Datasets:

hatakeyama-llm-team

/

PMC

like 0

Follow

Team Hatakeyama 25

Hemozoin-fed (HZ-fed) monocytes are strongly exposed to oxidative stress, shed large amounts of peroxidation derivatives with subsequent impairment of numerous functions and overproduce proinflammatory cytokines. Nevertheless histopathologic features of autoptic tissues from patients with severe malaria show abundant presence of HZ in Kupffer cells and other tissue macrophages, suggesting that function impairment and cytokines production are not accompanied by cells death. The aim of present study is to clarify the role of hemozoin on cell survival focusing on the involvement and temporal setting of proinflammatory and anti-apoptotic molecules.Short term gene expression analysis was performed through macro-array of a complete panel of cytokines and confirming real-time RT-PCR. Intermediate term HSPs protein expression was evaluated by western blotting. Long term cell viability was analysed by immunocytochemistry and flow cytometry.Short term gene expression analysis (0-4h after 2h-phagocytosis) showed that HZ induced immediately IL-1 β gene expression, furtherfollowed by additional transcription of eight chemokines , two cytokines (TNFα and IL-1RA), and cytokine/chemokine-related proteolytic enzyme MMP-9. Furthermore, real-time RT-PCR analysis showed that 15-HETE, a potent lipoperoxidation derivative generated by HZ through heme-catalysis, recapitulated HZ effects on five chemokines expression. Intermediate term investigation (9h after 2h-phagocytosis) showed that HZ increased protein expression of HSP27, a chemokine-related molecule with anti-apoptotic properties. Finally, long term cell viability (24-72h after 2h-phagocytosis) was unaffected by HZ in human monocytes.Collectively, present data suggest that apoptosis of HZ-fed monocytes is prevented through a cascade involving 15-HETE-mediated higher transcription of IL-1 β, rapidly endorsed by chemokines, TNFα, MMP-9 and IL-1RA transcription and up-regulation of anti-apoptotic HSP27 protein expression, favouring persistence of impaired monocytes in the bloodstream and clinical progress towards fatal complicated malaria.

Throughout the 20th century, the mission of local and state public health departments broadened from infectious disease prevention and control to encompass maternal and child health, immunizations, food and water safety, environmental health, and chronic disease prevention -3. Now iThe Institute of Medicine has recommended that "each state have a department of health that groups all primarily health-related functions" . It furtNineteen respondents believed that mental health issues fit best under "community health" on the public health agenda, but all the respondents acknowledged that public health professionals should promote mental health in the context of public health issues. Although the survey indicates that states want their public health models to encompass mental health, funding and administrative barriers exist. Federal funding for state mental health services is separate from that for state public health departments and provides little support for prevention services. States have few incentives to integrate physical and mental public health care. Funding for mental illness prevention comes from limited state and county resources. These factors discourage integration of services and do not recognize the vital role that mental health plays in chronic disease outcomes.In 2004, California voters passed Proposition 63 , which supports the integration of primary care and mental health. The purposes of this law were to 1) define serious mental illness as a condition deserving priority attention, including prevention and early-intervention services and medical and supportive care; 2) reduce the long-term adverse effect for people and state and local budgets resulting from untreated serious mental illness; 3) expand successful, innovative service programs ; 4) make state funds available to provide services that are not already covered by federally sponsored programs; and 5) develop services that are best practices and subject to local and state oversight. Proposition 63 finances county-based mental health programs to expand overall services, including prevention and early-intervention programs. These investments will support the growth of capacity for more integration of mental health and primary care, thus establishing new practice models that will be worth watching. The California Mental Health Directors Association has reported that several counties are using their Proposition 63 dollars to fund integration of mental health and primary care programs. For example, San Diego County has established new mental health services in a primary care diabetes clinic that serves a large Latino population to treat and prevent depression and diabetes in an integrated approach.To support integration, state and local health departments and mental health departments must take a more active role in developing specific strategies and identifying system-level support to begin working together. For example, pilot projects could be developed that use integrative approaches to encourage local mental health providers to collaborate with public health providers and increase access to mental health treatment for racial and ethnic minorities. Such efforts could address disparities among minorities who are not accessing mental health treatment. Health departments could also better inform the public of the role that mental health plays in overall prevention and treatment of many chronic diseases. Both public health and mental health providers need training to increase their understanding that there is no health without mental health. Furthermore, public health and mental health professionals should work together to convince funders that integration of public health and mental health is important to overall health. Through this effort, national legislation, policies, and funding could begin to provide incentives for public health and mental health integration.

LRRK2 plays an important role in Parkinson's disease (PD), but its biological functions are largely unknown. Here, we cloned the homolog of human LRRK2, characterized its expression, and investigated its biological functions in zebrafish. The blockage of zebrafish LRRK2 (zLRRK2) protein by morpholinos caused embryonic lethality and severe developmental defects such as growth retardation and loss of neurons. In contrast, the deletion of the WD40 domain of zLRRK2 by morpholinos targeting splicing did not induce severe embryonic developmental defects; rather it caused Parkinsonism-like phenotypes, including loss of dopaminergic neurons in diencephalon and locomotion defects. These neurodegenerative and locomotion defects could be rescued by over-expressing zLRRK2 or hLRRK2 mRNA. The administration of L-dopa could also rescue the locomotion defects, but not the neurodegeneration. Taken together, our results demonstrate that zLRRK2 is an ortholog of hLRRK2 and that the deletion of WD40 domain of zLRRK2 provides a disease model for PD. Parkinson's disease (PD) is a degenerative disease of the brain that often impairs motor skills, speech, and other functions. PD was long thought to be caused by environmental factors, but the discovery of several gene mutations in the patients clearly demonstrated the involvement of genetic factors in the development of PD. Among the identified genes, LRRK2 was discovered to be one of the most important genetic causes of PD. The biological function of LRRK2 was, however, largely unknown. In this study, we studied the function of LRRK2 in zebrafish by blocking the normal function of LRRK2. The zebrafish showed features of neurodegeneration and locomotion defects, similar to those of PD patients. The defects of the fish could be rescued by expressing the normal protein of LRRK2, and the locomotion defect could also be rescued by the administration of L-dopa that is commonly used for treating PD patients. We have therefore developed a zebrafish model for PD that can be used for understanding the mechanism underlying the development of PD and will be helpful for future screening of new drugs to treat PD. Parkinson's disease (PD) is a common neurodegenerative disorder characterized by the selective loss of dopaminergic neurons of the substantia nigra pars compacta (SNpc) and movement symptoms, including resting tremor, rigidity and postural instability Of the identified disease genes for PD, mutations in LRRK2 are the most prevalent in both familial and sporadic PD patients in vitro and in vivo model systems Drosophila (dLRRK2) revealed conflicting findings; and it was not clear whether the disruption of dLRRK's function caused parkinsonism-like neurodegeneration and locomotive defects in this model system The biological function of LRRK2 is, however, largely unknown. Human LRRK2 (hLRRK2) encodes an unusually large protein composed of multiple functional domains, including armadillo repeats, ankyrin repeats, two enzymatic S/T kinase and Roc GTPase domains, COR and WD40 domains (as the dimerization motif), indicating that LRRK2 is a complex multifunctional protein in vivo loss-of-function study of LRRK2 in zebrafish. We cloned the zebrafish homolog of human LRRK2 and performed a series of molecular and genetic analyses to characterize its expression and biological functions, particularly the role of the WD40 domain, in embryonic and neuronal development.In this study, we performed the first zlrrk2 mRNA detected by Northern analysis stages and was then degraded by the beginning of the gastrula stage. The zygotic expression of zlrrk2 was first detectable at the tail bud stage (the last stage of gastrulation) and increased gradually during the segmentation and pharyngula stages, reaching a peak around 24 hours post fertilization (hpf). After a short period of reduction, the expression of zlrrk2 increased again through the hatching and larval stages up to, at least, 10 days post fertilization (dpf). At both 24 hpf and 6 dpf, a strong expression of zlrrk2 could be detected in the brain by whole mount in situ hybridization (WISH) analysis, and zlrrk2's expression in the brain is ubiquitous indicateiquitous . In adulanalyses , but fulanalyses .Microinjection of morpholinos targeting the ATG start site into embryos effectively abolished the expression of zLRRK2 protein, as determined by Western blot analysis . Knockdozlrrk2 and consequently introduced a pre-mature stop codon just upstream of the WD40 domain (zlrrk2 mRNA without the WD40 domain (zLRRK2-ΔWD40), as confirmed by RT-PCR and sequencing analyses line Over-expression of either wild-type zLRRK2 or hLRRK2 could reTo investigate the locomotion behavior of the zLRRK2-ΔWD40 morphants, we measured the swimming distance of larval fish within time windows of 30 seconds. As shown in In addition to the investigation of the WD40 deletion, we also investigated the impact of the over-expression of human LRRK2 G2019S and G2385R mutant alleles in zebrafish. The over-expression of both the mutant alleles could induce a similar blood accumulation between the swim bladder and yolk sac as the zLRRK2-ΔWD40 deletion and a mild loss of TH+ cell compared to wild-type . FurtherIn this study, we provide strong evidence that zLRRK2 is an ortholog of hLRRK2. The proteins of zLRRK2 and hLRRK2 show a conservation of amino acid sequence and share an identical domain structure. Phylogenetically, zLRRK2 is clustered together with hLRRK2, instead of hLRRK1, as well as the LRRK2 proteins of other animal species. Finally, the successful rescue of the defects of zLRRK2 morphants, in terms of both neurodegeneration and swimming abnormality, by over-expressing hLRRK2 mRNA, provides the most convincing evidence for a functional conservation of LRRK2 between zebrafish and human.zlrrk2 mRNA was expressed in multiple tissues or organs. Western blot analysis (using an antibody against the WD40 domain), however, showed a rather restricted expression of zLRRK2 protein in the brain. Together with the previous finding that the LRRK2 protein isolated from transgenic mouse brain showed a higher kinase activity than from transgenic mouse lung or transfected cultured cells zLRRK2 shows a dynamic expression profile in zebrafish. During embryonic development, zLRRK2 transcript is mainly restricted to the brain, but demonstrating ubiquitous expression within brain, as observed in mouse, rat and human brains zLRRK2 plays an important role in neuronal development. The involvement of zLRRK2 in neurodevelopment is first suggested by the retarded brain development and the loss of TH+ neurons in the zLRRK2 ATG morphants and further evidenced by the neurodegenerative phenotypes of the zLRRK2-ΔWD40 deletion. The zLRRK2-ΔWD40 deletion caused a significant loss of DA neurons in the diencephalon, and other types of neurons are also likely affected. Interestingly, our preliminary study showed that the zLRRK2-ΔWD40 deletion had a rather limited impact on the development of neurons during early embryonic development. Considering that, 1) zLRRK2 shows a ubiquitous expression in the brain, 2) the zLRRK2-ΔWD40 deletion leads to an increased apoptosis activity across the brain, and 3) the midbrain, particularly the optic tectum of zebrafish is very stress-sensitive, the loss of neurons in the zLRRK2-ΔWD40 morphans is more likely due to a neurodegeneration process instead of the interruption of normal neuronal development. The loss of DA neurons in zLRRK2-ΔWD40 deletion likely happens as a result of a rather broad neurodegeneration within several regions of the brain. We speculate that LRRK2 may be important for neuron survival and thus play a more prominent role in neural maintenance, rather than development of neurons. The interruption of normal LRRK2 function may cause neurons to become more sensitive to factors that might trigger cell death.The zLRRK2-ΔWD40 deletion also caused a significant reduction and disorganization of axon tracts, more prominently in the midbrain. This is consistent with the previous finding from transgenic mouse study that LRRK2 is involved in neurite growth in vitro, which could be restored to a normal level by the over-expression of the gain-of-function mutation R1441C This is the first demonstration of the role of the WD40 domain of LRRK2 in neural development and/or neural maintenance. The WD40 domain is known to mediate protein-protein interaction in many contexts, such as signal transduction, transcription regulation, cell cycle control, apoptosis and cytoskeleton assembly We have demonstrated a locomotion defect in the zLRRK2-ΔWD40 morphant. More importantly, we confirmed that the locomotion defect likely happens as a direct result of the dopamine insufficiency (due to the loss of DA neurons), since the defect can be rescued by supplementing dopamine through the administration of L-dopa. The administration of L-dopa did not rescue the loss of DA neurons in the diencephalon of zLRRK2-ΔWD40 morphant. This is consistent with the therapeutic effect of L-dopa in treating human PD condition where the treatment can only offer a temporary relieve of clinical symptoms, but cannot restore the degeneration of DA neurons It is noteworthy to point out that the neuron loss of zLRRK2-ΔWD40 can be observed as early as in the late stage of embryonic development. As a limitation of this model, the early-onset phenotype of zLRRK2-ΔWD40 does not fully recapitulate the late-onset PD phenotype in human. This difference may, at least partially, due to the fact that the knock-down effect of splice-blocking morpholino could be up to 90% in zebrafish, whereas PD patients usually carry heterozygous point mutations of LRRK2. Consequently, the early-onset phenotype of zLRRK2-ΔWD40 may be due to more severe mutational effect of WD40 deletion than heterozygous point mutations in human. Furthermore, although the molecular function of LRRK2 is conserved between zebrafish and human, the neuronal system, including dopaminergic one, may not be fully conserved between two species. As a consequence, mutations of functionally conserved LRRK2 may show partially different phenotypes. It is not truly unexpected because it is rather uncommon for animal models to recapitulate the full phenotype of human disease.Drosophila, the expression of wild-type and mutant forms of human α-synuclein lead to a progressive DA neuron loss Drosophila parkin-null mutants also showed motor deficits et al. found that the loss of Lrrk2 in Drosophila lead to impaired locomotive activity and degeneration of DA et al's study did not confirm this observation and instead found an increased sensitivity to oxidative stress Drosophila resulted in loss of DA neurons, locomotor dysfunction and early mortality, which could be rescued by the administration of levodopa Dorsophila LRRK2 model for PD.Several animal models for PD were developed in recent years. DJ-1 knockout mice show decreased motor functions, increased striatal dopamine level without the loss of DA neurons In summary, we have demonstrated that zLRRK2 is an ortholog of hLRRK2. As a vertebrate model, the zLRRK2-ΔWD40 morphant recapitulates some key molecular, physiological and behavioral hall-marks of PD. Together with other animal models, this potential vertebrate model provides opportunities to investigate the biological mechanisms underlying the development of PD. The fact that the locomotion defect of the zLRRK2-ΔWD40 morphant can be ‘treated’ by L-dopa also raises the possibility that this zebrafish model may be used for screening new drugs to treat PD.A TBLASTN analysis of the human LRRK2 protein against zebrafish cDNA sequences yielded two hits, XM_682700 and XM_682192. Through reciprocal TBLASTX, we found that XM_682700 was the possible homolog of human LRRK2 (hLRRK2), whereas XM_682192 was the possible homolog of human LRRK1. As indicated, XM_682700 is a predicted cDNA of zebrafish LRRK2 (zLRRK2) with about 6 kb sequences. To verify whether it is a true coding gene, we blasted this sequence against the genome of zebrafish and identified 6 EST sequences . To identify the full length transcript of zLRRK2, we performed RACE analysis by using mRNA isolated from the brain of adult fish and the sequence of BI884532 (most 5′ end) for designing the primer of 5′-RACE and AL918398 (most 3′ end) for designing the primer of 3′-RACE. Likewise, using the sequences of the same two ESTs, a pair of primers was designed to amplify the middle part of the zLRRK2 transcript. After cloning and sequencing, we identified a 9168 bp transcript carrying both start and stop codons.5′ CTGCATTTCAGCAACACAGG 3′ and Gene Specific Primer for 3′ end is 5′ AAGTCCAGCGTGTAGCTGAGCGTGGAAATG 3′.5′ RACE and 3′ RACE were performed by using the GeneRacer Kit according to manufacturer instructions. Gene Specific Primer for 5′ end is 5′GACTCCGAGGCGATACAG 3′ and 5′ CAAGGGCACTCAGACAGG 3′. Internal control beta-actin primers are 5′ TGGCAAAGGGAGGTAGTTG 3′ and 5′GTGAGGAGGGCAAAGTGG 3′.qRT-PCR was performed with HIGH CAPACITY CDNA REVERSE TRANSCRIPTION KIT and SYBR Green 1 PCR Master Mix. Gene specific primers are Wild type AB line and Tg(DeltaD∶GAL4/UAS∶Kaede) line zebrafish were maintained according to methods described in The Zebrafish Book . Details are provided in 5′ TGCAAACGGAGGTAAAAACC 3′ and 5′AGATGATCCTGGTCCCACAG 3′ for zlrrk2; 5′AAGGATGGCTTGGAGGAC3′ and 5′CTCGGAGGGTGGAGTAGA3′ for th. PCR product was cloned into pGEMT vector for probe synthesis. For dat, 5′GGGGTTCAGTTCACCTCCTC3′ and 5′CATTAACCCTCACTAAAGGGAAGACTCCATCCCTCCCATAGC3′ (with T3 promoter) were used for PCR and probe synthesis.Procedure was followed by the method described in The Zebrafish Book . Gene specific primers are: zlrrk2, ATG–ACAACTCCTCTATTTCTGCCATGAT; intron 45 splice donor junction; EI–CACAAGCAGATTTATTAACCTGTGC; intron 44 splice acceptor junction, IE–GCTCCTGAAACACAGCATTAGGAAC) were obtained from Gene Tools and injected at the one- to two-cell stage. Details of splicing interfering mopholino design are provided in F1-5′TGCAAACGGAGGTAAAAACC 3′ and in conjunction with reverse primer R1- 5′AGATGATCCTGGTCCCACAG 3′. Dosage-dependent effects of morpholinos were observed regions of LRRK2. Western analysis was conducted using standard techniques. Details are provided in zlrrk2 or hLRRK2 cDNAs tagged by Flag and hLRRK2 G2019S or G2385R cDNAs tagged by myc were used. At 2 to 3 days after the microinjection of the linearized plasmids by SfiΙ, total fish homogenate was subjected to anti-Flag Western blot analysis, clearly showing that both the zlrrk2 and hLRRK2 cDNAs could be expressed in zebrafish harboring ebrafish . Upon coobserved . For theFor L-dopa rescue, L-dopa (1 mM) (Sigma) was applied at 5 dpf stage and behavior test was performed at 6 dpf.Apoptosis assay was carried out by using In Situ Cell Death Detection Kit, TMR red (Roche).Procedures are referenced from Michael Hendricks and Suresh Jesuthasan's work On a Zeiss LSM510 META confocal microscope, live embryos' brains were imaged using an Achroplan 10X/0.30 water immersion objective and alpha tubulin stained brains were imaged using a EC Plan-Neofluar 10x/0.30 objective. Projection of confocal z-stacks was done using Zeiss software.Video recording for the behavior analysis of 6 dpf larva were taken with a Sony HDR-SR12E. Behavior analysis was done using NIH ImageJ.http://smart.embl-heidelberg.de). Each domains and whole protein of zLRRK2 and hLRRK2 were aligned by ClustalW2 .Protein domains of zebrafish LRRK2 were predicted by SMART Click here for additional data file.Figure S2Quantification analysis of the results in (0.39 MB TIF)Click here for additional data file.Figure S3Phenotypes of zLRRK2 ATG morphants. (A) Western blot analysis at 72 hpf showing the strong reduction in expression of zLRRK2 protein as well as the decreased TH protein level in embryos injected with ATG morpholino. The analysis was done in duplicate, and adult brain protein was used as positive control for zLRRK2. (B) WISH analysis at 2 dpf showing retarded brain development and decreased TH expression in an ATG morphant (right). An uninjected sibling is shown for comparison (left). Quantification of the TH+ cell loss in ATG morphant as well as the rescue of ATG morphant with hLRRK2 was shown on the right. Co-injection of hLRRK2 significantly rescue the number of TH+ cells compared to ATG MO alone. ***P<0.001 (unpaired Student's t-test). (C) Heart edema phenotype of ATG morphant and rescue effect of hLRRK2 on ATG morphant.(4.98 MB TIF)Click here for additional data file.Figure S4Dosage-dependent effect of morpholinos. (A) Dosage dependent experiment of WD40 morpholino and lrrk2 plasmid basing on the phenotype of blood accumulation. (B) Dosage dependent experiment of ATG morpholino basing on the quantification of TH+ cell loss. ***P<0.001 (unpaired Student's t-test).(1.01 MB TIF)Click here for additional data file.Figure S5RT-PCR Analysis to confirm the blockage of exon 45 splicing by WD40 morpholino. (A) Schematic representation of the exons 44 to 47 of zLRRK2 to show the morpholinos used for blocking the 45th exon splicing (the track above the exons) as well as the primers (the track below the exons) used in the RT-PCR verification of the splicing blockage effect at 2 dpf and 3 dpf. (B) RT-PCR analysis at 2 and 3 dpf showing that the WD40 morpholino could block the splicing of exon 45, and the major of transcripts were the abnormally spliced one without exon 45 . (C) The percentage of the normally spliced transcript in the total amount of normal and abnormally spliced (without exon 45) transcripts in WT and WD40 morphant at 2 and 3 dpf. The densities of normal and abnormal spliced transcripts (in B) at 2 and 3 dpf were measured, and the percentage of normally spliced transcript was calculated by comparing the density of normal transcript to the total density of both normal and abnormal transcripts . The percentage is presented as mean ± SD from 4 independent experiments. In wild-type embryos, no abnormal splicing forms were detected. ***P<0.001 (unpaired Student's t-test). (D) Quantitative RT-PCR analysis of wild-type controls and WD40 morphants at 2 and 3 dpf, showing that both TH and WT zLRRK2 mRNA levels were reduced to 40%–60% of WT fishes.(0.26 MB TIF)Click here for additional data file.Figure S6Morphological phenotype of WD40 morphants (From 3 dpf to 7 dpf). Morphants show no significant morphological defects compared to WT fishes except the mild blood accumulation in gut and pronephric duct between the york sac and swimming bladder.(0.91 MB TIF)Click here for additional data file.Figure S7Linearized plasmid harboring either zLRRK2 or hLRRK2 cDNA tagged by Flag can be expression in zebrafish embryos by microinjection.(0.04 MB TIF)Click here for additional data file.Figure S8Swimming tracts of 15 fish from each of the five fish pools: wild-type (wt), WD40 morphants (WD40), WD40 morphants co-injected with plasmid harboring either zLRRK2 (WD40+zLRRK2) or hLRRK2 (WD40+hLRRK2) and WD40 morphants treated with levodopa (WD40+levodopa).(0.81 MB TIF)Click here for additional data file.Figure S9Morphological phenotype of hG2019S and hG2385R overexpression. At 6 dpf, hG2019S and hG2385R overexpression shows no significant morphological defects compared to WT except the blood accumulation in gut and pronephric duct between york sac and swimming bladder.(0.60 MB TIF)Click here for additional data file.Figure S10Analysis of zLRRK2 antibody specificity. (A) Specificity of zLRRK2 antibody specificity was verified by western blot analysis. Positive signals could be largely blocked by pre-incubating the anti-zLRRK2 antibody with the neutralizing peptide . Similarly, the zLRRK2 signal was completely blocked by pre-incubating the anti-zLRRK2 antibody with the neutralizing peptide in the zLRRK2-overexpressing Cos-7 cells . (B) Western blot analysis showing the specificity of the zLRRK2 antibody against zLRRK2 in Cos-7 cell line. Human LRRK2 and zLRRK2 recombinant proteins were overexpressed in Cos-7 cells separately and detected by anti-hLRRK2 (left panel) and anti-zLRRK2 (right panel), respectively. A positive band was only detected in hLRRK2-overexpressing cells , using anti-hLRRK2 antibody (NOVUS NB 300–268). No obvious band was detected in zLRRK2-overexpressing and untransfected control cells ; On the other hand, a sharp band (arrow) was detected in zLRRK2-overexpressing cells using the anti-zLRRK2 antibody , but not in hLRRK2-overexpressing and untransfected control cells . This indicates the anti-zLRRK2 antibody is specifically against zLRRK2 proteins.(0.11 MB TIF)Click here for additional data file.Text S1cDNA sequence and exon information of zLRRK2.(0.09 MB DOC)Click here for additional data file.Protocol S1Supporting materials and methods.(0.04 MB DOC)Click here for additional data file.

Melanomas are highly malignant and have high metastatic potential; hence, there is a need for new therapeutic strategies to prevent cell metastasis. In the present study, we investigated whether statins inhibit tumor cell migration, invasion, adhesion, and metastasis in the B16BL6 mouse melanoma cell line.The cytotoxicity of statins toward the B16BL6 cells were evaluated using a cell viability assay. As an experimental model, B16BL6 cells were intravenously injected into C57BL/6 mice. Cell migration and invasion were assessed using Boyden chamber assays. Cell adhesion analysis was performed using type I collagen-, type IV collagen-, fibronectin-, and laminin-coated plates. The mRNA levels, enzyme activities and protein levels of matrix metalloproteinases (MMPs) were determined using RT-PCR, activity assay kits, and Western blot analysis, respectively; the mRNA and protein levels of vary late antigens (VLAs) were also determined. The effects of statins on signal transduction molecules were determined by western blot analyses.2, integrin α4, and integrin α5 and decreased the membrane localization of Rho, and phosphorylated LIM kinase (LIMK) and myosin light chain (MLC).We found that statins significantly inhibited lung metastasis, cell migration, invasion, and adhesion at concentrations that did not have cytotoxic effects on B16BL6 cells. Statins also inhibited the mRNA expressions and enzymatic activities of matrix metalloproteinases (MMPs). Moreover, they suppressed the mRNA and protein expressions of integrin αThe results indicated that statins suppressed the Rho/Rho-associated coiled-coil-containing protein kinase (ROCK) pathways, thereby inhibiting B16BL6 cell migration, invasion, adhesion, and metastasis. Furthermore, they markedly inhibited clinically evident metastasis. Thus, these findings suggest that statins have potential clinical applications for the treatment of tumor cell metastasis. Metastatic melanoma is a highly aggressive, often fatal malignancy, which exhibits resistance to all the current therapeutic approaches. At the time of diagnosis, about 20% of melanoma patients already have metastatic disease. Once metastasis has occurred, the overall median survival is only 6-9 months . The recMetastasis is a complex process that is dependent on the capacity of cancer cells to invade and migrate into adjoining cells and tissues, and proliferate into tumor growths ,4. Consi2β1 integrin, α3β1 integrin and α4β1 integrin is generally up-regulated [Cell adhesion is an essential process of metastatic cascades. Integrin-mediated cell adhesion affects the formation of focal adhesions, which are multimolecular structures that enable firm adhesion of cells. Integrins are a family of heterodimeric cell-surface adhesion receptors composed of α and β subunits ,9. Each egulated ,12.The mevalonate metabolic pathway is essential for membrane formation and the isoprenylation of a number of small GTPases, which are involved in cell growth and differentiation. The products of this pathway include farnesyl pyrophosphate and geranylgeranyl pyrophosphate, which modify and direct small GTPases to their site of action ,14. The in vitro and in vivo [3-hydroxy-3-methylglutaryl-coenzyme A (HMG-CoA) reductase is considered to be the major regulatory enzyme of mevalonate metabolic pathway. HMG-CoA reductase inhibitors (statins) are reversible inhibitors of the rate-limiting step in cholesterol biosynthesis . Most ex in vivo -21. Howe in vivo -25. FurtSimvastatin was purchased from Wako , and fluvastatin was purchased from Calbiochem . These reagents were dissolved in dimethyl sulfoxide (DMSO) and filtered through 0.45-μm syringe filters . The dissolved regents were resuspended in phosphate-buffered saline and used in the various assays described below.Y27632, a Rho-associated coiled-coil-containing protein kinase (ROCK) inhibitor, was purchased from Wako and dissolved in DMSO. The dissolved regent was resuspended in PBS and filtered through syringe filters before use.2.B16 melanoma BL6 cells (B16BL6 cells) were supplied by Dr. Inufusa and cultured in RPMI 1640 medium (Sigma) supplemented with 10% fetal calf serum (FCS) , 100 μg/ml penicillin (Gibco), 100 U/ml streptomycin (Gibco), and 25 mM HEPES in an atmosphere containing 5% COFemale C57BL/6J mice were purchased from Shimizu Laboratory Animals . The mice were maintained in a pathogen-free environment at 25°C under controlled lighting (12-h light/12-h dark cycles) and allowed free access to water and food pellets. All animal studies were performed in accordance with the Recommendations for Handling of Laboratory Animals for Biomedical Research compiled by the Committee on Safety and Ethical Handling Regulations for Laboratory Animal Experiments, Kinki University. The ethical procedures followed met the requirements of the UKCCCR guidelines (1998).5 cells in 0.2 ml) were injected into the tail vein of syngeneic C57BL/6J mice, after viable cells were counted with trypan blue exclusion. The mice were anesthetized with pentobarbital and sacrificed at 14 d after the cell injection. Subsequently, their lungs were excised and fixed in a neutral-buffered formaldehyde solution. Nodules visible as black forms in the lungs were then enumerated.B16BL6 cells (1 × 105 cells in 0.2 ml) were injected into the tail vein of syngeneic C57BL/6J mice, after viable cells were counted with trypan blue exclusion. In the experiment, the B16BL6-inoculated mice were randomly divided into 3 groups comprising 9 mice each. For 14 d from the day of inoculation, 0.1% DMSO was administered orally to the first group, which was defined as the control group, whereas simvastatin or fluvastatin (10 mg/kg/d) was administered to the remaining 2 groups.B16BL6 cells . B16BL6 cells (2000 cells/well) were plated in 96-well plates and incubated with 0.01, 0.05, 0.1, and 0.5 μM fluvastatin, or 0.1, 0.5, 1, and 5 μM simvastatin for 1, 3, or 5 d. The absorbance values of the wells were measured at 492 nm by using a microplate reader .2 integrin antibody , anti-α4 integrin antibody , anti-α5 integrin antibody (SantaCruz Biotechnology), and anti-Rho antibody . Subsequently, the membranes were incubated for 1 h at room temperature with anti-rabbit IgG sheep antibody coupled to horseradish peroxidase (Amersham). Reactive proteins were visualized using a chemiluminescence kit (Amersham) according to the manufacturer's instructions. Mouse anti-β-actin monoclonal antibody (Sigma) was used as the primary antibody for detecting β-actin protein.B16BL6 cells treated under various conditions were lysed with a lysis buffer , and the protein concentrations of the resulting cell lysates were determined using a BCA protein assay kit . The membrane fraction of B16BL6 cells was extracted using the ProteoExtract Native Membrane Protein Extraction Kit . A 40-μg protein aliquot of each extract was fractionated by electrophoresis in a sodium dodecyl sulfate-polyacrylamide gel (SDS-PAGE) and transferred to a polyvinylidene fluoride (PVDF) membrane . The membranes were blocked with a solution containing 3% skim milk, and then incubated overnight at 4°C with each of the following antibodies: anti-phospho-LIMK antibody, anti-LIMK antibody, anti-phospho-MLC antibody , anti-MMP-14 antibody , anti-α1, integrin α2, integrin α3, integrin α4, integrin α5, and integrin α6, the cDNA was amplified with 35 cycles of denaturation at 94°C for 1 min, annealing at 55°C for 1 min, and extension at 72°C for 2 min were carried out. All PCR amplifications were performed using a DNA thermal cycler . The following primers were used: MMP-1, 5'-CGA CTC TAG AAA CAC AAG AGC AAG A-'3 (5'-primer) and 5'-AAG GTT AGC TTA CTG TCA CAC GCT T-3' (3'-primer); MMP-2, 5'-TGT GTC TTC CCC TTC ACT TT-'3 (5'-primer) and 5'-GAT CTG AGC GAT GCC ATC AA-3' (3'-primer); MMP-9, 5'-AGG CCT CTA CAG AGT CTT TG-3' (5'-primer) and 5'-CAG TCC AAC AAG AAA GGA CG-3' (3'-primer); MMP-14, 5'-ACA CCC TTT GAT GGT GAA GG-3' (5'-primer) and 5'-TCG GAG GGA TCG TTA GAA TG-3' (3'-primer); integrin α1, 5'-CCT GTA CTG TAC CCA ATT GGA TGG-3' (5'-primer) and 5'-GTG CTC TTA TGA AAG TCG GTT TCC-3' (3'-primer); integrin α2, 5'-TCT GCG TGT GGA CAT CAG TTT GGA-3' (5'-primer) and 5'-GAT AAC CCC TGT CGG TAC TTC TGC-3' (3'-primer); integrin α3, 5'-ATT GAC TCA GAG CTG GTG GAG GAG-3' (5'-primer) and 5'-TAC TTG GGC ATA ATC CGG TAG TAG-3' (3'-primer); integrin α4, 5'-GTC TTC ATG CTC CCA ACA GC-3' (5'-primer) and 5'-ACT TCT GAC GTG ATT ACA GGA AGC-3' (3'-primer); integrin α5, 5'-CTG CAG CTG CAT TTC CGA GTC TGG-3' (5'-primer) and 5'-GAA GCC GAG CTT GTA GAG GAC GTA-3' (3'-primer); integrin α6, 5'-GAG GAA TAT TCC AAA CTG AAC TAC-3' (5'-primer) and 5'-GGA ATG CTG TCA TCG TAC CTA GAG-3' (3'-primer); GAPDH, 5'-ACT TTG TCA AGC TCA TTT-3' (5'-primer) and 5'-TGC AGC GAA CTT TAT TG-3' (3'-primer). The PCR products were mixed with bromophenol blue (loading buffer) and separated by electrophoresis in a 2% agarose gel in Tris-acetate-EDTA (TAE) buffer. After staining with ethidium bromide, the bands obtained after PCR were visualized under ultraviolet light and recorded with a Coolsaver .Total RNA was isolated using TRIzol reagent , and a 1-μg aliquot of purified total RNA was subjected to reverse transcription-polymerase chain reaction (RT-PCR) analysis using a SuperScript First-Strand Synthesis System for RT-PCR (Invitrogen). The resulting cDNAs were used as a template for PCR amplification to generate products corresponding to the mRNAs encoding various gene products. Each PCR reaction mixture contained cDNA, dNTP mix , 10× PCR buffer , and Pyrobest . The cDNAs were amplified under the following cycling conditions: For GADPH, the cDNA was amplified with 30 cycles of denaturation at 94°C for 0.5 min, annealing at 60°C for 0.5 min, and extension at 72°C for 0.5 min; and for MMP-1, MMP-2, MMP-9, MMP-14, integrin α4 cells) and 1 ml of NIH/3T3 fibroblast-conditioned medium, respectively. After incubation for 24 h, the remaining cells in the upper layer were swabbed with cotton, and the cells that had penetrated the lower layer were fixed with 95% ethanol and extracted for hematoxylin staining. The cells that passed through each 8-μm pore of the culture insert were counted under a light microscope.Migration was analyzed by Boyden chamber assays using Falcon cell culture inserts . Invasive properties of the cells were analyzed using Falcon cell culture inserts covered with 50 μg of Matrigel (Becton Dickinson) per filter. Adjusted viable cells concentration was counted with trypan blue exclusion. The upper and lower chambers of the inserts for both assays were filled with 500 μl of a cell and drug suspension . Type I or type IV collagen was briefly labeled with fluorescein isothiocyanate (FITC) and added to the reaction mixture; this was followed by subsequent incubation for 2 h at 37°C or 42°C . The remaining substrate was precipitated with ethanol and extracted after centrifugation at 8000 rpm for 10 min. The release of denatured collagen into the supernatant of each reaction mixture was measured by the intensity of the fluorescence emission at 520 nm following excitation at 495 nm.2 atmosphere for 1 h. Immediately before use, the coated wells were overlaid with 1% bovine serum albumin (BSA) for 30 min, washed 5 times with PBS, and dried for 30 min at room temperature in the tissue culture hood. Adjusted viable cells concentration was counted with trypan blue exclusion. The cells were loaded into individual wells (1 × 104 cells/well) and incubated for 30 min at 37°C in a 5% CO2 atmosphere. Nonadherent cells were aspirated and washed 3 times. Adherent cells were counted under an Olympus microscope at 20× magnification. The measurements were conducted in triplicate for each experimental group.For this assay, 24-well tissue culture plates were coated with collagen I, collagen IV, fibronectin, or laminin (Becton Dickinson Biosciences) and incubated at 37°C in a 5% COP values < 1% were regarded as significant.All the results were expressed as the mean ± SD of several independent experiment values. Multiple comparisons of the data were performed by analysis of variance (ANOVA) with Dunnett's test. P < 0.01). On the basis of these results, we selected 0.05 μM and 0.1 μM as the concentrations at which fluvastatin and simvastatin, respectively, were not cytotoxic toward B16BL6 cells.Cell viability of B16BL6 cells was assessed in the presence of fluvastatin or simvastatin in order to examine the cytotoxic effects of fluvastatin or simvastatin. We determined the cell survival rate, which was defined as the number of living cells as compared with the number of live control cells (0.1% DMSO-treated). The cell survival rates were calculated 1, 3, and 5 d after fluvastatin or simvastatin exposure. In the presence of 0.01, 0.05, 0.1, and 0.5 μM fluvastatin, the cell survival rates were 99.39%, 94.74%, 81.59%, and 50.77%, respectively, on day 5 Figure . In the P < 0.01, Figure Mice injected with tumor cells following a 3-d pretreatment with 0.05 μM fluvastatin or 0.1 μM simvastatin displayed visible lung nodules at 14 d after the injection. The numbers of pulmonary nodules following pretreatment with 0.1% DMSO (control cells), 0.1 μM simvastatin, and 0.05 μM fluvastatin were 452.6 ± 40.8, 257.6 ± 45.6, and 256.0 ± 33.9, respectively . Further, we investigated whether the protein expression of integrin α2, integrin α4, and integrin α5 was actually inhibited in the B16BL6 cells when statins were administered; we observed that after the administration of statins, the protein expressions of integrin α2, integrin α4, and integrin α5 were significantly reduced . In contrast, the cytoplasmic localization of Rho proteins showed an increase in the reagent-treated cells compared to the control cells (0.1% DMSO-treated) Figure . MoreoveP < 0.01, Figure The results described so far have shown that the inhibitory effect of statins on lung metastasis is exerted via the inhibition of Rho prenylation. We next administered Y27632, a ROCK inhibitor, to B16BL6 cells in order to determine whether suppression of the Rho/ROCK pathway would cause the inhibition of lung metastasis. As observed in the case of statins, administration of Y27632 sufficiently inhibited lung metastasis and zinc-dependent endopeptidases are a family of structurally related zymogens that are capable of degrading the ECM, including the basement membrane. They are presumed to be critically involved in tumor invasion and metastasis . In mela2, integrin α4, and integrin α5. A recent study has reported that the activation of small GTPases increased cell adhesion to collagens, fibronectins, and laminins [2, integrin α4, and integrin α5.Cell adhesion is a fundamental cellular response that is intricately involved in the physiological processes of proliferation, motility, as well as the pathology of neoplastic transformation and metastasis. Integrins are the most important family of cell surface adhesion molecules that mediate interactions between cells and the ECM. Members of the β1 integrin subfamily are known to primarily bind to collagens, fibronectins, and laminins. We found that statins suppress cell adhesion to type I collagen, type IV collagen, fibronectin, and laminin. Furthermore, statins significantly inhibited the mRNA and protein expressions of integrin αlaminins . These fActivation of Rho could lead to the activation of LIMK and MLC . These sPrevious studies have shown that Rho pathway components are potential therapeutic targets for tumor progression and metastasis . Farina In the present study, the treatment of B16BL6 cells with 0.05 μM fluvastatin or 0.1 μM simvastatin for 3 days in vitro. The peak plasma concentrations of fluvastatin or simvastatin achieved with standard doses were ≤1 μM or 2.7 μM, respectively ,45. ThesWe also observed that statins inhibit lung metastasis when administered orally. Fluvastatin or simvastatin are usually administered orally at daily doses of 20 to 80 mg or 5 to 40 mg in patients with hypercholesterolemia. Importantly, the dosage of statins orally administered to patients with hypercholesterolemia would have prophylactic effects against metastasis. This data indicates that statins may be therapeutically useful for the treatment of a variety of tumors.In conclusion, our data show that statins inhibit tumor cell migration, invasion, adhesion, and metastasis through the suppression of the Rho/ROCK pathway. These findings suggest that statins are potentially useful as anti-metastatic agents for the treatment of melanoma.The authors declare that they have no competing interests.YK and MT carried out animal experiment, cell viability assay, boyden chamber assay, invasion assay, statical analysis, and drafted the manuscript. YY, KS, HN, MO, and MI carried out collagenase activity aasay, RT-PCR, and western bolotting analysis. JN participated in animal experiment. YT and MY participated in boyden chamber assay and invasion assay. TS and TI contributed to animal experiment and statistical analyses. SN designed the experiments and revised the manuscript. All authors read and approved the final manuscript.

