple attempts at peripheral vein cannulation had failed. A right sided subclavian vein catheter was planned in view of her general condition and need for fluid and inotropic support. A 15 cm 7 Fr triple lumen central venous catheter was inserted into the right subclavian vein using the Seldinger technique on first attempt with no difficulty. A good back flow of blood was also confirmed. Quick look at the post procedure chest radiograph confirmed the position of the catheter and absence of pneumothorax . InitialPossibility of a subclavian artery cannulation was suspected based on a re-examination of the chest radiograph which showed the catheter crossing the midline and tip located on the left side .Hence the catheter was removed immediately. There were no complications but for prolonged bleeding from the puncture site which required pressure for about fifteen minutes.Use of subclavian veins for CVP monitoring, fluid and blood products administration, and hyperalimentation has become very popular. Even though the infraclavicular approach for subclavian vein catheterization is a relatively simple technique, it is not without complications.Accidental puncture or cannulation of the subclavian artery are not common but are easily recognised clinically by a rapid pulsatile bright red back flow of blood and also difficulty in administering IV fluids. Use of DKnowledge of the anatomy of the subclavian area is essential for a successful cannulation of subclavian vein. The vein is found within the costoclavicular-scalene triangle. The axillary vein becomes the subclavian vein at the lateral border of the first rib. It then traverses over the first rib and behind the medial third of the clavicle while resting on the apical pleura, joins the internal jugular vein to form the innominate and subsequently forms the superior vena cava. It normally remains on the right side of the mediastinum.The right subclavian vein does not cross the midline, but the left subclavian vein does. In our cThe structures most often injured by improper insertion of the needle include the posterior wall of the vein, the apical pleura, the underlying lung, the subclavian artery, the brachial plexus, the phrenic nerve, etc. The complication rate varies from 0 to 9.9% and is higher when inexperienced individuals perform the catheterization. The subcIf the right subclavian central venous catheter is seen crossing the midline on a chest radiograph, arterial cannulation should be suspected and steps taken to determine arterial placement.

Enterobacteriaceae. In addition, conjugative plasmids encoding H-NS variants have hitherto been isolated only from members of the family. Thus, the H-NS system in enteric bacteria presents unique evolutionary features. The capacity to selectively discriminate between core and HGT DNA may help to maintain horizontally transmitted DNA in silent form and may give these bacteria a competitive advantage in adapting to new environments, including host colonization.Horizontal acquisition of DNA by bacteria dramatically increases genetic diversity and hence successful bacterial colonization of several niches, including the human host. A relevant issue is how this newly acquired DNA interacts and integrates in the regulatory networks of the bacterial cell. The global modulator H-NS targets both core genome and HGT genes and silences gene expression in response to external stimuli such as osmolarity and temperature. Here we provide evidence that H-NS discriminates and differentially modulates core and HGT DNA. As an example of this, plasmid R27-encoded H-NS protein has evolved to selectively silence HGT genes and does not interfere with core genome regulation. In turn, differential regulation of both gene lineages by resident chromosomal H-NS requires a helper protein: the Hha protein. Tight silencing of HGT DNA is accomplished by H-NS-Hha complexes. In contrast, core genes are modulated by H-NS homoligomers. Remarkably, the presence of Hha-like proteins is restricted to the Acquisition of DNA by horizontal gene transfer (HGT) significantly increases bacterial genetic variability. Relevant issues are the mechanisms that bacterial cells have evolved to efficiently integrate the newly acquired DNA into the host cell regulatory machinery. In Gram negative cells, the nucleoid associated protein H-NS has been shown to bind AT-rich sequences of HGT DNA and silence unwanted expression of these genes. This has led to consider H-NS as a “genome sentinel.” Nevertheless, this proposed role must be compatible with its role modulating core genome genes. Weak expression of recently transferred genes must be coordinated with proper expression levels of housekeeping genes. In this paper, we describe a strategy that enteric bacteria have developed to differentially modulate HGT and core genome genes. Two independent lines of experimental evidence suggest that the H-NS system of enteric bacteria may have evolved to discriminate between core genome and HGT DNA. The plasmid R27-encoded H-NS protein selectively modulates HGT genes. This avoids plasmid-encoded H-NS interfering with modulation of core functions. We also show that, for efficient silencing of HGT genes, resident chromosomal H-NS recruits the Hha protein and forms heteromeric complexes with DNA. In contrast, housekeeping genes are modulated by H-NS alone. Acquisition of DNA by horizontal gene transfer (HGT) is a crucial mechanism by which bacteria increase genetic variability. Among others, functions that enable bacterial cells to cause disease (virulence factors) as well as to overcome the effect of antimicrobial drugs are often encoded in HGT DNA . While HGT DNA may provide a potential advantage in host colonization, the incorporation of foreign DNA may constitute a potential perturbation for the regulation of the core genome, resulting in a significant fitness cost. An efficient mechanism that enables the bacterial cell to control the expression of foreign DNA is exemplified by the H-NS protein Salmonella enterica serovar Typhimurium chromosome by a ChlP on chip approach showed that H-NS binds preferentially to AT-rich HGT DNA H-NS targets both core genome and HGT genes Salmonella enterica subsp. enterica serovar Typhimurium, and are associated with the multi-drug resistance (MDR) phenotype that some isolates exhibit Salmonella enterica serovar Typhimurium in the 1960s and since then has been detected in several S. Typhi outbreaks. R27 is 180 kbp in length, confers tetracycline resistance and shows a temperature-dependent conjugative phenotype. R27 encodes single copies of hns and hha genes (ORFs 164 and 182 respectively). Both chromosomal- and plasmid-encoded H-NS and Hha proteins interact to modulate R27 temperature-dependent conjugative transfer Several conjugative plasmids, such as those of the IncH1 group, also encode plasmidic forms of H-NS and Hha. IncH1 plasmids are common in the causal agent of typhoid fever, To date, plasmid- and chromosome-encoded forms of H-NS proteins have been assumed to be functionally equivalent Salmonella hns mutant. For this purpose, we compared the gene expression patterns of wt and hns mutant from S. Typhimurium SV5015 (strain SV5015AV), the latter in the presence and in the absence of plasmid R27 in hns cells would result in the restoration of the wt expression pattern. Unexpectedly, the transcriptomic analysis of strain SV5015AV (R27) showed that the H-NSR27 protein has the capacity to compensate the effect of the hns mutation only for a subset of genes. Overexpression in the hns mutant was compensated by the presence of R27 in 61% of the genes and pSLT plasmid were not sensitive to H-NSR27 modulation in hns cells , H-NS represses its expression. Upon osmotic up-shift, its expression is increased up to 200-fold proVWX operon is present in the genome of both E. coli and Salmonella, and here we studied both promoters. As examples of promoters mapping in HGT DNA, we selected hilA, which controls the expression of the master regulator of the Salmonella pathogenicity island 1 (SPI1) R27 modulation in our transcriptomic study and hns (R27Δhns) cells. Deregulated expression of S. Typhimurium hilA and E. coli hly promoters in hns mutants was fully compensated by H-NSR27 ). This plasmid still had the capacity to complement the hns mutation (data not shown), thus evidencing that H-NSR27 is functional in the absence of Hha.Given that several H-NS-sensitive genes are also modulated by the Hha protein R27, the Salmonella H-NS regulon can be divided in two genetic compartments that can be tentatively associated with HGT and core genes. At this stage we considered it relevant to address whether these compartments could also be distinguished and differentially regulated by the resident chromosomal H-NS regulatory system. It was recently shown that the Hha modulator and/or its paralogue protein YdgT modulate a set of genes that largely map in AT-rich sequences of the Salmonella genome and that overlaps with the set of H-NS-regulated genes that map in genomic islands R27 are similar to the set of genes that are co-regulated by H-NS/Hha proteins. To test this hypothesis, we first performed global transcriptomic studies to determine H-NS and Hha-dependent modulation of the Salmonella genome in a range of conditions of osmolarity and temperature. Gene expression patterns of strains SV050515, SV5015AV (hns) and SV5015HY (hha ydgT) grown either in low and high osmolarity LB medium, and either at 25 or 37°C in conventional LB medium, were compared . We interpreted these data as strain BSN26 containing a very limited amount of HGT DNA.To date, plasmid-encoded H-NS-like proteins have been considered to be functionally equivalent to the corresponding chromosomally-encoded paralogues. Indeed, functional replacements and equivalent sets of interactions have been shown for plasmid- and chromosomal- H-NS-like proteins in vitro growth conditions , and a significant number are silenced by H-NS under the same conditions. H-NS-controlled weak expression of HGT DNA proV, which is silenced by H-NS alone and is insensitive to Hha silencing.Genes sensitive to Hha/YdgT modulation are silenced under several R27. Plasmidic genes and chromosomal genes incorporated by HGT are prominent members of the set that are both silenced by H-NSR27 or require Hha to be silenced by the chromosomal form of H-NS. This observation strengthens the notion that H-NS-modulated genes can be assigned to two genetic compartments. The first includes genes encoding housekeeping functions that are modulated by chromosomal H-NS alone and are insensitive or only weakly modulated by plasmidic H-NSR27. In contrast, the genes belonging to the second compartment, which includes mostly horizontally acquired genes, require a helper protein of the Hha family for their complete silencing by chromosomal H-NS, and can also be modulated by plasmidic H-NS.We found a significant coincidence between the set of genes modulated by H-NS/Hha and those sensitive to H-NSE. coli wt cells. In contrast, only one-third of these sequences are bound by StpA in the absence of H-NS. This partial binding results in only partial StpA-mediated modulation of H-NS-sensitive genes in hns mutants. While the basis for such differential affinity may be the generation of either StpA-H-NS hetero- or StpA-StpA homodimers, in the example reported here structural differences between H-NS and H-NSR27 might account for the differential affinity of these two proteins for some promoter regions. Sequence conservation between H-NSR27 and H-NS in the N- and C-terminal domains was very high; however, significant differences between H-NS and H-NSR27 were located in the linker domain (53% of the positions were different) (data not shown). The linker domain is predicted to be partially unstructured in the isolated protein and is associated with protein oligomerization although it has also been implicated in the modulation of DNA binding For many years, it was considered that H-NS did not recognize a consensus DNA sequence, but bound to AT-rich curved stretches of DNA EnterobacteriaceaeE. coli strains, have become such successful pathogens While H-NS-like proteins are widely distributed within γ-proteobacteria, both Hha-like proteins and the presence of H-NS-like proteins in conjugative plasmids appear to be an evolutionary trait of members of the Bacterial strains and plasmids used in this work are described in 3-sodium dodecyl sulfate permeabilization procedure.Levels of β-galactosidase activity were assayed by standard techniques, using the CHClE. coli BL21 (DE3) Δhns strain was used as host induction of H-NS-like R27 protein expression. Plasmid pETHNSR27his was introduced by transformation into this strain. One-liter culture was grown to an OD600 of 0.3, and at this point IPTG was added to 0.5 mM. Incubation at 37°C continued for 2 h. Cells were pelleted by centrifugation and resuspended in 20 mL buffer A . The cells were lysed by three passages through a French press at 1000 p.s.i. Plasmid pETHNSHIS was used to overexpress His-tagged H-NS protein as described previously 2+-NTA agarose (Qiagen).proV, hilA or rcsA genes were amplified by PCR using primers hilA-BS-5/hilA-BS-3, proU-BS-5/proU-BS-3 and rcsA-BS-3/rcsA-BS-5 respectively from the genome sequence of Figure S1lac fusions to proV in strains SV5015 (wt), SV5015AV (hnsM) and SV5015H (hha).Expression of β-galactosidase from (0.89 MB TIF)Click here for additional data file.Table S1Genes induced more than 2-fold (M≥1) in SV5015AV with respect to SV5015 with a p value less than 0.1, and the corresponding values in SV5015AV (R27) vs SV5015. Significative HGT genes have been highlighted in grey. Significative core genome genes have been highlighted in black.(0.12 MB XLS)Click here for additional data file.Table S2Genes repressed more than 2-fold (M≤−1) in SV5015AV with respect to SV5015 with a p value less than 0.1, and the corresponding values in SV5015AV (R27) vs SV5015. Significative repressed genes (cell motility) have been highlighted in grey. Significative core genome genes have been highlighted in black.(0.16 MB XLS)Click here for additional data file.Table S3Genes induced more than 2-fold (M≥1) in SV5015HY, SV5015AV, and SV5015AV (R27) with respect to SV5015 with a p value less than 0.1.(0.07 MB XLS)Click here for additional data file.Table S4Bacterial strains and plasmids used in this study.(0.06 MB DOC)Click here for additional data file.Table S5Oligonucleotides used in this work.(0.05 MB DOC)Click here for additional data file.Text S1Bacterial strains and growth conditions.(0.03 MB DOC)Click here for additional data file.

To the Editor: The influenza A pandemic (H1N1) 2009 virus contains a combination of 8 gene segments (www.who.int/csr/don/2009_07_06/en). Low virulence of the virus and preexisting immune status are among the main factors that account for lower death rates in influenza outbreaks. The Centers for Disease Control and Prevention reported that among persons >60 years old, 33% have preexisting, cross-reactive neutralizing antibodies against the new virus, but seasonal influenza vaccines do not elicit cross-reactive neutralizing antibodies against pandemic (H1N1) 2009 virus in either younger or older populations 2009 virus contains HLA-DRA*0101/DRB1 *0101-restricted SVIEKMNTQFTAV 2009 virus contains HLA-A*0201-restricted GLFGAIAGFI . Several points have to be made regarding the relevance of these epitopes to its high associated mortality rate. First, influenza virus (H5N1) is known to be highly virulent, replicating at a much faster pace than other influenza A viruses and spreading in vital organs shortly after infection and before epitope-mediated protective immunity can be launched, which may account for its high fatality rate. Second, the epitopes are MHC class I antigen-restricted, which means that only a fraction of the human population will possess the correct MHC class I molecules capable of presenting a specific epitope and eliciting appropriate and protective CMI responses. This lack of correct MHC class I molecules could explain why patients of varied genetic backgrounds may have different prognoses upon infection with pandemic (H1N1) 2009 virus or even influenza virus (H5N1).We note that ≈80% of MHC class I epitopes in NP of seasonal and flu vaccine viruses are also>40 years of age than for those <39 years of age , and the fatality rate was 32% (7/22) for those >40 years of age and 59% (106/180) for those <40 years of age from 2003 to 2006 (www.who.int/wer/wer8126.pdf). Therefore, repeated exposure to seasonal influenza viruses or vaccination may have resulted in partial cell-mediated or humoral immunity to influenza virus (H5N1). The same type of immunity may have happened in persons exposed to pandemic (H1N1) 2009 virus as well.In fact, although there are no experiments establishing a solid link, cross-reactive immunity from seasonal influenz or vaccination may result in partial protection of patients infected with influenza virus (H5N1). As reported by WHO for influenza virus (H5N1)–infected patients, the incidence of reported infections was lower for those

The program and the arrangement for a versatile, computer-controlledflow injection analysis system is described. A resident program (which can be run simultaneously and complementary to any other program) controls a pump and a pneumatic valve (emptying and filling position). The system wasdesigned to be simple and flexible for both research and routine work.

Despite the impact of hypertension and widely accepted target values for blood pressure (BP), interventions to improve BP control have had limited success.We describe the design of a 'translational' study that examines the implementation, impact, sustainability, and cost of an evidence-based nurse-delivered tailored behavioral self-management intervention to improve BP control as it moves from a research context to healthcare delivery. The study addresses four specific aims: assess the implementation of an evidence-based behavioral self-management intervention to improve BP levels; evaluate the clinical impact of the intervention as it is implemented; assess organizational factors associated with the sustainability of the intervention; and assess the cost of implementing and sustaining the intervention.e.g., qualitative analyses--pattern matching; quantitative methods--linear mixed models).The project involves three geographically diverse VA intervention facilities and nine control sites. We first conduct an evaluation of barriers and facilitators for implementing the intervention at intervention sites. We examine the impact of the intervention by comparing 12-month pre/post changes in BP control between patients in intervention sites versus patients in the matched control sites. Next, we examine the sustainability of the intervention and organizational factors facilitating or hindering the sustained implementation. Finally, we examine the costs of intervention implementation. Key outcomes are acceptability and costs of the program, as well as changes in BP. Outcomes will be assessed using mixed methods (The study results will provide information about the challenges and costs to implement and sustain the intervention, and what clinical impact can be expected. Controlling hypertension improves cardiovascular and renal outcomes, and the mechanisms for achieving control including diet, exercise, and medications are well known and accepted. Despite the increased incidence of hypertension-related diseases, well-established evidence-based guidelines, and the availability of over 100 antihypertensive medications, approximately 25% to 40% of veterans with hypertension in 2007 did not have adequate blood pressure (BP) control (≥140/90 mmHg) . B-6. B3-6]The intervention is a nurse-delivered tailored telephone intervention that was developed and previously evaluated in the Veteran-Study To Improve The Control of Hypertension (V-STITCH) ,8, and rThe intervention uses a behavioral-educational approach to enhance hypertensive patients' self-management capability and is organized around telephone encounters that occur approximately once every 4 to 5 weeks for 12 months. During the phone calls, trained nurses use the intervention software to gather medical and behavioral information. Patient responses to these questions activate a set of behavioral and educational modules within the intervention software that address such issues as social support, knowledge, health behaviors including smoking, weight loss, diet, alcohol use, stress, and participatory decision making ,10,12.We have included three intervention sites located in three separate Veterans Integrated Service Networks (VISNs). Intervention facilities were selected based on four criteria. First, these facilities perceived that they could further benefit from improving the level of BP control at their facilities. Second, their patient demographics vary, which increases the generalizability of evaluation results. Third, the investigators have established collaboration with the leaders of these VISNs. Finally, the intervention sites agreed to leverage resources and funds to support a nurse (or nurses) required to implement the intervention. Each intervention site is matched to three control sites based on the level of VA organizational complexity and VISN affiliation.Organizations often find it necessary and desirable to adapt evidence-based interventions to facilitate implementation, encourage ownership, and enhance acceptability among target populations . The chaWe sought to balance the competing demands of adaptation and fidelity by requiring intervention sites to use certain intervention features and implementation processes while allowing them the flexibility to tailor other aspects of the intervention and the implementation process to local conditions, and providing intervention sites with centralized implementation support Table . This apIntervention facilities are required to commit at least four staff members in this partnership to ensure open communication among site participants and increase the likelihood of effective implementation: nurse interventionist, site principal investigator (physician), representative of the nursing administration, and information technology (IT) support staff. Each site has to agree to fund at least one-half of a full-time equivalent (FTE) nurse position, filled by one or more individuals. The nurse(s) will need to implement the program for two years--one year of enrollment and one year of follow-up. The facilities are responsible for determining nursing resources available to deliver the intervention, so these individuals may include both primary care staff nurses and individuals with experience as case managers.The facility also is required to identify a specific site principal investigator, who leads the implementation effort at the facility and acts as a conduit between the facility and the centralized implementation support team. In the case of the present study, this person is typically a physician. In addition, participation requires the support of the director of nursing, who has the authority to dedicate nursing time for the intervention. Lastly, the site has to designate an information technology staff to be a contact and troubleshooter for the roll-out and use of the intervention software.Each intervention facility has the goal of enrolling 500 patients during the 12-month implementation period. Patients can be referred to the intervention in any of the following three ways, depending on the preferences of the primary care providers at each intervention site:1. For VA patients with a diagnosis of hypertension and last BP reading of >140/90 mmHg, primary care providers receive a reminder that the patient has poorly controlled hypertension that includes an option to place an order for the behavioral-educational intervention.2. An item has been added to the providers' primary care screen in the VA electronic medical record that will allow a patient's provider to order the intervention even if the hypertension reminder has not been triggered for the patient.3. If few intervention orders are received, the nurse is able to access a pre-populated list of patients who meet the same criteria as the hypertension care reminder. Starting with the patient with the most recent outpatient BP record, the nurse would contact the patient's primary care provider regarding the intervention.Facilities can use one of two approaches to scheduling patients. In some cases, facilities have developed a specific nurse telephone hypertension self-management clinic established for the purpose of delivering the intervention. Like other healthcare appointments, the clerk receives an order from a primary care provider to schedule a specific time for the nurse to call the patient. The other option allows facilities to develop an alert that goes to the nurse indicating that a new patient is in the queue to be called. Upon calling the patient, the ordering provider is notified.The nurse must place a note in the VA electronic medical record, the Computerized Patient Record System (CPRS), to describe any patient concerns. The nurse is responsible for addressing serious patient needs during the call following standard facility/clinic operating procedures.i.e., behind the VA firewall) using a point-to-point connection between the user's computer and a centralized server as the user goes through each screen that corresponds to call script and data collection.The intervention software is a distributed application built using the Microsoft .net framework. Users navigate to a VA intranet web page to launch the software. Using this system, nurses are able to access records from their site only. Data are transmitted within the VA protected computer environment , includiPart of the implementation process consists of presentations of our intervention to an expert panel and our key stakeholders for review and comments. This implementation process (and its study) is being conducted with support of the VA Quality Enhancement Research Initiative (QUERI)) -23 progrThe remainder of this article describes four different components of the evaluation project that address implementation, clinical impact, sustainability, and costs of the behavioral-educational intervention. Table Study one addresses the first specific aim: to assess organizational factors associated with the successful implementation of an evidence-based behavioral intervention to control BP. For this study, successful implementation of the intervention is defined by the degree to which patients receive scheduled phone calls that include presentation of content outlined by the intervention software. Informed by the conceptual model, study one research questions include: how do VA site leaders foster organizational readiness to implement the intervention; what VA clinic policies and practices are needed to support intervention use; and do VA clinics with a stronger implementation climate show more consistent, high-quality, appropriate intervention use as indicated by proxies such as patient retention, BP levels, and medication adherence? This component also seeks to describe the use of implementation approaches. While there are a number of methods available for implementing interventions, there is no consensus on the most efficient methods and dose of support for effectively implementing interventions .i.e., the cases). Quantitative data from the nine VA clinics in the comparison group account for secular trends in hypertension management practices and clinical outcomes.Study one employs a case study design involving the collection and analysis of both qualitative and quantitative data. Case study methods are well-suited for studying implementation processes, which tend to be fluid, non-linear, and context-sensitive ,26. In aStudy one draws upon primary data collected from multiple sources using multiple methods to analyze potential facilitators and barriers to implementing the intervention, including site visits, semi-structured interviews, phone calls, e-mail exchanges, and standardized surveys. Prior to the launch of the intervention, we conduct interviews with the clinic director, physicians, nurses, IT staff, and office staff identified by the local site principal investigator who are involved in or affected by the implementation of the intervention Table . We use In addition to the wealth of qualitative data we plan to collect, we administer two surveys. The Assessment of Chronic Illness Care (ACIC) is implemented at baseline and 12 months at both the implementation clinics. The ACIC is developed to allow healthcare teams to evaluate the degree to which their organization has implemented practices suggested by the Chronic Care Model ,29. The e.g., coordinating implementation activities), perceived commitment of the core implementation group to implement the intervention, and perceived commitment of the user group to support and use the intervention.At the same time the ACIC is administered, the Organization Readiness to Change Survey is administered. Twelve items assess perceived efficacy of the core implementation group to carry out critical implementation tasks effectively . If the patterns match, the predicted pattern is said to receive support. If the patterns do not, the investigator reformulates the predicted pattern by developing and investigating alternative predictions.Consistent with a case study research design, we use pattern-matching logic to guide data analysis . In pattProcedurally, qualitative data analysis involves three phases: data coding, within-case analysis, and between-case analysis. In the first phase, we use qualitative data analysis software (ATLAS.ti 5.2) to code the study data. The conceptual model provides a starting list of codes, which we supplement with emergent codes as needed. In the second phase, we conduct a within-case analysis of each VA clinic implementing the intervention. Using ATLAS.ti, we generate reports of all text segments for each code. We assess the degree to which the construct appears in the data (its 'strength'), the degree to which the construct positively or negatively affects implementation , and the degree to which relationships among constructs match the conceptual model.Consistent with the organization-level focus of the conceptual model, we aggregate and analyze quantitative data at the VA clinic level (three intervention sites and nine control sites). We then analyze the quantitative data in conjunction with the qualitative data using the pattern-matching logic described above. For example, using the ACIC data, we examine whether VA clinics with more developed organizational infrastructures and climates supporting chronic care delivery at baseline exhibit greater management support, stronger implementation climates, better innovation-values fit, and more effective implementation. These data also help us gauge whether implementing the BP control intervention stimulated or facilitated more systemic changes in chronic care organization and delivery within the implementing clinic, or whether secular trends within the VA represent a plausible rival explanation for the results that we see.Study one is expected to produce a theoretically informed, empirically grounded organizational model of implementation suitable for complex innovations and adapted to the context of clinical practice. An additional product of this phase of the study is an evaluation of approaches to implementation of the behavioral intervention.Study two seeks to assess the clinical impact of the implemented behavioral self-management intervention in order to assess the effectiveness of the intervention outside the supportive context of a randomized controlled trial. The population of interest is veterans with hypertension who meet criteria for the behavioral intervention and visit their primary care clinic at the VA for routine care. The two primary research questions are:i.e., clinical-level) program?1. What is the impact, in terms of average systolic BP improvement, of having implemented the behavioral intervention versus not having implemented the intervention as a facility-wide ?Question one is an organizational (or policy) question that addresses the impact of rolling out the intervention facility-wide by comparing facilities implementing the behavioral intervention (implementation facilities) versus those that do not (control facilities). Question two addresses the impact of the intervention from the perspective of the patient by comparing patients receiving the intervention versus those that do not within facilities/clinics that implemented the intervention. Figure i.e., observational, non-equivalent groups) design with repeated measures [i.e., hospital director approval, FTE requirements), for question one, clinics are not randomly assigned to implement versus not implement the behavioral intervention. Similarly, for question two, patients within facilities implementing the behavioral intervention are not randomly assigned to receive the intervention versus not receive the intervention.The study design is a clustered quasi-experimental at least three times in prior two years, and who have a BP measurement taken during the first visit. For question two, the study sample used to address question one is restricted to patients at implementation facilities.For both questions, the primary outcome is systolic BP, a continuous variable. Time is measured continuously in weeks since the first time a patient visits a participating facility during the implementation roll-out. For question one, the primary predictor variable is the implementation indicator variable . For question two, the primary predictor variable is the treatment received indicator variable .This study relies primarily on data from the Veterans Health Information Systems and Technology Architecture (VistA), the electronic medical record system used to support both inpatient and outpatient care in the VA. Specifically, BP measurements (the primary outcome variable for both questions) and other covariates will be obtained from the Health Data Repository (HDR) for patients in our target population of interest. BP measurements in the HDR are date-stamped, allowing us to derive time (as defined above) for data analysis. The treatment received indicator variable (for question two) will be obtained from the software used by the study nurse to administer the behavioral self-management intervention.Because facilities are not randomized to implement or not implement the behavioral intervention (question one), and patients within implementation facilities are not randomized to receive or not receive the intervention (question two), an important challenge is the potential presence of confounding variables. A confounder variable is related to the outcome and is unevenly distributed between 'treatment' conditions , but is not in the causal pathway between the intervention and the outcome . For queFor both questions, a linear mixed modeling (LMM) strategyi.e., repeated systolic BP measurements on patients nested within clinics), clustering by clinic and within-person correlations must be taken into account in both the data analysis and power calculations. Following Donner and Klar [Statistical power considerations are based on question one. Based on previous data ,36, we aand Klar , we use and Klar . Assuminand Klar ), a two-and Klar for the and Klar ,40, a miWe anticipate one major product of the study to demonstrate improved systolic BP in clinics using the intervention relative to clinics who did not receive the intervention.Study three assesses the sustainability of the behavioral-educational self-management intervention to control BP. Just as it is necessary to study the processes through which patients must make a long-term commitment to self-management of hypertension, we study the ability of VA facilities to make long-term commitments to support the intervention. In this study, sustainability is operationalized as the willingness and capacity of VA facilities to maintain intervention use beyond the initial 12-month period in which new patients are enrolled and existing patients continue to receive the intervention. Specifically, three research questions are examined: How do the benefits and costs of the intervention as perceived by various stakeholders affect the sustained use of the intervention by VA clinics? What policies and practices are necessary to support sustained use by clinics? And how do organizational factors like staff turnover, competing priorities, and organizational changes affect sustained use by clinics?i.e., the cases). The focus is on the three VA clinics implementing the intervention. Data from the nine VA clinics in the comparison group are used to account for secular trends in hypertension management practices and clinical outcomes.Study three employs a case study design involving the collection and analysis of both qualitative and quantitative data. VA clinics serve as the units of analysis , and a third type of costs not assessed in randomized trials that relate to intervention dissemination to the clinics, which involves initial time costs of study investigators and clinic leadership in the buy-in and planning phases of the study . TogetheThe study sample for the cost analysis includes the matched cohorts of 6,000 veterans with hypertension who meet criteria for the behavioral self-management intervention and have at least one visit to the participating clinics during the intervention roll-out period and have a BP measurement taken during the first visit .e.g., planning, intervention training, nurse time) [This includes three costs: study investigator time modifying the intervention in preparation for the roll-out period; study investigator and clinic staff time spent during the buy-in phase developing trust and commitment to the implementation study; and study investigator and clinic staff time spent on implementing the intervention (se time) . We are Inpatient utilization data from the patient treatment file (PTF) data and outpatient utilization data from the Outpatient Care File (OPC) are to be merged with VA Decision Support System (DSS) data on VA expenditures for all trial participants to compare VA resource utilization of veterans randomized to treatment clinics and veterans randomized to control clinics before and during intervention roll-out. The outcome of interest is annual healthcare costs over the 12-month period, and the patient is the unit of analysis. A VA payor perspective is applied. All costs are to be valued in 2010 US dollars, based on the Current Price Index-Medical (CPI-M).We anticipate a major product of the study to outline the full range of costs required to implement and sustain the intervention in the six intervention clinics relative to clinics who did not receive the intervention.Conducting implementation research can be challenging and because of initial IRB challenges, we had to modify the study from six intervention sites and six control sites to the current three intervention sites compared to nine usual care sites.The prevalence of hypertension has increased to 29.3% in 2003 to 2004 , resultiDespite solid evidence of efficacy, there has long been a knowledge-practice gap in implementing hypertension interventions . In addiThe clinical strengths of our evaluation project include: building upon previously successful interventions that have resulted in improved BP control; an intervention that uses resources already available in primary care clinics and that could be redeployed in new ways to achieve higher quality of care for patients with hypertension; and assessing the costs associated with implementation of the intervention. Demonstrating the costs of the intervention will help ensure the dissemination of the intervention.This implementation study capitalizes on the national healthcare system of the VA to systematically examine the local adoption of an effective program aimed to manage veterans' hypertension while informing implementation science. The goals of the intervention are aligned with the performance goals of the hospital administration as demonstrated with the leveraging of facility resources. Nonetheless, implementation of evidence based practices requires changes across the system, and this study is designed to facilitate and evaluate such changes.The magnitude of the gap between discovery and delivery cannot be understated. Nor can we underestimate the gap between what we know and what we need to know in terms of promoting the use of evidence-based guidelines in primary care settings. Given the magnitude of the 'systems change' that may be required to meet hypertension guidelines, the project may also have a significant impact on veteran's health by helping the VA to accelerate the translation of scientific advances into large-scale improvements in health and substantial reductions in health disparities. Findings from the current endeavor may transcend the VA into other healthcare settings.The authors declare that they have no competing interests.HBB and GLJ were responsible for obtaining funding. All authors contributed to the design of the study, implementation of the project, design and coordination of the study, and helped to draft the manuscript. All authors read and approved the final manuscript.

These algorithms captured dependencies in the gene expression profiles of the mouse lung, allowing the regulatory effect of Nrf2 in response to oxidative stress to be determined more precisely. In addition, a characterization of promoter sequences of Nrf2 regulatory targets was conducted using a Support Vector Machine classification algorithm to corroborate ARACNE and CLR predictions. Inferred networks were analyzed, compared, and integrated using the Collective Analysis of Biological Interaction Networks (CABIN) plug-in of Cytoscape. Using the two network inference algorithms and one machine learning algorithm, a number of both previously known and novel targets of Nrf2 transcriptional activation were identified. Genes predicted as novel Nrf2 targets include Atf1, Srxn1, Prnp, Sod2, Als2, Nfkbib, and Ppp1r15b. Furthermore, microarray and quantitative RT-PCR experiments following cigarette-smoke-induced oxidative stress in Nrf2+/+ and Nrf2−/− mouse lung affirmed many of the predictions made. Several new potential feed-forward regulatory loops involving Nrf2, Nqo1, Srxn1, Prdx1, Als2, Atf1, Sod1, and Park7 were predicted. This work shows the promise of network inference algorithms operating on high-throughput gene expression data in identifying transcriptional regulatory and other signaling relationships implicated in mammalian disease.A variety of cardiovascular, neurological, and neoplastic conditions have been associated with oxidative stress, i.e., conditions under which levels of reactive oxygen species (ROS) are elevated over significant periods. Nuclear factor erythroid 2-related factor (Nrf2) regulates the transcription of several gene products involved in the protective response to oxidative stress. The transcriptional regulatory and signaling relationships linking gene products involved in the response to oxidative stress are, currently, only partially resolved. Microarray data constitute RNA abundance measures representing gene expression patterns. In some cases, these patterns can identify the molecular interactions of gene products. They can be, in effect, proxies for protein–protein and protein–DNA interactions. Traditional techniques used for clustering coregulated genes on high-throughput gene arrays are rarely capable of distinguishing between direct transcriptional regulatory interactions and indirect ones. In this study, newly developed information-theoretic algorithms that employ the concept of A variety of conditions including certain cancers and heart diseases, diabetes mellitus, and rheumatoid arthritis have been associated with the generation of high levels of highly reactive molecular species under conditions known as “oxidative stress.” A number of protein molecules have been identified as participants in an elaborate response to oxidative stress. Sustained elevated generation of reactive species can overwhelm this response and lead to disease conditions. In these studies, we make use of data generated from over 250 studies (microarrays) in which messenger RNA levels of the gene precursors of mouse lung proteins have been examined collectively. We have made use of computational approaches to help identify the key regulatory relationships among the proteins that respond to oxidative stress. Nrf2, a protein known as a master regulator of oxidative stress response, was a principal focus of our studies. Among the novel regulatory targets of Nrf2 we identified is Als2, a protein involved in amyotrophic lateral sclerosis (Lou Gehrig's disease). We also identify important candidate three-party regulatory relationships, one of which involves the recently discovered Srxn1, an antioxidant protein that reverses S-glutathionylation, a common posttranslational modification associated with diseases such as Parkinson's disease, diabetes, hyperlipidemia, Friedreich's ataxia, renal cell carcinoma, and HIV/AIDS. These studies demonstrate the utility of network inference algorithms and affirm that Nrf2 has a direct regulatory role over the expression of other genes responding to oxidative stress. Sustained elevated levels of reactive oxygen species (ROS) have been associated with the etiology of a vast range of pathological conditions. These include a variety of neurodegenerative diseases, cardiovascular diseases, cancer, diabetes mellitus, rheumatoid arthritis, and obstructive sleep apnea The principal transcription factor that binds to the ARE is Nuclear factor erythroid 2-related factor (Nrf2) To find direct regulatory targets of Nrf2, we use two algorithms that can infer such regulatory links from gene expression data: Context Likelihood of Relatedness (CLR) Data derived from the promoter regions of known Nrf2 targets were used to train LibSVM, a machine learning support vector machine classification algorithm z-score cutoff of 2.0 on the CLR score set yielded eighteen edges above the cutoff between the probe sets representing the Nfe2l2 gene that produces Nrf2 and the probe sets for other genes in the combined dataset. In other words, the set of gene states for Nfe212 contained enough information on the states of 18 other genes (probe sets) to lift their pairwise score two standard deviations or higher above the average CLR score among all genes in the set. Given that Nfe2l2 and other genes are represented by more than one probe set, these eighteen edges yield connections from Nfe2l2 to twelve other genes.Use of the two network inference algorithms, ARACNE and CLR, on the gene expression data, as well as use of the LibSVM algorithm on sequence data, yielded a number of outcomes where the same regulatory edge was predicted by all three algorithms . ARACNE p-value of 1e-7. Post-processing of the inferred edges to remove indirect regulatory relationships was done using a DPI tolerance of 0.15. For a more focused view, interactions involving Nrf2 were selected. Cutoffs for both the ARANCE and CLR algorithms were empirically determined. The cutoffs were pushed as high as possible to exclude false regulatory connections while still retrieving at least a moderate size set of interactions to explore and validate with quantitative RT-PCR, LibSVM, and literature search. In this sense, our work is classic exploratory analysis. All the Nrf2 target genes found using the CLR algorithm were also selected under the ARACNE algorithm under the cutoff values as stated above, and with the parameter settings as given in ν = 0.36 and γ = 2−13, a true positive rate of 0.7 or better was obtained under two cross-validation conditions for the genes in the training set. Furthermore, the precision, recall, and area under the ROC curves were 0.7 or better and Nrf2 knockout (NO) mouse lungs were then conducted to verify the regulatory role of Nrf2 on the expression of the genes identified. The mice were exposed to either air or cigarette smoke (CS). CS-induced elevations of glutathione (GSH) and Thiobarbiturate reactive substances (TBARS) levels depicted in Thus, microarray data generated from CS-exposed mouse lungs can elucidate the regulation of gene expression in response to oxidative stress. In +/+ mice but not Nrf2−/− mice in response to CS exposure Rangasamy et al. list 45 genes whose expression increase in Nrf2The involvement of the ARE and Nrf2 in the regulation of the expression of genes involved in the response to oxidative stress has been noted Several of the genes that were identified in our work as potential targets of Nrf2 transcriptional regulation in the mouse lung have been implicated in certain neurodegenerative disorders. Of the set of 46 genes of interest see , six areDeath of motor neurons induced by an Amyotrophic Lateral Sclerosis (ALS)-linked Sod1 mutant is prevented by the Als2 gene product, alsin Human diseases associated with S-glutathionylation, a common post-translation modification, include PD, diabetes, hyperlipidemia, Friedreich's ataxia, renal cell carcinoma and HIV/AIDS Park7, also known as DJ-1, has been linked to a number of Parkinson's Disease (PD) pathways The four traditional classes of prion diseases all involve mutations of Prnp and multiple abnormal conformations of its protein product Prp Using the two algorithms (ARACNE and CLR), we establish direct statistical dependencies between the expressions of genes such as Sod1, Als2, Srxn1, and Park7, and the expression of Nfe2l2 (the Nrf2 gene) in the mouse lung. The LibSVM studies affirm that in the case of Als2 and Srxn1, the direct statistical dependencies indicate transcriptional regulation by Nrf2. Furthermore, our quantitative RT-PCR experiments show that CS-induced oxidative stress of the mouse lung increases the mRNA expression of several of these genes, and that these increases require the presence of Nrf2. Experimental evidence and 5 coNqo1, also known as DT-diaphorase or NAD(P)H:quinone oxidoreductase, was found to be a target of direct regulation by Nrf2 under both the CLR algorithm runs and the Both CLR and ARACNE use the concept of mutual information (MI). Why not use Euclidean distance or Pearson correlation for pair-wise calculations, as is done in standard microarray-based gene clustering? Why use MI? Unlike Euclidean distance and Pearson correlation, MI does not assume that the relationship between the genes is linear. A major advantage of this information theoretic calculation is its nonparametric nature, and the entropy calculations performed in calculating the MI value do not require any assumptions about the distribution of variables. MI provides a general measurement for dependencies in the data: negative as well as positive, nonlinear as well as linear The higher the MI score between two genes, the greater the information we derive on the states of the first gene from the pattern of states in the other, and the greater the likelihood that one of the genes is directly regulating the other. While both ARACNE and CLR are mutual information based algorithms, and while both were applied here to the same microarray datasets, we believe that there is a legitimate reason to conclude that a regulatory connection found by both algorithms is of higher probability of being a true regulatory relationship than if only one of the two algorithms scored such a connection highly. ARACNE and CLR impose a superstructure on the basic MI calculation that differs in important ways. ARACNE also post-processes the results in a different manner. Also, the binning (discretization) methods used are different—which can be highly important. Therefore when a gene-to-gene relationship is scored highly by both algorithms, the algorithms have arrived at that conclusion using different calculations. An analogy can be made here to the Oak Ridge National Laboratory GRAIL gene finder tool which uses several algorithms—operating on the same sequence data—and combines their results for improved gene calling. For our resource-limited, time-limited exploratory analysis, we focused on the inferred regulatory connections we believed had the highest probability of proving to be biologically valid and the most robust, that is, on the connections inferred by ARACNE and CLR together.As with the standard clustering metrics, MI calculations are symmetric, yielding identical scores from gene A to gene B and from gene B to gene A. Therefore the directionality (which of the two genes regulates the other) cannot be inferred from the MI score alone. More information is needed: is one gene known or suspected to be a transcription factor? Does one of the two appear to connect many other putative targets? Does one gene connect (have a high MI score) to two or more putative target genes in the same operon? Additional information must be sought, with the regulatory edge in question looked at in the wider context of the entire inferred network.Each edge connecting the nodes in In As noted above, some of the genes reported have been investigated and have been found to work with Nrf2, though they have not previously been identified as genes directly activated by Nrf2. They remain possible targets of Nrf2 regulation, with a possible fit into the category of feed-forward loops discussed below. Indeed we show that in the absence of Nrf2, CS elicits a suppression of Park7 and Jun mRNA expression , causing a very tight correlation in their gene expression patterns. These are not mutually exclusive categories. For example, Nrf2 and the transcription factor Atf1 can jointly regulate the target gene ferritin H, Such connected subsets of three genes can often form what are known as feed-forward loop (FFL) transcriptional regulatory network motifs. These FFL motifs appear in hundreds of gene systems. In this context, gene Nfe212 (Nrf2) would be one of the three genes in an FFL subgraph, having an edge to Nqo1 as an activating regulator of that gene. The direction of the edges from Nqo1 to X, and from X to Nfe2l2 remain to be determined, as well as type of regulation for those two edges–activation or repression.Other examples of possible feed-forward loops are as follows: (1) The gene product Jun with empirically determined high confidence thresholds, shown in Separate RT-PCR experiments indicate that Nrf2 positively regulates the expression of the Nqo1, Sod1, Ercc6, Prdx6, Als2, Txnrd2, Park7, Srxn1, and Epas1 genes in the mouse lung . In addiWe believe our work shows the usefulness of network inference algorithms such as CLR and ARACNE on the growing body of microarray data. Using such algorithms and datasets, exploratory analysis is now possible that can usefully guide laboratory work with a relatively modest effort.Finally, in addition to identifying putative targets of Nrf2, we extended our analysis of the network downstream of Nrf2 by identifying probable feed-forward loops involving Nqo1, one of the Nrf2 regulatory targets. We believe further extension of our analysis downstream of Nrf2 is possible, and hope to continue work in this area.CT) value indicates the number of PCR cycles that are necessary for the detection of a fluorescence signal exceeding a fixed threshold. The fold change (FC) was calculated by using the following formulas: ΔCT = CT(GAPDH)−CT(target gene) and CT1 represents the highest CT value among all the samples and ΔCT2 represents the value of a particular sample. Results are expressed as mean values of relative fold changes (RFC) for n = 3 with WT Air as the baseline.Total RNA was extracted using RNAeasy kit from Qiagen according to the manufacturer's instructions, and 2 µg of total RNA was used for cDNA synthesis. Quantitative PCR analyses were performed by using assay on demand probe sets commercially available from Applied Biosystems. Assays were performed by using the ABI 7000 Taqman system (Applied Biosystems). GAPDH was used for normalization. The cycle threshold as a measure lipid peroxidation was assessed by the method of Ohkawa et al. Az is the z-score of the MI score between gene A and gene B in gene A's MI score distribution, and Bz is the z-score of the MI score between gene A and gene B in gene B's MI score distribution, then the CLR value (likelihood estimate) produced between genes A and B is set to:The first algorithm we employed is the Context Likelihood of Relatedness (CLR) algorithm The second algorithm used is the Algorithm for the Reconstruction of Accurate Cellular Networks (ARACNE), and comes from the Califano group at Columbia University Support Vector Machines (SVMs) are a set of supervised machine learning techniques that lie in the family of generalized linear classifiers. They employ a training set, with the SVM classification results scored against the known data classification values, and with the SVM parameters iteratively refined against that metric http://cran.r-project.org/), the affy package of BioConductor (http://www.bioconductor.org/) was used to perform Robust Multi-array Average (RMA) analyses on the datasets Publicly available mouse lung microarray data from seven disparate laboratories were employed, as well as data from the Biswal lab. In all, 260 Affymetrix CEL files from two platforms, Affymetrix GeneChip Mouse Genome 430 2.0 array and the Affymetrix Mouse Expression Set 430 (MOE430A), were collected. Of these, 224 arrays were obtained from the publicly available Gene Expression Omnibus Datasets . These mthe 71 publicly available GeneChip Mouse Genome 430 2.0 arrays and viewed and analyzed in Cytoscape and CABIN (as was done with the ARACNE output).We used an implementation of the CLR algorithm within the Software Environment for BIological Network Inference (SEBINI) workbench p-value for establishing that the mutual information between gene pairs was significant enough to report out was set at 10−7. The percentage of MI estimates considered as sampling error (the DPI tolerance) was set at 0.15. A parser was written in Lisp to convert the outputs into the SIF file format. Each set of edges was thus represented as a network within Cytoscape and CABIN for further analysis. Interactions involving the transcription factor Nrf2 were selected out and entered into Cytoscape and CABIN as smaller-sized networks, for simpler visualization of our Nrf2-based analysis.The not Nrf2-regulated γ*|u−v|2) kernel type, with ν = 0.36, γ = 2−13, cost = 1. and training set size = 49.As detailed in http://www.genome.ucsc.edu). For each promoter sequence, a vector of size 308, with elements characterizing features of the sequence, was generated using Common Lisp code. The elements of the vector included a Boolean value indicating whether or not the Antioxidant Response Element (ARE) to which Nrf2 binds to activate gene transcription was present. The vector also included numbers characterizing the base pairs stretching between the ARE and the Transcription Start Site (TSS), the ARE and the TFIID bind site, the ARE and the Maf bind site, the ARE and the ATF4 bind site, the ARE and the cAMP Response Element (CRE), and the ARE and the TPA Response Element (TRE). For these characterizations, the three kinds of features used were Composition, Transition and Distribution. Composition is a reference to the proportions of nucleotide base types contributing to the promoter sequence make up. Transitions represent the frequency with which specific nucleotide base types are followed or preceded, within the sequence, by other nucleotide base types. Distribution is a statement concerning the dissemination of specific nucleotide base types within portions of the sequence (or the entire sequence). The data generated was formatted for use within the Weka Workbench software toolkit of machine learning packages in Java Details on the structure of the LibSVM datasets used are described in We used the Agilent literature search tool to conduct literature searches As indicated under “Data Sources” above, four sets of RMA-analyzed microarray data constituted the source of four networks for each of the algorithms used. These networks were inputs into the CABIN tool P≤0.05) of each identified change in gene expression. The results for Sod1, Nqo1 and Als2 indicating mean mRNA expression data from the microarrays are shown in Microarray experiments were conducted with CD-1 Nrf2 wild type (WT) and Nrf2 knockout (NO) mice exposed to either five continuous hours of cigarette smoke (CS) or twenty four hours of air. For the purpose of such studies, approximately 5 hours of continuous CS exposure is about equivalent to one day of cigarette smoking Text S1Components of instance vectors used for machine learning.(0.04 MB DOC)Click here for additional data file.Table S1Listing of microarray data sources.(0.03 MB XLS)Click here for additional data file.Table S2Gene symbols, Entrez IDs, and functions.(0.03 MB XLS)Click here for additional data file.Table S3Genes used For machine learning.(0.03 MB DOC)Click here for additional data file.

Dietary supplement use in the United States is prevalent and represents an important source of nutrition. However, little is known about individuals who routinely consume multiple dietary supplements. This study describes the dietary supplement usage patterns, health, and nutritional status of long-term multiple dietary supplement users, and where possible makes comparisons to non-users and multivitamin/mineral supplement users.Using a cross-sectional study design, information was obtained by online questionnaires and physical examination from a convenience sample of long-term users of multiple dietary supplements manufactured by Shaklee Corporation . Data for non-users and multivitamin/mineral supplement users were obtained from the National Health and Nutrition Examination Survey (NHANES) 2001–2002 and NHANES III 1988–1994. Logistic regression methods were used to estimate odds ratios with 95% confidence intervals.Dietary supplements consumed on a daily basis by more than 50% of Multiple Supp users included a multivitamin/mineral, B-complex, vitamin C, carotenoids, vitamin E, calcium with vitamin D, omega-3 fatty acids, flavonoids, lecithin, alfalfa, coenzyme Q10 with resveratrol, glucosamine, and a herbal immune supplement. The majority of women also consumed gamma linolenic acid and a probiotic supplement, whereas men also consumed zinc, garlic, saw palmetto, and a soy protein supplement. Serum nutrient concentrations generally increased with increasing dietary supplement use. After adjustment for age, gender, income, education and body mass index, greater degree of supplement use was associated with more favorable concentrations of serum homocysteine, C-reactive protein, high-density lipoprotein cholesterol, and triglycerides, as well as lower risk of prevalent elevated blood pressure and diabetes.This group of long-term multiple dietary supplement users consumed a broad array of vitamin/mineral, herbal, and condition-specific dietary supplements on a daily basis. They were more likely to have optimal concentrations of chronic disease-related biomarkers, and less likely to have suboptimal blood nutrient concentrations, elevated blood pressure, and diabetes compared to non-users and multivitamin/mineral users. These findings should be confirmed by studying the dietary supplement usage patterns, health, and nutritional status of other groups of heavy users of dietary supplements. Diet and nutrition play important roles in the maintenance of health and prevention of disease ,2. DietaThis cross-sectional study was undertaken to describe the dietary supplement usage patterns, serum nutrient and biomarker concentrations, and health status of a convenience sample of individuals who were daily users of multiple dietary supplements (median of 26 different dietary supplements taken daily in the prior 12 months). In addition, biomarker concentrations and the health status of multiple dietary supplement users were compared with two other convenience samples assembled from NHANES: non-users of supplements and those who consumed a multivitamin/mineral supplement only.To assemble a sample of long-term users of multiple dietary supplements, individuals who had been consumers of dietary supplements for ≥ 20 years from a dietary supplement manufacturer and distributor were invited to participate in the study. The invitation was sent by electronic mail to approximately 1,200 individuals meeting this criterion. Of the total invitees, 435 successfully completed online questionnaires to obtain information about height, annual household income, education, medical history and current medical conditions, and dietary supplement usage. Reasons for non-participation were not investigated. A subset of 300 individuals who completed the questionnaires and were free of cancer, other than non-melanoma skin cancer, were randomly chosen and asked to attend a physical examination for the purpose of providing a 12-hour fasting blood sample and having their body weight and blood pressure measured. A final analytic sample of 278 participants had complete questionnaire and examination data. These individuals composed the 'Multiple Supp' users. The study was reviewed and approved by an independent institutional review board , and all participants provided informed consent.For the Multiple Supp users, online questionnaires were used to obtain information about height, annual household income, education, medical history and current medical conditions, and current dietary supplement usage. Questions about medical history and current medical conditions were patterned after questions asked in NHANES 2001–2002 . The diePhysical examinations were conducted during a national meeting of Shaklee product consumers held in Chicago, Illinois in August 2005. Data collection took place between July and August of 2005. Body weight was measured using a physician's scale with shoes and heavy clothing removed. Triplicate blood pressure measurements were taken by an automated Welch Allyn device Model 5201) with an appropriate-sized cuff after subjects were seated quietly in a chair for 2 minutes, with feet on the ground and with the arm at the level of the heart. Twelve-hour fasting blood samples were collected, processed, aliquoted and stored frozen at -80°C. Samples were assayed for red blood cell (RBC) folate, serum ascorbic acid stabilized using 10% metaphosphoric acid, alpha tocopherol, carotenoids, retinol, 25-hydroxyvitamin D, ferritin, C-reactive protein (CRP), lipids, and homocysteine (Table with an We used NHANES (NHANES III and 2001–2001) data as a source of comparison data for multivitamin users and non-users of supplements. NHANES is designed to monitor the health and nutrition status of the US population and participation consisted of an in-home interview and an examination in the NHANES mobile examination unit . DietaryTo match the age and race composition of the Multiple Supp users, we selected from NHANES 2001–2002 participants all of the White men and women, >35 years of age, and free of cancer other than non-melanoma skin cancer, who met certain supplement use criteria. Only non-supplement users and users of supplements containing vitamins and/or minerals were included for the present analysis. We identified 602 NHANES participants who consumed no dietary supplements in the 30 days prior to the home interview; these became the 'No Supp' users. We also identified 176 individuals who consumed a multivitamin/mineral and no other dietary supplements, and did so at least 15 days over the past 30 days. These became the 'Single Supp' users. To obtain the most recent data possible for comparative purposes, RBC folate, and serum ferritin, homocysteine, CRP, and lipid data were obtained from NHANES 2001–2002 ,9. The gAfter combining the Multiple Supp users with the Single Supp and No Supp users from NHANES, data were reweighted. The weights for the NHANES groups were calculated by dividing each NHANES weight by the sum of the NHANES weights of the user group. Appropriate weights were used depending on whether the data came from the interview or the Mobile Examination Center. Multiple Supp users were assigned a weight of 1. Strata and primary sampling units from NHANES were used for those user groups. For the Multiple Supp users, a new stratum variable was assigned, and each member of the Multiple Supp group was assigned to a unique primary sampling unit. These adjustments permit more accurate variance estimates and account for stratification factors. However, the Single Supp and No Supp users from NHANES should not be interpreted as being nationally representative samples. Calculations used SUDAAN Version 9.0 .2, education category , income category and income2, and body mass index (BMI). For outcomes treated as dichotomous variables, logistic regression methods were used to estimate odds ratios (OR) with 95% confidence intervals (CI), adjusted for sex, age and age2, education category, income category and income2, and BMI. The model fit was examined using the Hosmer and Lemeshow Goodness-of-Fit test. The referent group for risk estimation was the No Supp user group. Statistical significance was defined as p < 0.05.Differences in the characteristics of the supplement user groups were evaluated using chi-square methods for categorical variables and one-way analysis of variance for continuous variables. Multiple regression techniques were employed to examine differences in nutrient and biomarker concentrations of user groups. Comparisons of mean nutrient concentrations among user groups were adjusted for sex and age. Comparisons of biomarker concentrations among user groups were further adjusted for ageElevated blood pressure was defined as >80 mmHg for diastolic and/or >120 mmHg for systolic blood pressure . SuboptiSignificant differences by user group were found for sex, age, BMI, education, and household income Table . The proBy definition, No Supp users consumed no supplements and Single Supp users consumed only a multivitamin/mineral dietary supplement and did so approximately every other day or more often. Multiple Supp users reported taking an average of 25 different supplements in the past 12 months , and took an average of 17 different supplements every day (data not shown). Dietary supplements consumed on a daily basis by more than 50% of both male and female Multiple Supp users included a multivitamin/mineral, B-complex, vitamin C, vitamin E, calcium with vitamin D, a herbal immune supplement, carotenoids, omega-3 fatty acids, flavonoids, lecithin, coenzyme Q10 with resveratrol, alfalfa, and glucosamine . No comparative 25-hydroxyvitamin D data were available from NHANES. No Multiple Supp users had suboptimal serum ascorbic acid concentrations (<0.4 mg/dL), compared with 9.4% among Single Supp users and 32.4% among the No Supp group (data not shown). Similarly, 94.1% of Multiple Supp users had serum ascorbic acid concentrations >1.0 mg/dL, compared with 46.6% of Single Supp users and 21.9% of No Supp users (data not shown).Adjusted risk estimates for elevated blood pressure and suboptimal or elevated concentrations of serum biomarkers are reported in Table Prevalence of self-reported disease was low in each user group and most risk estimates did not reach statistical significance Table . An exceLittle has been reported about daily users of multiple dietary supplements. We assembled a sample of long-term users of multiple dietary supplements for the purpose of describing their supplement usage patterns. On average, Multiple Supp users in this study consumed 17 different supplements every day. Dietary supplements consumed on a daily basis by more than 50% of Multiple Supp users included a multivitamin/mineral, B-complex, vitamin C, carotenoids, vitamin E, calcium with vitamin D, omega-3 fatty acids, flavonoids, lecithin, alfalfa, coenzyme Q10 with resveratrol, glucosamine, and a herbal immune supplement. Women also consumed gamma linolenic acid and a probiotic supplement, whereas men also consumed zinc, garlic, a soy protein supplement, and saw palmetto Table . By compA second objective of the study was to conduct a cross-sectional comparison of the relevant biomarker and nutrient concentrations in the Multiple Supp users, with those of Single Supp users and No Supp users (non-users) in NHANES 2001–20002 and NHANES III. Nutrient concentrations in serum or RBC generally increased across the three supplement user groups. It is notable that Single Supp users had higher circulating concentrations than No Supp users for RBC folate and serum retinol, ascorbic acid, and alpha tocopherol. This fact has important implications for nutrition intervention trials, some of which have permitted participants, including those in the control group, to take a multivitamin/mineral supplement . Our finDegree of supplement use was associated with several markers of disease risk. Elevated serum homocysteine concentrations were found in approximately 45% of No Supp users, 37% of Single Supp users, and 11% of Multiple Supp users, despite the fact that the data were obtained after the 1998 fortification of grain products with folate, and despite the low prevalence of inadequate RBC folate in any of the user groups. If moderately-elevated serum homocysteine is shown to be an important cardiovascular disease risk factor, the findings of this study suggest that intake of the relevant B vitamins above what is typically found in a multivitamin/mineral supplement, and/or the diet, may produce a more favorable homocysteine-lowering effect.Circulating CRP concentration has been shown to be predictive of future cardiovascular disease risk in prospective studies among asymptomatic individuals and may have a direct effect on the progression of atherosclerosis . In the Serum ascorbic acid concentration >1.0 mg/dL has been suggested as optimal relative to reduced risk of cardiovascular disease and cancer . By thisSerum 25-hydroxyvitamin D in Multiple Supp users is of interest because of possible beneficial and adverse effects from supplemental intake of vitamin D. Improving 25-hydroxyvitamin D concentrations above the level associated with subclinical deficiency (<37.5 nmol/L) may reduce the risk of skeletal fractures -19. AlsoSupplement use was also associated with lower serum triglycerides and higher HDL-cholesterol concentrations. In consequence, the risk of an elevated ratio of total cholesterol to HDL-cholesterol was significantly lower in the Multiple Supp group compared to the No Supp group Table . PrevaleSelf-assessed health status has been found to be a remarkably good marker of prospective health outcomes . CompareRisk of elevated systolic or diastolic blood pressure was significantly lower in the Multiple Supp group compared to No Supp users, but not in Single Supp users compared to No Supp users Table . DietaryThe lower risk of diabetes in the Multiple Supp group is consistent with evidence that oxidative stress may be a mechanism linking insulin resistance with dysfunction of pancreatic beta cells and endothelial dysfunction, eventually leading to diabetes . AlthougAn important limitation of the study is the fact that the data are cross-sectional, and therefore the reported associations, particularly with health outcomes , cannot presume causality. Also, the three user groups should not be interpreted to represent unbiased national estimates. In addition, although we adjusted for potential confounders such as age, sex, income, education, and BMI, residual confounding could possibly account for the findings. Better access to health care and variables related to higher socioeconomic status in the supplement user groups are logical hypotheses that may account for these results. However, the No Supp and Single Supp user groups were similar with respect to education and income Table , so thesThis study is the first we are aware of to describe the usage patterns of long-term users of multiple dietary supplements, an unusual sample that cannot be captured in national representative surveys. While only 3 individuals out of over 11,000 surveyed in NHANES 2001–2002 had taken 20 or more kinds of dietary supplements in the past 30 days, in our Multiple Supp users, 87% of the sample reported having taken 20 or more kinds of supplements daily. Thus, this sample of Multiple Supp users affords a rare opportunity to understand a segment of the population that take multiple dietary supplements, and to understand the nutrient and other correlates of this practice. In addition, Multiple Supp users were long-term consumers of dietary supplements. Thus, their serum nutrient and biomarker concentrations were likely to be representative of their long-term supplementation patterns.This sample of long-term users of multiple dietary supplements was found to consume a broad array of vitamin/mineral, herbal, and condition-specific dietary supplements on a daily basis. They were more likely to have optimal concentrations of biomarkers associated with reduced disease risk, and less likely to have suboptimal circulating nutrient concentrations, elevated blood pressure, and diabetes than multivitamin/mineral users and non-users. There was no evidence that intake of vitamin D in multiple supplement users was excessive based on serum 25-hydroxyvitamin D concentrations. These findings should be confirmed by studying the dietary supplement usage patterns and health and nutrition status of other groups of heavy users of dietary supplements. Our study findings should also be weighed in the context of recent randomized controlled trials and related meta-analyses ,40 whichUS = United States, NHANES = National Health and Nutrition Examination Survey, RBC = red blood cell, CRP = C-reactive protein, BMI = body mass index, OR = odds ratio, CI = confidence interval, HDL = high-density lipoprotein, LDL = low-density lipoprotein.The study was financially supported by Shaklee Corporation. LGW and JFM are employed by, and CDJ is a scientific consultant to the sponsor. GB has received research funding from the sponsor.GB, CDJ, and LGW participated in the design of the study, acquisition of the data, analysis and interpretation of the data, and drafting and revising of the manuscript.EPN and JFM participated in the acquisition of the data and revising of the manuscript. TBD and MLH participated in the analysis and interpretation of the data and drafting and revising of the manuscript. All authors read and approved the final manuscript.

Background. Knowledge, attitudes, and practices of obstetricians and gynecologists regarding the Centers for Disease Control and Prevention (CDC) recommendations for prevention of healthcare-associated group A streptococcal (GAS) infections as well as general management of pregnancy-related and postpartum infections are unknown. Methods. Questionnaires were sent to 1300 members of the American College of Obstetricians and Gynecologists. Results. Overall, 53% of providers responded. Postpartum and postsurgical infections occurred in 3% and 7% of patients, respectively. Only 14% of clinicians routinely obtain diagnostic specimens for postpartum infections; providers collecting specimens determined the microbial etiology in 28%. Microbiologic diagnoses were confirmed in 20% of postsurgical cases. Approximately 13% and 15% of postpartum and postsurgical infections for which diagnoses were confirmed were attributed to GAS, respectively. Over 70% of clinicians were unaware of CDC recommendations.Conclusions. Postpartum and postsurgical infections are common. Providing empiric treatment without attaining diagnostic cultures represents a missed opportunity for potential prevention of diseases such as severe GAS infections. Pregnant women are at risk ofinfection during labor and delivery; most infections of the female pelvicorgans occur when normal flora of the female genital or gastrointestinal tractcontaminate the normally sterile amniotic fluid and uterus. These bacteria canbecome pathogenic, particularly in devitalized tissue .BacteriStreptococcus (GAS), or Streptococcus pyogenes, is an uncommon, but serious and potentially preventable cause ofpostpartum and postsurgical infections. The incidence of confirmed GASinfections among deliveries in a study in Jerusalem over 6.5years ranged from 0.33 to 3.16 per 1000 births;suspected intra- or postpartum GAS infections occurred in 13.2% of all deliveries[Group A liveries. In a rliveries;these iIn 2002, Centers for Disease Control (CDC) published guidelines for prevention ofsecondary invasive GAS infections, including those among postpartum and postsurgicalpatients . RecommAlthough these guidelines were publishedin 2002, the level of awareness and adherence to these recommendations isunknown. Also, clinician knowledge and management of pregnancy-related and postsurgicalinfections has not been assessed. We conducted a survey of obstetricand gynecologic providers (OB/GYNs) to estimate the frequency of intrapartum,postpartum, and postsurgical infections they encounter to determine bacterialculturing practices among providers, and to estimate the frequency of GASisolation among the respondents’ patient populations.We also sought to estimate awareness andadherence to the CDC guidelines, assess barriers to follow the guidelines, andquery providers regarding more effective methods for distributing theserecommendations.In July 2005, an anonymous questionnaire focusing on current practices regarding intrapartum, postpartum, and postsurgicalinfections was mailed to 1300 American College of Obstetricians andGynecologists (ACOG) Fellows and Junior Fellows in Practice; 1000 subjects weremembers of the Collaborative Ambulatory Research Network (CARN). Membersof CARN are practicing OB/GYNs who have volunteered to participate regularly insurveys, facilitating assessment of clinical practice patterns, and aidingdevelopment of educational materials. The remaining 300 subjectsconsisted of a computer-generated random sample of ACOG Fellows and JuniorFellows in practice who are practicing obstetrics and/or gynecology and had notreceived a survey from ACOG during the previous two years (non-CARN). A secondmailing was sent approximately five weeks after the first to those individualswho did not initially respond. A final reminder mailing was sent approximatelysix weeks later. All survey respondents who reportedperforming deliveries or surgeries in 2004 were eligible for inclusion in our analysis.The survey included questions about the practitioner's age and training, his/herpractice, patient population demographics, and specific questions assessingexperience with diagnosing and treating intrapartum, postpartum , and postsurgical infections , particularlyinfections potentially due to GAS.Survey respondents were asked to estimate the racial and ethnicdistributions of their patient population, number of deliveries and surgeriesperformed and related infections seen during 2004. Questions also assessed thepractitioner's use and understanding of the CDC guidelines for prevention ofGAS infections among postpartum and postsurgical patients. Question formats were primarily multiple choice or opinion questions using a scaled response.Survey responses were double-entered into an American Standard Code for InformationInterchange (ASCII) file, corrected for data entry errors, and converted into anSAS 9 database . The racial and ethniccharacteristics of the provider's patient population were dichotomized into thefollowing categories, based on the distribution of responses: less than 80% white versus 80% or more white;less than 25% versus 25% or more black; less than 20% versus 20% or moreHispanic; less than 7% versus 7% or more Asian/Pacific Islander. The percentageof patients with Medicaid was divided into low (<25%), medium (25–49%), andhigh (≥50%) categories. Differences in categorical measures wereassessed using the chi-square test. The Wilcoxon 2-sample test was usedto compare medians among continuous measures. All analyses were tested forsignificance using a Completed surveys were returned by 614 (61%) CARN and 75(24%) non-CARN members . Respondents who had notperformed deliveries or surgeries in 2004 (54 CARN and 6 non-CARN respondents)were excluded. Demographic and practice characteristics of the remaining 629survey respondents are detailed in Nearly all providers performed bothdeliveries (91%) and surgeries (hysterectomies or Cesareandeliveries) (96%) in the year preceding the survey. Based on respondentsestimates, the median number (and range) of vaginal deliveries performed perprovider in 2004 were 120 (4–512) (P < .001 for each).Based on respondents' estimates,the median number of patients (per provider) who developed intraamnioticinfection or chorioamnionitis in the year preceding the survey was five (range: 0–100). Nearly all respondents (91% of 568) stated that they would treat anintraamniotic infection empirically, without obtaining a complete blood countor blood culture or waiting for the results of either test if obtained. Overhalf of respondents believe that the most common bacterial cause ofintraamniotic infections is polymicrobial . With inStaphylococcus aureus and group B streptococcalinfections differed for postpartum compared to postsurgical infections developed postsurgical infections. Over half of providers stated that they donot obtain diagnostic specimens from their patients with postpartum infections;only 14% always obtain specimens. Providers with increasingyears of experience were more likely to routinely obtain specimens formicrobiological diagnosis of postpartum infections or sometimes (52%) obtained cultures from patients with postsurgicalinfections compared to those with postpartum infections; only 30% empiricallytreated without obtaining specimens. Providers with increasing years ofexperience were more likely to always obtain specimens from patients with postsurgicalinfections (chi-square test for linear trend: Streptococcus (GBS), 9% of respondents stated that they would treat the patient withantibiotics, 15% would give intrapartum antibiotic prophylaxis similar tomanagement of GBS, most respondents (64%) would do nothing, and 8% stated thatthey either do not see this organism or their laboratory does not routinelytest rectovaginal cultures for GAS.When GAS is isolated during routinerectovaginal culture for group B all fivesites. Respondents chose the following as possible causes of a cluster ofpostpartum or postsurgical GAS infection in a facility:healthcare worker is a GAS carrier (44%respondents); patient being colonized prior to delivery or surgery (28%); aswell as poor infection control practices (23%). Answers given to questionsabout potential sites of GAS colonization and possible causes of clusters didnot vary by provider characteristics such as years in practice or practicetype.The majority of survey respondentscorrectly indicated that each of the five body sites listed may be colonized by GAS althoughWhen questioned about action taken when a postpartum or postsurgical GAS infection is identified, 25% would contact infection control personnel. Few respondents chose the other twoactions recommended in the CDC guidelines . The majOnly 5.6% of respondents , but are consistent with previous estimates in the literature.Intraamniotic infections have been reported to range from 0.5% to 10.5% of allpregnancies, occurring in 1–5% of term pregnancies and up to 10% in patientswith premature labor –32. PuerNearly all survey respondents treatintrapartum, postpartum, and postsurgical infections empirically althoughproviders are more likely to obtain diagnostic specimens from patients with postsurgicalinfections. While no formalized guidelines on diagnostic management ofintrapartum and postpartum infections exist, empiric therapy is not contrary tocurrent practice recommendations. Recently developed ACOG guidelines on the useof prophylactic antibiotics in labor and delivery recommend the use ofprophylactic antibiotics in both high- and low-risk patients undergoing Cesareandelivery although the data to support use among low-risk patients isinconclusive . Blood cE. coli in the 1940s–1970s, to group B streptococci in thecurrent era [Staphylococcus aureus infections among pregnant and postsurgical patients [Conversely, pretreatment culturesfacilitate management of patients who fail initial empiric antibiotic .Tailorirent era . Also, atients –40. Compatients –45. PeriAnother benefit of obtaining pretreatmentcultures is that identification of certain pathogens, such as GAS, shouldtrigger specific infection control measures to prevent spread of disease. GASinfections can be devastating with an overall case fatality ratio (CFR) of 13%and CFRs of 25–36% for the most severe manifestations—necrotizingfasciitis and streptococcal toxic shock syndrome . These Provider responses to theGAS-specific questions included in our survey underscore both the lack ofawareness of the CDC GAS guidelines among one of their targeted audiences—OB/GYNs—and potential meansto correct this information gap. Very few providers were aware of theguidelines and the recommended public health action following identification ofpostpartum and postsurgical GAS infections.The principal reason for notunderstanding or following these guidelines was a lack of awareness of their existence,most likely because they were published in a journal not read by this group ofproviders. Potential solutions to this dilemma include publication in journalsrelevant to OB-GYNs, incorporation into ACOG guidelines and hospital infectioncontrol protocols, presentation at relevant meetings, and inclusion in CMElecture series.A common thread in our surveyresults is the association of increasing years of experience and older age witha variety of practice patterns. Older, more experienced providers were far morelikely to attempt to determine the etiology of intra- and postpartum infectionsand also had different beliefs from younger providers as to the specificetiologies of such infections.Thereasons for these trends are unknown but may include changes in medicaleducation or in the epidemiology of these infections.Limitations of our survey includeour low response rate, particularly among non-CARN providers although it isconsistent with other ACOG surveys , 48. AnIn summary, although the use ofempiric antibiotics in intraamniotic, postpartum, and postsurgical infectionsmay currently be effective in most cases, the paucity of diagnostic culturesobtained presents a missed opportunity to monitor the etiology of theseinfections and to identify a potentially preventable cause of serious healthcare-associateddisease—GAS infections.Current efforts to educate providers regarding the settings in which theidentification of GAS should trigger a public health response and augmentinfection control practices are inadequate. However, our survey identified moreeffective means of communicating with practicing OB/GYNs and also emphasizedthat educational efforts should target the infection control practitioner (ICP)as most hospitals currently rely on the ICP to identify potential healthcare-associatedinfections and initiate necessary investigations. Periodic, time-limitedstudies of the etiologies of pregnancy-related infections by public health andclinical researchers would help to monitor changes in the principal pathogens,track trends in antimicrobial resistance, and guide clinical management.