Objective: To determine the prognostic value of patient and treatment parameters in osteosarcoma, and whether these areequally important across international boundaries. Design: Retrospective, cross-sectional study of 428 patients diagnosed with around-knee osteosarcoma, between 1990 and1997 in Birmingham, UK, and Bologna, Italy. Disease-free survival (DFS) and overall survival (OS) assessed by Kaplan–Meier,Fisher's PLSD and Cox proportional hazard regression. Results: Five-year DFS and OS were 56 and 73% at Centre 1, compared to 43 and 60% at Centre 2 . The most important bad prognostic factors for DFS and OS respectively were raised alkalinephosphatase at diagnosis (P=0.002 and P=0.003), tumour necrosis < 90% following chemotherapy (P=0.001 andP = 0.004) and volume > 150 cm3 at diagnosis (P=0.04 and P=0.006). The most significant combination of bad prognosticfactors was alkaline phosphatase and tumour necrosis. A total of 73% of patients at Centre 1 had greater than 90% necrosisof the tumour following neoadjuvant chemotherapy compared with 29% at Centre 2. Conclusions: Tumour-based prognostic factors have similar significance across international boundaries. Chemotherapyeffectiveness appears to be a major factor in explaining the survival difference between the two centres.

The purpose of this article is to present a rare case of localized, solitary amyloid tumor of tongue base and emphasize some of the characteristic features of challenging clinical and histopathologic diagnosis. In this paper, we focused on the clinical and pathological specifications of this rare tumor, so any unnecessary examinations or measures may be spared. Negative staining of amyloid material with AAC and osseous metaplasia noted in the histopathologic examination may not be thought as definite criteria for localized amyloidosis, but a supporter of localized, solitary amyloid tumor diagnosis. Amyloid can affect any site in thehead and neck including the orbit, sinuses, oral cavity, salivary glands,pharynx, and larynx. Amyloid involvement of tongue is almost always secondaryto systemic amyloidosis and localized involvement is extremely rare , 2.The etiology, treatment, andoutcome of systemic amyloidosis are totally different from localizedamyloidosis. The mean survival of patients with systemic amyloidosis is between5 to 15 months, whereas patients with localized amyloidosis have excellentprognosis [To rule out a systemic amyloidosisfor these patients is extremely critical because this can markedly change theexpected morbidity and mortality . AbdominThe purpose of this article is topresent a rare case of localized, solitary amyloid tumor of tongue base andemphasize some of the characteristic features of challenging histopathologicdiagnosis.A 61-year-old male patientpresented with pyrosis of tongue and a nodular mass in tongue base. Head andneck examination revealed a 1 × 1 cm well-circumscribed, rubbery, nodular massat the right side of the tongue base. His review of systems was negative forsymptoms including fever and weight loss.A computed tomography was performedand a possible granulomatous or inflammatory mass with calcification wasreported . An inciRough and irregular mass, 2 cm in diameter, was dissected from surrounding normal tissue withminimal tissue loss and enbloc excision could be achieved via transcervical suprahyoid approach.Postoperative microscopic examination of the specimenrevealed a well-circumscribed submucosal lesion characterized withstructureless eosinophilic material deposition. Overlying mucosa was inflamed and focally eroded. The amorphous, more orless homogenous eosinophilic materialresembled amyloid histologically and on Congo red staining, exhibited the classical apple-greenbirefringence under polarizedlight. Deposits of amyloid were also found in and around the walls of smallblood vessels. Immunohistochemical examination of the matrix with monoclonalantibody AA-Congo (AAC) revealed a non-AA-type amyloid deposition . At theDiagnostic workup includingcomplete blood count, liver and renal function tests, urine analysis,esophagography, chest X-ray, electrocardiography, echocardiography, bone-marrowbiopsy, ESR, RF, ANA, and abdominal fat biopsy was carried out.All examinations for exclusion ofsystemic amyloidosis, including bone-marrow and abdominal fat biopsies, werefound to be negative for Congo red staining and amyloid deposition. Bone-marrowaspiration biopsy was found to be free of any type of infiltrations. Thus, thepatient was determined to be free of systemic amyloidosis and diagnosed aslocalized, solitary amyloid tumor of the tongue base.Annual examinations were performed inthe four-year follow-up period.The differential diagnosis of the mass in tongue base includesneoplastic processes and also lingual thyroid. Because the mass was settledunder normal appearing mucosa, a preoperative incisional biopsy was performedin order to rule out thyroid tissue and malignancy. We could not achieve adefinitive pathology with preoperative biopsy so we planned total excision ofthe mass.When amyloidosis is the histopathologic diagnosis in the patientspresenting with a localized mass in head and neck region, the main diagnosticdilemma of the surgeon becomes the extension of the disease. Many diagnosticexaminations were proposed to rule out a systemic disease. Histopathologicexaminations of these lesions may help clinicians about the necessity of thediagnostic examinations. Amyloid tumor of tongue base is a rare condition andmay not be predicted preoperatively, therefore there is little information onthe clinical and histopathologic features of the disease. In this paper, wefocused on the clinical and pathological specifications of this rare tumor, soany unnecessary examinations or measures may be spared and patient may beinformed clearly about the disease.Also, in the literature there is no consensus on terminology of thedisease. We did not prefer to use the term “localized amyloidosis of tonguebase” for this disease because diffuse involvement of tongue with systemicamyloidosis may be mistaken with well-circumscribed amyloid tumor. The terms“localized primary amyloid tumor” and “solitary amyloid tumor” were both usedfor localized amyloid deposits without systemic amyloidosis or multiple myelomain the literature, and better distinguish from the systemic form and betterdefines the disease. So we decided to use the term “solitary amyloid tumor” forthe diagnosis after ruling out systemic involvement of the disease because itbriefly underlines the nature of the disease.The definitive treatment oflocalized amyloidosis was cited to be surgery. Surgery alone may be 100%curative [Although, negative staining withAAC and osseous metaplasia which is noted in histopathological examinationsupports non-AA-type amyloidosis, we performed these examinations to supportour diagnosis. Negative staining of amyloid material with AAC is mostly seen inprimary type of amyloidosis. Also, osseous metaplasia noted in the histopathologicexamination may not be thought as definite criteria for localized amyloidosis, but a supporter oflocalized, solitary amyloid tumor diagnosis. There is data about osseousmetaplasia in the literature regarding the solitary amyloid tumor of other tissues, and to A submucosal, surgically well-defined,well-circumscribed, and rubbery mass in tongue base with calcifications onradiologic studies may not be surgically differentiated from other tumors oftongue. When histopathology reveals amyloid deposits on light microscopy, theseclinical findings may come out as important features in order to differentiatelocal disease from involvement of tongue by a systemic disease.With this little informationregarding the clinical and histopathologic features of localized, solitaryamyloid tumor of tongue base, we may not discuss the necessity of theexaminations in order to rule out systemic disease including abdominal fat andbone-marrow biopsy. Therefore, the publication of more cases or series of thedisease may yield better characterization of the histopathologic, radiologic,and clinical features of solitary amyloid tumor of tongue base.

Objectives. We determine the prevalence of the metabolic syndrome in an urban population of Zanjan, a province located to the west of Tehran. Methods. Randomly selected adults >20 years were studied using stratified sampling. Target study sample was 2941 . Metabolic syndrome was diagnosed using Adult Treatment Panel-III (ATP-III) guidelines when any three of the following were present: central obesity, raised triglycerides ≥150 mg/dl, low high-density lipoprotein (HDL) cholesterol, blood pressure ≥ 130/ ≥ 85 mm Hg, and diabetes or fasting plasma glucose (FPG) ≥ 100 mg/dl. Results. Metabolic syndrome was present in 697 (23.7%) subjects , prevalence was 23.1% in men and 24.4% in women (P : .4). The prevalence increased from 7.5% in the population younger than 30 y to 45.6% in ages more than 50 years. Low HDL was the most common metabolic abnormality in both sexes. Most of those with metabolic syndrome had three components of the syndrome (75.6%), 170 subjects (24.4%) had four and none had five components simultaneously. The prevalence of obesity (BMI ≥ 30 kg/m2), hypercholesterolemia (≥200 mg/dl) and high LDL cholesterol (≥130 mg/dl) was greater in the metabolic syndrome group than normal subjects (P = .00). Conclusions. There is a high prevalence of metabolic syndrome in this urban population of the northern west of Iran. Focus of cardiovascular prevention should be undertaken in this area. The name of metabolic syndrome has been considered for the clustering of some cardiovascular risk factors from 1988 , 3. ThisThis study analyzed data from a cross sectional study , conducted by the Zanjan University of medical sciences between 2002 and 2003 in Zanjan, the capital of the Iranian province of the same name. The main ethnic groups living in the province are Azeries (Turks) and Kurds. In the original study the anthropometric parameters, nutritional status and cardiovascular risk factors in the population of Zanjan was assessed. A stratified, multistage random sampling was used and a total of 4000 subjects aged more than 15 years were enrolled in the study. We excluded 723 subjects for whom some information was missing and 336 people aged less than 20 years. The remaining subjects were 2941 subjects including 1396 men and 1545 women. Subjects completed a questionnaire which included dietary habits, past medical history, smoking status, physical activity, and educational levels.All the subjects received oral information concerning the study and gave their written consent. The study was approved by the Ethical Committee of Zanjan University of medical sciences.In the original study Waist circumferences between the lowest rib and the iliac crest at the level of umbilicus were measured in duplicate to the nearest mm with flexible tape. Blood pressure was measured sitting with a random zero sphygmomanometer. Systolic (Korotkoff phase I) and diastolic (Korotkoff phase V) blood pressure was measured twice on the left upper arm and the average used for analysis. Average systolic blood pressure more than 130 mmHg or diastolic blood pressure more than 85 mmHg or current use of antihypertensive medications was defined as hypertension.Laboratory measurements were done at the laboratory of Zanjan University of medical sciences, Valie-e-sasr Hospital. Plasma glucose was measured by the glucose-peroxidase colorimetric enzymatic method with a sensitivity of 5 mg/dl and intra-assay coefficients of variation (CV) I.7% in lower limit and 1.4% in upper limit concentrations. Inter-assay CV for the assay was 1.1% in lower limit and 0.6% in upper limit concentrations. Fasting plasma glucose (FPG) more than 100 mg/dl was defined abnormal in this study.Serum Cholesterol and Triglyceride of all the participants were measured after 12–14 hours of fasting with colorimetric method with a sensitivity of 5 mg/dl. Intra-assay and inter-assay CV for the assay was 1.6% and 1.1% in lower limit and 0.6% and 0.9% for upper limit concentrations respectively. High-density lipoprotein cholesterol (HDL-C) was measured after precipitation of the apolipoprotein B-containing lipoproteins with phosphotungstic acid .Hypertriglyceridemia was defined as triglyceride (TG) concentration more than 150 mg/dl. HDL Cholesterol less than 50 mg/dl in females and less than 40 mg/dl in males was considered to be abnormal.In this study, subjects with three or more of the following five risk factors of the criteria of the modified NCEP III were defined as having metabolic syndrome: (1) triglycerides ≥150 mg/dl, (2) HDL cholesterol <40 mg/dl in men and <50 mg/dl in women, (3) systolic blood pressure ≥130 mmHg or diastolic blood pressure ≥85 mmHg, (4) fasting plasma glucose ≥100 mg/dl and (5) Truncal obesity (waist circumference more than 102 cm in men and >88 cm in women). Subjects with a history of hyperlipidemia, hypertension, or diabetes were considered to have the risk factor, regardless of the biochemical or clinical values.x2 test. Logistic regression analysis was used to detect the value of variables such as body mass index (BMI) and hypercholesterolemia to predict the existence of metabolic syndrome. The analysis was done with SPSS 11.5 software package. P value of < .05 was considered statistically significant.The data are presented as frequencies, percentages, and 95% confidence intervals. The prevalence of different abnormalities was compared using P : .001). The prevalence of metabolic syndrome was the same in women and men (P = .4). There was a significant age-related increase in the prevalence of metabolic syndrome in both of the genders. Prevalence of metabolic syndrome increased from 7.5% within the 20–29-year-old group to 44.7% in people more than 60 years of age. The prevalence of individual components of the metabolic syndrome is reported in 2) was detected in 1068 (36.3%) and obesity (BMI => 30 kg/m2) was observed in 437 subjects (14.8%).The prevalence of the metabolic syndrome in the study population was 23.7% . Except for hypertension and hypertriglyceridemia, all abnormalities were more common in women than in men (P : .00). Most of those with metabolic syndrome had three components of the syndrome (75.6%), 170 subjects (24.4%) had four components. None of the people had five components.Low HDL-C was the most common metabolic abnormality in both sexes. Mean serum HDL-C was 36.9 ± 5.3 mg/dl in those with the metabolic syndrome and 46.7 ± 6 mg/dl in normal individuals without any risk factors . In females high LDL-C was detected in 19.6% versus 58% in normal subjects and those with metabolic syndrome respectively (P : .00).Within the 20–29-year-old group of the general population, 13.4% had no abnormality , while this figure dropped to 3.4% in people above 60 years of age . Totally 13.3% of males and only 3.4% of females had no cardiovascular risk factor in the population.The results of this study indicate that according to ATP III criteria, 23.7% of the studied adult population has metabolic syndrome. Since the study population is representative, the findings can be generalized to the whole urban population of the northern west of Iran.The prevalence of MS varies considerably worldwide. Some of the differences in the prevalence of MS might arise from varied definitions of the syndrome. For instance, Trevisan et al. reported Although the prevalence of the metabolic syndrome in this study is higher than some previously reported from the USA, Italy, and Finland , 10, 12,The exact reasons for high prevalence of MS in our study remain to be determined, but it is evident that substantial socioeconomic changes have occurred in the population over the past decades and the transition from a traditional to a western-like urban lifestyle has been associated with adverse changes in lifestyle habits. Based on the results of a national profile of non-communicable disease risk factors in Iran, 2005 fiber inIn our study the single most common abnormality was low HDL-C , which is more than what had previously been reported from USA , Turkey A positive effect of age on the prevalence of the syndrome in both sexes was detected in this study and resulted in 45.5% of MS in subjects more than 50 years. This effect has been reported in other studies , and an In conclusion the present study from the northern west of Iran demonstrated that MS is a serious problem among the urban populations of this country affecting primarily older individuals. Since the Iranian population, composed mainly of those less than 30 years old, it is very likely that the prevalence of MS will be even greater in the next decades. The prevention and treatment of this condition is of major public concern and urgently requires the application of appropriate policies and considerable investment.

Metastatic tumour cells are characterised by acquisition of migratory and invasive properties; properties shared by cells, which have undergone epithelial-to-mesenchymal transition (EMT). Disabled-2 (Dab2) is a putative tumour suppressor whose expression has been shown to be downregulated in various cancer types including breast cancer; however, its exact function in suppressing tumour initiation or progression is unclear.Disabled-2 isoform expression was determined by RT–PCR analysis in human normal and breast tumour samples. Using shRNA-mediated technology, Dab2 was stably downregulated in two cell model systems representing nontumourigenic human mammary epithelial cells. These cells were characterised for expression of EMT markers by RT–PCR and western blot analysis.β (TGFβ) signalling loop, concomitant with increased expression of the TGFβ2 isoform.Decreased expression of the p96 and p67 isoforms of Dab2 is observed in human breast tumour samples in comparison to normal human breast tissue. Decreased Dab2 expression in normal mammary epithelial cells leads to the appearance of a constitutive EMT phenotype. Disabled-2 downregulation leads to increased Ras/MAPK signalling, which facilitates the establishment of an autocrine transforming growth factor β-stimulated EMT, and therefore increase the propensity for metastasis.Loss of Dab2 expression, commonly observed in breast cancer, may facilitate TGF Breast cancer remains the most prevalent form of cancer diagnosed and the second-leading cause of cancer deaths in women. The ultimate cause of death in breast cancer is generally not because of the primary tumour itself, but rather from metastatic spread of the tumour. Metastasis is a coordinated process, which involves intravasation of tumour cells from the primary site into the circulation, followed by extravasation and establishment of a secondary tumour in a target organ .β (TGFβ) cytokine family has emerged as a key inducer of EMT in both developmental and pathological settings or deleted in ovarian carcinoma-2 is a putative tumour suppressor first identified in a screen for transcripts downregulated in ovarian tumours tumours . In humamours and 1 × antibiotic/antimycotic solution . HME5-cdk4 cells (−1 bovine pituitary extract (Invitrogen), 20 ng ml−1 EGF, 10 μg ml−1 insulin, 0.5 μg ml−1 hydrocortisone and 1 × antibiotic/antimycotic solution. Recombinant human TGFβ1 was obtained from R&D Systems and reconstituted as suggested. SB431542 was purchased from Sigma and U0126 was purchased from Calbiochem .MCF10A1 cells were obtained from the Barbara Ann Karmanos Cancer Center and cultured in DMEM/F12 media containing 5% equine serum , 20 ng mlμg ml−1 polybrene (Sigma-Aldrich), followed by selection in media containing 1 μg ml−1 puromycin (Gemini Bioproducts). Stable pools of cells expressing the various constructs were maintained in their respective media with puromycin.Nucleotide sequences were chosen for stable ablation of human Dab2 using shRNA-mediated technology beginning at nucleotides 600 and 1060 (sh599-F 5′-GCAACAGGCTGAACCATTA-3′ sh1059-F 5′-TCGACACCTTCTTCGTTTG-3′), based on Genbank accession U53446. DNA oligos were synthesised (Invitrogen), annealed and inserted into pSIREN-retroQ according to manufacturer's instructions. Following sequence validation , negative control (provided by Clontech) and shDab2 constructs were cotransfected along with pCL-10A1 into 293T packaging cells. Retrovirus was harvested from the media after 48 h and used to infect parental cells in the presence of 8 M Tris, pH 7.5, 1%, Triton X-100, 10% glycerol, 137 mM NaCl, 2 mM EDTA, 25 mMβ-glycerophosphate, 20 mM Na3VO4 and COMPLETE EDTA-free protease inhibitor mixture; Roche Diagnostics, Indianapolis, IN, USA), sonicated and protein concentrations were measured using Bio-Rad Protein Assay Dye Reagent Concentrate . Equal amounts of protein were resolved on SDS–PAGE gels, transferred to PVDF membranes and subjected to western blot analysis. For immunoprecipitation, lysates were pre-cleared with protein G-Sepharose , after which primary antibody (1 μg) was added. After 4 h, protein G-Sepharose beads were added for an additional 2 h. Following five washes with modified RIPA buffer , immunoprecipitated proteins were eluted with 2 × Laemmli sample buffer and subjected to SDS–PAGE and western blot analysis. Blots were developed using enhanced chemiluminescence and visualised by autoradiography. The following antibodies were used for western blot analysis and immunoprecipitation: Dab-2/p96 (610465) and N-cadherin (610921) from BD Transduction Laboratories ; p-ERK (sc-7383), ERK2 (sc-154), Grb2 (sc-255), HSP90 α (sc-7947), Sos (sc-17793) and Vimentin (sc-5565) from Santa Cruz Biotechnology .Whole cell extracts were prepared by lysis in buffer D , diluted and qPCR was performed for the indicated genes in triplicate using gene specific primers and SYBR Green detection (Roche Diagnostics) on an Applied Biosystems 7900 HT Fast System using the following cycling parameters: 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. After normalisation to β-actin, relative mRNA levels were quantitated by the ΔΔCt method. Transcript quantitation levels are expressed relative to that observed in untreated cells, which was set to 1.0. Shown is the mean±s.d. from an individual experiment; individual experiments were conducted a minimum of three times. Primer sequences used for qPCR analysis are provided in Total RNA was purified using the Qiagen RNeasy Mini Prep Kit according to manufacturer's instructions. Using 1.0–2.5 Determination of p96 and p67 isoform expression levels in normal and breast tumour samples was performed utilising the Human Breast Cancer Rapid-Scan Panel (Origene) according to manufacturer's suggestions and performed in duplicate using the two individual plates provided. Disabled-2 PCR was performed on cDNA samples arrayed at 1000 × concentration, whereas actin PCR was performed on samples arrayed at 1 × concentration using primers provided by the manufacturer. Primers for Dab2 isoform discrimination were as follows: forward 5′-GGGAGTGAGGCCCTAATGATT-3′ and reverse 5′-GTTCTGAGACGGGAGGAGCAAAG-3′. Reactions were analyzed by gel electrophoresis in 1% agarose gels containing ethidium bromide and visualised by UV transillumination. Images were captured using the Kodak EDAS 290 Electrophoresis Documentation and Analysis System .in situ (DCIS) sample (No. 11). The presence or absence of Dab2 mRNA expression does not appear to correlate with levels of expression of either the oestrogen or progesterone receptors as determined by the manufacturer or a MEK1 inhibitor (U0126), in the presence or absence of exogenous TGFβ for 48 h. Treatment of M1 Neg cells with SB431542 led to loss of TGFβ-stimulated induction of N-cadherin mRNA and protein expression, whereas treatment with U0126 led to a significant decrease in TGFβ-mediated induction of protein expression only cell line, derived from a patient undergoing breast augmentation, which possesses an extended of cdk4 leads to of cdk4 . In addill lines .β signalling exerts potent growth–inhibitory effects in normal epithelial cells; however, late in tumour progression, TGFβ has been shown to cooperate with other pro-oncogenic pathways to support tumour progression, which may be due to the ability of TGFβ to stimulate EMT of primary breast tumours, whereas overall 74% (67 out of 91) of breast tumours analyzed displayed decreased Dab2 protein expression, leading the authors to suggest that Dab2 promoter hypermethylation is an infrequent cause for loss of Dab2 expression in breast cancer (β treatment has long been known to lead to activation of MAPK signalling; however, until recently the mechanism by which activation of the TGFβ receptors led to activation of Ras remained unclear. βRI binds and phosphorylates ShcA proteins on tyrosine and serine residues, which induces the recruitment of Grb2 and Sos to TβRI, and hence activation of Ras, Raf and ERK. Here, we show that TGFβ stimulation leads to increased Grb2/Sos association (β-stimulated Ras/ERK signalling by shifting the levels of Grb2 available for binding to ShcA. Alternatively, the p96 isoform of Dab2, through its role as an endocytic adaptor molecule (β receptors to clathrin-coated pits. Athough the TGFβ receptors have been shown to reside in both clathrin-coated pits and lipid raft compartments of the cell membrane (β-stimulated MAPK activation and EMT, but not TGFβ-mediated phosphorylation of Smad2/3 (β receptors to lipid raft compartments leading to increased MAPK signalling and EMT.TGFociation . As it hmolecule , may dir Smad2/3 . Loss ofβ signalling pathways has been postulated to be important for induction and maintenance of stable EMT. In mouse EpH4 cells, expression of oncogenic Ha-ras was required for the cells to undergo EMT in the presence of TGFβ (β was shown to trigger sustained induction of EMT leading to repression of E-cadherin (β and establishment of an autocrine TGFβ signalling loop, which is consistent with the finding that blockade of MAPK signalling or blockade of TGFβ signalling decreases the EMT phenotype in Dab2 knockdown cells. Loss of Dab2 expression may thus supply activation of the Ras pathway in breast cancer, which along with other genetic changes, leads to the development of the aggressive and basal subtype of breast cancer.Cooperation between the Ras/MAPK and TGFcadherin . We showcadherin and 5, rβ has been shown to induce EMT in culture, individual isoforms have been shown to have distinct roles in regulation of EMT in developmental processes. During heart development, it was found that TGFβ2, but not TGFβ1 or TGFβ3, mediated cardiac cushion EMT, which is important for cardiac valve formation (β3, on the other hand, is required for induction of EMT in medial-edge epithelial cells, important for palate cleft fusion (β1 was found to be associated with a higher occurrence of distant metastasis (β2 isoform, whereas expression of TGFβ1 and TGFβ3 isoforms are also stimulated to a lesser extent (β2 promoter, which leads to increased promoter activity, was shown to be associated with lymph node metastasis (β2 isoform may contribute to breast cancer metastasis through induction of EMT in mammary epithelial cells.Although treatment of cells with all three isoforms of TGFr extent and 5. Iβ2 and constitutive EMT (β signalling. As global targeting of TGFβ signalling may not be desirable because of its function as a tumour suppressor in normal epithelial cells, strategies targeting TGFβ2 isoform expression may provide the specificity required to block only the pro-metastatic functions of the TGFβ signalling pathway. A further understanding of pathways modulated by Dab2, as well as the control of Dab2 expression itself, may thus provide additional targets for intervention in the metastatic process.In conclusion, we show here that downregulation of Dab2, which is commonly observed in breast cancer, can lead to enhanced Ras/MAPK signalling, increased expression of TGFtive EMT . Breast

The cytokines released from Th2 and Th2-like cells are likely to be central to the pathophysiolgy of asthma and allergy, contributing to aberrant IgE production, eosinophilia and, perhaps, mucosal susceptibility to viral infection. IL-4 has emerged as a central target, not only for B cell IgE production, but also in the commitment of both CD4+ and CD8+ T cells to cells with Th2 effector function capable of secreting IL-5 resultlng in eosinophilic inflammation. In view of the central role of this cytokine and the evidence that glucocorticoids are unable to modify many IL-4 dependent effects, Th2 inhibitors may prove to be novel therapies for the treatment of bronchial asthma.