Bilateral posterior fracture-dislocation of the shoulder is a very rare injury. Almost 50% of bilateral posterior dislocations are due to a convulsive seizure, rising to 90% if the dislocations are associated with fractures. Electric shock accounts for less than 5% of bilateral posterior dislocations of the shoulder. A systematization of the clinical and radiological approach, followed by an early diagnosis and proper surgical treatment is essential. Authors report 2 cases of bilateral posterior fracture-dislocation of the shoulder, one caused by a convulsive seizure and the other by an electric shock. A review of literature and a treatment protocol are also presented. Although the shoulder is the most frequently dislocated joint, posterior dislocation is uncommon. Of all shoulder dislocations, 4% are posterior and 1% are associated with fractures.[Bilateral posterior dislocation of the shoulder is a rare situation, representing less than 5% of all posterior dislocations. Posterio3Different aetiologies are attributed to this particular condition. The "triple E syndrome" stands for the 3 most frequent causes of bilateral posterior dislocation of the shoulder. Almost 5We present 2 cases of bilateral posterior fracture-dislocation of the shoulder, one caused by a convulsive seizure and the other by an electric shock, presented to our clinic over a period of 3 years.A 36-year-old man, with a dominant right hand, a farm worker, with a history of alcohol abuse was hospitalized after an electric shock. He had bilateral burns in his hands and painful stiff shoulders. Functions (sensory and motor) of axillary nerve and all peripheral nerves were tested and were normal. Findings from vascular examination were also normal.Plain anteroposterior and lateral radiographs of both shoulders showed a posterior four-part fracture-dislocation of the right shoulder and a posterior two-part fracture-dislocation of the left shoulder . AlthougThe patient was submitted to gentle closed reduction under general anaesthesia of both shoulders. There was an acceptable anatomical relationship between the fragments and pin fixation with K-wires was made to maintain the fracture alignment .Postoperatively both shoulders were immobilised for 4 weeks with a sling. Pins were removed after that, and active rehabilitation was started.Twenty-seven months after the trauma, the patient has painless shoulders, has returned to his previous level of work and is very satisfied with the results regarding functions of the shoulder: flexion on the left side, 130°; flexion on the right side, 120°; abduction on the left side, 120°; abduction on the right side, 120°; external rotation on the left side, 40°; external rotation on the right side, 40°; internal rotation on the left side, L3; internal rotation on the right side, T12. The final Constant score was 71 oA 57-year-old housemaid, with a dominant right hand, was hospitalized after an acute major convulsive seizure. The patient had very painful shoulders, and the functions (sensory and motor) of the axillary nerve and peripheral nerves were normal. Findings from vascular examination were also normal.Plain anteroposterior and lateral radiographs of both shoulders showed bilateral comminute proximal humeral fractures . She alsAttempts to carry out closed reduction under general anaesthesia of both shoulders were unsuccessful. The patient was submitted to open reduction of both sides, using a deltopectoral approach. At the right side an acceptable reduction of the fragments with a locking plate was achieved. At the left side the fragments were very small, displaced and without structural support to maintain the reduction, so at the left shoulder a hemiprosthesis was used.Postoperatively both shoulders were immobilized for 4 weeks with a sling; and after that, active rehabilitation was started. The patient had complaints of painful right shoulder during the first 3 months, with progressively better functional results.Fifteen months after the trauma, the patient has painless shoulders, has returned to her previous level of work and is satisfied with the results regarding functions of the shoulder: flexion on the left side, 130°; flexion on the right side, 100°; abduction on the left side, 110°; abduction on the right side, 100°; external rotation on the left side, 30°; external rotation on the right side, 30°; internal rotation on the left side, L3; internal rotation on the right side, L3. The final Constant score was 71 oBilateral posterior fracture-dislocation of the shoulder, first described in 1902 by Mynter,The proposed mechanism of shoulder injury during a convulsive seizure has been well described. The typiDiagnosis of this type of injury is often delayed,10 up to Accurate history-taking and physical examination with at least one anteroposterior and one axillary radiograph views are esseAlthough it is included in our standard protocol, the CT scan was not done in the first case described above. The surgical team only used plain anteroposterior and lateral radiographs of both shoulders, which conditioned the preoperative planning.Treatment should be adapted to the type of lesion, the interval of time between trauma and treatment, and also to the age, occupation and desired levels of activity of the patient. Good resWhen the fracture is minimally displaced and the viability of the humeral head is not in doubt,‐13 close14For displaced acute fractures in young patients, if an attempt of gentle closed reduction is not successful, open reduction and internal fixation is the option. If open reduction cannot be achieved or in cases in which more than 50% of the articular surface of the head is damaged, hemiarthroplasty is a good solution.In older patients (>65 years old) with three or four-part acute fractures, there is a high risk of avascular necrosis, and the option is hemiarthroplasty.517 In patIf there is involvement of humeral head and also glenoid damage, a total shoulder arthroplasty may be considered.Taking into account the above, we base our approach on the treatment algorithm we foundWhen the diagnosis is delayed for several weeks or months and when when there is no evidence of avascular necrosis, other procedures can be preformed: humeral osteotomy to correct mal-union and a McLaughlin's procedure‐22 or au231619

We looked for p16 gene deletion by Southern analysis and p16 gene point mutation by single-stranded conformation polymorphism (SSCP) analysis and direct sequencing of DNA from fresh tumour samples of 35 and 33 breast carcinomas respectively. No homozygous p16 gene deletion was found in any case. A missense point mutation of the p16 gene was found in only one patient. This point mutation was absent from the patient's lymphocytes, ruling out a polymorphism or a germline mutation. These findings suggest that p16 gene alterations are rarely observed in breast carcinoma.

STDSIM an individual-based model. A campaign that achieved 70% coverage over 5 years with a vaccine that reduced susceptibility to HSV2 acquisition and HSV2 reactivation by 75% for 10 years, reduced HIV incidence by 30–40% after 20 years (range 4–66%). Over 20 years, in most scenarios fewer than 100 vaccinations were required to avert one HIV infection. HSV2 vaccines could have a substantial impact on HIV incidence. Intensified efforts are needed to develop an effective HSV2 vaccine.Herpes simplex virus type-2 (HSV2) infection increases HIV transmission. We explore the impact of a potential prophylactic HSV2 vaccination on HIV incidence in Africa using HIV affects HSV2 shedding, and the frequency and duration of clinical reactivations HSV2 prevalence and the estimated proportion of HIV infections attributable to HSV2 are very high in sub-Saharan Africa (Africa) and therefore HSV2 control could have a substantial population-level impact on the HIV epidemic An ideal prophylactic vaccine would prevent infection, although partially effective prophylactic vaccines may still be useful if they shift the threshold of infection, or if they prevent or ameliorate disease Prophylactic vaccines to prevent HSV2 acquisition have been tested with limited success. The Chiron-gD2gB2-MF59 vaccine provided only temporary protection lasting a few months Estimating the population-level impact of an HSV2 vaccine on HIV is complex because of its potential effects on both acquisition and transmission of HIV as well as the bi-directional relationship between HIV and HSV2. Mathematical modelling can be used to make these estimates. Few modelling studies have examined the relationship between HSV2 and HIV STDSIM mathematical model.The aim of this paper is to explore the potential population-level impact of prophylactic HSV2 vaccines on HIV incidence in one low and one high HIV prevalence city in sub-Saharan Africa using the 22.1STDSIM has been fitted to population-based data collected from four cities in Africa in 1997 and to available data on trends over time, as published STDSIM is an individual-based stochastic model that simulates the natural history of, and interactions between, HIV, HSV2, syphilis, gonorrhoea, chlamydia and chancroid. It has been described in detail STDSIM is able to simulate realistic sexual networks and heterogeneity between individuals in sexual behaviour and in the natural history of infection. STDSIM has previously been used to explore the impact of STI treatment and male circumcision for HIV-1 prevention and the heterogeneous spread of HIV-1 in Africa tp) transmission probabilities for both HIV and HSV2 were assumed to be twice those for female-to-male (FtoMtp) tp = 0.29), and lower during periods of clinical reactivation (MtoFtp = 0.20) tp = 0.01) and ‘middle’ (MtoFtp = 0.005) stages to account for transmissions that occur during sub-clinical shedding The model representation of the natural history of HSV2, and the interaction between HIV and HSV2, was parameterised based on the literature where possible, and poorly known parameter values have been subjected to sensitivity analysis HSV2 clinical reactivation was assumed to increase HIV acquisition and transmission. The magnitude of the per-contact HSV2 cofactor effects on HIV acquisition and transmission were chosen to be at the lower end of the estimated range for genital ulcers (3–300) to account for possible residual confounding due to common risk behaviours that may inflate estimates C.Cohen, 20/4/2007). Per-contact cofactor effects of other STIs on HIV susceptibility and infectivity were assumed to be 25 for chancroid, 7.5 for primary syphilis, and 3 for gonorrhoea and chlamydia infection. Lack-of-male-circumcision was assumed to double the per-contact probability of male acquisition of HIV, syphilis and chancroid Other model parameter values, for the demography, sexual behaviour and natural history of the other STIs and their interaction with HIV were as reported in our previous publication In this paper we present results for two cities. Cotonou, Benin represents an HIV epidemic highly concentrated among female sex workers (FSWs) and their clients, while Kisumu, Kenya represents a more generalised HIV epidemic typical of many countries in Eastern and Southern Africa 2.2As the existing vaccines are unlikely to be efficacious in Africa, we explored the impact of a potential prophylactic vaccine. HSV2 vaccination was targeted at a proportion of HSV2-uninfected individuals who were simulated to benefit for a fixed duration of time. We simulated three primary scenarios in which the vaccine was assumed to (i) reduce susceptibility to HSV2 acquisition, (ii) reduce HSV2 reactivation , or (iii) both.In each of these three primary scenarios we assumed three ‘strengths’ of the effect of the vaccine. In the ‘weak, ‘moderate’ and ‘strong’ vaccine efficacy scenarios, the values of parameters listed above were reduced by either 30%, 75% or 90%, respectively. For example, in the ‘weak vaccine efficacy (iii)’ scenario, we assumed a 30% reduction in susceptibility to HSV2 acquisition, a 30% reduction in clinical reactivation duration, a 30% reduction in clinical reactivation frequency, and a 30% reduction in HSV2 infectivity during and between HSV2 clinical reactivations.We assumed a linear increase in the prevalence of vaccination over 5 years from 0% to 50%, 0% to 70% or 0% to 90% of targeted HSV2-uninfected individuals. We simulated routine annual vaccination of 14-year olds (chosen as the oldest children reliably in-school), and an initial ‘catch-up’ campaign targeting 15–29-year olds. Both groups were subjected to the linear increase in vaccination prevalence. We simulated two other scenarios in which (a) the vaccine was only efficacious in females, and (b) the catch-up campaign was omitted.We simulated separate scenarios in which the duration of the vaccine effect was assumed to be 5 years, 10 years or lifelong. We assumed all individuals would receive only one course of immunisation during their lifetime. The simulated intervention was ongoing from 1/1/2008. Results were based on means over 200–1000 simulations.2.3We present the percentage reduction in annual HSV2 and HIV incidence in adults aged 15–49-year old after 10 and 20 years, calculated by comparing intervention and baseline scenarios, and the number of vaccinations required to avert one HIV infection over 10 and 20 years.2.4We assessed the robustness of our findings to key baseline and intervention model parameter values known to affect impact. Full details are shown in 33.13.2The effects of the interventions in terms of percentage reduction in HSV2 and HIV incidence after 10 and 20 years in the two cities are shown in Prophylactic vaccination that only reduced HSV2 susceptibility tended to have a slightly larger impact on HSV2 incidence than vaccination that only reduced HSV2 reactivation . VaccinaConversely, a vaccination that only reduced susceptibility to HSV2 infection was predicted to have a slightly smaller effect on HIV incidence than a vaccination that only reduced HSV2 reactivation . Again vAs expected, the impact on HIV incidence increased with vaccination efficacy, duration of effect, and coverage . A vacciVaccination that was only efficacious in women would have around two-third of the impact on HIV incidence of vaccination that was efficacious in both genders . OmittinThe number of vaccinations required to avert one HIV infection was much lower in Kisumu than Cotonou, because of the higher HIV prevalence in Kisumu, but it fell over time in both sites because of ongoing indirect effects . Over 20The effect of the interventions on prevalence after 20 years was smaller for HSV2 than HIV despite the larger impact of the interventions on HSV2 incidence, because HIV-infected individuals are removed more quickly from the population by AIDS mortality. Vaccination that reduced both HSV2 susceptibility and reactivation reduced HSV2 and HIV prevalence by 3–35% and 5–53%, respectively, across both cities after 20 years.3.3For HSV2 incidence, the sensitivity analysis of the effect of changing each intervention parameter value individually shows that the effect on HSV2 susceptibility had the largest effect. For HIV incidence, the effects of the vaccine on HSV2 susceptibility, clinical reactivation duration and clinical reactivation frequency were approximately as important as each other , while tAssuming a between-clinical reactivation cofactor effect, while keeping the PAF for HSV2 constant by reducing the cofactor effects during clinical reactivation, reduced the impact of vaccination on HIV incidence in both cities. This is because the vaccine was assumed not to reduce between-clinical reactivation cofactor effects, so if this contributed to the total cofactor effect, the potential benefit of simulated vaccination was reduced.Changing HSV2 clinical reactivation cofactors had larger impacts on the effects of vaccination on HIV incidence because they changed the PAF of HIV incidence associated with HSV2 . However4This study shows that HSV2 vaccination could theoretically reduce HIV incidence sufficiently for a substantial public health impact. While the largest impact on HIV incidence would be achieved if vaccination reduced both HSV2 susceptibility and reactivation, our results suggest that most of this impact would be achieved by a vaccine that only reduced susceptibility or reactivation. A larger relative impact was seen in Cotonou, the lower HIV prevalence city, because of the higher PAF for HSV2, although more vaccinations would be required to avert one infection in this lower HIV prevalence population.In addition to the direct benefit of reducing HSV2-related morbidity, our results suggest that high efficacy HSV2 vaccines could have a substantial impact on population-level HIV incidence, and lower efficacy vaccines could still have a useful impact on HIV if given at high coverage. Vaccines inducing lifelong protection would be easier to implement because vaccination could be integrated into existing childhood vaccination schedules. If vaccines had shorter durations of effect they would need to be targeted at age groups just before their highest risk of HSV2 infection, such as women under 15 years and slightly older men.The impact of HSV2 vaccination on HIV incidence and prevalence in the model is directly dependent upon the assumed strength of the relationship between HSV2 and HIV. The simulated relative risks and PAFs were in line with empirical data, but the failure of the two recent randomised-controlled trials of herpes suppressive therapy to show an impact on HIV acquisition As our sensitivity analysis showed, the impact of vaccination was somewhat dependent on assumptions about the relative importance of clinical and sub-clinical reactivations for HIV transmission . HoweverIt is important to note that the impact of a prophylactic vaccination campaign on HIV incidence over a period of time will always be smaller than the simulated PAF for HSV2 over the same time period, because prophylactic vaccination will not have a direct effect on the large proportion of individuals that are already HSV2-infected. For this a therapeutic vaccination or HSV therapy is required. Results of a trial of the impact of HSV2 therapy on HIV transmission will be available in 2009.Specific assumptions about the action and mechanism of the interventions on HSV2 were informed by the literature wherever possible, but as this intervention was hypothetical, a wide range of values was explored. Even with these ranges, it is possible that our assumptions may have been overly optimistic in terms of some parameters, such as being able to vaccinate at least 50% of 14–29-year olds over 5 years, and being able to achieve a vaccine ‘strength’ at least as large as a 30% reduction in susceptibility, clinical reactivation duration and frequency, and HSV2 infectivity.A.Wald, 8/4/2008). Most African countries should be providing affordable antiretroviral treatment (ART) within this period. ART reduces HSV2 reactivation in individuals with ART-induced reversal of immunosuppression and this is likely to reduce the impact of a potential HSV2 vaccine. However, even at high coverage, ART may not reduce HIV incidence in Africa The most optimistic estimates suggests an HSV2 vaccine will not be available for at least 10 years (pc We have presented the reductions in HIV incidence and prevalence that could be achieved through the introduction of a hypothetical HSV2 vaccination in certain scenarios. Should a vaccine become available, the real-world impact of scaled-up HSV2 interventions would be tempered by logistical constraints, but HSV2 vaccination has considerable potential as an HIV preventive intervention. Intensified efforts are needed to develop an effective vaccine against HSV2.

Current management of patients diagnosed with prostate cancer (PCa) is very effective; however, tumor recurrence with Castrate Resistant Prostate Cancer (CRPC) and subsequent metastasis lead to poor survival outcome, suggesting that there is a dire need for novel mechanistic understanding of tumor recurrence, which would be critical for designing novel therapies. The recurrence and the metastasis of PCa are tightly linked with the biology of prostate cancer stem cells or cancer-initiating cells that is reminiscent of the acquisition of Epithelial to Mesenchymal Transition (EMT) phenotype. Increasing evidence suggests that EMT-type cells share many biological characteristics with cancer stem-like cells.In this study, we found that PCa cells with EMT phenotype displayed stem-like cell features characterized by increased expression of Sox2, Nanog, Oct4, Lin28B and/or Notch1, consistent with enhanced clonogenic and sphere (prostasphere)-forming ability and tumorigenecity in mice, which was associated with decreased expression of miR-200 and/or let-7 family. Reversal of EMT by re-expression of miR-200 inhibited prostasphere-forming ability of EMT-type cells and reduced the expression of Notch1 and Lin28B. Down-regulation of Lin28B increased let-7 expression, which was consistent with repressed self-renewal capability.These results suggest that miR-200 played a pivotal role in linking the characteristics of cancer stem-like cells with EMT-like cell signatures in PCa. Selective elimination of cancer stem-like cells by reversing the EMT phenotype to Mesenchymal-Epithelial Transition (MET) phenotype using novel agents would be useful for the prevention of tumor recurrence especially by eliminating those cells that are the “Root Cause” of tumor development and recurrence. Emerging evidence suggest that most solid tumors including prostate cancer (PCa) may arise from cancer stem cells Recent studies have indicated that somatic cells can be reprogrammed into pluripotent embryonic stem-like cells by co-expression of pluripotency stem cell markers such as Oct4, Sox2, Nanog and Lin28 Epithelial to mesenchymal transition (EMT) is a vital process for morphogenesis during embryonic development, but more recently it has also been implicated in the conversion of early stage tumors into invasive malignancies M cells with EMT phenotype also shared stem-like cell signatures characterized by increased expression of transcription factor Notch1 and enhanced clonogenic, prostasphere-forming ability compared with control cells (ARCaPE cells) with epithelial phenotype. These EMT-type cells also showed decreased expression of miR-200 or let-7, and reversal of EMT by forcing expression of miR-200 significantly inhibited clonogenic and prostasphere-forming ability, which was consistent with the inhibition of Notch1 and Lin28B expression. Moreover, knock-down of Lin28B markedly increased let-7 expression, suggesting that miR-200 and let-7 could act as a target for the prevention of tumor recurrence and metastasis in PCa.Therefore, it is important to identify which factors could induce EMT and how the EMT cells could become a resource for cancer stem-like cells, which further underscores the mechanistic role of such factors toward the development of novel and targeted therapies for CRPC. Studies have shown that platelet derived growth factor (PDGF) signaling contributes to EMT M cells having mesenchymal morphology showed an increased expression of mesenchymal markers and decreased expression of epithelial markers compared to ARCaPE cells with epithelial phenotype ability of PC3 PDGF-D cells compared to PC3 Neo as well as ARCaPeo cells . The proeo cells . In ordeeo cells . ARCaPM capacity , suggestTo discover the genes regulating and maintaining the stem cell phenotype of PC3 PDGF-D cells having EMT signatures, we performed microarray to determine gene expression profiling of PC3 PDGF-D cells compared to PC3 Neo cells. We found that PC3 PDGF-D cells showed dramatic changes in expression of genes associated with EMT phenotype . InteresPolycomb group proteins are known to be involved in the regulation of gene repression through chromatin modifications, which is essential for the maintenance of the embryonic and adult stem cells M cells compared to ARCaPE cells with the self-renewal capacity of PC3 PDGF-D cells, we knocked down the expression of Sox2, Nanog, Oct4 and Lin28B by siRNA transfection using Sox2, Nanog, Oct4 and Lin28B specific siRNA. We found that knock-down of Sox2, Nanog, Oct4 and Lin28B significantly repressed prostasphere-forming ability . Furthern vivo have the signatures in the expression of genes similar to in vitro experiments, we assessed the expression of selected genes related to EMT and stem cell markers. We found down-regulation of E-cadherin and up-regulation of mesenchymal markers such as vimentin and ZEB1 in tumor tissues derived from PC3 PDGF-D cells compared with PC3 Neo control cells. Concomitantly, Lin28B, Sox2, Nanog and Oct4 as well as Notch1 expression was also significantly increased in tumors derived from PC3 PDGF-D cells, which was consistent with increased PDGF-D expression .E and ARCaPM cells were purchased from Novicure Biotechnology . ARCaPE and ARCaPM were established from bone tumor tissue derived from ARCaP cells. ARCaPE with cobblestone morphology expressed higher E-cadherin and cytokeritin 18, 19, which were associated with typical epithelial cell characters, and concomitant with lower level of vimentin expression. In contract, ARCaPM with spindle-shape fibrobastic morphology expressed more genes associated with mesenchymal markers such as increased vimentin and N-cadherin expression, and these cells also acquired drug-resistant phenotype 2-humidified atmosphere at 37°C, and genotypically characterized to support the authenticity of these cells, which was consistent with its origin.Generation of stable cell lines over-expressing PDGF-D was accomplished by transfection of PC3 cells with the corresponding empty vector pcDNA3 Neo or pcDNA3-PDGF-D:His as previously described t-Butyl Ester) was purchased from EMB Bioscience .Antibodies against slug, Oct4, Sox2, Nanog and Lin28B were purchased from Cell Signaling Technology . Antibody against EZH2 was purchased from BD Biosciences . Antibody to vimentin was acquired from Abcam (Cambridge MA). Antibodies against ZEB1, ZEB2, Stat3, E-cadherin, jagged2, delta1, delta3, delta4, Notch1, Notch2, and Notch3 were obtained from Santa Cruz . Goat anti-rabbit IgG (H + L)-HRP conjugate and goat anti-mouse IgG (H + L)-HRP conjugate were obtained from Bio-Rad . Antibody to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was purchased from Affinity BioReagents . DAPT ]-S-phenylglycine E and ARCaPM cells were collected after trypsinization, and re-suspended in the complete medium. Single cell suspensions were plated in regular 10 cm in diameter Petri dishes at the clonal density of 1,000 cells per dish. After 2–3 weeks of culture, colonies were fixed with 4% paraformaldehyde for 10 min, stained with crystal violet for additional 10 min, and washed with 1X PBS. The colonies were photographed. The colony numbers were counted using software image analysis program Scion Image downloaded from NIH website (http://www.scioncorp.com). Particle Analysis program was used for counting the colony numbers. Data was presented as relative colony number of PC3 Neo or ARCaPE designated as unit value of one.PC3 Neo, PC3 PDGF-D, ARCaPPC3 Neo and PC3 PDGF-D cells were harvested and suspended in culture medium. To make the bottom layer, 1 ml of 0.5% agarose (Invitrogen) was added to 6-well plates, and allowed to gel at room temperature. To prepare the top layer (0.25% agarose), 500 ìl of 0.5% agarose was mixed with 500 ìl cell suspension containing the 5000 cells. This mixture were overlaid above the bottom layer and allowed to solidify at room temperature. An additional 2 ml of culture medium was added after solidification to the top layer, and cells were incubated for 3 weeks at 37°C. After three weeks of growth, the colonies were photographed (40 X). The colony numbers were counted under a phase contrast microscope (40 X). Data was presented as colony numbers per field.E, ARCaPM and PC3 PDGF-D cells transfected with Sox2, Nanog, Oct4, Lin28B or control siRNA as well as miR-200 and let-7, were plated on ultra low adherent wells of 6-well plate at 1000 or 2000 cells/well in DMEM/F12 (Invitrogen) supplemented with B27 and N2 (Invitrogen). Single cell status was confirmed under microscope. Fresh medium was added every 3–4 days. After 3 or 6 days, spheres termed here as “prostaspheres” (P1) numbers were counted under microscope and the proportion of sphere-generating cells was calculated by dividing the number of cells seeded by the number of prostaspheres. Prostaspheres were photographed and the size of the prostaspheres in diameter was measured using software image analysis program Scion Image downloaded from NIH website. To confirm that prostaspheres were the progeny of individual cells rather than the aggregation of the multiple cells, the prostaspheres (P1) were collected by centrifugation (300 X g for 5 min) and dissociated with accucute (Sigma) and the cells were plated at one cell per well in 96-well plate with ultra low attachment. Single cell status was confirmed under microscope. After 12 days incubation, the prostasphere (P2) numbers were counted under a phase contrast microscope.Single cell suspensions of PC3 Neo, PC3 PDGF-D, ARCaP3VO42, 1 mM EDTA, 1 mM EGTA, and 1 X protease inhibitor cocktail. Western blotting was performed as previously described Total cell lysates from different experiments were obtained by lysing the cells in RIPA buffer containing 50 mM Tris–HCl, 150 mM NaCl, 1% NP-40, 0.1% SDS, 0.5% sodium deoxycholate, 2 mM sodium fluoride, 2 mM NaCells were transfected with 100 nmol/L of Sox2, Nanog, Oct4, Lin28B siRNA or control siRNA (Santa Cruz) as well as 20 nmol/L of miR-200 or let-7 using DharmaFECT3 siRNA transfection reagent . After 3 days of transfection, cells were split and transfected repeatedly with siRNA or miRNA every 3–4 days for indicated times. After 24 h of incubation from last transfection, the cells were collected after trypsinization and then re-suspended in DMEM/F12 (Invitrogen) supplemented with B27 and N2 (Invitrogen). The single cell suspensions were plated on ultra low adherent wells of 6-well plate (Corning) at 2000 cells/well for generation of prostaspheres. In addition, the cell lysates from cells transfected with siRNA or pre-miRNA were prepared for Western blot analysis.3 cells per well in 96-well plate and incubated for 24 h. The cells were co-transfected with Notch1 3′UTR luciferase plasmid and pre-miR-200 using DharmaFECT duo transfection reagent . After 48 h of transfection, luciferase activity was assayed using Steady–Glo Luciferase Assay System (Promega). The renilla luciferase activity was used as a control for transfection efficiency.PC3 Neo and PC3 PDGF-D cells were seeded at a density of 6×10The total RNA was isolated using the Trizol reagent. Two micrograms of RNA were transcribed into cDNA using High Capacity RNA-to-cDNA Kit according to the manufacturer's instruction. Real time PCR was used to quantify mRNA expression by using SYBR® Green RT-PCR Reagents (Applied biosystems). Sequences of primers were shown in Microarray and miRNA microarray as well as data analysis were conducted following procedures documented under supplementary materials and methods in 5) in 100 µl serum-free RPMI medium were injected subcutaneously into the right and left flanks of each mouse. As soon as the majority of the tumors began to enlarge , mice with tumor take rate of 100% were carefully monitored and tumor volume were calculated in each group by twice-weekly caliper measurements. Comparison of growth kinetics between the PC3 Neo and PC3 PDGF-D cell line using this model system, the body weight of mice in each group was also monitored. All mice were euthanized 5 weeks later after the initiation of the experiment because large tumors were formed in the PC3 PDGFD group of mice, which required termination and their final body weight and tumor volume was recorded.Male homozygous CB-17 SCID/SCID mice (8 weeks old) were purchased from Taconic Farms . The mice were maintained according to the Animal Care and Use Guidelines approved by the NIH. Mice received Lab Diet 5021 . After 1 week of acclimatization, the mice were randomized into two groups (n = 5) for our study. PC3 Neo and PC3 PDGF-D cells were harvested and re-suspended in serum-free RPMI medium. Cells containing 0.3 ml of ice-cold RIPA buffer solution with added protease inhibitors and 0.1 mM PMSF. The suspension was centrifuged at 16,000× g at 4°C for 10 min. The supernatant was collected and kept at −70°C until used for Western blot analysis.Formalin-fixed tumor tissue sections were evaluated for tumor cell morphology, mitotic rate, growth pattern, necrosis, cystic change, and inflammatory cellular response. Immunohistochemical studies were performed after staining with specific primary antibodies against E-cadherin, Vimentin and Notch1, followed by 3,3′-diaminobenzidine (DAB). Sections were visualized under an Olympus microscope and images were captured with an attached camera linked to a computer.t test. Values of p<0.05 were considered statistically significant.Experiments (in vitro) presented in the figures are representative of three or more independent repetitions. The data are presented as the mean values ± SD. Comparisons between groups were evaluated by a two-tailed student's Text S1Supplementary materials and methods.(0.04 MB DOC)Click here for additional data file.Figure S1PDGF-D levels in PC3 Neo and PC3 PDGF-D cells. Western Blot showed full length and active form of PDGF-D from PC3 PDGF-D cell lysates (A) and conditioned medium (B).(1.63 MB TIF)Click here for additional data file.Figure S2MiR-200b and miR-200c inhibited prostasphere-forming ability of PC3 PDGF-D cells. PC3 PDGF-D cells were transfected with pre-miR-200. 3 days after transfection, cells were split and transfected repeatedly with pre-miR-200 every 3–4 days for 14 days. (A) MiR-200b and miR-200c increased the numbers of prostaspheres with <100 µm in diameter and decreased the numbers of prostaspheres with >100 µm in diameter. (B) MiR-200b and miR-200c but not miR-200a reduced the size of prostaspheres.(1.66 MB TIF)Click here for additional data file.Figure S3Binding sites of miR-200b and miR-200c in 3′UTR of Lin28B or Bmi1 mRNA. Conserved, predicted binding sites for the seed sequences of miR-200b and mir-200c in the 3′UTR of Lin28B or Bmi1 mRNA were shown.(3.36 MB TIF)Click here for additional data file.Figure S4Let-7 regulated the self-renewal of PC3 PDGF-D. (A) Transfection of pre-let-7 or combination of pre-let-7 and Lin28B siRNA reduced the size of prostaspheres. (B) Transfection of pre-let-7 or combination of pre-let-7 and Lin28B siRNA increased the numbers of prostaspheres with smaller size (30–50 µm) and reduced the number of prostaspheres with bigger size (>100 µm) compared to transfection with control. **, p<0.01 compared to control .(1.75 MB TIF)Click here for additional data file.Table S1Fold change in EMT-associated genes induced by over-expression of PDGF-D in PC3 cells.(0.03 MB DOC)Click here for additional data file.Table S2Fold change in the expression of genes associated with stem-like cells in PDGF-D over-expressing PC3 cells compared to PC3 Neo cells.(0.04 MB DOC)Click here for additional data file.Table S3The levels of miR-200 and let-7 family in PC3 Neo and PC3 PDGF-D cells.(0.02 MB DOC)Click here for additional data file.Table S4Primer sequences used in real time PCR.(0.04 MB DOC)Click here for additional data file.

P=0.019), among which HPV 16, 18, and 31 were the most important. The negative predictive value of HR-HPV detection for histologically confirmed high-grade lesions was 100%. An age limit for HPV reflex testing may be motivated in cases of low-grade squamous intraepithelial neoplasia (LSIL), because of high HR-HPV prevalence among younger women. By using HPV reflex genotyping, additional extensive workup can safely be avoided in about 50% of all cases of atypical squamous cells of undetermined significance (ASCUS) and LSIL among women ⩾30 years. This screening strategy could potentially reduce the total abnormal cytology-reporting rate in the Swedish screening programme by about 1% and provide more accurately directed follow-up, guided by cytological appearance and HPV test results.The aim was to evaluate human papillomavirus (HPV) ‘reflex genotyping’ in cases of minor cytological abnormalities detected in the gynaecological screening programme in Stockholm, Sweden. Liquid-based cytology samples showing minor cytological abnormalities were analysed using HPV genotyping . Colposcopically directed cervical biopsies were obtained and the HPV test results were correlated with the histological results. In all, 63% (70/112) of the samples were high-risk (HR) HPV (HR-HPV) positive. A statistically significant correlation was found between high-grade cervical lesions and HR-HPV ( Globally, cervical cancer is the second most common cancer, after breast cancer, among women . It is uIn Sweden, significant decreases in the incidence and mortality of cervical cancer have been observed since the introduction of a population-based gynaecological screening programme in the 1960 s (Liquid-based cytology (LBC) has shown higher sensitivity for high-grade cervical lesions than conventional cytology , but has not been generally recommended in cases of low-grade squamous intraepithelial lesions (LSIL) because of a high prevalence of oncogenic HPV in this group , 4204 liquid-based consecutively obtained samples from routine screening were prepared, using the ThinPrep 2000 Processor .Minor cytological abnormalities were found in 149 (3.5%) of these samples, comprising the cytological classifications of ASCUS, atypical glandular cells of undetermined significance (AGUS), and LSIL.The cytological diagnoses were defined using the Bethesda nomenclature (P=0.028), although the samples were consecutively derived from the same screening cohort. The age range was similar for both groups: 22–58 years for ASCUS and 22–59 years for LSIL.Mean age of patients was 33 years, median age 30 years, and age range 22–59 years. Women with ASCUS were older than women with LSIL; mean ages of 35 years and 31 years, respectively . HPV-DNA detection and genotyping were performed using the Linear Array HPV Genotyping Test (LA) according to the manual provided by the manufacturer (Roche Diagnostics). Thus, HPV-DNA was amplified by PCR using a pool of biotin-labelled primers that hybridise in the L1 region. Then, HPV-DNA amplicons were chemically denatured to single-stranded DNA, hybridised with matching type-specific DNA probes, immobilized on nylon strips, and detected by colorimetric determination.55, 61, 62, 64, 67, 69, 70, 71, 72, 81, 83, 84, IS39, and CP6108. Those of undetermined risk will be considered together with the LR-HPV types -HPV types 26, 53, 66, 68, 73, and 82; and those considered to be low-risk (LR)-HPV or of undetermined risk including types 6, 11, 40, 42, 54, The ability of the HPV test to identify or exclude a high-grade cervical lesion was evaluated with the histopathology as gold standard.χ2 statistics (exact tests), and Student's t-test were used. The null hypothesis of no difference was rejected at a significance level of P⩽0.05.To determine the statistical significance of differences between groups, The primary end point was histopathologically verified CIN2+. The sensitivity, specificity, negative predictive value (NPV), and PPV of HR-HPV detection using LA to detect such high-grade lesions (CIN2+) were calculated, with 95% confidence intervals CI; .Of the 149 cases of mild cytological abnormalities studied, histopathological follow-up was obtained in 112 cases. Histology results were available for 39/56 (70%) of the ASCUS and 73/93 (78%) of the LSIL samples. These are the cases that will be discussed here later.The cytological findings in relation to the histological diagnosis in 112 women are summarised in In all, 81% (91/112) of all samples were HPV positive. There was a significant proportion of multiple infections and overlap of infections with HPV types from one, two, or all three risk categories .P=0.026).The prevalence of HPV-infected samples increased with the grade of dysplasia: 74% (43/58) of the WNL, 85% (33/39) of the CIN1, and 100% (15/15) of the CIN2+ cases were HPV positive (P=0.019). In all, 63% (70/112) of the samples were HR-HPV positive (P=0.112).positive . In thisP=0.018).In P=0.045), 18 (P=0.039), and 31 (P=0.006) with high-grade cervical lesions. Presence of coinfection with other HPV types has not been taken into consideration when performing the calculations ; however, never as a single HR-HPV infection. In this limited material, we were able to demonstrate a significant correlation between HPV types 16 of all cases, and there were no HPV 11 infections.vs 36, and 42%, respectively). However, none of these differences were statistically significant, but of course, a multiple HPV infection increases the probability of harbouring a highly oncogenic HPV type.In all, 54% (61/112) of the cases had multiple HPV infection, and of all 91 HPV-infected individuals, 67% (61/91) were infected by more than one HPV type. Multiple HPV infection was slightly more common in cases of histological CIN2+ than in CIN1 and WNL cases . Among the HR-HPV-positive samples, 41% (29/70) were infected by more than one HR-HPV type. Also in the case of HR-HPV, multiple infections were slightly more common in cases of CIN2+ than in In the Swedish population-based gynaecological screening programme, abnormal samples are associated with follow-up investigations, and clinical recommendations for the management of minor cytological abnormalities vary. In Stockholm County, all women with any degree of atypia are referred for a colposcopic examination and targeting biopsy. The question of whether HPV testing may improve the Swedish screening programme is under discussion, especially for use as a follow-up test to identify possible precancerous lesions among mild cytological abnormalities and distinguish these from reactive and degenerative lesions. This is an approach, which is widely accepted internationally (see introduction), but has only been randomly adopted in Sweden.vs 10–15%), discounting subtle changes in deference to achieving cytological certainty NPV for high-grade cervical dysplasia during a maximum follow-up time of 1 year . This isIn the LSIL group, HR-HPV prevalence is high, about 80–85%, among women younger than 30 years, and drops to about 50% among women aged 30 years, or older. For this reason, specificity of HPV detection test can be improved by setting an age limit of 30 years for HPV reflex testing in cases of LSIL . An age In cases of ASCUS, where HR-HPV prevalence is considerably lower (about 40%), and the HR-HPV prevalence was not significantly higher among women under the age of 30 years than among older women, for which reason the diagnostic value of HPV testing in this group is independent of age.Thus, in HPV triage using the LA-HPV test for all cases of ASCUS and for cases of LSIL with age ⩾30 years, the need for extensive follow-up investigations would be reduced by about 50%, with good safety. In such cases, cytological evaluation and virological analysis could be performed using the same material (reflex testing). Because there is only one sampling event, sampling error would be reduced. Screening programme costs would also be reduced, because both analyses can be performed without recalling the patient. The decision of whether to set an age limit for HPV reflex testing in LSIL cases should be based on health–economic calculations.According to our results, only the HR-HPV group had a statistically significant correlation with CIN2+, for which the HR-HPV types 31, 18, and 16 were the most important . In thisIn cases where histology findings were WNL or CIN1, more than 50% were HR-HPV positive. These women need to be followed up, given their elevated risk for developing a high-grade cervical lesion. Repeated HPV genotyping allows diagnosing persistent HPV infection and risk stratification of women with cytological abnormalities, and might be useful for clinical management (Liquid-based cytology (LBC) combined with reflex detection of HR-HPV types in cases of minor cytological abnormalities probably provides increased sensitivity and increased specificity for the detection of high-grade cervical lesions, when used in population-based screening.Based on the fact that minor cytological abnormalities constitute 75–80% of all abnormal cytological results in Sweden, our preliminary calculations show that combining LBC with HPV reflex testing in gynaecological screening reduces the total abnormal cytology-reporting rate by approximately 1%. However, LBC screening generally yields a somewhat higher abnormal cytology-reporting rate than conventional cytology screening. Conventional cytology is the predominating screening method in Sweden today, which makes the potential 1% reduction of the abnormal cytology-reporting rate uncertain. The main value of introducing LBC combined with HPV reflex testing is probably an improved ability to identify women with an increased risk of developing premalignant and malignant cervical lesions, without increasing the abnormal cytology-reporting rate. A cost–efficiency analysis is ongoing. Unnecessary investigations and unnecessary psychological stress could be avoided, and resources could be used for more accurately directed follow-up of women with abnormal cytological findings.

Tumour cells may persist at the operative site after seemingly adequate surgery. Radiotherapy is often given in an attempt to prevent repopulation, but this modality cannot be relied upon to prevent locoregional recurrence. An alternative strategy is to take advantage of the requirement of tumour cells to develop an independent blood supply and block this process to prevent recurrence.In this study, we evaluate the effect of the angiogenesis inhibitor, ZD4190, using a rodent model of residual carcinoma in deep tissues, mimicking the clinical scenario where low numbers of malignant cells persist at the operative site.5 cells in the rectus muscle and 1 × 105 in the gastrocnemius, whereas control animals developed large tumours. When more than 2.5 × 106 cells were implanted into the rectus or 1 × 106 into the gastrocnemius and treatment was maintained for 3 weeks, the carcinomas that developed in ZD4190-treated animals showed a reduced microvessel density and increased necrosis when compared with the vehicle-treated controls, but an infiltrative growth pattern was common.The tumour burden that could be eliminated was dependent on the site where the cells were implanted. Immediate treatment with ZD4190 prevented outgrowth of up to 2.5 × 10These findings suggest that antiangiogenic agents have a role to play in preventing outgrowth of residual carcinoma and are likely to be most effective when the tumour burden is minimal. Vasculap53 gene mutation. This is of clinical relevance when evaluating antiangiogenic agents as tumours lacking p53 may show reduced apoptosis and a reduced treatment response under hypoxic conditions , injecting as the needle was withdrawn and were used in accordance with institution guidelines when they were 7–8 weeks old. Two tracts of malignant squamous keratinocyte PDVC57B cells, which are syngeneic for C57Bl/6 mice and mimic the clinical problem by invading into muscle, were implanted under halothane anaesthesia using a 30-gauge needle, into each gastrocnemius muscle and five tracts were implanted into the larger rectus muscle. This cell line carries a p53 mutation at codon 231 (ATG-CTC) and an A–T transversion at codon 61 of the H-ras gene for 8–12 h. Each muscle was bisected at the midpoint and the two halves embedded, with the cut surface uppermost, and processed into wax. General tissue morphology was evaluated by the examination of haematoxylin- and eosin-stained sections. The combined area of the tumour tracts and any areas of necrosis were measured using a Leica Q500IW workstation at 40 mg kgPilot studies with antibodies recognising CD31, CD34, VWF and CD105 identified rat anti-mouse CD31, diluted 1 : 20 as the most appropriate reagent to estimate the number of blood vessels present in the tumour tracts. The secondary antibody was donkey anti-rat alkaline phosphatase diluted 1 : 200 followed by development with the alkaline phosphatase substrate kit . Sections incubated with antibody dilutant were used as negative controls. Immunolocalisation of VEGF was with goat anti-mouse VEGF , of VEGFR2 was with rabbit anti-VEGFR2 and of cytokeratins with guinea pig anti-mouse .in situ detection kit with biotinylated anti-BrdU ). Proliferating endothelial cells were scored as such when they expressed CD31 and BrdU and were associated with tubular structures. The percentage of double-stained cells was estimated by counting 200 nuclei. We did not find any evidence that PDVC57B cells expressed CD31 or of cytokeratin-positive cells lining vessels containing red blood cells, suggesting that it is unlikely that vascular mimicry was added and the optical density measured at 490 nm. Cells were also grown to 40% confluence and treated with 1–100 μM ZD4190 for 7 days and the cytopathic effect examined by staining with crystal violet.The cytotoxicity of ZD4190 for PDVC57B cells was established when 10P<0.05 was considered statistically significant.One-way ANOVA was used to compare the microvessel density (MVD) and the combined area of the tumour tracts at the midpoint of the muscles for groups of rodents treated with ZD4190 and the vehicle-treated controls. SPSS 11.1 for windows was used and a 5 PDVC57B cells were implanted to create each tumour tract, proliferating malignant keratinocytes were detected after 96 h. The tumour foci included fibroblasts and inflammatory cells, and by day 7, cords of malignant cells extended between the muscle fibres . In contrast, implanting defined numbers of malignant cells provided a reproducible way to examine the effects of an antiangiogenic agent. When 1–5 × 10e fibres . Typicale fibres . ImplantVascular endothelial cell growth factor and VEGFR2 were detected in clumps of PDVC57B cells and in the stroma at day 6. Following double staining for BrdU and CD31, proliferating endothelial cells were identified at the edge of the tumour, with vascular sprouts, chains of endothelial cell and hyperplastic vessels detected from day 8 . Approxi4 PDVC57B cells were implanted to create each tumour tract in the gastrocnemius and rectus muscles, no tumours were detected clinically for the rodents treated with ZD4190. Histological assessment of tissues at day 22 did not reveal any evidence of tumour in 16 of 20 muscles implanted with a total of 35 tracts, but rather fibrotic foci with collagen fibrils, fibroblasts and scattered inflammatory cells replaced the muscle and the rodents gavaged with ZD4190 and the fraction of the tumour area showing necrosis was increased when ZD4190-treated (22.32%±4.79) and vehicle-treated groups (4.93%±3.17) were compared (P=0.00). A similar reduction in the tumour area, and a corresponding increase in the fraction of the tumour area showing necrosis, was found for the gastrocnemius . A reduction in the MVD was apparent when the ZD4190- and vehicle-treated groups were compared were introduced into the gastrocnemius. The different microvessel densities are explained on the basis that MVD reflects the balance of pro- and antiangiogenic stimulators in the tissue environment and is not only a measure of the metabolic burden or the angiogenic dependence of the supported tumour cells , ZD4190 has the potential to prevent tumour outgrowth. The most frequent findings were fibrotic foci that represent a spectrum of change as hypoxic malignant cells die elicit an inflammatory response, phagocytes clear debris and granulation tissue is remodelled. Typically, these were associated with vascular hot spots and this enhanced blood supply may help recruit scavengers that clear any debris.We started treatment immediately after tumour cell implantation, because when treating patients it makes sense to give adjuvants early, as the growth of residual malignant cells may be stimulated when the wound bed contains many growth factors. We showed that following implantation of small numbers of malignant cells (a maximum of 5 × 104 cells implanted to create each tract), ZD4190 prevented outgrowth of most of the implanted cells. This suggests that this agent exerts its effects by blocking vasodilatation and the changes in permeability that aid the process of vessel co-option and increase diffusion of nutrients to the tumour, as well as by modulating endothelial cell proliferation. Dynamic contrast-enhanced magnetic resonance imaging of vascular changes induced by ZD4190 has shown that this agent reduces vessel permeability and modulates blood flow (in vitro, supporting the notion that the primary action is to inhibit angiogenesis mediated by VEGFR2. Some tumour nodules that developed in the ZD4190-treated rodents contained viable malignant cells. Most likely, these did not proliferate as they were too far from blood vessels to obtain adequate nutrients by diffusion. A small number of fibrotic foci also contained proliferating tumour cells, suggesting that they are able to overcome the effects of the drug, or become vascularised by pathways that do not involve VEGFR2.We did not detect endothelial cell proliferation until day 8, yet when the tumour burden was low (2–5 × 105 cells were implanted to create each tract. At day 9, the tumour area in the rectus and gastrocnemius muscles was broadly similar for the test and the control groups, although there was a reduction in the MVD of the fibrotic foci in the gastrocnemius. Most likely, the reduction in MVD is confined to tumours in the gastrocnemius as the tumour burden is less and the drug blocks any proangiogenic stimuli. However, this response does not translate into a reduction of tumour area for either muscle at this time, presumably as proliferation of the implanted cells is not critically dependent on the presence of functional new vessels.The treatment effects were different when more than 10When treatment with ZD4190 was continued for 22 days, there was a significant reduction in the tumour area, in the microvascularity and increased necrosis when the test and vehicle-treated groups were compared. This illustrates that as the tumour expands it becomes critically dependent on new vessel formation and the drug modulates the balance of pro- and inhibitory angiogenic factors, mirroring the earlier experience indicating that antiangiogenic agents are more effective when given over a longer term (ZD4190 was replaced by ZD6474 in development, as this agent has better bioavailability (

As one of the most common protein post-translational modifications, glycosylation is involved in a variety of important biological processes. Computational identification of glycosylation sites in protein sequences becomes increasingly important in the post-genomic era. A new encoding scheme was employed to improve the prediction of mucin-type O-glycosylation sites in mammalian proteins.k-spaced amino acid pairs (CKSAAP) based encoding scheme, the proposed method was trained and tested in a new and stringent O-glycosylation dataset with the assistance of Support Vector Machine (SVM). When the ratio of O-glycosylation to non-glycosylation sites in training datasets was set as 1:1, 10-fold cross-validation tests showed that the proposed method yielded a high accuracy of 83.1% and 81.4% in predicting O-glycosylated S and T sites, respectively. Based on the same datasets, CKSAAP_OGlySite resulted in a higher accuracy than the conventional binary encoding based method (about +5.0%). When trained and tested in 1:5 datasets, the CKSAAP encoding showed a more significant improvement than the binary encoding. We also merged the training datasets of S and T sites and integrated the prediction of S and T sites into one single predictor (i.e. S+T predictor). Either in 1:1 or 1:5 datasets, the performance of this S+T predictor was always slightly better than those predictors where S and T sites were independently predicted, suggesting that the molecular recognition of O-glycosylated S/T sites seems to be similar and the increase of the S+T predictor's accuracy may be a result of expanded training datasets. Moreover, CKSAAP_OGlySite was also shown to have better performance when benchmarked against two existing predictors.A new protein bioinformatics tool, CKSAAP_OGlySite, was developed to predict mucin-type O-glycosylation serine/threonine (S/T) sites in mammalian proteins. Using the composition of .Because of CKSAAP encoding's ability of reflecting characteristics of the sequences surrounding mucin-type O-glycosylation sites, CKSAAP_ OGlySite has been proved more powerful than the conventional binary encoding based method. This suggests that it can be used as a competitive mucin-type O-glycosylation site predictor to the biological community. CKSAAP_OGlySite is now available at Representing one of the most common but complicated protein post-translational modifications (PTMs), protein glycosylation is abundant in many cell surface and secreted eukaryotic proteins -3. GlycoThe detection of glycosylation sites in a query protein is very helpful to understand its biological function. Compared with the huge number of known protein sequences obtained from genomic and proteomic studies, the experimentally identified glycosylation sites are still limited. Proteomics analysis of glycoproteins by mass spectrometry (MS) is very promising to speed up the experimental identification of glycosylation sites . Meanwhii.e. the one-letter abbreviations of serine and threonine) are regarded as mucin-type O-glycosylation sites. Mucin-type O-glycosylation is commonly found in many secreted and membrane-bound mucins in mammal, although it also exists in other higher eukaryotes [N-linked and O-linked are two major types of glycosylation. N-linked glycosylation (N-glycosylation) is characterized by the β-glycosylamine linkage of N-acetylglucosamine (GlcNac) to asparagine (Asn) . It has karyotes ,9. As thkaryotes . For inskaryotes . Unlike karyotes . Considekaryotes . In the et al. used a matrix statistics method to initiate the prediction of O-glycosylation sites [A series of important prediction methods for mucin-type O-glycosylation sites have been elegantly developed. In 1993, Elhammer on sites . Subsequon sites ,13. Furton sites ,14-18. Son sites . Therefoi.e. encoding scheme) is very important in obtaining a machine learning algorithm based predictor. Generally the input for an O-glycosylation site predictor is presented by a 2n+1 residue long sequence with S or T in the center . The common position-specific features such as the standard binary encoding have been widely used as input features [The input feature vector is suitable for representing an O-glycosylation site's sequence context. The CKSAAP reflects the short-range interactions of amino acids within a sequence or sequence fragment, which has been successfully employed for the prediction of protein flexible/rigid regions [k = 0, the CKSAAP reduces to the dipeptide composition, which has been applied in diverse prediction topics in the field of protein bioinformatics [In the present study, the prediction of O-glycosylation sites was improved by seeking new encoding schemes. After evaluating different encoding schemes, it was found that the composition of regions and prot regions . When k ormatics -29. WithAc), Sensitivity (Sn), Specificity (Sp) and Matthew correlation coefficient (MCC), were jointly used to assess the performance of the proposed O-glycosylation site predictor (cf. Table i.e. 2n+1 = 19) and kmax was also optimally set as 4 . The CKSAAP encoding with a CC-based feature selection resulted in the highest accuracy in predicting O-glycosylation sites. The overall prediction accuracy (Ac) reached 83.1% for S and 81.4% for T , which is almost equal to the IE-based feature selection and slightly better than the CKSAAP encoding without feature selection and 0.608 for T . Methods based on different ratios of positive to negative sites were reported in the literature [The result based merely on balanced datasets is not sufficient to evaluate the performance of an encoding scheme because of the fact that there are much more non-glycosylation sites than O-glycosylation sites in mammalian proteins. To have a reliable evaluation of the CKSAAP encoding, the proposed predictor was also carried out using 1:5 datasets with the same window size and terature . The perThe negative dataset may contain numerous un-annotated positive sites, which is one of the major limitations of the machine learning based O-glycosylation site predictors. To remove these "potential" O-glycosylation sites within the data sets of negative sites, those with >40% identity with any positive site were discarded. The definition of the identity between two sites is detailed in the section of Datasets. Based on this strategy, some "true" negative sites with relatively high sequence identity with any positive site were filtered. Thus, it seems that only the "easy" negative sites remain in the training datasets, then one may argue that such a filtration may "artificially" result in a higher performance. To clarify this point, we performed another computational experiment by selecting negative sites without the filtration of 40% identity, and then the proposed prediction method was re-trained and assessed. As shown in Table IG was set as 0.1 and the final dimensionality is around 640–660 for S, 730–750 for T. Based on all the cross-validation tests, the top 20 k-spaced amino acid pairs after the dimensionality reduction were listed in Table The limited improvement resulted from the dimensional reduction (+0.9% for S sites and +0.1% for T sites) is probably because SVM has a good tolerance to high dimensional data. In other words, SVM is not sensitive to the so-called "the curse of dimensionality". The dimensionality reduction was able to allow us to catch a glimpse at those "important" amino acid pairs remained after the CC- or IE-based feature selection. To guarantee the 10-fold cross-validation is a real cross-validation, the rule of dimensionality reduction is strictly limited to be inferred from the training data set. In the 10-fold cross-validation, therefore, the final dimensionality is different in different SVM models. With a cut-off value of 0.1 in the CC-based feature selection, the final dimensionality are in the range from 490–510 for S and 300–330 for T. Regarding the IE-based feature selection, the cut-off of k-spaced amino acid pairs between S and T sites, the histogram of occurrences of each amino acid in the top ranked 500 k-spaced pairs was plotted in Figure k-spaced amino acid pairs is similar between S and T sites, suggesting that it is reasonable to integrate the prediction of S and T sites into one predictor. To materialize this concept, we merged the datasets of S and T sites to construct a new predictor. In this new predictor (i.e. S+T predictor), we combined central S and T to create a new amino acid type. The same encoding scheme, prediction method and performance assessment were then carried out. The new predictor was also tested in datasets with two different ratios of O-glycosylation to non-glycosylation sites (i.e. 1:1 and 1:5) and the results were summarized in Table cf. Tables To compare amino acid usage in the top ranked k-spaced amino acid pairs may strengthen our understanding on the characteristics of the sequence surrounding O-glycosylation sites. As shown in Table cf. Table Further analysis on the top cf. Table MCC value of 0.211 and 0.192 in predicting S and T sites, respectively , and the other procedures were the same as the sequence identity based filtration. After the filtration, the final positive dataset including 85 glycosylated S and 164 glycosylated T sites and the final negative dataset containing 938 non-glycosylated S and 1494 non-glycosylated T sites were obtained. The same prediction method and performance assessment were carried out on the new datasets. The results showed that the performance of CKSAAP encoding is better than the binary encoding (+4.6% and +4.1% accuracy improvement in predicting S and T sites) and machine learning method (i.e. SVM), the prediction accuracy of our method based on the binary encoding is much less impressive (about 78.0% accuracy in predicting S sites and 76.6% accuracy in predicting T sites) . Considering the middle residue in each fragment is always the same (S/T), the central position is excluded when calculating the sequence identity, meaning that only sixteen residues are maximally allowed to be identically matched in the alignment. The similar filtration method was previously used for the preparation of training datasets in the prediction of phosphorylation sites [The experimentally validated mucin-type O-glycosylation sites from mammalian proteins were extracted from the Swiss-Prot database Release 52.4), which con sites ,35. Thus.4, whichAll S and T residues in these 103 protein sequences with no annotation related to O-glycosylation site were selected as negative sites. In the present study, 1506 non-glycosylated S residues and 2529 non-glycosylated T residues were initially selected, and were further compiled into two negative datasets (Neg_S and Neg_T). Likewise, we also filtered the negative data sets using a 40% sequence identity to avoid the redundancy. Furthermore, the negative site sharing over 40% identity with any of the positive sites was also discarded. Finally, we got 1153 non-glycosylated S and 1702 non-glycosylated T residues [see Additional file k-spaced amino acid pairs (CKSAAP) based encoding, was employed. The detailed procedures are described as follows. Generally, a sequence fragment of 2n+1 amino acids is used to define a glycosylation site. For k-spaced amino acid pairs (i.e. pairs that are separated by k other amino acids) within this sequence fragment, there are 441 possible types . Then, a feature vector of that size is used to represent the composition of these pairs, which can be described asA new feature construction, the composition of m times in this fragment, the corresponding value in the vector (i.e.cAD) is equal to m. The amino acid pairs for k = 0, 1, ..., kmax are jointly considered in this study, so the total dimension of the proposed feature vector is 441 × (kmax+1).The value of each feature denotes the composition of the corresponding amino acid pair in the fragment. For instance, if an AD pair occurs n+1 residues, the central residue is always S/T, which is not necessary to be taken into account. Therefore, the total dimension of the proposed binary feature vector is 21 × 2n.To benchmark the proposed CKSAAP encoding, the prediction based on the binary encoding was also carried out. In this encoding scheme, each amino acid is represented by a 21-dimensional binary vector, e.g. A (100000000000000000000), C (010000000000000000000), ..., O (000000000000000000001), etc. For a query O-glycosylation site represented by a fragment of 2et al. [Due to the high dimensionality as well as the sparse nature of the CKSAAP encoding, the dimensionality reduction seems to be required. CC- and IE-based dimensionality reduction methods, previously reported by Chen et al. , were emX) and the known predicted variable (Y), the correlation coefficient cor is computed. The value of cor is in the range from -1 to 1. Higher value of | cor| means the corresponding variable X is more significantly correlated with Y. To reduce the dimensionality, therefore only those variables with higher | cor| were kept.For each variable from the CKSAAP based feature vector denotes the prior probability of xi. The conditional entropy of X under the condition of Y is defined asWhere {P(xi|yj) is the posterior probability of xi given the value yj of Y. Then, information gain IG(X|Y) is given byWhere IG(X|Y) indicates the additionally increased information about X provided by Y [X1 and X2) from the CKSAAP encoding, if IG(X1|Y) > IG(X2|Y), the feature Y is regarded as more correlated with X1 than X2. To reduce the dimensionality, therefore the features with higher IG are selected.The information gain ded by Y . For anyC, which controls the trade-off between training error and margin, the width parameter γ in the RBF kernel d in the polynomial kernel The SVM is a machine-learning algorithm for two classes of classification with the goal to find a rule that best maps each member of training set to the correct classification , which hi.e. Neg_S_Sub and Neg_T_Sub). Finally, the overall performance was averaged over these 5 times of 10-fold cross-validation tests. Thus, the current cross-validation generally reflected the overall performance of the proposed method over the selected data sets. The same training and testing procedures were used in assessing the binary encoding based predictor.In this study, two subsets (Neg_S_Sub and Neg_T_Sub) were randomly constructed from Neg_S and Neg_T to have the same size as Pos_S and Pos_T, respectively. Each set of Pos_S and Pos_T with the corresponding negative sets of Neg_S_Sub and Neg_T_Sub was used to construct predictors for S and T sites. Then, a 10-fold cross-validation was performed. To check the difference of predictive accuracy caused by the different choices of negative data sets, the above 10-fold cross-validation was repeated 5 times by randomly changing the negative datasets as a function of false positive rate (i.e. 1-Sp) for all possible thresholds. The AUC was also calculated to provide a comprehensive understanding for the proposed prediction method. Generally, the closer the AUC value is to 1, the better the prediction method is.The prediction accuracy was also measured by using the ROC analysis ,45. For Project Name: CKSAAP_OGlySite predictorProject home page: Operating system: Online service is web based; local version of the software [see Additional file Programming language: Perl.Other requirements: None.License: Free.Any restrictions to use by non-academics: None.YZC collected data, wrote codes and developed the web server. YRT and ZYS participated in the research design, method assessment and preparation of the manuscript. ZZ directed the research and wrote the manuscript. All authors read and approved the final manuscript.O-glycosylated S sites. This file contains the positive dataset of O-glycosylated S sites used in training and testing the proposed CKSAAP_OGlySite predictor.Click here for fileO-glycosylated T sites. This file contains the positive dataset of O-glycosylated T sites used in training and testing the proposed CKSAAP_OGlySite predictor.Click here for fileNon-glycosylated S sites. This file contains the negative dataset of S sites used in training and testing the proposed CKSAAP_OGlySite predictor.Click here for fileNon-glycosylated T sites. This file contains the negative dataset of T sites used in training and testing the proposed CKSAAP_OGlySite predictor.Click here for fileThe source code of CKSAAP_OGlySite. The data provided contain the source code of CKSAAP_OGlySite, in which a file (readme.txt) addressing how to use CKSAAP_OGlySite is included.Click here for file

The double bond adopts a Z configuration. In the crystal structure, weak C—H⋯N inter­actions link the molecules into a zigzag chain. A weak intramolecular C—H⋯N hydrogen bond is also present.In the title compound, [Fe(C DOI: 10.1107/S1600536808021843/bq2088Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

Linear basal cell carcinoma (BCC), which has a ratio of its long and short axes of more than 3: 1, is a distinct clinical entity among BCC. We report the first case report of a linear BCC in an Asian patient. An 87 year-old woman presented with an ulcerated black nodule, 15×5mm (3: 1), on her nasojungal fold of the right lower eyelid. The tumor was excised with 5 mm safety margin. The pathological examination confirmed the tumor was a BCC with a clear margin. Diagnosis of a linear BCC is based on its morphological features and occurrence along the wrinkle line, which needs to be also considered in Asian. Linear basal cell carcinoma (BCC), first reported in 1985, is a definite clinical entity among BCC and the Most linear BCC microscopically show a “nodular” subtype, and have low recurrence ,4,6, whiWe here report a case of a linear BCC that occurred on the nasojugal fold of the right lower eyelid. This is the first case report of a linear BCC involving an Asian patient.1). Her lower eyelid was everted toward the tumour because of the traction and the lateral margin of the tumour was situated to around the half of the lower eyelid. Computed tomography did not show any spread to deep orbital structures or to bone. Based on these clinical findings, a linear BCC was suspected. The tumour was excised with a 5 mm safety margin, and the traction of the skin was completely released, after which the defect of the tumour became very large . The defect was reconstructed with a cheek rotation flap for the lower eyelid area and a nasolabial VY advancement flap for the medial canthal area . The upper lacrimal outflow system could be left, and by reconstructing the lower eyelid suspending laterally, the lower eyelid slope toward nasally was made to flow the lacrimal fluid. The pathological diagnosis was “BCC (nodular type)” with a clear margin . No perineural and vascular invasion was noted. Postoperatively, although the patient felt a little epiphora, its extent was not so severe. No recurrence or metastasis was found within the following 12 months .An 87 year-old woman presented with an ulcerated black nodule, 15 x 5 mm (3: 1), on nasojugal fold of the right lower eyelid . Since tThe first choice therapy for BCC is surgical excision ; the samThis is the first report of a linear BCC in an Asian patient. Diagnosis of linear BCC is based on its morphological features and occurrence along the wrinkle line, which needs to be also considered in Asian.

In this study, we developed a novel enhancer–promoter system, κB4-CEA205, in which the basal carcinoembryonic antigen (CEA) promoter sequence (CEA205) was placed downstream of the four tandem-linked NF-κB DNA-binding sites (κB4). In combination with a κB4 enhancer, the transcriptional activity of the CEA promoter was significantly enhanced (three- to eight-fold) in cancer cell lines but not in normal cells. In cancer cell lines, the transcriptional activity of κB4-CEA205 was comparable with that of the SV40 promoter. We also constructed vectors in which the thymidine phosphorylase (TP) cDNA was under the control of CEA205, κB4, κB4-CEA205 and CMV promoters, respectively. TP protein and enzyme activity were detected at comparable levels in κB4-CEA205- and CMV-driven TP cDNA-transfected cancer cell lines (H630 and RKO). The κB4-TP and CEA205-TP-transfected cell lines, respectively, only demonstrated negligible and low levels of TP protein and enzyme activity. Both CMV- and κB4-CEA205-driven TP cDNA transiently transfected cells were 8- to 10-fold sensitised to 5-fluorouracil (5-FU) prodrug, 5′-deoxy-5-fluorouradine (5′-DFUR), in contrast to only 1.5- to 2-fold sensitised by the κB4- and CEA205-driven TP cDNA-transfected cells. The bystander killing effect of CMV- and κB4-CEA205-driven TP cDNA-transfected cells was comparable. This is the first report that indicates that the NF-κB DNA-binding site could be used as a novel cancer-specific enhancer to improve cancer-specific promoter activity in gene-directed enzyme prodrug therapy.Nuclear factor-kappa B (NF- Lack of selectivity for malignant cells leading to dose-limiting toxicity is one of the major obstacles for the success of cancer chemotherapy. Gene-directed enzyme prodrug therapy (GDEPT) is potentially an elegant way to improve the therapeutic index of active anticancer drugs, but one of the major limitations for the clinical application of this approach is the lack of strong cancer-specific promoters is not expressed in normal and overexpressed in epithelial cancer cells . Four ciκB) (κB (IκB) to influence downstream gene expression. κB site is a strong cis-acting enhancer sequence possessing very weak transcriptional activity on its own. In cells with high NF-κB activity, κB enhancer specifically magnifies relevant promoter activity in a cis-acting manner . NuclearκB (IκB) . All of in vivo by a three-enzyme-catalysed process. Capecitabine is converted to 5′-DFCR and then to 5′-deoxy-5-fluorouradine (5′-DFUR) by carboxylesterase and CD, respectively. Both conversions take place in liver and are not limiting steps for efficient conversion of CAP to 5-FU. The final and critical step is the conversion of 5′-DFUR to 5-FU by thymidine phosphorylase (TP). In comparison with normal cells, cancer cells express relatively higher levels of TP. The TP expression contrast between cancer and normal cells would potentially enable the enrichment of 5-FU in tumour cells, while reducing the exposure of normal tissues to 5-FU. However, TP is only detected in 24–66% (in vitro and in vivo (Capecitabine (CAP), a prodrug of 5-FU , has beeκB-CEA enhancer–promoter system (κB4-CEA205), which demonstrated high cancer-specific transcriptional activity. Transfection of TP cDNA driven by the NF-κB-CEA enhancer–promoter cassette highly sensitised CRC cell lines to 5′-DFUR in vitro.Based on our understanding of the molecular biology of cancer, in this study, we used a non-virus expression system to develop a strong and highly cancer-specific NF-−1 penicillin and 50 μg ml−1 streptomycin. Normal human mammary epithelial cells were cultured in MEGM medium (Clonetics CC-3051) supplemented with BPE, hEGF, insulin and hydrocortisone. The human primary endothelial cells were cultured in EBM-2 medium (Clonetics CC-3156) supplemented with hFGF-B, VEGF, hEGF and 2% FCS. The normal human nasal epithelial cells were cultured in the AECGM medium with SupplementMix (PromoCell C-39165). The primary cells were subcultured and maintained according to the instructed culture system from the suppliers. Human endothelial cell line EAhy926 was kindly provided by Dr Angel Armesilla and cultured in RPMI 1640 medium supplemented with 10% FCS, 50 U ml−1 penicillin and 50 μg ml−1 streptomycin. Thymine, thymidine, 5′-DFUR and tetrazolium-based semiautomated colorimetric (MTT) were purchased from Sigma .The human CRC cell lines HT29, HCT15, HCT116, LoVo, Caco2, DLD-1 and RKO were obtained from ATCC. H630 were generously provided by Professor PG Johnston (University of Belfast). Cancer cell lines were cultured in DMEM medium supplemented with 10% fetal calf serum (FCS), 50 U mlκB enhancer elements. As shown in cis-acting elements, respectively. The BglII and HindIII restriction sites were introduced into the forward and reverse primers, respectively. The primers used were as follows (the underlined: restriction sites). CEA205: forward 5′-GCGCAGATCTGAAAATAGAAGGGAAAAAAG-3′ and reverse 5′-GCGCAAGCTTGAGTTCCAGGAACGTTT-3′; CEA421: forward 5′-GCGCAGATCTAGAGCATGGGGAGACCCGGGA-3′ and reverse 5′-GCG CAAGCTTGGTCTCTGCTGTCTGCTCTGTC-3′. The PCR fragments were subcloned downstream of four tandem NF-κB-binding sites replacing the TATA-like promoter fragment into a commercially available pNF-κB-Luc vector . To produce the pκB4-Luc vector without the essential promoter sequence, the TATA-like promoter sequence was removed by restriction enzyme cutting and the backbone plasmid DNA was blunt-ended using DNA polymerase Klenow fragment and religated. To produce expression vectors without the NF-κB enhancer, the κB-binding sites in pκB4-CEA205-Luc and pκB4-CEA421-Luc were removed and the backbones religated as described above. Thymidine phosphorylase cDNA (pCMV6-XL5/TP) was purchased from Origene . Thymidine phosphorylase cDNA was subcloned into pcDNA3 using EcoRI/XbaI to develop pcDNA3-TP in which TP cDNA is under the control of CMV promoter. To develop TP expression vectors for transient transfection, the luciferase cDNA in the above luciferase reporter gene expression vectors was replaced with TP cDNA derived from pcDNA3-TP by HindIII/XbaI cutting. For stable expression of TP in CRC cell lines, the CEA205-TP and κB4-CEA205-TP fragments were subcloned into a pFastBacDual vector from which the p10 and polyhedrin promoters have been removed . The integrity of the sequences of the constructs was verified by DNA sequencing.The human CEA promoter cDNA (pDRIVE-hCEA) purchased from InvivoGen was subcloned by polymerase chain reaction (PCR). The CEA basal promoter sequences in this paper are numbered relative to the middle nucleotide of the first ATG was mixed with 90 μl of reaction buffer consisting of 10 mM thymidine, 10 mM KH2PO4 (pH 7.4). The reaction was incubated at 37°C for 2 h and terminated by addition of 400 μl of 0.2 N NaOH. The concentration of thymine converted from thymidine was measured spectrophotometrically at 300 nm. The amount of thymine in the reaction was calculated from a standard curve plotted from known thymine concentrations. Thymidine phosphorylase activity was presented as nmol thymine/mg protein/hour.The TP enzyme activity was assayed using the method published by μg/cell line) was electrophoresed through a 10% SDS-PAGE and transferred to a PVDF membrane using a semi-dry electrophoretic transfer chamber (Millipore). Nonspecific binding was blocked by incubating the membranes for 1 h in TBS-T with 5% non-fat milk, which was also used to dilute primary and secondary antibodies. The signal was detected using an ECL Western blotting detection kit (Amersham), and visualised by exposure to X-ray film.Total protein was extracted in RIPA buffer. The lysate was centrifuged for 5 min in a microfuge and the supernatants retained. The protein (200 Cells (70% confluent) cultured in 25 cm flasks were harvested by trypsinisation. Total RNA was isolated using TRIzol reagent according to the manufacturer's protocols. The CEA mRNA expression levels in different cell lines were determined using the Access RT–PCR System following the instruction of the supplier. The CEA-specific primers were designed from human CEA DNA sequence (GenBank ID: M17303). The forward (5′-CGC CAA AAT CAC GCC AAA TAA TAA-3′) and reverse (5′-ACC CCA ACC AGC ACT CCA ATC AT-3′) primers were used to amplify a 171 bp PCR product. The human housekeeping gene GAPDH (GenBank ID: XR018317) was used as the RNA loading control, which was amplified by the same RT–PCR system using the following primers, forward: 5′-CATGACAACTTTGGTATCGTG-3′; reverse: 5′-GTGTCGCTGTTGAAGTCAGA-3′. The RT–PCR amplification conditions were as follows. One cycle at 48°C for 45 min; 1 cycle at 94°C for 2 min; 35 cycles at 94°C for 30 s, 60°C for 30 s, 72°C for 1 min; 1 cycle at 72°C for 5 min. The RT–PCR products were separated on a 1% agarose gel and the bands visualised and photographed under UV light.in vitro cytotoxicity analysis, the overnight-cultured cells (5000/well in 96-well flat-bottomed microtiter plates) were constantly exposed to 5′-DFUR for 72 h and then subjected to a standard MTT assay as previously described -transfected cells, respectively, were exposed to 5′-DFUR and subjected to MTT analysis. The IC50s of 5′-DFUR were calculated.For Stable transfection Colorectal cancer cell lines (1 × 106/well) were cultured in six-well plates overnight and transfected with pFastBacDualΔpromoter/κB4-CEA205-TP using Lipofectamine 2000 following the manufacturer's instructions. The pFastBacDual empty vector-transfected cells were used as a negative control. The successfully transfected clones were selected in G418 (1 mg ml−1). After TP enzyme activity assay and Western blotting analyses, the positive clones were selected and cultured in G418-containing medium to enlarge the cell population. Two positive clones were subjected to further analysis.Transient transfection H630 and RKO cells (2 × 106/flask) were cultured in 25 cm tissue culture flasks overnight and transfected with pcDNA3, pcDNA3-TP, pκB4-TP, pCEA205-TP and pκB4-CEA205-TP using Lipofectamine 2000 following the manufacturer's instruction. After 48 h transfection, the transfected cells were collected and split for MTT, Western blotting and TP activity assays, respectively.4/well cells were cultured in 24-well plates overnight. The luciferase reporter vectors were co-transfected with 0.008 μg well−1 pSV40-Renilla DNA, an internal control for normalisation of the transcriptional activity of the reporter vectors. Forty-eight hours after transfection, the cells were lysed and luciferase activities were determined using Dual Luciferase Assay reagents according to the manufacturer's instructions. The luciferase activity in each well was normalised to pSV40-Renilla using the formula of Ln=L/R . The Ln was further standardised by the transcriptional activity of the pGL3-Basic using the formula of RLU=Ln/pGL3-basic (RLU: relative luciferase unit). All transfections were performed in triplicate and all experiments were repeated at least twice.All transfections were performed using Lipofectamine transfection reagent according to the instruction of the manufacturer . Briefly, 5 × 10κB-CEA enhancer–promoter system in 5′-DFUR prodrug based GDEPT, it is essential to determine the background status of TP (protein and enzyme activity), CEA (mRNA and protein) and NF-κB in cancer and normal cells. In a panel of eight CRC cell lines, only two (LoVo and HCT116) expressed the 55 kDa TP protein at moderate levels (25%). No TP protein expression was detected in the remaining six CRC and normal endothelial and epithelial cells in tandem (κB4). There are four cis-acting DNA-binding sites located within −303 to −143 base pairs of the CEA promoter region. The transcription factors Sp1, Sp1-like and USF bind to the first three DNA-binding sites and the transcription factors for the fourth element are still not clear and chimeric enhancer–promoter elements (κB4-CEA205 and κB4-CEA421) were examined in CRC and normal human endothelial and epithelial cells. As showed in κB4, the transcriptional activity of both CEA205 and CEA421 in cancer cell lines was enhanced. The κB4 enhancer demonstrated a significantly greater enhancing effect on the CEA205 promoter than on the CEA421 promoter from each transfection was subjected to luciferase assay. The transcriptional activity of κB4-CEA205 enhancer–promoter system was highly comparable to that of the strong SV40 virus promoter in all CRC cell lines with low TP expression were transiently transfected with pκB4-TP, pCEA205-TP, pκB4-CEA205-TP, pcDNA3-TP or pcDNA3 empty vector. After 48 h transfection, the cells were harvested and subjected to different analysis. High levels of TP protein were detected in both pcDNA3-TP- and pκB4-CEA205-TP-transfected cells. Only very low levels of TP protein were detected in the pCEA205-TP-transfected cells and no TP protein was detected by Western blotting analysis in the pcDNA3- and pκB4-TP-transfected cell lines or pcDNA3-TP. Two positively transfected clones were selected from each cell line for further study. The TP protein expression and TP enzyme activity in the pFBD/KCT-transfected cell lines were high and comparable with that in the pcDNA3-TP-transfected cells were exploited as a cancer-specific enhancer to improve the transcriptional activity of the CEA promoter. The enhancing effect of κB4 on the transcriptional activity of two basal CEA promoters covering the first three (CEA205) and four (CEA421) DNA-binding sites on the CEA promoter region was examined. Both promoters demonstrated comparable transcriptional activity, which was further enhanced by κB4 in CRC cell lines. In comparison with that on CEA421, the κB4 enhancer demonstrated stronger enhancing effect on CEA205 promoter promoter region (κB and Sp1 in the HIV-1 LTR is highly space and orientation-dependent. The promoter activity is significantly impaired by the insertion of DNA fragments between the κB- and Sp1-binding sites. Mutation of the adjacent κB and Sp1 DNA-binding sites completely abolishes the phorbol myristate acetate inducible transcriptional activity (κB enhancer (κB and Sp1 needs direct contact of both proteins and other transcription modulators (κB and Sp1 may also play a role in our κB4-CEA205 enhancer–promoter system. The κB4 enhancer demonstrated higher enhancing effect on CEA205 than CEA421 in most CRC cell lines (κB4 and the 5′ Sp1 in κB4-CEA205 and κB4-CEA421 fragments was 29 and 250 nt, respectively. The spatial rule may also partially apply to the enhancer–promoter systems in this study. Sp1 is a common element in cancer-specific promoters, for example CEA, survivin and hTERT (κB4 also improved the transcriptional activity of hTERT promoter. Therefore, investigation of the relationship between κB4 and Sp1 might provide evidence for using κB4 to improve the transcriptional activity of other cancer-specific promoters.The molecular mechanisms of enhancing effect of dulators . Therefoll lines . The disin vitro study using NF-κB DNA-binding site as a cancer-specific enhancer element to improve the cancer-specific transcriptional activity of CEA promoter. The in vivo investigation needs to be carried out to use this enhancer system for GDEPT approach.The lack of strong cancer-specific promoter system remains one of the major obstacles for the clinical success of GDEPT. This is the first

The use of musculoskeletal ultrasound (MSUS) in the diagnosis and management of foot and ankle musculoskeletal pathology is increasing. Due to the wide use of MSUS and the depth and breadth of training required new proposals advocate tailored learning of the technique to discrete fields of practice. The aims of the study were to evaluate the inter-observer agreement between a MSUS radiologist and a podiatrist, who had completed basic skills training in MSUS, in the MSUS assessment of the forefoot of patients with Rheumatoid Arthritis.A consecutive sample of thirty-two patients with rheumatoid arthritis was assessed for presence of synovitis, erosions and bursitis within the forefoot using MSUS. All MSUS assessments were performed independently on the same day by a podiatrist and one of two Consultant Radiologists experienced in MSUS.Moderate agreement on image acquisition and interpretation was achieved for bursitis and erosions and fair agreement for synovitis during the primary assessments. Following a further training session, substantial agreement (kappa 0.702) between the two investigators was recorded. The sensitivity of the podiatrist using MSUS was 82.4% for detection of bursitis, 83.0% for detection of erosion and 84.0% for detection of synovitis. Specificity of the podiatrist using MSUS was 88.9% for detection of bursitis, 80.7% for detection of erosion and 35.9% for detection of synovitis.This study demonstrated good inter-observer agreement between a podiatrist and radiologist on MSUS assessment of the forefoot, particularly for bursitis and erosions, in patients with rheumatoid arthritis. There is scope to further evaluate and consider the role of podiatrists in the MSUS imaging of the foot following appropriate training and also in the development of reliable protocols for MSUS assessment of the foot. As technology has improved, clinical expertise in performing musculoskeletal ultrasound (MSUS) has also advanced dramatically ,2. The aThere have been a number of studies that have utilised MSUS to diagnose specific soft tissue foot pain in healthy volunteers -5 and soMSUS is, however, affirmed as being highly operator dependent . The proModels for the use of MSUS by clinicians other than radiologists, have been demonstrated ,16 and sThis study provided an opportunity to evaluate the inter-observer agreement between a radiologist and podiatrist who had followed recommended training guidelines for MSUS, in the MSUS assessment of the forefoot of patients with RA. This work forms part of an ultrasound based research programme investigating the clinical relevance of soft tissue inflammation within the forefoot of patients with RA.The initial approach for recruitment was based upon potential participants with rheumatoid arthritis diagnosed according to the American College of Rheumatology (ACR) criteria, and starPrior to data collection, the diagnosis of RA was confirmed by the supervising rheumatology consultant using the ACR criteria. Following acceptance into the study all participants were assessed by a trained specialist rheumatology nurse and Disease Activity Scores (DAS28) were calculated .Data collection took place between March 2004 and August 2007. On each occasion, the same treatment bays and ultrasound facilities were utilised in an attempt to standardize environmental factors, i.e. room temperature and scanning positions. All investigators performing MSUS were blinded to the other's results in order to minimize the risk of bias.General demographic data of age, gender, disease duration, presence of rheumatoid factor, weight and limb dominance were obtained from the clinical notes and rheumatology department database. Clinical characteristics included visual analog scale (VAS 100 mm) assessment for the patient's global impression of health and disease activity and the number of painful, tender and swollen joints calculated as DAS28.The presence and location of any bursitis , was used by the podiatrist. The Diasus scanner operates as a system with dual probe, but for the study, a L5–10 MHz 26 mm ultra wideband linear array probe was used.A Philips HDI 5000 System was used by the radiologists . The Philips system also operates with broadband linear probes and in order for direct comparisons to be made within the study a L5 – 12 MHz probe was used.The Podiatrist attended the BSR (British Society for Rheumatology) core MSUS course that is organised by experts in MSUS providing hands on experience at different levels of basic, intermediate and advanced specifically for non-radiologists within the UK . MSUS prOn the same day the MSUS foot scans were performed independently and without access to the clinical findings by the podiatrist and one of two Consultant Radiologists experienced in MSUS Table . ScanninAt the end of the data collection period, a consensus meeting took place between one of the radiologists and the podiatrist. During this meeting, all archived study images recorded by the Diasus ultrasound system were reviewed and discussed and confirmed by the radiologist as being bursitis, synovitis, erosion, or normal.Following the consensus meeting, thirty six images were randomly selected from the Diasus ultrasound system archived data by an independent research assistant. All thirty six images were numbered, logged and the sequence for image viewing was randomized in an unrestricted random method of allocation by the research assistant. Both the primary investigator and consultant radiologist were blinded to the image selection procedure.The two investigators independently scored all 36 images for the presence of bursitis, synovitis, erosion or normal and both were blind to each others findings.Data evaluation and statistical analysis were performed using SPSS version 14.0 software . The data was initially examined using histograms and scatter plots to identify 'outliers' that may have occurred due to data entry bias or normal biological outliers.Inter-observer agreements were calculated by overall agreement (percentage of observed exact agreement) and kappa statistics . Sensitivity and specificity of the podiatrist's results were calculated from cross-tabulation against the radiologist's results as the gold standard.Thirty two patients with RA were recruited. One patient withdrew due to time issues during the visit. Thirty one patients completed the study. There were 24 female and 7 male patients, 12 seronegative and 19 seropositive. The mean age was 59.58 (SD 10.1) years and all patients had active disease with mean DAS scores of 5.8 (SD 0.9) Table .Overall agreement was 83.3% for presence or absence of bursitis, 81.8% for presence or absence of erosion and 68.3% presence or absence of synovitis. Kappa scores for from the primary data revealed moderate agreement for bursitis and erosions and fair agreement for synovitis .The sensitivity of the podiatrist using MSUS was 82.4% for detection of bursitis, 83.0% for detection of erosion and 84.0% for detection of synovitis. Specificity of the podiatrist using MSUS was 88.9% for detection of bursitis, 80.7% for detection of erosion and 35.9% for detection of synovitis.Following the consensus meeting and test on a randomised selection of thirty six images from the DIASUS machine, good levels of agreement were achieved between the podiatrist and radiologist for 8/9 bursitis, 4/10 synovitis, 6/9 erosion, 8/8 normal images .The use of MSUS assessment of the foot and ankle in clinical practice would be beneficial to patients with RA in facilitating more effective timely referral and management of foot problems. This is the first study to investigate tailored learning of MSUS to the discrete field of foot and ankle practice in evaluating the inter-observer agreement in the use of MSUS between an allied health professional (podiatrist) and an expert radiologist on imaging of the foot. We have demonstrated good agreement for bursitis and erosions, but only fair agreement for the presence of synovitis.Competency assessment in MSUS is an important issue . UsuallyIn our study overall exact agreement between the radiologist and podiatrist was recorded as 83.3% for bursitis, 68.3% for synovitis and 81.8% for erosions. Acceptable sonographic images were obtained by the podiatrist with moderate agreements for bursitis and erosions . Low agreements for synovitis were obtained initially, however following further training, levels of agreement for all three variables increased to a good standard .Within the MSUS literature the foot is under-investigated and those who have reported on assessments of the foot joints have observed similar low agreement scores for synovitis -28. InteThe use of MSUS by the podiatrist within this study did reveal good sensitivity and specificity for detecting forefoot bursitis (82.4% and 88.9%) and erosion (83.0% and 80.7%), although in detection of MTP synovitis sensitivity was good, specificity was low (84.0% and 35.9%) with over-reporting of false positives. As reported by others we did eA number of potential limitations within this current study should be acknowledged. The prevalence of synovitis, erosion and bursitis within the forefoot was not validated by any other 'gold standard' imaging technique such as MRI. Other authors have not attempted to address this issue either although results from the OMERACT MSUS special interest group highlighted the need to consider comparison of MSUS data with histology and MRI . MRI howThis study was the first to attempt to investigate inter-observer agreement in the use of diagnostic ultrasound between an allied health professional (podiatrist) and an expert radiologist. Performance of MSUS in image acquisition and interpretation by the podiatrist was of an acceptable standard during the primary investigation and following further training levels of agreement increased to a good standard. The foot is a complex structure with many small joints and podiatrists are well placed to be involved in its MSUS assessment, however we have highlighted the importance of appropriate training and further mentorship from experts in MSUS imaging techniques. Finally, we have recommended that further work is undertaken in establishing reliable protocols for MSUS assessment of the foot.MSUS: Musculskeletal ultrasound; MRI: Magnetic Resonance Imaging; MTPJ: Metatarso-phalangeal joint; RA: Rheumatoid Arthritis; ACR: American College of Rheumatology; TNF: Tumour necrosis factor; DAS28: 28 joint Disease Activity Score; VAS: Visual Analog Scale; BSR: British Society for Rheumatology; RCR: Royal College of Radiologists; EULAR: European League Against Rheumatism; SD: Standard Deviation; OMERACT: Outcome Measures in Rheumatology Clinical Trials.No benefits in any form have been received or will be received from a commercial party related directly or indirectly to the subject of this article.The authors declare that they have no competing interests.All authors read and approved the final manuscriptCB conceived of the study and participated in its design, coordination and collection of clinical variables, MSUS assessments and writing of the manuscript. KD participated in the design of the study, MSUS assessments, consensus meeting and helped to draft the manuscript. MS participated in the MSUS assessments, and helped to draft the manuscript. SS participated in study design and coordination. JB participated in the design of the study and helped to draft the manuscript. CE participated in the design of the study, coordination, confirmation of RA diagnosis and helped to draft the manuscript. NA participated in the design of the study, coordination and helped to draft the manuscript.

BRCA1 germline mutations have an increased sensitivity to DNA damaging chemotherapeutic agents, such as cisplatin, due to defective DNA repair. Thus, inhibiting BRCA1 in sporadic EOC using novel targeted therapies is an attractive strategy for the treatment of advanced or recurrent EOC. Several classes of small molecule inhibitors that affect BRCA1 have now been tested in preclinical and clinical studies suggesting that this is a rational therapeutic approach. The aim of this paper is to provide an understanding of how BRCA1 has evolved into a promising target for the treatment of sporadic disease and to outline the main potential small molecule inhibitors of BRCA1 in EOC.In sporadic epithelial ovarian cancer (EOC), the inactivation of BRCA1 through various mechanisms is a relatively common event. BRCA1 protein dysfunction results in the breakdown of various critical pathways in the cell, notably, the DNA damage response and repair pathway. Tumors from patients with Breast Cancer 1 (BRCA1) and BRCA2 [BRCA1 tumor suppressor gene codes for a 220 kD nuclear phosphoprotein which has been shown to be involved in many cellular processes such as cell cycle checkpoint control, DNA damage recognition and repair, apoptosis, the ubiquitin-proteasome pathway, and transcriptional regulation [Up to 10% of epithelial ovarian cancers (EOCs) are caused by germline mutations in the tumor suppressor genes, nd BRCA2 . The majnd BRCA2 –6. The Bgulation –10. BRCABRCA1 are believed to display a better response to platinum-based therapies and improved survival compared to patients without BRCA1-associated disease [BRCA1 gene therapy is provided as well as an overview of the preclinical and clinical studies on the most relevant small molecular inhibitors, poly(ADP-ribose) polymerase-1 (PARP), histone deacetylases (HDAC), checkpoint kinases (CHKs), and proteasome inhibitors in the context of how these agents alter the BRCA1 pathway to enhance sensitivity to platinum-based chemotherapy. Finally, the potential for clinical use of BRCA1 as a biomarker in EOC is reviewed.Ovarian cancer patients with tumors known to harbor a germline mutation in disease . BRCA1 dBRCA1. In preclinical efficacy studies in mouse xenograft models, this new vector was found to be minimally immunogenic and increased survival compared to both the control vector and the first generation vector used in the Phase II trial [The first efforts to target BRCA1 in EOC involved restoring BRCA1 function via gene therapy . In its II trial . No clinVector reconstitution, in an attempt to regain normal function of BRCA1, has never proceeded to Phase III study. Thus, attention has recently focused on taking advantage of the inherent weakness of BRCA1-deficient tumor cells, namely, the inability to effectively repair DNA damage.+) substrate. They play a critical role in the repair of single-stranded DNA breaks (SSBs) via the base excision repair (BER) pathway and inhibition of PARP results in failure of SSB repair. Unrepaired SSBs which encounter a DNA replication fork result in double-strand breaks (DSBs). Normal cells are able to repair DSBs via the homologous recombination (HR) DNA repair pathway. However, cells with defective BRCA1 are unable to repair DSBs due to defective HR repair and are forced to use the error-prone nonhomologous end-joining (NHEJ) pathway. The ensuing genomic instability ultimately results in cell death . The PARll death . This abBRCA-null cells was published simultaneously by two different groups in 2005 [BRCA2-null V-C8 cells were extremely sensitive to PARP1 inhibitors of varying potency and that this was likely due to their inability to execute effective HR repair. Farmer et al. also demonstrated similar findings in BRCA2−/− mouse embryonic stem (ES) cells, as well as BRCA1−/− ES cells. Treatment of V-C8 and BRCA-null ES cells with PARP inhibitors resulted in an increase in chromosomal instability, cell cycle arrest, and apoptosis. The results of the in vitro studies were validated in vivo by creating xenograft mouse models using the same V-C8 and BRCA2-null ES cell lines. It was consistently found that treatment of the mice with PARP inhibitors blocked the growth of BRCA-null tumors but had no significant effect on reconstituted BRCA control tumors.The first preclinical work to demonstrate susceptibility to PARP inhibitor-induced cytotoxicity in in 2005 , 17. BryBRCA1 status. One study looked at a PARP-1 inhibitor, 3-aminobenzamide, and found increased cisplatin cytotoxicity in CH1cisR cisplatin-resistant ovarian tumor cells [PARPi have also been shown to enhance the cytotoxicity of platinum-based agents in vitro and in vivo, irrespective of or cells . A novelor cells . CombinaBRCA-mutant and BRCA-deficient breast cancer models. Donawho et al. used a BRCA1-deleted and a BRCA2-mutated MX-1 breast carcinoma xenograft mouse model to perform the in vivo evaluation of the Abbott Cancer Research PARPi, ABT-888. [There are preclinical data evaluating the combination of PARPi and platinum-based agents in both ABT-888. . ABT-888ABT-888. , 22. In ABT-888. . SynergiBRCA1/2-mutant breast and ovarian cancers have recently generated interest as a potential therapeutic option in the treatment of cancer, having demonstrated their ability to inhibit the proliferation of cancer cell lines in vitro and in vivo . HistoneHDACi may have a significant effect on the sensitivity of EOC tumors to DNA-damaging agents. Zhang et al. performed a gene expression profile on squamous carcinoma cells and observed that most genes involved in cell cycle control, DNA replication, and DNA damage repair were downregulated when treated with Trichostatin A (TSA) . Our groSAHA (vorinostat) has been approved for the treatment of cutaneous T-cell lymphoma and subsequently, a number of clinical trials are currently underway to evaluate the toxicity and dose of HDACi in solid tumors, including ovarian cancer Tables and 2. A Following DNA damage, BRCA1 is involved in the control of cell cycle checkpoints, which represents another potential mechanism to target BRCA1 therapeutically. Two genes involved in this aspect of the DNA damage cascade are Checkpoint Kinase 1 and 2 (CHK1 and CHK2). CHK1 is activated by ATR in response to stressors such as replication stress, chemotherapeutic agents, and SSBs; whereas CHK2 is activated by ATM in response to ionizing radiation, chemotherapeutics, or DSBs . Activatp53-wildtype cells. A phase I clinical trial of UCN-01 in combination with topotecan was performed in patients with advanced solid tumors, including a significant proportion of EOC [Husain et al. found that the CHK inhibitor UCN-01, a staurosporine derivative, potentiated the cytotoxicity of cisplatin in a panel of ovarian cancer cells, with a notable increase in apoptosis . Furthern of EOC . This trn of EOC . The effBRCA1 is known to have a role in the ubiquitin-proteasome proteolysis pathway, whereby damaged and misfolded proteins are tagged with a polyubiquitin chain and targeted for ATP-dependent degradation by the 26S proteasome [BRCA1 contains a zinc ring finger domain in its amino-terminal region which has E3 ubiquitin ligase activity and aids in the transfer of ubiquitin to the target substrate. Mutations in the RING finger domain of BRCA1 are thought to predispose to the development of cancer because they abrogate ubiquitin ligase activity [oteasome . BRCA1 cactivity . It has β-actones, which prevent the degradation of ubiquitinated proteins. Several groups have demonstrated that the treatment of ovarian cancer cell lines with a proteasome inhibitor in combination with cisplatin treatment increased the cytotoxicity of platinum drugs, increased DNA damage and inhibited repair. Mimnaugh et al. pretreated ovarian cancer cells with either ALLnL or lactacystin proteosome inhibitors prior to cisplatin treatment and observed an abrogation in the expected increase in excision repair cross-complementation group 1 (ERCC1) expression with cisplatin and more efficient apoptosis [Proteasome inhibitors include compounds such as peptide aldehydes, boronates, and epoxyketones as well as poptosis . The sampoptosis . They obpoptosis . They agpoptosis .Based on the preclinical results, proteasome inhibitors, namely, PS-341, have entered into clinical trials, including studies in EOC. In a Phase I trial examining a combination of carboplatin and PS-341 in recurrent EOC, an overall response rate of 47% was observed, including two patients demonstrating a complete clinical response, one of whom had platinum resistant disease . AnotherA range of preclinical studies using both in vitro and in vivo models have supported the association of low BRCA1 mRNA and protein expression with an enhanced sensitivity to platinum agents , 49. An BRCA1 tumor suppressor gene have an improved initial response to treatment with platinum-based chemotherapy regimens and have an improved overall survival [BRCA1 promoter [EOC patients with germline mutations in the survival . Severalpromoter . Recent promoter . IHC waspromoter , with a promoter –60. The The group of Quinn et al. was the first to report that decreased BRCA1 mRNA expression by quantitative RT-PCR in tumors from patients with sporadic EOC who received platinum-based chemotherapy was predictive of an improved overall survival . Our recA consistent finding in the few studies on human EOC tumors is that BRCA1 mRNA and protein are frequently expressed at low levels within cell nuclei relative to the commonly used positive tissue control MCF7, a breast cancer cell line. This may represent a potential challenge in utilizing BRCA1 as a clinically useful predictive marker. Distinguishing “high” expressors from “low” expressors can be particularly difficult, especially at the protein level via IHC, where the scoring method is usually qualitative. Quantitative methods such as analysis of mRNA levels may provide more accurate results and could facilitate differentiating between true high and low expressors in a population where baseline levels are low. Considerable success using this method has been achieved in the use of BRCA1 as a predictive marker in nonsmall cell lung cancer (NSCLC) .BRCA1 mutation-associated EOC, but to the large proportion of patients with sporadic disease with tumors that display BRCA1 deficiency due to epigenetic changes. Furthermore, as BRCA1 shows promise as a prognostic and predictive marker in sporadic EOC, patients identified as being high expressors could be treated with agents that downregulate BRCA1, thus sensitizing them to standard therapies. Further work, both in vitro and in clinical trials, is needed to assess the correlation between BRCA1 expression levels and response to these potential targeted therapies.The array of cellular processes in which BRCA1 plays an integral role offers several mechanisms by which its function could be targeted for the treatment of EOC. All of these options take advantage of the weakness that is central in a BRCA1-deficient cell, the inability to effectively repair damaged DNA. As a result, the therapies outlined in this review offer promise not just in

The cell cycle machinery interprets oncogenic signals and reflects the biology of cancers. To date, various methods for cell cycle phase estimation such as mitotic index, S phase fraction, and immunohistochemistry have provided valuable information on cancers (e.g. proliferation rate). However, those methods rely on one or few measurements and the scope of the information is limited. There is a need for more systematic cell cycle analysis methods.We developed a signature-based method for indexing cell cycle phase distribution from microarray profiles under consideration of cycling and non-cycling cells. A cell cycle signature masterset, composed of genes which express preferentially in cycling cells and in a cell cycle-regulated manner, was created to index the proportion of cycling cells in the sample. Cell cycle signature subsets, composed of genes whose expressions peak at specific stages of the cell cycle, were also created to index the proportion of cells in the corresponding stages. The method was validated using cell cycle datasets and quiescence-induced cell datasets. Analyses of a mouse tumor model dataset and human breast cancer datasets revealed variations in the proportion of cycling cells. When the influence of non-cycling cells was taken into account, "buried" cell cycle phase distributions were depicted that were oncogenic-event specific in the mouse tumor model dataset and were associated with patients' prognosis in the human breast cancer datasets.The signature-based cell cycle analysis method presented in this report, would potentially be of value for cancer characterization and diagnostics. Althoug cancers . However cancers ,4.Gene expression signatures, which are capable of predicting the state of a sample from a given microarray dataset, are the emerging technology for developing cancer therapeutics. The "70-gene signature" from a breast cancer dataset has shown predictive power for the risk of recurrence . The "pacycling. Eighteen CCS subsets, each composed of genes whose expressions peak at a specific stage of the cell cycle, represent the phases of the cell cycle and are denoted using the subscript naming convention of CCSphase. For example, the CCS subsets for the G1 phase are expressed as CCSG1, for the G2-M phase as CCSG2-M, and so on.To analyze cell cycle phase distribution, a series of CCSs were created as described in Methods Fig. . The CCScycling genes to non-cycling state (day 7) the cell cycle phase distribution reflects the oncogenic events in tumors, and (ii) the cell cycle phase distribution can be better indexed when the influence of non-cycling cells is taken into account. The advantage of the CCS method can be underscored considering that the current cell cycle phase estimation methods relying on one or few measurements are not sufficient to depict cell cycle phase distribution or to distinguish non-cycling cells.The CCS method was applied to the Herschkowitz dataset which coet al. dataset [cycling scores, indicative of variations in the proportion of cycling cells in the sample , consistent with the common view that a larger number of cycling cells correlates with worse clinical outcome. The CCSS-G2-M and several CCSG1 scores for the total gene dataset were also predictive of poor prognosis. On the other hand, CCSG1 scores for the cycling gene dataset had an adverse prognostic power and gave the highest prognostic value among the tests .The CCS method was applied to the Ivshina dataset from a pted Fig. , remindited Fig. . The CCS67) Fig. , CCSG1.et al. dataset [cycling scores and non-uniform changes in CCSphase scores in some patients were observed. Patients with high CCScycling scores for the total gene dataset had high CCSS-G2-M and low CCSG1 scores for the cycling gene dataset with some exceptions. CCSG1 scores for the cycling gene dataset were predictive for DFS as with the Ivshina et al. dataset and gave the highest prognostic value variations in the proportion of cycling cells exist among tumors, (ii) the proportion of cycling cells correlated to the cell cycle phase distribution per cycling cells with several exceptions, and (iii) the cell cycle phase distribution per cycling cells better associated with patients' prognosis.To exclude the possibility of dataset specificity, the CCS method was also applied to the Langerød dataset from a pIn this study, we developed a signature-based method to index cell cycle phase distribution from microarray profiles under consideration of cycling and non-cycling cells, providing two sources of valuable information on cancers.cycling scores for the total gene dataset, indicative of a larger number of cycling cells in the sample, did associate with poor prognosis. Naturally, it can be thought that an increase in the number of cycling cells leads to a uniform increase in the number of cells at all cell cycle phases. However, some patients showed non-uniform changes in CCSphase scores for the total gene dataset . Cells were washed with normal medium followed by treatment with DMSO for 0, 2, 4, 6, 7, 8, 9, and 10 h as a control or 0.1 mg/ml nocodazole (Sigma-Aldrich) for 7, 8, 9, and 10 h. Cells were stained with propidium iodide and analyzed with DNA flow cytometry.The HCT116 colorectal cancer cell line (ATCC) was grown in McCoy's 5A medium modified (Sigma-Aldrich) with 10% FBS (JBS) and maintained at 37°C and 5% COTotal RNA was reverse transcribed, labeled, and hybridized to Human Genome U133 Plus 2.0 arrays (Affymetrix) according to the manufacturer's instructions. The expression value for each probe was calculated using the GC-RMA algorithm. The microarray data were deposited in the GEO database (GEO number: GSE14103).et al. dataset [et al. [Two datasets were used to create the CCS. First, the Whitfield dataset of 47 pr [et al. ) demonstPi is the Fourier transformation magnitude of the 14.75-h periodicity for probe i, i = 1,..., 44,160. The analysis yielded a list of 1,633 periodically expressed probes representing 976 genes. Second, the Bar-Joseph et al. dataset [where dataset of 17 preij is the expression value for probe i of serum-starved FFs sample j, j = 1, 2, and eik is the expression value for probe i of the synchronized FFs sample k, k = 1,..., 17. This yielded 2,304 out of 22,277 probes representing 1,779 genes. Then, from the intersection, a list of 335 probes representing 252 genes was obtained. These genes which preferentially express in cycling cells and in a cell cycle-regulated manner compose the CCS masterset (CCScycling). A number of well-known proliferation markers such as Ki67, geminin, TOP2A, aurora A, and PCNA [p21 and cyclin G1 whose expression can be up-regulated in non-cycling cells [cycling were assigned to 18 CCS subsets (CCSphase) which correspond to a 360° cell cycle evenly divided into 20° increments, so that each CCS subset contains at least 3 genes. Because some genes were represented by multiple probes, the same genes may appear in different CCS subsets. The CCS gene list is shown in Additional file where and PCNA were incng cells ,37 were cycling constituents from the total gene dataset. Both total and cycling gene datasets then underwent the following steps independently to give CCS scores. Expression values were log-transformed, quantile normalized to achieve the same expression value distribution for each sample, and standardized with Z-transformation across the samples. The Z-scores of the probes for each CCS genes were averaged for each sample and used as the CCS scores. To obtain robust scores, each CCSphase score was adjusted by averaging with the neighboring CCS scores twice for a total of two cell cycle rounds. Heat maps were created by "Java Treeview" [phase scores for the cycling gene dataset.The given microarray dataset was used as the total gene dataset. The cycling gene dataset was created by extracting the expression values for CCSreeview" . In the reeview" . In the Patients were dichotomized by the median of each CCS score. To assess the risk difference between two groups for DFS, Kaplan-Meier survival analysis, log-rank test and Cox univariate analysis were conducted using R "survival" package.HM and KK designed the research. HM and YN performed the research. HM, NI, AS and KK participated in writing the manuscript. All authors read and approved the final manuscript.The gene list for cell cycle signatures. The CCS genes and assigned CCS subset IDs are listed.Click here for fileet al. cell cycle dataset. Validation of CCS method in the Whitfiled CCS scores were calculated for the total (upper panel) and the cycling (lower panel) gene dataset. The purple bars above the columns indicate Whitfield et al.'s estimations of the S phase.Click here for fileet al. dataset. Analysis of the Yamamoto Serum starved NIH3T3 cells were stimulated with FGF to re-enter the cell cycle. Profiles of unstimulated cells (FGF 0 h) and FGF-stimulated cells (FGF 3–12 h) were analyzed.Click here for fileCCS score plots for the WAP-Myc model. Same as for Fig. Click here for fileet al. breast cancer dataset. Analysis of the Langerød (A), (B) and (C) are the same as in Fig. Click here for filePower spectrum of the 51 cell cycle-regulated genes. The Hela S3 cell cycle dataset was processed as described in Methods. Fourier transformation magnitudes for the known 51 cell cycle-regulated genes for each periodicity were averaged and plotted.Click here for file

Research on cannabis use has emphasized frequency as a predictor of problems. Studies of other drugs reveal that frequency relates to psychological and physiological outcomes, but quantity also plays an important role. In the study of cannabis, quantity has been difficult to assess due to the wide range of products and means of consumption.The present study introduces three new measures of quantity, and examines their contribution to cannabis-related problems. Over 5,900 adults using cannabis once or more per month completed an internet survey that inquired about use, dependence, social problems and respiratory health. In addition to detailing their frequency of cannabis use, participants also reported three measures of quantity: number of quarter ounces consumed per month, usual intensity of intoxication, and maximum intensity of intoxication.Frequency of use, monthly consumption, and levels of intoxication predicted respiratory symptoms, social problems and dependence. What is more, each measure of quantity accounted for significant variance in outcomes after controlling for the effects of frequency.These findings indicate that quantity is an important predictor of cannabis-related outcomes, and that the three quantity measures convey useful information about use. Most research on cannabis emphasizes frequency of consumption. For example, three prominent surveys, the National Epidemiological Survey on Alcohol and Related Conditions , The EpiQuantity of cannabis used is an important predictor of psychosocial outcomes. In a study conducted by Stephens and colleagues cannabisFor those who smoke cannabis, quantity also contributes to respiratory symptoms. Inhaling cannabis smoke exposes the lungs to harmful gaseous and particulate matter ,12 and iWhile quantity of use is an important factor to consider, it is rarely measured. For example, of forty-one articles identified through the PsychInfo literature database that address cannabis use and psychosocial problems, only two include a measure of quantity ,17. In aThe assessment of quantity is important for understanding outcomes of cannabis use, but the design of a meaningful measure is not without its challenges. Tobacco use may be relatively easy to quantify due to cigarette manufacturing standards, but there is no standardized cannabis product. Alcohol researchers have devised a "standard drink" to measuThe present study introduces new measures of quantity and examines the relation between quantity of cannabis consumption and problems. As a direct measure of physical quantity consumed, we inquired about the number of quarter ounces used per month. Cannabis users may not be able to report the precise dosage of individual joints, but are likely to be familiar with the rate at which they consume quarter ounces, as this unit of weight typically corresponds with product purchase ,21. In aConsistent with previous cannabis research ,26-28, wData were collected by means of an internet survey. In order to access a sample of regular cannabis users, participants were recruited from among the constituency of several organizations promoting drug law reform. The researchers requested The Drug Policy Alliance, The Marijuana Policy Project, and The National Organization for the Reform of Marijuana Laws to notify their membership of the survey through e-mail. Participants were asked to forward the survey information to others, and were entered into a drawing for a cash prize.M = 31.24, SD = 12.33), with an average educational attainment between some years of college and an associate's degree. Participants were 89% Caucasian, 5% mixed race, 1% African/Caribbean descent, 1% Asian, 1% Latino, 1% Native American, and 2% chose not to specify ethnicity. Approximately 97% of participants were from the United States, 1% were from the regions of Oceania, Western and Northern Europe, and the remaining 2% were from a large variety of countries around the world, not representing any particular region.Data from 5,987 participants who reported using marijuana at least once per month was used for the analyses. These individuals included 3,884 men and 2,103 women ranging in age from 18 to 88 years , as well as the maximum level of high experienced in the past 90 days ("What's the highest you've been in the past 90 days?"). To maximize consistency between individuals' ratings, response options were provided along a six-point scale describing a range of highs .Six questions that have been used in previous work on cannabis smokers inquiredNineteen items from the Marijuana Problems Scale assessedDependence symptoms were assessed using a seven-item measure based on the DSM-IV-TR criteria for substance dependence ,30. In eCigarette smoke contributes to similar respiratory symptoms as cannabis smoke ,31. TherM = 22.62, SD = 10.01), with an average monthly consumption of 3/8 of an ounce . A mean of 0.58 respiratory symptoms was reported (SD = 0.96), with responses ranging from no symptoms to all six symptoms. Participants reported experiencing an average of 1.37 dependence symptoms over the past year, and an average of 4.02 cannabis-related social problems in the past 90 days. The distributions of responses for cannabis-related problems, quarter ounces consumed per month and dependence symptoms were skewed. Subsequently, these variables were transformed to normalize the distribution of responses. Usual and maximum intoxication levels ranged from the lowest to the highest response option. The average level of usual intoxication was near the midpoint , and the average level of maximum intoxication approached the high end of the scale .Participants' cannabis use ranged in frequency from 1 to 31 days per month over the past year . Both usual and maximum intoxication levels did significantly predict problems, with more intense 'highs' corresponding with the experience of more social problems.The set of predictors in this analysis accounted for approximately 12% of variance in participants' report of problems associated with cannabis use. As shown in Table As shown in Table The results demonstrate that quantity is an important indicator of cannabis-related outcomes. The first hypothesis was supported, as frequency was found to be a significant predictor of respiratory symptoms, social problems and dependence. The second hypothesis was also supported. Quantity of cannabis use predicted respiratory symptoms, social problems and dependence, after controlling for the effects of frequency. Each of the three quantity measures was positively related to dependence symptoms. Two of the quantity measures, quantity of monthly consumption and level of usual intoxication, were positively associated with respiratory symptoms. When examining social problems, more intense usual and maximum intoxication levels significantly predicted a higher number of problems. In addition to predicting outcomes over and above frequency, each of the three quantity measures related significantly to outcomes when controlling for the effects of each other. These findings indicate that monthly consumption, usual and maximum intoxication levels not only predict cannabis-related outcomes, but that each measure conveys distinct information.The present study provides evidence that quantity of cannabis use is an important predictor of both psychosocial and physiological outcomes. Variability in products, dosage and delivery has posed a challenge to the quantification of cannabis use, and past research has typically focused on frequency. To explore the contribution of quantity to cannabis-related outcomes, we introduced three new measures of quantity and examined their relation to respiratory symptoms, social problems and dependence.Quantity was measured directly by inquiring about the number of quarter ounces participants consumed per month. As an indirect measure of quantity, we also asked participants to report their usual and maximum levels of intoxication. Consistent with the extant literature, frequency of use predicted social problems and dependence, as well as respiratory symptoms among cannabis smokers. After controlling for the effects of frequency, quantity of cannabis use also predicted respiratory symptoms among smokers, social problems and dependence. Each of the three quantity measures accounted for significant and unique variance in outcomes, indicating that monthly consumption, maximum and typical intoxication levels each convey distinct information related to outcomes of cannabis use.Although the observed effects of frequency were notably larger than those of quantity, even the relatively small effects of quantity bear considerable consequence in an epidemiological context. With over 40% of people in the United States trying cannabis once or more , and a pThere are limitations to the interpretation of results due to sampling methodology. Participants were recruited from organizations that advocate drug policy reform, and could have been hesitant to report negative experiences associated with cannabis use. The occurrence of problems might therefore be underrepresented in the data. However, a full range of responses was observed for each outcome, suggesting that participants were likely to have been forthcoming. Previous research also indicates that substance use may be reported at least as candidly in Internet surveys as in paper-based surveys, if not more so ,36. TherThe extent that the present sample represents the larger population of cannabis users is unclear. Internet survey methods enable data to be collected from a large, geographically diverse group of individuals, but respondents may differ from the population at large. In the present study, participants were recruited via the Internet, and the majority of the sample consisted of Caucasian Americans with some amount of college education. For these reasons, the characteristics of these participants may not generalize to others of different demographic backgrounds, those with lower educational attainment, or individuals who may not have access to the internet. An astute and anonymous reviewer emphasized that the role of medical use could prove particularly important in these results. We failed to assess the role of medicinal use in this study. Medical users might require relatively large quantities of cannabis while experiencing few negative side effects like those assessed here. A responsible medical user could consume large amounts without numerous symptoms of social problems, dependence, or respiratory irritation. Thus, the current results may be overestimates of the potential impact of quantity on problems in medical users. More importantly, the potential positive effects of cannabis overall and in relation to quantity do not appear in these data. Medical users may report greater symptom relief as quantities increase, or an optimal dose that is neither too high nor too low. Recreational users may also find that the effects that they appreciate most will vary with quantity, perhaps with an optimal dose that is neither too high nor too low. The results on respiratory effects also suggest that using smaller amounts of higher quality cannabis could enhance the safety of the plant. Examining the implications of quantity in more diverse populations would require different sampling and survey methods.Clearly, quantity of cannabis consumed can be an important predictor of problems. Further research can employ the three new measures of quantity to help clarify its role in outcomes. These single-item indicators each reveal unique aspects of the amount consumed and contribute to the prediction of negative consequences. Continued efforts to examine quantity can have important implications for prevention and treatment of cannabis-related problems. As another astute and anonymous reviewer mentioned, these data support the idea that efforts to increase the safety of cannabis can emphasize decreasing amount as well as frequency of consumption. Despite the challenges to quantification, the present findings suggest that perhaps researchers and clinicians should not only ask people how often they smoke; they should also ask how much they consume and how high they get.ME is affiliated with organizations devoted to changing cannabis laws.NW managed data, performed analyses, and drafted the manuscript, ME contributed to study design, coordination of data collection, and manuscript revisions.

Psychological distress (PD) includes symptoms of depression and anxiety and is associated with considerable emotional suffering, social dysfunction and, often, with problematic alcohol use. The rate of current PD among American Indian women is approximately 2.5 times higher than that of U.S. women in general. Our study aims to fill the current knowledge gap about the prevalence and characteristics of PD and its association with self-reported current drinking problems among American Indian mothers whose children were referred to screening for fetal alcohol spectrum disorders (FASD).Secondary analysis of cross-sectional data was conducted from maternal interviews of referred American Indian mothers (n = 152) and a comparison group of mothers (n = 33) from the same Plains culture tribes who participated in an NIAAA-funded epidemiology study of FASD. Referred women were from one of six Plains Indian reservation communities and one urban area who bore children suspected of having an FASD. A 6-item PD scale was constructed with a summed score range of 0-12 and a cut-point of 7 indicating serious PD. Multiple statistical tests were used to examine the characteristics of PD and its association with self-reported current drinking problems.Referred and comparison mothers had an average age of 31.3 years but differed (respectively) on: education , PD-6 mean scores , current prevalence of serious PD , and a current drinking problem . Among referred mothers, those with a current drinking problem had a significantly higher mean PD-6 score. Having PD, serious PD, and 2 specific scale items significantly increased the odds that a referred mother would have a current drinking problem.Psychological distress among referred mothers is significantly associated with having a self-reported drinking problem. FASD prevention requires multi-level prevention efforts that provide real opportunities for educational attainment and screening and monitoring of PD and alcohol use during the childbearing years. Mixed methods studies are needed to illuminate the social and cultural determinants at the base of the experience of PD and to identify the strengths and protective factors of unaffected peers who reside within the same communities. Psychological distress (PD) is an unpleasant subjective state involving co-occurring mood and anxiety symptoms . It is aAmong participants of the 2007 National Survey on Drug Use and Health [The following summary points from the PD-associated literature frame the importance of PD research: 1) PD is associated with heavier alcohol consumption among women of childbearing age ; 2) womeIt follows then that many American Indian women would be at increased risk for serious PD. In fact, during 2000-2004, American Indian women were reported to have a past 30 day PD prevalence of 9.7%, a rate at least two times that of Black women (4.0%), White women (3.4%), and Asian women (2.4%) . They alAlso relevant is a recent finding that the prevalence of past month binge drinking among American Indian women is higher than that of non-American Indian women in the U.S. . However, neither group of women meet the Healthy People 2010 goal of reducing binge drinking to 6% .This PD study took place within a larger NIAAA-funded epidemiology and community-wide prevention study of fetal alcohol spectrum disorders (FASD). In this program, diagnosis and comprehensive prevention of FASD were carried out in a time-sequenced manner to reduce the prevalence of FASD, first in four reservation communities of the Northern Plains and then in two additional reservations sites and one urban catchment area. FASD diagnostic clinics were held regularly in order to identify cases and families in need of intervention and prevention services. Rates of FAS have been reported in the literature to be between 8 and 9 per 1,000 children on Plains culture reservations which is approximately 2 to 4 times the estimates for the U.S. general population .In addition, in the larger investigation in which this PD study took place, depression and anxiety seemed common. Although drinking in general among American Indian women of the six reservation study communities was not significantly more prevalent than in the general population of the U.S., binge drinking was very high among those who chose to drink . FurtherThe examination of maternal risk factors for FASD and PD-associated risk factors, and our knowledge of the prevalence of these risk factors in the landscapes of American Indian women of the Plains challenged us to more fully describe any association between PD and problem drinking. Especially important is to explore this association among Plains Indian women in their childbearing years and particularly among those women who may already have given birth to a child with FASD. Therefore, while a small comparison group of mothers is initially introduced as a means of providing additional context, the main focus of the study is on the referred mothers. Mothers of children with FAS are at greater risk for having more children with FAS . If mothIn explaining the treatment of PD for use in FASD prevention, it is our hope to increase awareness about the need for treatment to decrease the psychosocial burdens of PD on American Indian mothers in general and to provide empirical evidence for the development of effective prevention and policy that might support the health of American Indian mothers and their children. Therefore, this investigation explores the following questions: 1) What is the current prevalence of PD and drinking problem among referred mothers?, 2) Are there significant differences in prevalence of current drinking problem and PD mean scale score between the referred and comparison groups of mothers?, 3) Do PD scale scores significantly differ by drinking status among referred mothers?, and 4) What are the associations between various characteristics of PD such as PD in general, serious PD, and individual PD scale items, and the potential of having a current drinking problem among referred mothers?All research and interventions in this study were carried out under the authority of resolutions from the participating tribal councils and with ongoing approval of a variety of human subjects review boards. Protocols and consent forms used were approved by The University of New Mexico , three Indian Health Service (IHS) IRBs, and the NIH Office of Protection from Research Risks (OPRR). All women gave active consent before providing information or otherwise participating in the main study and in this sub-study.Women who are the focus of this paper were recruited from multiple community sources and were originally identified via their children's enrollment in a NIAAA-funded comprehensive fetal alcohol syndrome (FAS) research and prevention project . The FASER project took place in six Northern Plains Indian communities and one urban area in the Plains. To test for possible differences between referred mothers residing on the participating reservations and those mothers residing in the urban location (12% of the referred mothers' sample), we compared the means or percentages on each key variable with and without the urban mothers subsample and found no statistically significant differences. Therefore, we included the urban group in our analyses. All female participants in the study self-identified as American Indian of a Plains or Plateau cultural heritage.Children were referred to the study if they had a previous diagnosis of FAS, another FASD, or fetal alcohol effect (FAE), if a school, medical, or social service official suspected that a particular child had been exposed to alcohol during the mother's pregnancy , or if a child was having difficulty in school, either academically or behaviorally. The referred children were seen in special developmental clinics and provided dysmorphology examinations by physicians specifically trained in FASD diagnostics and human genetics. A short while later, the referred children were administered a battery of educational tests, and the mothers of the referred children were interviewed by FASER staff.Children, matched on age and gender with 33 participating children in their respective communities who were not suspected of having an FASD, were recruited via flyers and word of mouth by project coordinators from local health clinics and other locales within the community for comparison. The recruitment of the comparisons emphasized that the children were to be considered as "normally developing" children within these communities. These comparison children were given the same educational tests, and the mothers were also interviewed concerning risk or protective factors during the index pregnancy.One hundred eighty-five women were included in the particular sub-study reported on here: 152 women whose children were referred because their children were suspected of having an FASD (the children of 23 or 15.1% of these referred mothers were found to have an FASD),); in this comparison there are 33 comparison women whose children were recruited specifically because their children were believed to have no identified physical or learning/behavioral problems, and the diagnostic process confirmed this to be the case. Furthermore, the maternal interviews administered to the mothers of the comparison children confirmed that they engaged in little drinking in the child's prenatal period or in the present.Data for this study are derived from the FASER comprehensive prevention trial. Beyond the baseline and ongoing epidemiological research, the ultimate aim of FASER was to demonstrate that fetal alcohol syndrome can be prevented by the application of the FAS prevention model put forth by the U.S. Institute of Medicine (IOM) in 1996 . It utilWithin the main study, maternal risk factor data were collected via an extensive questionnaire containing over 200 items pertaining to socio-demographics, general health, pregnancy history, nutrition, tobacco, alcohol, and drug use. Some of the demographic and alcohol data were used for this sub-study, including age (a continuous variable), and education ), to some college or a college degree. Alcohol use was determined by self report after the administration of an extensive set of alcohol consumption questions for the past week, past month and year, and also during the three months before and during each trimester of the index pregnancy. After reflecting on those questions and her own drinking behavior, the respondent was presented with the question "Do you currently have a drinking problem?". Response options included "yes" or "no". Thus, it was each woman's self report, in response to this single measure that she did or did not have a current drinking problem, that was used in the analysis of the data.In the scientific literature, psychological distress (PD) is measured in a number of ways. Some studies use a combination of measures for depression, anxiety, and daily hassles . Others In the study reported here, PD is measured with a 6-item scale that was constructed from the SSCL-51 included in the FASER maternal survey and that we will now refer to as the PD-6. Items from the SSCL-51 were selected for the PD-6 based on their similarity to items used in the K6 , a natiot-test was conducted to assess the differences in mean PD-6 scores by current drinking problem among referred mothers. Although the test group sizes were unequal, Levene's test for equality of variance was non-significant, thus signifying an appropriate use of the t-test.Descriptive statistics were used to identify sample characteristics and PD mean scale scores. Prevalence of serious PD was determined as being the proportion (%) of women with a FASER PD-6 summed score ≥7. Mean differences for the key variables by referral and comparison mothers were calculated with the chi-square test statistic for the categorical measure and, because of the substantial difference in group sample sizes, the Mann-Whitney U test statistic for continuous measures. A two-tailed, independent samples Logistic regression was used to calculate bivariate and multivariate odds ratios and confidence intervals were calculated to provide an estimate of the risk for self-reported current drinking problem in association with PD and serious PD. We also conducted the same analyses for each of the PD-6 individual items to better understand the specific PD symptoms that are most troublesome. In preparation of the logistic regression used to produce the odds ratios for the individual PD-6 items we first examined the cell sizes of the response categories and found relatively small cell sizes (ranging from 4.6%-19.1%) for the response option "a lot of trouble". Questioning about mental health symptoms can provoke a perception of social stigma, particularly in the present study whereby the survey was conducted face-to-face in contrast to a more discreet method such as anonymous, self-administration. Therefore, it is possible that social desirability (responding in a way to avoid criticism or judgement) and or social approval (responding in a way that seeks praise) response set biases may have been present in the mothers' answers to the PD questions, as has been reported for other populations and conditions -30. ThusDescriptive statistics for the key variables are presented in Table The results presented in Table With a continued focus on referred mothers, the odds ratios reported in Table Despite compelling evidence about the elevated prevalence of serious PD among American Indian women compared to women of other racial/ethnic groups in the U.S., and the numerous validations of PD-related social- and health-related consequences including increased binge and heavy alcohol use, this study is a first effort to examine PD among Plains Indian women in conjunction with FASD epidemiology and prevention. The PD-6 scale, created solely for the current investigation and thus with some limitation, was a reliable measure of PD among the American Indian women in our study and provided us with the means for examining associations between PD and maternal drinking.We identified mean scores of past 30-day PD, prevalence of serious PD, and prevalence of self-reported current drinking problem among Plains Indian mothers with children referred for FASD screening within a context that included a small comparison group of Plains Indian mothers of unexposed and unaffected children. The women, who lived in the same communities, shared a common tribal culture, and had a common mean age, were markedly different in three important ways as shown in Table Within the group of referred mothers, we found a significantly higher PD-6 mean score for mothers with a self-reported current drinking problem Table . Not onlFrom a prevention perspective and specific to the prenatal care setting where routine depression screening is gaining ground nationally, the PD associated with alcohol use may be missed if symptoms of anxiety are not also assessed in the presence of depression. As was discovered Table , women wWhile we emphasize the role of PD as an important consideration for the prevention of maternal drinking, we also point out that the readiness of accessible, effective treatment for depression, anxiety, and stress does not correspond to the women's well-documented need. A disproportionate mental health burden for American Indian women with PD includes a substantially higher self-reported unmet need for mental health treatment as compared to women of all other major racial/ethnic groups . When meEffective treatment for PD and co-occurring conditions such as alcohol abuse is even more elusive. However, the lack of such treatment is not specific to American Indian communities alone. In the general population, co-occurring alcohol use and PD are under diagnosed and inadequately treated ,44. AmonOur study is limited by several factors. The first consideration is the cross-sectional design that prevents us from establishing the causal relationship between PD and self-reported current drinking problem among the women. Our construction of the issue contends that PD increases the potential of having a current drinking problem. However, it is also likely that having a drinking problem leads to or exacerbates PD as was the finding in a recent longitudinal study of the relationship between cocaine and methamphetamine use and PD . A seconAn important outcome of our comparison of the two groups of mothers is the direction that it suggests for future studies. Of particular benefit for prevention efforts would be an investigation that identifies the assets and protective factors of Plains Indian women who reside in the same communities, but for whom serious PD and alcohol use are not co-occurring issues. Such factors could include further examination of this study's finding that the comparison group of mothers who were three times more likely than the referred mothers to have at least some college did not meet the established cut point criteria for serious PD. In addition, qualitative studies with Plains Indians and other American Indian mothers who may be at risk for maternal drinking can contribute to our understanding of the relationship between PD and maternal drinking. For instance, maternal narratives may reveal internal and external resources for coping with PD that are suggestive of intrinsic culture- and community-based strategies for FASD prevention that are contextualized to the women's real life experiences. From the parent FASER study, some earlier data on psychological distress, socioeconomic status (SES), and maternal risk factor variables have been identified . With a A significant association exists between PD and a self-reported current drinking problem among Plains Indian mothers who may already be at risk for having a child with FASD. The social disadvantage of these women is confirmed by their low educational attainment. For tribal and other communities that are seeking solutions to maternal drinking, including clearly defined goals and programming for female educational achievement and occupational opportunity may increase the benefits of their FASD prevention efforts and policy. Routine, concurrent screening of women of childbearing age for psychological distress and alcohol use can provide important information to the health care provider about the potential need for active monitoring before and during pregnancy. An important caveat to our study is that while a quantitative measure of PD seems to capture the signs of the emotional experience of American Indian women, a parallel process of qualitative inquiry is also needed in order to illuminate the social and cultural determinants at the base of the experience of PD itself.The authors declare that they have no competing interests.TP and MAM constructed the PD measures from the FASER data base and conducted the secondary analyses. TP took primary responsibility for writing the first drafts of the paper. MAM helped write the discussion and conclusion sections of the paper. All data were originally collected in the FASER project by a large team and network of NIAAA-funded individuals listed in the acknowledgements. PTL conducted the majority of the maternal interviews in the seven communities. JG was the primary manager and monitor of all data collection, data entry, data set construction, and also compliance with IRB requirements. PAM was the Principal Investigator on each of the three NIAAA grants and the supplement that funded TP's work on this particular part of the study; he oversees all aspects of the FASER research from conceptualization to methodology to the relationships with the study communities, tribal councils, and NIAAA. All authors read, and contributed to the writing, and approved the final draft of the manuscript.

Here we show that 5-fluorotryptamine (5-FT) is a partial agonist at both 5-HT3A and 5-HT3AB receptors with an Rmax (Imax / Imax5-HT) of 0.64 and 0.45 respectively. It is about 10 fold less potent than 5-HT: EC50 = 16 and 27 μM, and Ki for displacement of [3H]granisetron binding = 0.8 and 1.8 μM for 5-HT3A and 5-HT3AB receptors respectively. We have also explored the potencies and efficacies of tryptamine and a range of 5-substituted tryptamine derivatives. At 5-HT3A receptors tryptamine is a weak (Rmax = 0.15), low affinity partial agonist, while 5-chlorotryptamine has a similar affinity to 5-FT but is a very weak partial agonist (Rmax = 0. 0037). These, and data from 5-methyltryptamine and 5-methoxytryptamine, reveal the importance of size and electronegativity at this location for efficient channel opening.Antagonists, but not agonists, of the 5-HT The incorporation of B subunits results in some changes in the biophysical characteristics of the receptor, but has little effect on the pharmacological profile was from PerkinElmer . 5-FT, 5-chlorotryptamine (5-ClT), 5-methyltryptamine (5-MeT), 5-methoxytryptamine (5-MeOT) and tryptamine , except foetal calf serum which was from Labtech International . is the concentration of competing ligand and IC50 is the concentration of competing ligand that blocks half of the specific bound radioligand. Ki values were estimated from IC50 values using the Cheng–Prusoff equation:This was undertaken in HEK 293 cells which provide an established and robust method of studying ligand binding. Methods were as previously described , with miKi is the equilibrium dissociation constant for binding of the unlabeled antagonist, [L] is the concentration of radioligand and Kd is the equilibrium dissociation constant of the radioligand.where 2.5m-chlorophenylbiguanide (mCPBG), 5-FT and tryptamine (Sigma) were stored as 20–100 mM aliquots at−20 °C, diluted in Ca-free ND96 buffer and delivered to cells via the automated perfusion system of the OpusXpress. Glass microelectrodes were backfilled with 3 M KCl and had a resistance of ∼ 1 MΩ. The holding potential was − 60 mV. To determine EC50 values, concentration–response data were fitted to the four-parameter logistic equation, I = Imin + (Imax−Imin) / (1 + 10 A])nH(log(EC50 −  is the log concentration of agonist and nH is the Hill coefficient, using PRISM v4. 03 software . Relative efficacies of the partial agonists are reported as Rmax = Imaxdrug / Imax5-HT. One-way ANOVAs were performed with Dunnett's post test to determine statistical significance. Data are quoted as mean ± SEM (n) unless otherwise stated.Agonist-induced currents were recorded at 22–25 °C from individual oocytes using the OpusXpress system . 5-HT, 33.1Xenopus oocytes expressing 5-HT3A or 5-HT3AB receptors produced concentration-dependent, rapidly activating, inward currents that desensitised over the time-course of the application of 0.64 ± 0.03 for 5-HT3A receptors and Rmax of 0.45 ± 0.04 for 5-HT3AB receptors that was lower than that of 5-FT (16 μM).5-ClT was a very weak partial agonist of 5-HT3A receptors with an Rmax of 0. 0023. Dose response curves yielded an EC50 of 60 ± 3μM (n = 3) indicating it was slightly more potent than tryptamine (EC50 = 113 μM).5-MeT was also a very weak partial agonist at 5-HT3 receptors at concentrations up to 10 mM.5-MeOT was unable to activate 5-HT3.2Kd) of [3H]granisetron between 5-HT3A and 5-HT3AB receptors . Competition binding studies using [3H]granisetron revealed displacement of specific binding in a concentration-dependent manner by all the ligands. Kis and a lower Rmax, indicating the importance of the group at the 5 position of 5-HT. Further studies on other 5-substituted tryptamine derivatives confirm this hypothesis, and also reveal the importance of size and electronegativity at this location for efficient channel opening.The data described here show that 5-FT is a partial agonist at both 5-HTsubunits . Tryptam3A and 5-HT3AB receptors have been reported by a number of authors, and were also observed in the current study. Compared to the 5-HT3A receptor, responses from 5-HT3AB receptors are smaller and desensitise more rapidly; EC5O and Kd values differ by ∼ 2 fold and there is an ∼ 2 fold decrease in the Hill slope of the dose response curves. There is also a difference in the efficacy of mCPBG, which acts as a partial agonist at 5-HT3A receptors, but a full agonist at 5-HT3AB receptors. This indicates gating characteristics of the two receptors are different, and indeed it has been established that the channel conductance is greatly increased in 5-HT3AB receptors (Subtle differences between 5-HTeceptors .50 and IC50s) of 5-HT3A and 5-HT3AB receptors for a range of 5-HT3 selective ligands , establishing the importance of the hydroxyl group. However 5-FT can significantly compensate for the lack of a hydroxyl; it is only 10 fold less potent than 5-HT and Rmax = ∼ 0.5. In our model of the binding pocket hardly ever accepts a hydrogen bond but was much less effective in opening the channel (Rmax = 0. 0037). 5-ClT and 5-FT bind to the receptor with similar affinities (Kis are not significantly different), demonstrating there is no relationship between Ki or EC50 and Rmax Thus it appears that the atom at the 5 position of tryptamine plays a critical role in the conformational changes that result in channel opening. Since both 5-FT and 5-ClT present a relatively electronegative atom at this position, we propose that the increased steric size of Cl vs. F contributes to decreased efficacy of 5-ClT. Sterics also rationalize the inefficacy of 5-MeOT, which has an electronegative element in the 5 position but is apparently too large. The data from 5-MeT also support the hypothesis that size and polarity are important; Me is a similar size to Cl, but is nonpolar, and 5-MeT is less effective at opening the channel.To further explore this region of the binding site, we examined 5-ClT, 5-MeT and 5-MeOT in 5-HT50 and Ki, with EC50s 13–50 fold higher than Ki. This is expected, as Ki values are considered to represent binding to a high affinity desensitised state. However, for 5-ClT and 5-MeT, which have very low efficacy, EC50 is less than 5 fold higher than Ki. This suggests that if agonist binding does not result in significant channel opening (Rmax less than 0.01), then there may be no significant entry of receptors into a high affinity state.The data also show that for most agonists there is a direct relationship between ECRmax of ∼ 0.5, will be a useful addition to this class of compounds which includes the more usually used mCBPG (Rmax = ∼ 0.8) and 2-methyl-5-HT (Rmax = ∼ 0.2). Partial agonists are also potentially useful as therapeutic agents. The most well-established role of 5-HT3 receptors is in regulating gastrointestinal motility and the vomiting reflex, although they may play a role in many other neuronal functions. Currently, 5-HT3 receptor antagonists are used clinically as anti-emetics, and to treat irritable bowel syndrome (3 receptor partial agonists which might control gastroenteric motility without completely blocking 5-HT3-sensitized nerve function (3 receptor agonists also have a potential therapeutic role as they can modulate acetylcholine release in vivo (3 receptor agonists, however, cause nausea and vomiting; thus partial agonists are potentially more useful for therapeutic applications in this area. Recently developed compounds, e.g those described by Partial agonists are increasingly being used to distinguish between binding and gating events at Cys-loop receptors, and 5-FT, with an syndrome . Howeversyndrome . Thus thfunction . 5-HT3 r in vivo , making 3A and heteromultimeric 5-HT3AB receptors. The data have also revealed that the atom in the 5 position of 5-HT plays an important role both in receptor binding and in subsequent channel gating.In conclusion we have shown that 5-FT is a partial agonist at both homomeric 5-HT

Atopic dermatitis develops as a result of complex interactions between several genetic and environmental factors. To date, 4 genome-wide linkage studies of atopic dermatitis have been performed in Caucasian populations, however, similar studies have not been done in Asian populations. The aim of this study was to identify chromosome regions linked to atopic dermatitis in a Japanese population.We used a high-density, single nucleotide polymorphism genotyping assay, the Illumina BeadArray Linkage Mapping Panel (version 4) comprising 5,861 single nucleotide polymorphisms, to perform a genome-wide linkage analysis of 77 Japanese families with 111 affected sib-pairs with atopic dermatitis.P = .0012) and weak linkage to 1q24 .We found suggestive evidence for linkage with 15q21 (LOD = 2.01, NPL = 2.87, We report the first genome-wide linkage study of atopic dermatitis in an Asian population, and novel loci on chromosomes 15q21 and 1q24 linked to atopic dermatitis. Identification of novel causative genes for atopic dermatitis will advance our understanding of the pathogenesis of atopic dermatitis. Atopic dermatitis (ATOD) is a hereditary, pruritic, inflammatory, chronic skin disease that occurs most commonly in early childhood but can persist or start in adulthood. The prevalence of ATOD has been studied in a wide variety of populations , and itsATOD is associated with cutaneous hyperresponsiveness to environmental triggers that are innocuous to healthy individuals . In the ATOD is the result of complex interactions between multiple genetic and environmental factors. Sixty-nine percent of patients with ATOD have one or both of parents affected by ATOD , and chiIL4), IL13, IL5, IL12B, and serine protease inhibitor Kazal-type 5 (SPINK5) . -12. 9-12Examining SNPs, instead of microsatellite markers for linkage is unlikely to yield different results because it has been reported that SNP-based genome-wide linkage study has the potential to be as powerful as traditional microsatellite-based analysis and offers good identification of specific locations for further fine-mapping association analysis . We perfThe 15q21 linkage region has not been reported previously as a region associated with ATOD. However, linkage of 15q21 to several other inflammatory diseases including osteoarthritis and macuCD3Z) and chemokine ligand 2 (XCL2). CD3Z plays an important role to recognize the coupling antigen to several intracellur signal-transduction pathways [The 1q24 linkage region includes candidate genes such as T-cell receptor zeta chain isoform 2 precursor declare that they have no competing interests.HE carried out molecular genetic study, participated in the study design and coordination and wrote the draft of the manuscript. SI, TT, KH, MI, TK, TA, YS, MK, MT, TS, and FO carried out molecular genetic studies. EN and TA participated in the design of the study and performed the statistical analysis. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:

In systems where two or more species experience secondary contact, behavioural factors that regulate interspecific gene flow may be important for maintaining species boundaries and reducing the incidence of hybridisation. At subantarctic Macquarie Island, two species of fur seal breed in close proximity to one another, hybridise at very high levels , yet retain discrete gene pools. Using spatial and genetic information collected for pups and adults over twelve years, we assessed two behavioural traits - inter-annual site fidelity and differences in habitat use between the species - as possible contributors to the maintenance of this species segregation. Further, we explored the breakdown of these traits in pure-species individuals and hybrids.We found virtually complete spatial segregation of the parental species, with only one exception; a single territory that contained adults of both species and also the highest concentration of hybrid pups. The spatial distribution of each species was closely linked to habitat type (pebbled vs boulder beaches), with members of each species breeding almost exclusively on one type or the other but hybrids breeding on both or at the junction between habitats. Inter-annual site fidelity was high for both sexes of pure-species adults, with 66% of females and all males returning to the same territory or a neighbouring one in different years. An important consequence for pure females of breeding on the 'wrong' habitat type, and thus in a heterospecific aggregation, was the production of hybrid pups. Low habitat fidelity of hybrid females facilitated bi-directional backcrossing, resulting in more diverse hybrid offspring.In a disturbed system where two sympatric fur seal species breed in close proximity, discrete gene pools are retained by extremely fine-scale and strong spatial segregation of the species. Two behavioural traits were found to be important in maintaining this stable population structure, and habitat type was a strong indicator of where species locate and a potentially powerful predictor of future directions of hybridisation. A direct consequence of the breakdown of this trait was the production of hybrid offspring, which may have severe implications if hybrids have reduced fitness. Secondary contact between previously isolated species can result in hybridisation unless mechanisms are in place to prevent it. Outcomes of this depend on the fitness of hybrids relative to parental species, as well as behavioural and ecological attributes that contribute to the maintenance of species boundaries ,2. In syIn sympatry, species-specific differences in ecology, behaviour or physiology may allow discrete gene pools to be maintained. Adaptation to different habitats can reduce interspecific encounter rates and subsequent gene flow, thereby forming a barrier to hybridisation . For exaArctocephalus pusillus doriferus and A. forsteri, ) Georgia . This paA. gazella females of breeding in heterospecific aggregations are potentially severe; firstly in terms of the direct reproductive costs they may incur through the production of hybrid offspring, as A. tropicalis pups have a lactation length two and a half times that of A. gazella pups type was shown to be significantly weaker in hybrids than pure-species individuals. The consequences for pure 0 months ). Additi0 months ,45, pure0 months [45]. FurBased on the strong correlation between beach type and the distribution of both species on Macquarie Island, we may infer that one could be used to predict the other. As the population continues to expand, physical mapping of the locations and abundance of each of the habitat types at Macquarie Island could be useful for predicting potential new sites of colonisation by the two species as they continue to recover, as well as identifying areas where habitat types converge and 'hotspots' of admixture may occur. As a further step, modification of these habitats may theoretically enable the degree of hybridisation in the population to be managed. However, with both species recovering at a steady rate across their former ranges, at present there is little concern that continued hybrid production at Macquarie Island will threaten the genetic integrity of either species on a global scale. Nevertheless, this study has enabled us to identify and better understand two behavioural traits which appear to be of evolutionary significance in this instance of secondary contact.We have shown that even in a disturbed system with an initial rarity of conspecific mates and consequently a high level of hybridisation, two behavioural traits have promoted segregation of parental species and maintained the integrity of discrete gene pools. Variation in these traits has important fitness consequences for individuals, thus there may be strong selection for these traits in pure species to reduce the incidence of hybridisation. Future research will address this and related topics to further our understanding of population dynamics and the ecological and evolutionary consequences of secondary contact in these species.MLL examined hybridisation in fur seals at Macquarie Island for her PhD and this study forms part of her research. SDG initiated and manages the long-term fur seal monitoring program at Macquarie Island. Both PS and SDG supervised MLL during her PhD research. All authors read and approved the final manuscript.

Understanding the interaction between viral proteins and neutralizing antibodies at atomic resolution is hindered by a lack of experimentally solved complexes. Progress in computational docking has led to the prediction of increasingly high-quality model antibody-antigen complexes. The accuracy of atomic-level docking predictions is improved when integrated with experimental information and expert knowledge.Binding affinity data associated with somatic mutations of a rotavirus-specific human adult antibody (RV6-26) are used to filter potential docking orientations of an antibody homology model with respect to the rotavirus VP6 crystal structure. The antibody structure is used to probe the VP6 trimer for candidate interface residues.Three conformational epitopes are proposed. These epitopes are candidate antigenic regions for site-directed mutagenesis of VP6, which will help further elucidate antigenic function. A pseudo-atomic resolution RV6-26 antibody-VP6 complex is proposed consistent with current experimental information.The use of mutagenesis constraints in docking calculations allows for the identification of a small number of alternative arrangements of the antigen-antibody interface. The mutagenesis information from the natural evolution of a neutralizing antibody can be used to discriminate between residue-scale models and create distance constraints for atomic-resolution docking. The integration of binding affinity data or other information with computation may be an advantageous approach to assist peptide engineering or therapeutic antibody design. The Rotavirus (RV) particle is composed of three concentric viral protein (VP) layers. The intermediate layer consists of VP6 , and the potential flexibility of the antibody Fab, which is compose of 227 residues. However, biological knowledge helps to reduce the size of the docking search space. For example, it is known that the lower half of the VP6 is buried inside the RV double-layered particle and, thus, is not accessible to the antibody for binding. Docking predictions are most reliable when prior biological information is incorporated into the modeling process .The diversity of antibodies is due to the six complementarity determining region (CDR) loops, whose flexibility and large number of surface accessible side chains allow the antibody to match a particular antigen epitope. When such induced conformational changes are large, one expects docking predictions to become less accurate if backbone flexibility is not incorporated. However, the large binding affinity of antibody-antigen associations in general, and the RV6-26-VP6 complex in particular, may limit the size of conformational shifts upon complex formation due to the evolutionary advantage of constrained loops for tighter binding ,10. We uRosettaDock has performed well in the blind Critical Assessment of Predicted Interactions (CAPRI) protein-protein docking challenge , includiIn the current paper, our goal is to identify candidate VP6 epitopes of the human neutralizing antibody RV6-26 by defining an antibody orientation filter that combines the distances between interface residues of the docking partners with experimental binding affinity changes due to site-directed mutagenesis of somatic antibody mutations back to germline. Unique to this study is the use of somatic mutations, which occurred during the natural evolution of an adult human antibody. The orientation filter is used to select low-resolution RosettaDock model complexes for refinement. During a low-resolution RosettaDock search, each protein is represented as a backbone with the side chains approximated by their centroids. During a high-resolution search, all side-chain atoms are fully represented, and we use finer rotational and translational sampling as described below. After clustering the refined complexes, the RV6-26 antibody mutation that was most disruptive for binding following reversion to the germline sequence (Y66S ) acts asab initio molecular modeling for those parts of the antibody that are too variable for homology methods. For all docking runs, we included an alignment of our Fab with antibody binding subsequences of known antibody-antigen complexes, which allows RosettaDock to restrict the antibody from assuming an unlikely orientation of its CDR loops [Since a crystal structure is not available for mAb RV6-26, we built a homology model of the structure using the Web Antibody Modeling (WAM) . WAM useDR loops .Figure H1–46 is the known immunodominant region. Ref. [In the second step, we used a somatic mutation score (described below) based on binding affinity changes measured when naturally occurring RV6-26 antibody mutations were back-mutated to germline. This score was used to filter the 1000 low-resolution RosettaDock decoys. The motivation for using this data as a filter is that affinity is a measure of the evolutionary fitness of each mutation that occurs over the course of antibody evolution. The adult RV6-26 antibody contained 13 somatic mutations within the heavy chain. To identify which of these mutations affected binding to VP6, mutant antibodies were produced corresponding to the reversion of each somatic mutation amino acid back to the germline amino acid. Somatic mutations also occur in the light chain, but we focused on the 13 heavy chain mutations because the Von. Ref. providesFigure The third profile (TFN) of the alignment in Fig. D of pair-wise distances between the Cα atoms of the 13 residue mutations of the RV6-26 antibody and a collection of VP6 residues from the interface, chosen based on visual inspection of the cryo-EM density. Virus interface residues were selected for the filter from two of the three VP6 chains: B-chain residues 197–213, 253–282, 287–301, 304, and 308; and C-chain residues 157–173, 236–247, and 351–374. The rows of the matrix D correspond to theVP6 residues at the interface and the columns to the antibody mutations highlighted in Fig. D. These distances yield a vector d whose elements are given byFor each complex, we created a matrix whose length is equal to the number of antibody mutations.F of a complex is given by the following sum over all antibody mutations M (M = 13 for RV6-26)The filter score where the contribution from each residue isdc is a distance cutoff in Angstroms that characterizes our measure of closeness between the antibody and antigen. We classify a somatic mutation as "active" if back-mutation to germline has a disruptive effect on binding to the antigen. "Neutral" somatic mutations are non-disruptive when mutated back to germline. In Eq. (3a), an active somatic mutation contributes 1 to the affinity filter score of a complex if this residue is within dc Angstroms of the antigen interface. In our application, we chose a relatively loose cutoff of dc= 12Å to allow all active mutations the possibility of contributing to the score, including ones that may be more distant from the interface. It has been observed that many affinity-maturing mutations in singe chain Fv antibodies correspond to residues that are more distant from the interface [dc. This essentially penalizes neutral somatic mutations that are closer to the interface than the cutoff distance. Of course, it is still possible for non-disruptive mutations to be near the interface, so this soft distance constraint penalizes but does not exclude neutral residues from contacting the antigen. In the final piece (Eq. 3c), all other somatic mutations do not contribute to the filter score of Eq. (2).and nterface ,19. A smIn the third step of Fig. a priori choose the number of clusters in k-medoids; however, this choice is easily validated by visual inspection of the 3D complexes. The candidate binding sites were determined from the final candidate complexes by finding the VP6 residues within a 5Å radius of the RV6-26 Tyr66. This mutation was chosen as a computational probe because it had the largest effect on binding affinity as back-mutation of this residue resulted in an 83-fold decreased rate of dissociation [The resulting high-resolution decoys were ranked according to their full-atom scores. Candidate complexes were determined by an additional round of refinement following k-medoids (k = 3) clustering of the top Rosetta-scoring complexes. Root-mean-square deviation (RMSD) of the alpha-carbon coordinates was used as the cluster metric, and the cluster location was given by the decoy with the lowest full-atom energy score within the cluster. We used k-medoids clustering because, unlike hierarchical clustering, it does not require linkage assumptions, and it is simpler than mixture model clustering. Unlike model-based clustering, which has the advantage of a statistical model that allows it to estimate the number of clusters, we must Following the creation of 1000 antibody-antigen decoy complexes with the fit into the cryo-EM density map in Ref. as a staF = 9.0) low-resolution complex in Fig. Starting from the best 45 filtered low-resolution complexes from the top four clusters in Fig. In Fig. The best scoring high-resolution model, shown in Fig. In this study, we proposed an integrative structure-based computational approach to identify the RV VP6 epitope for a human adult antibody. Successful computational docking strategies have been developed that integrate experimental data, such as NMR chemical shift perturbations, residual dipolar couplings, and mutagenesis data ,7. To inThis strategy is unique in its use of naturally occurring somatic mutations of a human antibody as a filter. The fact that all six active antibody residues were within 12Å of the interface Fig. corrobor5) number of low-resolution complexes to explore the global space of potential interfaces, and then choose an encompassing region around the largest cluster as the VP6 residues near the interface.In the applied result in this paper, the algorithm had the advantage of an initial distance constraint provided by a cryo-EM density. This gave us added confidence in the antigenic-site candidates found by the algorithm, and it provided a starting point for validation of the algorithm on complexes where only binding affinity data is known. Unlike the two candidate complexes (whose antibody tyrosines were further down the VP6 neck in Fig. Affinity changes measured for the reversion of somatic mutations provides information about interface residues but not about specific antigen contacts. Additional feedback with experiment is necessary to unambiguously identify the interface. Thus, binding affinity changes caused by directed mutagenesis of the proposed viral protein residues will be used to eliminate false positive epitopes that we suspect in the less conservative complexes. Once residues from the epitope have been identified through this process, binding affinity changes from VP6 mutagenesis will be used together with the naturally evolved somatic mutations of the RV6-26 antibody that enhance binding affinity (Fig. in silico procedures for the prediction of antibody mutations that produce higher affinity, higher specificity binding to a desired target macromolecule than the natural antibody sequence. Studies involving the in vitro evolution of antibodies have shown that the diversity of structurally stable antibody sequences is much greater than the diversity observed in nature, which suggests that this diversity could be exploited for therapeutic antibody design [in silico-in vitro integrative approach to guide the design or enhancement of therapeutic antibodies.In addition to conformational epitope identification, computational docking that integrates experimental data may lead to more general y design ,23. CompThe authors declare that they have no competing interests.BAM and JM conceived of the computational strategy. BAM carried out the computational analysis and drafted the manuscript. NLK carried out the experimental studies, and JEC oversaw the experimental design. All authors contributed to the draft of the manuscript and helped interpret the results. All authors read and approved the final manuscript.