Archaea, where the order, family, and even a genus designation have become obsolete, and the naming and renaming of certain species has led to much confusion in the scientific community.The consistent use of the taxonomic system of binomial nomenclature (genus and species) was first popularized by Linnaeus nearly three-hundred years ago to classify mainly plants and animals. His main goal was to give labels that would ensure that biologists could agree on which organism was under investigation. One-hundred fifty years later, Darwin considered the term species as one of convenience and not essentially different from variety. In the modern era, exploration of the world's niches together with advances in genomics have expanded the number of named species to over 1.8 million, including many microorganisms. However, even this large number excludes over 90% of microorganisms that have yet to be cultured or classified. In naming new isolates in the microbial world, the challenge remains the lack of a universally held and evenly applied standard for a species. The definition of species based on the capacity to form fertile offspring is not applicable to microorganisms and 70% DNA-DNA hybridization appears rather crude in light of the many completed genome sequences. The popular phylogenetic marker, 16S rRNA, is tricky for classification since it does not provide multiple characteristics or phenotypes used classically for this purpose. Using most criteria, agreement may usually be found at the genus level, but species level distinctions are problematic. These observations lend credence to the proposal that the species concept is flawed when applied to prokaryotes. In order to address this topic, we have examined the taxonomy of extremely halophilic Bacillus halobius ruber", aware that these bright vermillion halophilic microbes were not spore formers, but his isolate was subsequently lost. A dozen years later, halophilic isolates thought to be similar to Klebahn's, were named "Bacterium halobium" by Petter in the Kluyver laboratory in Delft, Holland [Halobacterium halobium, H. salinarium, and H. cutirubrum [Bacillus to Bacterium to Halobacterium reflected the increasing sophistication of our knowledge of the microbial world during this period, and these changes were generally accepted by the scientific community. In the modern era, there have been many more proposals for taxonomic revisions among these halophiles, some of which have been readily acceptable, and others that have since been challenged or refuted [An important challenge in the classification of microorganisms is ensuring that scientists can follow the pedigree of isolates in the literature. This laudable goal is however especially difficult to achieve for microbes that have a long history and where variants have been isolated and re-isolated from an abundance of niches in the laboratories of many different investigators. For example, the group of extremely salt-loving halophilic microbes which produce red, pink, and purple hues in hypersaline ponds used to make salt from the sea, were among the earliest microorganisms to be recognized and described. They were, not surprisingly, originally identified as agents of food spoilage, before the advent of refrigeration when salting was widely used for preserving fish and meats . Some ea Holland . In the tirubrum . Many of refuted ,6.Archaea from halophilic Bacteria became apparent in the 1970's through the molecular phylogenetic work of Woese, who proposed the three-domain view of life. While halophilic microorganisms represented many different taxonomic groups in the bacterial domain, those in the archaeal domain fell into a single order and family [Bacteria and halophilic Archaea. In order to clarify the definitions, we propose that the term halobacteria be reserved only for halophiles that are members of the bacterial domain, while haloarchaea be used only for halophiles that are members of the archaeal domain. In addition, on a taxonomic level, the order Halobacteriales should be designated as Haloarchaeales and the family Halobacteriaceae should be as Haloarchaeaceae. Finally, the Halobacterium genus would be better named Haloarchaeum to reflect its membership in the archaeal rather than the bacterial domain. These revisions would help update the taxonomy and terminology of halophilic microorganisms to be consistent with our current understanding of the microbial world.Among extremely halophilic microorganisms, the distinction of halophilic Halobacterium , is considerably more complex. Over the past twenty-five to fifty years, this genus witnessed a contraction in the number of recognized species from over a dozen to just a single species. While some acquired new genus designations , in 1990, Grant and Larsen proposed combining three common species, Halobacterium halobium, H. salinarium, and H. cutirubrum, into a single one, H. salinarium [halobium predated salinarium in the literature and, by convention, the former name should have taken precedence over the latter. To complicate matters further, in 1996, Ventosa and Oren proposed renaming of H. salinarium to H. salinarum [i", in their opinion, for linguistic reasons. However, many investigators dissented and continued to use the original species designations. In Euzéby's List of Prokaryotic Names with Standing in Nomenclature [salinarium, is derived from the Latin adjective salinarius a um, meaning "of salt works", while salinarum is derived from salinae arum, meaning "salt works", and concluded that salinarium was indeed correct. There is no doubt that naming and renaming of these species has left the taxonomy of Halobacterium species in disarray in the literature and in the haloarchaeal community.While our proposed revision of haloarchaeal taxonomy is relatively simple, disentangling the taxonomy and pedigree within the original genus, linarium . Howeverlinarium . In partnclature , he repoHalobacterium isolate sequenced and also the most widely used haloarchaeal strain, which was published under the name H. halobium strain NRC-1 [Halobacterium sp. strain NRC-1", while its pedigree was being rigorously established and the relationships within this group of organisms fully clarified. However, despite the lack of appearance of definitive information on the identity of NRC-1, Gruber et al. [H. salinarum' species. In so doing, these authors ignored a variety of differences between strains, including their own pulsed-field gel patterns, as well as variations in restriction maps of the unstable resident megaplasmids. Overreliance on phylogenetic trees based on 16S rRNA sequences, some of which are already known to be divergent even within single haloarchaeal species [Perhaps the worst case of taxonomic ambiguity is for the first in NRC-1 . The oriin NRC-1 . Stocks in NRC-1 dropped r et al. publishe species , was a sHalobacterium isolates at the phylogenetic and taxonomic levels confirms the existence of serious complications. The 16S rRNA sequences vary in nearly all of the originally distinct species, with that of NRC-1 and H. salinarium differing in several positions. Differences also exist between the NRC-1 and H. halobium 23S rRNA sequences, as well as between NRC-1 and H. cutirubrum 5S rRNA. In fact, a recent publication even reported a major deletion in the 16S rRNA promoter region of 'H. salinarum' strain R-1 in comparison to strain NRC-1 and other similar strains [Halobacterium isolates is from the recent genotyping analysis of Cleland et al. using the DiversiLab repPCR system [Halobacterium strains in the ATCC collection show differences quantitatively similar to haloarchaea that are classified as different genera of the Halobacteriaceae family. Their examination of NRC-1 by this method isolates as a single species, especially without an existing consensus in the community on the definition of what constitutes a "species" among these organisms.Reexamination of the available data on strains . The mosHalobacterium strains have some clear-cut differences. An especially striking difference is the absence, in 'H. salinarum' (e.g. strain R-1), of gas vesicles, which are characteristic of Halobacterium sp. NRC-1. Gas vesicles permit NRC-1 to move vertically in the water column in response to oxygen, light, and temperature, and the corresponding expression of gas vesicle protein genes can be clearly seen in DNA microarray experiments [H. salinarum' indicates that these organisms exist in significantly different environments from NRC-1, with the latter inhabiting dynamic ones, and the former in more constant environments. This notable phenotypic difference is easily visible even to the naked eye. Some other Halobacterium species contain two different morphological types of gas vesicles in the same cell, those which are narrower and diagnostic of species inhabiting deep habitats, as well as those which are wider and found in shallow brines (like NRC-1), suggesting the widespread environmental distribution of these species. Examined more broadly, isolate-specific differences have been shown to exist at the level of antibiotic-resistance markers, measured cations in cells, and protein, lipid, and sugar content in the cell envelopes [At the phenotypic level, eriments ,18. The nvelopes .Halobacterium being studied in laboratories worldwide is also confounding. One example is the unclear relationship between NRC-1 and R-1, and another similar strain S-9, a purple membrane overproducer. While some investigators reported that NRC-1, R-1, and S-9, were very close relatives [Halobacterium species are reviewed by Grant and Larsen [The pedigree of the various strains of elatives , others elatives ,21. The elatives . Many add Larsen and Tindd Larsen . ClearlyThe incredible precision of the genomic era has empowered microbiologists with the genetic blueprints of more than a thousand microorganisms and allowed for the development of many new approaches for the interrogation of their biology. Unfortunately, studies of certain microbes, such as the haloarchaea, have been made exceedingly difficult by the arbitrary and unnecessary renaming of strains, poor record keeping of pedigree, and the lack of a universal definition of species. All of these shortcomings make it likely that future generations will not be able to fully interpret and utilize the current literature, ultimately diminishing the contributions of both past and present generations. While rigorous genetic studies and complete genome sequences are destined to make a permanent contribution to the field, taxonomic rearrangements based on inadequate experimentation and flawed logic hold it back. Although these points resonate especially true among the haloarchaea, we suspect that similar taxonomic issues and challenges are quite widespread among other prokaryotes as well and are deserving of further scrutiny.The authors declare that they have no competing interests.Both authors contributed to the development of the concepts and writing of the manuscript.

In recent years there has been a global increase in reports of disease affecting marine sponges. While disease outbreaks have the potential to seriously impact on the survival of sponge populations, the ecology of the marine environment and the health of associated invertebrates, our understanding of sponge disease is extremely limited.Rhopaloeides odorabile was purified using combinations of size exclusion and anion exchange chromatography. After achieving a 77-fold increase in specific activity, continued purification decreased the yield to 21-fold with 7.2% recovery (specific activity 2575 collagen degrading units mg−1protein) possibly due to removal of co-factors. SDS-PAGE of the partially pure enzyme showed two proteins weighing approximately 116 and 45 kDa with the heavier band being similar to reported molecular weights of collagenases from Clostridium and marine Vibrios. The enzyme degraded tissue fibres of several sponge genera suggesting that NW4327 could be deleterious to other sponge species. Activity towards casein and bird feather keratin indicates that the partially purified collagenase is either a non-selective protease able to digest collagen or is contaminated with non-specific proteases. Enzyme activity was highest at pH 5 and 30°C (the average ambient seawater temperature). Activity under partially anaerobic conditions also supports the role of this enzyme in the degradation of the spongin tissue. Cultivation of NW4327 in the presence of collagen increased production of collagenase by 30%. Enhanced enzyme activity when NW4327 was cultivated in media formulated in sterile natural seawater indicates the presence of other factors that influence enzyme synthesis.A collagenolytic enzyme suspected to enhance pathogenicity of bacterial strain NW4327 against the sponge Several aspects of the sponge disease etiology were revealed, particularly the strong correlation with the internal tissue chemistry and environmental temperature. This research provides a platform for further investigations into the virulence mechanisms of sponge pathogens. Reports of sponge disease are rapidly increasing with Mediterranean Rhopaloeides odorabileKnowledge of sponge disease dynamics is extremely limited. To date, only one study has confirmed Koch's postulates by verifying that an α -proteobacterium (strain NW4327) was the primary pathogen of the Great Barrier Reef sponge A stock culture of the bacterium NW4327 2, pH 7.8. Unless otherwise stated, 500 µl of the suspension was incubated with 500 µl of test sample at 37°C for 2 hours with shaking in a Jitterbug™ microtitre plate thermal shaker . The reaction was stopped by immersing the samples in ice for three minutes and the unreacted azocollagen was removed by centrifugation . Absorbance of the supernatant (200 µl) containing the azo-labelled peptidic digestion products was measured at 520 nm in a Synergy HT plate reader with increased absorbance values indicating higher collagenase activity.For rapid determination of collagenase activity the procedure described by Chavira and colleagues 2, pH 7.8. An aliquot (300 µl) of the reaction mixture was withdrawn, 60 µl of 0.05 M EDTA added and chilled in ice to stop the reaction. 400 µl of ninhydrin reagent For sensitive determination of ultra-low collagenase activity in the chromatography fractions and calculation of collagen digestion units (CDU) the following procedure was employed: collagenase or test sample (500 µl) was incubated for 5 hours with bovine Achilles tendon collagen (500 µl) (Sigma-Aldrich) dissolved in 50 mM Tris HCl with 1 mM CaClMicrobial growth was measured by quantifying either extracellular protein in the media or intracellular protein released after sonication. Intracellular protein was measured after pelleting a 1.0 ml aliquot of cultures using centrifugation, resuspending cells in deionised and purified water (1.0 mL) and then sonication at 50 kHz in 5 sec pulses for 5 min using a Cole Parmer Model 130W ultrasonic processor. Protein concentrations were measured using the Bio-Rad Protein Assay according to the manufacturer's protocol which is based on the method of Bradford The crude culture filtrate was ultrafiltered through a 50 kDa ultrafiltration membrane at room temperature (∼22–24°C) and the retentate used for chromatography. Ultrafiltration was conducted in an Amicon Model 52 stirred ultrafiltration cell with pressure applied using high purity nitrogen gas .2, pH 9.0, −1 with fractions collected every 13 min.The ultrafiltration retentate was applied to a 1×100 cm column packed with Superdex G200 which was eluted with 10 mM Tris HCl and 4 mM CaCl2, pH 8.5) and buffer B , at a flow rate of 1.0 ml min−1 with fractions collected every minute. The gradient profile was: 0–10 mins-100% A; 10–25 mins-100%A to 100%B; 25–30 mins-100%B; 30–35 mins-100%B to 100%A). The column eluate was monitored with a photodiode array (PDA) detector set at 280/254 nm. Collagenase activity was measured using the previously described and more sensitive ninhydrin method with active fractions pooled and concentrated by ultrafiltration through a 50 kDa membrane prior to analytical molecular size exclusion chromatography.Active fractions from the semi-preparative size-exclusion chromatography as determined using the rapid Azocoll assay were pooled and concentrated by ultrafiltration through a 10 kDa membrane . Portions (500 µl) of the concentrate were then applied to a Resource Q column (1×6 cm) attached to a Shimadzu Class VP HPLC system. Gradient elution was carried out between buffer A attached to the Shimadzu Class VP HPLC system with PDA detector set at 280/254 nm. The column was eluted with 10 mM Tris HCl with 4 mM CaClSDS-PAGE was performed in BioRad Criterion precast gels at a constant 200 V for 55 minutes. Initial staining was performed using LavaPurple Rhopaloeides odorabile spongin fibres was assessed by measuring its ability to degrade tissue fibres from other marine sponges. Material from Ianthella flabelliformis, Cacospongia sp., Ircinia sp. and Luffariella sp. was prepared by removing the non-fiber components by thorough rinsing with running tap water and homogenizing the remaining air-dried tissue in a Waring blender. Specificity was further assessed using commercial casein and gelatin (Sigma-Aldrich) and bird feather keratin obtained by homogenizing the vanes cut off from the central shaft of the moulted tail feather of the bush turkey (Alectura lathami). Since large amount of enzyme was required for these experiments and because of an observed loss of specific activity as the protein became more pure ethanesulfonic acid (MES)/50 mM Tris/50 mM acetic acid adjusted with tetramethylammonium hydroxide or HCl to the desired pH) was used to maintain a constant ionic strength and a constancy of the chemical nature of the buffers throughout this pH range Collagenase activity was measured using the sensitive ninhydrin protocol in the pH range 4.0 to 9.0. A three component buffer system was added to 50 ml of the pH adjusted Marine Broth solutions and sterilised in 250 ml Erlenmeyer flasks. The flasks were incubated in a rotary shaker at 28°C and 100 rpm for 48 h. Control flasks at the three pH values without added sponge tissue were included in the experiment.NW4327 was incubated in Marine Broth 2216 (Difco) prepared in autoclaved natural seawater collected from Davies Reef . The pH of the media was unadjusted and the composition was actually 2x seawater . Cultivation was also attempted in Marine Broth where the pH was adjusted to 5.0, 7.0 or 9.0 prior to autoclaving. In order to test the effect of sponge tissue on growth and collagenase production, fibrous Partially anaerobic conditions were created by flushing the 250 ml Erlenmeyer flask containing 50.0 ml Marine Broth 2216 prepared in MilliQ water (pH 7.0) with nitrogen gas and adding FeS −1 protein) but specific activity decreased in subsequent steps down to 21-fold with 7.2% recovery, the specific activity being 2574.7 CDU mg−1 protein. This was despite an apparent decrease in complexity after cation exchange chromatography according to SDS-PAGE , shown in −1 to 1935±70.6 CDU ml−1. Replacing MilliQ water with natural seawater when formulating the growth media enhanced microbial growth by 20% and collagenase production by 30% at the end of the five day cultivation. Growth of the isolate NW4327 was observed at pH 5.0 and pH 7.0 but not at pH 9.0. A neutral pH favoured growth while adding sponge collagen almost doubled collagenase production. The enzyme was equally able to degrade all of the sponge fibres, gelatin, casein and bird feather under the described conditions.Assay pH affected the activity of the NW4327 collagenase with highest activity observed at pH 5.0 compared to pH 4 or pH 6 and above. Assay temperature also affected the activity of NW4327 collagenase with higher activity observed at 30°C compared to that at 20°C or at 40°C or warmer. Partially anaerobic conditions reduced growth of NW4327 by 25% and lowered the yield of collagenase from 5227±92.7 CDU mlCollagen is the major fibrous component of vertebrate extracellular connective tissue such as skin, tendon, blood vessels and bone and its importance to invertebrates is increasingly apparent Clostridium histolyticum, Streptomyces lavendulaeBacillus subtilisVibrio alginolyticusStreptococcus gordoniiThermoactinomycetes sp. Vibrio B-30 ATCC 21250 Vibrio vulnificus CYK279H E. coli JM83 True collagenase may cleave simultaneously across all three chains or attack a single strand of the collagen macromolecule. This contrasts with other collagenases which split collagen in its native triple-helical conformation at a specific site yielding fragments. Bacterial collagenases, often from pathogenic strains, differ from mammalian collagenases in that they attack many sites along the helix. Although the most studied is that from Clostridium histolyticum collagenase preparations possess varied degrees of purity C. histolyticum Strain JCM 1403 produced only a 116-kDa polypeptide with collagenase activity under the condition used, a 98-kDa gelatinase and other polypeptides with potent gelatinolytic activity remained in the preparation. The authors concluded that it was not possible to obtain C. histolyticum collagenase free of gelatinase and other nonspecific proteases either from commercial sources or from C. histolyticum cultures. Similar observations were made by Merkel and Dreisbach Commercially available R. odorabileVibrio vulnificus CYK279H E. coli JM83 Rhopaloeides odorabile due to the sponge's tissue conditions being optimum for the collagenase's activity. Similar to the observation of Merkel et al. Activity towards casein and bird feather keratin indicates that the partially purified collagenase may be a highly active protease. Enzyme activity was greater at pH 5.0, the internal tissue pH of Enhanced enzyme activity when the microorganism was cultivated in natural seawater suggests the presence of other factors not available in the Marine Difco 2216 medium influencing enzyme synthesis although an effect due to increased concentration of sea water salts in the natural seawater based media is also possible.In conclusion, during partial purification of the collagenase enzyme from the sponge pathogen NW4327, several aspects of the sponge disease etiology were elucidated; namely the strong correlation with the internal tissue chemistry and environmental temperature. This research provides a platform for further investigations into the virulence mechanisms of sponge pathogens.

Kikuchi-Fujimoto's disease (KFD), also called histiocytic necrotizing lymphadenitis, is a rare, idiopathic and self-limited condition usually characterized by cervical lymphadenopathy and fever, most often affecting young patients. Aetiology is unknown. Differential diagnosis includes mainly malignant lymphoma, tuberculous lymphadenitis and systemic lupus erythematosus (SLE), so early diagnosis is crucial. Pleuropulmonary involvement due to isolated KFD has been seldom reported.a 32-year-old man, on treatment for iatrogenic hypothyroidism, was admitted due to high grade fever and painful cervical lymphadenopathies. KFD was diagnosed by lymph node biopsy. Some days after admission the patient got worse, he developed generalized lymphadenopathy, bilateral pleural effusion and interstitial lung disease. All of them resolved with prednisone and after two years of following up he remains asymptomatic and without evidence of any other associated disease.Pleural effusion and interstitial lung disease are very uncommon manifestations of KFD. In our experience, treatment with oral prednisone was effective. Kikuchi-Fujimoto's disease (KFD), or histiocytic necrotizing lymphadenitis, was first described in Japan in 1972 as a self-limiting disease mostly affecting the cervical lymph nodes of young individuals, mainly females . OccasioRubella, Toxoplasma, parvovirus B19, Yersinia enterocolitica, Salmonella and Brucella. Serum antinuclear antibody (ANA) and rheumatoid factor were also negative. On admission, chest X-ray was clear in both lung fields and computed tomography of the neck, thorax and abdomen revealed only lymphadenopathy affecting bilateral cervical and one mediastinal lymph nodes at a dose of 1 mg/kg/day, with rapid improvement: the patient became afebrile on day 10, cervical and axillary swelling and tenderness began to decrease, dyspnoea disappeared and respiratory auscultation normalized. The daily dose of thyroxine was slowly increased by the endocrinologist. Prior to discharge, chest X-ray was normal. Tapering doses of prednisone were prescribed throughout the subsequent two months; all biochemical and haematological parameters normalized except for TSH, which reached normal values four months later. After two years of follow-up appointments the patient remains asymptomatic, physical examination and chest X-ray are absolutely normal and serum antinuclear antibodies remain negative.A 32-year-old Caucasian man, with a history of hyperthyroidism six months previous due to toxic multinodular goiter, treated with radioactive iodine, who developed iatrogenic hypothyroidism and on initiation of substitutive treatment, was admitted due to persistent fever 39-40°C), malaise and painful cervical lymphadenopathies that had been present for two weeks. Laboratory findings were as follows: haematocrit 34%, haemoglobin 12 g/dl, leukocyte count 3400/mm3 , platelet count 246000/mm3, erythrocyte sedimentation rate 63 mm/h , alanine transferase (ALT) 176 IU/L (0-40 IU/L), aspartate aminotransferase (AST) 89 IU/L (0-40 IU/L), alkaline phosphatase (AlkP) 176 IU/L (40-129 IU/L) and gamma-glutamyl transpeptidase (GGT) 657 IU/L (10-50 IU/L); serum lactic dehydrogenase (LDH) 1896 IU/L (240-480 IU/L), thyroid-stimulating hormone (TSH) 73 μIU/ml (0.27-4.2 μIU/ml) and thyroxine (T4) 0,25 ng/dl (NR:0.93-1.71). Blood cultures and serologic tests were found to be negative for human immunodeficiency virus (HIV), hepatitis B virus (HBV), hepatitis C virus (HCV), Epstein-Barr virus (EBV), cytomegalovirus (CMV), herpes simplex virus (HSV), 0°C, malaYersinia enterocolítica, Bartonella, Brucella, Entamoeba histolytica and Toxoplasma [KFD is a benign disease that usually resolves spontaneously within one to four months, affects all ethnic groups and is more common in young women , manifests as localized lymphadenopathy, usually in the cervical region, and is commonly associated with fever and leukopenia . The aetxoplasma ,8. On thxoplasma .The differential diagnosis of lymph node enlargement in patients with the clinical signs of KFD includes mainly tuberculous and other infectious types of lymphadenitis, and malignant lymphoma . The diaKikuchi-Fujimoto disease has occasionally been described in association with simultaneous SLE ,5, SjögrIn conclusion, pleuropulmonary involvement in patients with KFD has seldom been reported. We describe a patient with isolated KFD in whom bilateral pleural effusion and an interstitial lung pattern developed. Clinical and radiological responses to prednisone were excellent.The authors declare that they have no competing interests.AGZ has contributed providing the clinical data, he has performed the literature review and he has written the main manuscript. He was involved in revising the manuscript critically for important intellectual content, and gave final approval of the version to be published. JTG was involved in revising the manuscript critically for important intellectual content, making substantial contributions and gave final approval of the version to be published. PBG was involved in revising the manuscript critically, and gave final approval of the version to be published. MFM was involved in revising the manuscript critically, and gave final approval of the version to be published. LZD provided the histopathological figures. She was involved in revising the manuscript critically, and gave final approval of the version to be published. MUM provided the Computed Tomography images and was involved in revising the manuscript critically, and gave final approval of the version to be published.Written informed consent was obtained from the patient for publication of this case report and any accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2466/10/54/prepub

P < 0.05. Forty-four patients were enrolled in this study and their data were subjected to statistical analysis: 22 patients in both the groups were comparable with regard to demographic data, haemodynamic parameters and other vitals and were statistically non-significant (P>0.05). The duration of analgesia was significantly prolonged in Group II (P<0.05). The dose requirement for post-operative pain relief was also significantly lesser in Group II. The incidences of side effects were almost comparable and non-significant. A caudal block with 0.25% of isobaric ropivacaine combined with 2 µg/kg of clonidine provides efficient analgesia intra-operatively and prolonged duration of analgesia post-operatively.The aim was to determine qualitative and quantitative aspects of caudal block, haemodynamic effects, and post-operative pain relief of ropivacaine 0.25% versus ropivacaine 0.25% with clonidine for lower abdominal surgeries in paediatric patients. A double-blind study was conducted among 44 paediatric patients in the Department of Anaesthesiology and Intensive Care of our institute. A total of 44 ASA-I paediatric patients between the ages of 1 and 9 years, scheduled for elective hernia surgery, were enrolled in this randomised double-blind study. The caudal block was administered with ropivacaine 0.25% (Group I) and ropivacaine 0.25% and clonidine 2 µg/kg (Group II) after induction with general anaesthesia. Haemodynamic parameters were observed before, during and after the surgical procedure. Post-operative analgesic duration, total dose of rescue analgesia, pain scores and any side effects were looked for and recorded. All the results were tabulated and analysed statistically. The variables in the two groups were compared using the non-parametric tests. For all statistical analyses, the level of significance was In paediatric regional analgesia, caudal epidural technique is one of the most popular, reliable, safe and easy methods to administer and is therefore the commonly performed procedure for intra-operative and post-operative analgesia especially for sub-umbilical surgeries in young children. One of the main drawbacks of this technique is the short duration of analgesia even with the use of long-acting local anaesthetics like bupivacaine and ropivacaine. The succRopivacaine has been extensively used for regional anaesthesia in adults and older children and has 3Clonidine is an alpha-2 adrenoceptor agonist which was widely used as an antihypertensive in 70s and 80s and presently it has been increasingly used for sedation, premedication and as an adjuvant analgesic.10 The po11µg/kg) to that of ropivacaine 0.25% following caudal administration in children.The addition of clonidine as an adjuvant has allowed the use of lower concentration of the local anaesthetic for achieving the same level of anaesthesia but with a prolonged duration of analgesia which increases the margin of safety and reduces the incidence of unwanted motor blockades.–13 With After the approval from the institutional ethics committee, written informed consent of the parents was obtained. We enrolled 44 ASA-I children, 1–9 years of age, scheduled for elective lower abdominal surgery (hernia surgery) for this study. The study design was randomized and double blind; patients were randomly allocated according to a computer-generated randomisation. The sample size represented the population of 7–8 lakh in the vicinity of 35–40 km radius which the institution caters to. Exclusion criteria consisted of local infection at the caudal region, bleeding diathesis, pre-existing neurologic or obvious spinal diseases, and any congenital anomaly of the lower back.2) were observed and recorded. A good IV access was secured; an induction of anaesthesia was achieved with sevoflurane 8% and 60% nitrous oxide (N2O) in oxygen. All the patients were paralysed with injection atracurium 0.5 mg/kg and were intubated with an appropriate sized endotracheal tube. After securing the endotracheal tube, patients were turned to the left lateral position for the administration of caudal anaesthesia which was achieved with 23 gauge intravenous needle under all aseptic conditions and the patients were turned supine immediately after the injection. Group I (n = 22) received 0.25% ropivacaine, 0.5 ml/kg, while patients in Group II (n = 22) received 0.25% ropivacaine, 0.5 ml/kg, with an addition of 2 µg/kg clonidine via the caudal route with a total volume being constant at 0.5 ml/kg in both the study groups. The pin-prick method was used to assess the level of sensory anaesthesia and the variation in HR was chosen as the response variable to confirm the dermatomal level which was attained up to T-8 to T-9 level in almost all of the patients.Patients were given oral midazolam (0.3 mg/kg) as premedication approximately 1 h prior to arrival in the pre-operative room. All the baseline parameters like heart rate (HR), mean arterial pressure (MAP) and peripheral oxygen saturation , end-tidal CO2 concentration (EtCO2) and peripheral oxygen saturation (SpO2) were recorded before induction, after induction, after intubation and then after caudal anaesthesia and at 10-min interval thereafter. Any increase in MAP or HR of more than 15% from the baseline observations and values during the surgical procedure was taken out of the purview of haemodynamic stability attributable to caudal analgesia. An increase in HR or MAP within 10–15 min of the start of the surgical procedure was adjudged as failure of caudal anaesthesia, and rescue analgesia in the form of fentanyl was administered (2 µg/kg). Intravenous fluids were administered according to body weight and the fasting status in the form of Isolyte-P solution.The syringes for the study solutions were prepared by a senior resident of the anaesthesiology department who was given written protocols for drug preparation and was unaware of the patients and operation theatre team. Anaesthesia was subsequently maintained with sevoflurane (2–3%)–oxygen–N2, pain and sedation scores were recorded at a 10-min interval after extubation and thereafter at intervals of 1, 2, 4, 6, 8, 12, 18 and 24 h. A modified objective pain scale (OPS) was employed to assess the post-operative pain and duration of analgesia which was based on behavioural objectives that included crying, facial expressions, position of legs, position of torso and generalized motor restlessness. A score of 0 was considered as excellent analgesia while a score of 10 signifies completely ineffective analgesia. Children who had a pain score of more than 4 were administered 15 mg/kg of oral syrup of paracetamol. The total amount of the analgesic dose and any complication or side effects were looked for and recorded. All the patients were observed for next 24 h in the special rooms and the recordings of all parameters were done by a senior resident of Anaesthesiology and a well-trained staff. All the observations were recorded half hourly for the first 6 h and thereafter hourly till the next 18 h. The patients were discharged the next day and the parents were given phone numbers to contact in the case of any untoward incident. During the follow-up after 1 week, none of the parents complained of any side effects or untoward incident. The data from the two groups were subjected to statistical analyses with the help of non-parametric tests and P values <0.05 were considered statistically significant. Data are presented mainly as arithmetic means and standard deviations.At the end of the surgical procedure all the anaesthetic gasses were turned off and the patients were extubated in a fully awake condition. MAP, HR, SpOWe enrolled 44 children (22 children in each group) in our study profile. No difference could be detected from the data of 44 children regarding the patient demographics.The demographic profile of the patients in group I and group II was comparable with regards to age, weight and height and on statistical analysis no significant difference was found as is clearly evident from the 2 and SpO2 showed no statistical significant difference between the two groups (P>0.05). There was no statistically significant difference between the two groups regarding the duration of surgery or time to extubation from cessation of anaesthesia (P > 0.05). No significant hypotension or bradycardia was observed in any patient. SpO2 (>97%) was always within the clinically acceptable range in both the groups throughout the procedure (P > 0.05).P < 0.05). Total analgesic consumption was statistically higher in Group I (172 ± 80 mg) when compared with Group II (96 ± 72 mg) (P < 0.05). Six children required paracetamol administration once and 1 child required it twice in Group II as compared to 11 children requiring it once and 8 children requiring paracetamol twice in Group I (P < 0.05). Fifteen children in Group II and three children in Group I required no additional pain medication during the first 24-h study period, which was statistically significant (P < 0.05).It is quite clear from the As is evident from the P > 0.05) which is clearly evident from the description in The post-operative sedation scores showed no statistically significant difference (P>0.05). No any other untoward side effects were observed in either of the groups.µg/kg provides better postoperative analgesia compared to ropivacaine 0.25% alone.Clonidine is being increasingly used nowadays for potentiating the analgesic action of various local anaesthetics administered regionally. The main interest of our study was to evaluate the efficacy of caudal clonidine when combined with the 0.25% solution of ropivacaine. Despite the hernia surgery being a day care procedure we decided to keep the patients in special rooms in the hospital which were fully furnished to give a ‘feeling at home’ to the patients and to their respective parents. This was mainly done to obviate any bias or error in the findings of the study. The main finding of the present study is that a caudal bolus injection of a combination of ropivacaine 0.25% with clonidine 2 et al. had studied the effectiveness of caudal clonidine in potentiating the post-operative analgesic effect and found that in small children with a mean age of 3 years who underwent an elective day care surgery for hernia operations, the addition of clonidine 1–2 µg/kg to bupivacaine 0.25% significantly prolonged the median duration of analgesia and reduced the total dose of post-operative analgesics compared with bupivacaine alone or bupivacaine plus epinephrine 5 µg/ml (P<0.05).[et al. as post-operative analgesia was significantly prolonged in the patients receiving clonidine as an adjuvant to ropivacaine.The quest for finding the ideal combination of drugs for caudal anaesthesia in children is never-ending but the efforts to use the relatively safer drugs and that too in lower concentration are growing day by day. Ropivacaine is one such drug that appears to be associated with a greater safety margin and reduced systemic toxicity although such toxicity has been reported in adults following various regional anaesthetic techniques.15 Ropiva(P<0.05). The findClonidine given by the neuraxial route decreases the impulse generation by preganglionic sympathetic nerves. Similarly, the dominance of the parasympathetic nervous system results in an increased vagal tone which causes bradycardia. We did oµg/kg clonidine to caudal bupivacaine.[Clonidine causes dose-dependent post-operative sedation in children as demonstrated by Lee and his colleagues in their study on adding 2 ivacaine. In our sivacaine.Ropivacaine produces a lesser post-operative motor blockade as compared to bupivacaine when used in a lower concentration.22 There µg/kg) added to ropivacaine 0.25% offers an advantage over 0.25% ropivacaine alone for post-operative pain relief in children undergoing lower abdominal surgery, without increasing the incidence of adverse effects.We conclude that a single caudal injection of clonidine (2