Ma) at and near Fossil Butte National Monument in Wyoming, USA, is world famous for its exquisitely preserved freshwater teleost fish in the former Fossil Lake. Nonetheless, trace fossils attributed to fish interacting with the lake bottom are apparently rare, and have not been associated directly with any fish species. Here we interpret the first known feeding and swimming trace fossil of the teleost Notogoneus osculus Cope (Teleostei: Gonorynchidae), which is also represented as a body fossil in the same stratum.The Green River Formation to make the swimming traces; and used a ventrally oriented mouth to make overlapping feeding marks. We hypothesize that the tracemaker was an adult Notogoneus osculus.A standard description of the trace fossil, identified as Our results are the first to link a specific teleost tracemaker with a trace fossil from the Green River Formation, while also interpreting the size and relative age of the tracemaker. The normal feeding and swimming behaviors indicated by the trace fossil indicate temporarily oxygenated benthic conditions in the deepest part of Fossil Lake, counter to most paleoecological interpretations of this deposit. Lastly, our spatial and mathematical analyses significantly update and advance previous approaches to the study of teleost trace fossils. Ma), a semitropical lacustrine deposit in the western U.S., is world-famous for its exquisitely preserved fossil-fish assemblage, particularly in the area of Fossil Butte National Monument in Wyoming, USA The Green River Formation , is the only one restricted to a single fossiliferous bed (F-1 of 1), colloquially called the “18-inch Layer.” N. osculus, the type species for the genus, is also notable for its ventrally oriented mouthparts, a rare anatomical trait among Green River Formation teleosts, supporting its interpretation as a bottom-feeder N. osculus in Fossil Lake is at odds with some sedimentological and geochemical interpretations for the 18-inch Layer, interpreted as the deepest part of the lake and hypothesized as anoxic, dysaerobic, or otherwise hostile to benthic fauna N. osculus, a catfish (Astephus antiquus), and rays in Fossil Lake suggest that bottom waters were occasionally aerobic enough to allow for these fish in deeper parts of the lake. Moreover, some seasonal mixing is suggested by alternation of kerogen-rich layers with micrite One of these fish species, N. osculus, lends new insights on its behavior, as well as the paleoecology of Fossil Lake. The trace fossil (FOBU-12718) indicates swimming and systematic benthic feeding by a teleost with downward-pointing mouthparts, linking it anatomically with N. osculus. Moreover, our calculations of dimensions and other aspects of the trace fossil are anatomically consistent with a adult tracemaker, based on recent growth series defined for this species As a result, the discovery of an extraordinary trace fossil from the 18-inch Layer, which we attribute to 40K/40Ar as 50.2±1.9 Ma40K/40Ar, resulting in a weighted mean age of 51.66±0.09 MaMa) or Wasatchian North American Land Mammal Age (about 55-51 Ma). The 18-inch Layer is well known for its exquisitely preserved fossil fish, particularly teleosts, but also includes body fossils of plants, insects, birds, mammals, and reptiles sensuFOBU-12718 was recovered from the Dayvault Quarry, which is adjacent to Fossil Butte National Monument and on Wyoming public land . This quThe trace fossil is discernable via exposure of darker, pale to moderate yellowish brown (10YR 6/2 to 5/4), kerogen-rich mud in a lamina just below the lighter-colored micritic surface, as well as through slight variations in relief along the planar surface. FOBU-12718 is from a horizon about 12.5 cm below the top of the 18-inch Layer, and consists of a part (FOBU-12718A) and counterpart (FOBU-12718B). Unless indicated otherwise, descriptions are of the part, which preserves the trace fossil in negative relief. The slab containing the studied specimen had been cut into a rectangle, 23×108 cm, for ease of extraction and storage, and the trace fossil is in the central lengthwise portion.The trace fossil contains several interrelated waveforms . Among tUndichnaUndichna cf. simplicitasUndichna cf. simplicitas, and it is preliminarily interpreted as a trace made by a swimming teleost fish.Thin, shallow impressions forming regular waveforms are assignable as trace fossils to the ichnogenus In order to better quantify the motion and size of the tracemaker, we conducted a spatial analysis of FOBU-12718. An actual-sized color digital composite photograph of FOBU-12718 was madej (jf) can be represented as a simple combination of sine and cosine functions as follows:0, an and bn defined by the integrals:A harmonic analysis was performed to describe the mathematical properties of the traces. By fitting the digitized data to a Fourier series j (λj) in Euclidian space was derived by the formulae λj = (j2π/w), whereas the 95% confidence intervals (CI) were derived by applying the same formulae to the CI of wj. Similarly, the maximum wave amplitude and CI of appendage j (jA) were derived by the formulae Aj = 2*2+b2)1/2. We applied fj, λj and jA to each appendage's fitted wave coefficients. For the central, overlapping ellipsoidal impressions, a Fourier series was also fitted to estimate the central axis of the digitized traces.From the above formula and coefficients, and considering that measurements of FOBU-12718 were made in Euclidian (XY) space, we were able to estimate the frequency and maximum amplitude of the waves associated with each putative appendage. Briefly, the wave frequency of an appendage The cyclical changes imparted by the tracemaker body parts, evidenced by impressions in the sediment, formed a running wave that was fitted accurately by a simple Fourier series , Table 1Notogoneus osculus, on the basis of interrelated qualitative and quantitative criteria, including the stratigraphic co-occurrence of the trace fossil with body fossils of N. osculus in the 18-inch Layer. As mentioned previously, thin, shallow impressions with regular waveforms are assignable to the ichnogenus Undichna; moreover, the paired, in-phase waveforms in association with a higher-amplitude waveform are best identified as U. cf. simplicatasUndichna are ascribed to trails made by the fins of swimming fish Specimen FOBU-12718 is interpreted as a compound swimming and feeding trail made by a bottom-dwelling teleost, specifically The single, high-amplitude trail is ascribed to the caudal fin, which was formed as an incision of the sedimentary surface by the ventral of the fin as it moved the fish along the bottom. This trail is typical of a subcarangiform swimming mode, in which the posterior half of the body length propels the fish forward and most of the power stroke is derived from the caudal fin All ventrally oriented fins of the tracemaker are thus accountable as wave-like traces in FOBU-12718. As a result, a feature of the tracemaker's ventral anatomy other than its fins must have made the medial series of traces . We propN. osculus is expected to have caused a minimal trace in comparison to that of the caudal fin, which is indeed the case in FOBU-12718.In our interpretation, the buccal diameter is estimated as 7–12 mm . The antN. osculusj) or amplitude (Aj) of a given fin trail j) for the pelvic and caudal impressions in FOBU-12718 (27–28 cm), estimated tracemaker length (L) would be 43–45 cm long (where L = λj/0.62). Using formulae by Videler j/0.68) and 36–37.5 cm with ventrally oriented mouthparts Hypsidoris farsonensis Lundberg and Case, Amyzon gosiutensis Grande et al., and Astephus antiquus Leidy. H. farsonensis is much smaller than our estimate for the FOBU-12718 tracemaker, at about 19–22 cm long, and thus far has only been found in Lake Gosiute deposits of the Green River Formation, east of Fossil Lake A. gosiutensis only occurs in the Laney Shale Member of the Green River Formation, having never been found in the Fossil Butte Member or Fossil Lake, and has a standard length of only 24 cm A. antiquus is unknown as a body fossil in the middle unit of Fossil Butte Member, and only one specimen has been found in all of Fossil Lake, although it is abundant in Lake Gosiute strata N. osculus was the most likely tracemaker for FOBU-12718 in terms of its stratigraphic occurrence in the same stratum and location in Fossil Lake.Because of this evidence, in addition to the occurrence of N. osculus is identified as its tracemaker, as it is the only species known from the Green River Formation that could have contacted the sediment-water interface with its mouth while swimming with a subcarangiform motion. N. osculus was originally described as lacking teeth in the maxilla, premaxilla, dentary, pterygoids, or hyoids, but a reexamination of a newly found specimen confirmed teeth on the endopterygoid N. osculus led to an assumption that it fed on soft organic matter or small invertebrates along lake bottoms, perhaps through suction N. osculus extended ventrally enough to have incised the sedimentary surface while swimming within a few centimeters of that surface, while minimizing contact of the anal fin with forward movement. In contrast, the lack of traces from the pectoral fins means these must have been elevated off the surface, and perhaps aided in swimming.Based on the related traits of the trace fossil FOBU-12718, Discontinuities of the pelvic-fin trails also likely relate to pitch and yaw of the fish while swimming. For example, a slight tilt of the axial plane of the fish to the left could have caused the right pelvic fin to lift off the surface and resulted in a gap on that side. These gaps correspond with the medial feeding trace approaching the lateral plane of the opposing side, which would have been consistent with a slight yaw as the fish swam along the lake bottom. In other words, these breaks in the continuity of the fin trails also constitute parts of the trace fossil, and have behavioral significance. Furthermore, our mathematical extrapolations of the incomplete waveforms define, with high probability, the locations of each tracemaking appendage above the sedimentary surface, even where no traces were made, as well as the size of the fish .N. osculus, the most significant implication of this discovery is of this teleost behaving normally in the deepest-water portion of Fossil Lake. Middle Unit deposition took place during a maximum high-stand (transgression) of Fossil Lake, which is associated with wetter climatic conditions Besides the first known linkage in the geologic record of a trace fossil with N. osculus, with its ventrally oriented mouth, was likely adapted for benthic feeding. Nonetheless, this feeding was originally assumed to have taken place in shallow-water environments of Fossil Lake or in nearby freshwater streams feeding into the lake N. osculus was presumed to have fed on bottoms under shallower depths than those interpreted for the 18-Inch Layer, most of its body fossils, accordingly, can be considered as allochthonous. This presumption, though, is contradicted in at least one instance by the trace fossil described here, which may indeed represent a time of at least temporary oxygenation of bottom waters. As a result, FOBU-12718 and other specimens of Undichna from the 18-inch Layer could represent seasonally linked behavior of Fossil Lake teleosts, although this idea requires more testing. Unfortunately, extant gonorynchid relatives of N. osculus, such as various species of Gonorynchus, provide imperfect models for seasonal variations in behavior, as these are all exclusively marine and live in the Indo-Pacific region. Nonetheless, their similar anatomies and bottom-feeding habits in shallow-marine environments, the latter lending to their nicknames as “sand fish” As mentioned previously, Undichna) was previously reported from the Fossil Lake deposit Undichna attributable to teleosts have been found since then in the 18-Inch Layer and other fish-bearing zones of the Green River Formation in the area of Fossil Butte, which will be the subjects of future study , a behavior that had been previously interpreted for this species The Green River Formation is a deposit world-famous for its fossil teleosts, but relatively little work had been conducted previously on its fish trace fossils. This paucity of ichnological data is advanced considerably by FOBU-12718, an extraordinary trace fossil from the 18-inch Layer of the Fossil Lake Member in Wyoming. This combined swimming and feeding trace fossil provides the first known independent evidence of bottom-feeding behavior in N. osculus, rare among fossil teleosts from the Green River Formation, comprised the only previous evidence of a bottom-feeding habit in this species. The trace fossil is from the same stratum containing the only known specimens of N. osculus from this area, further narrowing the identity of the tracemaker. This trace fossil and other swimming traces from the same stratum refute suggestions that benthic conditions in Fossil Lake of the Green River Formation were permanently anoxic and inhospitable for bottom-dwelling teleosts. Our discovery thus prompts a reexamination of the previously interpreted paleoecology of Fossil Lake, and adds bottom feeding as an aspect of the benthic ecology in the deepest part of the lake.The ventrally oriented mouthparts of Notogoneus osculus, rather than excluding them, as was previously supposed.The trace fossil represented by specimen FOBU-12718 is indeed special in showing more detailed evidence of behavior other than a teleost simply swimming along a lake bottom. This trace fossil also demonstrates the utility of ichnology in testing previous interpretations of teleost behavior based on functional morphology, while refining paleoecological interpretations of Green River teleosts in conjunction with their abundant and well-preserved body fossils in Fossil Lake. This discovery also suggests that, at least for brief periods, lake bottom waters were occasionally oxygenated and provided feeding opportunities for near-benthic fish, such as Lastly, the trace fossil itself represents only a fleeting moment in the tracemaker's interactions with the lake bottom, but has broad implications in terms of interpreting the paleoecosystems of Fossil Lake. This snapshot of teleost behavior from Fossil Lake is thus all the more remarkable for its brevity and apparent rarity, but also for how it potentially alters previous assumptions about the paleoecology of Fossil Lake.Text S1Supplementary text.(0.07 MB DOC)Click here for additional data file.Figure S1Cross-correlogram between caudal and pelvic fin distances derived for FOBU-12718. Lags are represented in cm from the caudal fin.(0.08 MB TIF)Click here for additional data file.File S1This datafile contains the raw XY coordinates (in mm) from all the FOBU-12718 identified appendages and mouth marks.(0.08 MB XLS)Click here for additional data file.

Ovarian cancer patients may experience psychological disorders due to the aggressive nature of the illness and treatment. We investigated the presence of psychological disorders longitudinally in women with a new diagnosis of ovarian cancer and the factors that predicted development and maintenance of these disorders. Patients were assessed in a prospective longitudinal study at the beginning of chemotherapy treatment, mid-treatment, end of treatment and 3 months follow-up for depression, anxiety, perceived social support, neuroticism and cognitive strategies to control unwanted thoughts. A total of 121 patients were recruited and 85 patients were assessed at all four time points. Three different longitudinal profiles of anxiety and depression caseness were found: non-cases (never cases), occasional cases and stable cases . Most of the women were occasional cases of anxiety , whereas for depression, the majority of women were non-cases . A subset of patients were stable cases of anxiety . Neuroticism and marital status were significant independent predictors of anxiety caseness profile. Neuroticism and use of anti-depressants were independent predictors of depression caseness profile. Social support was not related to psychological morbidity. Ovarian cancer is the fourth highest cause of mortality in female cancer patients and the most fatal malignancy of the female genital tract. It has a lifetime risk of approximately 2%. It is uncommon before the age of 40, but the incidence increases with age, reaching a peak in the late 70s. The disease presents, predominantly, at an advanced stage, with a 5-year survival rate of 45%. Less than 20% of tumours are localised at the time of diagnosis .Ovarian cancer patients may be at high risk of developing psychological morbidity . PublishThis study was designed to investigate the presence of psychological disorders in ovarian cancer patients from immediately after diagnosis and referral to a specialist treatment centre and over the period of their treatment and follow-up. We were interested in identifying caseness for psychological disorders and not just symptoms or distress, as this was considered a more important clinical outcome and accurate assessment of significant psychological morbidity. We used a prospective longitudinal design, in which patients were assessed at similar time points during their illness course and treatment. This allowed us to investigate the course of psychological disorders over time and identify those patients in which psychological morbidity was persistent. We hypothesised that (i) three different psychological morbidity profiles would appear across time, which were stable cases , occasional cases and non-cases of anxiety and depression (patients who were never classified as cases); (ii) poor social support, high neuroticism and use of worry as a coping strategy to control unwanted thoughts would be associated with the development and persistence of psychological morbidity.Participants were recruited from consecutive new referrals attending the ovarian cancer outpatient clinic of Christie Hospital, Manchester, UK, a specialist cancer centre, subsequent to their diagnosis but before the start of their treatment. Eligible participants were patients with a new diagnosis of ovarian, peritoneal or fallopian tube carcinoma, who provided informed consent, who did not have a pre-existing organic brain disorder or severe mental illness and were able to understand English language. Written consent was obtained from all patients.Patients with a diagnosis of peritoneal or fallopian tube carcinoma were recruited because they are remarkably similar in their morphology, clinical behaviour and treatment to ovarian cancer , time 2 , time 3 , and time 4 .Ethical Committee approval was obtained from the Local Research Ethics Committee before commencement of the study.A structured interview schedule was used to record general demographic and clinical information including age, marital status, employment status and education. Coexisting physical health problems, current mental health problems, current psychological treatment, past mental health problems, past psychological treatment , current anti-depressant medication, time since cancer diagnosis and family history of cancer were also assessed. A subjective rating of current subjective physical health was obtained by asking patients to rate their physical health on a 7-point scale , Karnofsky Performance status KP; , chemothThe following standardized psychological measures were used; all have acceptable psychometric properties.The Hospital Anxiety and Depression Scale HADS; was the r=0.55; perceived criticism r=0.79).The Social Support Inventory SSI; assessedr=0.68 and r=0.83).The Thought Control Questionnaire TCQ; assessedThe Revised Eysenck Personality Questionnaire EPQ-R; evaluateData were analysed using the SPSS Version 13.0. Descriptive statistics were used to analyse the sample characteristics and psychological measures.Patients were divided into three groups according to their profile of the occurrence and persistence of anxiety and depressive disorders across time. For both anxiety and depression separately, the following classifications were made: (1) patients who were never cases on any of the four assessment time points – ‘stable non-cases’; (2) patients who were cases on at least one assessment but not all four assessments – ‘occasional cases’; (3) patients who were cases on all four assessments – ‘stable cases’. Cases comprised of scoring 8 or above in the HADS anxiety or depression scale at that assessment time point.post hoc analyses. Multinomial Logistic Regression analysis was performed to estimate adjusted odds ratios (ORs) and 95% confidence intervals (CIs) for confounding variables. This method calculates ORs for a dependent variable with more than two categories, evaluating the effect of each explanatory variable. This analysis was performed to predict the three-category-dependent variable: ‘stable non-cases’, ‘occasional cases’ and ‘stable cases’ of anxiety. Binary Logistic Regression was used to predict the two-category-dependent variable: ‘stable non-cases’ and ‘cases’ of depression . This was carried out using Stepwise Forward model. Patient characteristics, medical and psychological variables identified in the univariate analysis with a P=0.1 (significance at a 10% level) entered the first model of the Multinomial Logistic Regression and the Binary Logistic Regression model. Statistical significance was set at P⩽0.05.Non-parametric statistical tests were used to compare measures that were categorical and where measures significantly departed from normal; otherwise, parametric statistics were used for group comparisons. Tukey's honestly significant differences (HSD) test was used for all n=121).From 148 patients who met the inclusion criteria, 25 refused participation and 2 provided informed consent but failed to return the questionnaires. The most common reasons for refusing to participate in the study were that the patient was not interested in the study or did not want to be reminded about their cancer. A total of 121 patients participated in the study and completed the measures for at least one time point, with 118 completing assessments at T1, 106 at T2, 100 at T3 and 95 at T4. Eighty-five patients completed all four assessment points. Eleven patients were assessed only once, 7 only on two occasions, 17 on three occasions and 86 on all four occasions. Eleven patients died during the duration of the study. U=1012.000, P=0.008; medians −80 and 70, respectively) and a better response to treatment (χ2 (2)=9.25, P=0.01). It is possible that those who did not complete assessments did so due to the severity of their illness.Of the 121 patients, 36 were excluded from the present longitudinal analysis due to incomplete data. Comparisons were made, on all variables, between the 85 patients with a complete data set and the 36 with incomplete data. Owing to the large number of comparisons, significance was set at 1%. There were no differences on demographic characteristics, psychological variables, time since cancer diagnosis, treatment type, stage of disease and type of diagnosis. Those with complete data had significantly higher KP scores ‘stable non-cases’, (2) ‘occasional cases’, and (3) ‘stable cases’. F=3.03; P=0.054). Post hoc analysis indicated that patients in stable cases were younger than those in stable non-cases. Groups also differed regarding marital status (χ2 (2)=6.11; P=0.047) and length of time since cancer diagnosis =5.43; P=0.006). The proportion of married women was greater in stable cases. Compared with the other two groups, patients in stable non-cases had a longer length of time since cancer diagnosis when compared to those in other groups.Comparisons of three anxiety profile groups were made on all characteristic and medical data. There were statistically significant differences among the groups with respect to age =19.04; P<0.001). Non-cases had the lowest scores of neuroticism, whereas stable cases exhibited the highest scores of neuroticism. Higher levels of neuroticism were associated with higher rates of anxiety, which tended to be persistent (stable cases). The three groups also varied significantly in the use of worry to control unwanted thoughts =3.94; P=0.024), with non-cases having significantly lower worry scores and stable cases the highest.The three groups differed significantly regarding neuroticism (n=47) and ‘cases’ (n=38). Comparisons of the two depression profile groups indicated statistically significant differences between the two groups with respect to subjective physical health rating scores , use of anti-depressants (χ2 (1)=8.91, P=0.003), length of time since cancer diagnosis (t(83)=2.87; P=0.005), stage of disease and KP . Non-cases self-rated their health status as better compared with cases . Significantly more patients in the cases group had taken anti-depressants. There was a longer time since diagnosis in non-cases (mean=61 days) than in cases (mean=45 days). Patients in the cases group had more advanced FIGO stage (stage III or IV) and lower KP scores than those in non-cases. Patients in the cases group reported higher neuroticism (t(80)=−4.05, P<0.001) and used more worry as a coping strategy to control unwanted thoughts (t(79)=−2.33, P=0.022) than non-cases.Occasional cases and stable cases were combined due to a low number of patients in stable cases. This resulted in two groups of patients: ‘non-cases’ (χ2 (4)=38.53, P<0.001. Marital status (P=0.041) and neuroticism (P<0.001) were overall significant and independent predictors of anxiety profile group. Married women and those with greater neuroticism were at higher risk of being in group 3 (stable cases) compared with no caseness of anxiety. The risk of being a stable case increases by 9.38 if the patient was married compared with not being married and by 1.59 for every unit increase in neuroticism.Age, marital status, education, length of time since cancer diagnosis, neuroticism, worry and punishment entered the first model of the Multinomial Logistic Regression to identify significant independent predictors of anxiety profile groups. The overall statistics for the final equation were χ2 (2)=17.89, P<0.0001. Neuroticism (P=0.005) and use of anti-depressants (P=0.027) were significant and independent predictors of depression profile group. Patients who used anti-depressants ) and had higher neuroticism scores ) were more likely present in the cases group. The likelihood of being a case increased by 5.073 if the patient used anti-depressants and by 1.17 for every unit increase in neuroticism scores.Length of time since cancer diagnosis, KP, stage of disease, subjective physical health rating, current mental health problems, use of anti-depressants, neuroticism, distraction, worry and social control entered the model of the Binary Logistic Regression. The overall statistics for the final equation were Our study is the first to assess anxiety and depression in patients with ovarian cancer prospectively and longitudinally over the illness course and treatment. We approached consecutive referrals to a specialist cancer centre of patients who were new cases of ovarian cancer before the commencement of their treatment regimen. This allowed us to assess psychological morbidity over a standard treatment regimen and time period. Thus, avoiding as much as possible the heterogeneity of patients and timing that potentially confounds psychological research in cancer patients. Secondly, we assessed patients over four assessment points so as to investigate the persistence of psychological disorder, thus avoiding the difficulties inherent in cross-sectional studies. We have also assessed ‘cases’ of anxiety and depression rather than symptoms so as to identify clinically significant levels of psychological morbidity rather than just distress, which may be understandable, transitory and less clinically important. Our results support previous findings that anxiety and depression are present after a recent diagnosis of ovarian cancer, and during the treatment of the disease and the follow-up period . We inveMarital status and neuroticism were independent predictors of anxiety caseness, whereas use of anti-depressants and neuroticism were the best predictors of depression caseness. Previous studies have shown equivocal results between marital status and psychological distress (In this study, neuroticism was associated with persistent psychological morbidity. This is a consistent finding in the general literature and in cContrary to our prediction, perceived social support was not associated with psychological morbidity. These results were surprising, as social support has been identified previously as an important factor associated with psychological distress and disorders in patients with ovarian cancer or that The use of worry as a strategy to cope with unwanted thoughts was significantly associated with anxiety and depression over time. Worry relates to persistent rumination in an attempt at problem solving . Our resOur results also showed that women who were persistent cases of anxiety were younger than women that were not cases, and there was a trend towards younger women being persistent cases of depression. This is consistent with previous findings in ovarian cancer patients (Lower subjective physical health ratings were significantly associated with caseness of depression. This result agrees with that of our earlier study (There are limitations to this study. First, we analysed a sample that was representative of ovarian cancer patients in the UK regarding disease stage and age of diagnosis . NeverthIn practical terms, our results support the need of routine and repetitive screening for identification of persistent psychological morbidity and the provision of adequate and appropriate psychological management. There is a question as to whether scarce resources for psychological treatment should be used to target only those whose psychological disorders persist, or should be used more generally to target early in treatment to prevent persistent morbidity or whether all, even transitory, morbidity is a legitimate treatment target. Furthermore, whether screening for risk factors based on predictive associations, such as high levels of neuroticism or ineffective coping strategies, would identify those at high risk of persistent morbidity and serve as treatment candidates. At least in depression, there appears to be an argument for the use of efficacious psychological treatments, such as cognitive behaviour therapy, as the use of anti-depressants is associated with more severe psychological morbidity so that treatment response can be assumed to be incomplete.

A total of 41 metastatic colorectal cancer (CRC) patients received tegafur/uracil (UFT)+leucovorin (LV)+oxaliplatin alternated with UFT/LV+irinotecan. The overall response rate was 58.5% , and the median progression-free survival was 8.8 months. There were no grade 4 toxicities; 12 patients (29%) experienced grade 3 diarrhoea. There were no cases of hand–foot syndrome. This alternating regimen seems to be effective and well tolerated in the first-line treatment of patients with metastatic CRC. Recent developments in the treatment of colorectal cancer (CRC) include the introduction of oral fluoropyrimidines, such as tegafur/uracil (UFT) and capecitabine, which may replace infusional 5-FU . TegafurAfter the promising response rates reported in phase II, two randomised trials of the UFT/leucovorin (LV) combination found that it was as efficacious as conventional 5-FU/LV, but had a better safety profile .In order to increase the efficacy while minimising toxicity, we designed a new chemotherapy protocol in which UFT/LV is alternately combined with L-HOP and CPT-11. The aim of this phase II study was to evaluate the antitumour activity and toxicity of this new regimen in patients with metastatic CRC.9 l−1 and platelet count of ⩾100 × 109 l−1, and creatinine and total bilirubin levels ⩽1.25 times the upper normal limit. Adjuvant 5-FU-based chemotherapy had to be completed >6 months before entry.The eligibility criteria were histologically proven metastatic colon or rectum adenocarcinoma, no previous chemotherapy for metastatic disease, age 18–75 years, an ECOG performance status of 0–2, bidimensionally measurable disease, a life expectancy of at least 3 months, an absolute neutrophil count of ⩾1.5 × 10The exclusion criteria were operable metastatic disease, severe cardiac dysfunction, chronic diarrhoea or uncontrolled infection.The study was approved by our local Ethics and Scientific Committee; all of the patients gave their written informed consent.The pretreatment evaluation included a detailed history and physical examination, complete blood cell count, whole blood chemistry, and chest and abdominal computed tomography (CT). During treatment, the patients underwent weekly complete blood cell counts, fortnightly clinical assessments, and routine biochemical tests.Response was evaluated after two 35-day cycles using WHO criteria paraesthesia or temporary (7–14 days) painful paraesthesia or functional impairment. In cases of persistent (⩾14 days) painful paraesthesia or functional impairment, L-HOP was omitted from subsequent cycles until recovery.−2 day−1) and LV (90 mg day−1) were given for 28 days of a 35-day cycle, combined with a 2-h infusion of L-HOP (85 mg m−2) on days 1 and 15. On day 35, the next cycle consisted of oral UFT/LV at the same doses for 28 days, combined with a 90-min infusion of CPT-11 (180 mg m−2) on days 35 and 49. The treatments were alternated until disease progression, unacceptable toxicity or consent withdrawal.Oral UFT every 8 h; if the doses could not be divided equally, the highest was administered in the morning.Intravenous (i.v.) 5-hydroxytryptamine-3 antagonists plus dexamethasone 8 mg i.v. were administered before the infusions. No cytokine prophylaxis was recommended.As at least 40% of patients respond to standard 5-FU/LV+CPT-11 or 5-FU/LV+L-HOP combinations, a >60% response to a new regimen with acceptable toxicity can be considered promising. Using Simon's two-stage minimax design, with alpha and beta error probabilities of 0.10, at least 41 patients were required .A total of 41 patients with metastatic CRC were enrolled between September 2001 and January 2003 and partial responses in 21 (51.2%): an overall response rate of 58.5% (95% CI 42.2–73.3%) confirmed by an independent radiological review. In all, 13 patients (31.7%) had stable disease, and four (9.8%) progressive disease. The median response duration was 7.1 months (range 3.2–16.4). Postchemotherapy surgery of residual metastases was attempted in eight patients (19.5%) with liver involvement only, and was macroscopically complete in four (9.8%). After the study, 12 patients received second-line chemotherapy with mitomycin and six a weekly 5-FU/LV bolus.The median follow-up was 15.6 months; median progression-free survival (PFS) 8.8 months (95% CI: 7.4–10.2); median overall survival 17.3 months (95% CI: 14.6–20.4) , 16.6 (98%), and 34.9 mg m−2 week−1 (97%).The median received cumulative dose intensity was 32 g mIn all, 12 patients (29%) and 21 cycles (12%) required dose reductions of at least one drug. A total of 34 cycles (19%) were delayed by >1 week because of diarrhoea (9%), neutropenia (2%), other toxicities (2%), or reasons unrelated to the treatment (6%). Tegafur/uracil was interrupted for a median of 3 days (range: 1–7) in 33% of the cycles, because of diarrhoea or other toxicities.−2 week−1) and CPT-11 (planned 36 mg m−2 week−1), but our results (58.5% response rate) and other recent clinical data suggest that prolonged tumour exposure to a fluoropyrimidine plus full doses of L-HOP alternated with full doses of CPT-11 can be highly efficacious in metastatic CRC and, if an increase in the rate of CR or PFS cannot be achieved by combining all the three active compounds in one regimen, much can be said in favour of sequential treatment regimens.Our alternating regimen was well tolerated as the proportion of patients with grade 3 diarrhoea (29%) was only slightly higher than that reported with UFT/LV alone. Grade 3 diarrhoea was most frequent during cycle 2, which suggests a cumulative component and/or overlapping toxicity with CPT-11.−2 day−1) was lower than the 300–350 mg m−2 day−1 used by other authors. The complete absence of hand–foot syndrome is very promising and a major advantage over similar studies of capecitabine. However, only a randomised trial can clarify the question as to whether capecitabine or UFT is the best oral 5-FU drug for combination chemotherapy.The low level of haematological toxicity was mainly due to the choice of an alternating regimen, which favours safety (no overlapping toxicity) at the expense of dose intensity. Nevertheless, a high incidence of severe neutropenia, associated with greater use of haematopoietic growth factors, is often reported when 5-FU, L-HOP, and CPT-11 are simultaneously combined (−2), and the fact that a biweekly schedule of a dose of 85 mg m−2 in a 2-h infusion may minimise the symptoms of chronic cumulative neuropathy (The low level of neurotoxicity was due to the low median cumulative L-HOP dose per patient (470 mg muropathy .In conclusion, our findings suggest that the combination of UFT/LV+L-HOP alternated with UFT/LV+CPT-11 is an effective and well-tolerated regimen for the first-line treatment of metastatic CRC.

Targets that modulate liver toxicity, in vitro, were computationally predicted and some targets were experimentally validated.Drug-induced liver toxicity is one of the leading causes of acute liver failure in the United States, exceeding all other causes combined. The objective of this paper is to describe systems biology methods for identifying pathways involved in liver toxicity induced by free fatty acids (FFA) and tumor necrosis factor (TNF)-α in human hepatoblastoma cells (HepG2/C3A). Systems biology approaches were developed to integrate multi-level data, i.e., gene expression, metabolite profile, toxicity measurements and The liver plays a central role in clearing toxic chemicals from the human body and is susceptible to toxicity during the process. More than 900 drugs have been found to induce liver toxicity, which is a leading cause of acute liver failure in the United States, exceeding all other causes combined . It is oin vitro using HepG2/C3A cells as the experimental model system. Saturated fatty acid, palmitate, was found to induce significantly higher toxicity as compared to unsaturated fatty acids [©) framework. Briefly, toxicity-relevant genes were identified using genetic algorithm coupled partial least squares analysis (GA/PLS) and toxicity pathways were subsequently reconstructed based upon the expression of the identified genes using Bayesian network analysis. The predicted toxicity pathways were then used to infer the effects of perturbing a gene on the liver toxicity using Bayesian inference. Finally, a hierarchical approach was developed to identify toxicity relevant genes by integrating toxicity measurement, metabolite profile, gene expression and pathway information. Gene targets, such as NADH dehydrogenase, were identified and experimentally confirmed to have significant effects on reducing the toxic signal, reactive oxygen species (ROS), and ultimately toxicity levels in palmitate treated liver cells. The details of the approaches discussed in this paper are published elsewhere [We investigated fatty acid induced liver toxicity lsewhere -6. The o2 atmosphere. After the cells reached confluence, the medium was replaced with 2 ml of the chosen medium, either HepG2; or the FFA medium containing 0.7 mM palmitate, oleate or linoleate; or the FFA-TNF-α medium. The FFAs were dissolved in 4% fatty acid-free BSA. TNF-α was added from a 100 μg/ml stock in deionized water to make the desired final concentrations of either 20 or 100 ng/ml.One million HepG2/C3A cells were seeded into each well of a 6-well culture plate. Cells were incubated at 37°C and in 10% COThe cytotoxicity of the treatments was measured as the fraction of lactate dehydrogenase (LDH) released into the medium. Cytotoxicity detection kit was used to measure the LDH release. The gene expression profiles were obtained with the cDNA microarrays at the Van Andel Institute, Grand Rapids, MI , constrained independent component analysis (CICA) and Bayesian network analysis (BN) were integrated within the framework. As a first approximation, we assume a log linear relationship between gene expression and toxicity. In order to extract an independent pathway related to a phenotype, such as cytotoxicity, from the gene expression profile, we applied a constrained ICA (CICA) approach. The relevance of the genes to the toxicity identified by GA/PLS along with the cytotoxicity profiles were used as constraints in CICA. CICA extracted a phenotype-relevant-component from the gene expression data. This was identified by minimizing the mutual information between the phenotype-relevant-component and the other independent components while maximizing the correlation between the component and the constraints. The expression profiles of the genes with the highest weights in CICA were used in BN analysis for network reconstruction. The reconstructed network was perturbed to identify i) which genes, when perturbed, had an impact on altering the cytotoxic phenotype in the palmitate cultures, and ii) how perturbing a gene (node) affected the other genes in the network. More details can be found in our published paper [© was further extended to identify genes relevant to multiple cellular responses, e.g., multiple metabolites, in a separate study [TIPSed paper . TIPS© wte study .A hierarchical framework was developed to integrate the toxicity measurement, metabolic profile and gene expression and pathway information to identify the genes and biological processes that may be involved in the phenotypic responses. The framework consisted of three stages. First, the metabolite changes associated with the cytotoxic phenotype were identified with Fisher's Discriminant Analysis (FDA). To identify the signaling and gene pathways involved in the toxicity, the genomic responses obtained using cDNA microarrays were analyzed with gene set enrichment analysis (GSEA) . FinallyDynamic gene module map analysis results are summarized in Table Note that PPP and glutathione pathways were down-regulated on day 2. PPP and glutathione are known to be related to cellular reactive oxygen species (ROS) level. PPP produces NADPH which is required in converting oxidized glutathione to reduced glutathione. Reduced glutathione is used to reduce ROS levels. Therefore we hypothesized that ROS maybe a toxic signal. We confirmed this hypothesis in a separate study by treat© approach. A simplified toxicity relevant network was reconstructed as shown in Figure To identify the gene targets that may be perturbed to reduce liver toxicity, we integrated the toxicity measurements with gene expression profile using the TIPSMotivated to identify more relevant toxicity-related genes using multiple-source information, we developed a hierarchical approach to integrate multi-level data, i.e., toxicity measurements, metabolite profile, gene expression profile with pathway information to identify potential target genes. First we identified toxicity relevant metabolites using discriminant analysis. As a result, ketone bodies, such as acetoacetate and beta-hydroxybutarate, were found to be highly relevant to the toxic phenotype. Second, we identified toxicity relevant gene sets with GSEA analysis. We found gene sets, such as ROS, ETC, PPP and fatty acid metabolism were significantly enriched. Finally, MBPLS was applied to identify individual genes that were relevant to the aforementioned metabolites and in turn toxicity. Genes, such as glutathione S-transferase, NADH dehydrogenase and ALDH1A1, were identified to be relevant based upon their regression coefficients. NADH dehydrogenase and ALDH1A1 were experimentally confirmed to have significant effects on the ROS as well as the toxicity levels. Further details of these results can be found elsewhere .© approach to first identify toxicity relevant genes and then reconstructed a network based upon the expression levels of those genes. The TIPS© approach provided a way to reconstruct context specific pathways using a limited number of microarray data. It provided an alternative method for pathway to network reconstruction based upon interaction measurements and genome wide network perturbations. It also provided a predictive framework to construct hypotheses based upon computational inference of virtual perturbations. However we would also like to point out that this study is based upon data from an in vitro system, namely HepG2 cells. Thus the insights gained from the analysis could be quite different from what takes place in vivo, i.e., in the liver. In vivo study would be necessary to derive biological insights of this kind.It is the objective of this paper to illustrate how biological findings can be derived from one or more data sources. We first demonstrated that integrating dynamic gene expression profile with pathway information helped to identify the dynamic changes in the pathways and derived hypothesis for further experimental testing. After identifying the timing of the events, we integrated gene expression profile with toxicity measurements using the TIPSWe also illustrated that integrating more information improved the ability of the computational model to identify relevant gene targets and predict possible effects upon perturbation. Within the hierarchical framework, incorporating information, such as metabolite profiles and pathway information, identified genes and pathways that were induced by a toxic signal, such as ROS. Perturbing the genes identified by the multi-source data provided more relevant targets of toxicity as compared with the genes identified with single source, i.e. gene expression, and toxicity measurements. Integrating other sources of information, such as sequence information, could further improve the modeling capabilities. For example, sequence information, such as single nucleotide polymorphism (SNP), has recently been successfully integrated with gene expression data using eQTL and Bayesian network analysis to identify disease related genes .In conclusion, it is feasible to identify phenotype relevant genes using data driven systems biology approaches. Incorporating more information in an effective manner, i.e., hierarchical approach, could improve both target identification and phenotype prediction.BN: Bayesian network analysis; CICA constrained independent component analysis; ETC: electron transport chain; FFA: free fatty acid; GA/PLS: genetic algorithm coupled partial least squares analysis; GSEA: gene set enrichment analysis; MBPLS: multi-block partial least squares; NASH: non-alcoholic steatohepatitis; PPP: pentose phosphate pathway; ROS: reactive oxygen species; SCD: stearoyl-CoA desaturase; SNP: single nucleotide polymorphism; TG: triglyceride; TIPS: Three-Stage-Integrative-Pathway-Search; TNF: tumor necrosis factor.The authors declare that they have no competing interests.ZL conceived the methodology and performed part of the experiments and wrote the manuscript. CC conceived the study and supervised the experiment and writing of the manuscript. All authors read and approved the final manuscript.

From October 2006 to February 2007, clinical specimens from 452 patients with symptoms related to respiratory tract infection in the northern region of Taiwan were collected. Real-time PCR and direct immunofluorescent antibody tests showed that 145 (32%) patients had influenza B virus infections. Subsequently, nucleotide sequence analyses of both hemagglutinin (HA) and neuraminidase (NA) genes of 39 isolates were performed. Isolated viruses were antigenically characterized using hemagglutinin inhibition (HI) test.Phylogenetic tree analysis showed that all the isolates belonged to the B reassortant lineage with HA gene belonged to the B/Victoria/2/87 lineage and the NA gene belonged to the B/Yamagata/16/88 lineage. In addition, a group of children aged between 6 to 8 years old resided in Yilan county were infected with a variant strain. Hemagglutinin inhibition (HI) tests confirmed that all the reassortant influenza B viruses were B/Malaysia/2506/04-like viruses. Pre- and post-immunized serum samples from 4 normal volunteers inoculated with 2007 influenza vaccine were evaluated for their HI activity on 6 reassortant B isolates including two variants that we found in the Yilan county. The results demonstrated that after vaccination, all four vaccinees had at least 4-fold increases of their HI titers.The results indicate that the 2006–2007 seasonal influenza vaccine was effective in stimulating protective immunity against the influenza B variants identified in Yilan county. Continuous surveillance of emerging influenza B variants in the northern region of Taiwan is important for the selection of proper vaccine candidate in the future. Enveloped orthomyxoviruses have segmented negative-sense RNA genomes that facilitate new strain development via mutations and the reassortment of gene segments. This genetic instability is responsible for annual international epidemics and periodic pandemics of influenza infections ,2. InfluHemagglutinin (HA) and neuraminidase (NA) genes have been used to study influenza B virus evolution -10. Two We conducted phylogenetic analyses of HA and NA genes from influenza B virus isolates collected from a group of children complaining of severe headaches in north Taiwan between October 2006 and February 2007. Variants were further tested using a hemagglutinin inhibition (HI) test with a panel of anti-flu B antisera; our results indicate incomplete inhibition. Data from an amino acid sequence analysis of the HA protein showed greater sequence variation to B/Malaysia/2506/04-like viruses in 5 influenza B variants .Between October 2006 and February 2007, 452 throat swabs from patients with symptoms related to respiratory tract infection were collected at the clinical virology laboratory of the Taipei Veterans General Hospital. This laboratory has a contract with the Taiwan's Centers for Disease Control and is responsible for the virological evaluation of all the specimens sent from different hospitals in the northern region of Taiwan. The epidemiological curve and geographic distribution were shown in Figures Filtrates from transport medium containing throat swabs were inoculated into Madin-Darby Canine Kidney (MDCK) cells. HA tests with guinea pig red blood cells were used to test the cultural supernatant for influenza B viral infection. Infected cells were detected using an IMAGEN™ influenza virus test kits contain fluorescein isothiocyanate(FITC) conjugated monoclonal antibodies which bind specifically to influenza virus type B.Viral RNA was extracted from 140 μL of infected tissue culture fluid using a QIAamp Viral RNA mini Kit . Real-time PCR was performed with 5 μL RNA, Taqman one-step RT-PCR master mix reagents , 400 nM primer and 100 nM probe. The primers and probe used were according to Garbino et al. and the EU234376 to EU234451).DNA sequence analysis was performed using software from the Wisconsin Genetics Computer Group (GCG) ,21,22. AAlignment of the respective 739 and 251 base pairs of HA and NA gene sequences was performed using the DNASTAR MegAlign clustal method. Phylogenetic trees were constructed using the neighbor-joining method based on Kimura's 2-parameter distance matrix with 1000 bootstrap replicates, using the MEGA (version 3.0) and PHYLIP (version 3.6) software packages -25. We uHI testing of 2006–2007 samples was performed using the World Health Organization (WHO) Influenza Reagent Kit for identifying influenza isolates, produced and distributed by WHO collaborating center for surveillance, epidemiology and control of influenza in American Continent as described in the kit's manual. Reference strain samples consisted of distinct influenza B anti-sera from four epidemics: B/Malaysia/2506/04 (B reassortant lineage), B/Hong Kong/330/01 (Victoria lineage), B/shanghai/361/02 (Yamagata lineage), and B/Sichuan/379/99 (Yamagata lineage).Among HA screening tests positive cases from 452 specimens, 145 (32%) were confirmed to have influenza B infection using both real-time PCR and IFA test. The epidemiological curve and geographic distribution analyses demonstrated that the influenza B infection reach the peak in December 2006 and there were four outbreaks in Yilan county located in the northern region of Taiwan: outbreak I, 8 children from Jiaosi town; outbreak II, 7 students from Shai-Jin Elementary School in Wujie town; outbreak III, 5 students from Li-Tse Elementary School in Wujie town; and outbreak IV, 5 children from Toucheng town of influenza B virus isolates from 39 patients including 38 children and 1 adult (B/Taiwan/3842/06), all isolates clustered with B/Malaysia/2506/04-HA with a bootstrap value of 96 (P < 0.01) and 4 variants (cluster I) from outbreak II , B/Hong Kong/330/01-like (Victoria lineage), and B/Hong Kong/1351/02-like (B reassortant with Victoria-like HA and Yamagata-like NA genes) ,21,22. WA total of 39 clinical isolates of reassortant influenza B viruses were used for molecular evolutionary analyses of HA and NA genes. Our results show that the HA genes belonged to the B/Victoria/2/87 lineage Figure –that is,Compared to amino acid residues 22–234 of the B/Malaysia/2506/04 HA protein, most of the Taiwanese isolates had only 2–3 changes. Exceptions included 1 strain from outbreak I with 9 changes and 4 variants (cluster I) from outbreak II with 14 changes collected between October 2006 to and February 2007 belonged to the B/Victoria/2/87 lineage Table . These rThe gene variable analysis of influenza viruses can provide information for epidemic and pandemic outbreak surveillance and determination of vaccine strain selection. In this study, we have shown data suggesting that the contemporary vaccine was still effective in stimulating protective immunity against the influenza B variants that we isolated. Therefore, continuous monitoring of emerging influenza B virus variants is vital to successful control not only locally, but also internationally.The authors declare that they have no competing interests.LYM performed the analysis of the data and drafted the manuscript. WSF and LCM revised the manuscript and did supplementary analysis. CKH, CYJ and LWT participated in the design of the study. CYMA participated in the design, revised the manuscript and coordination of the study. They all approved the final version of the manuscript.

Prompt diagnosis of an acute coronary syndrome is very important and urgent referral to a hospital is imperative because fast treatment can be life-saving and increase the patient's life expectancy and quality of life. The aim of our study was to identify GPs' reasons for referring or not referring patients presenting with chest pain.In a semi-structured interview, 21 GPs were asked to describe why they do or do not refer a patient presenting with chest pain. Interviews were taped, transcribed and qualitatively analysed.Histories of 21 patients were studied. Six were not referred, seven were referred to a cardiologist and eight to the emergency department. GPs' reasons for referral were background knowledge about the patient, patient's age and cost-benefit estimation, the perception of a negative attitude from the medical rescue team, recent patient contact with a cardiologist without detection of a coronary disease and the actual presentation of signs and symptoms, gut feeling, clinical examination and ECG results.This study suggests that GPs believe they do not exclusively use the 'classical' signs and symptoms in their decision-making process for patients presenting with chest pain. Background knowledge about the patient, GPs' personal ideas and gut feeling are also important. Chest pain can be a sign of an ischemic or non-ischemic cardiac disease, a gastro-oesophageal or pulmonary disease, a musculoskeletal disorder or psychiatric illnesses, all of which require specific treatment -14. For Severe prolonged chest pain of acute onset accompanied by other specific symptoms is rarely a decision-making problem. Attacks of chest pain that are experienced by patients as not very severe and prolonged, but distressing enough for them to contact a general practitioner, present a more difficult problem in diagnosis and management .In a diagnostic meta-analysis, we were not able to define an important role for individual signs and symptoms in the diagnosis of acute myocardial infarction or acute coronary syndrome (ACS), except chest wall tenderness on palpation, which largely rules out those diseases in low-prevalence settings .This is confirmed by Abu Hani et al. who found that GPs use criteria not present in classical textbooks when diagnosing acute coronary syndrome (ACS), such as person-specific discrepancies between previous and actual consultations.Pauker and Kassirer defined a threshold as the disease probability at which no action changes into action , based on the balance between risks and benefits of acting versus not acting. Similarly, in patients with chest pain, the GP has to decide on referral of the patient rather than making a specific diagnosis of ACS ,17. In fHowever, little is known about the grounds on which GPs decide to refer a patient with chest pain. The aim of our study was therefore to identify GPs' reasons for referring or not referring patients presenting with chest pain.We invited 85 GPs in the first author's region by invitation during a local CME meeting, by personal letter two months later, and by phone-call after another two months as a reminder, to participate in an interview-based study exploring why some patients presenting with chest pain were referred and others were not. To increase the number of participants, we also sent an email to 320 GPs in the region between Brussels and Antwerp. The GPs were asked to call us immediately after seeing a patient presenting with chest pain, regardless of their initial diagnosis and regardless as to whether or not the patient was referred. Cases were not limited to patients with an acute coronary syndrome, but the GPs were actively encouraged to include any patient consulting with chest pain.All interviews were carried out within at most two days after the contact, usually at the GP's office. The semi-structured interview consisted of three main questions: how does the GP act in general when seeing a patient with chest pain and what is considered important when referring or not referring a patient; how would the GP describe this specific patient and what actions were or were not undertaken for which reasons; and how does the GP cope when confronted when making an incorrect decision concerning a patient with chest pain. A more detailed list is given in Table The study was approved by the Medical Ethics Committee/Clinical Research of the Catholic University of Leuven. (ML 2378)Saturation was reached after 21 interviews with 21 GPs; GP characteristics are described in Table Fourteen of these patients were female (mean age 52). Six were not referred, seven were referred to a cardiologist (one of them refused) and eight were referred to the emergency department (one of them refused). Of those seven who accepted referral to the emergency department, three were transported by relatives, two by their GP and two by ambulance.Table All the GPs interviewed gave very personal accounts of their reasoning. All the GPs stated the importance of history taking.-And then I've actually already got an idea of what it is, before I investigate further, I'm 95% certain what it is. (GP17)The decision reasons mentioned by GPs could be divided into three general categories:the GP's background knowledge about the patient, independent of the current episode; the current clinical presentation; and the GP's personal ideas.[specific ACS] Previous coronary events and coronary risk factors were always considered important factors in the referral decision. However, two GPs mentioned that the presence of risk factors is not necessarily indicate ACS.-and given the medical history, i.e. two bypass operations, diabetes and high blood pressure, I had reason enough to think that there was something wrong with his heart again. (GP5)-..I've had patients like that in my office, people who have no risk factors at all and then have a heart attack. But that's extremely bad luck, unlike an obese diabetic who hasn't looked after himself for 20 years, who is a very high risk..(GP17)[not specific ACS] Discrepancies between previous and actual consultations were often stated as a trigger for the diagnosis of heart disease and a reason for referring.-She's normally an active woman, her house is always well cared for but that day she hadn't done a thing the whole day! So that influenced my decision. (GP2)[not specific ACS] The belief that the patient tends to play down the seriousness of his complaints was also an important factor in the decision-making process. It made the GP more suspicious about the possibility of a serious disease needing referral.-a complainer, but if there's really something physically wrong, she's so good at pretending there isn't a problem. (GP8)[specific ACS] Pain on exertion, radiating pain, oppression-like pain were of major importance for the decision. Retrosternal pain was the key for referral. Other localizations were less important.-I almost always ask if it feels tight and then I demonstrate it with my hand, like the tightening of a screwdriver, or pressure of the foot on the ribcage because I usually find that specific enough. (GP5)-I think that if the pain is not retrosternal, for example if it is lateral, there's a lot less chance of heart problems. (GP15)[specific ACS] The start, frequency and duration of the pain are used to decide on referral. Pain of longer duration, constant or very frequent pain dissuaded GPs from referring.-If it lasts longer, one hour or longer or even half a day, then I find that less alarming; it's more likely to be the result of stress or something...if it is only 5 minutes, then I'm much more likely to suspect angina than if it lasts two hours. (GP20)-Something that occurs very frequently, several times a day without being too much of a problem, means it's a lot less acute in my book. (GP7)[specific and not specific ACS] In general, GPs perform the clinical examination to rule in some diseases such as rhythm disorders, lung diseases and gastro-intestinal diseases. Chest wall tenderness is mentioned to rule in musculoskeletal diseases. But in the end, the clinical examination is not considered very influential as regards the referral decision.-Just blood pressure, and doing an auscultation as well to exclude heart arrhythmias, because you never know. A palpation of the abdomen. An auscultation of the lungs, it's rare to get thoracic pain of the lungs, so it would have to be pneumonia that causes the pain. (GP5)[specific ACS] When a GP decides to perform an ECG, it is mainly used to rule in acute coronary syndrome. In cases of an abnormal result, this was an important reason to refer. Sometimes, the combination of a normal ECG, the absence of risk factors and the presence of pain of longer duration was used to rule out ACS.-At that moment I was pretty sure that it was not an acute heart attack because I had an ECG of someone at rest, who had been complaining for a few days; I would have seen something at that moment if it had really been a heart attack. (GP5)[specific ACS] This picture was used in a positive and a negative way. If the picture was positive, urgent referral by ambulance was performed.-It actually depends a little on how the patient looks. If they are pale and sweaty, and really don't look well, then I will always call the medical rescue team. (GP2)-A young man with pain in the left hemithorax, frequent and daily shooting pain when at rest, not sharp, just a few seconds. He's not able to move during those moments and he is anxious. The clinical examination was completely normal. No ECG was taken; it's probably something musculoskeletal or perhaps nothing, just anxiety. (GP18)[not specific ACS] Without the 'typical coronary heart disease patient' picture, the appearance of the patient – their looks – was often stated as very important in the decision-making process. It is more than the combination of the signs and symptoms: it is more like a 'gut feeling'.-She came in and she was different from usual: she looked drawn. It was really striking: her countenance was so sharp. (GP2)-Basically, if it looks fishy, I refer them immediately. (GP1)[not specific ACS] Uncertainty as well as explicit certainty about an acute coronary syndrome were reasons for referring the patient.-If I'm not sure and anxious about it, then I refer. (GP4)-But I think that if I'm reasonably sure it's a heart attack, I will always call for the medical rescue team. (GP4)[not specific ACS] Younger patients were referred more readily to the emergency department than older ones. Older people were sometimes not referred because the expected benefit of the referral was considered to be limited.-For the whole of society too; why should society pay so much money if you know that the prognosis is very limited. Incidentally she died a few days later. (GP17)[not specific ACS] Some GPs objected to the attitude of these personnel, which made it more difficult to refer.-The whole scene; the sirens and waking up all the neighbours, and those men, my room is too small for them with their 5 cases and oxygen and you stand there...And when they remember to think of it, they ask if you've given the patient anything. (GP18)[specific ACS] If the patient has been given the all-clear by a cardiologist, can give the GP a false feeling of certainty about the absence of an acute coronary syndrome and influence his referral attitude.-I have to say that I hesitated a little, especially because he had been to the cardiologist a few days before and had been told everything was alright. (GP14)[specific and not specific ACS] Ten GPs mentioned an error relating to chest pain patients in the past. The reasons for the error were not recognizing ACS because of resemblance to gastric problems or chest wall tenderness on palpation; or because of the patient's behavior, e.g. the patient is always consulting with minor complaints or always complaining; and for GP-related reasons, e.g. the GP waited too long before making a home visit and the patient was transported by ambulance without the assistance of a medical rescue team. This error created various feelings such as regret and the realisation of the huge responsibility. Talking to the family is reported as being important, but the memory of the error keeps some GPs awake at night. Some GPs mentioned that an error influences subsequent decisions, in that they are more careful and their threshold for action is lower.-Then I can't go straight to sleep when I come home. I continue to think about it for a long time. (GP10)-You feel bad in a way because you made a wrong diagnosis, but I don't lie awake at night; this sort of thing happens, and then it's a case of not justifying yourself to these people, but instead having a chat with them about it. (GP21)-I have to be honest, it sometimes makes me a little over cautious as well. Then I may be too quick to refer a patient so as to be sure nothing is missed. (GP17)Background knowledge on the patient – coronary risk factors, differences in behavior, playing down the seriousness – was an important factor in the decision-making process about whether or not to refer. For those factors, knowing the patient is essential.This study suggests that the background knowledge on the patient, the patient's current clinical presentation and the GP's personal opinions are used by GPs when deciding on whether or not to refer a patient with chest pain. current clinical presentation: clinical examination in particular is used to rule in diseases other than acute coronary syndrome which need no referral. An ECG was used to confirm the presence of an acute coronary syndrome and refer the patient. A normal ECG was a reason for not referring, but only in combination with a long duration of pain and the absence of risk factors. A gut feeling is sometimes more important than the presence of individual signs and symptoms.The GP's personal ideas – the patient's age, perception of a negative attitude from the medical rescue team, recent patient contact with a cardiologist, past errors – were factors in the decision-making process. Sometimes, uncertainty about the diagnosis causes an unnecessary referral. Referring older people has a higher threshold than referring younger people because of the expected smaller benefit.The The interviews were taken very shortly after the GPs had seen a patient with chest pain. This is important, as the GPs may reinterpret their diagnostic reasoning in the light of information from a cardiologist or based on the evolution of the patient's condition.All the interviews were carried out by the principal researcher, himself a GP experienced in medical research and qualitative studies. Being a 'man of the field' and knowing the reality of the situation, certainly had an impact on the interviews, the participants and the analysis. The data were analysed by the principal researcher, who developed the initial codebook, and independently by a second researcher. The second researcher was a sociologist, who introduced a broader, non-medical perspective to the study topic.The recruitment of GPs who were willing to participate in the interviews was a difficult process. The prospect of being judged and facing possible criticism may have been a reason for non-collaboration.Loss of time – without financial compensation – could be another reason. More reminders may have been necessary. Although e-mail is an easy way to recruit GPs, the response is limited. On the other hand, the quality of the interviews of the GPs recruited by e-mail was very high.Compared to the general population of GPs in Flanders, the participating GPs were similar in age and practice organization – single-handed or group practice – but not in gender: female GPs are underrepresented in our sample. Our data did not reveal any difference in reasoning between the three females and the three trainees, and the male group of participants. Of course, gender bias is always possible. The same applies – although in reverse – for the patient population: women are overrepresented here. But female patients with chest pain may present a more diagnostic and decision-related dilemma, in which the selection of the sample does not necessarily threaten the validity of the results. In addition, in qualitative studies, the goal is not to recruit a representative sample of participants to quantify opinions, but rather to elicit all possible opinions and views on a specific subject. In our data, saturation was reached, which suggests that all important criteria were identified.In spite of the recruitment difficulties, all the interviews were conducted with highly motivated GPs. The GPs responded honestly and voluntarily to the interviewer. Although what doctors say they do is not the same as what they actually do, we believe the quality of the interviews was high . The latAbu Hani et al. identified the importance of differences in pain characteristics and the 'typical coronary heart disease patient', the patient's behaviour, the presence of standard cardiovascular risk factors and a tendency to play down the seriousness of the complaints by the patient . They weOthers have found that the 'typical' symptoms of myocardial ischemia are well known by patients . This 'tThe importance of 'certainty' and 'gut feeling' for GPs when referring patients with chest pain has already been demonstrated by Buntinx et al. ,13.We have shown in another quantitative study that, in the case of diagnostic uncertainty, 26% of the patients presenting with chest pain were urgently referred to the emergency department and 53% were not urgently referred to the specialist . In thisThe importance of the GP's gut feeling was also described by Van den Bruel et al. in her GP-based study on diagnosing serious infections in children .Our criterion that the 'perception of a negative attitude from the medical rescue team' increases the referral threshold is in line with Tod's finding, when it was demonstrated that the referral threshold decreases when the consultant was easily approachable and communicated well with the patients and the GPs .The new reasons for referral mentioned in our study should now be further evaluated for their effect in a subsequent quantitative study, in a synthesis of qualitative studies or both. Hopefully, these studies will further enhance our understanding of the referral decisions made by GPs for patients with chest pain.This study suggests that GPs believe they do not exclusively use the 'classical' signs and symptoms in their decision-making process for patients presenting with chest pain. Background knowledge about the patients, GPs' personal ideas and gut feeling are also important. What is already known on this subject- In general practice the low prevalence, the early and often diffuse stages of coronary heart disease are factors making this diagnosis difficult.- Discrepancies between previous and actual consultations alert the GPs to coronary heart diseases.- Based on the threshold theory of Pauker and Kassirer, the GP has to decide whether or not to refer a patient consulting with chest pain.What this study addsReasons for referral of patients presenting with chest pain were the GP's background knowledge on the patient, the patient's clinical presentation and the GP's personal opinions and ideas. In particular, a change in behaviour, typical presentation, a GP's gut feeling, and the perception of a negative attitude from the medical rescue team influence a GP's referral decision. Clinical examination is used to exclude and an ECG to include the possibility of an acute coronary syndrome.The authors declare that they have no competing interests.RB, AV, FB and BA designed the study. RB conducted the interviews. RB and EA analyzed the data. RB wrote the first draft of the article. AV, FB, KH and BA provided substantial subsequent contributions. BA supervised the study design and analysis. All authors read and approved the final manuscript. RB is guarantor.The pre-publication history for this paper can be accessed here:

Ring A is planar and rings B and C adopt chair conformations, while ring D adopts an envelope conformation with the C atom bonded to the methyl group at the flap. The crystal structure is stabilized by intermolecular O—H⋯O hydrogen bondsThe mol­ecule of the title compound, C Å b = 10.1765 (1) Å c = 28.8472 (3) Å V = 2440.25 (5) Å3 Z = 4 Kα radiationCu −1 μ = 0.79 mmT = 296 K 0.30 × 0.20 × 0.20 mm Bruker SMART APEX diffractometerAbsorption correction: none8346 measured reflections3397 independent reflectionsI > 2σ(I)3365 reflections with R int = 0.018 max = 58.8°θ R[F 2 > 2σ(F 2)] = 0.038 wR(F 2) = 0.101 S = 1.07 3397 reflections309 parametersH-atom parameters constrainedmax = 0.24 e Å−3 Δρmin = −0.13 e Å−3 ΔρAbsolute structure: Flack 1983, 1388 FrFlack parameter: 0.0 (2) SMART used to solve structure: SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008SHELXTL (Sheldrick, 2008SHELXL97.Data collection: 10.1107/S1600536809011969/sj2598sup1.cif Crystal structure: contains datablocks I, global. DOI: 10.1107/S1600536809011969/sj2598Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

Mycobacterium tuberculosis will develop activetuberculosis (TB) disease, suggesting a significant role for genetic variationin the human immune response to this infection. Here, we studied TB associationand expression of 18 genes involved in the Toll-like receptor (TLR) pathways.Initially, we genotyped 149 sequence polymorphisms in 375 pulmonary TB patientsand 387 controls from Indonesia. We found that four polymorphisms in theTLR8 gene on chromosome X showed evidence of associationwith TB susceptibility in males, including a non-synonymous polymorphismrs3764880  = 1.8, 95%c.i. = 1.2–2.7). We genotyped thesefour TLR8 polymorphisms in an independent collection of 1,837pulmonary TB patients and 1,779 controls from Russia and again found evidence ofassociation in males . Combined evidencefor association isP = 1.2×10−3–6×10−4.In addition, a quantitative PCR analysis indicated that TLR8transcript levels are significantly up-regulated in patients during the acutephase of disease(P = 9.36×10−5),relative to baseline levels following successful chemotherapy. A marked increasein TLR8 protein expression was also observed directly in differentiatedmacrophages upon infection with M. bovis bacilleCalmette-Guérin (BCG). Taken together, our results provide evidence,for the first time, of a role for the TLR8 gene insusceptibility to pulmonary TB across different populations.Despite high rates of exposure, only 5–10% of peopleinfected with Mycobacteriumtuberculosis, the bacterium that causes tuberculosis; however, only5–10% of those infected will develop active disease.Difference in polymorphisms within genes involved in host immune response hasbeen proposed as a plausible reason to explain this phenomenon. Here, we showgenetic association of four polymorphisms of TLR8, a member ofa well-known receptor family involved in pathogen recognition, in an Indonesianpopulation. The association was replicated in males of a follow up cohort fromRussia. Expression levels of TLR8 transcripts and proteinshowed a marked increase during bacterial infection, confirming our initialfindings. To our knowledge, this is the first time that TLR8has been associated with response to M. tuberculosis. Ourresults suggest that it may play a significant role in tuberculosissusceptibility and disease activity, and thus should be the focus of concertedstudies in human systems.One third of the world population is infected with M.tuberculosisAlthough one-third of the world's population is infected with It is becoming increasingly clear that innate immunity plays a crucial role indirecting many aspects of the host response, including the ensuing adaptiveresponse, making it a primary host defense mechanism. The initial phase of thisprocess is pathogen sensing involving a wide range of pattern recognition molecules.We and others have postulated that pathogen recognition could be a key component indetermining the outcome of infection TLR5 (GeneID:7100), werestudied. The latter was excluded due to a low level of polymorphism and to complexsequence duplications that could make SNP genotyping difficult. We also studiedcytoplasmic TLR adaptors including MYD88 (GeneID:4615),TOLLIP (GeneID:54472), TIRAP (GeneID:114609),TICAM1 (GeneID:148022), TICAM2 (GeneID:353376)and the downstream signaling molecules, IRAK1 (GeneID:3654) andIRAK4 (GeneID:51135), LY96(MD2) (GeneID:23643) CD14 (GeneID:929) TLR4 (GeneID:7099).These observations led us to investigate genetic variants in the Toll-like receptors(TLRs) TLR8 gene (GeneID:51311) on chromosome X that confer susceptibilityto pulmonary TB in males in an Indonesian population and in a large independentsample of TB patients and controls from Russia. Additional evidence in support ofTLR8 (NP_619542.1) in immunity to TB disease came from real-time PCR quantificationof elevated levels of TLR8 transcripts during activedisease, relative to the same individuals following successful completion of anti-TBchemotherapy. In line with this, analysis of differentiated macrophages uponstimulation with BCG over time showed a significant increase of TLR8 expression.Taken together, these results provide strong evidence for the first time, of a rolefor TLR8 in adult pulmonary TB infection.Here we identified four single nucleotide polymorphisms within theTLR8 gene with nominalp-values below 0.05 (TOLLIP and TLR9 (GeneID:54106), withsignificant p-values that were not followed up in this study due to their verylow allele frequencies. Three of the associated TLR8 variants,rs3764879, rs3788935 and rs3761624 localize in the putative regulatory regions,within five kilobases upstream of the gene between all fourpolymorphisms  = 1.22(1.01–1.47)] . Importantly, the minor allele frequency ofrs3764880 in the Indonesian population was strikingly different compared tofrequencies in the Russian cohort, which was concordant with results obtainedfor the populations of European and Asian origin from the HapMap project 1–1.47)] .−5),TLR8v2(p = 5.29×10−5)and MYD88 (NM_002468.3)(p = 4.09×10−5)were the most significantly upregulated in TB patients during active disease,relative to their convalescence. Both variants of TLR8 showed a greater thantwo-fold increase in expression, whereas MYD88 increased by 1.9-fold , whereas TIRAP(NM_148910.2) showed a downregulation of mRNA expression, foldchange = 0.2, but without statisticalsignificance , and againfollowing resolution of disease (6 months after completion of a standardanti-tuberculosis multi-drug chemotherapy). Real-time reverse transcription PCRwas used to study the mRNA levels of 18 genes .We obse1.9-fold . Transcrificance .M. bovis BCG , a new sub-family within the Toll-likereceptor genes. In contrast to the other TLRs, their protein products are localizedintracellular rather than at the cell surface, mostly in association with theendosomal vacuolar system M. tuberculosis is anintracellular pathogen that resides in characteristic phagosomes, which are notacidic and generally do not mature into phagolysosomes The cloning and characterization of human TLR8 polymorphisms are associated withsusceptibility to pulmonary TB among males. Initially we detected association in theIndonesian population and then observed the same effect in a large independentRussian TB collection, suggesting that this might be a true effect. Nevertheless,our combined evidence(P = 6×10−4)does not completely exclude association by chance and further studies instatistically powerful sample collections are important. TLR8 islocated on Chromosome X, which suggests that any allele conferring susceptibility todisease may well have a higher impact among males who carry only one copy of thegene. Indeed, the genetic association was more significant in affected males. Hence,inferences about gender-specific effects could possibly be drawn from our findings,where male carriers of rs3764880 allele A showed an increased susceptibility topulmonary TB. One might expect to find the same association among females homozygousfor the same allele, and a tendency towards an altered distribution of affectedfemales homozygous for the minor allele (10%) was indeed observed whencompared to female controls (6%) in the Indonesian cohort , is a good functional candidate. Its allele G, associated with protectionfrom TB, abolishes a putative start codon within the alternative transcript variant2 Prior to recruitment, subjects diagnosed with diabetes mellitus and HIVcoinfection, both of which are considered to be major risk factors fortuberculosis development, were not considered. Further tests on recruitedsubjects were done to confirm absence of diabetes mellitus and HIVcoinfection. werenot considered in the analyses. Controls with suspected tuberculosis afterchest X-ray examination (N = 24) or ahistory of tuberculosis (N = 7) were alsoexcluded.M. tuberculosis. Patients withextra-pulmonary TB or HIV-positive were not included in the study. Localblood bank donors with no known history of TB were recruited as controls.1,837 cases of pulmonary TB and 1,779 controls were recruited from twoRussian cities: St Petersburg and Samara. Clinical data has been describedelsewhere The demographic and clinical data of the Indonesian and Russian cohorts areshown in The self-reported ethnicity of each subject and his/her parents was carefullyconsidered in an effort to avoid spurious genetic associations arising frompopulation stratification. In order to detect traces of populationstratification in the Indonesian cohort, a large subset of individualsincluded in this first stage of the study, 330 cases and 368 controls, weregenotyped for an independent set of 299 SNPs. One of the SNPs was out of HWEand, thus, excluded from the analysis. These SNPs were chosen to be morethan 10 kilobases away from any known gene, to have average minor allelefrequencies around 30% and to be in linkage equilibrium with oneanother. The correction factor was calculated according to the method ofDevlin and Roeder Genomic DNA was extracted from whole blood following a protocol describedelsewhere RNA was successfully extracted using an RNeasy Mini Kit fromperipheral blood mononuclear cells (PBMCs) of a subset of 23 patients.Consent forms approved by local Institutional Review Boards of the MedicalFaculty of University of Indonesia and the Eijkman Institute for MolecularBiology in Jakarta were signed upon recruitment by all participants. Writteninformed consents from all Russian subjects as well as permission from ethicscommittees were obtained Selection of SNPs was carried out using an in-house database, GISSNP, whichintegrates data from public databases aswell as proprietary data. Polymorphisms with the following characteristics werepreferentially chosen: putative functional variants resulting in changes in theprotein sequence, minor allele frequencies over 5%, average spacingof one SNP every 1 to 2 kilobases. To screen for possible regulatory elements,flanking regions five kilobases upstream and downstream of the gene were alsocovered.Design of a custom Oligo Pool Assay (Illumina) was implemented following themanufacturer's specifications. Genotyping was performed with aBeadStation 500G Genotyping System (Illumina). Genotypes were analyzed withBeadstudio software also from Illumina. Ten SNPs were genotyped with a Sequenomprimer extension-based protocol described elsewhere Genotyping of 247 SNPs from 18 candidate genes was performed in the Indonesiancohort. We found that 75 SNPS (30%) of the genotyped polymorphismswere monomorphic in this population . VariantHelixTree v4.4.1 and Exemplar . Similarly, allelic association analysis was carried out in bothsoftware packages. Allelic p-values were calculated by means of a 2×2chi-square table. A two-sided Fisher Exact test, when counts in any cell fellbelow five, as well as odds ratios were calculated withExemplar. Allelic analysis of SNPs located on Chromosome X wasperformed with Haploview v3.31Hardy-Weinberg equilibrium was calculated in the control group usingHaploview v3.31.The statistical significance of nominal allelic p-values was assessed bypermutation analysis withHaploview v3.31 using the default algorithm proposed byGabriel et al Haplotype blocks and linkage disequilibrium plots were constructed withA subset of 23 patients with active pulmonary TB was selected from a cohortrecruited from an outpatient clinic in Jakarta, Indonesia. Blood samples weretaken from each of the patients at 2 time points: the active phase of pulmonaryTB disease (at the time of admission), and the convalescent phase (6 monthsafter admission and standard anti-tuberculosis multi-drug chemotherapy).Real-time reverse transcription PCR was used to study expression levels of 18genes on peripThe gfp cDNA cloned into mycobacterial-E.coli shuttle plasmid pMV206 was a giftfrom Dr. Alain Baulard . The plasmid was incorporatedinto competent BCG cells by electroporation. GFP BCG was observed by the FACSCalibur flow cytometer (Becton Dickinson).5/ml in 8-well chamber coverglass (LAB-TEK). Monocyteswere allowed to adhere and differentiate into macrophages for 48 hours with 5 nMPMA (Sigma Aldrich) at 37°C in a humidified atmosphere of 5%CO2. Differentiated macrophages were infected with GFP BCG at anMOI of 20∶1 and incubated at 37°C, 5%CO2. Infected cells at 1 hr post infection were washed twice withRPMI without antibiotics to remove uningested and unadhered bacteria. Cells werethen harvested for TLR8 expression as mentioned below. Infected cells at 20hours post infection were washed to remove uningested and unadhered bacteria at4 hours post infection to minimize cell death and re-incubated for a further 16hours. Cells were then fixed with 4% paraformaldehyde (Sigma Aldrich)for 15 minutes at room temperature and cell membrane was disrupted with1% saponin (Sigma Aldrich) for 20 mins at room temperature. Mouseanti-human TLR8 phycoerytrhin (PE) antibody (Imgenex) was used at 3 ug/ml for 1hour at room temperature and excess antibody was washed twice with PBS (SigmaAldrich). To prevent bleaching of the dyes during confocal viewing, anti fadeprolong gold with DAPI (Invitrogen) was added to slides so that it formed aprotective layer over the cells. Slides were stored at 4°C in the darkuntil confocal viewing.The monocytic cell line THP-1 cells were cultured in RPMI1640 supplemented with 10%FBS, penicillin (100 U/ml) and streptomycin(100 ug/ml) (Invitrogen). Cells were plated at a density of2×10The LSM 510 scanhead of the confocal laser-scanning microscope system was used to detect intracellular fluochrome. Cells were scanned bytriple excitation for PE (red), GFP (green) and DAPI (blue) fluorescence. A63× oil objective with numerical aperture of 1.4 was used and imageswere captured.Table S1Location, Allele, Genotype Frequencies, and Allelic p-values of 149 AnalysedSNPs.(0.06 MB XLS)Click here for additional data file.Table S2Genotype Distribution of TLR8 Polymorphisms among Indonesian TB Patients andControls in All and Females.(0.02 MB XLS)Click here for additional data file.Table S3Haplotype Analysis and Distribution of TLR8 Polymorphisms among Male TBPatients and Controls from Both Cohorts.(0.02 MB XLS)Click here for additional data file.Table S4Candidate Genes and SNPs Analyzed.(0.02 MB XLS)Click here for additional data file.Table S5Allele Frequencies of 298 SNPs Tested for Population Stratification in theIndonesian Cohort.(0.07 MB XLS)Click here for additional data file.

Mechanical study of polymethylmetacrylate (PMMA) mixed with blood as a filler.An attempt was made to modify the properties of PMMA to make it more suitable for percutaneous vertebroplasty (PVP).The expected mechanical changes by adding a filler into PMMA included decreasing the Young's modulus, polymerization temperature and setting time. These changes in PMMA were considered to be more suitable and adaptable conditions in PVP for an osteoporotic vertebral compression fracture.Porous PMMA were produced by mixing 2 ml (B2), 4 ml (B4) and 6 ml (B6) of blood as a filler with 20 g of regular PMMA. The mechanical properties were examined and compared with regular PMMA(R) in view of the Young's modulus, polymerization temperature, setting time and optimal passing-time within an injectable viscosity (20-50 N-needed) through a 2.8 mm-diameter cement-filler tube. The porosity was examined using microcomputed tomography.The Young's modulus decreased from 919.5 MPa (R) to 701.0 MPa (B2), 693.5 Mpa (B4), and 545.6 MPa (B6). The polymerization temperature decreased from 74.2℃ (R) to 59.8℃ (B2), 54.2℃ (B4) and 47.5℃ (B6). The setting time decreased from 1,065 seconds (R) to 624 seconds (B2), 678 seconds (B4), and 606 seconds (B6), and the optimal passing-time decreased from 75.6 seconds (R) to 46.6 seconds (B2), 65.0 seconds (B4), and 79.0 seconds (B6). The porosity increased from 4.2% (R) to 27.6% (B2), 27.5% (B4) and 29.5% (B6). A homogenous microstructure with very fine pores was observed in all blood-mixed PMMAs.Blood is an excellent filler for PMMA. Group B6 showed more suitable mechanical properties, including a lower elastic modulus due to the higher porosity, less heating and retarded optimal passing-time by the serum barrier, which reduced the level of friction between PMMA and a cement-filler tube. Vertebroplasty is a popular treatment for osteoporotic vertebral compression fractures, and various preventive strategies have been introduced to reduce the number and severity of complications. Bone cement leakage and embolism can occur when a lower viscosity cement is infused through a cement filling tube with a relatively small diameterExolent Spine contained 20 g (20 ml) of polymer and 9.2 g (8 ml) of monomer per one pack. The specimens were mixed in a operating room with a room temperature of 18℃ and 21% humidity with the cement preserved at room temperature for more than 24 hours. Six specimens were made in each group including the regular cement group (R) and blood-mixed groups , which contained separately 2 ml, 4 ml, and 6 ml of blood in a single pack of cement, respectively. One researcher gave blood, which had a hemoglobin and hematocrit level of 16.7 mg/dl and 34.8%, respectively. It was sampled immediately before being mixed with the cement and should be mixed within a short time (about 1 minute after sampling) prior to hematoma formation. Cement was mixed evenly at a 2 Hz speed for approximately 45 seconds and more 15 seconds after mixing the blood. The mixed cement was transferred into a 20 ml regular syringe and filled into a stainless mold with a 10 mm inner diameter and a 30 mm height to make one block for the Young's modulus, and into three filler tubes with a 2.8 mm inner diameter and 215 mm height to measure the optimal passing-time. The cement remaining in the syringe was transferred into a bowel to measure the polymerization temperature and setting time. The cement block was easily separated by light impact with a rod after 24 hours when the cement specimen had hardened completely. The height and diameter was manipulated accurately with sandpaper and inspected with Venier Calipers with 0.05 mm accuracy. The same procedures were repeated six times to make six samples and collect the data in each group.The Young's modulus was measured using an Instron Micro-test system under a compressive speed and load of 5 mm/minutes and 2 kN, respectively. The Young's modulus was defined as the slope of the stress-strain curve. The displacement by load was measured at 20 Hz and the data collected was analyzed using Bluehill 2 software (Instron). The polymerization temperature reached a maximum after mixing the polymer and monomer, and was measured using an Infrared Thermometer under the condition of 0.9 emissivity and within 10 mm from the specimen for the optimal optic-distance ratio. The setting time was defined as the interval time from a mixing-start point to a point reaching polymerization temperatureThe Young's modulus of group R, B2, B4 and B6 was 919.5±148.2 MPa, 701.0±76.1 MPa, 693.5±104.1 MPa, and 545.6±93.1 MPa, respectively. The Young's moduli of the Blood-mixed polymethylmetacrylate (PMMA) groups were significantly lower than that of group R. The more blood-mixed PMMA showed a lower modulus but the difference between the groups was not significant according to the Post Hoc multiple comparison test . The polThe setting time of the group R, B2, B4 and B6 was 1065±15 seconds, 624±8 seconds, 678±3 seconds, and 606±8 seconds, respectively. The optimal passing-time of group R, B2, B4 and B6 was 75.6±2.6 seconds, 46.6±2.3 seconds, 65.0±6.1 seconds, and 79.0±4.2 seconds, respectively. The optimal passing-time increased with increasing amount of mixed blood but the setting time decreased. The optimal passing-time of B2 was almost the same as that of group R in the Post Hoc test.The porosity of group R, B2, B4 and B6 in micro-CT was found to be 4.2±0.6%, 27.6±1.7%, 27.5±1.4% and 29.5±1.6%, respectively. The blood-mixed PMMA groups showed similar porosity regardless of the amount of mixed blood according to the Post Hoc test. Micro-CT revealed micropores distributed evenly in the blood-mixed PMMA groups .Vertebroplasty with PMMA for osteoporotic vertebral compression fracture is considered to be very successful in that stabilization of fractured osteoporotic vertebral body and dramatic pain relief. However, with the increasing use of the procedure, many complications have been reported. One of them was adjacent vertebral compression fractures, which might be caused by outward factors including stress transferred from a treated vertebra with PMMA, poor sagittal balance and compensation of the upper body shifting after pain relief, intradiscal cement leakage, cement configuration and an infused volume in the vertebral body as well as an inward resistant factor, i.e. bone densityThe moduli and porosities of the blood-mixed PMMAs were unaffected by the volume of blood. The lack on an increase in porosity with increasing blood volume was due to the previous mixing of the polymer and monomer for 45 seconds, which might already produce a certain level of polymerization, and the mixing methods with the hands in which there could be a limitation of flourishing porosity over a certain point. The early mixing of blood and PMMA might allow considerable porosity to the blood-mixed PMMA, but more porous PMMA was not required. Overplus blood, on the other hand, which did not be mixed with PMMA, was shifted to the surface of PMMA and produced a larger plasma barrier on the PMMA specimen.Porosity caused by the mixing of a filler can reduce the modulus of PMMA. A filler which is available in verterbroplasty to endow porosity, should have high viscosity, easy resorption and release from PMMA, water solubility, biocompatibility and biodegradabilityA filler and additive mixed with PMMA can reduce the polymerization temperature. A filler might produce pores in PMMA, which can allow the polymerization heat to dissipate quickly, and an additive may induce a new polymerization reaction with a lower heat of reaction. One of the theories of pain relief by verterbroplasty was the thermal necrosis of the peripheral endings of the nerve fibers in the vertebral body. However, calcium phosphate cement with no exothermic effect can show similar pain relief. On the other hand, a microscopic study showed that micronecrosis around PMMA after verterbroplasty was due to a resorption process rather than to a foreign body reaction caused by PMMA reaction heating or radiopaque bariumAccording to the Hagen-Poiseuille law, the pressure required in passing liquid PMMA through a filler tube is dependent on the viscosity of the PMMA in direct proportionThe setting time decreased in the blood-mixed PMMA, which is similar to the same results of various filler-mixed PMMAs. A decrease in setting times means that the viscosity is elevated faster and PMMA hardens earlier. Viscous PMMA should be passed through a filler tube of a smaller diameter during verterbroplasty rather than kyphoplasty. If the viscosity is elevated over a certain level and an optimal passing-point is missed, sufficient volume of PMMA could not be infused into the verterbral body and become stuck in the tube. However, the optimal passing-time of blood-mixed PMMA was lengthened in proportion to the volume of blood regardless of the shortened setting time, because of the plasma barrier formed on the surface of the PMMA specimen, which worked effectively as a lubricant between the PMMA and the tube. The optimal passing-time of group B6 was similar to that of group R but the setting time of group B6 was reduced by 43% compared to group R. Hence, the viscosity of group B6 was much higher than that of group R at the same point of infusion, which can clinically reduce the risk of extravasation from a vertebral body or an embolism of PMMA.Micro-CT revealed micropores which were distributed evenly but not interconnected, so the PMMA and cancellous bone could not be suspected to be conglutinated in the processing of bone union.In some point of view, bone substitutes were suspected to be replaced for PMMA even in treatment for osteoporotic vertebral compression fractures. Bone substitutes undergo a process of crystallization without an exothermic effect in the body temperature rather than polymerization. In addition, they can be resorbed by osteoclasts followed by the remodeling of host bone, and do not release toxic substances like the monomer in PMMAThere were several limitations in this study due to the aims of the study, which was focused on identifying the clinical problems and solutions during performing vertebroplasty, and the measurement criteria and methods were thought to be possibly affected by the subjective opinion by researchers. The optic-distance ratio must be considered when using an infrared thermometer as a noncontact measurement. The recorded temperature would have been lower than the real temperature if the temperature was measured far from the acceptable distance according to optic-distance ratio when the larger measured area was detected by a non-contact measurement method. An infrared thermometer calculates the average temperature over a certain area. The emissivity of PMMA was believed to be 0.8-0.9, which is similar to plaster or brick. Steinless showed lower emissivity. Therefore, the measured temperature would have been much lower than the real polymerization temperature if the polymerization temperature was measured on the surface of a steinless mold containing PMMA. Accordingly, more studies using similar instruments and objective methods would be done to overcome these limitations and more advisable and objective methods could be commented.Blood was used as a biocompatible filler to modify the properties of bone cement to make it more suitable to vertebroplasty by reducing the Young's modulus to that of the osteoporotic vertebral body and lowering the polymerization temperature. The blood-mixed cement is believed to have clinical benefits in vertebroplasty, in that a lower modulus can reduce the level of stress to the adjacent vertebrae. In addition, the lubricant effect of the plasma membrane can allow a high viscosity cement to pass smoothly under the same pressure for passing regular cement to reduce a risk of cement leakage and embolism. Furthermore, a lower polymerization temperature might also reduce a risk of thermal injury to the nerve tissue.

In spite of succesful adoption of electronic patient records (EPR) by Norwegian GPs, what constitutes the actual benefits and effects of the use of EPRs in the perspective of the GPs and patients has not been fully characterized. We wanted to study primary care physicians' use of electronic patient record (EPR) systems in terms of use of different EPR functions and the time spent on using the records, as well as the potential effects of EPR systems on the clinician-patient relationship.A combined qualitative and quantitative study that uses data collected from focus groups, observations of primary care encounters and a questionnaire survey of a random sample of general practitioners to describe their use of EPR in primary care.The overall availability of individual patient records had improved, but the availability of the information within each EPR was not satisfactory. GPs' use of EPRs were efficient and comprehensive, but have resulted in transfer of administrative work from secretaries to physicians. We found no indications of disturbance of the clinician-patient relationship by use of computers in this study.Although GPs are generally satisfied with their EPRs systems, there are still unmet needs and functionality to be covered. It is urgent to find methods that can make a better representation of information in large patient records as well as prevent EPRs from contributing to increased administrative workload of physicians. Norwegian GPs started to move their clinical documentation work from paper to EPR systems in the beginning of the 1980's. In the last decade more than 95% of Norwegian GPs have been using an EPR system . The high uptake of EPR systems may be looked upon as a proof of their value, but what constitutes the actual benefits and effects of the use of EPRs for GPs and patients have not been fully characterized. Evaluation of EPRs can provide developers, clinicians, and administrators with important information about success and failure .Efficient EPR systems support the workflow and may ease the burden of documentation and accounting, possibly allowing the GP to spend more time in direct interaction with the patient. However, time studies on physician use of EPRs have failed to demonstrate any noticeable reduction in the time spent on clinician-patient encounters -5. RegarUse of computers may influence the clinician-patient relationship. Some patients may feel reassured by an impression of a greater technical, medical and organizational support given by computers compared to paper folders. On the other hand, the screen may act as a barrier between clinicians and patients. EPRs that do not present reliable or relevant data to clinicians when needed could distract the relationship .In this report we have applied three different methods to study GPs' use of EPR: through focus group interviews, observations of clinical practice, and with use of a questionnaire survey. We have inquired about GPs' use of electronic patient records, measured the actual time spent interacting with the EPRs, and observed and interviewed patients and GPs about the impact of computers on the clinician-patient relationship to find out more about the rapid adoption of Norwegian GP EPR systems.Most Norwegian GPs are self-employed and organized in medical practices of an average of 3–4 physicians in a system with enlisted patients. Three different EPR systems offered by two vendors dominate the market . Different sections or modules for basic data, medical data, scheduling, financial functions, communications, statistics and other functions build up the EPR systems, but the information is also accessible from a common chronological view of all documentation in the record. The EPR supports most clinical tasks such as free text progress notes, computerized physician order entry, drug prescription, electronic communication, as well as facilitate other functions needed to be independent of paper records. The EPR systems in Norway do not include decision support or instructions on medical procedures.Data was gathered from interviews of GPs in focus groups, from observations of the use of EPR during encounters in clinical practice, and from a questionnaire sent to a random sample of GPs.Vocational and continuing GP specialist education programs from the Norwegian Medical Association include participation in approved educational groups. We identified some of the groups in the middle of Norway, and invited ourselves to three of them. We chose two continuing groups in the city of Trondheim, and one in the countryside outside Trondheim. The groups represented both GPs with experience with use of paper records and younger physicians with no such experience. There were 23 GPs all together in these groups representing 20 different medical practices. We joined one regular meeting of each of the three groups in 2002 and 2003. The interviews lasted approximately 3 hours. We used an interview guide previously validated by GPs from four different practices and two professors of family medicine. The interviews were recorded on a minidisc with subsequent transcription and later analyzed using NUD*IST Vivo, version 1.1.127. A health secretary familiar with medical terminology transcribed the interviews. Ambiguities were discussed and settled between the secretary, the author (TC) and the co-author (AG). The views expressed across the chosen focus groups were quite consistent and it was considered that more focus groups would not add much additional information.The observation study was conducted at various periods in 2002, 2003, and 2005. The functions in the EPR systems did not change in this period. A total of 80 GP-patient encounters involving four female and seven male GPs in five medical practices were studied. The practices were strategically chosen to represent all EPR systems. One of the GPs observed had participated in the focus group study. The observed clinicians obtained patient consents prior to each encounter and no patients declined to consent. The observer was situated out of the way behind the patient not to disturb the encounter. Use of different modules or sections in the EPR and time spent on EPR related to some of the encounters were recorded. TC and a sociologist research assistant familiar with observations of health personnel conducted the observations. An observation guide that included a short interview of both patients and clinicians was used after being validated by the researcher, GPs from pilot practices and the supervisor. According to the themes of the study, actual use of EPR was noted with subsequent transcription.The questionnaire consisted of two major sections and was validated by 20 randomly chosen GPs in a test-retest pilot study in 2002. The respondents in the main study were selected from a database with names and addresses of all GP members of the Norwegian Medical Association and matched with vendor lists of GPs using specific EPR systems. An electronic software program randomly extracted a group of 136 participants from each of the EPR system users. An information letter was sent on February 6th 2003 to all 408 selected GPs, followed by the questionnaire one week later. We collected the last questionnaires in June 2003 after two written reminders followed by three reminders by telephone.The completed questionnaires were scanned using Teleform and the data were analyzed with SPSS for Windows, version 11.5. Collected material concerning informants' comparative notions of paper records and EPRs, time spent using EPRs during encounters, and effects on clinician-patient relationship was identified and used for systematic text condensation. The analysis of the qualitative material was deductive and the themes and the quotes were derived from the data in four steps: Establishment of a total impression of the material, identification of meaningful units, abstraction of these units, and establishment of the importance of the abstractions . TC codeThe results from the focus group interviews and the observation study are presented together with relevant data from the questionnaire. Of the 408 GPs invited, 70 were lost due to unknown address, leave of absence, or resignation. Of the 338 GPs who received an invitation, 247 (73%) completed the questionnaire; 18 of the respondents were excluded because they used an older version of the system, used other systems, or EPR system data were missing. Wherever the sample size in the results is other than 229, it is due to missing data. Use of different EPR sections was studied in 53 of the encounters; by this time we were getting results that were very similar to those seen in earlier encounters and we did not consider it necessary to study the use of the different EPR sections in more encounters. Reading in EPR ahead of the encounters was studied in 44 observations. We observed that GPs were using the EPR less than expected from the questionnaire survey, and hence time measurement was added to the last 14 observations. We present the results from all three studies under the same research question headings.Saving time looking for patient records, was pointed out by many in the focus groups as a great advantage of EPRs compared to paper records; illustrated by this quote:The EPR is always available and you can easily maneuver between different records. (No 1)The focus group interviews revealed that the GPs had almost immediate access to the index pages of different sections in the EPR. However, this access did not imply that access to relevant progress notes and documents was easy. Patient records with many progress notes and documents were often dominated by redundancy of information and the GPs had problems with achieving sufficient overview. Many of the respondents felt it was troublesome to track earlier episodes and notes in the EPR:My main problem is decreased availability of the information within the EPR in the case of chronically ill patients and patients that have been visiting a number of times. (No 2)Some of the informants indicated that the overview some times could be better in previous paper records:"When using paper records we could spread out the papers on the desk to get an overview." (No 3)Data from the observation study revealed that the GPs rarely spent time searching for historical information in the EPR other than the latest progress notes, medications and results on laboratory tests. Instead, the GPs seemed to rely on their own memory or obtained information through asking the patients about previous episodes. Practically all GPs entered the patient record starting from the list of patients in the appointment book in the EPR. They read the eventual attached remarks or comments made by the health secretary or nurse. GPs read the previous progress note or other parts of the EPR before calling the patient into the office in 36 of 44 observed encounters.This was partly confirmed by results from the questionnaire study: Practically all respondents (99%) reported to find it useful to check upon previous notes while working with patients; 37% sometimes reported to give up searching for information because it was too time-consuming, and 35% found it easier to ask the patient again rather than to search in the patient record. Almost a third (28%) only occasionally tried to search for information because they found it was too time-consuming. More than half of the respondents (57%) found it difficult to display a summary of the actual progress notes.The data from the focus groups revealed that a majority of the GPs emphasized the great time and work savings offered by EPR systems compared to paper records. This was exemplified by renewal of regular prescriptions and account keeping, as well as use of text templates and automatic reuse of administrative and clinical information when writing referral letters, requisitions and forms as presented in this quote:You don't need to write the headings over and over again, and you can also reuse text templates. (No 3)On the other hand, a shift in administrative workload from health secretaries to GPS was also pointed out in the focus groups. Examples mentioned were scheduling and filling in forms as well as writing referral letters and updating demographic data; illustrated by this quote:Earlier I dictated referrals. Now I type them myself. (No 4)These findings were supported by data from the observations. We saw GPs filling in forms, scheduling patients and updating patient contact information, as well as doing all the work surrounding preparation of referral letters. Some even put the referral letter in the envelope themselves . We also observed that a few GPs retyped the same information for each referral letter and requisition instead of reusing former information. The use of the EPRs systems was comprehensive. In 53 of the 80 observed encounters, we recorded which EPR sections were in use. We found that 3 to 13 different sections of the EPR were in use during an encounter, with a mean of 6.2 and a median of 6. We also measured the total time spent using the EPR system in 14 of the observed encounters. Data revealed that the time spent registering and documenting in the EPR in the observed encounters was only half of the time compared to what was estimated by respondents in the questionnaire survey In the observation study we interviewed 24 of the patient after the encounters. None of them expressed discomfort with the GP's use of the computer during the encounter nor felt that the screen was an obstacle between them and the clinician. During interviews with all the observed GPs, most of them stated they were aware of the possibility of disturbing their relationship with the patient, and that they tried to avoid such disturbance. We observed that most of the GPs read in the EPR before the encounter began, minimized the use of the EPR during the encounters, and often did the documentation work when the patient had left.In this study we have found that although the availability of the EPRs was almost immediate, availability of the information within EPRs was not always satisfactory. Use of EPRs was efficient and comprehensive and tightly interwoven with the working processes in their medical practices, but also encompassed more administrative tasks for the physicians compared to paper records. Use of EPRs did not seem to disturb the clinician-patient relationship.The results indicate that although GP EPR systems are successfully adopted and highly integrated with the clinical work, there are still needs and functionality to be met. The information within the EPR was not always easily available. Instead of looking up information in the EPR, GPs often relied on their own or their patients' memory. This was revealed both in the focus groups, the observations and the questionnaire. Other studies also have confirmed that physicians have greater difficulties in achieving a clinical overview of the situation of the patient when using an EPR system .We found that GPs used the EPR widely and preferred them to paper records. We have in another questionnaire study identified extensive use of EPR with support of 21 of 23 important clinical tasks without need of additional support from paper records. (Paper submitted for publication). Hammond et al. have suggested that clinical information systems do lead to a significant improvement in documentation over handwritten flowsheets, both in volume and accuracy . Other sWe registered that GPs spent less time on reading and recording in the EPR than estimated by the doctors themselves in the questionnaire and that the use of EPR was limited during encounters. Studies support that EPRs can be well-designed and efficient clinical tools , but on In earlier studies patients meant that a computer diminishes the doctor's personal touch and could be regarded as an obstacle to eye contact ,20. Our We believe that the high acceptance and adoption of EPRs in Norway is related to user-centered design, integration, a strong support base of users, and reported improved care quality . This is also supported by other studies ,22. OtheIn this study both qualitative and quantitative methods were used to obtain data on experiences, behavior and practice processes. We used different methods and in addition observer triangulation to strengthen validity and relevance as well as credibility, confirmability and transferability in the study . The queOne of the motivations of conducting group interviews was to ensure individual reflections in the groups upon different opinions to ensure internal informant validation. Further validation strategies like negotiations and discussions between TC and AG and research assistants were implemented to avoid errors in the transcription from oral to written information and to validate the findings in both focus groups and observations. Triangulation was carried out in the conduct and analysis of observations to ensure that important or contradictory results related to the research questions were not left out.The observations revealed issues not thought of when designing a questionnaire. We identified late the need of recording the time used on the EPR during encounters. Time spent on documentation was overestimated by the GPs in questionnaires compared to what we observed. Additional time recordings could have strengthened this discovery. The clinician-patient relationship was another issue not planned for in the questionnaire. Even though the selection of GPs for the focus groups and observations were not randomized, we hold the selection to be representative due to the arbitrary recruitment of different GPs from medical practices in rural and urban districts in the existing groups. We also hold the results to be representative and strengthened when confirmed by several methods.Although GPs are generally satisfied with their EPRs systems, there are still unmet needs and functionality to be covered. It is urgent to find methods that can make a better representation of information in large patient records. Further studies are necessary to reveal why and how the introduction of EPRs have increased the administrative workload of physicians and how it could be reduced, as well as clarify contradictory results on time spent on EPR in primary care encounters.The author(s) declare that they have no competing interests.TC planned the investigation and developed the part of the questionnaires used in this study as well as the interview and observation guides with support from his supervisor, AG. TC organized the administration of the questionnaires, focus groups and observations, and analyzed the data with contributions from AG. TC wrote the manuscript with advice from AG.The pre-publication history for this paper can be accessed here:

Frank Netter's rendering of the different parts of the human body are familiar to medical students, physicians and surgeons the world over – moreover, many patients have seen them in consulting rooms. Netter produced over 4000 high quality illustrations over his career, and this atlas represents anatomical paintings from the Netter collection, now extensively revised and updated by an experienced team of consulting editors – they deserve a mention for their input into this book – Jennifer K. Brueckner, Stephen W. Carmichael, Thomas R. Gest, Noelle A. Granger, John T. Hansen and Anil H. WaljiThis book in hardback is 23 cm × 29 cm, and contains a CD ROM with plates from the Atlas Figure . There ast century with a multitude of radiological images, for example MRI and CT scans, and access to supplemental material on the worldwide web. This is a considerable achievement by the editorial team.It is logically divided into sections corresponding to the different regions of the body, and nearly every single page of this book contains a detailed and beautiful anatomical illustration Figure . These hI found this book invaluable in illuminating my understanding of complex areas of human anatomy – for example the pelvic floor and nervous systems.Medical students and surgical trainees without doubt would benefit the most from this book, but it is a must for all health care professionals to have on their bookshelf.The author declares that he has no competing interests.

In-vitro, AAV can interfere with the production of human papillomavirus virions. Adeno-associated virus-2 DNA has also been detected in cervical cancer tissue, although not consistently. To evaluate the role of AAV infection in relation to invasive cervical cancer, we performed a nested case–control study within a retrospectively followed population-based cohort. A total of 104 women who developed invasive cervical cancer on average 5.6 years of follow-up (range: 0.5 months–26.2 years) and 104 matched control-women who did not develop cervical cancer during the same follow-up time were tested for AAV and human papillomavirus by polymerase chain reaction. At baseline, two (2%) case-women and three (3%) control-women were positive for AAV-2 DNA. At the time of cancer diagnosis, 12 (12%) case-women and 3 (3%) matched control-women were positive for AAV-2 DNA. Persisting AAV infection was not evident. In conclusion, AAV-2 DNA was present in a low proportion of cervical cancers and we found no evidence that the presence of AAV in cervical smears of healthy women would be associated with reduced risk of cervical cancer.Adeno-associated virus (AAV) can impair the replication of other viruses. Adeno-associated virus seroprevalences have been reported to be lower among women with cervical cancer. Chlamydia trachomatis infection infection has been established as the main causal factor for cervical cancer . During in vitro : Umeå University , information about the study was made known to the public that donated the samples by press conferences.μl of proteinase K (20 mg ml−1) per 1.0 ml of buffer was used to dislodge the cells off the glass slide, and the cells were pipetted into a sterile Eppendorf tube. An additional 10 μl of proteinase K was added and digestion was carried out at 55–60°C for a minimum of 2 h. Protein was precipitated by the addition of 100 μl saturated ammonium acetate, and centrifuged at 14 000 rpm at room temperature for 5 min. DNA was precipitated using cold ethanol and dissolved in low EDTA, tris-EDTA (TE) buffer.DNA was extracted from archival smears and biopsies as described earlier . Digestion was carried out at 60°C for a minimum of 2 h until a clear lysate was obtained. Heating the samples at 98°C for 10 min inactivated proteinase K.Four 5 All samples were tested for DNA integrity by PCR using human ribosomal gene S14 primers, which gave 150 bp amplimers. The blank sections were tested by S14 PCR to check for contamination during sectioning.−1) and penicillin (500 U ml−1) and DNA was extracted for PCR. DNA was extracted according to the standard protocols and measurements were made by UV-1601spectrophotometer .As positive control, DNA extracted from HA-16 cells (kindly donated by Professor JR Schlehofer) was used. It is a cervical cancer cell line HeLa (containing HPV 18) transfected with AAV-2 . These crep gene. They were tested against a sensitive panel total HA-16 DNA with DNA concentration ranging from 230 ng to 0, 23 pg. The detection limit for non-nested AAV-2 PCR system was 23 pg while that of nested AAV-2 was 2, 3 pg. Oligonucleotide primers used in this study are detailed in Three primer pair sets were chosen for AAV detection. (1) The pan 1/pan 3 primer pairs are general primers for AAV-2, -3 and -5 which have a size of 338 bp , 10 pmol of each of pan-AAV or AAV-2 primers, respectively, 5 μl of 2% BSA and 1.0–1.5 U Taq DNA polymerase . Polymerase chain reactions were performed using Peltier Thermol Cyclerb PTC-100 . The PCR reaction consisted of 40 cycles with the denaturation step at 94°C for 30 s, followed by the annealing step at 62°C for pan-AAV or 64°C for non-nested AAV-2 or 62°C for nested AAV-2 PCR, respectively, for 30 s and extension at 72°C for 45 s. Each PCR was initiated by one denaturation step at 95°C for 1 min before the amplification cycles and completed by one extension step at 72°C for 5 min after 40 amplification cycles. A volume of 10 μl PCR products were loaded into 2% agarose gel and visualised with ethidium bromide. Positive PCR products were sequenced according to the protocol for ABI Prism™ BigDye™ Terminator Cycle Sequencing Ready Reaction Big Dye Terminators Kit kit . Blanks containing no DNA were included as contamination controls. Varying amounts of template DNA was used on repeated PCR runs to overcome the effect of inhibitors present in the DNA extraction.Optimisation of the PCR reactions was tested at different annealing temperatures, primer concentrations and MgClTo test the specificity of the AAV PCR systems, different PCR primer sets directed towards pan-AAV, AAV-2 (nested or non-nested) and HPV amplification were tested on DNA from HA-16 cells (contain HPV 18 and AAV-2), SiHa cells (contain HPV 16) and HeLa cells (contain HPV18).μl of DNA extracts from 10 HPV PCR-negative cervical smears as a check for PCR inhibition. Dilutions of (1 fg–10 pg) DNA extracts from HPV-16-positive SiHa cervical cancer cell-line were also included into each PCR run as a sensitivity panel. DNA from HPV-16-positive CaSki and HPV-negative C33A cervical cancer cell-lines were also included as controls and HPV-18 (E7: 591–900) as described was estimated as odds ratio (OR) by logistic regression using epiinfo software .The PCR primer specificity test showed a positive band using the pan-AAV and the two AAV-2 PCR systems with HA-16 DNA but not when SiHa or HeLa cell DNA was used as template. HPV general primers gave a positive band when all three cervical cancer cell-lines were tested, which is expected as they all contain HPV DNA.μl of template DNA.The level of sensitivity for the three PCR systems used in this study was 2.3 pg HA-16 DNA for nested AAV-2, 23 pg for non-nested AAV-2 and 100 pg for pan-AAV. The detection limits were repeatable and consistent in each PCR run for each system. The S14 PCR, which was incorporated to test the amplifiability of DNA, was positive in all samples tested in this material. To overcome possible intrinsic inhibition of PCR amplifications, three different rounds of PCR of the entire study material were repeated using 1–3 For pan-AAV PCR, AAV DNA was not detectable in any of the baseline smears and their corresponding matched controls, nor in the cervical cancer biopsies. The non-nested AAV-2 PCR system detected AAV DNA in one cervical cancer biopsy and one control smear matched to a cancer biopsy. With the nested AAV-2 PCR, 2/104 (2%) of the prediagnostic smears of cancer cases and 3/104 (3%) of the prediagnostic smears of matched control-women were positive for AAV DNA. At cancer diagnosis, 12/104 (11.7%) of biopsies with cancer were positive and 3/104 (3%) of matched control smears to the biopsies were positive for AAV DNA (OR for cancer in case of AAV DNA positivity: 4.39 (95% CI: 1.11–20.29). Persisting AAV infection in the same woman was not found in any one of the women in our study . ResultsWhen we compared the presence of AAV-2 DNA with HPV DNA of the same sample in the entire study material, none of the prediagnostic smear was positive for both AAV and HPV DNA while 10 biopsy case samples had both AAV and HPV DNA. None of the matched control smears were positive for both viruses. Ninety-seven samples were both negative for HPV and AAV-2 .Adeno-associated virus–2 is considered a common infection worldwide in both adults and children with seroprevalence from 30 to 60% according to a study done involving individuals from Germany, Brazil and Japan , HPV replication was slightly increased. The reverse was seen at high AAV MOI. Thus, suggesting that AAV may have a significant effect upon the kinetics of HPV life cycle regulation in the natural host tissue, where the exact mechanism behind the interaction effect is still largely unknown , as compared to 3% among control-women. The low prevalence in our study material could be influenced by the nature of the specimen. Fixed and stained samples often present with degradation of DNA. To overcome any technical problem, the PCR systems used had been carefully optimised, validated with variable template volumes used to overcome the effect of inhibition. Furthermore, the PCR products produced were within the range suitable for amplification by PCR from archival DNA. However, biopsies contain more cells as compared to smears and that could have contributed to greater success in amplifying AAV DNA. The detection limits for the PCR systems we used were similar for both biopsy and Pap smear. Despite the higher AAV DNA prevalence among the invasive cancers (11%) as compared to the matched smears from control-women, the data suggest an association but a larger sample population utilizing fresh smears or biopsies should be ideal.In conclusion, we found a low proportion of cervical cancer biopsies contain AAV-2 genomes. In addition, AAV DNA persistence was not detectable in our longitudinal study. Adeno-associated virus-2 infection cannot be associated with decreased or increased risk for future development of cervical cancer.

Ethane is released specifically following peroxidation of n-3 polyunsaturated fatty acids. We reasoned that the cerebral source of ethane would be the docosahexaenoic acid component of membrane phospholipids. Breakdown of the latter also releases phosphorylated polar head groups, giving rise to glycerophosphorylcholine and glycerophosphorylethanolamine, which can be measured from the 31-phosphorus neurospectroscopy phosphodiester peak. Schizophrenia patients were chosen because of evidence of increased free radical-mediated damage and cerebral lipid peroxidation in this disorder.This study tested the hypothesis that exhaled ethane is a biomarker of cerebral m/z = 30). Cerebral 31-phosphorus spectra were obtained from the same patients at a magnetic field strength of 1.5 T using an image-selected in vivo spectroscopy sequence . The quantification of the 31-phosphorus signals using prior knowledge was carried out in the temporal domain after truncating the first 1.92 ms of the signal to remove the broad component present in the 31-phosphorus spectra.Samples of alveolar air were obtained from eight patients and ethane was analyzed and quantified by gas chromatography and mass spectrometry .The ethane and phosphodiester levels, expressed as a percentage of the total 31-phosphorus signal, were positively and significantly correlated (n-3 lipid peroxidation. From a practical viewpoint, if human cerebral n-3 polyunsaturated fatty acid catabolism can be measured by ethane in expired breath, this would be more convenient than determining the area of the 31-phosphorus neurospectroscopy phosphodiester peak.Our results support the hypothesis that the measurement of exhaled ethane levels indexes cerebral Indeed,allenges . Since tallenges ,5. Peroxallenges ,7. SOD cin vitro studies have shown that ethane is released specifically following peroxidation of n-3 (and not n-6) PUFAs, a class which includes the long-chain PUFAs eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) [n-3 fatty acid oxidation [n-3 long-chain PUFA-rich cod liver oil, there was a linear increase in exhaled ethane over a period of three hours, compared with no increase in the exhalation of ethane in rats fed a low n-3 long-chain PUFA diet [n-3 PUFA peroxidation in humans, particularly in the brain, for example in children suffering from attention-deficit hyperactivity disorder [in vivo humans studies demonstrating that exhaled ethane is indeed a biomarker of cerebral n-3 PUFA peroxidation.The study of evolution of the volatile hydrocarbon ethane was suggested as a means to detect and monitor levels of lipid peroxidation following the finding that homogenates of mouse brain gave off ethane gas during the process of cerebral lipid peroxidation . The timid (DHA) ,13. Cellxidation ,15, whilUFA diet . Therefodisorder . Howevern-3 PUFA peroxidation. Second, a known non-invasive method must be found which indexes the breakdown of cerebral n-3 PUFAs, so that its results can be directly compared with exhaled ethane levels. We examine each issue in turn.In attempting to provide such evidence, two aspects need to be addressed. First, a cohort of human subjects is required in whom there is increased cerebral It is clearly unethical to promote free radical damage, and therefore increased cerebral lipid peroxidation, in a cohort of human subjects. However, there are several converging lines of evidence pointing to free radical-mediated damage and perturbation of the body's defences against such damage in patients with the brain disorder schizophrenia. Erythrocyte antioxidant enzyme activity has been reported to be altered in chronic schizophrenia , with, in-3 PUFA peroxidation in humans is to choose an appropriate non-invasive technique with which to compare the results of exhaled ethane levels in this patient group. If the source of ethane from the brain is n-3 PUFA peroxidation, then this must primarily be of DHA attached to the sn-2 position of neuronal and glial cell membrane phospholipids, and of intracellular organelle membrane phospholipids. Breakdown of such membrane phospholipids would release the phosphorylated polar head groups from the sn-3 phospholipid position, including phosphorylcholine and phosphorylethanolamine. Glycerophosphorylcholine and glycerophosphorylethanolamine, which are on their catabolic pathways [Ka of 9.5, which is characteristic of the ethanolamine moiety, and coresonated and comigrated with glycerophosphorylethanolamine; the resonance at 0.14 ppm was not titratable and coresonated with glycerophosphorylcholine; the resonance at -0.9 ppm disappeared when the pH was lowered to 8.5 [The remaining issue in investigating cerebral pathways , have bepathways . In a capathways . A furthd to 8.5 .Therefore the technique we chose was 31-phosphorus neurospectroscopy, with the aim of testing the hypothesis that the ethane levels in alveolar air from chronic medicated schizophrenia patients correlate positively with the PDE signal from the same subjects.Eight male patients with a diagnosis of schizophrenia according to DSM-IV-TR and aged-1. The oven was set at 45°C for 10 min and ramped at 14°C min-1 to 200°C at which temperature it was held for 120 s. Ethane (C2H6) was eluted at 2.6 min and identified and quantified by mass spectrometry at an m/z value of 30 by comparison with a standard curve (0–60 pmol) constructed from a C1–C6 alkane standard mix .Each subject was asked to exhale through a disposable sterile mouthpiece into a syringe in one long breath, until they were no longer able to exhale any further. This enabled alveolar (end expired) air to be collected from the lungs. The apparatus was designed in such a way that the same volume of end-expired air was collected from each patient. The air sample was then injected into an automated thermal desorption tube packed with carbotrap 300 via a sodium sulfate drying cartridge . The air samples were analyzed using a Perkin-Elmer autosystem XL equipped with a turbo mass spectrometer. The automated thermal desorption tubes were desorbed onto the cold trap at 320°C, with the cold trap temperature being held at 5°C. The trap was then rapidly heated to 350°C and the liberated volatiles injected onto a 30 m × 0.32 mm PLOT GQ column with helium gas at 2 ml minFor the ethane assay, variability and stability data were obtained using a group of 10 controls tested five days in a row with five tubes per test day. Inter-assay variability (as (standard deviation)/mean × 100%) was 17% and intra-assay variability was 10%. The method used was thermal desorption which is a very good way of collecting and immobilizing gases. The gas levels can reduce on the tube owing to chemical instability and simple desorption and diffusion. For the former ethane is a chemically stable molecule but desorption can occur. This was tested by introducing standards in air onto the tubes and testing at various times thereafter. It was found that after one week tubes retained 97% ethane, while retention was 95% after two weeks, and 90% after one month. Therefore the level diminishes over time, but slowly. Our samples were analyzed within one week of collection.1H, 64 MHz) and 31P (26 MHz). T1-weighted magnetic resonance images were acquired for spectral localization. Spectra were obtained using an image-selected in vivo spectroscopy sequence (ISIS) with a repetition time of 10 s with 64 signal averages localized on a 70 × 70 × 70 mm3 voxel. Owing to the low abundance of 31P compared with 1H, the maximum size voxel was used to collect signal from the brain and thus maximize the signal-to-noise ratio.Cerebral 31-phosphorus magnetic resonance spectroscopy data were obtained using a 1.5 T Marconi Eclipse system with a birdcage quadrature head coil dual-tuned to proton . The seven sets of peaks characteristically identifiable in the spectrum from a normal human brain were identified: in order of decreasing chemical shift, these peaks were assigned to phosphomonoesters, inorganic phosphate, phosphodiesters, phosphocreatine and gamma-, alpha- and beta-nucleotide triphosphate. The quantification of the lgorithm includedlgorithm . The firlgorithm ,36. For Statistical analyses were carried out using the SPSS version 12 statistics program .df = 8, p < 0.05), a non-parametric measure of correlation was calculated between ethane levels and the corresponding percentage PDE values. These two variables showed a significant positive correlation . The data, together with the straight line of best fit and its 95 per cent confidence interval, are shown in Figure Since the percentage PDE values showed a marked deviation from gaussian expected values on a normal Q-Q plot, and gave a Kolmogorov-Smirnov statistic of 0.37, corresponding to a significant deviation from normality , with a majority of the experimentally determined data points continuing to lie within the 95 per cent confidence interval of the mean.In this first study of this type, we have found evidence of a positive correlation between levels of ethane in expired alveolar breath in human subjects and cerebral levels of phosphodiesters, which lends support to our hypothesis. The correlation coefficient between the two variables is high, at over 0.7. We would not expect a perfect correlation, since the long-chain PUFA at the n-3 PUFA catabolism, it would clearly be more convenient, if possible, to measure ethane in expired breath than to determine the level of PDE. Taking a breath sample is quicker, easier and cheaper than carrying out 31-phosphorus neurospectroscopy. Moreover, magnetic resonance scanning is contraindicated in certain subjects, for example because of claustrophobia or safety reasons relating to the presence of certain types of implants. Furthermore, there are some patients who find it difficult to stay still for long enough to acquire meaningful data in a magnetic resonance scanner. An example is children with attention-deficit hyperactivity disorder. The prediction by the fatty acid model of attention-deficit hyperactivity disorder [From a practical viewpoint, when studying human cerebral disorder that thedisorder .n-3 polyunsaturated fatty acid peroxidation, although further studies are required.The evidence from our study would appear to be consistent with the hypothesis that exhaled ethane levels index cerebral The authors declare that they have no competing interests.All the authors made substantial contributions to the design and conception of the study. SJC and BKP were involved in data collection. BMR, GH, IHT and BKP analyzed the data. All authors were involved in the interpretation of the data. All the authors have been involved in drafting and revising the manuscript and have read and approved the final manuscript.

During the last 5 years a fundamental curriculum reform was realized at the medical school of the Ludwig-Maximilians-University. In contrast to those efforts, the learning objectives were not defined consistently for the curriculum and important questions concerning the curriculum could not be answered. This also applied to Occupational and Environmental Medicine where teachers of both courses were faced with additional problems such as the low number of students attending the lectures.The aims of the study were to develop and analyse a curriculum map for Occupational and Environmental Medicine based on learning objectives using a web-based database.Furthermore we aimed to evaluate student perception about the curricular structure.Using a web-based learning objectives database, a curriculum map for Occupational and Environmental Medicine was developed and analysed. Additionally online evaluations of students for each course were conducted.The results show a discrepancy between the taught and the assessed curriculum. For both curricula, we identified that several learning objectives were not covered in the curriculum. There were overlaps with other content domains and redundancies within both curricula. 53% of the students in Occupational Medicine and 43% in Environmental Medicine stated that there is a lack of information regarding the learning objectives of the curriculum.The results of the curriculum mapping and the poor evaluation results for the courses suggest a need for re-structuring both curricula. The concept of curriculum mapping was developed in the 1980s by English, who defined curriculum mapping as a reality-based record of the content actually taught, how long it was taught, and the match between what was taught and what was assessed .Harden describes a curriculum map as a map which displays what is taught, how, and when and with which kind of measurements success can be assessed. The logical arrangements of all parts of the curriculum can be made visible. To create a curriculum map is a time consuming task but it offers many opportunities for all stakeholders in a curriculum. For example, it can help teachers to match their course to the overall curriculum, create valid examinations, and help students identify the learning objectives they have to achieve .Over the past 5 years, a fundamental curriculum reform has been realized at the medical school of the Ludwig-Maximilians-University (LMU) as in many other medical schools worldwide .In addition to reorganization of course content, the integration of "new" teaching methods, such as problem-oriented learning (PBL) and E-learning, have been increased . HoweverAlthough studies show variant results concerning the effects of learning objectives in increasing learning success and extended memory, they are widely accepted as a necessary component of curriculum planning and in the instructional design process ,7. There• What are the priorities of the curriculum?• Are all of the relevant learning objectives covered? If not, which ones are not covered?• How are learning objectives incorporated into the curriculum?• Do redundancies within and between content domains exist. If so, are they intended or just planning errors?• When and how are the assessed learning objectives taught?The aims of the study were to develop and analyse the curriculum map in occupational (OM) and environmental (EM) medicine based on learning objectives using a web-based application ,9. At thA curriculum map for OM and EM based on learning objectives was developed. The reasons for choosing these two content domains as first step of the curriculum mapping were the manageable number of lecturers, the interdisciplinarity of the content and the high interest and enthusiasm of the teachers.In order to develop the map the following process was undertaken:1. Survey of the current curriculum structure2. Attend lectures and tutorials and work through the virtual patient cases during this term to define the learning objectives and course prerequisites in close cooperation with the lecturers.3. Implement an online evaluation (see appendix 1) of the two curricula by the students at the end of the term4. Determine the examined learning objectives of the final multiple choice examAnalyse dataThe course structure and the learning objectives in OM and EM were surveyed by one person attending the lectures and tutorials during one term. Each of the lectures and tutorials was attended, the learning objectives written down and sent to the lecturer for approval. The online virtual patient cases, a mandatory part of the curriculum, were worked through and tagged with learning objectives. In addition to the learning objectives, data collection included the date and duration of the lecture or tutorial, name of the teacher and number of participants.The evaluation was done by implementing a 36 item Online questionnaire course evaluations. Students where invited by email after the final exams and reminded twice to complete the anonymous survey.The results of the questionnaire were analysed in SPSS and are presented as mean values with standard deviation. Differences between groups were evaluated using a t-test."An objective is a description of a performance you want learners to be able to exhibit before you consider them competent. An objective describes an intended result of instruction, rather than the process of instruction itself." [The collected learning objectives were entered into a web-based database, a tool to develop a curriculum map based on specific learning objectives and standard catalogues of learning objectives -10. The itself." along wiitself." . This mo• Learning objectives should have a measurable verb.• Learning objectives should give a specification about what the learners are taught.• Learning objectives should provide criteria for success and competence shall be defined.The web-based tool provides the following functionalities:Teachers can enter their course and exam data including metadata, i.e. title and duration of lecture, specific learning objectives and prerequisites. The learning objectives and requirements have to be connected to one or more standard catalogue entries and assigned to courses using connection parameters such as context, time and quantification. A model of the mapping mechanism is shown in figure The planners of the curriculum can analyze the mapped curriculum and deduce inconsistencies and improvements.Currently the inconsistencies that can be deduced include:• Learning objectives that were not covered.• Overlap with other content domains can be detected.• Learning objectives covered multiple times can be determined.• Timing inconsistency (e.g. a prerequisite has not been taught before the course where it is required) can be found.• Inconsistencies between the learning objectives and the exam content can be identified.Learners will be given access to the database after the mapping is completed.The underlying catalogue is an integrated version of the "Hamburger Lernzielkatalog" (HLZK) , which iIn addition to the collection and analysis of the learning objectives, notes have been taken about the usability and useful improvements of the tool.Because the adequacy of the underlying catalogues was not verified at the beginning of this study, this was also an aspect for investigation.th year) in EM. The main aspects of the two curricula including course settings, covered topics and attendance are shown in Additional file 211 students (3rd year) participated in OM and 223 students (4The response was reasonable with 71 responses (33.6%) in OM and 64 (28.7%) in EM. When students were asked for the reasons why they did not attend lectures, 40% in OM while 39% in EM stated that the time of the lecture was inconvenient; 43.5% in EM vs. 16% in OM stated that lack of time was their reason for not attending the lectures.The students also stated that the subject was valued as "not relevant/boring" while 53% in OM and 43% in EM answered that there is a lack of information regarding the learning objectives.The overall rating of the different courses indicated a slightly better score for the online cases than for lectures or the tutorial .Comparing the learning objectives covered by the curriculum to the underlying catalogue (HLZK), it was shown that in OM, 8 catalogue entries were neither covered in a lecture, nor in a tutorial or case. For EM 8 catalogue entries were not covered.In OM, the tool identified overlaps with catalogue entries in internal medicine (11), prevention (10) and hygiene (3). In EM overlaps with hygiene (6), clinical chemistry (5) and occupational medicine (4) were identified.Analysing the redundancies within each curriculum, 31 learning objectives were covered multiple times in OM and 6 in EM. Timing inconsistency could not be discovered within each curriculum. The analysis of the objectives that were examined in comparison with the taught learning objectives, identified some discrepancies. Five learning objectives in OM and two in EM have been part of the MC exam but were not covered in the taught curriculum. Table The results of the study showed that it was feasible to develop and analyse a curriculum map of learning objectives with the tool we created. The analysis of the data identified overlaps, missing learning objectives and discrepancies between the taught and the tested curriculum.To avoid assessing a "fictional curriculum" , which cThe analysis of the mapped curricula in combination with the evaluation results and the low attendance rate at the lectures suggest a need for modification. These modifications such as reducing redundancies and adding the not-covered learning objectives to lectures cannot yet be done automatically by the tool, but have to be discussed and agreed upon by the teachers in OM and EM. The aims of such modifications include enhancing the number of participants in the lectures, enhancing motivation of students and sharpening the focus of the teaching.The response rate of the online survey was reasonable , but only 16% of the students in OM and 7% in EM actually attended and evaluated the lectures. Therefore the rating of the lectures might change significantly if the attendance rates were higher.In OM, the tutorials have been rated unsatisfactory and the structure will be reorganised and improved. Due to the low overlapping of content between the tutorials, taught by different teachers, the taught content is not consistent enough to be part of the final exam. Either the content should be changed, which might be difficult due to the different backgrounds of the tutors or the focus of the course could be sharpened. One possibility might be to accept that the tutorials are not exam relevant and deal with special topics in each tutorial, allowing students to elect which tutorials they would like to attend. If the focus of the curriculum includes practical topics such as history taking, physical exam, workplace investigations, it might be useful to include these in tutorials.On the other hand, the online cases have been well received by the learners, which is confirmed by earlier studies . To incrThe analysis of the not covered learning objectives strongly depends on the defined catalogue entries. Therefore, the completeness and adequacy of the underlying catalogues is essential for the significance of the analysis results. With the low number of defined learning objectives in OM and EM it is evident that the catalogue needs to be extended and modified. For example, work-related accidents are not mentioned in the curriculum or in the catalogue. In both, the practical aspects of OM and EM, such as taking an occupational/environmental history are absent. On the other hand, experts might consider deleting some other non-relevant catalogue entries, e.g. metal fume fever.th year. This might also allow tutors to increase the knowledge they require students to know from other content domains like internal medicine (which is currently taught in the same year as OM). Furthermore this might reduce redundancies between OM/EM and other content domains, although both fields have interdisciplinary aspects. Before assessing timing inconsistencies relating to the overall curriculum, the mapping of the relevant content domains like internal medicine has to be completed.The analysis of the curriculum showed redundancies in OM and EM of 5%, though the expected percentage was higher due to the fact that the topics covered are often similar. An explanation for this could be that the lecturers dealt with the same topic but focused on different aspects. Nevertheless it is reasonable to discuss combining OM and EM and teaching both in 4Although the adequacy of the final exam in OM was rated 2.9, the learning objectives for 5 out of 30 questions had not been taught. Having a mapped curriculum provides a review about the learning objectives of the curriculum and thus allows exam preparation to be in alignment with the covered learning objectives. The questions do not necessarily have to be created by the lecturers themselves. In the future one person can design the exam based on the curriculum database.The implemented curriculum map in OM and EM was the starting point for the complete mapping of the LMU medical curriculum (MeCuM). Lessons learned from this first step will be considered when extending the mapping and analysis to all MeCuM courses and learning resources.For example we discovered a need to extend the software. Instead of keeping the knowledge levels attached to the catalogue entries, another connection level will be included to allow teachers to alter the skills level of the catalogue entry. Also it has been detected that the underlying catalogues are not necessarily adequate for all content domains and have to be modified by experts. The next step will be to discuss the necessary adaptations of the HLZK in coordination with specific OM and EM catalogues. It will be important to find and implement solutions for adding catalogue entries while doing editorial checking. Based on these changes in catalogues, the analysis will be repeated.Currently the re-structuring in OM and EM and necessary changes are discussed and considered in a group of lecturers and students. These changes will be implemented, evaluated and students given access to the database. Acceptance and influences on students learning will be evaluated.After having implemented modifications, the mapping, evaluating and analysing of both curricula will be repeated and results compared with the data gained so far.The results from this analysis will be considered when restructuring both curricula. As a second step experiences from this approach will be used to map the complete medical curriculum at the LMU Munich (MeCuM).The authors declare that they have no competing interests.IH drafted the manuscript, developed the underlying software and contributed significantly to the conception, design and implementation of the study.DN contributed substantially to the conception, design and implementation of the study.KR and SK contributed significantly to the conception, design and implementation of the study, as well as to the interpretation of data.MF contributed substantially to the conception and design of the study and gave major didactical inputs.All authors have been involved revising the manuscript critically and given final approval.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1472-6920/10/60/prepubTranslated questionnaire developed for this study.Click here for fileTable S1.Click here for file

Extracts of glioblastomas and meningiomas were analysed by quantitative immunoelectrophoresis for the presence of foetal brain antigens and tumour-associated antigens, and levels of 2 normal brain-specific proteins were also determined. The following antibodies were used: monospecific anti-S-100 (glia specific); monospecific anti-GFA , (astroglia specific); polyspecific anti-foetal brain (12-16th week of gestation); a polyspecific anti-glioblastoma antiserum, absorbed with insolubilized serum, haemolysate and normal brain extract; polyspecific anti-alpha-foetoprotein; and monospecific anti-ferritin. Using the antibodies raised against the tumours, several antigens not present in foetal or adult normal brain were found in the glioblastomas and the meningiomas. These antigens cross-reacted with antigens present in normal liver and were therefore not tumour-associated. S-100 was found in glioblastomas in approximately one tenth the amount in whole brain homogenate, whereas GFA was found 2-4 times enriched. The 2 proteins were absent in meningiomas. The possible use of the GFA protein as a marker for astroglial neoplasia is discussed. Five foetal antigens were found in foetal brain, but none in the tumours. alpha-Foetoprotein could only be demonstrated in foetal tissue extracts, including foetal brain, but not in tumours. Ferritin was detected in all tumour extracts, although the amounts determined were unrelated to histological tumour type.

Weak intra­molecular C—H⋯S and C—H⋯Cl inter­actions generate S(6) and S(5) ring motifs, respectively. In the crystal structure, centrosymmetrically related mol­ecules are linked into dimers by N—H⋯S hydrogen bonds. These dimers are arranged into sheets parallel to the ab plane and are stacked along the c axis. C—H⋯π inter­actions involving the methyl­propyl­phenyl ring and π–π inter­actions involving the dichloro­phenyl ring [centroid–centroid distance = 3.5865 (3) Å] are also observed.In the title Schiff base compound, C Å b = 9.4441 (2) Å c = 14.4244 (4) Å α = 104.669 (2)°β = 95.492 (2)°γ = 110.418 (1)°V = 1042.33 (5) Å3 Z = 2 Kα radiationMo −1 μ = 0.43 mmT = 100.0 (1) K 0.29 × 0.20 × 0.16 mm Bruker SMART APEXII CCD area-detector diffractometerSADABS; Bruker, 2005T min = 0.887, T max = 0.934Absorption correction: multi-scan (19865 measured reflections6032 independent reflectionsI > 2σ(I)4139 reflections with R int = 0.050 R[F 2 > 2σ(F 2)] = 0.046 wR(F 2) = 0.136 S = 1.00 6032 reflections256 parametersH-atom parameters constrainedmax = 0.59 e Å−3 Δρmin = −0.47 e Å−3 Δρ APEX2 (Bruker, 2005APEX2; data reduction: SAINT (Bruker, 2005SHELXTL (Sheldrick, 2008SHELXTL; molecular graphics: SHELXTL; software used to prepare material for publication: SHELXTL and PLATON (Spek, 2003Data collection: 10.1107/S1600536808021272/ci2627sup1.cif Crystal structure: contains datablocks global, I. DOI: 10.1107/S1600536808021272/ci2627Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

The pathogenesis of SARS coronavirus (CoV) remains poorly understood. In the current study, two recombinant baculovirus were generated to express the spike (S) protein of SARS-like coronavirus (SL-CoV) isolated from bats (vAcBS) and the envelope (E) and membrane (M) proteins of SARS-CoV, respectively. Co-infection of insect cells with these two recombinant baculoviruses led to self-assembly of virus-like particles (BVLPs) as demonstrated by electron microscopy. Incorporation of S protein of vAcBS (BS) into VLPs was confirmed by western blot and immunogold labeling. Such BVLPs up-regulated the level of CD40, CD80, CD86, CD83, and enhanced the secretion of IL-6, IL-10 and TNF-α in immature dendritic cells (DCs). Immune responses were compared in immature DCs inoculated with BVLPs or with VLPs formed by S, E and M proteins of human SARS-CoV. BVLPs showed a stronger ability to stimulate DCs in terms of cytokine induction as evidenced by 2 to 6 fold higher production of IL-6 and TNF-α. Further study indicated that IFN-γ+ and IL-4+ populations in CD4+ T cells increased upon co-cultivation with DCs pre-exposed with BVLPs or SARS-CoV VLPs. The observed difference in DC-stimulating activity between BVLPs and SARS CoV VLPs was very likely due to the S protein. In agreement, SL-CoV S DNA vaccine evoked a more vigorous antibody response and a stronger T cell response than SARS-CoV S DNA in mice. Our data have demonstrated for the first time that SL-CoV VLPs formed by membrane proteins of different origins, one from SL-CoV isolated from bats (BS) and the other two from human SARS-CoV (E and M), activated immature DCs and enhanced the expression of co-stimulatory molecules and the secretion of cytokines. Finding in this study may provide important information for vaccine development as well as for understanding the pathogenesis of SARS-like CoV. Although the SARS epidemic was successfully contained by July 2003, the pathogenesis of SARS CoV remains poorly understood.Severe acute respiratory syndrome (SARS) is an emerging infectious disease caused by a novel coronavirus (CoV) variant, SARS CoV The viral envelope of SARS CoV contains at least three structural membrane proteins, spike (S), membrane (M), and small membrane or envelope (E) proteins Paguma larvata) and raccoon dogs (Nyctereutes procyonoides) in wild live markets in China suggests that the virus may be originally from animal reservoirs The isolation of SARS CoV from Himalayan palm civets (Virus-like particles (VLPs) represent a specific class of subunit vaccine that mimics the structure of authentic virus particles. VLPs present viral antigens in a more authentic conformation than other subunit vaccines and are readily recognized by the immune system In this study, we have investigated whether the S protein of SL-CoV isolated from bats can incorporate into VLPs formed by the E and M proteins of human SARS CoV. In addition, because in vitro infection model of bat SL-CoV has not so far been established, we intended to use VLPs as an alternative to study the immune responses induced in DCs. Therefore, we compared the phenotypic and functional changes of immature DCs inoculated with BVLPs or with SARS CoV VLPs. The S-specific immune activation was further confirmed in mice using S DNA vaccines. Findings described in this report may have significance for understanding the evolution and the pathogenesis of SARS CoV.bs gene was amplified by RT-PCR and cloned into pFastBac DUAL vector. The recombinant baculovirus vAcBS was generated following transfection in sf21 cells. The recombinant baculovirus vAcME, expressing the E and M proteins of SARS CoV WH20 strain (GenBank accession number AY772062), was previously described The VLPs formed by the S, E and M proteins of SARS CoV were successfully constructed in our previous study using a baculovirus system Immature DCs were incubated with 10 µg/ml BVLPs for 16 h. The expression of costimulatory molecules and the maturation marker CD83 were analyzed. DCs treated with PBS or Ac were used as negative controls. As shown in DC maturation not only leads to up-regulation of adhesion and co-stimulatory molecules, but also results in secretion of proinflammatory cytokines that can activate innate and adaptive immune responses We previously constructed SARS CoV VLPs and investigated the humoral and cellular immune responses induced by SARS CoV VLPs in mice To understand the types of T cells stimulated by VLPs-exposed DCs, IFN-γ and IL-2 intracellular staining was measured by flow cytometry. As show in s and bs gene into pcDNA3.1 to construct the recombinant plasmids pcDNA-S and pcDNA-BS, respectively. These two plasmids were then immunized in mice intramuscularly every two weeks. Ten days after the final immunization, IgG1 and IgG2a were measured to determine the humoral immune response profiles by ELISA. As shown in The observed difference in DC-stimulating activity between SARS CoV VLPs and BVLPs was very likely due to the S protein. To further confirm our conclusion, we cloned ELISPOT assay was also used to assess the magnitudes of S-specific IFN-γ (Th1) and IL-4 (Th2) T-cell responses after the mice were vaccinated with pcDNA-S or pcDNA-BS. Compared with pcDNA-S immunization, antigen-specific IFN-γ-secreting cell number was 2-fold higher and IL-4-secreting cell number was 3 times higher in mice immunized with pcDNA-BS (P<0.05) . Moreovehttp://www.ncbi.nlm.nih.gov/entrez/query.fcgidbpubmedcmdSearchitoolpubmed_AbstractPlusterm22ZhaoP225BAuthor5D. In the absence of S protein, expression of other structure proteins, such as M and E proteins, does not induce a detectable neutralizing antibody response The spike (S) protein of SARS CoV is a key protein involved in viral entry and therefore the main target for vaccine design Using baculovirus expression system, we constructed BVLPs incorporated with the E and M proteins of human SARS CoV and the S protein of SL-CoV of bats. Electron microscopy (EM) detection confirmed the formation of VLPs, which were very similar to the morphology of the native virus. Western blot indicated that BS protein was incorporated into BVLPs. Because the major difference of S proteins between SARS CoV and SL-CoV locates in the S1 region (∼64%) and the S2 region is more conserved (92% to 96%) SARS CoV mainly targets lung tissues and the clinical syndrome of SARS indicates that the host immune system is greatly damaged Our previous study found that VLPs formed by the S, E, and M proteins of human SARS CoV elicited strong SARS CoV-specific humoral and cellular immune responses in mice and conferred protective immunity against the infection of S protein -pseudotyped murine leukemia viruses (MLV) Different types of DCs may play different roles in the onset of a Th1 or Th2 immune response. The balance between Th1 and Th2 cells is important and may determine the outcome of an immune response toward infection and allergy. We therefore studied the influence of BVLPs-stimulated DCs on T cell polarization by intracellular cytokine staining. Compared to mock-treated DCs, BVLPs-exposed DCs increased the population of IFN-γ or IL-4 positive CD4 T cells. The IFN-γ secretion level was much higher than that of IL-4, indicating a bias of Th1 immune response. Because matured DCs can enhance native T cells differentiation, these results further confirm that BVLPs can induce DCs activation and maturation.BVLPs had stronger ability to stimulate DCs by inducing the production of IL-6 and TNF-α in our study. To address whether such difference was S protein specific, we constructed two recombinant plasmids pcDNA-S and pcDNA-BS, and detected their immune responses in mice. The higher level of IgG2a and the higher number of S protein-specific IFN-γ or IL-4-secreting cells in mice immunized with pcDNA-BS indicated that the S protein of bat SL CoV was more immunogenic. Our in vivo data provide evidence that the difference of immune modulating ability between BVLPs and SARS-CoV VLPs was highly likely contributed by the S protein.Taken together, we have successfully constructed BVLPs formed by membrane proteins of different origins, one from SL-CoV isolated from bats (BS) and the other two (E and M) from human SARS CoV. The formed BVLPs demonstrated stimulating activity in immature DCs. In the absence of an in vitro cell culture model for SL-CoV, our study has together demonstrated that BVLPs vs DCs can be used as a model to study the interaction between SL-CoV and host cells. Further study by using this model may provide important information for vaccine development and for understanding the pathogenesis and the evolution of SL-CoV.5′-TTTGGATCCCCACCATGAAAATTTTAATTCTT and 5′-GGG GAATTCTTATGTGTAGTGTAATTTTAC. bs gene was cloned into pFastBac DUAL vector gfp gene was cloned under the control of p10 promoter to generate pFBS. Recombinant baculoviruses were generated using Autographa californica multiple nucleopolyhedrovirus (AcMNPV) genome. In brief, vAcBS was generated by transfecting the BS plasmids into insect cells sf21 using Lipofectin (Invitrogen). Recombinant baculovirus vAcME was generated as previously described DNA coding the S protein (BS) of Bat SL-CoV was amplified from Rp3 strain (GenBank accession number DQ071615) by reverse transcription-polymerase chain reaction (RT-PCR) using the following primers: s and bs gene were subcloned into pcDNA3.1(+) to construct the recombinant plasmids pcDNA-S and pcDNA-BS, respectively. The accuracy of the constructs was confirmed by restriction digestion and sequencing. DNA plasmids were purified using Qiagen MegaPrep columns (Qiagen) and dissolved in endotoxin-free PBS to a final concentration of 2 µg/µl and stored at −20°C.In addition, Insect cells were co-infected with vAcBS and vAcME at a multiplicity of infection (moi) of 5. At 4 days post-infection, cells and medium were harvested and centrifuged at 90,100 g for 4 hours. BVLPs in the pellets were resuspended in PBS and further purified on a discontinuous 30–50% (w/v) sucrose gradient. A visible band between 30% and 40% sucrose layers was collected, concentrated by centrifugation and then resuspended in PBS at a total protein concentration of 2 µg/µl . The purity of the VLPs was then checked by SDS-PAGE. The presence of BS proteins in the purified preparations was confirmed by western blot using rabbit-derived anti-SARS-CoV antibody, kindly provided by Prof. Lin-Fa Wang in Australian Animal Health Laboratory . Immunogold labeling was detected using antiserum against BS2 (667–1242 aa in S2 region of Bat S protein). To generate BS2 antiserum, the cDNA of 667–1242 aa in S2 region was cloned into pMAL-c2x expression vector (NEB). BS2 protein was purified by using Amylose Resins (NEB) and then was used to immunize rabbit.For EM study of BVLPs budding from insect cells, Sf21 cells were co-infected with vAcBS and vAcME at a MOI of 5. At 72 h post-infection, the cells were collected and fixed with 2% glutaraldehyde and then with 1% osmium tetroxide. Thin-section samples were prepared and examined under a Hitachi-H7500 transmission electron microscope. For immunogold labeling, BVLPs were loaded onto a collodion-coated EM grid for 5 min. After removal of the excess sample solution, antibody against BS2 protein was added onto the grid and incubated for 1 h at room temperature. Grids were washed three times and then incubated with 15 nm gold conjugated anti-rabbit IgG for 1 h. The samples were stained with 2% phosphotungstic acid (PTA) for 1 min, then drained, and examined under the EM.6 cells/ml) for 2 hours. Adherent monocytes were washed with RPMI 1640 and then cultured for 6 days in complete medium containing 10% fetal calf serum (Life Technologies) and supplemented with rhGM-CSF (1000 U/ml) and rhIL-4 (500 U/ml) (both from Peprotech). Half of the medium was replaced every two days. The resulting differentiated DCs were >97% CD1a positive and <1% CD14 positive.Human peripheral blood mononuclear cells (PBMC) were isolated from healthy donors by Isopaque-Ficoll following the manufacturer's instructions. Immature DCs were generated from PBMC as previously described All participants gave written informed consent. This study was conducted in accordance with the Declaration of Hubei and approved by Health Department of Hubei Province and Wuhan Blood Center of Hubei Province, China.6 cells) were incubated with either 10 µg/ml of BVLPs or 10 µg/ml of lipopolysaccharide . Meanwhile, immature DCs were treated with PBS, Ac (culture supernatant of sf21 cells transfected with baculovirus expression vector pFastBac DUAL with gfp under the control of p10 promoter) or heat-denatured BVLPs (100°C for 10 min). Alternatively, an equivalent amount of BVLPs or LPS was incubated with 10 µg/ml polymyxin B quantification using enzyme-linked immunosorbent assay (ELISA) according to the manufacturer's instructions .DC surface markers were analyzed by flow cytometry. Briefly, cells were washed in cold PBS and cell surface staining was carried out using the following antibodies: fluorescein isothiocyanate (FITC)-conjugated anti-CD40, FITC-conjugated anti-CD80, phycoerythrin (PE)-conjugated anti-CD83, PE-conjugated anti-CD86 . After incubation with antibodies for 30 min at 4°C, cells were washed and analyzed using flow cytometer . Data were analyzed using EXOPO analysis software. A minimum of 10,000 events were collected and analyzed for each sample. Isotype-matched controls were included in each staining.4) were exposed to BVLPs (10 µg/ml), Ac or PBS for 24 h and washed thoroughly. Treated DCs were then co-cultured with CD4+T cells (1×105) in 96-well plates (Costar) in triplicate for another 72 h. For intracellular detection of IL-4 and IFN-γ, DCs/T cell mixtures were further stimulated with 10 ng/mL PMA (phorbol 12-myristate 13-acetate) and 0.5 µmol/L ionomycin for 6 h. After stimulation, mononsesin (1.5 µl/ml) was added to each well and plates were incubated at 37°C for 3 h to block reaction. The cells were then washed, fixed and permeabilized. Intracellular IFN-γ and IL-2 (both PE-conjugated) staining and flow cytometry analysis were performed in succession. Data were analyzed using EXOPO analysis software. A minimum of 10,000 events were collected and analyzed for each sample. Isotype-matched controls were included in each staining.CD4+T cells were prepared from PBMC by positive selection using anti-CD4 antibody (BD PharMingen) and the purity was consistently above 95%. Immature DCs (1×10E. Coli was purified and used as the detection antigen. Horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG, IgG1 or IgG2a (sigma) was used as the secondary antibody. Optical density (OD) was read at 490 nm (A490).6–8 wk-old female BALB/c mice were immunized intramuscularly with purified plasmid pcDNA-S or pcDNA-BS 3 times at a 2-wk interval. S-specific IgG and the subclasses (IgG1 and IgG2a) in serum were assessed by ELISA. Recombinant S2 protein expressed in 6 splenocytes were calculated. The medium background response in the absence of antigen was consistently <10 SFC per 106 splenocytes.Cellular immune responses to SARS-CoV were assessed by IFN-γ and IL-4 ELISPOT assays using mouse splenocytes. Assays were performed according to the instruction manual . Absorbance was read using an ELISPOT reader (Hitech Instruments) and spot-forming cells (SFC) per 10All data were presented as means±SD for the immunized mice per group. The SPSS 13.0 software for windows was used for statistical analysis. The LSD t-test was used for between group comparisons. P values<0.05 were considered statistically significant.