To date, few studies address disparities in older populations specifically using frailty as one of the health outcomes and examining the relative contributions of individual and environmental factors to health outcomes.Using a data set from a health survey of 4,000 people aged 65 years and over living in all regions of Hong Kong, we examined regional variations in self-rated health, frailty, and four-year mortality, and analyzed the relative contributions of lifestyle, socioeconomic status, and geographical location of residence to these outcomes using path analysis. We hypothesize that lifestyle, socioeconomic status, and regional characteristics directly and indirectly through interactions contribute to self-rated physical and psychological health, frailty, and four-year mortality.District variations directly affect self-rated physical health, and also exert an effect through socioeconomic position as well as lifestyle factors. Socioeconomic position in turn directly affects self-rated physical health, as well as indirectly through lifestyle factors. A similar pattern of interaction is observed for self-rated mental health, frailty, and mortality, although there are differences in different lifestyle factors and district associations. Lifestyle factors also directly affect physical and mental components of health, frailty, and mortality. The magnitude of direct district effect is comparable to those of lifestyle and socioeconomic position.We conclude that district variations in health outcomes exist in the Hong Kong elderly population, and these variations result directly from district factors, and are also indirectly mediated through socioeconomic position as well as lifestyle. Provision and accessibility to health services are unlikely to play a significant role. Future studies on these district factors would be important in reducing health disparities in the older population. With the ageing of populations worldwide, the major users of health services are older people. Increasing emphasis has been placed on the collection of data documenting variations or disparities in health outcomes, with a view to minimizing these disparities as part of public health improvement For health outcomes, other than macro indicators such as mortality, individual health descriptors such as self-rated physical and psychological health and degree of frailty are particularly pertinent to older populations. It has been pointed out that self-rated health may provide a more holistic indicator of health The total number of subjects from 11/18 districts with > = 100 participants was 3611 . After four years of follow up, 233 participants had died . VariatiVariations in self-rated physical and mental health , frailty index, and mortality are shown in Path analysis was carried out in order to determine the direct or indirect effect of district, socioeconomic and lifestyle factors on each of the four health outcomes. We also attempted to capture the impact of other geographical parameters such as air pollution index, population density, and net land area listed as open spaces (un-inhabited areas) using government provided data. However these were not available for all districts examined here, and little association with health outcomes was noted for districts with available data.2 with a population of 6.7 million people, small area variations in health outcomes exist among the elderly aged 65 years and over. District of residence, socioeconomic position and lifestyle factors directly as well as indirectly affect self-rated physical and mental health, frailty and four year mortality in a complex manner.Analysis of this dataset shows that even within a city of 1050 kmPrevious studies on health disparities placed great emphasis on the type and accessibility to health services The relationship between lifestyle and socioeconomic position, and the four health outcomes has been observed in other studies. A ‘healthy’ diet and physical activity have been shown to reduce mortality In this study we used self-rated socioeconomic position, as this measure captures psychological factors related to objective socioeconomic measures, which may be more powerful in examining social determinants of health compared with objective indicators alone The inclusion of frailty as a health outcome measure has not been reported previously in the context of disparities, since frailty is a characteristic of older people and there have been relatively few studies examining the elderly population in particular. The results show that a healthy lifestyle is also associated with reduced frailty, similar to the relationship for mortality Although district of residence may indirectly contribute to variations in health outcomes through socioeconomic position and lifestyle, the district factor alone directly contribute to the variation. These may consist of neighbourhood characteristics such as social support, accessibility to transport, leisure and medical facilities, and safety, these being composite of indicators of neighbourhood deprivation There are limitations in this study. Large database studies have the inherent limitations in that the study was not designed to address a single specific question, but is essentially hypothesis generating. Therefore conclusions would need to be regarded in this context. Except for mortality, other health outcomes are examined with associated factors in a cross sectional design, so that causal relationships may not be drawn. The participants may not be representative of their district of residence, since they responded to the initial invitation to the study centre and may be regarded as volunteers. Bias may occur in either direction: those who were health conscious and those who had health problems may both have been more likely to respond. The cohort as a whole was of a higher educational standard compared with the general Hong Kong population. No district based population norms were available for comparison. Furthermore, the number of participants from each of the 18 districts varied widely, with some districts having fewer than twenty participants. We arbitrarily examined only those districts with > = 100 participants, so that only 11/18 districts were included. We did not taken into account the life course dimension, inspite of literature documenting the impact of early life environment on subsequent health outcomes later in life Inspite of the limitations, we can conclude that district variations in health outcomes exist in the elderly population, and these variations result directly from district factors (yet to be determined) and also indirectly mediated through socioeconomic position as well as lifestyle. Provision and accessibility to health services are unlikely to play a significant role. Future studies on these district factors would be important in reducing health disparities in the older population.2. Approximately 12% of the population are aged 65 years and over http://www.had.gov.hk). For the purpose of effective coordination and responsiveness of government policies on district needs and problems, district offices communicate and advise the government on issues concerning the local well-being such as the provision of services and facilities, the promotion of community, recreational and cultural activities, and environmental improvements within the districts. Apart from this administration purpose, the boundaries of the 18 districts have also been constructed to delineate relatively homogeneous spatial units which are distinguished from one another both in terms of demography profile, socio-economic indicators as well as the provision of healthcare services across these districts . Health service delivery in Hong Kong is divided into public and private sectors. Hospital services at secondary and tertiary levels are largely provided by the public sector and subsidized by the local government. Hospital Authority (HA) and Department of Health (DOH) provide medical treatment and rehabilitation services to patients through public hospitals, general outpatient and specialist clinics and outreach services throughout the territory, targeted at serving socially disadvantaged and vulnerable groups. The private sector plays a complementary role by providing only 6 percent of total hospital care. With respect to curative primary care services, private practitioners of Western medicine account for more than half of the market share. However, people believe that public hospitals provide quality healthcare services to citizens at reasonable prices. Due to this inadvertently flawed incentive system, there is an over-reliance on hospitals such that people also visit the accident and emergency departments (AED), general and specialist outpatient clinics (GOPC and SOPC) in the public sector for primary care services.Hong Kong is a Special Administrative Region of China situated in the South Coast of the Guangdong province, with a population of 6.7 million in an area of 1,050 kmFour thousand men and women aged 65 years and over living in the community in all regions of HK were invited to attend a health check carried out in the School of Public Health of the Chinese University of Hong Kong, by placing recruitment notices in community centers for the elderly and housing estates. Several talks were also given at these centers explaining the purpose, procedures and investigations to be conducted. The inclusion criteria were that all participants should be able to walk or take public transport to the study site at the University teaching hospital in Shatin. Participants were volunteers, and the aim was to recruit a sample such that approximately 33% were in each of these age groups: 65–69, 70–74, 75+ years. Compared with the general population in this age group, participants had higher educational level A questionnaire containing information regarding demographics, socioeconomic status in terms of educational level and maximum life-time income, medical history, smoking, alcohol intake, physical activity level, and dietary intake was administered by an interviewer. Physician diagnosed disease was obtained by self-report. Self-rated socioeconomic status was assessed by asking participants to place a mark on a picture of an upright ladder with ten rungs, with the lowest rung being the most undesirable and the highest the most desirable state with respect to their standing in the community (community ladder). This is a subjective measure of social status developed by the John D and Catherine T MacArthur Research Network on Socioeconomic Status and Health, and has been associated with key health outcomes in various population surveys of different cultural and ethnic groups Physical activity level was assessed using the Physical Activity Scale of the Elderly (PASE) Dietary intake was assessed at baseline using a food frequency questionnaire (FFQ), and mean nutrient quantitation per day was calculated using food tables derived from McCance and Widdowson r = 0.43, P = 0.0005), β-carotene , lutein , and α-tocopherol and were inversely correlated with plasma total cholesterol The Diet Quality Index-International (DQI-I) was used to assess the quality of diet The Chinese version of DQI has also been developed and validated in a Chinese community using cross-sectional 3 day diet record and anthropometric data Frailty was quantified using the frailty index (FI). The majority of the ageing population spend a variable period before death in a state of declining function, described as the frailty syndrome, representing an excess of deficits over assets in a dynamic state of balance, covering physical, functional, psychological, nutritional and social domains The following items from the health check questionnaire were used to construct a list of deficits, used for calculating the frailty index: self-reported health, history of falls in the past 12 months, history of osteoporotic fractures, presence of back pain limiting activities, clumsiness in walking, clumsiness using hands, the number of prescription medications and any difficulties with performing activities of daily living . The presence or absence of disease was based on subjects' report of diagnosis by their doctors. Depressive symptoms were assessed using the Geriatric Depression Scale The following measurements were carried out: height, weight, time taken to walk 6 meters, grip strength, blood pressure, and ankle brachial index (ABI). Body weight was measured with subjects wearing a light gown, by the Physician Balance Beam Scale . Height was measured by the Holtain Harpenden standiometer . Body mass index was calculated by dividing the weight in kg by the square of the height in meters. Grip strength was measured using a dynamometer JAMAR hand dynamometer . The average reading for two readings on right and left side was used. Blood pressure was measured in the supine portion using a mercury sphygmomanometer and the averages of two readings were taken. Duplicate measures of supine blood pressure in right arm and both ankles were performed using a standard mercury sphygmomanometer and an 8-MHz Doppler probe . The ABI was calculated for each leg by dividing the posterior tibial systolic pressure in each lower extremity by the upper extremity pressure. The current standard for diagnosing peripheral vascular disease is defined as an ABI of less than 0.90. An ABI of less than 0.90 is 95% sensitive and 99% specific for angiographically diagnosed peripheral arterial disease Mortality after 4 years was ascertained from the Government Death Registry.Since there were variable numbers of participants from the 18 districts, we arbitrarily excluded districts with less than 100 participants (seven districts) as the number may be too small for detailed analysis. Shatin was used as the reference district as the study centre was located in Shatin. The relationship between contributory factors and each of the health outcomes is examined using path analysis. This is an extension of simple regression modeling of dependent variable on independent variables to show associations between variables. DQI, PASE, smoking and alcohol use were regressed on age, sex, socioeconomic status and districts. Four outcome variables: physical health , mental health , log-transformed frailty index and death were then regressed on all other independent variables in separate models. Standardized regression coefficients were presented within paths. All statistical analyses were performed using the statistical package SAS, version 9.1 . An α level of 5% was used as the level of significance.Appendix S1Frailty index.(0.04 MB DOC)Click here for additional data file.

Oncorhynchus kisutch, forming two classes i.e. odd- and even-year spawners.In this study, we used different animal models to estimate genetic and environmental variance components on harvest weight in two populations of The models used were: additive, with and without inbreeding as a covariable (A + F and A respectively); additive plus common environmental due to full-sib families and inbreeding (A + C + F); additive plus parental dominance and inbreeding (A + D + F); and a full model (A + C + D + F). Genetic parameters and breeding values obtained by different models were compared to evaluate the consequences of including non-additive effects on genetic evaluation.Including inbreeding as a covariable did not affect the estimation of genetic parameters, but heritability was reduced when dominance or common environmental effects were included. A high heritability for harvest weight was estimated in both populations (even = 0.46 and odd = 0.50) when simple additive models (A + F and A) were used. Heritabilities decreased to 0.21 (even) and 0.37 (odd) when the full model was used (A + C + D + F). In this full model, the magnitude of the dominance variance was 0.19 (even) and 0.06 (odd), while the magnitude of the common environmental effect was lower than 0.01 in both populations. The correlation between breeding values estimated with different models was very high in all cases (i.e. higher than 0.98). However, ranking of the 30 best males and the 100 best females per generation changed when a high dominance variance was estimated, as was the case in one of the two populations (even).O. kisutch, thus not including them may produce an overestimation of the predicted response; furthermore, genetic evaluation was seen to be partially affected, since the ranking of selected animals changed with the inclusion of non-additive effects in the animal model.Dominance and common environmental variance may be important components of variance in harvest weight in Several studies have shown that non-additive effects like common environmental and dominance genetic effects can be an important component in the total phenotypic variance of quantitative traits in fish -6. In saThe objective of this study was to investigate the magnitude of dominance genetic and common environmental variances, and the consequences of including these effects plus inbreeding on the genetic evaluation of harvest body weight in O. kisutch. Particularly, we are interested in the effects on heritability, genetic response and on ranking of animals selected as parents.O. kisutch. populations from the Genetic Improvement Center (CMG) maintained by the Institute for Fisheries Development (IFOP) and the University of Chile in Coyhaique . These two populations, termed 'even' and 'odd' year classes, were initiated in 1992 and 1993, respectively, from a common base population and managed in a two-year reproductive cycle. Since the program began, both populations were managed as closed populations, maintained by mating approximately one male with three females. The fish spawned from late April to June; the eggs of each full-sib family were incubated separately, and at the eyed egg stage, 120 families were moved to separate tanks for hatching and kept until fish were individually marked using PIT (passive integrated transponder) tags. Rearing families in separate tanks usually produces a common environmental effect that should increase in magnitude as full-sib families are maintained for a long time under these conditions.To prevent high common environmental effects in harvest and confounding effect with dominance, 60-80 fish from 100 families were individually PIT (Passive integrated transponder) tagged in December, seven months after spawning, when the fish averaged about 5-10 g. Then, fish were transferred to estuary water conditions (Ensenada Baja) where each full-sib family was randomly stocked in equal numbers of fish into three rearing sea-cages. Body weight at harvest (harvest weight) was recorded at about 620 days post-spawning, when the fish weight was on average over 2,500 g. Artificial selection for harvest weight and early spawning was applied for four generations as described and analyzed in Neira et al. , where l (θ|y) is the maximum of the likelihood function when fitted to a full set of parameters and l (θr|y) is the maximum likelihood, subject to the restriction that r parameters were constrained to fixed values. Asymptotically, the LR test statistic is freedom .Genetic responses per generation using the different models were calculated as the difference between mean breeding values in successive generations. To measure the magnitude of a possible over/under estimation of genetic response due to omission of dominance, common environmental effects, and/or inbreeding, the ratio of the genetic response of each model with the simplest model (A) was used.Performance rankings of animals obtained by different models were compared by: 1) Pearson correlations between estimates of breeding values of the total number of pedigree animals per population and 2) the count of the number of sires and dams that would have been excluded from the selected group using the simplest (A) model (30 best fathers and 100 best dams) in each of the other models.Estimation of the variance components and inbreeding coefficient for all models and for the two populations are shown in Table As Table Correlations between breeding values estimated with different models were near unity 0.98 to 1.00) suggesting that the breeding values of the selection candidates estimated by the different models do not re-rank Table . However.00 suggeO. kisutch. In our study, population sizes were almost half of that reported by Pante et al. [In the present study, the magnitude of additive and non-additive effects was estimated for body weight at harvest in e et al. in troute et al. in Atlane et al. . Few stue et al. ,4,5. As e et al. in both e et al. , in otheIncluding inbreeding coefficients as a covariable did not affect the heritability estimate, which agrees with results previously reported for trout by Pante et al. . In the Comparison of the rankings of animals between models was performed using two different approximations: a) Correlation of breeding values between models ,19, and O. kisutch. may be as important as additive variance, in contrast to common environmental effects, which are always small compared to additive and dominance variances. As reported by Pante et al. [The results presented in this study show that dominance variance of harvest weight in e et al. in troutO. kisutch, thus not including them may overestimate the predicted response. Genetic evaluation is partially affected, since the ranking of animals is partially changed when including non-additive effects in the animal model. However, the magnitude of these effects may be very different in different populations.Dominance and common environmental variances may be important components of variance of harvest weight in The authors declare that they have no competing interests.JAG carried out the data analysis and drafted the manuscript. JPL participated in data capture and helped draft the manuscript. RN conceived the study, participated in its design and coordination and contributed to draft the manuscript. All authors read and approved the final manuscript.Table S1 - Ranking of breeding values estimaed with different models for the Odd population. Sires and dams excluded from the group selected by the simple model per generation, 30 best sires and 100 best dams, in each of the models are marked in bold. This table shows the ranking based on breeding values obtained for the different models in the odd population. The top sires and dams for each model are colored in each generation for comparative purposes. This allows easy viewing of animals not selected in a model compared to the simplest model. Table S2 - Ranking of breeding values estimaed with different models for the Even population. Sires and dams excluded from the group selected by the simple model per generation, 30 best sires and 100 best dams, in each of the models are marked in bold. This table shows the ranking based on breeding values obtained for the different models in the even population. The top sires and dams for each model are colored in each generation for comparative purposes. This allows easy viewing of animals not selected in a model compared to the simplest model.Click here for file

P<0.01) and size of metastases (P<0.01) of B16F10 melanoma cells. This effect is also observed when an anti-TNF neutralising monoclonal antibody is administered, confirming the essential role TNF plays in metastasis in this model. This study suggests that TNF autovaccination is a cheaper and highly efficient alternative that can block TNF and reduce metastasis in vivo and trials with TNF autovaccination are already underway in patients with metastatic cancer.TNF is a proinflammatory cytokine involved in the pathogenesis of chronic inflammatory diseases, but also in metastasis in certain types of cancer. In terms of therapy, TNF is targeted by anti-TNF neutralising monoclonal antibodies or soluble TNF receptors. Recently, a novel strategy based on the generation of self anti-TNF antibodies (TNF autovaccination) has been developed. We have previously shown that TNF autovaccination successfully generates high anti-TNF antibody titres, blocks TNF and ameliorates collagen-induced arthritis in DBA/1 mice. In this study, we examined the ability of TNF autovaccination to generate anti-TNF antibody titres and block metastasis in the murine B16F10 melanoma model. We found that immunisation of C57BL/6 mice with TNF autovaccine produces a 100-fold antibody response to TNF compared to immunisation with phosphate-buffered saline vehicle control and significantly reduces both the number ( TNF is an important proinflammatory cytokine involved in normal physiological immune and inflammatory processes. However, when inappropriately expressed, TNF also plays a role in the development of chronic inflammation and diseases associated with it .α/KC, as well as matrix metalloproteinases (MMP) and urokinase-plasminogen activator, molecules involved in ECM degradation and cellular migration (Previous studies have suggested that one of the main mechanisms by which TNF promotes tumour growth is by upregulating metastasis. TNF activates key molecules involved in metastasis such as IL-8 (an angiogenic chemokine) and GroMonoclonal antibodies and IgG fusion proteins are now an established approach to blocking TNF. We have previously used monoclonal antibodies against TNF to ameliorate disease in animal models of arthritis emulsified with complete Freund's adjuvant (CFA), in a volume of 100 μl three times per week or PBS. Again to reduce biased selection, the treatments were blinded coding them A and B prior to insertion into the mice and the code was broken after the data were collected and analysed. The monoclonal antibodies were a rat mouse fusion protein . The day after the initial injection, 105 B16F10 murine melanoma cells in 200 μl of PBS were injected into the tail vein of each mouse. After 3 weeks, the mice were killed and the lung tumours counted and the diameter measured as described above.C57BL/6 mice (6-week old) were injected intraperitoneally (i.p.) with 500 μg ml−1 of TNF in PBS at 100 μl well−1 and incubated overnight at 4°C. The plates were blocked with 2% bovine serum albumin (BSA) in PBS (200 μl well−1) for 1 h at 25°C and washed with 0.5% Tween in PBS after this and all subsequent steps. A measure of 100 μl of one in three serial dilutions of serum samples and the positive and negative control sera were incubated for 1 h at 25°C. The detection antibody (100 μl well−1) was diluted in 0.5% BSA in PBS and incubated for 1 h at 25°C. A sheep anti-mouse polyclonal detection antibody conjugated to horseradish peroxidase was used. These samples were developed with a peroxidase substrate system TMB, the reaction was stopped with 1 M H2SO4 and absorbance read at 450 nm. Since standard known amounts of antibodies to these antigens were unavailable, eight serial dilutions of sample sera were made and their titres taken as the dilution that gave an OD corresponding to that of the negative control sera. The negative control sera were from unimmunised mice and the positive control sera were pooled sera from previously immunised mice that had been tested by ELISA and found to have antibodies that bound TNF.Microtitre plates were coated with 1 2 in RPMI supplemented with 10% foetal bovine serum (BioWhittaker), penicillin (100 U ml−1) and streptomycin (100 μg ml−1). B16F10 cells were plated in 96-well plates at 2 × 106 cells ml−1 and 200 μl well−1. The cells were stimulated with LPS at 10 μg ml−1; some cells were further stimulated with murine TNF (mTNF) at 10 or 100 ng ml−1 and other cells with media as a control. The plates were incubated 37°C. Supernatants were removed at 24 and 72 h and stored at −20°C for immunological detection assays. KC was measured by ELISA as described previously , and then B16F10 melanoma cells were injected into the tail vein. We found that mice treated with anti-TNF monoclonal antibodies had significantly less and smaller metastases compared to the mice treated with PBS , previously described to play a role in metastasis in keratinocytes . As we were unable to examine any cytokines in the mice sera, we examined the effects of blocking TNF inocytes , fibrobl tumours .Overall, our study shows that although metastasis is a complex multisystem process involving a large number of different molecules, in the B16F10 murine melanoma model TNF plays an important and rate-limiting role. This is likely to be partly due to its ability to increase the expression of prometastatic molecules such as KC. In addition, our study demonstrates that the TNF autovaccination technology is a very efficient strategy in producing anti-TNF antibodies in mice and preventing in that way the number and size of metastases. This strategy is also safe in this experimental system as no adverse effects or increase in tumour growth or metastasis was seen. We are currently conducting a phase I human clinical trial to evaluate the effect of blocking TNF by using TNF autovaccination in patients with a variety of cancers. Results from these trials are eagerly awaited. If this strategy is found to be effective in human trials, it would be a cost-effective alternative to infusing monoclonal antibodies and more convenient for patients who would possibly only require three injections for a 3-month benefit.

Despite the high prevalence of subthreshold depression in patients with type 2 diabetes, evidence on cost-effectiveness of different therapy options for these patients is currently lacking.Within-trial economic evaluation of the diabetes-specific cognitive behaviour therapy for subthreshold depression. Patients with diabetes and subthreshold depression are randomly assigned to either 2 weeks of diabetes-specific cognitive behaviour group therapy (n = 104) or to standard diabetes education programme only (n = 104). Patients are followed for 12 months. During this period data on total health sector costs, patient costs and societal productivity costs are collected in addition to clinical data. Health related quality of life (the SF-36 and the EQ-5D) is measured at baseline, immediately after the intervention, at 6 and at 12 months after the intervention. Quality adjusted life years (QALYs), and cumulative costs will be estimated for each arm of the trial. Cost-effectiveness of the diabetes-specific cognitive behaviour group therapy will be analysed from the perspective of the German statutory health insurance and from the societal perspective. To this end, incremental cost-effectiveness ratio (ICER) in terms of cost per QALY gained will be calculated.Some methodological issues of the described economic evaluation are discussed.The trial has been registered at the Clinical Trials Register (NCT01009138). P < 0.0001 (cost adjusted to reflect August 2001 dollars).Depression is a highly prevalent disorder with a substantial impact on quality of life and societal cost ,2. This Hence, the more effective depression treatment might not only improve health outcomes, but also reduce total health service utilization and therefore costs. Put differently, additional costs for improved depression treatment could be offset by reduction in other healthcare costs. In the IMPACT trial for examCost-effectiveness of treatment options for depression has been mainly evaluated for major depression co-occurring with diabetes. However, there is a need to examine the cost-effectiveness of therapies for subthreshold depression as well, since there is evidence that about 20% of patients with diabetes have elevated depressive symptoms without meeting criteria for major clinical depression ,5. In whThe clinical trial is carried out as randomised clinical trial comparing a diabetes-specific cognitive behaviour group therapy (DS-CBT) to a standard diabetes education programme (DEP). The trial is carried out in the in the Diabetes Centre Mergentheim, Germany, where about 6500 diabetic patients are treated annually. Approval for the study was granted by the local Medical Ethics Committee (Ethikkommission der Ärztekammer des Landes Baden-Württemberg). Primary endpoint of the clinical trial is the reduction of subthreshold depression at the 12 months follow up. Secondary variables are improvement of glycaemic control (HbA1c), health related quality of life (SF-36 and EQ-5D), diabetes related distress, and diabetes self-management. Assessments take place before the intervention (baseline), after the core intervention (at 2 weeks), and at 6 and 12 months of the trial.A remission in 65% and 40% of cases is assumed under the DS-CBT and DEP respectively. To detect a statistically significant difference with a power (1-β) of 90% 83 patients in each treatment group are required. Assuming a loss to follow-up of 20%, 104 patients in each arm of the trial are needed.Patients with type 2 diabetes and elevated depressive symptoms ADS > 22) [ [22], buTrials participants are randomly assigned either to the intervention group that receives the DS-CBT in addition to the standard diabetes education programme or to a control group that receives only standard diabetes education programme offered by the Diabetes Centre Mergentheim. The DS-CBT consists of 10 lessons of 45 minutes each, delivered in 5 sessions of 90 minutes in a group setting within a period of 2 weeks. Each DS-CBT group consists of minimum 3 and maximum 8 members. The DS-CBT is based on an evaluated German manual of cognitive behaviour therapy , which hThe objective of the economic evaluation, which is conducted alongside the trial, is to estimate the cost-effectiveness of the DS-CBT in terms of costs per quality adjusted year (QALY) from the perspective of the German statutory health insurance and from the societal perspective. To this end an incremental cost-effectiveness ratio (ICER) will be calculated, i.e. the ratio of the difference in costs between DS-CBT and DEP groups divided by the difference in QALYs gained in each group. Under statutory health insurance perspective on cost, ICER will be calculated using health sector costs only. Adopting the societal perspective, also patient costs and societal productivity costs will be added to the calculation of the ICER.For the purposes of economic analysis, measures comparable across various interventions as well as across different disease areas are preferred. Most popular outcome measure for this purpose are the quality adjusted life-years (QALYs), which explicitly combine length and quality of life in a single measure, weighting survival by utility scores. Utility weights reflect preferences for a particular health state and are measured on a scale from 0 to 1, where 0 and 1 represent death and full health, respectively . AlthougMore than 15 value sets are available for scoring the EQ-5D, based on rating scale and time trade-off (TTO) valuation derived from general population surveys in various countries . In thisBrazier and colleagues reported work on deriving a reduced health status index from the SF-36 that they termed the SF-6D and moreThe SF-36 and EQ-5D will be administered at baseline, immediately after the intervention, at 6 months and at 12 months after the intervention (see Table Resource use and costs directly associated with DS-CBT and DEP (e.g. staff time) will be derived from the therapy protocols. Information on the utilisation of other healthcare services will be obtained from trial participants by means of a cost questionnaire, which was developed for the study and incorporated into the case report files of the trial. The questionnaire is administered before the intervention (baseline), at 6, and 12 months of the trial and refers to the previous 6 months will be multiplied by unit costs/prices. Currently, there are no German guidelines for costing in economic evaluations containing standard unit costs. Hence, healthcare resource use will be valued by unit costs/prices obtained from published sources and official statistics for Germany .To estimate patient costs, reported consumption of healthcare services paid out of pocket will be multiplied by unit costs/prices available from official statistics and from providers.Days missed from work will be monetary valued according to the human capital approach .Mean total costs, health sector costs, patient costs and productivity costs as well as corresponding cost differences between the DS-CBT group and DEP group will be calculated. Sampling uncertainty will be estimated using bootstrap procedure because cost data are non-normally distributed.Effect in terms of QALYs will be analysed using linear regression on type of intervention and - if necessary - on baseline utility score, which has been shown to be important for the unbiased assessment of mean QALY differences between treatment groups .m resulting data sets will be analysed as described above and combined to produce a single result that takes uncertainty in the imputation process into account.Data will be analysed according to the intention to treat principle. A multiple imputation approach based on propensity scoring will be used to account for missing information with regard to effects and costs. Baseline variables will be entered into a logistic regression to predict the chance of a missing value ,34. AvaiIf a significant impact of DS CBT on both effects and costs is demonstrated, ICER will be estimated in terms of costs per QALY gained. ICER will be estimated for the total cost and for the health sector costs only . The non-parametric bootstrap method will be employed to generate confidence intervals around the ICER estimates derived from the study sample ,39. UnceBesides statistical uncertainty (sampling variation) with regard to costs and effects, every economic evaluation may contain some degree of data imprecision (e.g. resource costs/prices) and methodological controversy , which should be accounted for. To handle this type of uncertainty, sensitivity analysis is usually employed ,44. In tIn the context of the trial, it might be argued that, if true randomisation is achieved, any differences in cost between treatment arms can be attributed to the study intervention . Hence, Information on healthcare utilisation other than DS-CBT and DEP sessions will be collected by self-report by means of the cost questionnaire. To our knowledge no standard and validated instruments for collecting resource use data in clinical trials are available in Germany. Hence, we developed a data collection instrument specifically for this trial. The questionnaire was pilot tested, but has not yet been validated against other data sources. Recall bias may potentially occur, since resource use will be measured over the previous 6 months. However, there is no conclusive evidence regarding whether a prospective (a cost diary) or a retrospective (a questionnaire) instrument should be better applied and regarding an appropriate recall interval . Van denDepression and depression symptoms co-occurring with type 2 diabetes are highly prevalent and associated with a wide range of adverse outcomes, including less effective self-care, more severe physical symptoms, greater functional impairment and disability as well as increased healthcare utilization and expenditure. However, there is a lack of evidence on cost-effectiveness of treatment options for subthreshold depression co-occurring with diabetes. The described trial-based economic evaluation will provide additional evidence on cost-effectiveness of the DS-CBT in this target group.The authors declare that they have no competing interests.AI and NC developed the design and methods for the economic evaluation alongside the clinical trial. NC wrote the manuscript. MS and GG gave support relating to the statistical analysis. BK is the coordinator of the clinical trial; NH and TH are principal investigators of the clinical trial; AS and AG are investigators of the clinical trial; JK advised on the design and methods of the clinical trial; and CO is responsible for data management. All co-authors read, edited, and approved the final manuscript. All authors participated in the work sufficiently to take public responsibility for respective parts of the paper.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2458/10/625/prepub