A reciprocal translocation involving chromosomes 8 and 21 generates the AML1/ETO oncogenic transcription factor that initiates acute myeloid leukemia by recruiting co-repressor complexes to DNA. AML1/ETO interferes with the function of its wild-type counterpart, AML1, by directly targeting AML1 binding sites. However, transcriptional regulation determined by AML1/ETO probably relies on a more complex network, since the fusion protein has been shown to interact with a number of other transcription factors, in particular E-proteins, and may therefore target other sites on DNA. Genome-wide chromatin immunoprecipitation and expression profiling were exploited to identify AML1/ETO-dependent transcriptional regulation. AML1/ETO was found to co-localize with AML1, demonstrating that the fusion protein follows the binding pattern of the wild-type protein but does not function primarily by displacing it. The DNA binding profile of the E-protein HEB was grossly rearranged upon expression of AML1/ETO, and the fusion protein was found to co-localize with both AML1 and HEB on many of its regulated targets. Furthermore, the level of HEB protein was increased in both primary cells and cell lines expressing AML1/ETO. Our results suggest a major role for the functional interaction of AML1/ETO with AML1 and HEB in transcriptional regulation determined by the fusion protein. Acute myeloid leukemias (AML) are a group of hematologic malignancies initiated by chromosomal abnormalities that often give origin to oncogenic proteins with transcriptional regulatory functions. These aberrant transcription factors bind to specific sequences on DNA and influence the activity of adjacent genes. The result is that leukemic blasts display abnormalities in their gene expression programs, which are ultimately responsible for the malignant phenotype. In this study, genome-wide approaches were exploited not only to identify target genes, but also to discover interactions among different transcription factors, with the aim of defining disease-linked regulatory networks. We performed a detailed analysis of the DNA binding pattern of an oncogenic transcription factor, AML1/ETO, which is responsible for approximately 10–15% of AML. We identified a specific signature, which is characterized by the presence of binding regions for AML1/ETO and for other transcription factors, AML1 and HEB, and found that the DNA binding pattern of AML1 and HEB is significantly affected in cells expressing AML1/ETO. Our results, therefore, describe genes regulated by AML1/ETO and demonstrate that this oncogenic protein can significantly interfere with the function of other transcriptional regulators. AML1 and ETO genes, and express the resulting AML1/ETO fusion protein. AML1 is a DNA-binding transcription factor required for hematopoiesis Chromosomal translocations generating fusion genes are the genetic hallmark of Acute Myeloid Leukemia (AML) AML1/ETO9a includes ETO exon 9a, which leads to a frameshift of the original coding sequence and consequently to a C-terminally truncated protein. Co-expression of AML1/ETO and AML1/ETO9a results in earlier onset of AML and blocks myeloid cell differentiation at a more immature stage, suggesting the two isoforms could cooperate in patients to induce leukemia.Full length AML1/ETO is not sufficient to induce AML in mice, and requires treatment with mutagens to induce leukemic transformation in vitro, the conserved core sequence TGT/cGGT AML1 and AML1/ETO were originally characterized as DNA binding proteins that recognize, M-CSFR and BCL-2 promoters AML1/ETO functions as a transcriptional repressor by recruiting NCoR/SMRT/HDAC complexes to DNA through its ETO moiety AML1/ETO was recently hypothesized to target DNA through E-box motifs as the result of physical interactions with transcription factors of the E-protein family, in particular HEB/TCF12 The large-scale determinants of DNA binding by AML1/ETO and the correlation to global transcriptional effects remain to be elucidated. In this study, we present a comprehensive analysis of the DNA binding pattern of AML1/ETO, and its correlation to AML1 and HEB binding sites. The fusion protein preferentially binds to regions that are occupied by the wild-type AML1 transcription factor, without necessarily displacing it. The DNA binding pattern of HEB is reorganized following AML1/ETO expression, and the E-protein re-localizes to AML1/ETO binding regions. Our study provides an accurate description of the genomic distribution of AML1/ETO, and identifies AML1 and HEB as crucial elements for its transcriptional regulatory function.A U937 cell line that conditionally expresses HA-tagged AML1/ETO under the control of the mouse metallothionein (Mt) promoter U937-AE, was usedDifferent microarray platforms were expThe binding profile of AML1/ETO in human promoters was investigated through ChIP experiments with an anti-HA antibody on lysates of U937-AE and U937-Mt cells. ChIP products were PCR amplified, labeled with Cy3/Cy5 fluorescent dyes and hybridized to the NimbleGen Systems Human HG17 Promoter Array set, which explores 4 kb upstream and 1 kb downstream the transcription start site (TSS) of 24,434 annotated genes. Two biological replicates were prepared and hybridized to independent array sets. A proprietary software . The binding profile of AML1/ETO9a was similar to that of the long isoform, although relative enrichment levels were not comparable in all cases . This reAffymetrix GeneChip U133 2.0 arrays were used to identify genes differentially expressed in U937-AE cells compared to U937-Mt. Samples were processed and data analyzed as previously described . ExpressCross-comparison between ChIP-chip and expression data led to the identification of 358 genes with AML1/ETO peaks in their promoter regions whose transcriptional levels change >1.5-fold , of whichttp://www.genome.ad.jp/kegg/) Functional classification of the 2,513 AML1/ETO target genes according to KEGG molecular interaction networks AML1/ETO peaks mapped to 254 known genes, and can be further sub-localized as follows: 36% are within promoters (defined as −4 kb to +1 kb from the TSS), 4% within exons, 37% inside introns and 7% in 3′ sequences in proximity of the gene . Of the The distribution of AML1/ETO peaks in U937-AE cells was compared with that of histone mark H3K4me3, which consistently associates with active promoters. ChIP products obtained with an anti-H3K4me3 antibody on lysates of U937-AE cells were hybridized to the Chr. 19 Array. H3K4me3 peaks clustered in the proximity of TSS , while ABCL3, VAV1 and UHRF1) and lower in one gene (GNA15) were, therefore, used to titrate fusion protein levels, and qChIP was performed on both promoter and downstream binding sites in four of genes that present peaks in both locations . AML1/ET (GNA15) ; howeverWe next investigated if the binding profile of AML1/ETO reflects that of the native AML1 transcription factor. A ChIP-chip experiment was performed on the same cell lines using an anti-AML1 antibody that does not cross-react with AML1/ETO, since it recognizes the AML1 C-terminal portion, which is lost in the fusion protein. ChIP products were hybridized to Chr.19 Arrays: 883 AML1 peaks were identified in U937-AE cells and 919 peaks in U937-Mt cells . 420 of in vivo.The extent of overlap between AML1/ETO and AML1 binding regions was quantified by comparing peak coordinates . Of the in vivoDetailed sequence analysis using both supervised and unsupervised methods revealed a specific sequence signature associated with genomic occupancy of AML1/ETO, which includes a significant enrichment for AML1 and HEB binding sites . The finMany HEB peaks in U937-AE cells coincide with AML1/ETO binding regions: of the 408 AML1/ETO peaks, 285 (70%) are also recognized by HEB . To valiIn the absence of AML1/ETO, HEB and AML1 localize to the same genomic regions in approximately 25% of their global binding sites, suggesting they may be involved in co-regulation of common target genes . InteresThe correlation between gene expression and DNA binding pattern of AML1/ETO, AML1 and HEB was investigated by expression tiling. The Chr. 19 array was hybridized with RNA derived from U937-Mt and U937-AE cells and expression levels of the 1305 genes on chromosome 19 were calculated as described in HEB mRNA levels were, instead, identical in U937-AE and U937-Mt cells prior to and after ZnSO4 induction . On the other hand, 30% of target genes are induced, including HOX genes and the cell cycle regulators CDKN1A and CDKN1B. CDKN1A is of particular interest since it is know to regulate maintenance of quiescent hematopoietic stem cells In U937 cells, AML1/ETO binds to the promoter regions of 2,513 non-redundant genes, and causes transcriptional changes in 358 of them. Of these, 70% are repressed, including many genes involved in neutrophilic/myeloid differentiation myeloid leukemogenesis.The U937 AML1/ETO-HA#9 clone (U937-AE) was generated by stable transfection of AML1/ETO-HA cDNA cloned in the inducible pSG-MtNEO plasmid vector as already described U937-AML1/ETO9a cells (U937T-AE9a) were generated by stable transfection of U937T cells U937 cells were grown in RPMI-1640 supplemented with 10% FCS and 2 mM glutamine at 37°C in a humidified atmosphere containing 5% CO2. HeLa cells were grown in DMEM medium supplemented with 10% FCS and 2 mM glutamine. Myeloid cell lines used for Western Blotting were grown according to standard procedures.Immunopurified anti-HA from clone 12CA5 was used against AML1/ETO. Commercially available antibodies against ETO (Santa Cruz sc-9737), AML1/RUNX1 (Abcam ab23980), HEB (Santa Cruz sc-357), H3K4me3 (Abcam ab8580) were used in ChIP assay and Western blot. The anti-AML1/RHD (Oncogene PG285) antibody, recognizing both wild-type AML1 and AML1/ETO, anti-alpha-tubulin (SIGMA T9026), anti-vinculin (SIGMA V9131) and anti-actin (SIGMA A4700) were used for Western blotting.6 cells were used for each IP and incubated at 4°C overnight with the antibody of interest previously coated on Dynabeads Protein A magnetic beads . For anti-ETO ChIP, Protein G Sepharose beads were used .Cells were cross-linked with 1% formaldehyde for 10 minutes at room temperature, harvested and washed twice with 1× PBS. Pellet was resuspended in ChIP lysis buffer and sonicated to obtain an average chromatin length of 500 bp. 5×10Beads were then washed twice with each of the following buffers: Mixed Micelle Buffer , LiCl/detergent wash , Buffer 500 an a final wash was performed with 1× TE. Finally, beads were resuspended in 1× TE containing 1% SDS and incubated at 65°C for 10 minutes to elute immunocomplexes. Elution was repeated twice, and the samples were further incubated overnight at 65°C to reverse cross-linking, along with the untreated input . After treatment with 0,5 mg/ml proteinase K for 3 hours, DNA was purified with Wizard SV Gel and PCR Clean-up system according to manufacturer's protocol and eluted in nuclease-free water. ChIP products and input DNA were used for quantitative PCR or further treated for ChIP-chip.The NimbleGen Systems Human HG17 Promoter Array set from NimbleGen catalogue, which contains >700,000 probes exploring 4 kb upstream and 1 kb downstream of 24,434 annotated genes, were used for genome-wide identification of AML1/ETO binding sites. In addition, custom designed high-density oligonucleotide arrays, containing ∼360,000 isothermal probes (from 50 to 60 bp long) contiguously tiled along chromosome 19, were produced by NimbleGen Systems . Non-repetitive sequences of chromosome 19 available from UCSC Hg.17 were used for the probe design.GCGGTGACCCGGGAGATCTGAATTC and JW103: GAATTCAGATC. DNA was amplified in a 1st LM-PCR reaction using oligo JW102 and Phusion DNA Polymerase , and PCR products were purified with Wizard SV Gel and PCR Clean-up system. 200 ng were used as template in a 2nd LM-PCR. 4 µg of purified DNA were labelled by NimbleGen Services using random priming and Cy3/Cy5 fluorescent dyes. Input DNA and ChIP DNA were labeled with different fluorophores and co-hybridized on the same array. For every probe, results were rated as log2 (ratio ChIP/input). Labeling and hybridization were performed by NimbleGen Services, Reykjavik, Iceland. Data were visualized and images extracted using SginalMap software (NimbleGen Systems).ChIP products were obtained as described above. 80% of a single ChIP product and 40 ng of the input were further treated for array hybridization as described by Kim et al. th percentile, window of 1000 bp, |log|>2. For the analysis of Chr.19 Array data, stringent parameters were applied: 98th percentile, window of 500 bp, |log|>7.A perl script called PeakPicker was developed as a tool to perform peak analysis on different types of ChIP-chip platforms. Briefly, PeakPicker identifies binding regions (peaks) by centering a sliding window of user-defined size around every probe of the array, then picking out the number of probes within the window that are above a given percentile see . For thePeakPicker generates a tab file representing a list of binding peaks sorted by their first and last nucleotide mapped on UCSC Hg.17. Comparison between two lists of peaks is obtained by measuring the percentage of physical overlap. Peaks with at least 20% physical overlap are considered co-occurrent. To generate the high stringency list of 408 AML1/ETO binding peaks on Chr.19, we compared anti-ETO and anti-HA lists using a threshold of 60% peak overlap.All reactions were performed with the following reagents: 0.4 µM of each primer, 12.5 µl of SYBR Green PCR Master MIX , and a fixed volume of template DNA in a final volume of 25 µl. Thermal cycling parameters were: 2 minutes at 50°C, followed by 10 minutes at 95°C, followed by 40 cycles of 15 seconds at 95°C, and 1 minute at 60°C. We used 1/40 of the eluted DNA from both ChIP samples and input. Oligonucleotides were designed to validate regions occupied by AML1/ETO according to bioinformatics analysis of NimbleGen Promoter Array . For each of the U937 cell lines (AE and Mt), three independent RNA extractions were performed, and an equal quantity of each of the three RNA preparations was then mixed to generate an RNA pool for each sample.RNA pools were labeled and hybrydized to the Affymetrix HG-U133 Plus 2.0 array . Results derived from U937-AE cells (sample) were compared to results from U937-Mt (baseline) cells by “comparative analysis” with GCOS software. Data were then analyzed using GenePicker software 50 regulated genes were chosen for validation by qRT-PCR on an independent set of RNAs. qPCR was performed as already described for ChIP samples, using 15 ng of cDNA reverse transcribed with Super Script III according to manufacturer's protocol (see http://david.abcc.ncifcrf.gov) Functional classification was performed starting from the list of AML1/ETO target genes and the U937-AE and U937-Mt were treated with 100 µM ZnSO4, collected and resuspended in CoIP buffer . After brief sonication, lysates were cleared by centrifugation at 13,000 rpm and incubated with the indicated antibody and Protein A sepharose beads . Immunoprecipitates were washed 4 times in the CoIP buffer, eluted and separated by electrophoresis on denaturing SDS-PAGE. Immunoblotting was performed according to standard procedures.Bone marrow cells were harvested from 8- to 10-week-old 129SvEv mice and treated for purification of undifferentiated cells (Lin−). After centrifugation through a Ficoll gradient, mononucleated cells were enriched for progenitors by affinity depletion of cells presenting myeloid, erythroid, and lymphoid differentiation markers using commercially available reagents . Depleted cell were also collected as the differentiated subpopulation (Lin+).5 Lin−/mouse). After 4 weeks, animals transduced with AML1/ETO expressing cells were treated with N-ethyl-N-nitrosourea (50 mg/kg), as described Leukemic mice were generated by retroviral transduction of PINCO-AML1-ETO or PINCO-PML/RAR into Lin− cells, as described ATGGATCCTAATCCCCAGCAACAACGC and r- ATCTCGAGTTACATATGACCCATAGG . PCR reactions were run on an agarose gel, extracted, purified and inserted into BamHI-Xho digested pCDNA3.1 (Invitrogen), which contains an in-frame FLAG tag sequence at the 5′.The full-length HEB isoform (RefSeq accession number: NM_207036) was isolated from U937 cells by PCR amplification of cDNA, using the following primers: f-ATGGTACCAGAAGAATCTCACTTC and r-ATGAATTCCTAAGAGCTGGCCAGG primers. FLAG-pCDNA3.1 vectors containing SMYD2 and EPN3 were a gift from Bruno Amati and Pier Paolo Di Fiore, respectively. PINCO and PINCO-AML1/ETO vectors used in the co-transfection studies were already published A FLAG-pCDNA3.1 vector containing full length ZNF384 was also generated by PCR-cloning using f-Transfection in HeLa cells was performed using Lipofectamine (Invitrogen) and 500 ng of each plasmid (1 well in a 6-well plate), diluted in serum-free DMEM culture medium. Cells were collected and lysed for Western Blotting 24 hours after transfection.http://www.ncbi.nlm.nih.gov/geo/), and can be retrieved as Data Series with accession number GSE10537.Microarray data included in this manuscript have been deposited in GEO, (Table S1AML1/ETO target regions in human promoters identified by ChIP-chip on the NimbleGen Human Promoter Array set.(0.32 MB XLS)Click here for additional data file.Table S2Genes regulated by AML1/ETO in U937-AE cells.(0.23 MB XLS)Click here for additional data file.Table S3Validation of genes regulated by AML1/ETO.(0.03 MB XLS)Click here for additional data file.Table S4Genes that present binding of AML1/ETO and whose expression is regulated in U937 cells.(0.08 MB XLS)Click here for additional data file.Table S5Functional classification of AML1/ETO target genes.(0.13 MB XLS)Click here for additional data file.Table S6408 regions on chromosome 19 bound by AML1/ETO identified on the Chr. 19 Array.(0.12 MB XLS)Click here for additional data file.Table S7H3K4me3 regions on chromosome 19 in U937-AE cells.(0.15 MB XLS)Click here for additional data file.Table S8Binding regions of the endogenous AML1 transcription factor on chromosome 19 in U937-AE cells and U937-Mt cells.(0.36 MB XLS)Click here for additional data file.Table S9Binding regions of the endogenous HEB transcription factor on chromosome 19 in U937-AE and U937-Mt cells.(0.41 MB XLS)Click here for additional data file.Table S10Expression levels of genes on chromosome 19 in U937-Mt and U937-AE cells.(0.36 MB XLS)Click here for additional data file.Figure S1Calculation of baseline values for qChIP experiments.(0.10 MB DOC)Click here for additional data file.Figure S2qChIP analysis of AML1/ETO9a binding on AML1/ETO target regions.(0.18 MB DOC)Click here for additional data file.Figure S3Validation of transcriptional regulation of AML1/ETO target genes identified by gene expression profiling.(0.17 MB DOC)Click here for additional data file.Figure S4AML1/ETO interacts with the E-protein HEB in U937-AE cells.(0.10 MB DOC)Click here for additional data file.Figure S5qChIP analysis of HEB binding on AML1/ETO target regions in SKNO-1 cells.(0.12 MB DOC)Click here for additional data file.Figure S6Rearrangement of HEB and AML1 binding patterns in AML1/ETO expressing cells.(0.88 MB DOC)Click here for additional data file.Figure S7AML1/ETO preferentially binds in the proximity of expressed genes.(0.10 MB DOC)Click here for additional data file.Figure S8Displacement of HEB from its native binding sites is associated to transcriptional regulation.(0.20 MB DOC)Click here for additional data file.Text S1Supplementary data and methods.(1.58 MB DOC)Click here for additional data file.

Umbre (UMB) virus was first isolated from India in 1955 and classified as Orthobunyavirus (Turlock serogroup). Eight isolates of this virus, isolated from Culex mosquitoes were characterized on the basis of partial glycoprotein (G2) gene. Twenty-six percent differences at nucleotide level while 17% differences at amino acid level were noted within different isolates. Phylogentic data shows that this virus represents a distinct group within the genus Orthobunyavirus. Bunyaviridae family are spherical particles, range 80 to 120 nm in diameter and share a common genetic organization of three predominantly negative stranded RNA segments . Based on antigenic, genetic and ecological relatedness, the Bunyaviruses are divided into five genera. The genus Orthobunyavirus includes approximately 60 viruses, which are known to cause disease in humans . Virological surveillance of these viruses depends primarily on detecting the viruses in arthropod vector populations in nature. Although, serological test like immunoassays are available for antigen detection for a few viruses, cross-reaction in closely related viruses cannot be ignored .The viruses of Culex bitaeniorhynchus mosquitoes, collected in 1955 at Umbre, Kolaba district, Maharashtra State, India. The virus has been registered in the International Arbovirus Catalogue No. 43 . During further field investigations, seven more strains of virus were isolated from Cx. vishnui mosquitoes. Recent reports on Bunyaviruses via. Ganjam virus isolation from Maharashtra and antibody detection of Hantan virus in India , has provided evidences that Bunyaviruses are circulating in this country but their involvement in causing human and animal disease are not known yet. In the Gene Bank, only one sequence of Turlock serogroup i.e. N gene of M'poke virus is available.Umbre virus (UMB) [strain G-1424] was first isolated from VeroE-6 cells. Cytopathic effect (CPE) was observed during 4th – 6th post infection day. Infected cells were harvested, centrifuged and supernatant was used for molecular characterization of the virus.UMB viruses used in this study are listed in Table along wiet. al., (2001), represents the nucleotide sequences of the N-terminal half of the G2 glycoprotein. Superscript III single step RT-PCR with Platinum Taq DNA polymerase kit (Invitrogen) was used for amplification of partial M gene according to the manufacturer's instructions.RNAs were isolated using chloroform, isoamylalcohol and further purified using RNAaid kit (Biogene), according to the manufacturer's instructions. RNAs were dissolved in 50 μl nuclease free water. Different sets of primers were used to amplify partial N, L and M gene. Partial M gene of 570 bp could be amplified using primer pair M14C and M619R, as described by Bowen Amplified products were detected in 2% agarose gel after staining with ethidium bromide in Tris/acetate/EDTA buffer (TAE). A desired size of 575 bp product was purified using QIAquick gel extraction kit (Qiagen), as per manufacturer's instructions. The sequences of amplified products were determined by using ABI PRISM BigDye Terminator V3.1 cycle sequencing ready reaction kit (Applied Biosystems). Amplification primers were used to sequence the amplified products. Cycle sequencing PCR program was used for 96°C-1 min, 96°C-10 sec, 50°C-5 sec and extension of 2 min at 60°C for 30 cycles.W program. Phylogenetic analysis was performed using Mega 3.0 by using neighbor-joining algorithm with thousand bootstrap values.The partial M gene sequence was curetted with the help of KODON Software and aligned with known Gene Bank sequences of Bunyamwera serogroup, California serogroup, and Kaeng Khoi viruses using clastal Partial M gene sequences showed maximum homology with Bunyamwera serogroup virus. Nucleotide and amino acid similarity within eight isolates varied from 74–100% and 83–99% respectively. Isolate G1424 and 809365 come together with 6% and 1% difference of nucleotide and amino acid respectively, while other six isolates club together with 5% nucleotide and 4% amino acid differences are divides into six distinct lineage viz. Bunyamwera, Simbu, California encephalitis, Group C, Kaeng Khoi (KK) and UMB virus. Comparison of 550 bp of partial M gene showed four lineages, excluding Group C viruses and Simbu group of virus . Availability of more sequences of Turlock group may answer about placement of this group of viruses. Bunyaviruses being three segmented RNA viruses have the capacity to reassort their segments into new genetically distinct viruses, if the target cells are subject to dual infection. The possibility of drift, shift and UMB virus evolution towards an emerging disease pathogen cannot be predicted based on partial sequences. Complete genome sequencing of UMB virus can possibility suggest whether there is any reassortment between three genes of this virus as known for Ngeri, Batai and Jatobal virus .Turlock and Umbre virus are distinct from each other based on neutralization test (Calisher The authors declare that they have no competing interests.PDY performed the PCR and sequencing. ACM helped in preparation of manuscript. DTM and PDY designed, coordinated the study and prepared the manuscript.

Intra-abdominal hypertension is common in critically ill patients and is associated with increased severity of organ failure and mortality. The techniques most commonly used to estimate intra-abdominal pressure are measurements of bladder and gastric pressures. The bladder technique requires that the bladder be infused with a certain amount of saline, to ensure that there is a conductive fluid column between the bladder and the transducer. The aim of this study was to evaluate the effect of different volumes and temperatures of infused saline on bladder pressure measurements in comparison with gastric pressure.2; arterial oxygen tension/fractional inspired oxygen ratio 225 ± 48 mmHg) were enrolled. Bladder pressure was measured using volumes of saline from 50 to 200 ml at body temperature (35 to 37°C) and room temperature (18 to 20°C).Thirteen mechanically ventilated critically ill patients , but it significantly increased with 150 and 200 ml (21.1 ± 10.4 mmHg and 27.1 ± 15.5 mmHg). Infusion of saline at room temperature caused a significantly greater bladder pressure compared with saline at body temperature. The lowest difference between bladder and gastric pressure was obtained with a volume of 50 ml.The bladder acts as a passive structure, transmitting intra-abdominal pressure only with saline volumes between 50 ml and 100 ml. Infusion of a saline at room temperature caused a higher bladder pressure, probably because of contraction of the detrusor bladder muscle. Intra-abdominal pressure (IAP) is the pressure generated inside the abdominal cavity and depends on the degree of flexibility of the diaphragm and abdominal wall, and on the density of its contents . Intra-aSeveral clinical conditions such as accumulation of blood, ascites, retroperitoneal haematoma, bowel oedema, necrotizing pancreatitis, massive fluid resuscitation, packing after control laparotomy and closure of a swollen noncompliant abdominal wall may induce IAH ,9. IAH hBecause the abdomen and its contents can be considered to be relatively noncompressive and fluid in character, behaving in accordance with Pascal's law, the IAP measured at one point is assumed to reflect the IAP throughout the abdomen . A varieThe bladder technique, originally described by Kron and coworkers , assumesThe aim of this study was to evaluate IAP estimated by bladder pressure, measured with the bladder infused with different volumes of saline at room and body temperatures, in comparison with intra-gastric pressure (IGP).Thirteen sedated, mechanically ventilated patients admitted to the intensive care unit of Ospedale Policlinico were enrolled. Exclusion criteria were contraindications to bladder pressure measurement .The study was approved by the institutional review board of our hospital, and informed consent was obtained in accordance with Italian national regulations.The IBP was measured using a revision of the Cheatham's original technique with disThe IBP was measured at different volumes of saline infusion at room temperature (18 to 20°C). The sequence of measurements was then repeated using saline infusion warmed to body temperature (35 to 37°C). At each volume of saline, the IBP was recorded 5 to 10 s after the termination of saline infusion (early recording) and 5 min later (late recording) by keeping the bladder catheter closed. After each measurement the bladder was emptied.2O, with the other ventilatory parameters (previously selected by the attending physician) unchanged during the study. Thus, each patient underwent two randomized series of measurements.Each patient was studied at an external positive end-expiratory pressure of 10 cmHThe IGP was measured using a radio-opaque balloon connected to a pressure transducer . For meaThe IBP and IGP were measured at end-expiration and the signals were recorded on a personal computer for subsequent analysis .The level of sedation before the study was evaluated using the Ramsay scale . The SimP < 0.05 was considered statistically significant.The effects of volume, temperature of saline infused and time of recording were analyzed by two-way repeated measures analysis of variance, followed by Student/Newman Keuls test for multiple comparison . P < 0.0The mean bias (bladder minus gastric pressure), precision (standard deviation of the bias) and limits of agreement were calculated using the Bland-Altman analysis . The perAll data are expressed as mean ± standard deviation.The main clinical characteristics are reported in Table P = 0.071), but it was significantly higher with 150 and 200 ml saline were classified as having IAH (IAP >12 mmHg) when 50 ml saline was used. This increased to eight patients (61.5% of the population) when 100 ml saline was used.P < 0.005; Figure P < 0.001; Figure The IBP was significantly lower 5 min after saline infusion (late recording) than just after the saline infusion (early recording), but only with the bladder infused with 200 and 150 ml of saline , which in turn are associated with significantly increased in morbidity and mortality . DespiteThe most widely used technique to measure the IAP is the bladder pressure technique, as proposed by Kron and coworkers . In thatIn the present study, although we did not find any statistically significant difference (there was only a trend) in IBP measured using saline volumes of 50 and 100 ml, this difference could lead to a patient being incorrectly identified as having IAH if a 100 ml rather than a 50 ml of volume were used. Similarly, De Waele and colleagues demonstrAlthough these findings clearly indicate that the IBP can overestimate IAP when large volumes of saline are infused, the possible mechanisms involved are still not clearly understood. The bladder is a muscular membranous organ that is composed of four layers, namely mucous, adventitia, serosa and muscularis, and its elasticity decreases in response to a direct mechanical increase in stress and strain on its structure . In addition, the elasticity of bladder can also be reduced by contraction of the detrusor muscle, mediated by sensory receptors located in the bladder wall, after a rapid infusion of saline or other fluid that is not at body temperature .A recording of bladder pressure 5 min after termination of the infusion yielded a significantly lower IBP only with a volume of saline up to 150 ml; this suggests that the bladder takes longer to reach a stable condition only when it is infused with large volumes. However, this is not relevant in current clinical practice, because the IAP is usually measured with volumes of saline lower than 150 ml.We found that infusion of saline at body temperature, at each volume infused, also resulted in a significantly lower IBP compared with infusion of saline at room temperature. Rapid infusion of saline at a temperature lower than body temperature may activate contraction of the detrusor muscle (as mentioned above) by a reflex loop through nociceptors with C afferent fibres located in the bladder wall , causingAnother possible cause of reduced elasticity of the bladder might be continued urine drainage through the catheter . In critIn cases of bladder trauma, pelvic fractures or haematoma, or neurogenic bladder, in which the bladder pressure technique cannot be applied, the IGP technique is recommended . CompareIn clinical practice the IAP should be estimated using the IBP technique, infusing the bladder with only a small amount of volume of saline at body temperature to avoid overestimating the IAP. If this is not feasible, then the IGP should be measured.• In clinical practice, IAP should be estimated using the IBP technique with the bladder infused with only a small volume of saline.• The saline infused should be at body temperature to avoid overestimating the IAP.• It is recommended that sufficient equilibration time be allowed before the IAP is measured.• IGP correlates with IBP only at low volumes of saline.IAH = intra-abdominal hypertension; IAP = intra-abdominal pressure; IBP = intra-bladder pressure; IGP = intra-gastric pressure.The authors declare that they have no competing interests.DC conceived of the study, participated in its design and coordination, performed the measurements and wrote a first draft of the manuscript. FT participated in the study design and coordination, performed the measurements and to helped draft the manuscript. MC participated in the study design and coordination, and performed the measurements. FP performed the statistical analysis and helped to draft the manuscript. GLB participated in the study design and coordination, and performed the measurements. GM participated in the study design and coordination, and performed the measurements. SA participated in the study design and coordination, and performed the measurements. CC participated in the study design and coordination, and performed the measurements. LG conceived the study, participated in its design and coordination, coordinated the final analysis of collected data and revised the manuscript, writing its final version.

The 62 kDa protein product of the c-myc oncogene (p62 c-myc) is thought to be involved in the control of normal cellular proliferation and differentiation. We have measured oncoprotein levels using a flow cytometric assay in 141 operable breast cancers and have correlated levels with prognostic variables, patient survival and disease free intervals. High levels of p62 c-myc were associated with well differentiated tumours. There was no correlation with tumour DNA index, lymph node or oestrogen receptor status. C-myc oncoprotein levels were not predictive of patient survival or disease free interval. This relationship of oncoprotein levels with tumour histological grade is in keeping with the suggestion that the c-myc oncogene is important in the control of cellular differentiation. The other findings imply that measurement of c-myc oncoprotein levels does not yield useful prognostic information.

The vascular disrupting agent combretastatin A4 phosphate (CA4P) causes major regression of animal tumours when given as combination therapy.Patients with advanced cancer refractory to standard therapy were treated with CA4P as a 10-min infusion, 20 h before carboplatin, paclitaxel, or paclitaxel, followed by carboplatin.−2 with the carboplatin area under the concentration curve (AUC) 4–5, from 27 to 54 mg m−2 with paclitaxel 135–175 mg m−2, and from 54 to 72 mg m−2 with carboplatin AUC 5 and paclitaxel 175 mg m−2. Grade 3 or 4 neutropenia was seen in 17%, and thrombocytopenia only in 4% of 46 patients. Grade 1–3 hypertension (26% of patients) and grade 1–3 tumour pain (65% of patients) were the most typical non-haematological toxicities. Dose-limiting toxicity of grade 3 hypertension or grade 3 ataxia was seen in two patients at 72 mg m−2. Responses were seen in 10 of 46 (22%) patients with ovarian, oesophageal, small-cell lung cancer, and melanoma.Combretastatin A4 phosphate was escalated from 36 to 54 mg mThe combination of CA4P with carboplatin and paclitaxel was well tolerated in the majority of patients with adequate premedication and had antitumour activity in patients who were heavily pretreated. Combret−2. In view of the enhanced activity observed when CA4P is combined with cisplatin patients in any course 4 or 5), followed 1 h later by CA4P 27–36 mg m−3; platelet count >100 000 cells mm−3); adequate hepatic function ; adequate renal function with glomerular filtration rate (GFR) measured by EDTA clearance >50 ml min−1; no other anticancer therapy for 4 weeks; no active concurrent malignancies except cone-biopsied in situ carcinoma of the cervix, or adequately treated basal or squamous carcinoma of skin.Patients with histologically confirmed cancer, not amenable to standard therapy or refractory to conventional therapy, were eligible for this study. Other eligibility requirements included ECOG performance status 0–2; life expectancy ⩾4 months; age ⩾18 years; adequate bone marrow function , toxicity resulting in a treatment delay of >14 days, absolute granulocyte count <500 cells mmThe maximum tolerated dose was defined as the maximum dose level of CA4P, administered in combination with carboplatin and paclitaxel, at which one or fewer patients experience a DLT.Laboratory assessments (including full blood counts) were performed weekly. Tumour evaluations were carried out at screening and then every two cycles. Criteria for response were based on Response Evaluation Criteria in Solid Tumours (RECIST) .The plasma pharmacokinetics (PK) of carboplatin and paclitaxel were evaluated during cycle 1 in all patients receiving study treatment. For carboplatin and paclitaxel PK, blood samples were collected 20 h after CA4P infusion, on starting the 60-min carboplatin infusion and/or the 3-h paclitaxel infusion, respectively.Cmax) were determined manually. The terminal elimination rate constants (λz) were determined by linear regression analysis of the terminal log-linear part of the concentration–time curve. The total area under the observed plasma concentration–time curve (AUC) was calculated for each analyte from time zero to the last measured concentration, using the linear-log trapezoid rule. Area under the concentration curve values were extrapolated from the last observed time point to infinity by adding the last measured concentration divided by λz.Plasma concentration data for paclitaxel and carboplatin plasma ultrafiltrate concentrations were analysed using non-compartmental methods. Peak concentrations (U-test) data, and of correlations (Spearman).Non-parametric tests were used to calculate the statistical significance of differences between several groups , and between two groups for paired (Wilcoxon signed rank-sum test) and unpaired grade 4) as an allergic reaction to carboplatin. Short-lived and spontaneously resolving muscle weakness of the legs and arms (CTCAE grade 3 and 2) was observed in two patients, although the second patient's symptoms may also be explained by malignant meningeal infiltration, which was only diagnosed later.Ataxia was seen in two patients (CTCAE grade 2 and 3) and resolved spontaneously within a couple of hours. CTCAE grade 3 ataxia occurred 1 day after the first CA4P infusion in one patient and was considered DLT.−2. One patient was unable to speak for 1 min, 2 h after his second CA4P infusion , and a second patient experienced dysphasia the day after the first infusion of CA4P, lasting less than 5 min. This event was initially deemed grade 2 by the local investigator, but amended to grade 3 later by the principal investigator, and was therefore not captured as a DLT at the time; both patients continued on the trial.Short-lived and spontaneously resolving dysphasia was observed in two patients treated in trial arm 1 at a CA4P dose of 54 mg m−2 CA4P. In general, both systolic and diastolic blood pressures were highest at 1 h, followed by slight hypotension 4 h after CA4P infusion experienced hypertension, most were CTCAE grade 1 . Dose-liinfusion . Changesinfusion .QTc prolongations >450 ms were seen in 15 patients (33%) of mostly CTCAE grade 1, and in three patients with grade 2, the longest interval being 480 ms. Patients from all three treatment arms were affected. Two of the patients with QTc prolongations were on antihypertensive medication at study entry. Grade 1 tachycardia was seen in 11% of patients. No cardiac enzyme measurements were taken as none of the patients had clinical symptoms of myocardial ischemia. The only patient with a known history of ischemic heart disease did not experience hypertension or QTc prolongation.−2 had the AUC of paclitaxel measured, which varied from 463 to 4709 mg min ml−1, with no significant relationship to the dose of CA4P, indicating no interaction between these drugs using this regimen (data not shown).Complete plasma data were available for 12 patients for estimation of PK variables for carboplatin , and forSeven of 18 (39%) patients with epithelial ovarian cancer, primary peritoneal carcinoma, or cancer of the fallopian tube had a response according to RECIST and/or GCIG CA-125 criteria. Of them, one had a confirmed and two had an unconfirmed partial remission (PR) according to RECIST, and a response according to GCIG CA-125 criteria, and four had a response according to GCIG CA-125 criteria only.Three of 30 (10%) patients with non-ovarian cancer showed PR according to RECIST: one in trial arm 2 with extensive small-cell lung cancer, progressing to 2 months after previous response to carboplatin, etoposide, and thalidomide within a phase III trial; another in trial arm 2 with an adenocarcinoma of the oesophagus–gastric junction, for relapse after surgical resection and adjuvant epirubicin/cisplatin/capectabine, followed by second-line mitomycin C chemotherapy; and a third in trial arm 3 with metastatic melanoma of the skin progressing during first-line trial therapy with dacarbazine and sorafenib.This phase Ib trial was planned because of the severe myelosuppression observed when combining CA4P with carboplatin in a previous study and the concerns about combining the two different tubulin-binding agents, combretastatin A4 phosphate and paclitaxel. It was the concern about the possibility of CA4P enhancing haematological and neurotoxicity that led us to perform this trial rather than performing a phase II trial with a cohort of patients treated with a lower dose of CA4P, as was the approach followed in the trial of another VDA, DMXAA of patients suffering grade 3 or 4 thrombocytopenia and probably more related to paclitaxel than to CA4P. Motor neuropathy, ataxia, and dysphasia were observed in a total of six patients (13%) at doses between 45 and 72 mg m−2 CA4P and were of short duration, lasting a couple of minutes to a few hours.As ataxia and motor neuropathy were DLTs in the first phase I trial of CA4P at 114 mg mPatients who already took medication to control arterial hypertension at the time of study entry were more likely to experience hypertension after CA4P infusion. One patient received GTN for the treatment of CTCAE grade 1 hypertension, which proved to be highly effective in quickly normalising blood pressure, but we now recommend giving GTN as a dermal patch to reduce the side effects of sublingual GTN. The notion that nitrates and calcium channel blockers such as amlodipine are highly effective has recently been corroborated by a study in rats , and paclitaxel 175 mg m−2.Pharmacokinetics showed no evidence of pharmacological interaction between carboplatin or paclitaxel and CA4P. Dose-limiting toxicities were CTCAE grade 3 ataxia and CTCAE grade 3 arterial hypertension at 72 mg mIt is encouraging that responses were observed in a variety of tumour types, including ovarian cancer (7 of 18 patients responding), small-cell lung cancer, adenocarcinoma of the oesophagus–gastric junction, and malignant melanoma (three patients with PR), demonstrating response in a total of 22% of all patients (including two patients with unconfirmed response). The high response rate in ovarian cancer demonstrates further evidence that this disease is responsive to vascular strategies, and in consequence, a phase II trial in platinum-resistant ovarian cancer has been completed.

Depression has been associated with alexithymic features. However, few studies have investigated the differences in the general symptoms of patients with depressive disorders according to the presence of alexithymia. Thus, the aim of this study was to evaluate the relationship between alexithymia and symptoms experienced by patients with clinically diagnosed depressive disorders.A chart review of patients who were evaluated using the Korean version of the 20-item Toronto Alexithymia Scale (TAS-20) and Symptom Checklist 90-Revised (SCL-90-R) at the same time between the years 2003 and 2007 was conducted. A total of 104 patients with depressive disorders were included and divided into two groups: alexithymia (n=52) and non-alexithymia (n=52). A direct comparison between the two groups was carried out. Regression analysis was also carried out for the TAS-20 total and subset scores in order to model the relationship between alexithymia and symptoms.The presence of alexithymia was confirmed in 50% of the patients with depressive disorders, and the symptoms of depressive patients with alexithymia were more severe than those of their non-alexithymic counterparts on all 9 symptom domains of the SCL-90-R. Furthermore, regression analysis revealed that the presence of alexithymia was positively associated with depression, phobic anxiety, and psychoticism but inversely associated with anxiety.These results suggest that the clinical features of depression are partially dependent on the presence of alexithymia. Alexithymic patients with depressive disorders are likely to show more severe depressive, psychotic, and phobic symptoms. In other words, clinicians should suspect the presence of alexithymic tendencies if these symptoms coexist in patients with depressive disorders and address their difficulties in effective communication. Alexithymia, a term originally derived from Latin, is the inability to describe emotions with words. Sifneos, who formerly defined the clinical features of alexithymia, positioned this concept in a theoretical framework with Nemiah in 1970.To date, depression has been identified as the psychiatric feature most consistently associated with alexithymia. Previous literature has indicated that there is a strong association between depression and alexithymia in both depressive patients6In the clinical world, patients with depressive disorders do not solely suffer from psychiatric symptoms measured by the Beck Depression Inventory (BDI), which was used in most studies demonstrating the relationship between depression and alexithymia. For instance, psychotic features are estimated to be present in approximately 12% to 25% of patients with depressive disorders.Therefore, the aim of this study was to evaluate the relationship between alexithymia and the general symptoms experienced by patients with depressive disorders. We hypothesized that patients with depressive disorders and alexithymia would have different symptoms and manifestations than patients with depression but no alexithymia and that a certain dimension of alexithymia would be related to a specific symptom.This study included 104 patients diagnosed with depressive disorders. Sixty-two of the patients were male and 42 were female, and their mean age was 39.9±16.1 years . The primary diagnosis was major depressive disorder in 40 patients, dysthymic disorder in 35 patients, and depressive disorder not otherwise specified (NOS) in 29 patients. The mean Clinical Global Impression (CGI) score was 3.5±1.0, which was indicative of mild to moderate illness. Only 12 patients were not being treated with psychiatric medication; 86 patients were taking antidepressants at therapeutic dosages, most of whom (n=71) were also taking anxiolytic medications; two patients were only taking antipsychotic medications, and two patients were taking only anxiolytic medications. All patients met the Diagnostic and Statistical Manual of Mental Disorders, fourth edition (DSM-IV) criteria for a primary diagnosis of a depressive disorder and were evaluated in a single session using the Korean version of the 20-item Toronto Alexithymia Scale (TAS-20K)Data on demographic and psychosocial factors , clinical profiles , and results of psychological assessments were analyzed.Two experienced psychiatrists reviewed the patients' charts, newly confirmed the previous diagnosis of depressive disorders, and rated their CGI scores at the time the TAS-20 was conducted based on chart review. Ninety-nine patients (95%) completed these assessments at the time of their first psychiatric visit. This study was approved by the institutional review board of Kyungpook National University Hospital.The TAS-20 has become the most widely used measure of alexithymia.The SCL-90-R is one of the most widely used and well-validated self-report symptom inventories designed to evaluate a broad range of psychological problems and symptoms of psychopathology.18The CGI-Severity (CGI-S)Based on their TAS-20 scores, the subjects were divided into two groups, alexithymia and non-alexithymia . Between-group comparisons were performed using the chi-square test for categorical variables and independent t-test for continuous variables. To identify certain symptoms associated with alexithymia, multiple linear regression analysis was used to model the relationship between alexithymia and symptoms. Age, education level, duration of illness, and the presence of comorbid psychiatric disorder were also included to adjust for confounding effects. Regression analyses were carried out for total score and score on each of the three subfactors in the TAS-20.Statistic analyses were performed using SPSS software All significant levels were two-tailed and set at a 0.05 significance level.The only significant difference between the alexithymia and non-alexithymia groups was the ratio of comorbid psychiatric disorder to duration of illness . There were no significant group differences in the demographic and clinical characteristics of the patients. The patients with depressive disorders and alexithymia showed a significant increase on all 9 of the items on the SCL-90-R compared to those without alexithymia .2, indicating that approximately 70% of the variance was accounted for by the independent variables . After adjusting for possible confounders, total TAS-20 score was positively associated with depression, phobic anxiety, and psychoticism and inversely associated with anxiety, among the 9 dimensions of the SCL-90-R. Factor 1 was associated with somatization and showed a trend towards association with psychoticism. Factor 2 was positively associated with depression and negatively associated with anxiety. Factor 3 was positively associated with psychoticism and negatively associated with anxiety of the 104 patients with depressive disorders were considered alexithymic, and the patients' scores on the SCL-90-R revealed a greater incidence of psychopathology on all 9 SCL-90-R subscales in alexithymic patients than in nonalexithymic patients. These findings are generally consistent with those of a previous study showing that alexithymic patients with depressive disorders had a greater incidence of comorbid psychiatric disorder than their nonalexithymic counterparts.0% of theThe symptom of depression, measured by the SCL-90-R, was positively associated with TAS-20 total score and factor 2 (difficulties describing feelings) in this study. By definition, the depression item includes loss of energy, diminished interest and suicidal ideation, and these are consistent with the manifestations of depressive disorders. These findings mean that, even in patients with depressive disorders, the more severe the alexithymia, the more severe the depression. Furthermore, these findings corroborate the observation of Honkalampi et al.In particular, subjects having difficulties describing their feelings were found to suffer from more depressive symptoms in this study. Duddu et al.Another item that was associated with alexithymia in this study was the psychoticism domain, which showed a positive relationship with total TAS-20 score and factor 3 . This dimension includes isolation, withdrawal, schizoid lifestyle, hallucination and thought broadcasting. When compared with the paranoid ideation domain, it seems that psychoticism reflects behavioral or perceptual symptoms rather than the content of thought shown in paranoid ideation. Nkam et al. observed that negative schizophrenic patients had significantly higher total scores in alexithymia than those with positive symptoms,Thus, factor 3 may be closely related to anhedonia, poverty of thought, and alogia, which are also characteristics of the negative symptoms of schizophrenia. We assumed that this is the reason why factor 3 was specifically associated with psychoticism. In this context, some studies concluded that a deficit in the ability to experience emotions may contribute to interpersonal or social isolation, limited social engagement, and other impoverished environments.27Interestingly, the phobic anxiety dimension of the SCL-90-R was positively associated with TAS-20 total score while the anxiety dimension was inversely correlated with TAS-20 total score, factor 2 (difficulties describing feelings) and factor 3 . Anxiety includes general signs of anxiety such as nervousness, tension and trembling, while phobic anxiety is defined as a persistent fear response that is irrational and disproportionate to the stimulus and is very similar in definition to agoraphobia. Although Devine et al.The 'Somatization' category of the SCL-90-R was only associated with factor 1 (difficulties identifying feelings). Emotional deficits of alexithymic depressive patients underlie failures in the capacity to recognize physical sensations as the somatic manifestations of emotions. Consequently, choosing not to deal with the emotions that underlie these somatic sensations results in somatosensory amplification, which may then be misinterpreted as physical illness.30The limitations of the present study are as follows. The major limitation of this study is its cross-sectional nature, which makes a causal inference impossible. Second, although we thoroughly reviewed data and discarded improper data, some data such as diagnosis and disease severity could be biased due to the retrospective study design. Finally, the sample population was comprised of patients from Kyungpook National University Hospital, which makes it difficult to generalize this study to the general psychiatric population, and a selection bias may have occurred because more severe patients tend to be referred to university hospitals in Korea.In conclusion, the results of the present study indicate that the clinical features of depression partially depend on the presence of alexithymia. Alexithymic patients with depressive disorders are likely to show more severe depressive, psychotic, and phobic symptoms. In other words, clinicians should suspect the presence of alexithymic tendencies if these symptoms coexist in patients with depressive disorders, and consider specific psychotherapeutic techniques for improving affect differentiation in order to enhance effective communication.

Among dietary factors, learning and behavior are influenced not only by nutrients, but also by exposure to toxic food contaminants such as mercury that can disrupt metabolic processes and alter neuronal plasticity. Neurons lacking in plasticity are a factor in neurodevelopmental disorders such as autism and mental retardation. Essential nutrients help maintain normal neuronal plasticity. Nutritional deficiencies, including deficiencies in the long chain polyunsaturated fatty acids eicosapentaenoic acid and docosahexaenoic acid, the amino acid methionine, and the trace minerals zinc and selenium, have been shown to influence neuronal function and produce defects in neuronal plasticity, as well as impact behavior in children with attention deficit hyperactivity disorder. Nutritional deficiencies and mercury exposure have been shown to alter neuronal function and increase oxidative stress among children with autism. These dietary factors may be directly related to the development of behavior disorders and learning disabilities. Mercury, either individually or in concert with other factors, may be harmful if ingested in above average amounts or by sensitive individuals. High fructose corn syrup has been shown to contain trace amounts of mercury as a result of some manufacturing processes, and its consumption can also lead to zinc loss. Consumption of certain artificial food color additives has also been shown to lead to zinc deficiency. Dietary zinc is essential for maintaining the metabolic processes required for mercury elimination. Since high fructose corn syrup and artificial food color additives are common ingredients in many foodstuffs, their consumption should be considered in those individuals with nutritional deficits such as zinc deficiency or who are allergic or sensitive to the effects of mercury or unable to effectively metabolize and eliminate it from the body. Neuronal plasticity, the ability of neurons to undergo specific functional changes during the moments when learning takes place, appears to underlie learning capacity . NeuronaZinc deficiency related to dietary intake may be a factor in the development of several conditions that ultimately make learning more difficult for children. Such conditions include Autism Spectrum Disorders (ASD), Attention Deficit Hyperactivity Disorder (ADHD) and hyperactivity. In a recent review article, it was hypothesized that the increase in Autism may be related to transient maternal hypothyroxinemia resulting in low tri-iodothyronine (T3) in the fetal brain from insufficient dietary iodine intake and/or environmental exposure to antithyroid agents such as mercury . Zinc deThe "Mercury Toxicity Model" in figure Mercury exposure, in its various forms, is thought to be a risk factor in causing some of the more prevalent neurological learning disorders, including autism . A studyThe presence of mercury in our environment will increase as long as humans continue to burn coal and use mercury to manufacture products . With respect to mercury emissions into the atmosphere, the United States Environmental Protection Agency (USEPA) estimates that about one third of US emissions are deposited within the contiguous US and the remainder enters the global cycle, of which the US contributes roughly three percent . CurrentWith respect to mercury cell chlor-alkali chemicals, there are approximately 50 manufacturing plants left worldwide. In the US, many plants have closed and most of them are now abandoned Superfund sites or undergoing corrective clean up action for mercury contamination . The merAs mercury is discharged into the environment by different industrial processes and through the use of mercury contaminated chlor-alkali chemicals, humans become exposed via the water they drink, the air they breathe, and the foods they eat. Chen et al. found that human subjects living in a mercury contaminated region had a mean mercury concentration in serum nearly 40 times that of the control group and a mean mercury concentration in urine almost 75 times that of the control subjects living in a non-contaminated region . The merWith regard to cumulative mercury exposure, there are multiple possible sources. These sources may include mercury as a pollutant in air, soil, dust, and water, a contaminant in foodstuffs and consumer products, a material in dental amalgam and lighting fixtures, and a contaminant in fish and seafood. Overall environmental mercury exposure includes all of these sources as "environment" includes home and office as well as the outdoors. Given the growing evidence of ongoing, cumulative environmental mercury exposure, it may be prudent to follow the American Academy of Pediatrics' guidelines for limiting exposure to all forms of mercury to help prevent neurodevelopmental problems in children .Fish is an important dietary source of omega-3 fatty acids that are required for normal neural development. However, fish can also be contaminated with mercury. Figure . AccordiStudies suggest there is an interaction between mercury and selenium -46, howeThe results of a 2005 study found that, with moderate fish consumption during pregnancy, there was a benefit to offspring cognition, but that exposure to higher levels of mercury from fish led to adverse effects on child cognition Figure . The conFish advisories for mercury in the US increased from 2,436 in 2004 to 3,080 in 2006. Thirty-five of fifty states have issued statewide fish advisories for methylmercury that suggest limiting consumption of certain fish and some include recommendations for safe levels of consumption and/or exposure . These aA key discovery related to the isomerization of dextrose in the 1960's led to the development of high fructose corn syrup (HFCS) by the corn refining industry . HFCS isThe rates of diagnosed Autism Spectrum Disorders are shown in Table The decline in annual growth rates of Autism Spectrum Disorder in California could be explained by the reduction in annual per capita consumption of high fructose corn syrup or the reported reduction in the use of mercury cell chlor-alkali chemicals in the high fructose corn syrup manufacturing process. Whatever the case, there may be a biochemical connection between low level mercury exposures, zinc deficiency and the development of learning disorders such as ADHD and autism spectrum disorders. In a 1990 human study, researchers found that consumption of fructose and HFCS may lead to certain mineral imbalances including zinc loss and copper gain is of paChildren with Autism Spectrum Disorders have increased body burdens of mercury . BecauseAs indicated by our toxicity model figure , mercuryEssential amino acids, fundamental building blocks of proteins that provide the structural integrity of all living organisms, are provided by a diet rich in protein. Essential amino acids (those not produced endogenously) include histidine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan, and valine. Essential amino acid deficiency can lead to adverse health effects. For instance, a deficiency of the essential amino acid methionine can adversely affect behavior and learning. Researchers found that 51 percent of autistic children showed evidence of methionine deficiency . In a moGSH is the primary defense used by the neuron against free radicals. Depletion of GSH in rats can impair short-term and long-term mechanisms of synaptic plasticity and stress the redox balance in the normal function of brain circuitry . Metals,2O2; a byproduct of cellular respiration) to water. This prevents oxidative stress, which could lead to lipid peroxidation and cell damage [n in Figure in vitro study of Jurkat T cells exposed to thiomersal demonstrated concentration-dependent apoptosis [The GSH system is effective at scavenging free radicals and serves as an oxidation reduction buffer that allows for the reduction of the highly reactive hydrogen peroxide , collectively playing a major neuroprotective role against these various environmental insults. Constitutive cellular abundance of MTs -1, -2, -3 and -4 are therefore an important index of a tissue's susceptibility, and capability to handle a wide array of toxic insults. As the nasal cavity, primary olfactory neurons at the cribiform plate, and anatomically connected olfactory bulb are continually exposed to various airborne pollutants in the external environment, the olfactory system provides a direct route of entry into the central nervous system for an assortment of environmental neurotoxic agents including mercury. It is therefore not surprising that the olfactory system has one of the highest MT abundances of the mammalian central nervous system, and that expression of the MT-1, -2, and especially -3 isoforms are greatest in the olfactory neurons of the brain and the anatomically adjacent hippocampal region, which has direct nerve fiber projection contacts from the olfactory bulb ,103-105.MT-3 is a brain specific, high zinc containing MT, which is found in neuronal and glial cells ,104-107.Linum usitatissimum) and Chia seeds, and are found in small amounts in walnuts, soybeans, canola oil, and free-range chicken eggs [Omega-3 fatty acids have been found to be a basic component of normal neural development and maintenance of neural plasticity . Dietaryken eggs . The onlken eggs ,112.The role of DHA in brain development and visual acuity has been extensively studied . The breDHA protects neurons and glia from death, in part, by maintaining BDNF, which is a small protein, made within the brain that is crucial for maintaining neuronal plasticity ,116. Wu Researchers have been investigating the link between essential fatty acids and ADHD in children. Stevens et al. found thDespite the fact that low levels of DHA were found in children with ADHD, supplementing with DHA alone or in high amounts relative to other essential fatty acids (EFAs) have not been shown to be effective in improving behavior. Researchers have begun to look at other fatty acids and found that a combination of EFAs and in particular EPA may be more effective in the modulation of behavior disorders. Forty-one children with learning difficulties were randomly assigned to supplementation with EPA 186 mg, DHA 480 mg, gamma linolenic acid (GLA) 96 mg, linoleic acid 864 mg, and AA 42 mg or placebo (olive oil) for 12 weeks . The gro2 which in excess can deplete the phospholipids of the long chain polyunsaturated fatty acids critical to normal brain function. EPA may be a useful adjunct in the treatment of various neurological conditions including depression, bipolar disorder, schizophrenia, dyslexia, dyspraxia, ADHD, and Autism Spectrum Disorders [EPA and DHA are both essential for optimal brain function, but for different reasons. DHA is important for the structure of the neuronal membranes, while EPA plays a role in brain function by regulating neuronal signaling, neurotransmitter uptake, and the activity of phospholipase enzymes. EPA has been shown to reduce the overactivity of phospholipase Aisorders ,129,130.Magnesium and zinc are needed to help convert the 18-carbon, plant-derived essential fatty acids (EFAs) to long chain fatty acids, notably DHA and EPA . Many chChildren who have difficulty converting EFAs to long chain fatty acids can obtain a preformed source of EPA and DHA as a nutritional supplement or in the diet by consuming fish or fish oil. As discussed above, cold-water fish provide the only rich dietary source of these omega-3 fatty acids; however, recent research on trace metal contamination has questioned their safety. Guallar et al. found, fWhile the total dietary intake of mercury is not known, mercury is widely accepted to be an unusually toxic heavy metal and the American Academy of Pediatrics has recommended that minimizing exposure to any form of mercury is essential for optimal child health . The curWith regard to total mercury exposure, the Joint Expert Committee on Food Additives (JECFA) recommends an exposure limit of 1 ppm for mercury in their 2005 Evaluation of Food Additives report . This reIn 2007 alone, there were 1000 studies published on all aspects of ASD . As is tAdequate nutrition, specifically omega-3 fatty acids, methionine, and the trace minerals zinc and selenium are important for maintaining neuronal plasticity and learning capacity. The evidence does suggest that improper or inadequate nutrients may lead to behavior and learning disorders when mercury is present in the environment. Because current standards allow the use of mercury cell chlor-alkali chemicals in food manufacturing, food products that are made with one or more of these ingredients may contain trace amounts of mercury such as is the case for HFCS and other food additives. These low-level mercury exposures may contribute to cumulative environmental mercury exposure and present a problem for sensitive individuals who do not have adequate levels of glutathione and metallothionein and/or are deficient in the trace minerals needed for metal metabolism. Because consumption of HFCS and other food additives may lead to trace mineral imbalances and/or zinc deficiency, further research is needed to determine whether or not these food ingredients are safe for consumption by sensitive populations. If food manufacturers continue to use mercury grade chlor-alkali chemicals, it may be necessary to account for this source of mercury exposure in dietary guidelines for sensitive populations such as children with ADHD and autism spectrum disorders. In addition, consideration of dietary micronutrients required to enhance neurological development and support proper functioning of metallothionein, glutathione peroxidase, and other metal clearing and detoxifying mechanisms in the brain seems warranted.ASD: Autism Spectrum Disorder; ADHD: attention deficit hyperactivity disorder; T3: tri-iodothyronine; US: United States; USEPA: United States Environmental Protection Agency; WHO: World Health Organization; FDA: Food and Drug Administration; MeHg: methylmercury; NHANES: National Health and Nutrition Examination Survey; GSH-Px: glutathione peroxidase; HFCS: high fructose corn syrup; ug: micrograms; MT: metallothionein; BDNF: brain-derived neurotrophic factor; GSH: glutathione; GSSG: oxidized glutathione; GSH-Rx: glutathione reductase; EPA: eicosapentaenoic acid; DHA: docosahexaenoic acid; AA: arachidonic acid; GRAS: generally recognized as safe; GLA: gamma linolenic acid; EFAs: essential fatty acids; mg/kg: milligrams/kilogram; RfD: reference dose; ppm: parts per million; JECFA: Joint Expert Committee on Food Additives.The authors declare that they have no competing interests.RD spearheaded the review and recruited interdisciplinary collaborators to contribute to the development of the manuscript. RD was the lead environmental investigator and literature reviewer for the sources of mercury exposure section. LP and BL both contributed greatly to the development of the amino acids and glutathione system section. WL was the lead investigator and reviewer for the metallothionein section. RS was the lead investigator and reviewer for the fatty acids section. RC reviewed, analyzed, and prepared the epidemiological data. CC, DW, and SG were instrumental in editing the manuscript and reviewing it critically for intellectual content. All authors read and approved the final manuscript.

Ppargc1a], PGC-1β [Ppargc1b], and PRC [Pprc]) coordinates the upregulation of mitochondrial biogenesis, and Ppargc1a is known to be activated in response to mitochondrial damage in sepsis. Therefore, we postulated that the PGC family is regulated by the innate immune system. We investigated whether mitochondrial biogenesis and PGC gene expression are disrupted in an established model of Staphylococcus aureus sepsis both in mice with impaired innate immune function (TLR2−/− and TLR4−/−) and in wild-type controls. We found an early up-regulation of Ppargc1a and Ppargc1b post-infection (at 6 h) in WT mice, but the expression of both genes was concordantly dysregulated in TLR2−/− mice (no increase at 6 h) and in TLR4−/− mice (amplified at 6 h). However, the third family member, PRC, was regulated differently, and its expression increased significantly at 24 h in all three mouse strains . In silico analyses showed that Ppargc1a and Ppargc1b share binding sites for microRNA mmu-mir-202-3p. Thus, miRNA-mediated post-transcriptional mRNA degradation could account for the failure to increase the expression of both genes in TLR2−/− mice. The expression of mmu-mir-202-3p was measured by real-time PCR and found to be significantly increased in TLR2−/− but not in WT or TLR4−/− mice. In addition, it was found that mir-202-3p functionally decreases Ppargc1a mRNA in vitro. Thus, both innate immune signaling through the TLRs and mir-202-3p-mediated mRNA degradation are implicated in the co-regulation of Ppargc1a and Ppargc1b during inflammation. Moreover, the identification of mir-202-3p as a potential factor for Ppargc1a and Ppargc1b repression in acute inflammation may open new avenues for mitochondrial research and, potentially, therapy.The PGC family of transcriptional co-activators (PGC-1α [ Nrf1), NRF-2 (Gabpa)), thereby initiating nuclear gene expression for mitochondrial proteins Ppargc1a), PGC-1β (Ppargc1b), and PRC (Pprc)) are variably affected by inflammation; for instance, Ppargc1a mRNA levels may decrease after exposure of cells to LPS, while PGC-1α protein content and stability are increased in mice exposed to LPS The PPAR-gamma coactivator (PGC) family of transcriptional co-activators have been called ‘master regulators’ of mitochondrial biogenesis because they co-activate the transcription factors nuclear respiratory factor-1 and -2 (NRF-1 (Ppargc1a levels in mice infected with Staphylococcus aureus (S. aureus) have been shown to increase as mitochondrial damage develops under the stresses of excessive reactive oxygen and nitrogen species generation The program of mitochondrial biogenesis is responsible for maintaining adequate mitochondrial mass and quality in the cell, and it is indispensable for energy homeostasis and cell viability during periods of cell stress that increase mitochondrial turnover. Mitochondrial biogenesis is a bi-genomic process that requires coordination between nuclear- and mitochondrial-encoded genes −/− mice, compared with WT mice, show less mitochondrial damage in a model of heat-killed E. coli sepsis, but also show less activation of mitochondrial biogenesis and a slower recovery of mtDNA copy number The signal transduction pathways that link sepsis-induced inflammation to the up-regulation of mitochondrial biogenesis are not well understood, but there is some evidence that the Toll-like receptor (TLR) family of innate immune receptors may provide such a link. The TLRs are transmembrane proteins that sense conserved pathogen-associated molecular patterns. When activated, the TLRs signal through various downstream kinases to mobilize pro-inflammatory transcription factors such as NF-κB, AP-1, and IRF3/7 S. aureus sepsis to test the hypothesis that TLR signaling leads to downstream regulation of the PGC family of genes. We examined the expression of genes of mitochondrial biogenesis program in this sepsis model in the livers of WT, TLR2−/−, and TLR4−/− mice in order to compare the wild-type response to the effects of specific innate immune receptor deficiencies on mitochondrial biogenesis. This study focused on the liver because it is both a key metabolic and immune organ (through the presence of Kupffer cells), and because the liver receives the portal circulation and so its immune cells are stimulated by peritoneal infection.To better understand the regulatory role of the PGC family in the complex process of mitochondrial biogenesis during the acute inflammatory response, we used an established fibrin-clot model of in silico, though comparatively few matches have been shown to result in gene silencing. Thus, along with gene promoter maps, we compared the 3′ UTRs of PGC family genes to locate conserved miRNA binding sites.Most of the research on the regulation of mitochondrial biogenesis has focused on the roles of cytosolic kinases and transcription factors that activate and regulate the genes involved, but post-transcriptional mechanisms are probably also important. In fact, several miRNAs have been demonstrated to target genes involved in metabolism, including PGC-1α Ppargc1a and Ppargc1b are co-regulated independently of PRC. Moreover, we report that Ppargc1a and Ppargc1b gene expression is negatively correlated with mir-202-3p, which is differently expressed in WT, TLR2−/−, and TLR4−/− mice.Our findings demonstrate a dampening and a delay in mitochondrial biogenesis during Gram-positive inflammation in both TLR-deficient mouse strains, but also demonstrate that −/− and TLR4−/− mice on a C57Bl/6J background obtained from Shizuo Akira, Japan The studies were conducted in C57Bl/6J mice purchased from Jackson Laboratories and in TLR2Mice were anesthetized with an intraperitoneal injection of xylazine and ketamine, and the abdomen was shaved and cleaned with povidone-iodine. Midline laparotomy was performed and an infected fibrin clot was inserted in the peritoneum. The peritoneum and abdomen were then closed with proline sutures. All mice were resuscitated with 1 ml of 0.9% NaCl administered subcutaneously. Mice were sacrificed at 6, 24, 48, or 72 hours PI by overexposure to isoflurane. Livers of healthy control (HC) mice of each strain were also obtained. The livers were harvested immediately and either the mitochondria were isolated at once or the tissue was snap-frozen and stored at −80°C.Staphylococcus aureus (ssp aureus) was reconstituted and suspended in fibrin according to published methods 10cfu/ml based on optical density at 550 nm. Doses of 105, 106, or 107 cfu were then suspended in 500 ul fibrin clots.To prepare the fibrin clots, Mouse AML12 hepatocytes were purchased from the American Type Culture Collection . AML12 cells were cultured in 5% CO2–95% air at 37°C in DMEM/F12 medium containing l-glutamine and 2.438 g/L sodium bicarbonate. The medium was supplemented with 10% FBS, a mixture of insulin, transferrin, selenium and 40 ng/ml dexamethasone.7 cfu heat-killed S. aureus per ml (prepared from the same strain as that implanted in mice) and were harvested at different time-points. Gene expression was tested by real time RT-PCR.AML12 cells were exposed to 10AML12 cells were transfected at approximately 60% confluency with scrambled siRNA or miRNA mimic for mmu-mir-202-3p (Qiagen) using Lipofectamine RNAiMax transfection reagent (Invitrogen). Transfection to 80% was confirmed with BlockIT fluorescent oligo (Invitrogen). Serum starvation was achieved 24 hours after transfection by replacing cell culture media with media without FBS for 4 hours. mRNA was extracted with Trizol and gene expression was tested by real time RT-PCR.g for 3 min at 4°C. The supernatant was centrifuged at 12,500xg for 8 min at 4°C, and the pellet recovered for mtDNA extraction using the mtDNA Extraction Kit according to the manufacturer's instructions.Liver mitochondria were isolated from ∼2 g of fresh tissue using a modified Clark protocol b (Cyt b) plasmid with a Cyt b probe as described RNA was extracted from frozen liver with TRIzol reagent and subjected to reverse transcription with the ImProm-II Reverse Transcription System according to the manufacturer's instructions. Mouse-specific primers were designed and realMicroRNAs were prepared with an All-in-One™ miRNA qRT-PCR Detection Kit according to the manufacturer's instructions. Briefly, the extracted RNA was reverse-transcribed in the presence of a Poly-A polymerase with an oligo-dT adaptor. Quantitative PCR was then carried out with SYBR green detection with a forward primer for the mature miRNA sequence and a universal adaptor reverse primer.Mus musculus NCBI assembly m37) and human (Homo sapiens NCBI assembly GRCh37) genomes were accessed on Ensembl (www.ensembl.org), and aligned using zPicture (zpicture.dcode.org). The alignments were then fed into rVista 2.0 (rvista.dcode.org) and analyzed for transcription factor consensus sequences according to the Transfac Professional library (v10.2) with similarities optimized for function To prepare promoter maps, mouse (www.targetscan.org/mmu_50) www.microrna.org). mRNA folding and single-strand frequency predictions were made with mfold version 3.2 MicroRNA binding predictions were made with TargetScan Mouse release 5.1 of its own strain using a one-sided Student's S. aureus sepsis was evaluated in all three strains of mice. At all bacterial doses, WT mice showed very low mortality at 72 hours post-implantation (PI). In contrast, TLR2−/− mice were dose-dependently susceptible to S. aureus, with 106 cfu causing approximately 65% mortality by 72 hours PI. Somewhat unexpectedly, TLR4−/− mice also showed a high mortality in response to 106 cfu S. aureus, approaching 100% by 72 hours PI in WT and TLR2hours PI . The TLRNrf1, Gabpa, and mitochondrial transcription factor A (Tfam) were measured by Q-PCR in WT, TLR2−/−, and TLR4−/− mice was similar, suggesting the possibility of mutual transcriptional control during acute inflammation.The mRNA levels for −/− mice . There wb (Cytb), superoxide dismutase-2 (Sod2), and thioredoxin reductase-2 (Txnrd2) were measured as indices of damage and recovery of mitochondrial respiratory and antioxidant capacity, respectively . Cytb and Sod2 showed trends towards a decrease in the TLR2−/− and TLR4−/− mice compared to the WT mice . Again, this group of genes may be under mutual transcriptional control during acute inflammation, since innate immune system dysregulation impairs their transcription. Since Cytb is a downstream target of Tfam Sod2 and Txnrd2 are up-regulated in mitochondrial biogenesis The mRNA levels of cytochrome ectively . The indPpargc1a, Ppargc1b, and Pprc showed differential regulation in the WT, TLR2−/−, and TLR4−/− mice . Ppargc1a and Ppargc1b, however, were both maximally induced in WT mice at 6 hours PI , but failed to be induced in TLR2−/− mice at 6 hours PI , and were over-expressed in TLR4−/− mice at 6 hours PI . Comparisons of Ppargc1a and Ppargc1b mRNA between the three strains at 6 h show that each strain behaved significantly differently from the others . This unexpected finding demonstrates the differential regulation of the PGC family members, with Ppargc1a and Ppargc1b showing a TLR-dependent response to S. aureus-induced inflammation. Pprc mRNA levels were not affected by deficiencies of TLR2 or TLR4, and were up-regulated at 24 h PI in all three strains. To test whether S. aureus directly activates Ppargc1a in hepatocytes, studies were conducted in AML12 cells, which were shown to express TLR2 by endpoint RT-PCR (data not shown). AML12 cells were exposed to 107 heat-killed S. aureus (HKSA) per mL, and Ppargc1a mRNA levels were measured after different periods of exposure. The means of triplicate time-course experiments showed significant increases in Ppargc1a mRNA levels at 1, 2, and 3 hours post-exposure to HKSA of the three PGC family members were performed to uncover any obvious transcription factor binding site similarities between Ppargc1a and Ppargc1b that were not also present in the promoter of Pprc that might explain their co-regulation. Using the web-based programs zPicture and rVista, we were able to demonstrate good conservation of the Ppargc1a and Ppargc1b promoters in the mouse and the human, whereas the proximal Pprc promoter region is poorly conserved between mouse and human. There is modest overlap in the predicted transcription factors for the three genes, but no binding sequences that are conserved between Ppargc1a and Ppargc1b but not Pprc . We then tested mir-202-3p and found that it was significantly increased at 6 h and 24 h in TLR2−/− mice , was unchanged at 6 h, but was increased at 24 h PI with borderline significance in WT mice , and was unchanged at 6 h but decreased at 24 h in TLR4−/− mice . The miRPpargc1b .Ppargc1a expression and mir202-3p under more general conditions, we obtained a microRNA mimic of mir-202-3p (a dsRNA sequence that matches the mir-202-3p sequence) for transfection into AML12 cells. AML12 cells were transfected with either mir-202-3p mimic or scrambled RNA for 24 hours, and were then serum-starved for 4 hours to induce Ppargc1a mRNA . There was also a significant reduction from the scramble-treated cells , however this reduction was significantly less than in the mir-202-3p treatments (scramble vs. mir-202-3p mimic P<0.01). The effect of scrambled RNA on the system may have been due to activation of a non-specific dsRNA response. In any event, the microRNA mir-202-3p experiment functionally confirmed a decrease Ppargc1a mRNA levels in cultured cells.In order to confirm the association between mRNA See . In thisS. aureus sepsis on the expression of the PGC family and other genes that regulate mitochondrial biogenesis in WT, TLR2−/−, and TLR4−/− mice and had two major new findings. First, there is a differential regulation of the PGC family members in S. aureus sepsis that occurs downstream of TLR signaling. Specifically, Ppargc1a and Ppargc1b show a peak expression at 6 h PI in WT mice (confirmed in vitro by exposing mouse hepatocytes (AML12 cells) to HKSA) and TLR4−/− mice, whereas Pprc expression peaks at 24 h PI in all three strains. The fact that Pprc is equally expressed in all three mouse strains indicates that the gene is not being regulated by signals downstream of either TLR2 or TLR4. However, Ppargc1a and Ppargc1b gene expression are modified by changes in TLR signaling, as TLR2−/− mice fail to up-regulate either gene, but TLR4−/− mice show greater mRNA up-regulation than WT mice. Second, we discovered that Ppargc1a and Ppargc1b gene expression may be controlled post-translationally in vivo. The microRNA mir-202-3p is specific for both Ppargc1a and Ppargc1b, and its expression correlates negatively with both genes. In addition, mir-202-3p functionally decreases Ppargc1a mRNA levels in AML12 cells. Thus, we report that Ppargc1a and Ppargc1b are co-regulated in the acute phase of S. aureus sepsis by factors that are downstream of innate immune activation, and that this co-regulation is correlated with the expression of mir-202-3p.This study examined the effects of acute −/− mice have an increased susceptibility to S. aureus, and have higher bacterial loads during S. aureus sepsis in vivo in the response to live S. aureus. The available data show that TLR4−/− mice have an impaired ability to respond to S. aureus−/− mice respond differently than WT mice to S. aureus sepsis is in line with the literature. In this study, the increased mortality of TLR4−/− mice (as compared to WT) in the setting of increased Ppargc1a and Ppargc1b gene expression does not rule out the possibility that overexpression of these genes could, in fact, increase survival. The loss of TLR4 has major repercussions for host defense, including impaired resolution of infection. TLR4−/− mice have dysregulated immune systems such that multiple factors unrelated to mitochondrial biogenesis probably contribute to the increased mortality rate. In general, TLR-deficient mice tend to fail to upregulate inflammation early in response to their TLR-specific pathogens Ppargc1a and Ppargc1b gene expression; instead, we showed a link between their deficiency in an otherwise intact physiologic system and differential regulation of Ppargc1a and Ppargc1b. Further studies such as in vitro work on TLR-deficient cells or a in a system of single TLR expression (such as TLR-expressing HEK293 cells) will be important in confirming the roles of TLRs in the regulation of Ppargc1a and Ppargc1b.TLR2 is activated by components of the Gram-positive cell wall, whereas TLR4 is activated in response to components of the Gram-negative cell membrane Nrf1,Gabpa, and Tfam were all up-regulated in response to S. aureus sepsis in all three mouse genotypes, but there was a lag in time-to-peak in TLR2−/− mice compared with WT mice (48 h vs. 24 h). In addition, TLR2−/− peak transcript levels trended towards being greater than WT peak transcript levels, implying that the system attempts to rescue the TLR2−/− phenotype. Furthermore, the genes of the downstream mitochondrial proteins showed less activation (Txnrd2) or a trend towards less activation at 24 h PI in TLR2−/− and TLR4−/− mice compared with WT mice. Taken together, the delayed or dampened activation of the assayed genes in TLR2−/− and TLR4−/− mice implies that appropriate activation of mitochondrial biogenesis requires TLR signaling.The mitochondrial biogenesis transcription factors Ppargc1a and Ppargc1b were co-regulated at 6 h PI in the mouse model, so analyses of both the proximal promoter regions and the 3′UTRs of all three PGC family members were performed in silico in order to identify similarities that could account for the observed co-regulation. Several transcription factors are known to regulate either of the genes alone, and several microRNAs have been shown to be involved in the stability of Ppargc1a and other mitochondrial genes in response to exercise Ppargc1a and Ppargc1b showed no similarities not also shared by that of Pprc, but the 3′UTRs of the two genes showed binding sites for at least three of the same miRNAs, none of which were found in the 3′UTR of Pprc. This narrow subset of miRNAs was further restricted to those that showed good binding characteristics and whose targets in the two mRNAs were predicted to be in single-strand formation.Ppargc1a and Ppargc1b mRNAs at sites likely to be in a single-strand formation. Measurements of mature mir-202-3p by Q-PCR revealed that mir-202-3p is increased at 6 h and 24 h in TLR2−/− mice and also at 24 h in WT mice, but is decreased at 24 h in TLR4−/− mice. This fits with both the lack of up-regulation of Ppargc1a and Ppargc1b mRNA in TLR2−/− mice at these time points, and their return to baseline levels at 24 h in WT mice. Thus mmu-mir-202-3p expression correlates with decreased Ppargc1a and Ppargc1b in this in vivo model of sepsis. We suspect that this degradation is caused by binding of mir-202-3p to the identified sites in the target mRNAs, leading to their degradation by the RISC. This in vivo finding was confirmed by in vitro reduction of Ppargc1a in response to mir-202-3p, but the differing magnitude of the changes in Ppargc1a may indicate that secondary effects are also at work. MicroRNAs can individually regulate large networks of genes, so the finding that mir-203-3p correlates with the down-regulation of Ppargc1a and Ppargc1b could in theory be due to a secondary effect of mir-202-3p on a different gene. Further in vivo studies of the microRNA may yield additional information on the complete range of functions of mir-202-3p.The microRNA mmu-mir-202 was previously shown to be one of the small subset of microRNAs that are found in the mitochondria, indicating that it may have associations with mitochondrial function Nrf1 and GabpaPpargc1a or Ppargc1b develop minor metabolic abnormalities, but mice deficient in both factors have a severely disrupted perinatal cardiac phenotype Ppargc1a and Ppargc1b are co-regulated in response to sepsis, and that mRNA stability for each correlates inversely with the expression mir-202-3p, indicate that both may serve pro-survival functions in sepsis. This also identifies mir-202-3p as a possible target for therapy, although currently there are no interventions that can target the blockade of specific miRNA in vivo. Future studies should identify the key transcriptional control mechanisms for mir-202-3p. This could open potential new avenues of mitochondrial therapeutics, as a decrease in mir-202-3p levels is associated with increases in Ppargc1a and Ppargc1b gene expression. This would translate to therapeutic potential if Ppargc1a or Ppargc1b gene activation could be shown to improve recovery or lessen mortality in clinical sepsis.It is well-recognized that dysregulation of oxygen metabolism leads to cellular dysfunction and that mitochondrial damage correlates with mortality in sepsis. Moreover, since mitochondrial biogenesis is activated by cell survival pathways, it is a pro-survival event in sepsis. The PGC family members are known co-activators of the mitochondrial biogenesis transcription factors Figure S1In silico promoter and intronal analyses of Ppargc1a, Ppargc1b, and Pprc. (A) The proximal 500 bp from the TSS in Ppargc1a, Ppargc1b, and Pprc from both mouse and human were aligned with zPicture and then submitted to rVista, with all transcription factors searched under an optimized matrix. (B) The proximal 1000 bp in intron 1 in Ppargc1a, Ppargc1b, and Pprc from both mouse and human were aligned with zPicture and then submitted to rVista, with all transcription factors searched under an optimized matrix.(6.63 MB EPS)Click here for additional data file.Figure S2In silico 3'UTR miRNA binding analyses of Ppargc1a, Ppargc1b, and Pprc. The 3'UTRs of Ppargc1a, Ppargc1b, and Pprc were analyzed in the mouse using TargetScan Mouse release 5.1. Shown are miRNAs with good seed-binding characteristics. The let-7 family and mir-202-3p were conserved between Ppargc1a and Ppargc1b.(3.31 MB EPS)Click here for additional data file.Figure S3In silico 3'UTR mRNA folding analyses of Ppargc1a and Ppargc1b. The entire mRNA sequences of Ppargc1a and Ppargc1b were separately fed into the program mfold, and predictions were made on average single-strand characteristics of the mRNA. Shown are the regions surrounding the predicted mir-202-3p binding sites. The green bars show the seed-binding regions, while the red bars show the length of predicted mir-202-3p binding.(1.09 MB EPS)Click here for additional data file.Table S1Real-time PCR primer sequences and gene accession numbers.(0.02 MB XLS)Click here for additional data file.