The search was refined with terms that would identify the Phase I, II and III immunotherapy trials open for adult glioma patient accrual in the United States. From the list, those that are currently open for patient accrual are discussed in this review. A variety of adoptive immunotherapy trials using ex vivo activated effector cell preparations, cell-based and non-cell-based vaccines, and several combination passive and active immunotherapy approaches are discussed.Despite new additions to the standard of care therapy for high grade primary malignant brain tumors, the prognosis for patients with this disease is still poor. A small contingent of clinical researchers are focusing their efforts on testing the safety, feasibility and efficacy of experimental active and passive immunotherapy approaches for gliomas and are primarily conducting Phase I and II clinical trials. Few trials have advanced to the Phase III arena. Here we provide an overview of the cellular therapies and vaccine trials currently open for patient accrual obtained from a search of The majority of primary tumors of the central nervous system (CNS) are of astrocytic lineage . Glial thttp://www.clinicaltrials.gov, NCT00006353) [Even with new aggressive standard of care upfront radio-chemotherapy 0006353) , the ove3 , the o0006353) to the pWe provide a synopsis of the individual active and passive immunotherapy trials and those that use combined active and passive approaches. Three tables summarize the information to include treatment site(s) and lead investigator, an abbreviated trial description, the study phase and estimated enrollment, and indication of whether eligible patients must have recurrent (R), persistent (P) or newly diagnosed (ND) brain tumors at a particular malignant stage (WHO grade). Figure ex vivo activated cytotoxic effector cells to the patient is categorized as a form of passive immunotherapy. The effector cells are administered either systemically or intracranially. If placed intratumorally, the effector cells may be either autologous or allogeneic to the patient. The types of effector cells tested include cytotoxic T lymphocytes (CTL) that are specifically-sensitized to glioma associated antigens (GAA) and exhibit human leukocyte antigen (HLA) restriction [The adoptive transfer of triction . Alternatriction ,7.Currently, there are five clinical trials evaluating the safety and effectiveness of cellular therapy approaches Table . At The reg) before receiving intravenous infusion of the allogeneic CMV-specific CTL [Two other clinical trials, one at Baylor College of Medicine (NCT01109095) and another at Penn State University (NCT00990496), evaluate the safety and patient response to intravenous adoptive transfer with autologous or allogeneic CTL, respectively. The CTL target the highly immunogenic human β-herpes cytomegalovirus (hCMV) specific antigens that have been shown to be associated with ~70-90% of glioma cells but not normal brain -17. The ific CTL .ex vivo to recognize patient HLA that is highly expressed on the surface of glioma cells but is not present on normal neurons or glia. The trial is predicated upon the results of an earlier pilot study where 3 of 6 recurrent malignant glioma patients demonstrated benefit [A dose escalation trial involving intratumoral adoptive transfer of alloreactive CTL is open for accrual of recurrent glioma patients at the University of California, Los Angeles . After surgical debulking, alloCTL will be placed in the resection cavity. Later alloCTL infusions are delivered through a subgaleal Rickham reservoir/catheter placed at the time of surgery. Patients are treated with 2 alloCTL infusions, 7 days apart to complete 1 cycle. Up to 5 treatment cycles are possible and given every other month. The alloCTL are derived from different donors at each cycle who are allogeneic to the patient. The effector alloCTL are trained benefit . One patAt Hoag Cancer Center , an open, randomized double arm Phase II clinical trial is evaluating the safety of single dose intracavitary autologous LAK cells. This is being compared to Gliadel wafer in newly diagnosed GBM patients (NCT00814593). LAK cells are generated when the patient's PBMC are cultured with high dose recombinant human IL-2 .Immunization of patients relies upon activation of endogenous immune cells and is categorized as a form of active immunotherapy. In Table The ongoing Phase I dose-escalation trial at UCLA (NCT00068510) involves DC that are pulsed with autologous tumor cell lysates. The primary endpoint is to evaluate dose limiting toxicity and the maximum tolerated dose of tumor cell lysate pulsed DC in patients with newly diagnosed and recurrent gliomas. Patient response was seen previously when patients received DC pulsed with acid-eluted peptides or tumor lysate administered in combination with chemotherapeutic agents ,24.Another variation of the DC vaccine approach is being tested at Cedars-Sinai in Los Angeles (NCT00576641) and is enrolling recurrent WHO grade IV or brain stem gliomas. The approach offers patients with tumor located in unresectable locations an opportunity to receive adjuvant immune therapy. Enrollment into this clinical trial is restricted to patients who are HLA Class I A1 or A2 positive since the synthetic peptides used to pulse the DC are from GAA that display HLA-A1 or -A2 restrictions. Other vaccine trials at Cedars-Sinai using DC pulsed with autologous tumor cell lysates with or without intratumoral Gliadel wafer recently were closed for accrual.in vitro study using human glioma tissue and autologous PBMC [At Duke University (NCT00890032), recurrent GBM patients are treated with autologous DC that are pulsed with mRNA isolated from autologous CD133+ brain tumor stem cells. The method of using mRNA isolated from the patient's own tumor cells to pulse their DC has shown promise in mouse glioma studies, and in an ous PBMC ,26.Last, at Massachusetts General/Dana Farber Cancer Institute (NCT00694330) a vaccine comprised of irradiated autologous whole tumor cells are given along with K562 cells engineered to produce granulocyte-macrophage colony stimulating factor (GM-CSF), theoretically as a constant source of immune-adjuvant cytokine . Since treg cells are more sensitive to that antibody compared to the cytotoxic T cell counterpart. Intradermal injections of CDX-110 peptide, or peptide loaded DC has led to increased overall survival in clinical trials without reported autoimmunity [The lower half of Table immunity .Two Phase 0 clinical trials open at Pittsburgh Cancer Center are evaluating subcutaneous immunization with GAA peptides and 1 or 2 adjuvants. The first adjuvant is polyinosinic-polycytidylic acid stabilized with polylysine and carboxymethylcellulose (poly-ICLC) that acts as a Toll like receptor 3 agonist and is given intramuscularly 8 times 3 weeks apart. The second adjuvant is Montanide ISA-51, a water-in-oil emulsion that is also given intramuscularly as an immune modulating agent . HLA-A2 Two more vaccine trials are open at University of California, San Francisco for recurrent (NCT00293423) or newly diagnosed (NCT00905060) patients with GBM. Enrolled patients are being vaccinated with the heat shock protein peptide complex (HSPPC)-96 with or without concurrent TMZ therapy. Heat shock proteins (HSP) are highly conserved proteins that are transiently expressed during cell stress. They function as molecular chaperones and in the proper folding, assembly, and transport of nascent peptides, and in the degradation of misfolded peptides. Some HSP are highly upregulated on brain tumor cells ,36. Intereg cells, and CMV-specific CTL.Four trials have complex treatment strategies that employ combined active and passive approaches for patients with brain tumors Table . Three cThe first trial (NCT00639639) is randomized into 4 arms that evaluate a) CMV-DCs with CMV-ALT, b) CMV-DC alone, c) radiolabeled CMV-DCs following unpulsed DC administration, and d) radiolabeled CMV-DCs following skin site preparations with tetanus toxin. The CMV-specific DCs are pulsed with the pp65-lysosomal-associated membrane protein (LAMP) mRNA and given 3 times. For CMV-ALT, autologous pp65-specific CTL are given once intravenously. The second trial (NCT00693095) involves patient treatment with CMV-ALT with or without CMV-DCs pulsed with pp65 mRNA. Patients will also receive standard of care radiotherapy and TMZ. Interestingly, patients whose tumor recurs following experimental therapy will be offered a resection of the intracavitary tissue with intracranial placement of radiolabeled CMV-DC. The third trial (NCT00627224) similar to the first has four arms: a) CMV-ALT with CMV-DC, b) CMV-ALT alone, c) radiolabeled CMV-DC, and d) radiolabeled CMV-DC that are pulsed with mRNA for the CC chemokine receptor 7 (CCR7) in an effort to direct the CMV-specific DC to the lymph nodes. Upon recurrence, biopsies will be evaluated for DC or CTL infiltrates, and for pp65-antigen escape.ex vivo, and then administered intravenously. Pilot clinical trials showed promising results with this approach to expand autologous anti-tumor CTL [Finally, an open Phase I/II trial at St. Lukes Hospital combines active and passive immune strategies in patients with recurrent grade III or IV glioma (NCT01081223). Patients are immunized with irradiated autologous tumor cells and GM-CSF (TVAX). Later, autologous T cells are harvested and expanded umor CTL . A similumor CTL -42.Six states have immunotherapy trials open for patient enrollment at present with a strong contingency of investigators conducting immune therapy trials concentrated on the west coast of the United States Figure . CompariCommonly, Phase I dose-escalation studies in standard 3+3 design are conducted to ensure safety at any given dose before randomized studies focusing on a particular dose level are initiated. In small Phase 0 and I trials, some now using creative designs with as few as 6-15 patients per arm (see Tables) where toxicity is the primary concern, the likelihood of variability in treatment outcome, especially when they are receiving different doses, is high. Therefore, the studies are underpowered to make robust correlations between clinical outcomes and the immunologic responses generated. Furthermore, there are challenges in making comparative assessments between individual trials. The patient populations treated must be segregated into uniform groups for data analysis. For valid statistical conclusions to be reached one cannot directly compare the outcomes of two individual trials where in one the patients enrolled have persistent or recurrent tumors, and in the other, only recurrent tumors.Although promising yet anecdotal results have been documented in brain tumor patients treated with a variety of immunotherapeutic approaches ,43-46 fe®-Brain) is sponsored by Northwest Biotherapeutics. Although no longer recruiting patients, there are currently 12 institutions participating in the conduct of the Phase II study that is completing treatment and follow-up of 141 enrolled patients http://clinicaltrials.gov/ct2/show/record/NCT00045968[®-Brain is predicated, encouragingly continue to demonstrate delays in disease progression and extensions in overall survival http://www.nwbio.com/clinical_dcvax_brain.php[http://www.celldextherapeutics.com/[http://clinicaltrials.gov/ct2/show/study/NCT00458601 is successful [http://ir.celldextherapeutics.com/phoenix.zhtml?c=93243&p=irol-newsArticle&ID=1434902&highlight=[http://www.imuc.com/[http://www.tradingmarkets.com/news/stock-alert/avrod_imuc_immunocellular-therapeutics-signs-agreement-with-averion-international-to-conduct-phase-ii-glioblast-1176363.html[http://www.antigenics.com[The number of slots open for patient accrual to the immunotherapy protocols contained in our list of open trials totals 489. Based upon the 2010 CBTRUS estimations that 18,980 patients will be diagnosed with a glioma this year in the United States [T00045968. The patbrain.php. Also, Ctics.com/ has planccessful . Interim6363.html. Finallyenics.com is suppoFurthermore, standardization of the immunologic monitoring endpoints would also help advance the immunotherapy field. Centralized immunologic monitoring laboratories could offer uniform sample handling and analysis. Common endpoints could more reliably provide better comparisons between the individual protocols. Patient responses to immune treatments are assessed over time in cytotoxicity assays by increases in GAA-specific CTL or GAA tetramer analysis in the patients PBMC. Other measurements have included qPCR or Elispot for T helper 1 cytokines, such as IFN-γ, appearance or increases of phenotypically defined cytotoxic subsets in PBMC upon exposure to relevant target cells, and for vaccines in particular, lymphocytic infiltrates at biopsied vaccination sites or tumor site -67. Sincreg cells or myeloid-derived suppressor cells that also can produce immunosuppressive or T helper (Th) 2 or Th3 cytokines such as IL-10 or TGF-β, respectively [Adjuvant experimental immune therapies are more likely to be of benefit for treating the smaller number of tumor cells remaining after surgical resection. Tumor resection provides an advantage for immune therapies as it helps to reduce the level of immunosuppressive factors produced and secreted by the tumor cells, such as transforming growth factor-beta (TGF-β) or prostaglandin-E2 ,70. Whenectively .http://projectreporter.nih.gov/project_info_description.cfm?aid=7746420&icde=4191938[Should the single or combined immune therapy modalities be ineffective, combining active or passive immunotherapy approaches with other gene therapy approaches may come to fruition. For instance, our group is currently exploring the possibility of combining alloCTL cellular therapy, now being tested individually (NCT01144247), with gene therapy employing replication competent retroviral vectors encoding suicide genes (NCT01156584), also now being tested individually ,72. The e=4191938, but forFinally, besides contrast-enhanced magnetic resonance imaging (MRI) scans for following brain tumor patient response to immune therapy, other tests should be factored in with those assessments. It is difficult to differentiate inflammation from tumor progression, as both result in enhancement on scans. Follow-up using this one assessment modality has resulted in premature placement of patients off protocol. New experimental MRI and positron emission tomography (PET) techniques are becoming available to help make these assessments and distinguish between pseudo-progression and true tumor progression ,75. If vglioma and biotherapy or immunotherapy, autologous, allogeneic, and vaccine; we limited the search to trials enrolling adult patients and asked for all Phase I, II and III trials in the United States. Of the listed trials, we focused on those employing cellular therapy, DC or peptide-based vaccines, or combined approaches. Overall, we are encouraged by the advances this field has seen in the last decade. A welcome precedence, the FDA recently approved PROVENGE®, a dendritic cell-based vaccine made by Dendreon Corporation http://www.dendreon.com for metastatic, hormone-refractory prostate cancer [To refine the searches on clinicaltrials.gov we included the following terms: e cancer -78. We l(A): astrocytoma; (AA): anaplastic astrocytoma; : alloreactive cytotoxic T lymphocytes; (AODG): anaplastic oligodendroglioma; (ALT): autologous lymphocyte transfer; (BTSC): brain tumor stem cell; (CBTRUS): Central Brain Tumor Registry of the United States; (CD): cytosine deaminase; (CED): convection enhanced delivery; (CMV): cytomegalovirus; (CNS): central nervous system; (CTL): cytotoxic T lymphocytes; (DC): dendritic cells; (GAAs): glioma associated antigens; (GM-CSF): granulocyte-macrophage colony stimulating factor; (GBM): glioblastoma multiforme; (hCMV): human cytomegalovirus; (HLA): human leukocyte antigens; (HSP): heat shock protein; (HSPPC): heat shock protein peptide complex; (HSV): herpes simplex virus; (HyTK): hygromycin phosphotransferase-thymidine kinase; (IFN): interferon; (IL): interleukin; (LAK): lymphokine-activated killer; (LAMP): lysosomal-associated membrane protein; (MRI): magnetic resonance imaging; (MHC): major histocompatibility complex; (MAG): mixed anaplastic glioma aka mixed anaplastic oligoastrocytoma; (MG): mixed glioma aka mixed oligoastrocytoma; (MLR): mixed lymphocyte reaction; (mRNA): messenger ribonucleic acid; (ND): newly diagnosed; (NIH): National Institutes of Health; (NK): natural killer; (ODG): oligodendroglioma; (PBMC): peripheral blood mononuclear cells; (P): persistent; (PCR): polymerase chain reaction; (PET): positron emission tomography; (R): recurrent; (TAA): tumor associated antigens; (TCR): T cell receptor; (TGF): transforming growth factor; (TMZ): temozolamide; (TNF): tumor necrosis factor; (Treg): T regulatory cell; (UCLA): University of California, Los Angeles; (UCSF): University of California, San Francisco; (WHO): World Health Organization.The authors declare that they have no competing interests.MJH and CAK conceived, outlined the direction of, and drafted the manuscript. MJH, CCM and KLE refined the search for information, gathered references and generated the tables and figure. MRJ, RMP, LML provided information to shape the manuscript content and discussion. All authors have read and approved the final manuscript.

Over the last years key stake holders in the healthcare sector have increasingly recognised evidence based medicine (EBM) as a means to improving the quality of healthcare. However, there is considerable uncertainty about the best way to disseminate basic knowledge of EBM. As a result, huge variation in EBM educational provision, setting, duration, intensity, content, and teaching methodology exists across Europe and worldwide. Most courses for health care professionals are delivered outside the work context and lack adaptation to the specific needs for EBM at the learners' workplace. Courses with modern 'adaptive' EBM teaching that employ principles of effective continuing education might fill that gap. We aimed to develop a course for post-graduate education which is clinically integrated and allows maximum flexibility for teachers and learners.A group of experienced EBM teachers, clinical epidemiologists, clinicians and educationalists from institutions from eight European countries participated. We used an established methodology of curriculum development to design a clinically integrated EBM course with substantial components of e-learning. An independent European steering committee provided input into the process.We defined explicit learning objectives about knowledge, skills, attitudes and behaviour for the five steps of EBM. A handbook guides facilitator and learner through five modules with clinical and e-learning components. Focussed activities and targeted assignments round off the learning process, after which each module is formally assessed.The course is learner-centred, problem-based, integrated with activities in the workplace and flexible. When successfully implemented, the course is designed to provide just-in-time learning through on-the-job-training, with the potential for teaching and learning to directly impact on practice. There is an increasing imbalance between the exponential growth of medical knowledge and the opportunities available to average clinicians to read, assimilate and apply this information to improve health care. Estimates suggest that 27 kg of guidelines, 3,000 new papers, 1,000 new indexed Medline articles, and 50 new randomised clinical trials (RCTs) are published each day. However, clinicians only manage to spend one hour a week to digest this huge amount of information [Good doctors use individual clinical expertise, the best available external evidence as well as patient preferences, and neither alone is enough. Without current best evidence, practice risks becoming rapidly out of date, to the detriment of patients[EBM is the integration of up-to-date patient-oriented valid research into clinical decision making by doctors and patients. " patients." For EB patients and life patients. At presCurrently, EBM is mainly taught through courses, conferences, workshops, journal clubs or educational meetings, so called "stand alone" courses that are insufficiently integrated into daily clinical practice and clinical postgraduate training . TherebyIncreasingly, it is required that health care decisions are based on sound evidence . ExpertsWe report on this initiative named the European Union (EU)-EBM project that aspires to develop a clinically integrated EBM course. In a pilot project, we designed and developed the first teaching unit, with emphasis to its promotion and piloting across the European health care sector and beyond. This paper describes the process of curriculum development along with its current results.The goal of the curriculum is to develop a postgraduate course integrated into daily clinical practice allowing a maximum of flexibility to learners.A curriculum committee consisting of experts in the field of EBM, clinical epidemiologists, clinicians and educationalists from the participating countries commenced the work. We based the design and development of the EBM curriculum on an educationally sound methodology includin• identification of EBM needs in each partner country• formulation of the aims, objectives and learning outcomes of the curriculum• development and organisation of the content of the curriculum• development of the teaching methods• definition of the educational strategy and educational environment• definition of the assessment strategy• communication of the curriculum to learners• the overall management of the process.In addition, an independent European Steering Committee provided input into the content, educational approach, applicability and sustainability, giving advice at critical stages in the curriculum development and thereby assured external validation and triangulation of the syllabus prepared.First we identified specific needs of learners, which could direct the curriculum development. Definitions needed to take into account differences in levels of EBM education and the variety of teaching and learning opportunities across European health care systems. This was mainly done by an in-depth discussion among the participating experts at the beginning of the project, who had a good overview of the ongoing activities in their countries, with input from the external steering committee. This process helped to identify definable educational goals for the documented learning needs. During meetings, consensus was achieved in a Delphic fashion on the nThe aim was to familiarise course participants with EBM basics to help them incorporate evidence from systematic reviews on therapeutic interventions into daily clinical practice. It was stipulated that the course should be clinically integrated with a large component of e-learning. To meet these objectives we aimed at short individual sessions to allow learning at the worksite during a short break, with the e-learning modules structured in a way they can be easily interrupted and taken up again. The following learning objectives and outcomes were identified: "After completion of the course, participants should first be able to generate structured questions arising from problems in their own clinical practice in PICO format . AlthougThe curriculum is subdivided into five modules each of which addresses core competencies in evidence-based practice.These modules are:1. Asking and framing clinical questions.2. Searching for the evidence3a. Critical appraisal of primary randomised controlled trials3b. Measures of effectiveness3c. Critical appraisal of systematic reviews of intervention studies4. Applicability of the evidence to the patient5. Implementation of the evidence into practiceAt the beginning of the course, learners and facilitators receive a handbook with the overall aims and objectives of the curriculum and modules, relevant additional methodological and clinical papers, an outline of the teaching, learning and assessment strategy, and its timetable. The 5 modules of the course are delivered sequentially over a period of 5 weeks. Order and sequence of the teaching sessions ensure that the prerequisites and the basic content appear first while more advanced content appears later. We refer to Table Each of the sessions integrates a combination of teaching methods: Figure :• A facilitator (e.g. the supervising consultant) plays a central role in the clinically integrated curriculum by acting as a moderator in the learning process of the learner, by identifying learning opportunities encountered by the learners in daily care for patients and by directing appropriate use of learning resources in a clinical setting. This could be done during ward-rounds, daily meetings when shifts are transferred, in fact the facilitator can point out learning opportunities in every patient-doctor encounter.• Self-directed, independent e-learning via the Internet or CD-ROM. These sessions (one or more per module) are structured such that a learner can work them through in 10 to 20 minutes. This allows maximum flexibility to the learner and easy access from multiple sites, both inside and outside the hospital, which addresses the needs of a busy clinician. The e-learning materials consist of slides and written scripts; a talking head which covers the content of the scripts and guides the lecture; play, pause and skip options; and hyperlinks to main sections within the sessions. An example of one of the e-learning modules is shown in Figure • A variety of minor activities where learners perform practical tasks and thereby transfer their knowledge into skills. The learner is expected to frame five clinical questions according to the PICO format from problems encountered in daily practice, to develop two structured search strategies in Pubmed, to appraise a randomised clinical trial on the topic on several validity items, to identify the (dis)similarity of their clinical patient with the patients included in the systematic review, and to read an essay on barriers that exist when implementing EBM in daily clinical practice.• Each module ends with an assignment that learners hand in to the facilitator, such as the search used to identify a systematic review for one of PICO questions formulated in the first module, or a paper on the learner's deliberations on how to implement the found evidence in their own clinical setting. By providing feedback on learning exercises/assignments, these assignments can act as a starting point for a one-to-one interaction between learner and facilitator or a small group discussion in the resident's regular teaching session. Before moving to the next module, learners will finish each module with a multiple choice questionnaire that covers the content of that specific module. All completed assignments contribute to the learner's documented portfolio.Many educational models have been developed on which teaching strategies can be based . We chosThe course will be piloted formally on ten doctors per participating country . The curriculum assessment concerns evaluation of participants' knowledge, skills and attitudes through formative and summative assessments. For this, a multiple choice questionnaire (MCQ) was modelled according to the validated Berlin Questionnaire that evaTo assure sustainability, an independent steering committee of clinical epidemiologists, EBM experts and educational experts from countries both participating and non-participating in the partnership overlooked the development of the curriculum, content of the teaching materials, its assessment and the evaluation of the pilot project. The committee gave advice to strategic questions addressing implementation and dissemination across Europe and provided external feedback to the group.On national levels the project aims to obtain certification by continuous medical education agencies, in line with the Copenhagen Declaration (2002) of the European Union , which iThe EU-EBM curriculum presented in this paper targets postgraduate training and continuing education, using a clinically integrated e-learning methodology. To our knowledge, clinically integrated teaching of EBM is currently not provided in Europe. Furthermore, existing courses do not have a comparable format with continuous repetitive learning over a longer period, which includes small activities and individualised assignments to acquire skills and to deepen knowledge, standardised assessments at the end of each module and special emphasis on implementation of evidence in practice. Furthermore, one of the main innovations here is to get European countries to work together in order to harmonize an integrated teaching of EBM, which has not been subject of any harmonization effort before.The main purpose of the curriculum is to provide doctors with the basic skills needed to practice and implement evidence-based therapy. For this, the course covers the 5 key steps of evidence based practice, namely framing the clinical question, searching for the evidence, appraisal and interpretation of the evidence, applying the evidence to the patient and implementing the evidence into practice, using problems encountered in daily patient care. An e-learning platform or accesA distinct feature of the EU-EBM curriculum is the low threshold approach to facilitate integrated EBM teaching and thereby addressing specific problems of the target group. Teaching basic concepts in short learning units and allowing maximum flexibility in the location of the learning takes into account the timeframe and working patterns of busy clinicians. The course separates the practice of EBM in the day-to-day patient encounter from the acquisition of methodological knowledge which is mainly taught on the e-learning platform. An EBM enthusiastic senior clinician can act as a moderator in this learning process, but is not expected to teach the methodology of EBM. This division of responsibilities fosters the spread of EBM-teaching and learning to clinical settings with strong interest for EBM but with a lack of specialists teaching the methodology of critical appraisal. Inspired learners will receive additional reading material and guidance on how to advance their skills. Furthermore, groups of residents could pass the course simultaneously as part of their in-house training. We envision that this joint learning experience might stimulate constructive critical reflection on current clinical practice beyond the specific course content, initiating a new culture of discussion and EBM-practice within a department or unit. Last but not least, the translation of the curriculum in French, German, Spanish, Hungarian and Polish should help non-native English speakers to learn new concepts in their own language and ensure greater accessibility of the learning materials.The key aims of this project will need to be met by raising awareness of the importance of training in EBM throughout Europe as a means of enabling health care professionals to provide better care to patients and ultiSo far, in this pilot project, we only covered one unit of EBM, namely systematic review of therapeutic effectiveness, due to time and financial constraints. Furthermore, the current program is designed for medical doctors. However, numerous organisations of allied health professionals already expressed interest in this course as did consumer organisations and patient self-help groups. We need testing of the existing course in those groups and modify it according to their learning needs. Furthermore, the course is so far only available in six different languages. Additional translation in other European and non-European languages might be warranted. The curriculum assessment currently contains evaluation of participants' knowledge, skills, and attitudes. Although we acknowledge that behavioural changes are essential to fully implement life long learning, measurement of such changes require longer follow-up than is possible within the current duration of this pilot-project.Once fully implemented, the ultimate outcome of this pilot project will be a European qualification in EBM, which will be used by doctors, hospitals, professional bodies responsible for postgraduate qualifications and continuous medical education. In the long term this project has the potential to benefit the general public as EBM will contribute to a more transparent healthcare system, better-informed patients and a generally better informed society, which is what EBM is all about.The EU-EBM project has shown that it is possible to harmonize EBM teaching across Europe, with the development of a clinically integrated course based on e-learning technologies. The course is designed to provide just-in-time learning through on-the-job-training, with the potential for teaching and learning to directly impact on practice.The author(s) declare that they have no competing interests.SC, JE, JH, BWM, RMK, RAK and KSK drafted the first version of the manuscript. All authors revised the manuscript and approved final submission for publication. All authors are member of the EU-EBM and were involved in the design, development and implementation of the course described.The pre-publication history for this paper can be accessed here:

Internet search patterns have emerged as a novel data source for monitoring infectious disease trends. We propose that these data can also be used more broadly to study the impact of health policies across different regions in a more efficient and timely manner.As a test use case, we studied the relationships between abortion-related search volume, local abortion rates, and local abortion policies available for study.Our initial integrative analysis found that, both in the US and internationally, the volume of Internet searches for abortion is inversely proportional to local abortion rates and directly proportional to local restrictions on abortion.These findings are consistent with published evidence that local restrictions on abortion lead individuals to seek abortion services outside of their area. Further validation of these methods has the potential to produce a timely, complementary data source for studying the effects of health policies. Traditional health surveillance techniques are limited in their abilities to measure the impact of health policies in a timely and geographically comprehensive fashion. Emerging surveillance approaches that track patterns of online searches have the potential to provide timely global population health monitoring across a range of health indicators . These sAs an example of the potential value of search query data, we focus on the relationship between local abortion policies and local abortion rates, both in the US and internationally. Abortion policies and their effects have been widely researched, and their impact continues to be intensely debated around the world. Major issues include differences in ethical and cultural approaches towards abortion and concerns about patient safety -10. The We propose that Internet search patterns could provide a complementary information source for understanding the impact of abortion policies in a specific region. When analyzed in conjunction with information on the region's abortion policies, these data could be used to study the relationships between abortion policies and rates. In this brief report, we describe an initial proof-of-concept evaluation of these methods.For our initial analysis, we examined four types of abortion data in each of the 50 US states: 1. Abortion rates - percentage of all pregnancies that end in abortions, excluding fetal deaths and miscarriages; 2. Abortion policies, such as mandatory waiting periods and parental consent; 3. Abortion availability - percentage of counties with providers; and 4. Legal context, including current and past legislation. We compared these data to abortion search volume by state, defined as relative Internet search volume for the term "abortion", normalized by total Internet search volume for that state. We also compared abortion search volume and abortion rates and restrictions across 37 different countries, using 19 search terms to cover the term "abortion" across the major languages used in these countries. All search statistics examined were anonymous summary statistics and were further aggregated over an entire state or country over an entire year in order to address potential privacy concerns surrounding the analysis of Internet search data.http://unstats.un.org), the United States Centers for Disease Control and Prevention (cdc.gov), the Gutmacher institute http://www.guttmacher.org, and the Johnston Archive http://www.johnstonsarchive.net. Data on search volume were obtained from Google Insights for Search http://www.google.com/insights/search/, representing the proportion of Google Web searches performed in a particular geographic region relative to the total number of searches performed in that region. Regions with insufficient data were excluded. We used the following 19 search terms to cover abortion in multiple languages: abortion, aborto, abortus, avortement, аборт, 流 产, 中 絶 pobačaj, potrat, abort (Scandinavia only), abortti, abtreibung, abortusz, הלפה, abortas, aborcji, aborcja, aborcje, and avort. Search volumes for the different search terms were scaled against common reference statistics to allow for comparison across languages. Data regarding restrictions on abortion for each country included whether abortion was available on request, for economic or social reasons, to preserve mental health, to preserve physical health, in cases of fetal impairment, in cases of rape or incest, or to save a woman's life http://unstats.un.org. All data regarding abortions referred to legal abortions that were reported, and do not account for the potential impact of illegal abortions that most often go unreported.A comprehensive set of abortion and search data were available for 2004. Abortion statistics were obtained from the United Nations (data freely available at inverse correlation to local abortion rates (Spearman's Rho -0.547, p < 0.001.; Figures Looking at abortion rates across the 50 US states, abortion search volume had a strong In the international analysis of 37 countries, search volume for abortion was also inversely proportional to local abortion rates (Rho = -0.484, p = 0.004; Figures inverse relationship to local abortion rates and availability, and a significant direct relationship to the legislative and policy restrictions on abortion available for study. One likely interpretation of these findings is that individuals with limited access to local abortion services typically use the Internet to search for providers outside their area, while those with greater access to local abortion services may access them through local channels and are thus less likely to turn to the Internet to find an abortion provider. This interpretation is consistent with published evidence that local restrictions lead individuals to seek abortion services outside their area [Our case study examining the relationship between abortion policies and abortion rates reveals the potential value of Internet search patterns as a complementary measure of the impact of health policies. Perhaps the most interesting overall finding from this initial analysis is that abortion search volumes had a significant eir area ,12.Another interesting finding is that the coastal US states (blue, Figure Further validation of these Internet search data has the potential to provide a valuable complementary data source for measuring the effects of health policies. Basic privacy issues around search data make accessing individual search records for the purposes of validation unfeasible. Furthermore, Internet-based surveys of this topic would be difficult given the sensitivity of the topic. Therefore, a fuller validation of these methods would require a resource intensive observational study. Such a study could involve classic community-based survey or potentially a survey performed at the clinics themselves to determine what the individuals were seeking in their Internet searches, why they chose to search on the Internet as opposed to other means, whether they eventually received an abortion, and if so, where the abortion was performed. Such a study could then be used to further examine the relationships between abortion-related searches, individual searchers' motivations, and rates of procedures performed. This validation could only take place in certain settings, as many of the countries where search results are available would not allow such an analysis for a variety of political or other reasons, highlighting one of the potential advantages of such data to overcome international barriers to health policy research.Timeliness - while traditional data often take years to collect, search data are available in near-real-time; Efficiency - while traditional measures require dedicated reporting infrastructure in each region, and many countries do not have strong public health reporting infrastructures, search data may be automatically collected in a centralized fashion; and Transparency - as mentioned above, search data are available outside traditional reporting channels and thus subject to less government censorship and control.Search data have a number of advantages over traditional surveillance sources that make them attractive as potential measures of health outcomes and policies: Limitations of search data include varying online access and Internet search usage across different demographic, socioeconomic and geographic subpopulations, and searches for abortion by individuals who are not seeking abortion services. Evaluation across a range of different settings and topics will provide a deeper understanding of the strengths and weaknesses of these data. Evaluation will also further clarify the potential benefits of conducting analyses based on data collected over long periods of time, compared to data collected over shorter periods of time that may be subject to a variety of transient effects. Furthermore, access to information on illegal abortions, may provide additional insight into the value of Internet query surveillance.Due to their significant advantages in timeliness, efficiency, and transparency, search data have the potential, with adequate validation, to become an important complementary data source for researchers and decision-makers studying the effects of public health policies in local and international settings.The authors declare that they have no competing interests.BR and JB conceived of the study, collected and analyzed data and wrote and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2458/10/514/prepub

Inclusions of TAR DNA binding protein-43 (TDP-43) are the defining histopathological feature of several neurodegenerative diseases collectively referred to as TDP-43 proteinopathies. These diseases are characterized by the presence of cellular aggregates composed of abnormally phosphorylated, N-terminally truncated and ubiquitinated TDP-43 in the spinal cord and/or brain. Recent studies indicate that C-terminal fragments of TDP-43 are aggregation-prone and induce cytotoxicity. However, little is known regarding the pathways responsible for the degradation of these fragments and how their phosphorylation contributes to the pathogenesis of disease.220-414). We report that expression of this fragment within cells leads to a time-dependent formation of inclusions that are immunoreactive for both ubiquitin and phosphorylated TDP-43, thus recapitulating pathological hallmarks of TDP-43 proteinopathies. Phosphorylation of GFP-TDP220-414 renders it resistant to degradation and enhances its accumulation into insoluble aggregates. Nonetheless, GFP-TDP220-414 inclusions are reversible and can be cleared through the ubiquitin proteasome system. Moreover, both Hsp70 and Hsp90 bind to GFP-TDP220-414 and regulate its degradation.Herein, we established a human neuroblastoma cell line (M17D3) that conditionally expresses an enhanced green fluorescent protein (GFP)-tagged caspase-cleaved C-terminal TDP-43 fragment (GFP-TDPOur data indicates that inclusions formed from TDP-43 C-terminal fragments are reversible. Given that TDP-43 inclusions have been shown to confer toxicity, our findings have important therapeutic implications and suggest that modulating the phosphorylation state of TDP-43 C-terminal fragments may be a promising therapeutic strategy to clear TDP-43 inclusions. Inclusions of TAR DNA binding protein-43 (TDP-43) are the defining histopathological feature of frontotemporal lobar degeneration with ubiquitin-positive inclusions (FTLD-U) and amyotrophic lateral sclerosis (ALS) ,2. UnderRecent findings have shown that TDP-43 C-terminal fragments form cytoplasmic aggregates and cause cytotoxicity ; thus, Tin vitro phosphorylation of recombinant full-length TDP-43 by casein kinases enhances TDP-43 oligomerization and fibrillization [in vitro.The hyperphosphorylation of aggregated proteins is a common feature of many neurodegenerative diseases. For instance, the microtubule-associated protein tau is abnormally phosphorylated in Alzheimer's disease as is α-synuclein in Parkinson's disease. It is believed that an imbalance of kinase and phosphatase activity contributes to the abnormal phosphorylation state of tau, which impairs the normal functioning of tau while inhibiting its degradation and facilitating its assembly into paired helical filaments . With relization . Howeverlization . Even th220-414), and we examined how the phosphorylation state of GFP-TDP220-414 impacts its solubility, aggregation and degradation. We found that the gradual expression of GFP-TDP220-414 within cells caused the formation of cytoplasmic inclusions that were immunoreactive for both ubiquitin and phosphorylated TDP-43. Of great significance, we found that these inclusions could be cleared through the UPS, although phosphorylation of TDP-43 C-terminal fragments delayed their degradation. Knocking-down the expression of heat shock proteins (Hsp), Hsp70 or Hsp90, impaired the clearance of GFP-TDP220-414 and led to the preferential accumulation of phosphorylated species, which suggests that the Hsp90/Hsp70-based chaperone machinery regulates the degradation of phosphorylated C-terminal TDP-43 fragments. Our findings provide novel insight into understanding how phosphorylation affects the degradation and aggregation of TDP-43 C-terminal fragments. Furthermore, given that TDP-43 inclusions have been shown to confer toxicity [To bridge this gap in our understanding, we generated a human neuroblastoma cell line M17D3) that conditionally expresses an enhanced green fluorescent protein (GFP)-tagged caspase-cleaved C-terminal TDP-43 fragment were transiently expressed in human neuroblastoma M17 cells and compared to the expression of full-length TDP-43. The transient expression of GFP alone, full-length TDP-43 and all three fragments resulted in a similar level of protein expression , indicating that inclusion formation was not merely due to the GFP tag. Note that only TDP-43 fragments were phosphorylated at pathologically specific sites (serine 409 and serine 410) [208-414, GFP-TDP220-414 and GFP-TDP247-414, but not that of GFP-TDP-43, appeared to moderately induce the molecular chaperone Hsp70 in order to study how phosphorylation influences degradation and inclusion formation of TDP-43 C-terminal fragments.In TDP-43 proteinopathies, TDP-43 is cleaved to generate C-terminal fragments . Given tn Figure . Full-len Figure , which i0 Figure , suggest0 Figure . Based o220-414 in the absence of doxycycline, a tetracycline derivative. No GFP-TDP220-414 was expressed in cells when doxycycline was present that inducibly expresses GFP-TDPt Figure and 2B, 4 Figure . GFP-TDP8 Figure . By 6 dag Figure . The appg Figure . Cleavagg Figure .220-414 . Of interest, phosphorylated-GFP-TDP220-414 was cleared from cells more slowly than total GFP-TDP220-414 was concentrated in the detergent soluble fraction also leads to inclusion formation. By slowing the time-course over which inclusions are formed, we were able to investigate the aggregation process in more detail. It is important to note that numerous small cytoplasmic inclusions were observed within cells as early as 2 days following the induction of GFP-TDP220-414 promoter [220-414 in our inducible cell model, it is ideally suited to assess steady-state levels of GFP-TDP220-414 and how GFP-TDP220-414 protein levels are affected upon treatment with proteasome inhibitors. Our findings indicate that GFP-TDP220-414 was ubiquitinated and markedly accumulated when cells were treated with the proteasome inhibitor, MG-132. In contrast, only modest increases in GFP-TDP220-414 were observed following inhibition of the autophagic-lysosomal pathway. The accumulation of GFP-TDP220-414 upon proteasome inhibition was specific, since GFP, unlike GFP-TDP220-414, did not accumulate during MG-132 treatment. These findings suggest that C-terminal TDP-43 fragments are degraded predominantly through the UPS At the time-points examined, the inclusions are reversible and cleared primarily through the UPS; 3) Phosphorylation of TDP-43 C-terminal fragments slows degradation and likely facilitates aggregation; and 4) Hsp70 and Hsp90 regulate GFP-TDP220-414 degradation, such that knocking-down Hsp70 or Hsp90 expression causes GFP-TDP220-414, and especially phosphorylated-GFP-TDP220-414, to accumulate. Our findings provide novel insight regarding the influence of phosphorylation on the degradation and aggregation of TDP-43 C-terminal fragments. Because phosphorylation may hinder TDP-43 degradation and accelerate inclusion formation in disease, modulating the phosphorylation state of TDP-43 truncation products may prove to be a promising therapeutic approach to enhance clearance of TDP-43 inclusions. Indeed, it is most promising that our results indicate that inclusions, once formed, can be reversed. Our novel cell model provides an ideal tool for high-throughput screening of small-molecule libraries for the identification of compounds that diminish TDP-43 inclusions.In summary, the findings of the present study indicate: 1) Gradual expression of GFP-TDP208-414 and GFP-TDP247-414) were generated by PCR to fuse GFP to the 5' end of TDP-43. The primers were: GFP-TDP208-414: 5'-CGGGATCCATGCGGGAGTTCTTCTCTCAGTACG-3' and 5'-GCTCTAGACTACATTCCCCAGCCAGAAGAC-3'; GFP-TDP247-414: 5'-CGGGATCCGACTTGATCATTAAAGG-3' and 5'-GCTCTAGACATTCCCCAGCCAGAAGAC-3'. The PCR product was subcloned into the pEGFP-C1 vector (Clontech) using restriction sites BamHI and XbaI.The GFP-tagged TDP-43 C-terminal fragments was used to eliminate the SacII site using the following primers: 5'-GAATTCTGCAGTCGACGGTACAGCAGGCCCGGGATCCATG-3' and 5'-CATGGATCCCGGGCCTGCTGTACCGTCGACTGCAGAATTC-3'. Afterwards, the pTRE-GFP-TDPX-X plasmids were generated using primers 5'-TCCCCGCGGCGCCACCATGGTGAGCAAG-3' and 5'-GCTCTAGACTACATTCCCCAGCCAGAAGAC-3'. The pTRE-GFP plasmid was generated by using the primers: 5'-TCCCCGCGGCGCCACCATGGTGAGCAAG-3' and 5'-GCTCTAGACTACTTGTACAGCTCGTCCATG-3'. The pTRE-GFP-TDPX-X or pTRE-GFP plasmids conditionally express GFP-tagged full-length TDP-43, TDP-43 C-terminal fragments or GFP upon removal of doxycycline from the media.The pTRE-GFP-TDPTo detect if various TDP-43 C-terminal fragments share similar pathological features in cells, M17 founder cells were grown in 24-well or 6-well plates in Opti-Mem supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin. When cells reached 90% confluency, they were transfected with 0.3 μg/well (24-well plate) or 1 μg/well (6-well plates) of plasmid using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. After 48 h, the cells were fixed for confocal analysis or harvested for Western blot analysis.220-414 plasmid, M17 D cells were seeded in a 10 cm dish. Once 90% confluency was reached, cells were cotransfected with 5 μg pTRE-GFP-TDP220-414 and 0.5 μg PVGRX (zeocin-resistant gene) by using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. Forty-eight hours after transfection, the cells were suspended in 5 ml medium, and then suspended cells were diluted 1000 times and seeded in a 10 cm dish. Twenty-four hours later, 100 μg/ml zeocin was added to the medium to screen for clones resistant to zeocin. After incubating cells for 10 days, single clones were picked and seeded into a 24-well plate. When the cell confluency reached ~80%, each clone was split into duplicate wells and cells were grown in Opti-Mem supplemented with 10% FBS, 1% penicillin/streptomycin, 400 μg/ml G418, 1 μg/ml doxycycline and 100 μg/ml zeocin. When cell confluency reached ~80%, doxycycline was removed from one of the duplicate wells to induce transgene expression. Inclusion formation was monitored by fluorescence microscopy. The clone M17D3 was chosen and used throughout the study.The human neuroblastoma M17 D tetracycline off (TetOff) founder line has previously been described . M17 D c220-414 protein expression by Western blotting, M17D3 cells, seeded at 6.0 × 104 cells per well in 24-well plates or at 2.4 × 105 cells per well in 6-well plates, were grown in culture medium in the presence of 1 μg/ml doxycycline to inhibit GFP-TDP220-414 expression or in the absence of doxycycline to induce GFP-TDP220-414 expression. Cells were fixed or harvested at the indicated time-points for confocal microscopy and Western blot analysis, respectively.To examine inclusion formation by confocal microscopy and to assess GFP-TDP220-414 expression can be degraded when protein expression is arrested, GFP-TDP220-414 was inducibly expressed for 5 days. On day 5, 1 μg/ml doxycycline was added to the culture medium to halt GFP-TDP220-414 expression. Also added was 10 μM MG-132 (proteasome inhibitor), 50 μM chloroquine (lysosome inhibitor), 10 mM NH4Cl (lysosome inhibitor) or 10 mM 3-MA (autophagy inhibitor). On day 6, cells were fixed or harvested for confocal microscopy and Western blot analysis, respectively.To determine whether inclusions formed during GFP-TDP220-414, its expression was induced for 5 days, at which point 1 μg/ml doxycycline was added to the medium to halt transgene expression. Cells were harvested at 0, 6, 12, 18 or 24 hours after the addition of doxycycline for Western blot analysis.To determine the half-life of GFP-TDP220-414 is not simply due to targeted degradation of the GFP tag, M17 founder cells seeded in 6-well plates were transfected with 0.5 μg of pTRE-GFP-TDP220-414 or pTRE-GFP plasmid in the presence or absence of 1 μg/ml doxycycline. Twenty-four hours after transfection, 1 μg/ml doxycycline (with or without 10 μM MG-132) was added to the culture medium and cells were harvested for Western blot analysis 24 hours later.To confirm that degradation of GFP-TDP220-414 degradation, their expression was reduced by using small interfering RNA (siRNA). Briefly, M17D3 cells, seeded at 2.4 × 105 cells per well in 6-well plates, were grown in doxycycline-free medium for 4 days. Then, 20 nM/well of siRNA was transfected into cells using siLentFect transfection reagent (Bio-Rad) according to the manufacturer's instructions. After 48 hours, cells were harvested for Western blot analysis. The siRNA was predesigned by Qiagen. The sense sequence for each were: Hsp90 r(CCGACGAUAUUACUAAUGA)dTdT; Hsp70 r(CCAUUGAGGAGGUAGAUUA)dTdT.To determine if Hsp90 or Hsp70 knockdown affects GFP-TDPTo determine if inclusions composed of C-terminal fragments are ubiquitinated and phosphorylated, cells grown on coverslips were fixed with 4% paraformaldehyde in phosphate-buffered saline (PBS) at 4 °C for 15 min, and then permeabilized with 0.5% Triton X-100 in PBS for 10 min. After blocking with 5% bovine serum albumin for 1 h at 37 °C, the cells were incubated overnight at 4 °C with rabbit polyclonal ubiquitin antibody or rabbit polyclonal anti-pTDP-43 . After washing, cells were incubated with the Alexa 568-conjugated goat anti-mouse or anti-rabbit IgG secondary antibody . Hoechst 33258 (1 μg/ml) was used to stain the nuclei and images were obtained on a Zeiss LSM 510 META confocal microscope.220-414. Cells were harvested 48 h later using Co-IP buffer containing PMSF as well as protease and phosphatase inhibitors. The lysates were sonicated and centrifuged at 16,000 g for 20 min. The protein concentration of supernatants was determined by BCA assay (Thermo Scientific). Supernatant containing 300 μg of total protein was pre-cleared with 15 μl Protein G agarose (Pierce) for 30 min, then incubated with rabbit polyclonal anti-GFP antibody overnight at 4 °C with gentle shaking. Next, 15 ul Protein G agarose was added to capture the protein-antibody complex. Following a 6 h incubation at 4 °C, the agarose was pelleted by centrifugation at 1, 000 g for 3 min and washed with Co-IP buffer 6 times. Captured protein was eluted from the beads using sample loading buffer and resolved by SDS/PAGE for Western blot analysis.For co-immunoprecipitation studies, M17 founder cells were cotransfected with 0.5 μg HA-Ubiquitin and 1 μg GFP or GFP-TDPBriefly, cells were lysed in a buffer containing Co-IP buffer plus PMSF and both a protease and phosphatase inhibitor mixture. After sonication, cells were centrifuged at 16,000 g at 4°C for 20 min. Triton X-100-insoluble pellets were dissolved in the Co-IP buffer plus 1% SDS, PMSF, and both a protease and phosphatase inhibitor mixture. The soluble and insoluble fractions were used for Western blot analysis.220-414, phosphorylated-GFP-TDP220-414, Hsp70 and Hsp90 were normalized to their corresponding GAPDH bands to correct for protein loading.Cells were lysed in lysis buffer consisting of Co-IP buffer plus 1% SDS, PMSF, and both a protease and phosphatase inhibitor mixture. The protein concentration of cell lysates was measured using a BCA assay (Pierce). Samples were heated in Laemmli's buffer and equal amounts of protein were loaded into 10-well 4-12% Bis-Tris gels . After transfer, blots were blocked with 5% nonfat dry milk in TBST (TBS plus 0.1% Triton X-100) for 1 h, and then blots were incubated with rabbit polyclonal cTDP-43 antibody , rabbit polyclonal GFP antibody , rabbit polyclonal anti-pTDP-43 , mouse monoclonal GAPDH antibody , mouse monoclonal Hsp70 antibody , rabbit polyclonal LC3B antibody or rat monoclonal Hsp90 antibody overnight at 4°C. Membranes were washed three times for 10 min in TBST and then incubated with donkey anti-rabbit, anti-mouse or anti-rat IgG conjugated to horseradish peroxidase for 1 hour. Membranes were washed three times each for 10 min, and protein expression was visualized by ECL treatment and exposure to film. The levels of total GFP-TDPData from 3 separate experiments were analyzed by 1-way ANOVA, followed by Tukey's posthoc analysis.(ALS): amyotrophic lateral sclerosis; CMV: cytomegalovirus; FBS: fetal bovine serum; FTLD-U: frontotemporal lobar degeneration with ubiquitin-positive inclusions; GFP: green fluorescent protein; HMW: high-molecular weight; Hsp: heat shock proteins; PBS: phosphate-buffered saline; TDP-43: TAR DNA binding protein-43; UPS: ubiquitin-proteasome systemThe authors declare that they have no competing interests.YZ and YX performed experiments. YZ and TG performed data analysis and co-wrote the manuscript. TG contributed to the siRNA knock-down and solubility studies. LK and SY provided M17D cell line and assistance with the characterization of the cell culture model. LP conceived of the study, participated in its design and coordination and edited the manuscript. All authors read and approved the final manuscript.

The thio­phene-2,5-dicarboxamide core approximates C 2 point symmetry. The tetra­hydro­furan solvent mol­ecule is linked to the main mol­ecule through an inter­molecular N—H⋯O hydrogen bond. The central ring makes dihedral angles of 90.0 (2) and 76.5 (2)° with the pendant rings.The title compound, C Å b = 12.1810 (4) Å c = 29.6787 (11) Å V = 3002.06 (17) Å3 Z = 4 Kα radiationMo −1 μ = 0.16 mmT = 293 K 0.40 × 0.21 × 0.08 mm Oxford Xcalibur (Eos) CCD detector diffractometerCrysAlis PRO RED; Oxford Diffraction, 2009T min = 0.941, T max = 0.988Absorption correction: multi-scan (7782 measured reflections5081 independent reflectionsI > 2σ(I)3167 reflections with R int = 0.022 R[F 2 > 2σ(F 2)] = 0.047 wR(F 2) = 0.094 S = 0.91 5081 reflections363 parametersH-atom parameters constrainedmax = 0.19 e Å−3 Δρmin = −0.21 e Å−3 ΔρAbsolute structure: Flack 1983, 1964 FrFlack parameter: −0.05 (9) CrysAlis PRO CCD (Oxford Diffraction, 2009CrysAlis PRO CCD; data reduction: CrysAlis PRO RED (Oxford Diffraction, 2009SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008Mercury (Macrae et al., 2008SHELXL97.Data collection: 10.1107/S1600536810034410/bh2306sup1.cif Crystal structure: contains datablocks global, I. DOI: 10.1107/S1600536810034410/bh2306Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

Stem cells are a unique source of self-renewing cells within the human body. Before the end of the last millennium, adult stem cells, in contrast to their embryonic counterparts, were considered to be lineage-restricted cells or incapable of crossing lineage boundaries. However, the unique breakthrough of muscle and liver regeneration by adult bone marrow stem cells at the end of the 1990s ended this long-standing paradigm. Since then, the number of articles reporting the existence of multipotent stem cells in skin, neuronal tissue, adipose tissue, and bone marrow has escalated, giving rise, both in vivo and in vitro, to cell types other than their tissue of origin. The phenomenon of fate reprogrammation and phenotypic diversification remains, though, an enigmatic and rare process. Understanding how to control both proliferation and differentiation of stem cells and their progeny is a challenge in many fields, going from preclinical drug discovery and development to clinical therapy. In this review, we focus on current strategies to differentiate embryonic, mesenchymal(-like), and liver stem/progenitor cells into hepatocytes in vitro. Special attention is paid to intracellular and extracellular signaling, genetic modification, and cell-cell and cell-matrix interactions. In addition, some recommendations are proposed to standardize, optimize, and enrich the in vitro production of hepatocyte-like cells out of stem/progenitor cells. The totipotent fertilized egg is the ultimate stem cell that gives rise to all tissues of the developing embryo. In the adult, “multipotent” stem/progenitor cells reside for a nearly infinite term at restricted locations to allow continuation of the cycle of life –3. These3–106 cocultured cells +/albumin [ALB]+, and biliary cytokeratin 8.5), specification from endodermal stem cells toward the hepatic epithelial lineages requires, next to HNF3β and activin A signaling, signaling from two adjacent mesodermal cell types: FGFs (FGF1 and basic bFGF) from the cardiogenic mesoderm cells, and BMPs from the septum transversum mesenchyme –29 Fig.. Then (a+/CK19+) –29. At r+/CK19+) , 29. Cone kinase , 29. As e kinase , 29. Dife kinase , 29, 30.e kinase , 33. Sube kinase , 28, 33 e kinase , 29. ComKey signaling and molecular cross-talk events are thus patterned to occur in the right place at the right time . InteracES cells spontaneously differentiate into cell types of the three germ layers, including hepatocytes, upon removal of leukemia inhibitory factor and feeder layers –37. The The use of growth factors and cytokines is pivotal for hepatic growth of ES cells in vitro. Hormones and corticosteroids have a supporting role .Basically, activin A enriches ES cell cultures for endodermal populations , 39 and Imitation of the ontogenic scaffold (particularly collagen) , 52–58 a(a) LETFS overexpression. HNF3β functions as a vital regulator of the initial intracellular signaling pathways in liver development/regeneration , 32 Fig. In addi(b) Epigenetic modification. The actual idea of changing cell fate via direct interference with the local chromatin structure of plastic cells was introduced only a few years ago. In 2003, ES exposure to 5 mM sodium butyrate led to 10%–15% enrichment with pure hepatic cells . Lately,Unidirectional/downstream differentiation into other mesenchymal cell types, such as adipocytes, chondrocytes, and osteoblasts readily occurs in the presence of a simple cocktail of growth factors and nutrients . SuccessMultipotent adult progenitor cells (MAPCs), discovered by Verfaillie and coworkers, were the first plastic cells found within adult bone marrow that gained the ability to undergo hepatic differentiation. Using combined exposure to FGF + HGF + ITS + dexamethasone, MAPCs transformed into cells with morphological, phenotypic, and functional characteristics of hepatocytes . Yet, thCocultures of stromal bone marrow cells with primary hepatocytes were at first designated to develop long-term functional hepatic in vitro models . Jagged1Another critical factor affecting cellular differentiation status is the spatial distribution between cells. Differentiation is usually initiated upon 60%–100% confluence . Signifi(a) LETFS overexpression. To the best of our knowledge, only one study thus far has investigated the putative inductive effect of LETFs on hepatic differentiating MSCs. More specifically, Talens-Visconti et al. confirme(b) Epigenetic modification. Epigenetic modification may contribute to overcome cell fate. determinism of MSCs. As such, we found previously that addition of 1 μM trichostatin A (TSA) to cultured human (h) MSCs, pretreated for 6 days with hepatogenic stimulating agents, triggers their “transdifferentiation” into cells with phenotypic and functional characteristics similar to those of primary hepatocytes . In lineLPCs mainly comprise a bipotent progenitor cell population within the liver . Their bDifferentiation of LPCs into either the biliary or hepatic lineage greatly depends on the type of growth factor/cytokine used. (a) In midphase fetal liver, transforming growth factor (TGF) β promotes LPCs to undergo biliary differentiation , whereasGuidance of their cell fate by corticosteroids and hormones is less unidirectional. For example, dexamethasone upregulates the number of both hepatic- and bile duct-like cells in LPCs derived from midphase fetal mouse liver tissue . DespiteThe decisive factor of the microenvironment in directing the liver ontogeny underlines the importance of local cell and tissue paracrine signaling. In the context of this rationale, cocultivation of LPCs with stellate cells and mesenchymal feeder layers, including embryonic chick lung mesenchyme, growth-inhibiting embryonic STO fibroblast, or mesenchymal NIH3T3 fibroblast feeder layers, stimulate differentiation along the hepatic lineage , 104. CuBesides signals secreted by the surrounding environment, cell density may also trigger differentiation. In essence, the differentiation efficiency is linearly related to the level of confluence , 108.Long before their first introduction as cell fate modulators in ES and MSC cultures, epigenetic modification was found to actively contribute to the regulation of liver stem cell responses. The most commonly used HDACis in LPC cultures are DMSO and sodium butyrate , 108–111Stem cell-derived hepatocyte-like cells may be characterized in vitro at four levels: morphological, RNA, protein, and activity levels. Usually, the analytical work is limited to the elucidation of (a) endodermal/hepatogenic RNA transcripts via (quantitative) reverse transcriptase-polymerase chain reaction and (b) proteins by immunofluorescence. The most studied endodermal markers include LETFs , plasma proteins , and cytoskeletal proteins –3. A minThe following three features inherent to hepatic stem cell transitions need to be taken into account to perform accurate phenotyping. (a) The differentiation of stem/progenitor cells toward the hepatocyte lineage often involves uncontrolled processes, resulting in a heterogeneous cell population. Genes such as TAT , phospho(b) The differentiation of hepatoblasts into hepatocytes is a steady process. It is known that embryonic, fetal, and adult hepatocytes differ in their molecular phenotype , 2. BasiPfp/Rag2−/− . Dosage, timing, and combinations of cytokines/growth factors should thus be fine-tuned according to the differentiated state and type of stem cell involved. The suitability of epigenetics to promote hepatic (trans)differentiation requires a delicate balance between biological activity, pharmacokinetic, and toxicological characteristics; proliferation/differentiation; and finally apoptosis/cell survival. Successful improvement of the hepatocellular phenotype and functionality of stem cell cultures relies, as is the case for primary hepatocyte cultures, on appropriate selection of type of epigenetic modifier applied and optimal fine-tuning of its dose and timing of exposure .Another major consideration is the dichotomy between hepatocyte proliferation and expression of differentiated functions (overview in ). In conFinally, in addition to variability at the in vitro level, it should be clarified whether or not the multipotency of stem/progenitor cells significantly depends on the donor's profile , 174. SiIn conclusion, a more scrupulous understanding of the instructive signals emanating from the stem cell niche, together with a deeper analysis of cell-intrinsic mechanisms governing replication versus differentiation-inducing signals, is needed to reliably expand and differentiate stem/progenitor cells. Identification of reliable surface markers, useful for accurate and efficient isolation of plastic progenitor cells may upregulate the current hepatic potential of MSC and eventually serve to construct efficient and standardized devices that enable specific direction of MSCs and other progenitors towards the hepatocyte lineage. Standardization is, in any case, a sine qua non for prospective preclinical and clinical purposes of stem cells and their differentiated progeny.

The Hedgehog (HH) pathway promotes tumorigenesis in a diversity of cancers. Activation of the HH signaling pathway is caused by overexpression of HH ligands or mutations in the components of the HH/GLI1 cascade, which lead to increased transactivation of GLI transcription factors. Although negative kinase regulators that antagonize the activity of GLI transcription factors have been reported, including GSK3β, PKA and CK1s, little is known regarding positive kinase regulators that are suitable for use on cancer therapeutic targets. The present study attempted to identify kinases whose silencing inhibits HH/GLI signalling in non-small cell lung cancer (NSCLC).To find positive kinase regulators in the HH pathway, kinome-wide siRNA screening was performed in a NSCLC cell line, A549, harboring the GLI regulatory reporter gene. This showed that p70S6K2-silencing remarkably reduced GLI reporter gene activity. The decrease in the activity of the HH pathway caused by p70S6K2-inhibition was accompanied by significant reduction in cell viability. We next investigated the mechanism for p70S6K2-mediated inhibition of GLI1 transcription by hypothesizing that GSK3β, a negative regulator of the HH pathway, is activated upon p70S6K2-silencing. We found that phosphorylated-GSK3β (Ser9) was reduced by p70S6K2-silencing, causing a decreased level of GLI1 protein. Finally, to further confirm the involvement of p70S6K2 in GLI1 signaling, down-regulation in GLI-mediated transcription by PI3KCA-inhibition was confirmed, establishing the pivotal role of the PI3K/p70S6K2 pathway in GLI1 cascade regulation.We report herein that inhibition of p70S6K2, known as a downstream effector of the PI3K pathway, remarkably decreases GLI-mediated transactivation in NSCLC by reducing phosphorylated-GSK3β followed by GLI1 degradation. These results infer that p70S6K2 is a potential therapeutic target for NSCLC with hyperactivated HH/GLI pathway. Cyclin D1 [γ-catenin [GLI1 [PTCH expression by HH signaling is also an important feature of negative feedback [The Hedgehog (HH) signaling pathway is essential for the control of multiple cell proliferation processes such as pattern formation, stem cell maintenance and tumorigenesis ,2. Activyclin D1 , γ-caten-catenin , and selin [GLI1 . The evein [GLI1 -10. Up-rfeedback . Positivfeedback . AlthougAlong with the multiple cellular processes and functions known to be derived from HH cascade activation, recent findings showing that the HH pathway plays a pivotal role in stem cell maintenance have attracted great attention, especially in the field of cancer research as a new potential therapeutic target pathway for the treatment of various types of cancers ,11,12. Tp70S6K2 is a member of the ribosomal S6 kinase family and is involved in protein synthesis and cell proliferation ,25. Incrp70S6K2-silencing by siRNA decreases GLI regulatory transcription ability in NSCLC through modulating GSK3β. This report provides the first evidence that p70S6K2 positively regulates the HH cascade and could serve as a therapeutic target in GLI1 cascade-activated NSCLC independent of HH ligands.In this study, a kinome-wide siRNA screen was performed to identify kinases whose silencing inhibits HH/GLI signaling in NSCLC. We found that GLI1 were expressed in the cell lines, indicating that the HH/GLI1 pathway plays a pivotal role in NSCLC cancer cell progression . Examination of reporter activity after introduction of GLI1-siRNA into the A549-GLI cells to confirm that the GLI regulatory β-lactamase reporter gene was under the control of GLI1 transcription factor, showed that reporter gene activity was reduced to 32% compared with control-siRNA treated cells was previously reported to positively regulate HH/GLI1 pathway [PRKCD-siRNA, were selected as promising candidates as positive regulators for HH/GLI1 pathway. Among the kinase siRNAs that were hit, p70S6K2 (RPS6KB2) significantly reduced GLI-mediated reporter gene transcription activity to 38%. Although it is well recognized that inhibition of p70S6K2 down-regulates the oncogenic PI3K pathway, the effect of p70K6K2 on the activity of the HH pathway has not been reported. Therefore, we focused on p70S6K2 in the subsequent confirmation and validation studies.It has previously been reported that the HH/GLI1 pathway is activated in some portion of NSCLC cell lines and primary lung tumors . Expression Fig. . Of the lls Fig. . The silase Fig. . In the p70S6K2 inhibition. Treatment of A549-GLI with a different sequence of p70S6K2-siRNA from the one used in the large scale siRNA screen, followed by recovery of RNA from the transfected cells 48-hr after siRNA transfection, and measurement of the silencing level of p70S6K2 by quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) Fig. showed tion Fig. , which wion Fig. . ReductiRNA Fig. and 3B. p70S6K2-silencing by siRNA in A549 cells were measured. Through western blotting, it was observed that p70S6K2 levels were remarkably reduced in preclinical studies have shown significant progress in regressing tumor development ,12. It hPRKCD-siRNA as a negative regulator of the HH pathway . Moreover, simultaneous double-knockdown of p70S6K1 and p70S6K2 was investigated to examine any synergistic effect on the inhibition of the GLI1 cascade. This resulted in no enhancing effect on the GLI reporter gene by p70S6K1-siRNA. This indicates that the role of p70S6K2 in inhibiting the HH pathway may be distinct from that of p70S6K1, although we cannot eliminate the possibility that p70S6K1 may exert similar function in different types of cells. Further studies to examine expression/activation levels of p70S6K1/2 and the GLI1 cascade in diverse types of clinical samples and cell lines would provide some insights on this issue.The kinome-wide siRNA screen of the HH signaling pathway performed in the present study found that sduction . An examWe report herein that p70S6K2 positively regulates GLI1-mediated transcription through modulating GSK3β in NCSLC. Given the recent finding that various types of tumors have deregulations in the HH/GLI cascade independent of the HH ligand, in which modulation of upstream components are less effective , it is iPI3K inhibitor, LY294002, and KAAD-cyclopamine were purchased from Merck KGaA . Cell culture reagents and media were obtained from Invitrogen .β-lactamase reporter gene under the transcriptional control of a (8×) Gli response element with tata-minimal promoter, by lipofection using Lipofectamine reagent (Invitrogen). The cells transfected with the vector were cultured with growth medium containing 3.8 μg/ml of blasticidin for 14 days, and stable cell lines were established. Several stable clones were transfected with GLI1 siRNA and a few clones were identified in which β-lactamase activity was reduced by more than 70% with GLI1-silencing.A549 cells were transfected with pLenti-bsd/GLI-bla vector (Invitrogen), which contains p70S6K2 siRNA used in the present experiments, other than kinome-wide siRNA screen, was GCCUAGAGCCUGUGGGACAtt . The phenotypes observed in the p70S6K2 were confirmed by two additional sequences, GGUGUUCCAGGUGCGAAAGtt and GCAGAGAACCGGAAGAAAAtt (B-bridge). The following siRNAs were also used: GLI1-siRNA ; polo-like kinase 1 (PLK1)-siRNA (M-003290-01-0010: Thermo Fisher Scientific Inc.); control-siRNA (D-001810-01-05: Thermo Fisher Scientific Inc.); and, human kinome siRNA set . For siRNA transfection, 900 cells were seeded per well in 96-well plate and incubated for 24 hr. siRNA was mixed with a lipofection reagent, siLentFect according to the manufacturer's instructions, and transfected into the A549 cells. mRNA was recovered and extracted 48 hr after transfection with RNAeasy . Reverse transcription was performed for 500 ng of total RNA, and the cDNA obtained was applied to TaqMan PCR for quantification of mRNA expression. The primers and probe used for the quantitative polymerase chain reaction (qPCR) were: p70S6K2 ; GLI1 , Cyclin D1 ; and, γ-catenin . Data were collected and analyzed using an ABI 7900HT Fast Real-Time PCR System (Applied Biosystems). The relative mRNA expression data were normalized to β-actin expression, measured with pre-designed qPCR primers and probe .The sequence of Cell viability was measured by CellTiter-Glo Luminescent Cell Viability Assay , 72 or 96 hr after siRNA transfection. An equal volume (100 μL) of CellTiter-Glo Reagent was added to medium, and mixed gently for 2 min on an orbital shaker. The solution was incubated at room temperature for 10 min to allow it to stabilize and luminescence to appear, after which the luminescence was measured. The activity of β-lactamase was quantified with GeneBLAzer™ Detection Kits (Invitrogen) according to the manufacturer's instructions. A 6 × substrate loading solution was added to the cells to 1 × final concentration and the cells in the buffer were incubated for 6 hr. β-lactamase activity was then measured using a fluorescent plate reader. The β-lactamase activity was normalized to cell number, measured by CellTiterGlo Luminescent Cell Viability Assay (Promega).For immunoblotting of total and phosphorylated GSK3β and GLI1, cell lysate was extracted from A549 or H1915 cells with a lysis buffer comprising a 1:00 dilution of protease inhibitor cocktail containing AEBSF, Aprotinin, Bestatin, E-64, Leupeptin, Pepstatin A), and a 1:00 dilution of phosphatase inhibitor cocktail (Thermo Fisher Scientific Inc.) containing sodium fluoride, sodium orthovanadate, sodium pyrophosphate and β-glycerophosphate. The extracted 20 μg of total protein was subjected to 10% SDS-PAGE analysis. Proteins were visualized by ECL chemiluminescence reagents using primary antibodies specific to total GSK3β , phosphorylated GSK3β at Ser9 residue and GLI1 , p70S6K1 and p70S6K2 .The authors declare that they have no competing interests.SM was involved in the design and execution of the experiments and drafted the manuscript. AK conducted most of the experiments and contributed to manuscript preparation. HH contributed to the overall experimental design. All authors read and approved the final manuscript.