Statistically significantly upregulated genes were classified using gene ontology (GO) terms. Parallel samples were examined by flow cytometry for apoptosis by annexin V-binding and the expression of selected proteins were confirmed by immunoblotting.Significant differential modulation of 151 genes were found at 4 h after start of induction therapy with cytarabine and anthracycline, including significant overexpression of 31 genes associated with p53 regulation. Within 4 h of chemotherapy the BCL2/BAX and BCL2/PUMA ratio were attenuated in proapoptotic direction. FLT3 mutations indicated that non-responders are characterized by a unique gene response profile before and at 4 h. At 18–24 h after chemotherapy, the gene expression of p53 target genes was attenuated, while genes involved in chemoresistance, cytarabine detoxification, chemokine networks and T cell receptor were prominent. No signs of apoptosis were observed in the collected cells, suggesting the treated patients as a physiological source of pre-apoptotic cells.Pre-apoptotic gene expression can be monitored within hours after start of chemotherapy in patients with acute myeloid leukemia, and may be useful in future determination of therapy responders. The low number of patients and the heterogeneity of acute myeloid leukemia limited the identification of gene expression predictive of therapy response. Therapy-induced gene expression reflects the complex biological processes involved in clinical cancer cell eradication and should be explored for future enhancement of therapy. The pin vivo . As incrin vivo , there iClinical response to chemotherapy and karyotype analysis of AML cells provide prognostic information about risk for relapse . Gene exde novo AML patients before, at 2–4 h and at 18–24 h after start of intensive chemotherapy infusion. There was no detectable decline in viability in the sampled cells. Early gene expression was dominated by p53-associated genes, while the later gene expression was dominated by genes involved in cytarabine detoxification, chemoresistance and cell-cell interactions.In the present work we used high-density oligonucleotide microarrays to monitor therapy-induced changes of gene expression of AML blasts in seven 9/L eligible for treatment with chemotherapy. TP53 mutations are in general infrequent in AML [2 during 30 min on days 1–3) and cytarabine (200 mg/m2 daily as continuous infusion on days 1–7). Peripheral blood was collected by antecubital vein puncture. Cells were prepared by density gradient separation . The percentage of blasts exceeded 95% for all patients [in vitro . The control cells were cultured with vehicle (NaCl 0.9%) and all cells were sampled at the 4 hours time point, before the appearance of any morphological signs (bright field and Hoechst epifluorescence microscopy) of apoptosis. Patients 1, 2 and 3 have previously been analyzed for gene expression (cDNA array only) after 4 h and presented in reference [The study was approved by the local Ethics Committee affiliated with the University of Bergen, and samples were collected after signed written informed consent. During the time period 2001–2003 we consecutively collected peripheral blood AML blasts from 7 patients with WBC counts above 1.5 × 10t in AML as confit in AML . This anhttp://www.ncbi.nlm.nih.gov/projects/geo/ was used for partial validation. Poly(A)RNA purification, cRNA synthesis, aminoallyl cDNA synthesis and hybridization were performed as previously described [http://www.ebi.ac.uk/arrayexpress (Accession number: E-TABM-632)) in agreement with the MIAME guidelines.The cDNA microarray Agilent Human clone 1_clonesetB containing 12,814 unique clones, sourced from Incyte's UniGene 1 and Human Drug Target DNA clone sets escribed . The Agiescribed . Aminoalhttp://source.stanford.edu[Agilent's background subtracted signals were used to filter spots lower than background intensity in both channels and intra-array normalization was carried out using lowess . Genes wnford.edu. False dex vivo experiment cell samples were treated with different doses of anthracycline (daunorubicin). The untreated sample was kept as a control. Subsequently, the mRNA expression levels of the untreated sample were compared to the treated. To study if there was a general trend of up- or downregulation of genes in the treated compared to the untreated sample, the difference in expression levels was calculated for each gene. The genes were ranked according to expression difference for each of the three comparisons, e.g. three different rankings of the genes were produced, and these rankings were analyzed together using the rank product test [p-value for up- and downregulation in the treated samples relative to the untreated sample. On top of the rank product derived gene lists, we performed an iterative group analysis using GO terms as groups [In the uct test . The gens groups .http://www.molmine.com[The gene expression profile of patients with FLT3 length mutation/internal tandem mutation (ITD) (2/7) was analyzed against patients harboring FLT3 wildtype (5/7) using Significant Analysis of Microarray (SAM) and Analysis of Variance (ANOVA) performed in J-Express lmine.com.To confirm the observed differential gene expressions, we also performed qPCR by using TaqMan Low Density Arrays (T-LDA) (Applied Biosystems). We validated 22 upregulated genes and 8 downregulated genes of AML blasts sampled at start and at 4 h after start of treatment. The results of the T-LDA expression analysis were concordant with the Agilent cDNA and the oligo DNA microarray analyses , as described in Abrahamsen et al. 2002 . Cell siMaterial for protein analysis was collected according to standard procedures . The p53In this study we examined seven AML patients before (-30 min), at 2–4 h and at 18–24 h after start of first day standard induction therapy is strongly associated with disease relapse and low overall survival . We compSamples from all treated patients were analyzed using Agilent 44 k oligonucleotide microarrays and comparing gene expression before and after induction therapy with anthracycline and cytarabine. 113 upregulated genes (23 of unknown function) at early time points (2 – 4 hours) and 108 genes at late time points (18 – 24 hours) performed a minimum fold change of 1.6 and false discovery rate (FDR) below 11%. Downregulation was likewise observed for 38 genes at early and 17 genes at late time points after treatment. Several of the highly overexpressed genes did not have known function and performing BLAST analysis revealed that several of them contained Alu-like sequences. The downregulated genes showed low fold changes ranging from 1.6 to 2.0. The 113 upregulated genes (1.7 – 8.1 fold) in AML blasts 2–4 h after induction chemotherapy included 31 genes related to the tumor suppressor p53 . In contrast, the cells collected after approximately 24 h of chemotherapy demonstrated an increasing number of genes related to cell-cell contact annotations associated with the upregulated genes that discriminate early and late response to the drugs Figure . In totat Figure ; this inDifferentially overexpressed genes at 2–4 h included p53-induced genes related to oxidative stress, cell cycle arrest, DNA repair, autophagy and apoptosis ratio decreased at early time points in all samples analyzed Figure . Interesin vivo. We observed no induction of genes that are involved in the classical clearance of apoptotic cells in the circulating AML blasts [Studies by others have suggested that apoptotic AML blasts will not be detected in peripheral blood samples during chemotherapy ,28. DediL blasts ,43 excepL blasts . AnotherL blasts . We hypoWe observed increased expression of T-cell receptor complex components after 18–24 h of therapy Figure . AML celin vivo following start of induction chemotherapy confirms the vivid response to therapeutic DNA damage observed in experimental systems. The most prominent genes that were upregulated immediately after chemotherapy are pivotal determinants of apoptosis regulation in vitro and 18–24 h (late response) following treatment in vivo with anthracyclines according to Oligo DNA arrays, cDNA arrays and TaqMan Low Density Array (T-LDA).Click here for filein vivo chemotherapy.Permuting relationship between GO-terms and genes induced at late response following The iterative group analysis was used to analyze whether gene products associated with any term in gene ontology (GO) were over-represented among those found to be significantly regulated for early and late response. Source http://source.stanford.edu. False discovery rates for the list of reported GO-terms were estimated by performing 100 permutations.Click here for filein vivo.Early gene expression signature of chemotherapy treated AML The gene expressions of p53-associated genes implicated in the response to oxidative stress, cell cycle arrest, DNA repair, autophagy and apoptosis using standard anthracycline and cytarabine-based chemotherapy are shown. Red colored receptors and nodes represent upregulated genes observed within the first 24 hours of chemotherapy in vivo.Click here for file

The 1,3-di-4-pyridylpropane ligands are doubly bridging and connect the CoII ions into one-dimensional chains. The asymmetric unit also contains one uncoordinated 1,3-di-4-pyridylpropane mol­ecule, one 2-methyl-4-nitro­aniline mol­ecule and one perchlorate anion. In the crystal structure, inter­molecular O—H⋯N hydrogen bonds connect the one-dimensional chains into a two-dimensional network.In the title compound, {[Co(C DOI: 10.1107/S1600536808026470/lh2679Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

To compare the effects of low versus recommended levels of dairy intake on weight maintenance and body composition subsequent to weight loss.Two site , 9 month, randomized trial. Weight loss was baseline to 3 months, weight maintenance was 4 to 9 months. Participants were maintained randomly assigned to low dairy (< 1 dairy serving/d) or recommended dairy (> 3 servings/d) diets for the maintenance phase. Three hundred thirty eight men and women, age: 40.3 ± 7.0 years and BMI: 34.5 ± 3.1, were randomized; Change in weight and body composition from 4 to 9 months were the primary outcomes. Blood chemistry, blood pressure, resting metabolism, and respiratory quotient were secondary outcomes. Energy intake, calcium intake, dairy intake, and physical activity were measured as process evaluation.2-D while no change was observed in the low dairy group. No other differences were found for blood chemistry, blood pressure or physical activity between low and recommended dairy groups. The recommended dairy group showed significantly greater energy intake and lower respiratory quotient compared to the low dairy group.During weight maintenance, there were no overall significant differences for weight or body composition between the low and recommended dairy groups. A significant site interaction occurred with the low dairy group at KU maintaining weight and body composition and the low dairy group at UT increasing weight and body fat. The recommended dairy group exhibited reductions in plasma 1,25-(OH)Weight maintenance was similar for low and recommended dairy groups. The recommended dairy group exhibited evidence of greater fat oxidation and was able to consume greater energy without greater weight gain compared to the low dairy group. Recommended levels of dairy products may be used during weight maintenance without contributing to weight gain compared to diets low in dairy products.ClinicalTrials.gov NCT00686426 Almost two thirds of US adults are overweight or obese and at aRecent clinical studies are consistent with these observations. Increasing dietary calcium intake from ~400 to ~1200 mg/day during constant energy restriction resulted in 26 and 28% increases in weight and fat loss, respectively, compared to the lower calcium intake over a 24-week period, while significantly (~2-fold) greater effects were noted when dairy foods were utilized as a calcium source . HoweverRetrospective, observational, and epidemiological reports, including a two-year study of normal weight women and ten-Nonetheless, the role of dietary calcium in attenuating adiposity is further supported by mechanistic data. The increase in calcitriol elicited by low calcium diets modulates both lipogenesis and lipolysis, thereby increasing lipid filling and adiposity ,18; in aThus, multiple lines of evidence suggest a potentially important role for dietary calcium and dairy foods in the prevention and treatment of obesity. However, weight maintenance following successful weight loss is a critical component to the successful management of obesity, and although there are animal data to support the concept of calcium and dairy attenuation of weight and fat regain , no clinThis was a 2 site investigation located at the University of Kansas (KU) and The University of Tennessee (UT). Weight loss was from baseline (0) to 3 months followed by weight maintenance from 4 months to 9 months. To be eligible for weight maintenance, participants had to achieve the greater of a 10 kg or 10% weight loss from baseline. Participants who did not achieve this value were referred to alternative weight management programs. The primary outcomes were changes in weight and body composition during maintenance (4 months to 9 months).Potential participants underwent initial eligibility screening by telephone. Participants were 19 to 65 years of age and between 25 and 39.9 BMI. Participants were excluded if they could not participate in moderately vigorous physical activity, used special diets (i.e. vegetarian), used medications affecting metabolism , or were currently taking calcium supplementation. Participants were excluded if they exhibited eating disorders (score >20 on the Eating Attitudes Test) , restraiWeight management clinics were conducted weekly for the entire investigation for ~60 minutes for both recommended and low dairy groups. The same health educator at each site led both recommended and low dairy groups to diminish investigator bias. Groups met on separate days to minimize contamination. Both groups received the same behaviorally based clinic on topics of lifestyle change, physical activity, and nutrition. For example, topics included preparation of meals, shopping, label reading, addition of fruits and vegetables (F/V), physical activity (PA), goal-setting, self-monitoring, social support, etc. Information differed only on the topic of nutrition during weight maintenance where the group randomized to recommended dairy received information and strategies for achieving = 3 servings of dairy per day and the group randomized to low dairy did not receive this information. At each meeting, participants reported the estimated energy expended each week through PA as well as the number of steps recorded by step counter. For quality assurance, clinics were supervised by one of the investigators.Energy intake was reduced to ~1,200 to 1,500 kcal/day using a combination of meal plans, pre-packaged meals (PMs), F/V, and shakes. A typical daily weight loss diet can be found in Table Participants consumed a weight maintenance diet using healthy eating strategies learned during clinics . Maintenance levels of calorie intake were estimated from predicted resting metabolic rate (RMR) and level of reported physical activity. Participants were encouraged to continue to use meal plans, PMs, 5 servings of F/V, and non-caloric beverages of choice as part of their weight maintenance strategy. Participants in the recommended dairy group were instructed to consume at least 3 servings of dairy per day as fluid milk, yogurt, or cheese and those in the low dairy group were instructed to consume 1 or fewer servings of dairy per day. Dairy servings were standardized at 1 cup (240 mL) milk, 1 cup (227 g) yogurt or 42 g hard cheese (e.g. cheddar).A progressive program of MVPA was designed to target ~10,000 steps per day by week 4. Participants were given pedometers at baseline and reported steps at weekly meetings. The number of steps per day was averaged across 3 month intervals and recorded at 3, 6, and 9 months..Three day food records were obtained at baseline, 3, 6, and 9 months. The records were reviewed and clarified in an interview with a registered dietitian utilizing food models and neutral probing questions, as previously described ,28. SubsStaff training occurred at each site according to mutually approved protocols. Prior to data collection, all staff had to be certified per procedure. For example, values for dual energy X-ray absorptiometry (DEXA), food records, etc., were compared to known standards or to values generated by the investigators. Adherence to protocols was monitored by the site PI. All data collected from both sites were transferred to a data coordinator at KU to check for accuracy, completeness, outliers, etc. Data were subsequently transferred to the study statistician (MM) for analysis.All laboratory assessments were obtained at baseline, 3, 6, and 9 months using standardized protocols.Height and weight were obtained after a 12 hour fast between the hours of 6 am and 10 am. Height was obtained using a stadiometer and weight was obtained with a calibrated scale accurate to + 0.1 kg. Participants were measured in a standard hospital gown after attempting to void.a priori as the action level requiring instrument service and recalibration; however, this action was not required during the study. Application software provided by the manufacturer was utilized to quantitate body composition. As a surrogate measure of abdominal adiposity, waist circumference was measured using the procedures of Lohman et al. [DEXA (Lunar Corp.) was used to determine, total fat mass, trunk fat mass, fat free mass, and percent body fat. Women received a pregnancy test prior to each DEXA test. The DEXA was calibrated daily using the calibration block supplied by the manufacturer and weekly using a spine phantom, and each site utilized a single operator. A drift of more than 3% was established n et al. .2-D levels were measured via immunoassay using commercial kits.Blood samples were obtained after a 12 hour fast. Serum cholesterol and triglyceride concentrations were measured by the hospital clinical laboratories at each site using an automated analyzer (Du Pont Co), and using standard enzymatic techniques. High-density lipoproteins (HDL) were measured after removal of very-low-density lipoproteins (VLDL) and low-density lipoproteins (LDL) from samples by precipitation with phosphotungstate . GlucoseBlood pressure was measured using a sphygmomanometer with the subject seated for a minimum of 5 minutes in an isolated room with the arm bared, supported, and positioned at the heart level. A cuff was selected based on measurement of the length and circumference of the arm . SystoliRMR was determined by indirect calorimetry using the open circuit technique between the hours of 6 am and 10 am after a 12 hour fast and 48 hour abstention from exercise . The parDescriptive statistics for all variables were calculated for the entire study population and also calculated by treatment group at all four time points. Frequencies and percentages were used to summarize categorical variables and means and standard deviations were used to summarize quantitative variables.The primary method of analysis was linear mixed models and the primary outcomes were change from the start of the maintenance period (3 months) to the midpoint (6 months) and end (9 months) of maintenance periods . The models had a mean structure consisting of an intercept and the following variables: baseline (time 0) value, time period , treatment group , site , and an interaction of treatment group by site. Interaction between treatment group and time period was tested but was not significant in any of the models so it was not used.The covariance structure used for the models was compound symmetric and its parameters were allowed to differ for the two treatment groups. The p-values shown in the tables for "Type III Tests of Fixed Effects" are from F-tests against the null hypothesis that the parameter value for each variable is zero given that all other variables and the interaction are in the model. Kenward-Roger adjustments for the denominator degrees of freedom were used in all models. Due to the significant site by treatment group interaction in the models, post-hoc Tukey adjusted t-tests for pair-wise comparisons of interest were calculated when the overall tests were significant. A separate model was run for each variable.Differences within treatment groups in the mean change in weight, RMR, RQ, BMI, total body fat, trunk fat and waist circumference between baseline and 3 months was tested via a Satterthwaite adjusted two sample t-test. The same type of test was used for testing differences in dietary/energy intake variables between treatment groups at each of the four time periods. All analyses were done using SAS version 9.1 .Registration: ClinicalTrials.gov NCT00686426Three hundred thirty eight participants were randomized at baseline and 270 (82%) were eligible for evaluation during maintenance. Of those not eligible for evaluation, 46 did not meet the weight loss requirements. Seventy nine percent of participants were Caucasian, 15% Hispanic, 5% African American, and 1% Other. No significant differences at baseline existed for participants in the recommended or low dairy groups Table . The UT Reported energy intake during weight loss was 1258 ± 202 kcal/d for the recommended dairy group and 1199 ± 187 kcal/d for the low dairy group (p = 0.01). Reported energy intake during weight maintenance at 6 months was 9% below study baseline values for the recommended dairy group and 22% below baseline values for the low dairy group. Reported energy intake during weight maintenance at 9 months remained 9% below baseline values for the recommended dairy group and was 19% below baseline values for the low dairy group. Energy intake was significantly greater (p < 0.0001) for the recommended dairy group compared to the low dairy group during weight maintenance Figure ; howeverDuring weight loss, the recommended dairy group consumed 1.2 ± 0.5 servings of dairy/d and low dairy consumed 1.1 ± 0.5 servings of dairy/d (NS). From 3 to 6 months, recommended dairy consumed 3.0 ± 0.6 servings of dairy/d and low dairy consumed 0.6 ± 0.3 servings of dairy/d (p < 0.0001). From 6 to 9 months, recommended dairy consumed 3.1 ± 0.5 servings of dairy/d and low dairy consumed 0.7 ± 0.4 servings of dairy/d (p < 0.0001). During weight loss, calcium intake was 731 ± 251 mg/d for the recommended dairy group compared to 707 ± 230 mg/d for the low dairy group (NS). During weight maintenance, calcium intake was 1325 ± 254 mg/d for the recommended dairy group compared to 579 ± 166 mg/d for the low dairy group (p < 0.0001).PA was nearly identical for recommended and low dairy groups. The recommended level of dairy group at 3, 6, and 9 months had 8546 ± 2008, 8754 ± 2227, and 8765 ± 2252 steps/d, respectively. The low dairy group at 3, 6, and 9 months had 8332 ± 2320, 8729 ± 2436, and 8789 ± 2320 steps/d, respectively.There were no significant differences between the recommended and low dairy group for weight loss, BMI, total body fat, trunk body fat, or waist circumference from baseline to 3 months Table . The pri2-D. Baseline 1, 25-(OH)2-D was 43.8+9.8 pg/mL in the recommended dairy group and decreased by 5.8 and 6.9 pg/mL at 6 and 9 months, respectively (p < 0.0001), while there was no significant change in the low dairy group.There were no significant differences between recommended and low dairy groups for changes in total cholesterol, triglycerides, HDL, LDL, SBP, DBP, glucose, and insulin. Both the recommended and low dairy groups showed significant increases during maintenance for cholesterol (p = 0.0001), HDL (p = 0.02), LDL (p = 0.0009), SBP (p = 0.02), and DBP p = 0.006). Differences for triglycerides, glucose, and insulin were not significant (Table . DiffereRMR declined significantly during energy restriction from baseline to 3 months for both recommended and low dairy groups (p < 0.0001). RMR showed a trend (p = 0.08) for greater increase during weight maintenance for the recommended compared to low dairy group. RQ decreased for both recommended and low dairy groups during energy restriction p = 0.0007). During weight maintenance, the low dairy group showed a significantly greater increase (p < 0.01) in RQ compared to the recommended dairy group Of interest, the low dairy group had decreased energy intake compared to the recommend dairy group at all time points yet maintenance of body weight and fat were not different. This suggests that diets with recommended levels of dairy may be higher in energy content while producing similar effects on body weight and fat as diets low in dairy. The reason for this is unclear; however, the recommended level of dairy group had a trend towards greater RMR during weight maintenance compared to the low dairy group (p = 0.08) and a significantly lower RQ (p = 0.01), indicating greater fat oxidation. Greater RMR may impact energy balance by allowing a greater energy intake for the recommended dairy group without increased weight gain when compared to the low dairy group. Additionally, the recommended dairy group also may have benefited from increased fat oxidation compared to the low dairy group, and this also may have influenced energy balance.In support of this, calcitriol inhibits lipolysis and fat oxidation , and supAn additional consideration is the potential direct effect of recommended vs. low levels of dairy intake on appetite and food consumption. Dairy products have been proposed to increase satiety and attenuate food intake due to both protein-induced satiety ,42 and tad libitum dietary phase while others demonstrate rapid regain, although longer term studies consistently demonstrate regain within 12 months. Although consistent methodology was used across the two sites, it appears that there were site differences in the retention of the behavioral strategies acquired by subjects during the weight loss phase. Nonetheless, the effects of recommended dairy intakes on fat oxidation as evidenced by RQ changes and on the ability to consume more food energy than low dairy consumers without adversely affecting body weight or body composition was consistent across the two sites in both separate and combined analyses.There were significant site differences with respect to weight change during the maintenance phase. During the first three months of maintenance, the low dairy group at UT exhibited weight regain that was significantly attenuated in the recommended dairy group; in contrast, the KU cohort exhibited continued weight loss during the first three months of the maintenance phase. Both patterns are common in studies of regain, with some extending adherence to behavioral strategies learned during weight loss into the early 2-D in the recommended dairy group during the maintenance phase.This study was conducted in free-living outpatients, with attendant limitations of adherence to protocol and under-reporting of energy intake. Nonetheless, key strengths of this investigation include its sample size and adherence to diet, the latter of which is supported by confirmation of anticipated suppression of 1,25-(OH)Fifty percent of adults attempt to lose and maintain weight loss annually. Individuals frequently utilize diets that restrict nutrients and eliminate food groups in the effort to achieve weight loss and maintenance, and dairy products are often viewed as potentially fattening by many who diet, especially women. This investigation could find no disadvantage for weight maintenance by consuming a diet with the recommended levels of dairy products compared to a low level of dairy products. Those who did consume the recommended amount of dairy products during weight maintenance exhibited evidence of greater fat oxidation and were able to consume a greater amount of total energy compared to those who consumed less dairy products without any additional weight gain. Being able to consume greater amounts of energy may provide benefit for chronic adherence to a weight maintenance diet. This study indicates that dairy products may be used in a weight maintenance diet without contributing to weight gain compared to diets that are low in dairy products.MBZ and JED have received grants from the National Dairy Council. MBZ holds patents covering uses of dietary calcium in weight management.MBZ and JED participated in the design, interpreted the results and helped draft the manuscript. DKS participated in the design and assisted with interpretation of the results and manuscript preparation. MSM participated in the study design and data analysis. GCW assisted with the data analysis and manuscript preparation. ELW and DM-H assisted with analysis and interpretation of the nutritional data and manuscript preparation. JR assisted with analysis of the clinical data and manuscript preparation. BB assisted with data acquisition and manuscript preparation. XS assisted with the design and interpretation of results. RAW assisted with the analysis and interpretation of the physical activity data and manuscript preparation.

Membrane protein function is regulated by the cell membrane lipid composition. This regulation is due to a combination of specific lipid-protein interactions and more general lipid bilayer-protein interactions. These interactions are particularly important in pharmacological research, as many current pharmaceuticals on the market can alter the lipid bilayer material properties, which can lead to altered membrane protein function. The formation of gramicidin channels are dependent on conformational changes in gramicidin subunits which are in turn dependent on the properties of the lipid. Hence the gramicidin channel current is a reporter of altered properties of the bilayer due to certain compounds. Springer Protocols for more information about preparing artifical bilayers and using gramicidin channels for probing membrane elasticity.Please visit

Because vanadate ion is a potent mitogen and accumulates in the gut of rodents fed vanadate supplements, effects of ammonium metavanadate in drinking water (10 ppm or 20 ppm) were studied on the development of large bowel neoplasms in mice treated with 1,2-dimethylhydrazine (DMH) (20 mg kg-1 weekly for 20 weeks). In the colon at 30 weeks DMH treatment caused a 14% increase in RNA content, an 18% increase in DNA content, and 33% deeper crypts. Vanadate at either 10 ppm or 20 ppm decreased RNA content by approximately 11%. Although vanadate increased thymidine incorporation 210% to 550% compared with controls, it had no influence on the attack rate, incidence, or histological type of tumours induced by DMH.

Eosinophilic oesophagitis (EO) is an emerging yet increasingly prevalent disorder characterised by a dense and selective eosinophilic infiltration of the oesophageal wall. While EO is considered an atopic disease primarily triggered by food antigens, disparities between standard allergen testing and clinical responses to exclusion diets suggest the participation of distinct antigen-specific immunoglobulin E (IgE) in the pathophysiology of EO.To find evidence for a local IgE response.Endoscopic biopsies of the distal oesophagus of atopic and non-atopic EO and control individuals (CTL) were processed for immunohistochemistry and immunofluorescence to assess the presence of B cells, mast cells, and IgE-bearing cells. Oesophageal RNA was analysed for the expression of genes involved in B cell activation, class switch recombination to IgE and IgE production, including germline transcripts (GLTs), activation-induced cytidine deaminase (AID), IgE heavy chain (Cε) and mature IgE mRNA using polymerase chain reaction and microarray analysis.<0.05) and of IgE-bounded mast cells compared to CTL. Both EO and CTL expressed μGLT, εGLT, γ4GLT, AID, Cε and IgE mRNA. However, the frequency of expression of total GLTs (p = 0.002), εGLT (p = 0.024), and Cε (p = 0.0003) was significantly higher in EO than in CTL, independent of the atopic status.Regardless of atopy, EO showed increased density of B cells (pThese results support the heretofore unproven occurrence of both local immunoglobulin class switching to IgE and IgE production in the oesophageal mucosa of EO patients. Sensitisation and activation of mast cells involving local IgE may therefore critically contribute to disease pathogenesis. Eosinophilic oesophagitis (EO) is a chronic inflammatory disorder, restricted to the oesophagus, whose pathogenesis is poorly understood. Studies from North America,10Several lines of evidence support the view that EO is an atopic disorder.Mast cells are resident cells of the oesophagus, shown previously to be increased in number and to correlate with eosinophil counts and eotaxin-3 in the mucosa of EO patients.+ in the oesophagus supports its participation in allergen sensitisation and IgE production, highlighting a potential role for B lymphocytes and mast cells in this disease. Following antigen stimulation, mature B lymphocytes undergo class switch recombination (CSR) by changing the C region of the Ig H chain (CH) with a downstream region on human chromosome 14,The oesophageal mucosa displays a strong immunological capacity conveyed via a diversity of resident immune cell types,We hypothesised that the oesophageal mucosa acts as a site for IgE generation in EO. We examined a cohort of paediatric patients and studied B cell levels in the oesophageal mucosa, and the molecular steps involved in CSR to IgE. Our results identify the human oesophagus as an immunologically active tissue with regard to B cell antibody production, suggesting a role for B lymphocytes and local IgE synthesis in EO and implicating local IgE-mediated mast cell degranulation as an important contributor to EO pathogenesis.Patients were retrospectively selected without any regard to age, atopic status, or gender from our database at the Division of Pathology and Laboratory Medicine at Cincinnati Children’s Hospital Medical Center. Biopsy specimens were collected from the distal oesophagus, fixed in formalin and processed for pathological analysis with haematoxylin & eosin (H&E) staining. Diagnosis of EO was established by a pathologist based on a maximum eosinophil count of ⩾15 eosinophils per high-power field , the presence of inflammatory infiltrate, and the hyperplasia of the basal epithelial layer. The control group (CTL) included patients with symptoms typical of GORD and EO, most of them under PPI therapy, which showed normal endoscopic and histological evaluation and the presence of ⩽5 eosinophils/hpf. We first studied the cellular infiltrate and the expression of B cell-related genes in patients from our database regardless of therapy, and thereafter selected a cohort of patients without corticosteroids or diet therapy to assess molecular markers of CSR and IgE synthesis. The detailed clinical characteristics of the selection of EO and CTL patients including eosinophil counts in the oesophageal epithelium, atopic status and therapy are shown in + cells using the Metamorph Imaging system . Total stained cells and total surface area were quantified in the three compartments of the oesophageal mucosa: the epithelium, the vascular papillae (projections of the lamina propria towards the undersurface of the epithelium)2 of tissue. Tryptase+ cells were counted in at least 10 non-overlapping fields and the results are expressed as the maximum number of positive cells per hpf.Formalin-fixed, paraffin-embedded biopsies were sectioned at 4 μm and stained with antibodies following standard procedures. B lymphocytes were identified with mouse anti-human CD20 , and mast cells with mouse anti-human tryptase . Staining was developed with the LSAB®2 System-HRP . Sections of human tonsils and nasal polyp were used as positive control for CD20 or tryptase staining, respectively. The primary antibody was omitted as a negative control. One biopsy section from each patient was subjected to CD20 or tryptase staining. Morphometric analysis was performed for quantification of CD20Double immunofluorescence staining was performed in side-mounted paraffin sections. Mast cells were identified with rabbit anti-human CD117 (Cell Marque) and IgE-bearing cells with chicken anti-human IgE primary antibodies. Secondary antibodies were Alexa Fluor 488-labelled goat anti-rabbit and biotinylated donkey anti-chicken , following Alexa Fluor 594 labelled streptavidin (Invitrogen). Slides were cover-slipped using antifade medium containing 4′,6-diamidine-2′-phenylindole dihydrochloride (DAPI) and assessed and photographed using an RT Slider digital camera mounted on an E600 fluorescence microscope . Nasal polyp biopsy sections from an allergic patient were used as positive control tissue. Isotype-matched control antibodies were used as negative control. Results are expressed as the maximum number of stained cells per reticle area using a Nikon CF1 ×10 eyepiece.Each biopsy from the distal oesophagus was immediately immersed in RNAlater and stored at 4°C. Total mRNA was isolated using the RNAeasy Mini Kit (Qiagen) and hybridisation to DNA microarray was performed by the Microarray Core. Microarray analysis and assessment of transcripts from B lymphocyte-related genes were performed as previously described.36The RNA samples (500 ng) were subjected to reverse transcription analysis using Inscript reverse transcriptase following the manufacturer’s instructions. Germ-line transcripts (GLTs) from εGLT, μGLT, γ1GLT and γ4GLT, and AID mRNA were amplified with validated primer sets.IL4, IL13 and the heavy chain of the IgE gene (Cε) were first amplified by PCR and sequenced to confirm their identity. PCR products were used to build a standard curve for the real-time PCR reaction by means of the LightCycler instrument and LightCycler FastStart DNA Master SYBR Green I as a ready-to-use reaction mix . Primers used were: IL4F (5′-ACATCTTTGCTGCCTCCAA), IL4R (5′-AGGCAGCGAGTGTCCTTCT); IL13F (5′-ACAGCCCTCAGGGAGCTCAT), IL13R (5′-TCAGGTTGATGCTCCATACCAT); CεF (5′-CACGCTCTCTGGTCACTATG) and CεR (see above). Amplification conditions were denaturation at 96°C for 10 min, followed by 40 cycles of denaturation at 96°C for 5 s, annealing at 60°C (IL4 and IL13), or 65°C (Cε) for 15 s and elongation at 72°C for 15 s. The expression of the different transcripts was normalised to GAPDH, and results are expressed as fold induction with respect to the CTL group.2 test was used for comparison of frequencies of GLTs and IgE transcripts. Numeric variables were analysed with the non-parametric Mann–Whitney U test. Correlation between CD20+ cells and tryptase+ counts was analysed using the Spearman rank correlation test. A value of p<0.05 was considered statistically significant.All histological samples were randomly coded, and sections were counted blinded, independent of the clinical protocol. The χ+ cells than the CTL samples, and no difference was observed in the lamina propria (<0.001)). Mast cell infiltration was also increased in EO compared to CTL samples , being individually nine of 11 EO, and three of eight CTL for εGLT (p = 0.024); six of 11 EO, and four of eight CTL for μGLT (p = 0.456); and five of 11 EO, and one of eight CTL for γ4GLT (p = 0.064). Interestingly, GLTs were similarly detected in both atopic and non-atopic EO patients. All PCR products were gel-extracted and sequenced to confirm their identity with the corresponding IgH chain sequences present in GeneBank (data not shown).The transcription of GLTs is essential for CSR and is the first step in the commitment of B cells to the synthesis of IgG, IgA and IgE. We detected εGLT, μGLT and γ4GLT but not The enzyme AID catalyses the initial step of CSR in germinal-centre B cells, and has recently been detected outside lymphoid structures.All EO subjects showed higher expression of Cε than CTL patients, as determined by quantitative PCR . The amp = 0.0635). Importantly, and consistent with the data presented herein, detection of mature IgE mRNA suggests in situ production of IgE in the oesophageal mucosa, independent of the atopic status of the patient.The final step of CSR is antibody production. Mature IgE mRNA was detected in five of 11 EO, regardless of atopy, and in one of eight CTL subjects . Differe+ cells were detected only in EO and mast cells were present in both groups; however, only the EO group showed IgE-bearing mast cells. Of the total intraepithelial mast cells, the percentage of IgE+ cells was increased in atopic compared to non-atopic EO patients . Notably, the epithelium contained a population of IgE+ CD117− cells which was absent in CTL subjects.We detected three different cell populations in the oesophageal epithelium based on IgE and CD117 positivity . IgE+ ceEosinophilic oesophagitis is a chronic inflammatory disease in which the presence of mediators such as IL5, IL13 and eotaxin, the cellular infiltrate , and the association with allergic disorders, all point to a Th2-associated disease. A prominent feature of the Th2 immune response is antibody production; however, the participation of B cells in the pathogenesis of EO has not been extensively studied, probably because of the low amount of infiltrating B cells as compared with other immunocytes in the oesophageal epithelium. Our study also shows that B lymphocytes are moderately increased, consistent with studies in adult EO patients,CSR has been restricted to lymphoid tissues; however, recent studies have proved this phenomenon at certain mucosal sites.41Atopy is more prevalent in subjects who have EO than in the general population.IL4 and IL13 have a key role in the induction of IgE switching by stimulating transcription from the germline promoter site of IgE, via STAT6 sites,+ cells in the oesophageal epithelium has been shown previously in EO, and it has been assumed that those IgE-bearing cells were all mast cells.+ cells and tryptase+ cells, the expression of IgE mRNA and the density of IgE+CD117+ in EO, suggest that IgE-mediated mast cell activation importantly contributes to disease pathogenesis.The presence of IgE+CD117− population. In patients with allergic rhinitis, approximately 4% of the B cells and 15% of plasma cells express IgE in the nasal mucosa and, in that situation, it has been suggested that the maturation of IgE-expressing B cells (activated or memory) to IgE-producing plasma cells takes place locally.+ cells in the oesophageal epithelium has been proven previously.+CD117− cells, since the Ig J chain gene is expressed only after the terminal differentiation of B cells towards plasma cells.48Of interest, we report a population of IgE-bearing cells lacking CD117 expression. Eosinophils could account for this population, since they express FcεRI and FcεRII.+ cells are a specific feature of EO compared with control individuals. As such, we propose that the oesophageal mucosa is a site for initiation and development of humoral responses. These results offer an explanation for the dissociation between skin-prick test results and food elimination diets in EO.In summary, we have demonstrated increased B cells and expression of molecular Ig machinery in the oesophageal mucosa of paediatric patients with EO regardless of the atopic status. Furthermore, we have determined that IgE

Gradient recalled echo (GRE) MRI, sensitive to blood oxygenation changes, and spin echo (SE) MRI, sensitive to perfusion/flow, showed large signal intensity increases with carbogen breathing. Nicotinamide, thought to act by suppressing the transient closure of small blood vessels that cause intermittent tumour hypoxia, induced a small increase in blood oxygenation but no detectable change in perfusion/flow. Carbogen combined with nicotinamide was no more effective than carbogen alone. Both carbogen and nicotinamide caused significant increases in the nucleoside triphosphate/inorganic phosphate (βNTP/P i) ratio, implying that the tumour cells normally receive sub-optimal substrate supply, and is consistent with either increased glycolysis and/or a switch to more oxidative metabolism. The most striking observation was the marked increase in blood glucose (twofold) induced by both nicotinamide and carbogen. Whether this may play a role in tumour radiosensitivity has yet to be determined. Copyright 2000 Cancer Research Campaign© 2000 Cancer Research CampaignBoth host carbogen (95% oxygen/5% carbon dioxide) breathing and nicotinamide administration enhance tumour radiotherapeutic response and are being re-evaluated in the clinic. Non-invasive magnetic resonance imaging (MRI) and

Neuropathological, animal, and cell culture studies point to a role for the body's own endogenous cannabinoids (eCBs) system in Alzheimer's disease (AD) pathology and treatment. To date, no published studies have investigated the potential utility of circulating eCBs as diagnostic biomarkers for AD or the impact of central eCBs on cognition.In comparison with healthy controls, there were no significant differences in measured eCB concentrations in plasma samples from patients with AD. Detectable eCBs in cerebrospinal fluid (CSF) had no relationship to cognitive performance in healthy controls at risk for AD. In pooled plasma samples, an inverse correlation was observed between plasma levels of the eCB 2-AG (2-arachidonoylglycerol) and TNF-α .These results suggest that circulating endocannabinoids do not have utility as diagnostic biomarkers for AD and do not have a robust correlation with cognitive performance. Circulating levels of 2-AG may downregulate TNF-α production. N-arachidonoylethanolamide (AEA) and 2-arachidonoylglycerol (2-AG) produced "on-demand" from cell membrane precursors in a variety of cell types including both neurons and immune-competent cells in the periphery and central nervous system ; degradative enzymes; and at least two cannabinoid receptors (CB1 and CB2) N-arachidonoyl ethanolamine (D8-AEA) was purchased from Cayman Chemical .High performance liquid chromatography (HPLC) grade water, methanol, and acetonitrile used for mass spectrometric studies were purchased from VWR international, Plainview, NY. Mass spectrometry/HPLC grade acetic acid, formic acid, and ammonium acetate were purchased from Sigma-Aldrich. [2H8] N-arachidonoyl ethanolamine was spiked into each sample to measure recovery. This solution was vortexed for 1 minute then underwent centrifugation at 19,000 × g at 24°C for 20 minutes. The supernatant was diluted with HPLC water to reach a concentration of 25% organic. Lipids were partially purified from plasma on C8 solid phase extraction columns from which the final eluent of 100% methanol was further extracted on C18 solid phase extraction columns. Lipids were partially purified from CSF on C18 solid phase extraction columns only. In brief, each 500 mg (plasma) or 100 mg (CSF) column was conditioned with 5.0 ml methanol and 2.5 ml water followed by loading of the water/supernatant solution. Columns were then washed with 2 ml water and 1.5 ml 55% methanol. Compounds were eluted with 1.5 ml 100% methanol. The final elution from the C18 column was used for analysis of anandamide and 2-AG.Lipid extractions were performed on human plasma with the addition 9.5 milliliters of a 1:1 mixture of methanol and acetonitrile to each 1.5 ml of plasma. Lipid extracts of cerebral spinal fluid (CSF) were made by first adding 9.0 milliliters of a 1:1 mixture of methanol and acetonitrile to 1.0 ml CSF. An internal standard of 50 picomoles of [Rapid separation of analytes was obtained using 20 μl injections of the 100% methanol elution onto a Zorbax eclipse XDB 2.1 × 50 mm reversed phase column. Gradient elution using mobile phase A of 20% methanol, 1 mM ammonium acetate and 0.5% acetic acid and mobile phase B of 100% methanol, 1 mM ammonium acetate and 0.5% acetic acid (200 μl/min) was formed under pressure on a pair of Shimadzu 10AdVP pumps. Mass spectrometric analyses were performed with an Applied Biosystems/MDS Sciex API 3000 triple quadrupole mass spectrometer and an API 4000 QTRAP that were both equipped with an electrospray ionization source. Levels of each compound were analyzed by multiple reactions monitoring (MRM) on the LC/MS/MS systems as previously reported . Mass spTNF-α ELISA was performed at the LZRC using R and D Systems Quantikine High Senstivity TNF-α/TNFSF1A Immunoassay for serum and plasma (#HSTAOOD). C-reactive protein was quantified with an immunoturbidimetric assay.Plasma For endocannabinoid quantification, we compared AEA and 2-AG values between AD subjects and controls using a non-paired t test. We correlated AEA and 2-AG values with CRP and TNF-α using Pearson's r. One subject, whose 2-AG levels were over three and a half standard deviations from the mean, was excluded from analysis. For analysis of cognition, we correlated 2-AG values with cognitive test performance using Spearman's rank order method so as to reduce the chance that outliers might "drive" a finding.Concentrations of AEA and 2-AG were successfully quantified in all plasma samples assayed. There were no significant differences in mean plasma concentrations of either AEA or 2-AG between AD subjects and elderly controls . AEA was not detected in any CSF samples. The mean age of subjects was 62.7+/-8.0 yrs, and 71% were female. There was no significant correlation found between CSF 2-AG concentrations and any measured domain of cognition.In a sample of 19 subjects with AD and 12 elderly controls, we found no significant differences in concentrations of plasma eCBs. An argument could be made that this study was not sufficiently powered to detect difference. However, significant alterations in concentrations of plasma eCBs have been demonstrated in similarly sized samples of patients with other neuropsychiatric conditions. In a sample of 12 women with bulimia nervosa, 15 women with anorexia nervosa, and 15 healthy women, a significant increase in plasma AEA was reported in both bulimic and anorexic patients compared with controls; leptin concentrations were significantly inversely correlated with AEA concentrations in both anorexic patients and healthy controls . Plasma Although a larger study would be necessary to conclusively dismiss any impact of AD pathology on circulating eCBs, our aim was to evaluate the utility of eCBs as diagnostic biomarkers for AD. There was sufficient power in the present study to detect a clinically useful discrepancy in eCB plasma concentrations had one existed in the populations represented by these samples. While this study does not support the utility of eCBs as diagnostic biomarkers of disease state in AD, longitudinal studies are required to evaluate whether perturbations in eCBs occur over the course of disease, and whether they are associated with particular presentations or rates of disease progression.in vitro data seems to support the notion that eCBs exert some control over its production via the CB2 receptor. For instance, 2-AG inhibits the production of TNF-α production in both lipopolysacharide-stimulated mouse macrophages [in vivo research is required to clarify these relationships.Elevations in inflammatory plasma proteins, most notably C-reactive protein, have been found to be associated cross-sectionally and prospectively with AD . For thirophages and liporophages . Most strophages ; althoug9-THC impacts learning and memory. Consistent with this, CB1 receptor localization has revealed abundant expression in hippocampus, cerebral cortex, cerebellum, and basal ganglia [1 receptors in hippocampus and neocortex are distinctly expressed by GABAergic interneurons, and interact with endocannabinoids produced in post-synaptic neurons in a retrograde manner, with resultant depolarization-induced suppression of inhibition [There is little doubt that the active cannabinoid constituent Δ ganglia . In the ganglia . CB1 rechibition . As moduIn summary, we did not find evidence suggesting a direct relationship between the eCB system and AD. The potential value of eCB quantification for AD and the functional relevance of eCBS as mediators of cognitive performance remains unclear. The neuropathological, animal, and cell culture reports which have implicated the eCB system in AD require focused translational experiments in clinical research to determine what consequence, if any, eCB functional variability has on cognition, disease development or progression.PD is a paid consultant to, and equity owner in, Applied Neurosolutions, Inc. The authors have no competing interests.JK designed study, wrote protocol, recruited subjects. MG performed lumbar puncture and helped with manuscript preparation. TG designed cognitive testing strategy, performed statistical analysis. PM and HK performed immunoassays (ELISA). HB, MP, and JMW designed and carried out eCB analysis in plasma and CSF. EC and PD aided in the design of the study, interpretation of data, and helped to draft the manuscript.

P-values (derived using an appropriate hypothesis test) below a certain rejection level. This selection, however, is not possible without accepting some false positives and negatives since the two sets of P-values, associated with the genes whose expression is and is not affected by the distinction between the different malignancies, overlap. We describe a procedure for the study of differential expression in microarray data based on receiver-operating characteristic curves. This approach can be useful to select a rejection level that balances the number of false positives and negatives and to assess the degree of overlap between the two sets of P-values. Since this degree of overlap characterises the balance that can be reached between the number of false positives and negatives, this quantity can be seen as a quality measure of microarray data with respect to the detection of differential expression. As an example, we apply our method to data sets studying acute leukaemia.A basic problem of microarray data analysis is to identify genes whose expression is affected by the distinction between malignancies with different properties. These genes are said to be differentially expressed. Differential expression can be detected by selecting the genes with Microarrays allow for the simultaneous measurement of expression levels of thousands of genes in tissues originating from different classes of malignancies is used to rank the genes with respect to their differential expression between the different tumour types or experimental conditions. Subsequently, an arbitrary threshold or rejection level α is chosen to select the genes that warrant further investigation or validation , the choice of this rejection level has some consequences can be considerable (problem of multiple testing).However, due to the overlap of the P-value that is larger than the rejection level, resulting in discarding potentially valid targets.Secondly, the choice of the rejection level can also result in a certain number of false-negative genes (Type II error). These are the genes that are actually differentially expressed but that have a Recently, much attention has been paid in literature to the control of the number of false positives or Type I error . ClassicWhile the study of multiple testing finds its roots in genetic studies where the number of positives is usually small and control of false positives is paramount, the number of positives in studies of differential expression between patient biopsies is large and false negatives become an equally important issue. Owing to this historical reason, we believe that the control of false negatives in multiple testing methods has been somewhat overlooked.balance them. We aim to obtain a sensible or optimal – according to a certain criterion – trade-off between false positives and negatives. Moreover, the use of ROC curves enables us to estimate the degree of overlap between the P-values of genes that are and are not actually differentially expressed. This amount of overlap in its turn determines the relationship between the false positives and negatives and the level at which the optimal trade-off or balance between them can be reached . The assessment of the amount of overlap between the P-values by ROC curves can therefore be used to assign a quality measure to a specific microarray data set. Using two publicly available data sets , we show that this quality measure can be used to compare different microarray data sets with respect to their ability to discriminate between genes whose expression is and is not affected by the different conditions. Since, in the near future, microarray data sets that address similar hypotheses will become increasingly available curves that does not control the Type I or Type II errors but that tries to N genes. Assume that we have already used a certain hypothesis test to calculate the P-values pi of the respective genes. These P-values reflect the probability that an equally good or better test statistic, quantifying the difference between the gene expression levels of the different conditions, is generated if a certain null hypothesis is true. In general, the null hypothesis states that there is no actual differential expression. Also assume that the genes are ordered according to this P-value, so that p1<p2<…<pN. Note that, in this paper, we chose the Wilcoxon rank sum test to generate the P-values , true negatives (TN), false positives (FP), and false negatives (FN) at each rejection level. Using these estimates, the sensitivities and specificities at each rejection level can be calculated. Finally, we use these quantities to construct a ROC curve.N0 the number of genes that are not actually differentially expressed and N1 the number of genes that are actually differentially expressed – also see N0, which essentially consists of an evaluation of the following formula:Call N0 is derived, N1 can easily be estimated by N−N0.After N0 and N1, we applied this method on five synthetic data sets generated by the model introduced by N1 and N0 were known beforehand. For each data set, 8000 (N0) genes had a constant true expression level over the 100 experiments, while 2000 (N1) genes had a different true expression level in the first 50 experiments compared with the last 50 experiments. The five estimates of N1 varied between 1939 and 1866, dependent on the settings for the additive and multiplicative error. Note that using a two-sample t-test instead of the Wilcoxon test did not result in a significantly different result (estimates varied between 1909 and 1847).To test whether this approach results in reliable estimates for P-value smaller than or equal to a certain rejection level α=pi as differentially expressed and the genes with a P-value larger than this rejection level as not differentially expressed . When the declared status of differential expression is compared with the actual status, four categories of genes emerge that are defined in N1 and N0, derived in the previous section, we can calculate the number of genes in each category using the formulas from Suppose that we declare the genes with a α=pi is defined as and that we construct a graph where sensitivity is plotted vs 1−specificity. This graph is called the ROC curve with a tangent line with slope 1 is chosen, for which it can be proven that it maximises the sum of the sensitivity and specificity (and hence minimises the sum of the probability of the Type I and Type II errors) – this is also the definition of optimal that will be used in this paper. Alternatively, one can also try to optimise a more custom-defined cost function of the Type I and Type II errors that meets some specific requirements. One could, for example, use a cost function that puts more weight on either the Type I or Type II error and therefore allows for the selection of a rejection level gi with actual differential expression with P-value pi and a gene gj without actual differential expression with P-value pj, then it can be proven thatSecondly, the area under the ROC curve (AUC) has a special meaning increases if the AUC increases. Therefore, the AUC can be seen as a quality measure with respect to the detection of differential expression for a specific set of microarray experiments. Provided the same hypothesis test is consistently applied, the AUC can be used to compare . The results can be inspected and compared in et al (95.13%) is significantly , which is reflected in the fact that the level of the optimal balance between sensitivity and specificity is higher in the data from Armstrong et al when compared to the data from Golub et al (175.82 vs 166.09%).We analysed the data from Golub Note that in the et al with respect to the detection of differential expression between ALL and MLL and with respect to the detection of differential expression between MLL and AML and compared this with the results from the previous section with respect to the detection of differential expression between ALL and AML on the same data set. The results can also be inspected in vs 95.13%, P<0.0001), which also resulted in a considerable decrease in the level of the optimal balance between sensitivity and specificity (maximum of sensitivity+specificity=154.71 vs 175.82%), as could be expected.We analysed the data from Armstrong In this paper, we describe and use a procedure for the detection of differential expression based on the construction of ROC curves. In contrast with current practice only to control the Type I error, this method enables to balance the Type I and Type II errors according to a certain criterion or cost function and enables, through the AUC, to quantify our ability to discriminate between genes with and without actual differential expression in a specific data set and using a certain hypothesis test. As was shown in the Results section, the AUC also reflects how well the Type I and Type II errors can be balanced. We therefore propose to use the AUC as a quality measure to compare data sets for their appropriateness to detect differential expression, provided the same hypothesis test is used consistently.P-values could have an effect on the result of our analysis. Therefore, as an example, we repeated all the analyses described in this manuscript using a two-sample (parametric) t-test instead of the Wilcoxon test. This did not significantly change the estimated values for N1. The resulting AUCs, however, differed somewhat from the values observed in In theory, using other tests to derive the et al are more appropriate to discriminate between genes that are and are not differentially expressed than the data from Golub et al, although the last data set contained more experiments than the first (72 vs 52). In our opinion, the optimisation of the Affymetrix technology and protocol (year 2002 vs 1999) and perhaps a more optimal selection of the genes arrayed on the chip for Armstrong et al could have contributed to this difference in quality, which was accurately detected by the rise in AUC. The methodology described here could be suited to compare the performance of different microarray platforms . It might also be a good idea to use our procedure to detect whether there are differences in quality between different data sets performed on an equal number of samples captured on the same platform or chip set.The quality measure proposed here could be used for different types of comparisons, of which we illustrated two. As a first example, we investigated how this quality measure could be used to compare data sets that study the same conditions (in this case ALL and AML) but that originate from different sources. After comparing their AUCs, we concluded that the data from Armstrong vs 52 for the analysis of the difference between ALL and AML) could have partially caused the significant drop in AUC, but this was, to a lesser extent, also true for the analysis of the difference between MLL and AML (48 patients), which did not show a drop in AUC. The behaviour of the AUC and the results in As a second example, we examined what the effect on the AUC could be of a change in condition (replacement of ALL or AML patients by MLL patients). The difference between MLL and AML did not result in a significant decrease in AUC when compared to the difference between ALL and AML, while the difference between ALL and MLL did. The lower number of experiments that were available for the analysis of the difference between ALL and MLL . The fact that these estimates for N1 also include the genes whose difference in expression is only subtle could explain this. However, we cannot exclude that an experimental bias between the two conditions not removed by adequate pre-processing could partially be responsible for these observations.Note that the estimated values for αopt and suppose one performs a set of additional experiments in order to obtain a more optimal identification of the genes that are actually differentially expressed. Comparison of the AUCs of the basic set and of the basic+additional set could quantify whether this has succeeded and could even help us to decide if more additional experiments would be beneficial .

The 2007 St Gallen international expert consensus statement describes three risk categories and provides recommendations for treatment of early breast cancer. The set of recommendations on how to best treat primary breast cancer is recognized and used by clinicians worldwide. We now examine the variability of five-year survival of the 2007 St Gallen Risk Classifications utilizing the ER/PR/HER2 subtypes.Using the population-based California Cancer Registry, 114,786 incident cases of Stages 1-3 invasive breast cancer diagnosed between 2000 and 2006 were identified. Cases were assigned to Low, Intermediate, or High Risk categories. Five-year-relative survival was computed for the three St Gallen risk categories and for the ER/PR/HER2 subtypes for further differentiation.There were 9,124 (13%) cases classified as Low Risk, 44,234 (65%) cases as Intermediate Risk, and 14,340 (21%) as High Risk. Within the Intermediate Risk group, 33,735 (76%) were node-negative (Intermediate Risk 2) and 10,499 (24%) were node-positive (Intermediate Risk 3). For the High Risk group, 6,149 (43%) had 1 to 3 positive axillary lymph nodes (High Risk 4) and 8,191 (57%) had four or more positive lymph nodes (High Risk 5).Using five-year relative survival as the principal criterion, we found the following: a) There was very little difference between the Low Risk and Intermediate Risk categories; b) Use of the ER/PR/HER2 subtypes within the Intermediate and High Risk categories separated each into a group with better five-year survival (ER-positive) and a group with worse survival (ER-negative), irrespective of HER2-status; c) The heterogeneity of the High Risk category was most evident when one examined the ER/PR/HER2 subtypes with four or more positive axillary lymph nodes; (d) HER2-positivity did not always translate to worse survival, as noted when one compared the triple positive subtype (ER+/PR+/HER2+) to the triple negative subtype (ER-/PR-/HER2-); and (e) ER-negativity appeared to be a stronger predictor of poor survival than HER2-positivity.The use of ER/PR/HER2 subtype highlights the marked heterogeneity of the Intermediate and High Risk categories of the 2007 St Gallen statements. The use of ER/PR/HER2 subtypes and correlation with molecular classification of breast cancer is recommended. The 2007 St Gallen international expert consensus statement described three risk categories and provided recommendations for treatment of early breast cancer . Since tMolecular classification is rapidly becoming the gold standard for complete characterization of breast cancer and the underlying technology has already led to generation of gene-profiling models to predict outcomes -5. DespiBreast cancer cases used in these analyses were identified using the population-based California Cancer Registry (CCR). Cases are reported to the Cancer Surveillance Section of the California Department of Public Health from hospitals and any other facilities providing care or therapy to cancer patients residing in California .For the current study, we identified 114,786 first primary cases of invasive breast cancer (ICDO-3 sites C50.0-C50.9) [The CCR requires the collection of tumor marker information from the medical record on the status of ER and PR for breast cancers diagnosed on or after January 1, 1990 and HER2 for breast cancers diagnosed on or after January 1, 1999. ER and PR status are recorded according to the pathologist's interpretation of assays. A tumor is considered to be ER negative and PR negative if less than 5% of tumor cell nuclei are immunoperoxidase positive in immunohistochemistry (IHC) assays. ER and PR status may also have been determined by examining cytosol protein HER2 was assessed through IHC or fluorescence in situ hybridization (FISH). IHC is scored on a qualitative scale based on staining intensity: 0 and 1+ are negative, 2+ is borderline, and 3+ is positive. FISH is scored on a quantitative scale: less than 2 copies of the HER2 gene is negative and 2 or more copies is positive. Cases with complete tumor marker data were used in this study and were categorized into one of the eight distinct subtypes based on ER/PR/HER2 status of the tumor. Cases with unknown or borderline tumor marker status were excluded from these analyses .th edition [Stage at diagnosis was collected from the patient's medical record and coded according to the American Joint Commission on Cancer (AJCC) Cancer Staging Manual 6 edition . The CCR edition , and in edition . EOD was edition . For the edition .Treatment information available from the registry abstract was recorded as one of four possibilities: a) chemotherapy without endocrine therapy; b) endocrine therapy without chemotherapy; c) chemotherapy and endocrine therapy; d) no chemotherapy or endocrine therapy or unknown. Information about the use of specific anti-HER2 therapy was not available.Cases were assigned to Low, Intermediate, or High Risk categories according to published criteria with oneCounts and 5-year relative cumulative survival were calculated using SEER*Stat 6.1.4. The actuarial method was used for relative survival calculations. Five-year-relative survival was computed for the three St Gallen risk categories, and also for the ER/PR/HER2 subtypes to further differentiate the risk categories. Differences between survival curves were compared using the Z- test for comparison of relative survival rates .There were 114,786 incident cases of Stages 1-3 invasive breast cancer diagnosed between 2000 and 2006. After exclusion of 38,418 cases with at least one missing tumor marker there were 76,368 cases. An additional 8,670 were eliminated because they lacked age, size of tumor, stage, or grade resulting in 67,698 (59%) cases available for survival analysis Figure . There wWhen the St Gallen Risk categories were analyzed according to ER/PR/HER2 subtypes, no difference in survival was seen in the Low Risk group (not shown) but distinct differences were noted in the Intermediate Risk Figure and HighFor the High Risk group, a similar ER-positive pattern was noted except for the ER+/PR-/HER2- subtype. When the Intermediate and High Risk categories were analyzed according to axillary lymph node status as well as ER/PR/HER2 status, the ER+/PR-/HER2+ and ER+/PR-/HER2- subtypes had equally excellent five-year relative survival within the node-negative group (Intermediate Risk 2) (p = 0.234), and the ER+/PR+/HER2- and ER+/PR-/HER2- subtypes had significantly better survival than the ER-/PR+/HER2- subtype within the node-positive group (Intermediate Risk 3), as seen in Figures Within the High Risk category characterized by 1 to 3 positive nodes (High Risk 4), the ER+/PR+/HER2+ and ER+/PR-/HER2+ subtypes had excellent five-year survival whereas the remaining subtypes, all ER-negative, had significantly worse survival (p < 0.02) Figure . For thoTreatment information is summarized in Table Clinicians have a variety of resources and guidelines to assist in treatment decisions for early breast cancer patients . AdjuvanOur initial CCR investigations of triple negative breast cancer ,28 prompThe Intermediate Risk is the largest of the three risk categories defined in the 2007 St Gallen statement, constituting 65.3% of all patients, the Low Risk the smallest (13.4%) and the High Risk next at 21.3%. Based solely on five-year relative survival, there is not much difference between Low and Intermediate Risk, but clear separation of the High Risk category is noted.Use of the ER/PR/HER2 subtypes clearly separates the Intermediate Risk category into two distinct groups, one with better five-year survival and one with worse survival . This separation persists for the node-negative subgroup (Intermediate Risk 2) as well as the node-positive subgroup (Intermediate Risk 3), although in this latter subgroup the ER-/PR+/HER2- subtype is rather small. The existence of the ER-/PR+ subtypes is controversial ,30 althoMarked variation in five-year survival is noted within the High Risk category, both for the subgroups with 1-3 positive axillary lymph nodes (High Risk 4) and >3 positive axillary lymph nodes (High Risk 5). The widest variation in five-year survival is seen for this latter subgroup, ranging from the triple positive subtype (ER+/PR+/HER2+) at 83% to the triple negative subtype (ER-/PR-/HER2-) at 48%. Clearly, there are different levels of risk. Once again, ER-positive subtypes have better survival than ER-negative subtypes, regardless of HER2 status.That the 2007 St Gallen risk categories are useful for therapy guidance is evident from the limited treatment analysis, with 85% within Low Risk category receiving only ET, and 94% within High Risk category receiving chemotherapy with or without ET. However, our study has shown that, using five-year relative survival as the single principal criterion, (a) there is very little difference between Low Risk and Intermediate Risk categories, (b) use of the ER/PR/HER2 subtypes within the Intermediate and High Risk categories separates each into a group with better five-year survival (ER-positive) and a group with worse survival (ER-negative), irrespective of HER2-status, (c) the heterogeneity of the High Risk category is most evident when one examines the ER/PR/HER2 subtypes with four or more positive axillary lymph nodes, (d) HER2-positivity, per se, does not always translate to a worse survival, as noted when one compares the triple positive subtype (ER+/PR+/HER2+) to the triple negative subtype (ER-/PR-/HER2-), and (e) ER-negativity appears to be a stronger predictor of poor survival than HER2-positivity.The 2009 St Gallen conference proposed "a radically different treatment selection algorithm for the management of early breast cancer" and abandoned the three risk categories . InsteadIn a departure from the previous conference, the panel of the 2009 St Gallen meeting also supported the use of a validated multigene-profiling assay, if readily available, as an adjunct to high quality phenotyping of breast cancer in cases in which the indication for adjuvant chemotherapy remains uncertain. We are in agreement with this recommendation, and further urge use of the ER/PR/HER2 subtype or phenotype expression as a surrogate, albeit imperfect, for the molecular classification of breast cancer ,34. CorrAlthough we studied a large, racially diverse group of breast cancer patients, we recognize the limitations of this type of population-based registry investigation. Histologic grading of tumors, as well as tests for ER, PR, and HER2 were performed by a wide variety of laboratories without central review. Only 59% of the original cohort of patients was found to have complete clinicopathological factors. Of the 38,418 cases found lacking at least one tumor marker, the majority (86%) were missing HER2. The exclusion of subjects without ER or PR results has been noted in other population-based cancer registry studies and our findings are similar -37. MissDespite these shortcomings, we believe our study is of value because of the large number of breast cancer patients examined, reflecting real-world experience of a statewide cancer registry in an ethnically diverse population. We have shown how the use of ER/PR/HER2 subtype or phenotype expression highlights the marked heterogeneity of the Intermediate and High Risk categories of the 2007 St Gallen statements. We welcome the use of the molecular classification of breast cancer and gene-profiling assays. Further, we believe it is prudent to correlate molecular findings with less expensive techniques such as the use of ER/PR/HER2 subtypes and immunohistochemical (IHC) profiles, the so-called "Poor Man's IHC definitions of microarray-based intrinsic subtypes" .The use of ER/PR/HER2 subtype highlights the marked heterogeneity of the Intermediate and High Risk categories of the 2007 St Gallen statements. The use of ER/PR/HER2 subtypes and correlation with molecular classification of breast cancer is recommended.The authors declare that they have no competing interests.CP and VC conceived the idea for the study and interpreted the data. KB obtained the data from the California Cancer Registry and conducted the statistical analysis. All three authors contributed to the writing and have read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2407/10/228/prepub

We propose a computer aided detection (CAD) system for the detection and classification of suspicious regions in mammographic images. This system combines a dimensionality reduction module , a feature extraction module , and a feature subset selection module (using rough set model). Rough set model is used to reduce the effect of data inconsistency while a fuzzy classifier is integrated into the system to label subimages into normal or abnormal regions. The experimental results show that this system has an accuracy of 84.03% and a recall percentage of 87.28%. Breast cancer is the most common cancer among women worldwide. National cancer institute estimateSeveral rough set-based and fuzzy-based methods have been proposed in literature for breast cancer detection. Hassanien and Ali proposedIn , an algoIn an algorThe novelty of this work is the integration of RSM for feature selection with a fuzzy classifier as well as generating the framework for the integration of the PCA, ICA, RSM, and fuzzy classifier for breast cancer detection. The rest of this paper is organized as follows.PCA is an orthogonal transform and a decorrelation technique that captures maximum variance. The correlation between components of a vector is used to measure data redundancy. This means that most of the information contained in the original vector can be represented by a much smaller vector after the PCA stage. In this paper, PCA is used as a dimensionality and noise reduction module. This step ensures that the source components of a vector are uncorrelated.ICA is a statistical technique that can be used to extract hidden features within a set of data.X can be expressed as a linear mixture of a set of features or basis functions ai as shown in that makes the source components S as statistically independent as possible with non-Gaussian (super-or sub-Gaussian) distribution which results in obtaining independent components as shown in or suspicious (S) image. The cardinality of Cardinality is used to replace traditional rough set theory operations. Therefore, algorithm efficiency will be improved with reduced complexity. The cardinality of a set is defined as the number of elements in the set. For example, I = {Feature 1, Feature 2, Feature 3, Decision}. Core attributes should be in every Reduct to ensure correct classification. Therefore, removing any core attribute affects the classifier accuracy. Hu et al. [|I|=6  obI is the decision matrix I = [C⋮D], C is the condition attributes (selected features), D is the decision attribute , and Cj is the current attribute to be classified as a core or not. The merit value of an attribute or the significance of the attribute is calculated using =  Applying will resThe antecedent results are applied then to the consequent, which is known as the inference step. In this case, the classifier will label the tested subimage as normal.This paper integrates four techniques, namely, PCA, ICA, Rough Set, and Fuzzy classifier to build a CAD system. PCA algorithm is used as a dimensionality and noise reduction tool (prewhitening), and ICA algorithm is used as a feature extraction module while RSM is used as a feature subset selection module followed by a fuzzy classifier.119 regions of suspicion (ROS) are manually extracted from MIAS database based onFour other sets of normal subimages are randomly and automatically extracted such that the first set is of size 35 × 35 and the other sets are of size 45 × 45 pixels from the normal MIAS mammograms. Each set has 119 subimages. Each set of ROS is mixed with one set of normal subimages and then divided into two groups: one for the training phase and the other is for the testing phase as shown in RN×Mtrain is constructed by placing training subimages as rows in the matrix where N represents number of training subimages (119) and M represents size of each square subimages. PCA algorithm is used to reduce its dimensionality according to the following equation where v represents number of selected principal components and RM×v represents a matrix with the principal components in its columns sorted by descending order according to their variancesA training matrix Wand the independent source region matrix S in an unsupervised mode as follows.In this paper, ICA scheme is based on minimizing the mutual information of the source components which can be achieved using cumulants. This is proposed (a modified version of ) in ordeW is initialized to the identity matrix. Then, S is calculated using the following equation. This means that ICA is performed on a set of v linear combinations of the original subimages instead of performing it on all N subimages. This should reduce its computational complexity and hence increase its speed:(i) W is calculated using the natural gradient . In this paper, alpha is chosen to be 0.5.(iv) The separating matrix is updated and then normalized:W converges.(v) Stop the algorithm when Finally, the reduced dimensionality selected features can be estimated as follow.RN×Mtrain can be found using the following equation , where Q contains the condition attributes (selected features from PCA-ICA phase) and D is the decision attribute .Construct the decision matrix, Find the Core attributes using the following procedure.∅.Initialize Core vector into Cj ∈ C; if it satisfies |I − Cj|/|I − Cj − D| ≠ 1, then update core vector as Core = [Core⋮Cj].Check the cardinality for each attribute Reduct attributes using the following procedure which is a modified version of Let Update Rest = I − Reduct.Reduct has inconsistent elements (with ratio of T) greater than or equal to that of the decision matrix:If K ≥ T or the significance values of the remaining attributes are zeros, stop the procedure. Equation means thElse, go to step (II).QN×vtest in the same order they were selected from QN×vtrain during the training phase.In this step, features are selected from the matrix QN×vvtrain and QN×vvtest are reconstructed with selected Reduct features while dispensable features are thrown away.Finally, Two single fuzzy if-then rules are used to represent the normal and abnormal fuzzy sets. The membership functions of each antecedent fuzzy set are aggregated using the information about the selected feature values of the training subimages.The proposed fuzzy-based classification algorithm can be summarized as follows:μN×1as and μN×1ns are initialized to 0 where each element of them represents the aggregated membership functions of the selected feature values for the corresponding testing subimage. These parameters are defined as.Two activation functions μk×1as represents the membership degree of the kth testing subimage to the fuzzy set abnormal.μk×1ns represents the membership degree of the kth testing subimage to the fuzzy set normal where 1 ≤ k ≤ N.μj represents mean of all samples of the current selected feature xj, σj represents their standard deviation, and i is an index for the selected features from the training phase.Using , membersThe membership functions are normalized usingi is an index for the selected features from the testing phase:The membership functions are aggregated using in orderC is used as an index of a testing subimage being identified as normal or abnormal:By assigning the corresponding testing subimage into the fuzzy set with the maximum degree of activation, a crisp decision is made, that is, normal or abnormal. Equation is used As the results show, fuzzy classifier cannot be implemented with ICA model alone without a dimensionality reduction since, without it, a large number of membership functions will be generated. Also, without a feature subset selection module, the classifier task complexity is increased and performance is degraded. Furthermore, results indicate that integrating ICA model with PF generated better results than integrating RSM with PF. The average accuracy was improved by 4.68% and false negative rates were improved by 4.76% if a PCA model was used with the ICA model while following it with RSM improved its average accuracy by 0.29% and its FN rates by 6.33%. Integrating RSM improved total PF algorithm performance by 0.29% but degraded its FN rates by 6.34%. Results also indicate that RSM and PIF integration improves accuracy with an average of 3.35%. Comparing the results using FN rates, we find that PIRF has an FN of 8.82%, PIF of 12.61%, IRF of 13.66%, PF of 13.24%, PRF of 14.08%, and IF of 40.34%. Results indicate that using PCA as a dimensionality reduction module reduces FN rates in PIRF and PF at the expense of a little increase in the FP rates. Also, average FN rates are very close to average FP rates in PIF and PRF algorithms. On the other hand, average FN rates are increased in IRF and IF algorithms when no dimensionality reduction was integrated. Finally, integrating RSM into PIF and PF algorithms reduces the number of principal components required to obtain Reduct. The previous discussion shows that each one of the integrated techniques is necessary and should be implemented in the proposed sequence in order to achieve the highest accuracy rates.An implementation of the PIF proposed in reports,The average accuracy for PIF improved by 3.35% with PIRF system and its average FN rate improved 30.01%. Also, the average selected number of principal components in PIRF algorithm which is 7.75 is less than that of PIF algorithm which is 9.75. In other classification methods such as in , three sThe proposed CAD system uses several parameters that impact performance accuracy such as number of the principal components in the PCA algorithm, learning rate and alpha in the ICA algorithm, threshold in the Reduct process, and mapping range.Reducing data dimensionality using PCA module affects PIRF algorithm accuracy. When large number of principal components is selected, extracted features will have redundant information and therefore will degrade the performance accuracy. However, if a small number is selected, extracted features cannot be estimated precisely and the fuzzy classifier performance will also be degraded.On the other hand, W and S is affected by the learning rate, which determines the speed and accuracy of convergence to the optimal value. Since optimal values of W and S are unknown and they are data dependent, optimal value of η cannot be estimated adaptively. Also, since η represents the step size for ΔW, choosing a small value of it ensures accuracy but reduces the speed of convergence. Learning rate impact on four testing sets is shown in Figures η (0.001) produces the largest area under the curve which means that it produces the highest average accuracy.The estimation of the matrices W that should be added to the current ΔW to increase the convergence speed of W. Since ΔW utilizes the natural gradient to find direction of W toward a minimum point, adding its previous value to its current value pushes it toward the minimum point faster but does not change its direction.This constant determines the ratio of the previous ΔIn investigating the mapping range values' effect on the accuracy of the results, we found that mapping the data into a limited range results in accuracy loss but simplifies computational complexity and processing time. Figures T is necessary, . Therefore, an alternative route that may be worthwhile to investigate is to use a learning rule of the ICA algorithm that is based on negentropy instead of cumulants.