Receptors for granulocyte colony-stimulating factor (G-CSFRs) have been confirmed on the cell surfaces of several non-haematopoietic cell types, including bladder cancer cells. This observation has naturally led to the hypothesis that the expression of G-CSFR on these cells may enhance their growth by G-CSF. In this study, the expression of G-CSFR was determined in both established human bladder cancer cell lines and primary bladder cancers. We studied five different human bladder cancer cell lines and 26 newly diagnosed bladder tumours. G-CSFR mRNA expressions on cultured cell lines were determined using the reverse transcriptase polymerase chain reaction (RT-PCR) method. Furthermore, the G-CSFR binding experiments on the cultured cell lines were conducted using the Na(125)I-labelled G-CSF ligand-binding assay method. Moreover, the G-CSFR mRNA expressions on primary bladder tumour specimens were assessed using the in situ RT-PCR method. Three out of the five cultured cell lines exhibited G-CSFR mRNA signals when the RT-PCR method was used. The G-CSFR binding experiments showed an equilibrium dissociation constant (K[d]) of 490 pM for KU-1, 340 pM for NBT-2 and 103 pM for KK cells. With in situ RT-PCR, the tumour cells of 6 out of 26 primary bladder tumour specimens (23.1%) presented positive G-CSFR mRNA signals. Thus, in this study, G-CSFR expression was frequently observed on bladder cancer cells. Therefore, the clinical use of G-CSF for patients with bladder cancer should be selected with great care.

Carbon monoxide (CO) is a colorless, odorless, tasteless, nonirritating, but significantly toxic gas. It is a product of combustion of organic matter in presence of insufficient oxygen supply. Symptoms of mild poisoning include headaches, vertigo and flu like effects, whereas larger exposures can lead to significant toxicity of the central nervous system (CNS), heart, and even death. We are reporting two cases that presented to us in the winter months of December to January with history, sign, symptoms, and radiological evidence of suspected CO poisoning. Carbon monoxide (CO) is one of the leading causes of accidental poisonings. Experts agree that it is difficult to estimate the incidence of CO poisoning cases, because the symptoms resemble many other common ailments.2 This isA 11-year-old male child was admitted with a history of having been found unconscious in the bathroom by the elder brother of the patient. There was no evidence of associated tonic-clonic movements, tongue bite, frothing from mouth, vomiting, bladder, and bowel incontinence or trauma. There was no history of fever, seizures, headache, vomiting, and substance abuse prior to this episode. At the time of admission, patient was unresponsive and decerebrating. Pupils were normal size and well reacting to light, and plantar reflex was extensor bilaterally and systemic examination was normal. Patient was intubated, mechanically ventilated, and was started on antiedema measures and other supportive treatment. Magnetic resonance imaging (MRI) showed bilateral gyral swelling of the frontal and parietal lobes with reduced signal intensity in the bilateral caudate nuclei and putamen. Patient improved and was extubated on the fourth day of admission and was discharged in satisfactory condition after seven days without any neurological sequelae.A 25-year-old male was found lying unconscious and brought out after breaking open the bathroom door after one hour. There was no evidence of seizures, vomiting, urinary and bowel incontinence or any kind of trauma at the time of incident and no history of fever, seizures, headache, and substance abuse in the past. Patient when brought was unresponsive. Pupils were 3.5 mm bilaterally reacting to light and plantar reflex was extensor on both sides. There was no neck rigidity, fever, and any cranial nerve deficit at the time of presentation. Patient's blood pressure was 90/50 mm Hg, which responded to fluid resuscitation. Systemic examination and investigations were normal. Level of consciouness improved over the next few hours, and he was managed with oxygen with a venturi mask, antiedema measures, and supportive treatment. MRI on the day of admission was normal. Patient's condition worsened on fourth day as his sensorium deteriorated and he developed flexor posturing. He was intubated and put on ventilatory support. Cerebrospinal fluid (CSF) examination was normal. MRI at this time showed diffuse gyral swelling with hyperintense signal in bilateral basal ganglia and focal areas of diffuse restriction in bilateral frontoparietal cortex. Patient developed fever and chest radiograph showed opacities on the right side. He was managed on the lines of ventilator-associated pneumonia with antibiotics and was extubated on the tenth day of admission. Patient was discharged after 25 days of hospital stay. He had residual hypoxic damage in the form of persistent vegetative state and was discharged to a domiciliary care on request.Gas geysers have emerged as a cost-effective efficient method for heating water at homes. Gas geysers run on LPG, the combustion of which leads to generation of CO, hydrocarbons, and nitrogen oxides. These by-products when enclosed in a small space can result in serious morbidity and mortality in the victims. Sources of CO poisoning could be house fires, faulty furnaces, gas water heaters, wood burning stoves, motor vehicle exhaust, and various propane fuelled equipments, etc.2CO toxicity occurs by competitive binding of CO to the hemoglobin heme groups with a resulting increase in the affinity of the remaining for oxygen, shifting the oxygen-hemoglobin dissociation curve to the left. CO bindsThe mean half-life of COHb is 320 minutes on room air, 80.3 minutes at 100% oxygen at one atmosphere, and 23.3 minutes at three atmospheres. Continued exposure to CO can lead to flu-like symptoms, headaches, dizziness, tiredness, and nausea that may progress to confusion, irritability, and impaired judgment, memory impairment and incoordination or even death. Normal COHb levels are less than 5%, up to 9% in cigarette smokers. Serious toxicity is associated with levels above 25%, and risk of fatality at 70%. In late presenting patients, a normal COHb level cannot be used to rule out poisoning.[The predilection for the globus pallidus may relate to hypotensive effect of CO poisoning in the watershed territory of the arterial supply. Lesions within deep white matter have been reported as being indicator of poor prognosis compared to those in the globus pallidus.Treatment includes immediate removal of the victim from the exposure and administration of high-flow or 100% oxygen by a nonrebreather reservoir oxygen mask. Hyperbar8In case of our patients, diagnosis was made on the basis of history, response to supportive treatment, exclusion of other causes, and MRI evidence. Six of seven patients had no neurological sequelae of the illness. One patient (Case 2) had a prolonged course of disease and was discharged after a prolonged stay in the hospital. This patient also had residual neurological damage. The cause could be prolonged exposure to toxic levels of CO resulting in hypoxic brain damage.Prevention always takes precedence over everything else. The geyser should not be switched on after locking the door from inside, ventilation should be kept open and gap should be maintained between two people taking bath to avoid increase in the CO density. Gas geyser unit should be placed outside the bathroom with a hose of hot water going inside. Gas geyser switch should ideally be at such a height that it can be switched off easily.Following these precautions can decrease the incidence, mortality, and morbidity due to accidental CO poisoning.

The mol­ecules are linked by N—H⋯O hydrogen bonds, forming a layer network.In the mononuclear title compound, [Cd(C DOI: 10.1107/S1600536808009409/ng2436Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

Studies relying on outdoor pollutants measures have reported associations between air pollutants and birth weight.Our aim was to assess the relation between maternal personal exposure to airborne benzene during pregnancy and fetal growth.We recruited pregnant women in two French maternity hospitals in 2005–2006 as part of the EDEN mother–child cohort. A subsample of 271 nonsmoking women carried a diffusive air sampler for a week during the 27th gestational week, allowing assessment of benzene exposure. We estimated head circumference of the offspring by ultrasound measurements during the second and third trimesters of pregnancy and at birth.3 . Log-transformed benzene exposure was associated with a gestational age–adjusted decrease of 68 g in mean birth weight and of 1.9 mm in mean head circumference at birth . It was associated with an adjusted decrease of 1.9 mm in head circumference assessed during the third trimester and of 1.5 mm in head circumference assessed at the end of the second trimester of pregnancy .Median benzene exposure was 1.8 μg/mOur prospective study among pregnant women is one of the first to rely on personal monitoring of exposure; a limitation is that exposure was assessed during 1 week only. Maternal benzene exposure was associated with decreases in birth weight and head circumference during pregnancy and at birth. This association could be attributable to benzene and a mixture of associated traffic-related air pollutants. Maternal exposure to air pollutants, and possibly traffic-related air pollutants during pregnancy, may influence fetal growth . TrafficFor a few traffic-related air pollutants, animal experiments have reported effects of maternal exposure on fetal growth . In rode2.5) and head circumference assessed during pregnancy by ultrasonography and at birth.This study was conducted in a subgroup of the EDEN mother–child cohort . The priThe study was approved by the relevant ethical committees , and all participating women gave informed written consent for themselves and for their child to be part of the study.a priori choice was to use the average of these two postnatal measures; in sensitivity analyses, we also report the association between exposure and the single measure of head circumference at birth. We conducted ultrasound examinations between 29 and 36 gestational weeks , between 19 and 27 gestational weeks , and before 15 gestational weeks . Because of the possible association between head circumference at birth and cognitive development in childhood ultrasound examinations. Therefore, we also report associations of exposure with biparietal diameter (the widest diameter of the head), which we assessed at the first trimester examination; this was strongly correlated with head circumference during the second and third trimesters . Ultrasound measurements were performed according to We assessed birth weight from maternity records. Head circumference was assessed at birth and also during a clinical examination of the newborn performed in duplicate by midwife research assistants within 3 days after birth for 95% of newborns. Our hildhood , and becn = 4). The charcoal cartridges were then temporarily stored and then shipped to the Maugeri Foundation, where they were stored at 4°C before analysis. Cartridges were shipped together with a bar code identifier and information on the hours and days of start and end of exposure to ambient air, but no information on pregnancy outcome. We desorbed the collected vapors from the cartridge using carbon disulfide solvent with a benzene concentration < 0.1 μg/mL and analyzed the solution using high-resolution gas chromatography with flame ionization detector. Taking into account the actual number of hours of exposure of the dosimeter, we converted the benzene concentration in the solution to a mean concentration in the air during the period of exposure. The detection limit for an exposure of 5 days is 0.1 μg/m3 benzene. Women were given illustrated instructions and were asked not to touch the diffusive air sampler with their hands, avoid contact with water, carry the air sampler always with them, attaching it on their clothes as close as possible to their collar, and to keep it close to their bed when they slept.We used a diffusive air sampler , which rWe studied the relationship between benzene and birth weight and the relationship between benzene and measures of head size assessed at birth and during the third trimester in distinct linear regression models . We also studied the association between benzene exposure and measures of head size assessed during the first and second trimesters, assuming that benzene levels were indicative of exposure in early pregnancy. Benzene was considered either as a continuous variable, using the log-transformed values because of the skewed distribution of exposure, or as a variable whose categories corresponded to exposure tertiles defined on the whole population with an exposure estimate. We performed linear trend tests with a categorical variable whose values corresponded to the category-specific median benzene level.Additionally, we conducted a longitudinal analysis including all three assessments of head circumference simultaneously, using multiple linear regression with a random effect variable corresponding to the mother–child pair and interaction terms with gestational age. We plotted the values of head circumference predicted by this longitudinal analysis as a function of benzene and gestational age, together with the observed values.We repeated the analyses among women who declared that their schedule during the week of use of the air sampler was similar to that during the previous month . We also estimated the effect of benzene levels adjusting for the ultrasound-based gestational age instead of the LMP-based gestational age . To detea priori, excluding all variables possibly affected by the health outcome or exposure (n = 5) to potentially include smokers and excluded them; additionally, we excluded two women who had declared to be nonsmokers during the interview with the midwife but who later declared to have smoked during the third trimester of pregnancy. Mean cotinine levels were 0.8 ng/mL among women who declared not to have been exposed to passive smoking and 2.3 ng/mL among women who declared to have been exposed to passive smoking (p < 0.01). In addition to passive smoking, cotinine levels, and gestational duration at the time of the measurement of fetal size (linear and quadratic terms), we also adjusted for sex of newborn, birth order, maternal height (continuous variable), prepregnancy weight , maternp-values > 0.29).A total of 2,002 pregnant women were recruited in the cohort. Among these women, 484 were nonsmoking women whose clinical examination took place after February 2005, and 304 women (63%) agreed to carry the dosimeter. Benzene levels and one measure of fetal growth were known for 271 women . Compared with approached nonsmoking women who refused to carry the air sampler or with no exposure estimate, those with an estimated benzene exposure were more often > 25 years of age and nulliparous at inclusion and more often declared to be exposed to passive smoking , compared with the lowest exposure category. Each increase of one in log-transformed benzene exposure (corresponding to a multiplication of exposure by 2.72) was associated with an adjusted decrease of 68 g in birth weight and 3.7 mm , respectively and 1.3 mm for biparietal diameter and biparietal diameter (p = 0.09).At the third-trimester ultrasonography, the adjusted decrease associated with benzene exposure in the highest exposure category was 4.8 mm for head circumference , and the adjusted decrease in biparietal diameter was 1.0 mm . Each inp-values were generally larger, with smaller sample sizes. The association with benzene was somewhat stronger when we assessed head circumference from the single measurement at birth , compared with our original analysis using the average of two measurements within 3 days after birth . We observed qualitatively similar results after exclusion of small-for-gestational-age births . AssociaIn a cohort of nonsmoking women recruited during the first half of pregnancy, we observed decreased birth weight, decreased head circumference during the second and third trimesters of pregnancy and at birth, and decreased biparietal diameter during pregnancy in association with maternal benzene exposure.Several studies in which exposure had been estimated from the air pollution levels in the vicinity of the home address had reported decrements in birth weight or increases in the risk of small-for-gestational-age births in association with air pollution levels . Our stuSeveral studies have tried to identify windows of sensitivity to air pollutants during pregnancy, by testing associations between trimester-specific exposure variables and birth weight, without yielding a consistent picture (reviewed by 2.5 (PM with an aerodynamic diameter < 2.5 μm) exposure was more strongly associated with head circumference (using additive models) among male than among female newborns between benzene and fetal growth among male than among female newborns. newborns . Strongenewborns . Our resnewborns , relyingPrevious studies of associations between maternal benzene exposure and birth outcomes in human populations have been conducted in occupational settings, where benzene is used as a solvent and as an intermediate in the synthesis of many families of products . In a stThe main strengths of our study are its prospective design, the use of ultrasound measurements to assess fetal growth, and the personal assessment of benzene exposure. The main limitation is that assessment was performed only once during 7 consecutive days, so we had no direct information on the variability in exposure during pregnancy. In addition, the sample size was too limited to study rare events such as occurrence of small-for-gestational-age births.Head circumference is correlated with brain volume in neonates . The pos3 in the Poitiers area , compared with 2.9 μg/m3 in Nancy area, a more densely populated city of 300,000 inhabitants with higher mean environmental concentrations of NO2 estimated by the air quality monitoring stations . By comparison, mean exposure levels of 5.1 μg/m3 have been reported among non-smokers in Madrid, Spain, for the year 2003, and of 2.9 μg/m3 in Dublin, Ireland, in 2004 (3 planned for the ambient air in 2010 for 26 subjects (10% of the population).The mean personal benzene levels were 2.1 μg/m in 2004 . Among o2 levels does not speak in favor of important indoor sources of benzene. About 10% of women lived in a home where wood was used for heating; exclusion of these women did not modify the association between benzene and head circumference. Benzene is used as an additive in unleaded gasoline, in which a volume concentration of up to 1% is currently permitted in the United States and the European Union. Its presence in traffic exhaust is attributable to some benzene escaping the combustion process and benzene being a by-product of the partial combustion of other organic compounds. Benzene is also present in the environment because of other combustion processes such as residential heating or industrial emissions. Benzene levels much higher than common outdoor levels have been reported in car cabins on fetal weight [reviewed by The association between benzene exposure and head size at birth was stronger when we assessed head size from the single measurement right after birth than when we assessed it from the repeated measurements performed within a few days after birth, although trends were qualitatively similar. In additional analyses performed on the whole cohort, the estimated adjusted effect of maternal smoking was stronger for the single measure than for the average of the two measures (data not shown). The amplitude (but not the frequency) of measurement error is expected to be lower for the two measures than for the single measure. However, several factors that could not be adjusted for might influence head size in the days after birth, so specific studies are warranted to determine which measure of head size is more relevant to characterize the influence of environmental factors on head circumference. In agreement with our expectation , the estCompared with approaches relying on measures in the environment, personal air samplers have the advantage of taking into account both indoor and outdoor exposures, as well as exposure in each microenvironment such as vehicle cabins. A limitation is that, unless repeated measurements are performed, they do not allow the capture of temporal variations in exposure. In our study, women carried the sampler at the same stage of fetal development and for a whole week to try to capture most of the usual situations of exposure. A German study with repeated measurements of indoor and outdoor benzene levels 6–13 months apart showed important intraindividual variation; however, after adjustment for season of measurement and region, the between-home standard deviation of benzene levels was greater than the within-home standard deviation, and the seasonal variations in benzene levels showed similar patterns across locations of measurement . AlthougWe adjusted for both questionnaire-based exposure to passive smoking and cotinine urinary levels; our sensitivity analyses showed that excluding subjects exposed to passive smoking, as assessed by questionnaire or cotinine urinary levels, did not alter associations between benzene and head circumference, compared with adjusted analyses. However, we cannot firmly exclude any residual confounding due to passive smoking, because questionnaires have limited validity for low levels of exposure , and becWe report an association between maternal pregnancy exposure of nonsmoking women to benzene and gestational age–adjusted offspring head size assessed at birth and by ultrasound imaging during pregnancy, and between exposure and birth weight. The association with head size manifested before the third trimester of pregnancy. Because benzene is a marker of exposure to traffic-related air pollutants, the association observed might be attributable to a mixture of traffic-related air pollutants, although we cannot completely rule out the existence of indoor sources of benzene not related to cigarette smoke or fuel.

Objective. Animal data suggest that cocaine has an immunosuppressive effect, but no human studies have been conducted to assess the relation of cocaine use with human papillomavirus (HPV) infection, the viral cause of cervical cancer. Since both cocaine use and HPV infection are common among HIV-positive women, we sought to determine whether use of cocaine and/or crack influences the natural history of HPV among women with or at high risk of HIV. Methods. Women enrolled in the Women's Interagency HIV Study (2278 HIV-seropositive and 826 high-risk seronegative women) were examined every six months for up to 9.5 years with Pap smear, collection of cervicovaginal lavage (CVL) samples, and detailed questionnaires regarding health and behavior, including use of crack and cocaine (crack/cocaine). CVLs were tested for HPV DNA by PCR, with genotyping for over forty HPV types. Results. In multivariate logistic regression models, censoring women treated for cervical neoplasia, crack/cocaine use within the last six months was associated with prevalent detection of oncogenic HPV DNA (odds ratio [OR] = 1.30 (1.09–1.55)), and with oncogenic HPV-positive squamous intraepithelial lesions (SIL) (OR = 1.70 (1.27–2.27)), following adjustment for age, race, HIV-serostatus, and CD4+ T-cell count, the number of sexual partners in the past six months, and smoking. In multivariate Cox models crack/cocaine use was also associated with a trend that approached significance in regard to incident detection of oncogenic HPV-positive SIL , and while the rate of oncogenic HPV clearance was not related to cocaine use, the clearance of any SIL was significantly lower in those with versus those without recent crack/cocaine use . Conclusions. Cocaine use is associated with an increased risk of detection of both prevalent and incident oncogenic HPV infection, as well as an increased risk of HPV-positive SIL over time. Human papillomavirus (HPV) infectionsof women, though common, typically resolve. Persistence of oncogenic HPV isnecessary for the development of cervical precancer and invasive cervicalcancer (ICC). The incident detection and persistence of HPV infections andrelated lesions have been shown by us –4, and oCocaine use is also common amongHIV-infected women , 10 and Any disruption to host defensesattributable to cocaine, in conjunction with those associated withHIV-infection per se, could increase the incidence and/or duration of oncogenicHPV infection. That in turn could contribute to an enhanced risk of cervicalneoplasia to which HIV-infected women are demonstrably prone . AdditioThe Women'sInteragency HIV Study (WIHS) is a prospective study of the natural history ofHIV infection in women that initially enrolled HIV-seropositive and at riskseronegative women participants at six clinical sites between October 1994 and November1995. A subsequent recruiting cycleoccurred in 2002. The recruitment methods and data collection procedures forWIHS have previously been described [Therewere a total of 3768 subjects in WIHS. We excluded 16 subjects who had HIVseroconverted during follow-up, and 253 subjects who did not have a cervixpresent at baseline. Thus 3499 women were included. We censored all the visits afterhysterectomy. The current analysis includeswomen recruited in 1994/1995 and additional women recruited in 2002. The initialrecruits were tested for HPV infection during visit 1 through visit 15, and themore recent recruits were tested for HPV infection during their baseline visit(V15 or V16) through visit 19.Eighty-nine (9.7%) of the 915 HIV-seronegative women and 306 (11.8%) ofthe 2584 seropositive women did not have HPV DNA test results available andwere excluded from analysis. Comparisons were made between HPV carriagepatterns (defined below) of women who did or did not acknowledge cocaine use.μL of each cell digest was used in reactionscontaining 10 mM Tris-HCL, 50 mM KCL, 4 mM MgCl2, 200 μM of eachdeoxyribonucleotide triphosphate, 2.5 U Taq DNA polymerase, 0.5 μM of eachprimer. There were 40 amplification cycles . Amplified material was thendetected using filters individually hybridized with biotinylated type-specificoligonucleotide probes for multiple HPV types including HPV 6, 11, 16, 18, 26,31, 32, 33, 35, 39, 40, 45, 51, 52, 53, 54 (AE9), 55, 56, 58, 59, 61, 62, 66,67, 68, 69, 70, 71 (AE8), 72, 73 (PAP238A), 81 (AE7), 83(PAP291), 82v(AE2), 84 (PAP155), 85 (AE5), and 89 (AE6), asdescribed in [Thelaboratory technique for HPV assessments have been described in detailelsewhere . HPV DNA2, 73 PAP8A, 81 using the 1991 Bethesda System criteriafor cytologic diagnosis . All smeT-cellsubsets were determined by immunofluorescence using flow cytometry inlaboratories participating in the AIDS Clinical Trials Quality AssuranceProgram. Plasma HIV RNA levels weremeasured using a nucleic acid sequence-based amplification (NASBA) technique with a lower threshold of detection of 4000copies/ml .β-globingene—see Laboratory Methods). We defined “incidentdetection” of HPV as detection of an HPV type that was not found at baseline orat any other earlier visit in a given woman. The term “incident detection” isused instead of “incidence” to reflect the fact that it is impossible todistinguish newly acquired HPV infection and reactivation of previouslyacquired latent HPV infection in a population with many years of sexualactivity, regardless of the HIV status of that population. Persistence of HPVinfection was defined as the time to clearance of a specific HPV type, and wefurther distinguished in our analysis between the persistence of HPV detectedprevalently at baseline and those first detected incidentally at a subsequentvisit (see below). Clearance itself was defined as either a single negative ortwo negative type-specific HPV results at sequential visits. The findings weresimilar using either approach for defining clearance, and herein we present theresults of clearance using the former definition.Cocaineused in the last six months was examined both as a binary outcome (use/nouse), and as an ordinal variable (no use/less than once a month/once amonth—once a week/2–6 times a week/once a day ormore). Consistent with prior studies the prevThebaseline characteristics of cocaine users and nonusers in this study wereexamined, and the distributions for selected parameters compared using standardPearson chi-square tests for categorical data, or by theCochran-Mantel-Haenszel tests when examining trends in ordinal data. Thesevariables were also evaluated as potential confounders in the multivariableanalyses described below.Theassociation of cocaine use with prevalent HPV DNA detection was measured in multivariate logistic regression models that incorporatedgeneralized estimating equations (GEE) to adjust the standard errors forrepeated measures , and assuming an independent correlation structure. In previous papers,we have shown that the results in this dataset are unaltered by using other possiblecorrelation structures , 27, andTreatmentof abnormal cervical cytology can introduce a bias into analysis of HPVinfection, since treatment can alter the underlying mucosa; either increasinginfection or decreasing infection . Censoring women at the time of cervical treatment iscommonly employed to address this bias and was used in the analyses reportedherein. Adjusting for therapy is an alternate approach that was also used, butas the results were in the same direction and of similar magnitude to thosefound with censoring they are not presented. Other time-dependent covariates included in our multivariate models were CD4+ T-cell count, recent sexual behavior, smoking status, and age group.Ethnicity was adjusted as a time-independent variable.Coxproportional-hazard regression models were usePrevalent SIL and its association with cocaine use was assessed using similarmultivariate logistic regression models incorporating GEE, as described above,to control repeatedobservations over time. The associations of cocaine use and incident detectionof SILs were assessed using multivariate Cox models.This analysis included data from 2584 HIV-seropositive and 915HIV-seronegative women. The median follow-up time among those recruited during1994-1995 was 10 years and for those recruited during 2002 was 3 years; a totalof 20 849 person years of observation among HIV-seropositive and 6385 among HIV-seronegative womenwere included in this analysis. At baseline 16.1% of participants reported useof crack within the prior 6 months, 11.5% had used cocaine, and 6.9% had usedboth. The prevalence of HPV in the cohort was34.4%. Although we initially analyzed the effects of cocaine use on HPVinfection separately from the effects of crack use, no significant (orotherwise notable) differences were observed (data not shown). Therefore, wecombined these data, and herein report a comparison of the prevalence,incidence and time to clearance of HPV among women who used either cocaine orcrack (crack/cocaine use) to that among women who used neither drug.Prevalent detection ofoncogenic HPV was significantly more common among women who reportedcrack/cocaine use during the prior 6 months , than woIncident detection ofoncogenic HPV was increased among crack/cocaine users, although therelationship did not reach significance at traditional values . Crack/cClearance of oncogenic HPV infection was not associated with crack/cocaine use during the prior 6 months . SimilarSimilar analyses wereperformed for alcohol and heroin use. No association was found between eitherdrugs and any of the outcomes of interest .In this prospective study ofHIV-infected and HIV-uninfected women, we observed increased risk of oncogenicand nononcogenic HPV infection in those with crack/cocaine use but not in thosewith heroin or alcohol use, consistent with our a priori hypothesis. If correct, the data suggest that the immunologic effects of cocaine, previously reported primarily in animal models, may have relevance to humans.Shen and colleagues, evaluating amouse model in which cocaine was injected intraperitoneally found that allimmune parameters, other than lymphocyte transformation of thesplenic or the peripheral blood lymphocytes, were suppressed . OtheriThese data suggestthat response to HPV infection might be altered by cocaine. While HIV-infectedwomen are already at immunologic jeopardy and prone to numerous coinfections,the relationship between cocaine use and HPV, one of the most common sexuallytransmitted infections, has not, to our knowledge, been the focus of priorresearch. While we and others have considered drug use as a covariate in studies of HPV infections, those studieshave often not looked specifically at cocaine or crack, controlled for otherfactors, or used drug use as a primary focus of analysis . Our datThisstudy had several limitations. The finding of increased detection of HPV amongwomen acknowledging cocaine or crack use could reflect either an immunologicphenomenon or a behavioral one despite ourefforts to controlthis in our analyses. However, we did not find a similar relationship betweenHPV and the use of other drugs that might also be markers of risk taking. Ourfailure to detect a consistent biologic gradient in cocaine's effect suggests that caution must be exercised in interpretation of results and that further work is warranted toconfirm and potentially extend these findings.An additional limitation to this studyis our inability to provide biologic measures of drug exposure. We note,however, that the same study personnel performed repeated interviews over thecourse of the study and formed a close rapport with the WIHS participants.Further, we have previously observed a close correlation of acknowledged druguse and reliable surrogates . More importantly, it is most likely thatmisclassification would have been in the direction of understating the frequencyof drug use, which would most likely have biased our results toward thenull. A final concern is that, since wehave previously shown that HAART use can modify the course of HPV disease , it is pIn summary, our data suggestan association of crack/cocaine use with increased prevalence, incidence, anddelayed time to clearance of oncogenic HPV among HIV-infected women and womenat risk of HIV. These data lend support to animal studies suggesting a linkbetween cocaine use and predilection to infections and add to the litany ofreasons for making drug treatment a component of the care of HIV-infectedindividuals.