In the amide group, the C—N bond is relatively short [1.3283 (16) Å], suggesting some degree of electronic delocalization in the mol­ecule. In the crystal structure, mol­ecules are linked into infinite chains along the a axis by inter­molecular O—H⋯N hydrogen bonding.The title compound, C N-heterocyclic systems as potential supra­molecular reagents, see: Portalone Å b = 6.5885 (12) Å c = 25.754 (5) Å β = 94.227 (3)°V = 870.4 (3) Å3 Z = 4 Kα radiationMo −1 μ = 0.11 mmT = 295 K 0.12 × 0.10 × 0.06 mm Bruker APEXII CCD area-detector diffractometerSADABS; Bruker, 2005T min = 0.988, T max = 0.994Absorption correction: multi-scan (4367 measured reflections1528 independent reflectionsI > 2σ(I)1364 reflections with R int = 0.015 R[F 2 > 2σ(F 2)] = 0.030 wR(F 2) = 0.079 S = 1.04 1528 reflections135 parametersH atoms treated by a mixture of independent and constrained refinementmax = 0.13 e Å−3 Δρmin = −0.15 e Å−3 Δρ APEX2 used to solve structure: SHELXTL (Sheldrick, 2008SHELXTL; molecular graphics: SHELXTL; software used to prepare material for publication: SHELXTL.Data collection: 10.1107/S1600536809021199/bg2267sup1.cif Crystal structure: contains datablocks global, I. DOI: 10.1107/S1600536809021199/bg2267Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

The indispensability of certain genes in an organism is important for studies of microorganism physiology, antibiotic targeting, and the engineering of minimal genomes. Time and resource intensive genome-wide experimental screens can be conducted to determine which genes are likely essential. For metabolic genes, a reconstructed metabolic network can be used to predict which genes are likely essential. The success rate of these predictions is less than desirable, especially with regard to comprehensively locating essential genes.We show that genes that are falsely predicted to be non-essential (for growth) share three characteristics across multiple organisms and growth media. First, these genes are on average connected to fewer reactions in the network than correctly predicted essential genes, suggesting incomplete knowledge of the functions of these genes. Second, they are more likely to be blocked (their associated reactions are prohibited from carrying flux in the given condition) than other genes, implying incomplete knowledge of metabolism surrounding these genes. Third, they are connected to less overcoupled metabolites.The results presented herein indicate genes that cannot be correctly predicted as essential have commonalities in different organisms. These elucidated failure modes can be used to better understand the biology of individual organisms and to improve future predictions. The dispensability and essentiality of genes in single-celled organisms is an extensively studied field with mulin silico methods can be used to predict gene essentiality. Such in silico studies have been undertaken for a variety of organisms, including Escherichia coli [Saccharomyces cerevisiae [Helicobacter pylori [Staphylococcus aureus [Bacillus subtilis [Mycobacterium tuberculosis [Sizeable screens for essential genes have been undertaken in a number of organisms ,5, neceshia coli Saccharomrevisiae , Helicobr pylori , Staphyls aureus , Bacillusubtilis , and Mycrculosis . These mrculosis . These rrculosis .in silico gene deletions experiments have also been described; see for example [in silico than can be performed in vivo. Computational studies can be used as screens to identify potentially interesting multiple knock-outs to pursue in the lab, as has been demonstrated for metabolic engineering applications [Multiple, simultaneous example ,13. In m example ,15. Expeications ,17.in silico methods for predicting gene essentiality are not perfect. There are four possible outcomes when comparing the results from in silico methods with experiments: true positives (TP), true negatives (TN), false positives (FP), and false negatives (FN). True positives occur when both the model and experiment indicate that a gene is essential, and true negatives occur when the model and experiment agree that a gene is nonessential. False positives occur when the model says a gene is essential, but experiments suggest otherwise. False negatives occur when the model says a gene is nonessential, but experiments indicate that it is essential. The overall success rate is given by the ratio of TP and TN to FP and FN. The best large-scale studies cite overall success rates in the vicinity of 90% [in silico studies are considered as screens for essential genes, perhaps for antibiotic target discovery, false-negative errors limit the usefulness of such screens. As detailed herein, when only experimentally-determined essential genes are considered for statistical purposes, success rates are lower.Unfortunately, y of 90% ,6,10, buThere are several reasons for incorrect essentiality predictions, and incorrect predictions for a single organism are frequently studied and described in the publications that describe these predictions. Incorrect predictions are believed to usually occur for several reasons. False negative errors can be caused by incomplete definition of the biomass function, uncertainty in the growth medium used for experiments, and toxic-intermediate buildup. False positive errors can be caused by overly stringent definition of the biomass function, uncertainty in the growth medium, and the presence of unknown isozymes for a given reaction. The biomass function is central to the simulation of gene deletions, because a gene is predicted to be essential if its deletion results in the complete impairment of flux through this special reaction. The growth medium used for experiments is also very important because genes essentiality is dependent on what substrates are available for use. The buildup of toxic intermediates is difficult to simulate accurately with constraint-based methods because, in the absence of knowledge that the cell will produce a metabolite even if it cannot be broken down, there is no way to predict the production of toxic metabolites. The presence of unknown isozymes suggests that the organism is not understood as well as it could be.While organism and gene specific explanations for incorrect predictions can be informative and lead to new discoveries, we have elected to study and classify incorrect predictions across organisms without trying to justify each inaccuracy by itself. Herein we report that genes that are incorrectly predicted as dispensable share common characteristics in multiple organisms. In terms of computational predictions, these genes are less connected in the network, more likely to be predicted inoperative, and connect to less overcoupled metabolites. Taken together, these characteristics suggest that incorrectly predicted genes are connected beyond the boundaries of known metabolism, both through limited knowledge of the reactions they catalyze directly and through the limited understanding of metabolism surrounding those reactions.We used six genome-scale metabolic networks -8,10,11 E. coli on glucose minimal medium. The green region represents true positives (TP), where both prediction and experiment indicate a gene is essential. The orange region represents false negatives (FN), where a gene is predicted to be non-essential but in reality it is essential. The blue and red regions indicate genes that are not essential, and are predicted correctly and incorrectly, respectively. Although genes in the red region are also predicted incorrectly by the model, these mistakes are easily found with limited experimental screens. Genes in the orange region cannot be deciphered as incorrect predictions without a genome-wide experimental screen, because we cannot distinguish the orange region from the blue region without a full set of experiments. Reducing the number of FN genes is thus a worthwhile and important goal. Toward this end, we focus on the green (TP) and orange (FN) regions to elucidate the differences between the sets of genes of which they are comprised.Gene deletions were simulated using flux balance analysis, which is the most common method in use. In short, reactions that absolutely rely on a particular gene for catalysis were removed from the networks one at a time. If growth (biomass production) was still possible, the gene is predicted to be non-essential; otherwise, it is predicted to be essential. Full details are presented in the methods section. The gene essentiality experiments used herein vary in methodology and coverage; interested readers should consult the papers cited above for full details. It must be noted that the experimental gene essentiality results are almost certainly not perfect; for example, it is possible that a gene is refractory to the attempted knock-out methodology and yet is not absolutely essential for growth of the organism. Figure in silico studies are used to identify potentially essential genes to test experimentally, even in the best cases, nearly a third of essential genes would be missed. These genes share certain characteristics that provide insight into cellular metabolism and the state of knowledge we currently have.The basic characteristics of the networks and the experimental data sets are shown in Table Topological summary statistics were noted for each metabolic network studied. These statistics were tightly correlated with each other; for example, a network with a larger number of genes is likely to have a larger number of reactions and metabolites (results not shown here). However, these statistics showed no significant correlation with the ability of a network to correctly predict the essentiality of genes. Model performance, at least in terms of predicting essential genes, does not appear to be related to model size. This lack of correlation suggests that the number of components in a network does not impact our ability to reconstruct an accurate network.A particular metabolic gene, either alone or in conjunction with other genes, encodes one or more enzymes responsible for one or more biochemical reactions. The associations between genes, enzymes, and reactions for each metabolic network we analyzed are publically available and are termed gene-protein-reaction associations (GPR's) . Herein,E. coli and one S. aureus dataset , across the organisms, TP genes are more connected than are FN genes (p < 0.01). Within the network of each organism, an arbitrary but identical number of gene connectivities falling into the TP and FN class were randomly selected and their means compared. After repeating this procedure many times, S. cerevisiae, H. pylori, and M. tuberculosis all consistently had mean FN gene connectivities less than mean TP gene connectivities. S. aureus had mean FN gene connectivities less than mean TP gene connectivities approximately 94% of the time, and for B. subtilis it occurred approximately 83% of the time. As might be expected from Table E. coli. This indicates that when all networks and experimental conditions are considered together, the trend is clear, but not all networks can be proven to have this trend with statistical significance.The differences in gene connectivity across organisms/media conditions and between TP and FN genes are shown in Figure E. coli, arguably the best understood microorganism, does not show this trend, supporting the notion that incomplete knowledge of gene function leads to the connectivity differences. We expect that as more is learned about the FN genes in other organisms their connectivity will increase and they will concurrently become TP genes as the reasons for their essentiality are understood.The outwardly obvious reason for this trend is that we do not have a comprehensive understanding of the function of FN genes. The lesser connectivity of FN genes suggests that they may be essential for reasons that are yet to be discovered or fully understood. The connectivity of essential genes may vary widely. However, we do not expect for it to fall into two groups corresponding to TP and FN unless the connectivity for FN genes is an artifact of an incomplete network Given a metabolic network and an objective function, the allowable variability of the flux through each reaction can be computed with a series of linear programming problems . In geneH. pylori to 888 in E. coli on glycerol minimal medium. We then mapped these reactions to genes, defining a gene as blocked if it is associated with at least one blocked reaction, and completely blocked if all reactions with which it is associated are blocked. Thus, a blocked gene may have some functionality in the network, but a completely blocked gene cannot.To identify a relationship between gene essentiality and flux variability, we computed the maximum and minimum allowable flux through each reaction in each metabolic network, constraining the network to produce biomass at no less than 90% of the optimal rate. Because biomass production is permitted to take a range of values, as would be the case amongst any experimental population of cells, any reaction that has no flux span must also be a blocked reaction. We found a widely variable number of blocked reactions in the networks, ranging from 75 in S. cerevisiae, where all media conditions lead to the conclusion that with high certainty (p < 0.01), FN genes are more likely to be blocked and completely blocked than non-FN genes. M. tuberculosis (p < 0.01) and S. aureus (p < 0.06) also have reasonably compelling evidence for FN genes being preferentially blocked, but not completely blocked. The results are detailed in Figure We found that when all organisms and media conditions are considered together, FN genes are more likely to be both blocked and completely blocked than non-FN genes (p < 0.02). However, this trend does not hold true on an individual level for each organism and experimental screen. The trend is largely driven by the highly uniform and significant results for E. coli is again a very well-studied organism and it is not surprising that FN genes cannot be explained by incomplete knowledge of the surrounding network. H. pylori has a very compact metabolic network, with 45% fewer genes than the next smallest network. It also has one environment in which it is specialized, the human stomach. Thus, it is reasonable to conclude that this organism may have a reasonably comprehensively known metabolism. On the other hand, S. cerevisiae has a variety of factors complicating its metabolism, including the compartmentalization that is an essential feature of eukaryotic organisms. With metabolic processes spanning various organelles and intracellular transport mechanisms incompletely understood, it is logical that FN genes would result from a lack of knowledge of the surrounding metabolism.Whereas the simplest explanation for the gene connectivity results above was incomplete knowledge about FN genes themselves, a better rationale for the blocked reactions here is incomplete knowledge of areas of metabolism closely associated with these genes. The network neighborhood of these genes is not completely understood. In genome-scale metabolic networks, certain pairs of metabolites occur in reactions together many times; for example, ATP and ADP. Some of these metabolite pairs can be classified as overcoupled based on statistical calculations that consider the individual connectivity of each metabolite and the network structure . These oWe calculated overcoupled metabolites by the previously published method , using pth gene is calculated asThe overcoupling count for the iip•Ŝ•Gcount = whereŜ is the binary form of the stoichiometric matrix;G is the gene-reaction association matrix ; andp is the overcoupled metabolite vector, with each entry specifying the number of overcoupling interactions with which a metabolite is associated.This works out to the sum of the number of overcoupling interactions in which the compounds that are associated with a particular gene are involved, allowing compounds to be counted multiple times if they participate in multiple reactions. A simple example is presented in the methods section for clarity.E. coli on glycerol and H. pylori are the key exceptions, and the small number of experimentally verified S. aureus essential genes stymies statistical tests).As previously shown figure , FN genein silico. It is possible that the FN genes are responsible for reactions beyond what is currently known, similar to the proposed reason that FN genes have lower connectivity. It is also possible that the reactions with which FN genes are associated are not completely correct. For example, some of these reactions may have alternative substrate/product pairs that are highly important for the network.Because FN genes, on average, interact less with overcoupled metabolites, they are less likely to be tied into important, evolutionarily conserved metabolic processes, at least Herein we have demonstrated that incorrectly predicted essential metabolic genes have network level differences that are largely conserved across organisms. These differences are (1) a smaller mean number of reactions per gene, (2) a larger percentage of blocked genes, and (3) a smaller overcoupling count.These three differences all rely on the interactions between networks components. Fundamentally, gene essentiality is a network-level property, so it is to be expected that explanations will rely on the network as a whole. We did not find any explanation for incorrect gene essentiality predictions based on simple statistics such as rudimentary network size metrics.E. coli, the best characterized microorganism considered here. One might expect, based on the numbers for E. coli shown in Table The results suggest that incomplete knowledge of the metabolic processes associated with essential genes and the immediately surrounding metabolic processes are driving forces in incorrect gene essentiality predictions. These factors in most cases cannot with statistical significance explain incorrect gene essentiality predictions in One potentially fruitful area may be a comparative analysis of more precise network roles of FN genes vs. those of TP genes. One could, for example, computationally predict the necessity of each gene in the network for a variety of functions other than growth, such as redox balance or energy production. This may allow the determination of imperfectly understood areas of metabolism, even in well studied organisms. We foresee increased comparative analysis of microbial metabolism as more networks become available, akin to the growth of genome sequence comparisons from a curiosity to the essential tool that is BLAST today.Metabolic networks for all six organisms were obtained as SimPheny output files and imported into the COBRA Toolbox in Matlain silico experiments were compared with previously published experimental results to distinguish TP genes from FN genes . Each gene in each organism under each media condition was identified as TP, FN, or not essential.Gene deletions were simulated using the singleGeneDeletion command in the COBRA Toolbox. The set of zero or more reactions that cannot occur without the presence of each gene were removed from the model, and we attempted to simulate growth. If no growth was possible, the gene was predicted to be essential. The results from the G describing the associations between genes and reactions. The number of non-zero entries in each column describe the connectivity of a single gene. The mean connectivity of TP and FN genes was determined with simple arithmetic. All graphs were made in Excel .Given the boolean gene-protein-reaction associations, the COBRA Toolbox automatically produces a binary matrix G, and genes associated with only blocked reactions are termed completely blocked; those associated with one or more blocked reactions are termed blocked.The flux variability of each reaction in each network under each set of media conditions was determined using the fluxVariability command in the COBRA Toolbox, constraining biomass production to be no less than 90% of maximum. Reactions that cannot take any flux are found this way and termed "blocked." These blocked reactions are mapped back to genes through M is calculated asOvercoupled metabolites are computed with the same procedure as has been previously published . The metM = TŜ•ŜŜ is the binary form of S.where M is a symmetric matrix with off-diagonal elements indicating the number of reactions in which two metabolites (rows and columns of M) co-participate. The diagonal elements give the total number of reactions in which each metabolite appears.Ŝ such that the diagonal elements of M remain the same but the off-diagonal elements vary, in effect simulating the effects of random co-occurrence of metabolites but maintaining the connectivity structure of the network. After many redistributions, p values can be determined by comparing the actual value of Mij to the random distribution of values. We used only metabolites that are overcoupled with p < 0.01.Overcoupled metabolites are determined by redistributing the elements of The overcoupled count for each gene was calculated as described above. As an example, consider a gene that catalyzes two isomerization reactions:A -> BB -> CA is a member of one overcoupled metabolite pair, B is a member of 3 overcoupled metabolite pairs, and C is not overcoupled with any other metabolite. The count is 1 + 3 + 3 = 7 .Except for determining which metabolite pairs are overcoupled, the statistics of which are summarized above and fully covered in , two staS. cerevisiae are less connected than TP genes, were assigned a confidence score by randomly picking the same number of genes from each group and comparing their means. The number of times that the sampled mean for FN genes is less than the sampled mean for TP genes divided by the number of random samplings gives a confidence score or p value. No fewer than 10,000 randomizations were used.Comparisons within a dataset, for example, whether FN genes in SAB conceived of the study, carried out all calculations, and wrote the first version of the manuscript. BOP participated in the design of the study and helped write the manuscript. All authors read and approved the final manuscript.

Bloom's syndrome, an autosomal recessive inherited disorder, belongs to the group of chromosomal breakage syndromes. The clinical diagnosis of BS is confirmed cytogenetically. Its frequency in the general population is unknown but it is common in eastern European Ashkenazi Jews.A 12-year-old girl was referred to us because of short stature. She was the second child of the first cousin marriage. She had a slender body frame, short stature, and microcephaly. Her face was long and narrow with prominent nose, and malar and mandibular hypoplasia. The spots of hyper and hypo pigmentation were observed in the trunk and limbs. Telangectasia spots were observed in some areas of the trunk. Additionally, generalized hirsutism was present in the whole body. Cytogenetic findings revealed an abnormality in the structural chromosome.This is the first BS case that has been reported in Iranian female population. Bloom's syndrome (BS), also known as congenital telangiectatic erythema, was first described by Dr. David Bloom, a dermatologist, in 1954.[BLM gene that is located on chromosome 15 . Mutation in this gene causes errors in the copying process during DNA replication and results in a higher number of chromosomal breakages and rearrangements. This leads to the signs and symptoms of BS.[BS is an autosomal recessive inherited disorder caused by mutation in the The clinical features of BS are proportionate pre and postnatal growth retardation, dolichocephaly, facial sun sensitivity, telangiectatic erythema, patchy areas of hyper and hypopigmentation of skin, moderate to severe immunodeficiency manifested by recurrent respiratory tract and gastrointestinal infections, and increased susceptibility to wide range of cancers, especially to leukemia and lymphoma.blmAsh mutation. Also, it appears that men are affected by this syndrome slightly more than their counterparts.[BS is a very rare disease and its frequency in the general population is unknown, but it is common in eastern European Ashkenazi Jews with a prevalence rate of approximately 1 in 48000 persons. This is due to a founder effect, approximately 1% of the Ashkenazi Jewish population being heterozygous carriers for the BS belongs to a group of chromosomal breakage syndromes whose clinical diagnosis is confirmed cytogenetically through demonstration of characteristic chromosome instability, but heterozygotes are not detectable by cytogenetic studies.There is no curative treatment for BS. However, a physician should carefully follow BS patients in order to ensure early diagnosis of cancer.In this paper, we have reported a new case of BS in an Iranian female which has been investigated at the Genetic department of Yazd Welfare organization.A 12-year-old girl was referred to Genetic Research Center of Welfare organization, Yazd, Iran, in June 2008, because of short stature. She was the second child of the first cousin marriage. All the other members of her family – parents, the first and third brothers – were healthy. At birth, the ages of her mother and the father were 23 and 28 years, respectively. There was no history of infections or medications during pregnancy. Family history revealed that two of her maternal cousins had similar signs and symptoms, though their features were comparatively worse .rd centile), height of 44 cm (< 3rd centile), and a head circumference of 32 cm (10–50 percentile). She was discharged from hospital without any problem. Her developmental milestones were normal. At nineteen weeks of birth, for the first time, a urinary tract infection occurred and then she had to be repeatedly hospitalized for recurrent urinary, respiratory, and gastrointestinal infections.She was born by vaginal delivery at 38 weeks of gestation with a low birth weight of 1700 g (<3rdcentile), with a height of 133 cm (< 3rdcentile), and a head circumference of 49 cm (<3rdcentile). She had a long narrow face with prominent nose, and malar, and mandibular hypoplasia [Clinically, she was of slender frame weighing 25 kg examinations were all unremarkable. Her bone age was two years deficient of her chronological age. Routine biochemical tests and abdominal ultrasound were normal.GTG-banded analysis of over 50 metaphases was abnormal. The following structural chromosome abnormalities were seen in four of the observed cells: 46, XX; chrb(1) (q42); 46, XX; chrb(X) (q21); 46, XX; chrb(7) (p22); and 46, XX; chrb(9) (q13). The final diagnosis was: 46, XX (46)/ 46, XX; chrb(1)/46, XX;chrb(X)/ 46, XX;chrb(7)/ 46, XX;chrb(9).Also, sister chromatid exchange (SCE) analysis showed a mean of 80 SCE per cell in comparison to a mean of seven per cell for the normal control .BS is a rare human autosomal recessive disorder belonging to a group of chromosomal breakage syndromes. This syndrome is characterized by marked genetic instability, including a high level of SCE’s, associated with a greatly increased predisposition to a wide range of cancers commonly affecting the general population.Kelly reported a case of BS in a black female. In 1991,Szalay provided the first evidence of a genetic basis in BS. He described an isolated case in the child of first cousin parents and two affected siblings. Then, GeThe patient, who is reported in this paper, is the second child of first cousin parents. Also, two of the children of her mother's sister had signs and symptoms similar to her. Her pedigree showed autosomal recessive inheritance in this disease.She had a slender body frame, short stature, and microcephaly. Her face was long and narrow with prominent nose, and malar and mandibular hyperplasia. Also, sun-sensitive erythema was present on the butterfly area of face. In addition, the spots of hyper-and hypo pigmentation were seen in the trunk and limbs. In some parts of trunk, telangectasia spots were observed. Generalized hirsutism was present in the whole body.et al, reported about an 18-year old girl diagnosed BS. Her ophthalmologic examination revealed mild lens opacities bilaterally,[Cefle aterally, whereas,et al, reported diabetes mellitus in BS,[Mori us in BS, while inClinical diagnosis of Bloom syndrome is confirmed cytogenetically by demonstrating characteristic chromosome instability. The chro

Adjuvant treatment for intramedullary tumours is based on radiotherapy. The place of chemotherapy in this setting has yet to be determined. Between May 1992 and January 1998, eight children with unresectable or recurrent intramedullary glioma were treated with the BB SFOP protocol . Six children had progressive disease following incomplete surgery and two had a post-operative relapse. Three patients had leptomeningeal dissemination at the outset of chemotherapy. Seven of the eight children responded clinically and radiologically, while one remained stable. At the end of the BB SFOP protocol four children were in radiological complete remission. After a median follow-up of 3 years from the beginning of chemotherapy, all the children but one (who died from another cause) are alive. Five patients remain progression-free, without radiotherapy, 59, 55, 40, 35 and 16 months after the beginning of chemotherapy. The efficacy of this chemotherapy in patients with intramedullary glial tumours calls for further trials in this setting, especially in young children and patients with metastases. © 1999 Cancer Research Campaign

Chlamydia trachomatis (CT) and Neisseria gonorrhoeae (GC) using nucleic acid amplification tests. Several reports have shown the accuracy of such testing on ThinPrep (TP) LBC samples. Fewer studies have evaluated SurePath (SP) LBC samples, which utilize a different specimen preservative. This study was undertaken to assess the performance of the Aptima Combo 2 Assay (AC2) for CT and GC on SP versus endocervical swab samples in our laboratory.Liquid-based cytology (LBC) cervical samples are increasingly being used to test for pathogens, including: HPV, The live pathology database of Montefiore Medical Center was searched for patients with AC2 endocervical swab specimens and SP Paps taken the same day. SP samples from CT-and/or GC-positive endocervical swab patients and randomly selected negative patients were studied. In each case, 1.5 ml of the residual SP vial sample, which was in SP preservative and stored at room temperature, was transferred within seven days of collection to APTIMA specimen transfer tubes without any sample or patient identifiers. Blind testing with the AC2 assay was performed on the Tigris DTS System . Finalized SP results were compared with the previously reported endocervical swab results for the entire group and separately for patients 25 years and younger and patients over 25 years.P = 0.02).SP specimens from 300 patients were tested. This included 181 swab CT-positive, 12 swab GC-positive, 7 CT and GC positive and 100 randomly selected swab CT and GC negative patients. Using the endocervical swab results as the patient’s infection status, AC2 assay of the SP samples showed: CT sensitivity 89.3%, CT specificity 100.0%; GC sensitivity and specificity 100.0%. CT sensitivity for patients 25 years or younger was 93.1%, versus 80.7% for patients over 25 years, a statistically significant difference (Our results show that AC2 assay of 1.5 ml SP samples transferred to APTIMA specimen transfer medium within seven days is sufficiently sensitive and specific to be used to screen for CT and GC. CT sensitivity may be somewhat reduced in samples from patients over 25 years. SP specimens retained in the original SP fixative for longer time intervals also may have decreased sensitivity, due to deterioration of RNA, but this was not assessed in this study. The ability to tap the live pathology database is a valuable tool that can useful to conduct clinical studies without a costly prospective clinical trial. Chlamydia trachomatis (CT) is one of the most common sexually transmitted diseases, affecting an estimated 3 million sexually active adolescents and young adults annually in the United States.[Neisseria gonorrhoeae (GC), is that most women with a lower genital tract infection have no symptoms. Hence, the disease goes undetected, increasing the risk of spread to others through sexual contact and spread to the upper genital tract and possible sequelae of pelvic inflammatory disease, ectopic pregnancy, and infertility. Because of these serious complications of a disease that is often asymptomatic, annual screening for CT infection is now recommended for all sexually active women up to 25 years of age and for women older than 25 years who are high risk.[d States. The majoigh risk.This routine annual screening for CT is feasible because of the development of nonculture tests for chlamydia that are easy to perform, economical, and accurate. Of the tests available, Gen-Probe’s APTIMA AC2 nucleic amplification assay for CT and GC , which is based on detecting rRNA, is among the most sensitive and specific.–10 This 9Crystal Reports version 8.5 software was used to conduct a daily search of the live pathology database of Montefiore Medical Center for patients with completed endocervical swab AC2 results who also had a SP cervicovaginal sample collected at the same visit. Montefiore Medical Center is a major tertiary hospital with an extensive network of outpatient clinics that serves an urban population with a high prevalence of sexually transmitted disease. SP samples from patients whose endocervical swab specimens tested positive for CT, GC or both, and a random selection of patients whose endocervical swab specimens tested negative for both were selected for the study.® Unisex Swab Specimen Collection Kit for Endocervical Swab Specimens and were submitted directly to virology for AC2 testing. The SP cervical specimens had been taken with a Cervex-Brush® , the head of which was detached into a specimen vial containing 10 ml of SP Preservative Fluid . In the cytology lab, the SP specimen vials were first sampled by the SP Prepmate device, which draws off 8 ml to be processed for cytology and subsequent high risk HPV testing (Hybrid Capture 2), where indicated. The remaining samples, still in the SP Preservative Fluid in the original perforated specimen vials, were kept at room temperature in a covered plastic tray. Prior to sampling, each vial was covered with parafilm and vortexed, and 1.5 ml of sample was transferred to 2.9 ml APTIMA® Specimen Transfer tubes labeled only with the study sample number and without patient identifiers. Dates of specimen collection and transfer were tracked. SP samples with less than 1.5 ml remaining in the specimen vial (10 cases), together with samples more than 7 days old from date collection to transfer were excluded. The time to transfer of the SP specimens into the APTIMA transfer medium ranged from 2 to 7 days .Endocervical swab samples had been collected with the APTIMAOnce transferred into the APTIMA transfer medium, samples were refrigerated at 4°C until testing using the Tigris DTS System . Samples were run in duplicate with appropriate positive and negative controls. Only after the SP results were finalized were they compared with the previously reported AC2 endocervical swab CT and GC results.P values.Sensitivity and specificity for the SP results were calculated taking the reported AC2 endocervical swab results as the patient’s infection status. Fisher’s exact test was used to calculate Over a three month period, SP specimens from 300 patients aged 15–70 years (median age 23 years) were tested, 188 of whom had CT-positive and 19 of whom had GC-positive endocervical swab samples taken at the same visit (including 7 CT and GC coinfected patients). SP versus endocervical swab results are displayed in SP GC results from all 19 endocervical swab GC-positive patients were positive, and the SP GC results from all 281 GC-negative patients were negative . Thus, A® in two previous studies. The first of these prior SP studies reported rare false positive CT results, most from a single collection site among their 1615 patients, which were attributed to errors in specimen collection or processing. There were no false positives among our 111 CT swab negative cases.Overall, AC2 testing of 1.5 ml SP samples for CT had a sensitivity of 89.3% (CI 84.0%-93.3%) and a specificity of 100% (CI 96.7%-100.0%). This sensitivity for CT is slightly lower than the 93.1% reported for AC2 on ThinPrep samples,[9Although the number of swab GC-positive cases was low n = 19), AC2 testing of 1.5 ml SurePath samples for GC had a sensitivity of 100.0% (CI 82.4%-100.0%) and a specificity of 100.0% (CI 98.7%-100.0%). This compares favorably with the 100.0% sensitivity and specificity reported on Thin Prep[, AC2 tes® vs. swab). Although no study has compared these two devices specifically, a prior study comparing ACS testing of SP samples taken with the Cervex-Brush® vs. a combination of the Medscand Pap Perfect® plastic spatula and the Cytobrush® found no significant difference between samples taken with these devices.[-9 suggests that sample volume and dilution may not be critical factors.[Several factors may have contributed to the slightly decreased sensitivity of the SP samples in testing for CT. First to consider are differences in sampling related to the different sampling devices than in patients older than 25 . The decreased sensitivity in patients over 25 years may relate to less active infection and lower numbers of organisms in the older age group and the difficulty of obtaining adequate material from a chronically infected cervix due to fibrosis and stenosis. However, although these results seem biologically plausible, they are based on a small sample size in the >25 year age group. A larger study is needed to determine if these findings are generalizable.Finally this study illustrates the potential of search in a live LIS database to identify current patient samples for a prospective study. The ability to search for patients with concurrent AC2 and SurePath samples and to target known CT and GC positive, and random negative samples made it possible to conduct this study without enrolling patients in a large multi-center study. With regard to potential bias introduced by the analysis of samples with previously known endocervical swab results, if any bias is introduced it would be a negative one. Unlike a prospective study, in which special care would be taken in obtaining and transporting patient samples, in this study the clinicians who obtained the samples were unaware that they would be part of a comparison study. If anything, this might introduce a negative bias, where the sensitivity of the test might be reduced due to sampling error. Such use of the live database to select samples based on known results and other parameters will have a significant impact on research done in the future, and, when an LIS database can be used in a similar fashion, cost savings can be significant.In summary, AC2 testing of SP samples transferred to the APTIMA transfer medium within seven days of collection is highly sensitive and specific for detecting GC infection. It also is highly sensitive and specific for detecting CT in patients under 25 years, which is precisely the age group that is at highest risk for CT infection and its multiple associated comorbidities including PID, ectopic pregnancies and infertility. In older patients AC2 testing of SurePath samples may be somewhat less sensitive but, recognizing that false negative results may occur, it still may be utilized for screening purposes and in cases where endocervical swab testing was overlooked. Use of a larger volume of the sample remaining in the SurePath specimen vial and minimizing the time to transfer SP sample may further enhance sensitivity of the test. Conversely, testing of smaller volumes (3% of specimens in our lab) or of samples stored in the SP fixative at room temperature for periods longer than seven days prior may yield lower sensitivities than reported in this study.No competing interest to declare by any of the authors.http://www.icmje.org/#author. Each author has participated sufficiently in the work and take public responsibility for appropriate portions of the content of this article.Each author acknowledges that this final version was read and approved. All authors of this article declare that we qualify for authorship as defined by ICMJE This study was conducted with approval from Institutional Review Board (IRB) of the institution associated with this study. Authors take responsibility to maintain relevant documentation in this respect.To ensure integrity and highest quality of CytoJournal publications, the review process of this manuscript was conducted under a double blind model (authors are blinded for reviewers and reviewers are blinded for authors) through automatic online system.

N-substituted-4-desoxypodo­phyllotoxin and derivatives, see: Bilal et al. Åb = 12.639 (3) Åc = 20.463 (4) ÅV = 2683.9 (10) Å3Z = 4Kα radiationMo −1μ = 0.30 mmT = 113 K0.28 × 0.24 × 0.12 mmRigaku Saturn CCD area-detector diffractometerCrystalClear; Rigaku/MSC, 2005Tmin = 0.920, Tmax = 0.965Absorption correction: multi-scan (22515 measured reflections6397 independent reflectionsI > 2σ(I)5768 reflections with Rint = 0.036R[F2 > 2σ(F2)] = 0.036wR(F2) = 0.079S = 1.016397 reflections374 parametersH-atom parameters constrainedmax = 0.18 e Å−3Δρmin = −0.34 e Å−3ΔρAbsolute structure: Flack 1983, 2800 FrFlack parameter: 0.04 (4)CrystalClear used to solve structure: SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008SHELXTL (Sheldrick, 2008SHELXTL.Data collection: 10.1107/S1600536809050612/vm2011sup1.cifCrystal structure: contains datablocks I, global. DOI: 10.1107/S1600536809050612/vm2011Isup2.hklStructure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF reportAdditional supplementary materials:

Earth has experienced five major extinction events in the past 450 million years. Many scientists suggest we are now witnessing a sixth, driven by human impacts. However, it has been difficult to quantify the real extent of the current extinction episode, either for a given taxonomic group at the continental scale or for the worldwide biota, largely because comparisons of pre-anthropogenic and anthropogenic biodiversity baselines have been unavailable. Here, we compute those baselines for mammals of temperate North America, using a sampling-standardized rich fossil record to reconstruct species-area relationships for a series of time slices ranging from 30 million to 500 years ago. We show that shortly after humans first arrived in North America, mammalian diversity dropped to become at least 15%–42% too low compared to the “normal” diversity baseline that had existed for millions of years. While the Holocene reduction in North American mammal diversity has long been recognized qualitatively, our results provide a quantitative measure that clarifies how significant the diversity reduction actually was. If mass extinctions are defined as loss of at least 75% of species on a global scale, our data suggest that North American mammals had already progressed one-fifth to more than halfway (depending on biogeographic province) towards that benchmark, even before industrialized society began to affect them. Data currently are not available to make similar quantitative estimates for other continents, but qualitative declines in Holocene mammal diversity are also widely recognized in South America, Eurasia, and Australia. Extending our methodology to mammals in these areas, as well as to other taxa where possible, would provide a reasonable way to assess the magnitude of global extinction, the biodiversity impact of extinctions of currently threatened species, and the efficacy of conservation efforts into the future. Species diversity in any region varies within some limits through time. Therefore, in order to measure the extent to which humans are causing a biodiversity crisis z, where S = number of species, A = area sampled, and z and c are empirically derived constants that express the slope of the power function. While alternatives to the power law have been proposed The species-area relationship is one of ecology's few widely-recognized “laws” We assessed SARs for terrestrial, non-volant mammals at 19 different intervals of time in 10 diWe used only fossil data to avoid the sampling and analytical complexities of comparing fossil with modern samples. That limited our study to assessing anthropogenic influence only up to 500 years ago, thus yielding a conservative assessment of diversity decline in respect to pre-anthropogenic times. Even though no terrestrial non-volant mammals are known to have gone extinct in our study area in the past 500 years, there have been severe range reductions of many species and at least nine subspecies have gone extinct We used standard, accepted techniques to adjust for the well-recognized sampling problems inherent in using fossil data to assess diversity is suggested by the nested analyses. Only two pre-Holocene time intervals, the early and late Barstovian , had a sIn addition, it is important to note that the slopes (z) of the power law equations of the fossil Type I curves are less than those seen among modern faunas in the Colorado Plateau than elsewhere. Only further field work to discover and report well-sampled Rancholabrean fossil localities in the Colorado Plateau can resolve these alternatives.Rancholabrean species richness for the Colorado Plateau falls noticeably below that of the Holocene data point . While iThe depression of Holocene diversity indicated by our data largely results from the well-documented extinctions of Pleistocene mammalian megafauna Likewise, our results are concordant with previously reported late Pleistocene and early Holocene range shifts that decreased small-mammal species richness in some places, attributed to end-Pleistocene climatic changes These results are consistent with the idea of synergy between human impacts and end-Pleistocene climate being the underlying driver of the initial Holocene diversity reduction Our results provide a quantitative assessment of what has long been primarily a qualitative observation: namely, the decline in mammal diversity that occurred as human presence first began to dominate the North American landscape. We demonstrate that this decline represented a 15–42% loss (depending on biogeographic province) in mammal species richness. Therefore, the diversity baseline we are at today already is well below the “normal” biodiversity baseline for North American mammals, if we define “normal” as the condition that prevailed through most of the millions of years modern mammal families have been on Earth. In that light, the current indications that extinction of mammals may be accelerating in North America, as evidenced by the historic loss of at least nine subspecies and severe historic range reductions of many species It is not yet possible to quantify diversity loss using the same metrics for mammals of other continents or for other types of organisms. Nevertheless, it is informative to compare the diversity decline we document for North American mammals with species losses that characterize the five mass extinctions recognized in the geological record. Each of those mass extinctions resulted in the loss of at least 47±4.1% of the known genera living on Earth at their respective times to zoom in on the set of localities at appropriate scales, trace the minimum convex polygon that would enclose all the localities of interest within a particular province, and calculate the area enclosed by the polygon. The SARs were evaluated by constructing both Type I and Type IV curves . We plotted these standardized richness counts against geographic area to determine paleospecies-area relationships. Geographic areas were calculated by using the Berkeley Mapper mapping interface . Methods used to temporally sort the fossils include radiometric dating techniques, such as Ar-Ar dating of the fossil-bearing rocks, or relative dating tied to radiometric dates, such as magnetostratigraphy, or biochronologies determined using the evolutionary stage of the fossils themselves. Innovative algorithms based on taxon co-occurrences have been developed to sort fossil occurrences into equal 1 million year intervals Two alternative methods for calculating the number of species per geographic area are maximum and minimum counts . Only minimum counts were employed here as previous work has shown little difference among them http://www.uga.edu/~strata/software/). A review of the development of rarefaction methodology can be found in Tipper Rarefaction of the raw minimum species counts was accomplished with S. Holland's analytic rarefaction software Click here for additional data file.Table S1Number of Occurrences for Each Temporal Bin by Biogeographic Province.(0.06 MB DOC)Click here for additional data file.Table S2Number of Total Species for Each Temporal Bin by Biogeographic Province.(0.05 MB DOC)Click here for additional data file.

Pervasive developmental disorder (PDD) has an uncertain etiology, no method of treatment, and results in communication deficiencies and other behavioral problems. As the reported recurrence risk is 5%-10% and there are no methods of either prevention or prenatal testing, mothers of PDD children may face unique challenges when contemplating second pregnancies. The purpose of this study was to explore the mothers' lived experiences of second child-related decision-making after the birth of a child with PDD.The participants for this study were restricted to mothers living within the greater Tokyo metropolitan area who had given birth to a first child with PDD within the past 18 years. The ten participants were encouraged to describe their experiences of second-child related decision-making after the birth of a child with PDD on the basis of semi-structured interviews. Data analysis was performed by using Interpretive Phenomenological Analysis (IPA), which is concerned with understanding what the participant thinks or believes about the topic under discussion.We identified two superordinate themes. The first was balancing hopes and fears, in which hope was the potential joy to be gained by the birth of a new child without PDD and fears were characterized as uncertainty of PDD and perception of recurrence risk, burden on later-born children, and negative effects on a child with PDD.The second superordinate theme was assessing the manageability of the situation, which was affected by factors as diverse as severity of PDD, relationship between mother and father, and social support and acceptance for PDD. Our 10 participants suffered from extreme psychological conflict, and lack of social support and acceptance for PDD created numerous practical difficulties in having second children.Our participants faced various difficulties when considering second pregnancies after the birth of children with PDD in the Japanese society. As lack of social support and acceptance for PDD also played a large role in second child-related decision-making, creating a social environment that more fully accepts those disabled and providing flexible support systems for families of children with PDD are crucial. Pervasive developmental disorder (PDD) refers to a group of disorders, namely, autistic disorder, Asperger's disorder, pervasive developmental disorder not otherwise specified, Rett's disorder, and childhood disintegrative disorder , althougMany studies have shown how these disabilities cause significant stress for families ,7, exaceFurthermore, traditional gender roles remain, and this results in mothers largely being responsible for child-rearing ; thus, mIn Japan, reported ASD/PDD has increased rapidly , and a rWe considered a qualitative phenomenological approach to the experiences of this population the most appropriate for the current study given the lack of existing research and the sensitive nature of the issues involved. According to Phelps et al. , individThe population of potential participants for this study was restricted to mothers living within the greater Tokyo metropolitan area who had given birth to a first child with PDD within the past 18 years. We used purposeful sampling methods to recruit study participants through parents' groups and day service centers for developmentally disabled children. We were determined to recruit participants with first children younger than 18 years for several reasons . First, childcare staff stated in preliminary interviews that inviting mothers of young children with PDD to participate might be ethically questionable as these mothers might not have had time to accept their children's disorder and are often themselves still emotionally vulnerable. Second, parents are often unaware of their children's disorders before they matriculate to elementary school. Third, mothers of children under the age of 18 will be knowledgeable about changes in offered social support systems over time. Finally, the timing of decision-making about second children has not been studied in this population, and we did not want to artificially eliminate a potentially useful segment from our study by setting too stringent a time limit since the birth of the first child. In Japan, the ideal number of children is overwhelmingly considered to be two , which iData collection was performed in one-on-one semi-structured interviews with the first author using a set of questionnaire and interview guide years, whereas the first child age range was 7-15 (mean 10) years. At the interview, four out of the 10 participants had second children, two of whom also had PDD. Of the remaining six, three participants made active choices not to have second children, one is still undecided, and the remaining two desired second children but were unable to become pregnant. Nine out of 10 mothers were still married, while one was divorced following the birth of her first child. Six participants were full-time homemakers, while four worked part-time. None had full-time jobs. Participant characteristics are shown in Table Two superordinate themes emerged from the descriptions of mothers of children with PDD when considering second pregnancies. The first was balancing hopes and fears, which included four subordinate themes: uncertainty of PDD and perception of recurrence risk, burden on later-born children, negative effects on a child with PDD, and the potential joy to be gained by the birth of a new child without PDD.In other words, the mothers were caught between the hope that a new child without PDD could help improve their current status and fears about the multitude ways in which a new child could exacerbate the current situation. The second was assessing the manageability of the situation, which included three subordinate themes: severity of PDD, relationship between mother and father, and social support and acceptance for PDD. These influenced the balancing of hopes and fears, and decision-making of the participants through determining whether or not the available environment was conducive to a second child, and whether or not the mother herself could manage given the constraints imposed on her : Once I started bringing my child to education/care centers after discovering he was autistic, so many mothers there only had one child...There were also lots of mothers there whose first children were autistic, and their second children had autism or other developmental disorders as well. So, I began to think of what would happen if my second child were disabled as well.Interviewer (I): You didn't know the recurrence risks...P: Not at all...I saw some children with developmental disorders, but I never thought it could happen to my own child...so I was scared...I couldn't imagine our future...yeah...I was so scared...This description illustrates typical ways in which mothers learned of the risk of recurrence and how they came to consider a potential second pregnancy. Similar to Mother E, most participants were overwhelmed with fundamental uncertainties surrounding PDD. What were the chances of a second child developing it as well? What did that mean for the future? Although most of the participants had at least some knowledge of Down's syndrome, they had almost no level of familiarity whatsoever with autism or other forms of PDD. Indeed, until their own children began displaying problematic behavior, these mothers lived in a world completely removed from PDD and its attendant worries. The next participant, Mother I immediately decided against a second child after hearing rumors about recurrence risk.I: When did you first start considering a second child?P: During my first pregnancy.I: What were your thoughts at the time?P: At that time, I was 35 years old...so I wanted to have a second child as soon as possible. But after the birth, I had to take care of my first child and I couldn't have a second baby soon. And...nearly three years later, my child was diagnosed as PDD...When I realized my child had a disability, and heard from another mother in the same situation that a second child would also have a high probability of disability, I decided not to get pregnant again. The probability of the second child also being disabled is, what, 50-60%? So, I have no regrets now about deciding not to have a second child.I: What are the reasons for that decision on your part?P: The reason for my decision is discrimination against the disabled. Whatever people say, the disabled are discriminated against. Japan as a society isn't an easy one for the disabled to live in. Mother I experienced no indecision about giving up the idea of a second child after hearing about the risk of recurrence. This participant's own discrimination closely mirrored that of society at large, which she was criticizing. However, when asked whether or not she considered consulting a specialist about the risk of recurrence, mother I answered "I didn't bother, because I knew I wouldn't get the only answer I wanted anyway (100% chance of a child without PDD)." Similarly, the majority of participants did not consult a specialist about the possibility of the risk of recurrence, and so came to the conclusion that it was "high" after speaking with other mothers in similar situations. Further, participants were not motivated to look for answers about the risk of recurrence in books or Internet resources because of the lack of material about the participants written for a lay audience in Japanese. Instead, most participants responded that "Asking other mothers (of children with PDD) was both faster and more reliable."Mother A was the only mother who actually consulted a pediatrician about the risk of recurrence, although she did not obtain scientific information.P: I had no significant relationships with mothers of other disabled children when contemplating my second pregnancy, but I noticed that many mothers in similar situations did not have second children.I: Yeah...uh...Did you talk about your plans for second pregnancy with mothers in similar situations...?P: No, No, I couldn't...but...um...I felt something strange...something wrong...so I consulted my pediatrician about the risk of the second child being disabled as well.I: Did you?...well...What did your pediatrician say?P: My pediatrician said there was almost no chance that my second child also would be disabled and that I should hurry up and give my first child a sibling (laughter).I: Really? Hum...uh...How did you feel?P: I...I was relieved (laughter). I just believed him and thought the probability was very low. Of course, I did hear about the "high" recurrence risk from another mother of a PDD child after my second child was born (laughter).I: Oh...How can I say this (laughter)...umm...What do you think about your pediatrician?P: Maybe he didn't know about the recurrence risk (laughter), or maybe he lied to encourage me. Either way, my second child is healthy, so I'm glad that I got pregnant again without knowing the truth [about the recurrence risk]. Mother A expressed gratitude towards the pediatrician who downplayed the very possibility of the risk of recurrence probably because if he had not, fear would have prevented her from having a second child, and she would have deprived herself of the experience of raising a child without PDD.The participants also began hearing about negative effects on siblings without PDD from mothers in the same situation. Instead of an equal relationship in which siblings could be of assistance to each other, what now awaited younger siblings was the role of a "sibling of a child with PDD" and the unavoidable demands that are involved. Participants were nearly universal in expressing extreme hesitation in bringing this about.I: Please tell me about your decision-making as to whether or not to have a second child.P:Ah...it's too complicated..I wanted to have a second child, of course, but I was afraid of burdens of later-born children.I: Burdens? What do you mean?P: I felt that having a sibling with PDD would be unfair to a younger brother or sister without PDD. They would be forced to provide care, and I heard about bullying as well (sobbing).... Mother A's voice broke down as soon as she began speaking of her PDD child's "siblings." She gave birth to a normal second child, but continues to worry about the burden placed on this younger "sibling of disabled." Her main worries are that the second child will be bullied and be forced to provide care for the older sibling, sentiments shared by Mother F.P: When I noticed my son's disability, I almost gave up the thought of having a second child.I: Why did you think so?P: I have a friend whose older sister is intellectually disabled. I know how she has struggled in her own situation...it's too difficult.I: Did she complain about her circumstances?P: Not really...but...but I know that she has been patient. Please think about it.Parents and others always tell siblings of disabled children that everything will be alright, but in reality they know that they will end up having to care for their disabled brothers and sisters. It may be an obstacle to the sibling's own marriage, since the parents of the prospective spouse may object. I cannot help but think that it's very hard on the siblings. These show how significant the issue of assumed burden on the later born children without PDD can be. In addition, many participants reported witnessing or hearing about "siblings with behavioral problems" and "siblings being deprived of attention" from other mothers in similar situations, and felt that having siblings with PDD represented a significant burden. Additionally, the burden takes the form of economic, psychological, and physical stress associated with caring for the disabled sibling after the parents' deaths, as well as the discrimination against family members of the disabled. As illustrated by worries about opposition to marriage with siblings of the disabled, Japanese society has difficulty accepting not only the disabled, but family members as well. Therefore, "If the second child has a disability, then things will be even harder on me, while if the second child is healthy, then having a PDD older sibling will be hard on them" (Mother I). Most participants shared similar feelings.In addition to worrying about the burden placed on younger siblings, participants also contemplated the possible negative effects on their children with PDD brought about by the birth of younger siblings.P: I also thought that I should forgo having a second child so that I could look after my first child as well as possible. With a second child, my attention would be divided in half. That means I won't be able to give my older child as much care as before.I: You mean...the existence of the second child might not be good for your first child...P: Yeah...I am worried about my first child's condition... This description is particularly representative of those participants who decided not to have a second pregnancy. As another participant said, "I want to give one child 100%" (Mother I). Indeed, several participants reported "...personally witnessing deterioration of the child with PDD after the birth of a younger sibling" (Mother D), a pattern making it even more difficult for mothers to have second children because of the possible negative effects on their own firstborn children with PDD. Here we see participants struggling with internal ideals of motherhood, which are complicated by the fact of their first child's PDD. Most participants reported feelings similar to "I'm so sorry for giving birth to a child like this," experiences which are likely tied to hesitation and guilt surrounding the decision to rear a second child. Moreover, one participant hypothesized about the direct negative effects on her child with PDD that a second child could bring.P: If my second child had PDD, it may have a negative impact on my son (first-born child).I: What kind of negative impact?P: From pre-school on, my child has uttered self-denigrating statements, such as "Why did you have me?" "You would be better off without me," or "I want to erase myself." So, if my second child also had PDD, but of a different, opposite kind where they blamed everything on other people, then I think my first child might even commit suicide.I: Oh...you imagined such...P: This could be happen. There are various types of children with PDD, and their behavioral problems change all the time. Mother F is aware that although some children with PDD are extremely critical of and even harm themselves, the opposite type, with aggression directed outward, occurs as well. She is therefore fearful that her current child with PDD might be driven to extremes if her second child developed this second type of PDD. All participants were aware of the fact that expression of underlying PDD varies significantly according to the individual, and that even individual symptoms vary over time: "He just stopped talking one day," or "He was such a gentle child, then suddenly he began hurting others." These realizations lead to fears about uncertainty of how PDD might be expressed in a second child with PDD, and the possibility that differing forms of PDD within the same family might exacerbate the situation.In contrast to the fears described above about giving birth to a second child, nearly all participants had a desire for children without PDD. This desire was different from that experienced before learning of their first child's disability, and could be better described as a fervent hope for an opportunity to improve their current situation, alter their lives, and reclaim lost dreams.I: You have a second child...When you think about your second pregnancy?P: When I realized that autism is never cured, I couldn't accept such a life of dealing one-on-one with a child who never spoke... Then I thought that having a second child give me only opportunity to escape such life.I: You mean, having a second child may improve your situation?P: Yes. I really want to raise a healthy child, and experience normal life. My husbands' family members, his mother and brother, always blamed me for my child's behavior. They didn't understand the nature of PDD, and...and...Can you believe this? They had not accepted my son's disability for the past 12 years. In the case of Mother B, the difficulties posed by her child only strengthened her resolve to have another child. In addition, as the husbands' family members denied Mother B's ability to raise a child a long time ago, she struggled to escape from her situation. Similarly, in the case of Mother D, her husband's father, despite being a doctor himself, has yet to accept the nature of his 11-year old grandchild's condition, continually insisting that the mother's childrearing is at fault. With the husband's support limited to telling her to "ignore what [the grandfather] says," Mother D is extremely isolated within her husband's family. According to Mother B, "causes are not sure, disability is invisible at first sight, and diagnosis needs long time, so accepting PDD should be difficult for family members, especially for grandparents. They had wanted to treat my son as a healthy, normal, and ideal grandchild." These may result in blame against mothers, and increasing mothers' wishes to change the current circumstances by giving birth to a child without PDD.P: I never considered disabilities as something special, but uh...wanted to have a second child who would be normal (laughter).I: Yeah...what do you think about your second pregnancy?P: I was looking forward to reading children's books and doing other things for my child. But, my child won't listen to me read, and tears up the books. It's hard to communicate...I don't get to feel the typical joys of raising a child. So, I decided to gamble on a second child, in the hopes of being able to experience the fun and joys of raising a child without PDD. Mother J considered reading books aloud integral to and metaphor of the joys of raising her own child. Her unexpected inability to do so only heightened her sense of loss for the "joys of raising a child without PDD." Klaus and Kennel describeThis superordinate theme consisted of an assessment of their current situation on the part of the participants to determine if giving birth to and raising a second child was feasible. The feelings of helplessness experienced by participants engendered both hope and fear, sometimes influencing decision-making directly.In addition to the lack of communication that characterizes PDD, secondary behavioral disorders include self-injury, injuring others, sleep disorders, panic attacks, and hyperactivity. The presence of these often brought participants to the point of physical and psychological exhaustion.P: Making a second child would be impossible, both psychologically and in terms of time. I don't have time for myself, and I am so sleep-deprived that it's hard to stay awake...My child might do something if I fell asleep.I: So, you couldn't rest at all?P:Yeah...and his behaviour has changed all the time. Now, my son always blames himself, but when he was younger age, he was very aggressive. For example, he always hit me more than two hours, and once he broke my nose.I: Broke your nose?P: Yes, he did. I was so miserable.... Please imagine...I was an adult women, and the mother of my son. But he...just tiny infant, around three or four years old, made me cry and broke my nose.I: Oh...did you consult with specialists?P: Yes, I consulted with a specialist of developmental disability, and she said, "You have to just be patient, as a stone." Mother F has faced the difficulties that are not only her child's behavioral problems, but also uncertainty of PDD, which we already mentioned. Mother F was not able to imagine how her son's behavior would be changed and how she tackles him. That is, after she became the mother of child with PDD, her life was not able to be planned by herself. Therefore, in Mother F's case, the severity of PDD and uncertainty of PDD are intertwined and obstacle for planning to have a second child.I: You have wondered for a long time...but you still have time to make a decision about a second child...P: Yes, but it's almost too late (laughter). Certainly...yeah...I am not quite too old to give birth again, and I have not completely given up on the idea of a second child, but I'm already at the end of my rope, especially physically. My mother can only look after [my child with PDD] for an hour at a time, and I can't even go to the bathroom without worrying. One time I was busy with something else, and came back to find a cord wrapped around his neck. Mother E's husband frequently looks after the child, and the grandmother helps out as well. However, the child is so hyperactive that even the grandmother can only watch the child for an hour at a time, leaving the mother completely lacking in time or resources. In cases such as these with high-level disorders, mothers' time and energy are both diminished to the point that participants despair of a second child as being "physically and psychologically impossible." This feeling of despair is closely linked to other subordinate themes, such as fears that if the second child has PDD as well the mother's exhaustion will double, while if the second child has not PDD he/she will bear a burden for their older sibling and the older sibling themselves may deteriorate. At the same time, the high level of severity only increases the desire to escape from the current situation in some way.All participants reported at least some change in relationships with their partners during and after discovering their child's disability. Although differing widely among participants, this relationship exerted an extremely large impact on decision-making.P: We can't go back to a romantic relationship, can't feel that way. Right now it truly takes everything I have to raise our child.I: When did your sexual relations end?P: Let's see...They probably truly ended when...our child was about three years old, I think.I: So... about four years ago?P: Maybe...Yes, Yes. My husband and I were having problems as well when things truly hit bottom. I couldn't understand how he could be so aloof, and was frustrated that he didn't understand how I felt. Mother F complained her husband's attitudes, which were cool and didn't express sympathy for her. However, although at one time she considered divorce, the relationship has now improved and she thinks of her husband as "a good source of advice," "a fellow soldier." This mother F' change was underpinned the increasing understanding for husband that even he shocked and wanted to cry, he couldn't do so with wife because of gender differences, and he must work outside with equanimity to feed his family. In other words, mother F became accepting that mother and father had different parenting roles and she should engage her son's care. However, the fact that the 37-year-old woman has had no sexual relationship with her husband for the past 4 years speaks to the great change wrought upon their relationship by their child with PDD. All participants reported at least some change in relationships with their partners during and after discovering their child's disability. Although differing widely among participants, this relationship exerted an extremely large impact on the decision-making. As typified by Mother F's statement that "His opinion is irrelevant... He isn't around on weekdays," more than half of the participants' husbands played a supportive role in child-rearing, but the mothers were left alone to care for their children with PDD on weekdays. For this reason, the mothers who bore the brunt of responsibility in making decisions about second children. The next case is similar to that of Mother F, except that they were unable to repair their relationship, with a permanent rift developing between them.P: How about your ex-husband? Did he support you?I: Not at all...Rather, he shut himself into his own territory...P: Own territory?I: Yeah. He had his own world...He never tried to research our child's disability, and wasn't very interested. Then he started hitting our child when [the child] yelled, which was the start of our relationship becoming rocky. Although I might have paid too much attention to our child, too.P: Oh...that must have been really difficult...I: Yeah...yeah...I decided to divorce him...It had nothing to do with my child's disability...I just no longer trusted him. This illustrated that as the child grew older, the differences between the mother and father in terms of understanding PDD and deciding future plans widened, and these differences led to a breakdown in the marital relationship. Thus, despite the mother's strong desire for a second child, her marital relationship prevented her from fulfilling her wish.In other cases as well, the husbands' words and actions were the source of significant stress for the participants. Mother B's husband simply rejected his son: "My husband stopped coming home, saying that our child was not his" (Mother B). However, these marital relationships, as well as the attitudes of the fathers, were subject to change over time, altering participants' perceptions of what was possible or impossible. A few years later, Mother B's husband eventually came to accept his child and became so actively involved that the participant was inspired to say that "It's OK if my next child is disabled too. These I thought, we will manage somehow" (Mother B). In direct opposition to Mother J, Mother B's case indicated the differences in the understanding of PDD between mother and father had decreased as time passed, and resulted in the decision to have a second pregnancy. Similarly, Mother A also describes the husband's cooperative attitude as a key element in alleviating her own burden and helping overcome inhibiting factors, such as the burden on the later-born child and negative effects on the first child. These illustrated how the husband's attitudes influence participants' assessment of their own ability to manage and the decision to have a second pregnancy.Since available family supports were limited, the degree to which others and society in general offered social support and acceptance for children with PDD both directly and indirectly influenced the decision to have a second pregnancy.I: Do you still want to have a second child?P: Oh, it's too late (laughter)...I wanted someplace to take care of him temporarily, but not many places will look after disabled children. I was told that they have a hard time looking after such kids. There was only on public facility for looking after disabled children near me, and they had no openings. The government doesn't distribute that kind of information, either. It would be unthinkable to have another child without someone to look after my first child. I could have had another child with support. Mother H was worried about both the burden of the later-born child and negative effects on the first child, but not enough to give up on the idea of a second child. Instead, it was the severity of PDD and lack of social support for children with PDD that directly prevented the decision to have a second child.P: He [first born child] loves babies.I: Really? Does he like to take care of other kids?P: Yes, he does...and...and my boy [with PDD] said that he wanted siblings. So, I said, who would look after you when I was in the hospital giving birth? What would we do if I had to stay in the hospital for a long time? There is no place willing to look after a child like that, and no one I can feel good about entrusting him to.P: Oh...that was a logical explanation (laughter). Did he understand?I: Yes, for a while, he was just thinking (laughter). That time, he was a kindergarten boy...so he couldn't say more. Mother F envisioned potential trouble if her second birth required a longer than anticipated hospital stay. She assumed that appropriate aid would be unavailable in her area, and lacked the energy to investigate the matter herself. She ultimately elected not to have a second pregnancy given worries about the burden on later-born child and negative effects on her child with PDD, which were compounded by severity of PDD, relationship between mother and father, and lack of social support and acceptance for PDD. Mother D reports that "the authorities take no initiative in providing information at all," a sentiment echoed by every mother interviewed: "[Government offices] will only give us the absolute minimum of information possible" (Mother C); "I read the public notices from cover-to-cover, and there is nothing about disabled children, not even that the system itself had changed" (Mother E); "Several years passed without us receiving the financial aid we were entitled to" (Mother D). All participants complained about the lack of social support and even information about what little support was theoretically available, an experience that heightened feelings of lack of social acceptance: "We are just social baggage anyway" (Mother B). Similarly, many other participants did describe the hardships faced by the disabled in current Japanese society: "People can be cruel to these children" (Mother H); "My child was so hurt by the words of his special needs teacher in elementary school that he refused to go to school afterwards" (Mother E). Perceptions of lack of social acceptance toward the disabled that accompanied these experiences only served to intensify anxiety about recurrence risk or burdens of later-born children.P: I wanted to go to a hospital, but I couldn't.I: You needed to seek medical treatment or something?P: I mean...I need fertility treatments to get a second child, but I couldn't bring my hyperactive child with me to the hospital for the treatment. I would have to work to put him in daycare, but no one would hire me, having to take so many days off for my fertility treatments and care for my child. And, there are so few spots for disabled children at elementary schools, and there are no after-school programs he could join anyway...I: I understand that depends on regions; only children of working mothers may be eligible for daycare centers...ah...are there no exceptions?P: No exceptions for my area...um...I think, having a second child may be impossible...may be an impossible dream... In Mother E's case, planning a second pregnancy through fertility treatments required greater flexibility in daycare eligibility requirements and other social services. An unavailability of such services may contribute to a sense of hopelessness; indeed, Mother E remains undecided about having a second child and regards it as "an impossible dream." This shows that negative appraisals of one's own situation overwhelm the desires for and preclude any possibility of having a second child.Japanese mothers of first children with PDD face dilemmas, which center around themes of judging whether or not their situation will improve or deteriorate with a second child by balancing hopes and fears, and assessing whether or not such a child is feasible at all. According to Woodgate et al. , the CanHowever, our study may add different types of difficulties based on second child-related decision-making after the birth of a child with PDD in a Japanese society.In Japan, 99.8% of all births take place in a hospital or clinic , and theThe lack of social support leads to feelings of lack of social acceptance, which in turn intensifies psychological anxiety. It has been noted that "Perception of disability is affected by the value system of the group or society in which one is raised and lives" , and indFurthermore, there are gender differences. Gray reports There are clear differences between our findings and previous research into decision-making about second pregnancies by mothers of children with Down's syndrome. According to Tsuji , JapanesWe were able to gain insight about our participants' perceptions of the risk of recurrence, a factor which to date had not been subject to study in Japan. The tendency in our country is not to offer scientific data about recurrence risk. Only one participant in the current study stated a concrete perceived recurrence risk probability at 50%-60%, but we found that most participants perceived recurrence risk to be high enough to feel hesitant about a second pregnancy. Similarly, in a recent study in Tasmania, one quarter of subjects thought recurrence risk to be higher than 60%, constituting a huge gap with the 5%-10% generally considered to be the actual recurrence risk for PDD/ASD -15. As tWhereas husbands, other family, and doctors are sometimes known to use amniotic test results to strongly pressure mothers to abort their fetuses , none ofIPA is regarded as a useful tool to hear the voices of participants from across the sociocultural spectrum and challenges the traditional linear relationship between sample size and value of research . HoweverOn the other hand, our findings, which described the difficulties faced by mothers of children with PDD may be useful to medical, educational, policy makers, social service, and other related professions, and improving the support services available should benefit both mothers and their children.To alleviate the fear of the recurrence risk, family planning centers, still relatively rare in Japan, as well as telephone counseling may be made more readily accessible. Similarly, in order to relieve worries such as burden on younger siblings, more social acceptance and support for the disabled are needed in the society. Moreover, an increased number of available social support systems such as daycare centers without onerous eligibility requirements, after-school programs, and paternal childbirth leave may be desirable. In addition to greater flexibility, greater dissemination of relevant information and education about the disabled as well as chances to interact with them from a young age are required.In conclusion, our participants who are the Japanese mothers of first-born children with PDD faced various dilemmas when considering second pregnancies. They balanced hopes that a new child could help improve their current situation against fears about the multitude ways in which things could deteriorate even further. Also, our participants assessed both whether their current environment was conducive to a second child and if they themselves could manage given current constraints. Therefore, our participants suffered from extreme psychological conflict, and lack of social support and acceptance for PDD created numerous practical difficulties in having second children in Japanese society.The authors declare that they have no competing interests.MK carried out the interviews, analysed the data and drafted the manuscript. YY, MM, TO participated in the design of the study and independently confirmed the appropriateness of interpretation and analysis of the data at each stage, provided alternative ideas about the first author's work, and helped to draft the manuscript. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2393/10/69/prepubQuestionnaire and interview guide. Questionnaire for interviewees and interview guide for an interviewer in this studyClick here for fileSuperordinate themes and Subordinate themes. Superordinate themes and Subordinate themes derived from the interview dataClick here for file