To design and implement surveys of malaria infection and coverage of malaria control interventions among school children in Kenya in order to contribute towards a nationwide assessment of malaria.Plasmodium infection using rapid diagnostic tests, assessed for anaemia and were interviewed about mosquito net usage, recent history of illness, and socio-economic and household indicators. Children's responses were entered electronically in the school and data transmitted nightly to Nairobi using a mobile phone modem connection. RDT positive results were corrected by microscopy and all results were adjusted for clustering using random effect regression modelling.The country was stratified into distinct malaria transmission zones based on a malaria risk map and 480 schools were visited between October 2008 and March 2010. Surveys were conducted in two phases: an initial opportunistic phase whereby schools were selected for other research purposes; and a second phase whereby schools were purposively selected to provide adequate spatial representation across the country. Consent for participation was based on passive, opt-out consent rather than written, opt-in consent because of the routine, low-risk nature of the survey. All children were diagnosed for 49,975 children in 480 schools were sampled, at an estimated cost of US$ 1,116 per school. The overall prevalence of malaria and anaemia was 4.3% and 14.1%, respectively, and 19.0% of children reported using an insecticide-treated net (ITN). The prevalence of infection showed marked variation across the country, with prevalence being highest in Western and Nyanza provinces, and lowest in Central, North Eastern and Eastern provinces. Nationally, 2.3% of schools had reported ITN use >60%, and low reported ITN use was a particular problem in Western and Nyanza provinces. Few schools reported having malaria health education materials or ongoing malaria control activities.School malaria surveys provide a rapid, cheap and sustainable approach to malaria surveillance which can complement household surveys, and in Kenya, show that large areas of the country do not merit any direct school-based control, but school-based interventions, coupled with strengthened community-based strategies, are warranted in western and coastal Kenya. The results also provide detailed baseline data to inform evaluation of school-based malaria control in Kenya. Plasmodium infection collected among young children and pregnant may not be optimal due to the modifying presence of maternal antibodies and sequestered parasites [The epidemiology of malaria in sub-Saharan Africa (SSA) is in transition, with funding agencies dedicating substantial resources in tackling malaria and national governments making great efforts in increasing access to malaria control interventions. It is essential that this transition is accurately monitored in order to evaluate the impact of interventions but also to allow for better targeting of interventions. A number of studies provide evidence of declining malaria-related mortality and morbidity -6, but tarasites . A cheaparasites .Historically, such school surveys were routinely conducted as part of malaria surveillance in Africa and todaThe epidemiology of malaria in Kenya has been changing with reported reductions in malaria associated hospital admissions and mortality in children under the age of five years -17. ThesIn 2009, the Government of Kenya launched its National Malaria Strategy (NMS), 2009-2017. This identified the need to tailor malaria control interventions to the local diversity of malaria risk, target specific population sub-groups to achieve effective and sustainable control, and strengthen the surveillance, monitoring and evaluation systems thereby The Kenya NMS also included the proposal to undertake school malaria surveys to monitor trends of malaria transmission in the context of increasing intervention coverage. Such school surveys have a historical precedent in Kenya, dating back to the 1950 s, when the Division of Vector Borne Diseases (DVBD) was established and school surveys of malaria, helminths and other parasites were one of its core activities. Routine school survey stopped in the 1980 s due to financial constraints and deteriorating school enrolment rates .The renewed potential for school malaria surveys builds on the increased funding for malaria surveillance but also recent improvements in primary school enrolment in Kenya. There are a total of 19,177 government primary schools, the majority (98.5%) of which are day schools with pupils living at home. Primary education in Kenya begins at the age of 6 or 7 years old after completion of a year of nursery school and includes eight years of schooling. The Kenyan school year runs from January to December. In the 1980 s and 1990 s, there was a growth of privately owned schools while the government schools deteriorated. In 2003, the Government of Kenya re-introduced free primary education, resulting in a marked increase in school enrolment. However, parents must pay fees for uniforms and other items and some poorer children still do not attend primary school. The overall net enrolment rate in Kenya was 91.6% in 2007, but this ranged from 27.5% in North Eastern Province to 97.8% in Nyanza Province .Plasmodium infection in a given district based on 95% confidence limits, 80% power, and a design effect of 2. Based on these assumptions, a minimum sample size of 16 schools per district was calculated as necessary to estimate prevalence of 5%, with 1% precision. An additional 54 schools were sampled as part of an evaluation of school net distribution programmes along the Tana River per school would be optimal as this was the number of children, which could practically be sampled in a single day. In each school, 11 boys and 11 girls were selected from each of classes 2-6 using computer generated random table numbers. If there were insufficient pupils in these classes, additional pupils were sampled from class 1. Some of the schools visited were small, and this meant that in these schools all children were selected to achieve the target sample size and fewer than 110 children were present and, therefore, examined.Mobile survey teams consisted of a team leader, three laboratory technicians and three interviewers. Technicians were typically from the Division of Vector Borne and Neglected Tropical Diseases (DVBNTD) of Ministry of Public Health and Sanitation, holding diplomas or first degrees and who had extensive experience of conducting school surveys. Interviewers were either from the Ministry of Public Health and Sanitation or Ministry of Education, who had previous survey experience. Each team was supervised from an experienced researcher from the Kenyan Medical Research Institute (KEMRI) or KEMRI-Wellcome Trust Research Programme. These teams were accompanied by an education officer from the district education office who helped teams locate schools.All team members underwent training in all survey procedures and received a field manual outlining the survey purpose and methods according to national guidelines.Selected children were asked to provide a finger-prick blood sample, which was used to assess dipstick , these ttiMAL-IT able to Pv Combo which caIn all 480 schools, thick and thin blood smears were also prepared for each child. Slides were labelled and air-dried horizontally in a carrying case in the field, and stained with 3% Giemsa for 45 minutes at the nearest health facility when the teams returned from the school. Due supply difficulties in securing Hemocue curvettes for all schools, haemoglobin concentration was assessed in 399 schools and estimated to an accuracy of 1 g/L using a portable haemoglobinometer . Children identified as severely anaemic (haemoglobin levels < 70 g/L) were referred to the nearest health facility for treatment according to national guidelines. Transportation costs were provided and an agreement was reached with facilities to waive drug costs.A questionnaire was administered to pupils to obtain data on mosquito net ownership and use and when treated, recent travel history, recent history of illness, key socio-economic variables such as household construction, education level of the child's guardian and ownership of household items such as mobile phones. An additional questionnaire was administered to the head teacher to collect information on ongoing school health activities, including malaria control, as well as information, education and communication (IEC) material on malaria. The pupil and school questionnaire data will be used in future analyses. The geographical location of each school was determined using a Garmin eTrex global positioning system .Blood smears of all RDT-positive children, where available, and an equivalent number of randomly selected blood slides from RDT-negative children were examined by expert microscopy either at the KEMRI-Wellcome Trust laboratory in Kilifi or the KEMRI laboratory in Nairobi. Parasite densities were determined from thick blood smears by counting the number of asexual parasites per 200 white blood cells (or per 500 if the count was less than 10 parasites/200 white cells), assuming a white blood cell count of 8,000/μl. A smear was considered negative after reviewing 100 high-powered fields. Thin blood smears were reviewed for species identification. Two independent microscopists read the slides, with a third microscopist resolving discrepant results . The locations of schools were linked with survey data and mapped using Arc GIS 9.2 .Anaemia was defined as a haemoglobin concentration <130 g/L for male children above 15 years, <120 g/L for children aged 12-14 years and female children above 15 years, <115 g/L for children aged 5-11 years and <110 g/L for children aged less than five years, with adjustment made for altitude of the school . Severe Plasmodium infection and corresponding 95% binomial confidence intervals (CI) were estimated using a zero inflated Poisson (ZIP) model to account for the excess of schools with zero prevalence. The ZIP model was favoured over a standard Poisson model on the basis of the Vuong test [Plasmodium infection except for Nairobi and Rift Valley provinces where a standard Poisson model was used. National and Province-level estimates of anaemia and net use were estimated using generalized linear and latent mixed models (GLLAMM) adjusted for clustering at the school level.Results were adjusted for clustering at the school-level using random effects regression modelling . Specifiong test . The ZIPThe overall financial cost of the survey was estimated from the project accounting system, with costs divided into staff, transport, operating costs and consumables.The study protocol received ethical approval from the Kenya Medical Research Institute and National Ethics Review Committee (numbers 1407 and 1596). Additional approval was provided by the Permanent Secretary's office of the Ministry of Education (MoE) and the Division of Malaria Control, Ministry of Public Health and Sanitation. All national, provincial and district-level health and education authorities were briefed about the survey purpose and selected schools. Official letters of support were prepared by Provincial MoE officers.Head teachers were briefed about the survey and were provided with an information sheet detailing the survey procedures and asking for their permission to have their school involved in the survey. The head teachers were also asked to inform the students, parents and the school committee members about the survey and obtain their approval for the study. Parents/guardians who did not want their children to participate in the study were free to refuse participation. If a parent or guardian chose not to allow their children to participate in the survey, the child's name was removed from the school rolls. On the survey day, the survey team leader informed all children in the school about the sampling and survey procedures, making it clear to their participation was voluntary and that they may opt out of the testing at any time if they choose to. After randomly sampling the students from the classrooms, individual assent was also obtained from the children before samples were collected. Very few children refused to participate in the survey and therefore replacement sampling was not required. Individual written parental consent was not sought since the survey was conducted under the auspices of the Division of Malaria Control, Ministry of Public Health and Sanitation, which has the legal mandate to conduct routine malaria surveillance, and because only routine diagnostic procedures were undertaken.The surveys were carried out in two main phases Figure : first, The average cost of surveying one school was estimated to be US$ 1,116. The largest cost component was staff (32.0%), following by transport (26.9%). Operating costs included laboratory consumables, courier services and hiring of mini-laptop computers and accounted for 24.7% of total costs. Other costs included slide reading (7.2%) and administration costs (9.2%).A total of 49,975 children in 480 schools across Kenya were included in the survey. Table P. falciparum, with the remainder being either P. ovale (0.1%) or P. malariae (0.6%) or mixed infections (2.6%); no P. vivax was detected. Prevalence was significantly higher in children aged 5-9 and 10-14 years old (4.4%) than children older than 15 years , but did not significantly differ between males and females . The prevalence of malaria infection by province is shown in Table The overall prevalence of infection, based on slide-corrected RDT positivity, was 4.3 . The vast majority (96.8%) of these infections were The overall prevalence of anaemia was 14.1% 95% CI: 13.0-15.3%) and the mean haemoglobin concentration was 128.8 g/L (95% CI: 127.9-129.7 g/L). Anaemia was more common among children aged 15 years and above than 10-14 years and 5-9 year olds . There was no difference in prevalence of anaemia among males and females (13.3% (95% CI: 12.1-14.7) vs 13.3 (95%CI: 12.0-14.8)). Anaemia varied markedly by school of children reported having a bed net and 42.1% (95% CI: 40.9-42.8%) reported sleeping under a net the previous night. However, of the children asked about sleeping under an ITN, less than a quarter reported sleeping under an ITN while 6.4% did not know whether their nets were ITNs or not. The majority of nets, non-ITNs or ITNs, were reportedly obtained from the health facilities. Reported use of ITNs varied markedly across the country Figure , and wasOverall, 13.5% of children reported a fever on the day of the survey, but of the children that had their axillary temperature measured only 733 (2.4%) children had a temperature >37.5°C. Of these febrile children, only 55 (7.5%) children had a malaria infection. Of the children asked about their absenteeism history , 26.9% of children reported being absent from school due to illness for at least one day in the last two weeks, with the commonest cause of illness being headache (56.7%), whilst 17.0% reported malaria as the cause for absenteeism.A comprehensive school level questionnaire was administered in 344 schools, predominantly in Western, Central, Rift Valley and Nyanza provinces during the second phase of the survey. Of these schools, only 59 (17.2%) reported having had any malaria control activities, such as indoor residual spraying of the school buildings and draining of stagnant water, in the last 12 months and the majority (21) of these schools were located in the malaria high transmission zone. Only, seven schools had malaria IEC materials in at least 1 classroom, 8 had IEC materials in the head teacher's office while 17 schools had IEC booklets in the school library.Plasmodium infection was relatively low at 4.3%, there existed marked variation across the country. This finding is consistent with national level malaria prevalence estimate observed in the Kenya MIS in 2007, where the malaria prevalence by RDTs was 7.6% and 3.4% by microscopy [Reliable, contemporary data are essential prerequisites for the planning and implementation of effective malaria control. Each national programme needs to be tailored to its specific national context, based on a cartographic understanding of malaria transmission intensity and current intervention coverage. The data from the present study show that although the national prevalence of croscopy .The observed distribution of low transmission in most of Nairobi and Central provinces and some parts of the Eastern and Rift Valley provinces and high transmission along the shores of Lake Victoria and the south coast is consistent with a recent model of malaria risk in Kenya . The curPfPR than estimates among under fives and pregnant women [The current survey took advantage of the existing school infrastructure and historical experience in carrying out school surveys in Kenya to achieve a rapid, inexpensive approach to malaria surveillance. The adopted approach has a number of advantages over malaria indicator surveys (MIS) which provide nationally-representative household survey data on coverage of malaria interventions as well as malaria parasitaemia and anaemia among household members most at risk, namely children under five years and pregnant women . First, nt women . FinallySchool malaria surveys are not without their limitations, however (for a review see ), and a A further drawback of school surveys is that they cannot provide complete information on household ownership of insecticide-treated mosquito nets and their use by children under five years of age and pregnant women, or on the use of the intermittent preventive treatment during pregnancy and the type and timing of treatment of fever in children under five years of age. However, a study in Uganda found that reports by schoolchildren on household net ownership provide a rapid method to collect reliable coverage data at the community level .There are also several practical features of the present survey worth highlighting. First, the survey used modern technology to achieve a more cost efficient approach to data collection. In particular, data captured were achieved using netbook computers with customized data entry screens. Electronic data capture systems, mainly based on the use of personal digital assistants (PDAs), are shown to be acceptable and reduce data entry errors considerably -42. ExpeSecond, consent for the survey was based on a passive, opt-out method of parental permission. This approach is considered to be an ethical and practical way of informing participants in low-risk studies and interventions , and hasThird, malaria parasitaemia was ascertained using a two-stage approach of malaria RDTs and blood slides. Importantly, this approach enabled appropriate treatment of clinical malaria in schools on the day of the survey, but also allowed assessment of the reliability of RDTs at a later stage. A drawback of using RDTs is that they can result in false positives, especially those RDTs that detect the histidine-rich protein-2 (HRP-2) antigen -51, leadIn conclusion, the current study describes recent experiences of school malaria surveys in Kenya and highlights the potential of school surveys as a complementary approach for malaria surveillance to MIS. The adopted survey approaches evolved over time and important practical lessons were learnt which can inform the conduct of future school malaria surveys. Notwithstanding, there remain several issues requiring further investigation, including the representativeness of schools, the reliability of school children's reports of ITN ownership and use, the reliability of RDTs among school children. It is hope that addressing these issues will provide clearer direction on the role, in Kenya and elsewhere, of schools in an integrated national malaria surveillance system, which also includes household surveys and health facility reporting.The authors declare that they have no competing interests.CWG participated in the data collection, analysis and developed the draft manuscript. PNK, JK and MM were responsible for fieldwork supervision and contributed to the final manuscript. EJ, RWS and AN were responsible for the study design, interpretation and scientific guidance. SB was responsible for the overall project management, study design, scientific guidance and writing of the manuscript. All authors read and approved the final manuscript.Field manual for school malaria surveys, Kenya. The field manual developed for the national school malaria survey and used the field teams.Click here for fileMicroscopy results flowchart. A flow chart showing the numbers of slides examined and the microscopy results, including discrepant results, in the school malaria surveys in Kenya, 2008-2010.Click here for file

In the crystal, C—H⋯O hydrogen bonds link the mol­ecules into dimers which are further connected into a chain along the a axis by C—H⋯S hydrogen bonds.In the title mol­ecule, C For det al. 2005. For a r al. 2009. 16H22O2S8 CM r = 502.82 Triclinic, a = 9.1748 (18) Å b = 10.177 (2) Å c = 14.273 (3) Å α = 98.49 (3)°β = 105.58 (3)°γ = 113.33 (3)°V = 1129.1 (4) Å3 Z = 2 Kα radiationMo −1 μ = 0.80 mmT = 291 K 0.14 × 0.12 × 0.12 mm Rigaku R-AXIS RAPID diffractometerABSCOR; Higashi, 1995T min = 0.896, T max = 0.910Absorption correction: multi-scan (8752 measured reflections3948 independent reflectionsI > 2σ(I)3345 reflections with R int = 0.014 R[F 2 > 2σ(F 2)] = 0.042 wR(F 2) = 0.128 S = 1.17 3948 reflections237 parametersH-atom parameters constrainedmax = 0.89 e Å−3 Δρmin = −0.47 e Å−3 Δρ RAPID-AUTO (Rigaku, 1998RAPID-AUTO; data reduction: CrystalStructure (Rigaku/MSC and Rigaku, 2002SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008PLATON (Spek, 2009SHELXL97.Data collection: 10.1107/S1600536809041804/hg2569sup1.cif Crystal structure: contains datablocks global, I. DOI: 10.1107/S1600536809041804/hg2569Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

Improved knowledge of cercozoan diversity is expected to help resolve major branches in the tree of eukaryotes and demonstrate important cellular innovations for understanding eukaryote evolution.Comparative morphological studies and environmental sequencing surveys indicate that marine benthic environments contain a diverse assortment of microorganisms that are just beginning to be explored and characterized. The most conspicuous predatory flagellates in these habitats range from about 20–150 μm in size and fall into three major groups of eukaryotes that are very distantly related to one another: dinoflagellates, euglenids and cercozoans. The Cercozoa is a diverse group of amoeboflagellates that cluster together in molecular phylogenies inferred mainly from ribosomal gene sequences. These molecular phylogenetic studies have demonstrated that several enigmatic taxa, previously treated as Eukaryota Auranticordis quadriverberis n. gen. et sp., was isolated from marine sand samples. Uncultured cells were in low abundance and were individually prepared for electron microscopy and DNA sequencing. These flagellates possessed several novel features, such as (1) gliding motility associated with four bundled recurrent flagella, (2) heart-shaped cells about 35–75 μm in diam., and (3) bright orange coloration caused by linear arrays of muciferous bodies. Each cell also possessed about 2–30 pale orange bodies that were enveloped by two membranes and sac-like vesicles. The innermost membrane invaginated to form unstacked thylakoids that extended towards a central pyrenoid containing tailed viral particles. Although to our knowledge, these bodies have never been described in any other eukaryote, the ultrastructure was most consistent with photosynthetic endosymbionts of cyanobacterial origin. This combination of morphological features did not allow us to assign A. quadriverberis to any known eukaryotic supergroup. Thus, we sequenced the small subunit rDNA sequence from two different isolates and demonstrated that this lineage evolved from within the Cercozoa.A rare tetraflagellate, A. quadriverberis underscores how poorly we understand the diversity of cercozoans and, potentially, represents one of the few independent cases of primary endosymbiosis within the Cercozoa and beyond.Our discovery and characterization of Marine benthic environments contain a diverse assortment of microorganisms that are still just beginning to be explored and characterized ,2. The cinsertae sedis, fall within the Cercozoa, such as Allantion, Allas, Bodomorpha and Spongomonas .Cell shape ovoid, prominently lobed or inverted heart-shaped; cell size 35–75 μm long, 25–70 μm wide; four homodynamic flagella, inserted subapically and bundled within a ventral longitudinal groove; anterior nucleus with nucleoli; bright orange coloration caused by linear rows of minute orange muciferous bodies; corrugated cell surface with about 80 longitudinal ridges; no cell wall or test; cytoplasm with 2–30 pale orange pigmented bodies; black inclusions usually present at anterior part of the cell; locomotion by slow gliding. Small subunit rRNA gene sequences .The above processes was repeated on one additional cell of Auranticordis quadriverberis were aligned with ClustalW , Auranticordis quadriverberis [GenBank:EU484393 and GenBank:EU484394], Bodomorpha minima [GenBank:AF411276], Bodomorpha sp. [GenBank:DQ211596], Cercomonas plasmodialis [GenBank:AF411268], Cryothecomonas aestivalis [GenBank:AF290539], Dimorpha-like sp. [GenBank:AF411283], Ebria tripartita [GenBank:DQ303922], Euglypha rotunda [GenBank:AJ418784], Exuviaella pusilla [GenBank:DQ388459], Gymnophrys cometa [GenBank:AF411284], Heteromita globosa [GenBank:U42447], Lecythium sp. [GenBank:AJ514867], Massisteria marina [GenBank:AF174372], Metopion-like sp. [GenBank:AF411278], Paulinella chromatophora [GenBank:X81811], Proleptomonas faecicola [GenBank:AF411275], Protaspis grandis [GenBank:DQ303924], Pseudodifflugia cf. gracilis [GenBank:AJ418794], Pseudopirsonia mucosa [GenBank:AJ561116], Rigidomastix-like sp. [GenBank:AF411279], Spongomonas minima [GenBank:AF411280], Thaumatomastix sp. [GenBank:AF411261], thaumatomonadida environmental sample [GenBank:EF023494], Thaumatomonas coloniensis [GenBank:DQ211591], Thaumatomonas seravini [GenBank:AF411259], uncultured eukaryote [GenBank:AB252750], uncultured eukaryote [GenBank:AB252755], uncultured eukaryote [GenBank:AB252756], uncultured eukaryote [GenBank:AB275058], and uncultured marine eukaryote [GenBank:DQ369017].The SSU rDNA nucleotide sequences included in 32-taxon analyses for this paper are available from the GenBank database under the following accession numbers: CC and BSL conceived and designed the experiments. CC, HJE, and BSL performed microscopical studies. CC conducted the molecular studies, the sequence alignments, and phylogenetic analyses. CC and BSL analyzed the data, drafted the manuscript, and wrote the paper. All authors have read and approved the final manuscript.

Mycobacterium tuberculosis (M.tb), the causative agent of one of today's most widely spread infectious diseases. The resulting drug-target interaction network for all structurally characterized approved drugs bound to putative M.tb receptors, we refer to as the ‘TB-drugome’. The TB-drugome reveals that approximately one-third of the drugs examined have the potential to be repositioned to treat tuberculosis and that many currently unexploited M.tb receptors may be chemically druggable and could serve as novel anti-tubercular targets. Furthermore, a detailed analysis of the TB-drugome has shed new light on the controversial issues surrounding drug-target networks http://funsite.sdsc.edu/drugome/TB) has the potential to be a valuable resource in the development of safe and efficient anti-tubercular drugs. More generally the methodology may be applied to other pathogens of interest with results improving as more of their structural proteomes are determined through the continued efforts of structural biology/genomics.We report a computational approach that integrates structural bioinformatics, molecular modelling and systems biology to construct a drug-target network on a structural proteome-wide scale. The approach has been applied to the genome of Mycobacterium tuberculosis, the causative agent of tuberculosis, to all structurally characterized approved drugs, and hence construct a proteome-wide drug-target network – the TB-drugome. The TB-drugome has the potential to be a valuable resource in the development of safe and efficient anti-tubercular drugs. More generally, the proteome-wide and multi-scale view of target and drug space may facilitate a systematic drug discovery process, which concurrently takes into account the disease mechanism and druggability of targets, the drug-likeness and ADMET properties of chemical compounds, and the genetic dispositions of individuals. Ultimately it may help to reduce the high attrition rate in drug development through a better understanding of drug-receptor interactions on a large scale.The worldwide increase in multi-drug resistant TB poses a great threat to human health and highlights the need to identify new anti-tubercular agents. We have developed a computational strategy to link the structural proteome of Mycobacterium tuberculosis (M.tb) genome, only nine have been pharmaceutically investigated The construction and analysis of molecular interaction networks provides a powerful means to understand the complexity of biological systems and to reveal hidden relationships between drugs, genes, proteins, and diseases. In particular, the study of drug-target networks may facilitate an improved understanding of the principles of polypharmacology and hence improved rational drug design It is important to construct and analyze a proteome-wide drug-target network that includes not only the primary targets, but also all of the potential off-targets of the drugs in the network. Such a network, if available, would provide unparalleled opportunities for mapping a comprehensive drug-target space and understanding the molecular basis of drug efficacy, side- effects and drug resistance, thereby providing the foundation for the rational design of polypharmacological (multi-target) drugs. For anti-infectious drug discovery, where pharmaceutically investigated targets only represent a small portion of the whole pathogen's proteome, it is more challenging to establish a proteome-wide drug-target network. The linkage of drugs to less exploited proteins such as virulence factors, transport proteins and transcription factors will greatly expand the repository of anti-infectious drug targets and provide new solutions for combating multi-drug and extensively drug resistant pathogens, and for repurposing existing drugs for new uses.M.tb proteome, there are 284 unique proteins in the RCSB Protein Data Bank (PDB)M.tb. By taking reliable homology models into consideration, it is possible to increase the structural coverage of the M.tb proteome to approximately 43%. By taking advantage of this structural information, we have developed an integrated structural bioinformatics, molecular modelling and systems biology method to construct and analyze a drug-target interaction network, to discover novel druggable targets, and to propose new drug repositioning strategies. Our method is based on the comparison of the binding sites of existing drugs approved for human use against the entire structural proteome of the pathogen under investigation, in order to relate these drugs to new targets. For each identified drug-target pair, the atomic details of the interaction are studied using protein-ligand docking. If the protein is in a metabolic network model, the phenotype change resulting from the drug perturbation is further investigated using flux balance analysis (FBA) of the metabolic network. This strategy has been applied to study several selected drug targets, and proven, both computationally and experimentally, to be a useful tool in drug repositioning Structural bioinformatics provides an alternative and complementary way to extend drug-target networks to less characterized proteins on a proteome-wide scale. The structural coverage of a given pathogen proteome is usually much larger than the pharmaceutical target coverage. In the case of the M.tb strains resistant to all existing, affordable drug treatments means that the development of novel, effective and inexpensive drugs is an urgent priority. However, conventional drug discovery is a time-consuming and expensive process that is poorly equipped in the battle against tuberculosis. In this study, we apply our integrated approach in constructing the drug-target network of M.tb, which we refer to as the ‘TB-drugome’. Using the TB-drugome we first attempt to characterize all drug-target interactions of the M.tb proteome and to shed new light on controversial issues surrounding drug-target networks M.tb proteins may be highly druggable and could therefore serve as novel anti-tubercular targets. The TB-drugome is publically available (http://funsite.sdsc.edu/drugome/TB) and has the potential to be a valuable resource for the development of safe and efficient anti-tubercular drugs. Structural biology and structural genomics efforts continue to increase the structural coverage of the M.tb proteome The continuing emergence of A total of 274 different drugs approved for human use in the United States and Europe were identified in the RCSB Protein Data Bank (PDB) M.tb, was constructed by associating the putative ligand binding sites of M.tb proteins with the known binding sites of approved drugs for which structural information about the target was available. The premise is that two entirely unrelated proteins can bind similar ligands if they share similar ligand binding sites. In this way, a M.tb protein can be connected to a drug through the drug's target, irrespective of whether that protein target is from human or another organism. The binding site comparison software SMAP M.tb proteins (blue circles) connected to drugs (red circles), where a single connection indicates binding site similarity between any of the structures of the connected M.tb protein, and any of the binding sites of the connected drug. The TB-drugome is highly connected, indicating that many binding site similarities were observed between M.tb proteins and drug targets, even though those proteins had different overall structures.The TB-drugome, a structural proteome-wide drug-target network of P-value threshold that gives a balanced false positive and negative rate in the TB-drugome, the average connectivity of the drugs was plotted against the SMAP P-value. A turning point in the curve exists for a SMAP P-value of 1.0e-5 . Thus, it is estimated that around 40% of these 274 approved drugs, or their associated compound libraries, may be active against around 25% of the P-value threshold . The nLCC values for M.tb targets and drugs are 0.93 and 0.84, respectively, compared to nLCC values of 0.97 and 1.0, respectively, for a random network , cyp51 (Rv0764c), embA (Rv3794), embB (Rv3795), embC (Rv3793), folK (Rv3606c), InhA (Rv1484), katG (Rv1908c) and rpoC (Rv0668) To our knowledge, there are currently only nine M.tb metabolism. The GSMN-TB model in vivo conditions, while the iNJ661 model in vitro conditions.Although gene essentiality is not necessarily correlated with chemical druggability, it is interesting to investigate whether or not those proteins with a large TCDI are crucial for bacterial survival or virulence. If a gene is both essential and chemically druggable, it will be an ideal target for drug development. The biological roles of these proteins were determined primarily from the literature. Since several of the proteins listed in M.tb CRP/FNR transcriptional regulator has been demonstrated through knockout studies. Indeed, deletion of this gene is known to cause growth defects in laboratory medium, in bone marrow derived macrophages and in a mouse model of tuberculosis M.tb protein with the second highest TCDI is InhA (enoyl-acyl carrier protein reductase), which is actually the target of the front-line anti-tubercular agent isoniazid M.tb strains has promoted the discovery of a number of direct inhibitors of InhA in vitro bacterial growth study and an enzyme kinetic assay supported our previous in silico prediction that Comtan, a drug used in the treatment of Parkinson's disease, could potentially be repurposed to target InhA directly Most of the proteins in M.tb proteins that, although not predicted to be essential, may play important roles in the host-pathogen interaction. The protein with the third highest TCDI is Rv1264, a class III adenylyl cyclase which synthesizes cAMP from ATP in response to sensing the mildly acidic pH of the host macrophage phagosome. Biochemical studies of Rv1264 have suggested that it may be crucial for the M.tb host-pathogen interaction, thereby highlighting it as another potentially interesting drug target There are a number of M.tb. For example, Rv1272c is an efflux pump that detoxifies antibiotics. Combination therapy using antibiotics mixed with efflux pump inhibitors could therefore be a practical solution for increasing the efficacy of antibiotics Several other non-essential genes may contribute to drug resistance mechanisms exhibited by M.tb protein. This is advantageous both in terms of drug effectiveness and preventing the development of drug resistance. Indeed, large-scale functional genomics studies in model organisms have shown that the vast majority of single-gene knockouts actually exhibit little or no effect on phenotype The TB-drugome reveals that, of the 274 different drugs investigated, 92 drugs could potentially inhibit more than one M.tb proteins simultaneously. It is important to note that there are two types of connections in the TB-drugome; those that involve proteins belonging to the same fold, and those that involve proteins belonging to different folds. The detection of functional relationships between proteins belonging to the same fold is considered to be a trivial task because it can be achieved by simply using conventional sequence and structure comparison tools. It is more interesting and novel to relate proteins across fold space, i.e., when the primary drug target and its off-target(s) do not share similar global structures. Such cross-fold connections constitute around 60% of all connections in the TB-drugome has not been solved, therefore explaining why it is not listed as a potential target in Thermus thermophilus. The fact that rifampin has connections with six other solved M.tb proteins in P-value of 4.32e-4. Rifampin is predicted to bind to the NAD and FAD binding sites of InhA and lpdA, respectively. Both of these predictions are supported by the compound association listed in the TDR target database The front-line anti-tubercular agent rifampin is listed as the fifth most highly connected drug in M.tb proteins listed in M.tb, and absent from humans M.tb is the sigma factor sigC, which controls the environment dependent regulation of transcription M.tb persistence is the universal stress protein, TB31.7, which is required for the entry of the tubercle bacillus into the chronic phase of infection in the host M.tb targets listed in A literature search of the M.tb proteins listed in M.tb metabolism. The GSMN-TB model in vivo conditions. Those genes that were present in the GSMN-TB model, and whose knockout could therefore be simulated, are underlined in could potentially inhibit may be interesting anti-tubercular targets. For instance, pknG, a eukaryotic-type protein kinase, has been shown to support the survival of mycobacteria in host cells Since many of the genes encoding the If all members of a set of proteins can bind to the same set of multiple drugs, this set of proteins could provide interesting targets for polypharmacological drugs. Such polypharmacological drug targets can be derived from the TB-drugome. Indeed, several multi-drug-multi-target clusters are distinguishable within the drug-target matrix shown in An interesting cluster is ilvG (acetolactate synthase), asd , fadE13 (acyl-CoA dehydrogenase) and Rv0037c (MFS-type transporter), all of which are predicted to bind to HIV-1 protease inhibitors. There is a major problem with coincidence of HIV and tuberculosis in sub-Saharan Africa. Indeed, HIV and tuberculosis form a deadly combination, each accelerating the other's progress. Since HIV weakens the immune system, HIV-positive individuals are much more susceptible to developing an active form of tuberculosis and becoming infectious M.tb genome, only nine proteins have been pharmaceutically investigated All existing drug-target networks have been constructed from annotated drug-target pairs or predicted based on the chemical properties of the ligands from these drug-target pairs. As a result they only include the limited number of human drug targets that have been pharmaceutically investigated, i.e., a small, highly biased subset of the human proteome. The lack of a broad spectrum of drug-target pairs is more severe in pathogens than it is in human. For example, among the 3,999 proteins encoded in the M.tb proteome is limited. Currently only 7.2% of M.tb proteins have solved structures in the PDB. The use of reliable homology models increases the structural coverage to around 43%. However, each homology model consists of only a single chain rather than the entire biological unit, which could be a multi-polypeptide chain complex. As a result interesting binding sites located in the interface between the chains may be missed. Similarly, only around 20% of all drugs approved for human use have actually been solved with a protein target structure in the PDB. Coverage of drug space can be increased by using crystal structures or homology models of proteins that are known targets of approved drugs, but for which there are no structures with the drugs bound. For instance, the additional inclusion of homology models of GPCRs would double the number of targets.Notwithstanding, there are major limitations in the methodologies applied in this study. Firstly, the structural coverage of the Two proteins may bind to similar ligands even though their binding pockets may have varied geometrical and physicochemical properties. Such proteins may be sequence homologues, have similar structures, or belong to entirely different folds. For the first two scenarios, SMAP is more sensitive than conventional sequence and structural comparison methods in detecting ligand binding site similarity M.tb proteome and the completely different ligand binding poses, ligand binding site similarity is necessary but not sufficient to determine the cross-reactivity between two proteins for a specific ligand. The chemical nature of the ligand also determines off-target binding. Although off-target predictions based on similar ligand binding sites are invaluable for the progressive design of selective or polypharmacological drugs, they may result in false positive connections between proteins and existing drugs. Thus, the TCDI may be not correlated with the docking scores. The direct assessment of protein-drug interactions using protein-ligand docking may solve part of this problem, but success is not guaranteed due to the inaccuracy of docking scoring functions. While free energy calculations based on molecular dynamics simulations may improve the prediction of protein-ligand interactions, they are computationally intensive and currently impractical on a proteome-wide scale. It remains a significant challenge to develop new methodologies for accurate and efficient protein-ligand docking and free energy calculation for the prediction of drug off-targets on a proteome-wide scale.Aside from the false negatives that result from the limited structural coverage of the et al. discovered that the topologies of drug-target networks are implicitly dependent on drug properties and target families It has been argued that drug-target networks are not modular but random et al. found that polar molecular surface area, H-bond donor counts, H-bond acceptor counts and partition coefficients are key factors that can be used to discriminate hub ligands from others In the case of protein-ligand interaction networks, the structural basis behind their power-law distribution and scale-free nature could be the modularity of protein-ligand binding sites, the modular arrangement of chemical fragments There are two aspects of target druggability; biological and chemical. From a biological point of view, druggability is conventionally based upon multiple criteria such as gene essentiality, conservation across kingdoms, protein-protein interactions, redundancy among pathways, endogenous metabolite distributions, and coupling between metabolic, regulatory and signalling pathways. However, a biologically druggable essential gene is not necessarily chemically druggable because it may be difficult to design a drug-like molecule to bind it with high affinity and specificity. Thus, biologically validated drug targets need to be linked to their chemical space as early as possible in order to determine their chemical druggability. Although chemical druggability can be predicted from the ligand binding site of a protein If the functional site of a single protein is connected to, and could therefore potentially be inhibited by, one or more approved drugs, this is a strong indication that this protein may be chemically druggable. Moreover, if a protein has a high TCDI, this implies that any new ligand found will likely occupy the chemically constrained space of approved drugs, as opposed to the essentially unlimited chemical space, and this could benefit drug discovery in many ways. Firstly, it could narrow down the infinite chemical space needed for high-throughput screening to identify lead compounds. Secondly, it provides information about the ligand binding site, which is critical for rational drug design. Thirdly, it may reduce medicinal chemistry efforts to optimize the lead compound as a drug candidate. Finally, and perhaps most critical in this new era of drug discovery, it offers more opportunities to design polypharmacological drugs, which may not only improve drug efficacy and combat drug resistance, but also minimize human side effects. By taking gene essentiality data, chemical druggability information, ligand binding site information, and the ligand coverage of drug space into account simultaneously, the significant time and costs associated with anti-infectious drug discovery and development could be significantly reduced.M.tb proteins with a high TCDI other than InhA. Thus, the TB-drugome provides abundant testable hypotheses for the development of new anti-tubercular therapeutics. It is expected that the discovery of a drug candidate by the targeted screening of these drugs will require a fraction of the time and costs associated with conventional high-throughput screening. Even if a drug shows weak activity in an initial assay, the assay can be extended to include the large number of analogues of that drug that have already been synthesized and tested. In this way, it may be possible to discover a potent compound that weakly inhibits the primary drug target, but strongly binds to the M.tb target. Such a strategy has been successfully applied to repurpose a library of protein kinase inhibitors to target bacterial biotin carboxylase A search of the TDR target database Conventional drug discovery and development proceeds as a linear process from target identification and validation, to lead discovery and optimization, to preclinical and clinical trials. It is estimated that more than 90% of drug candidates fail during the late stages of drug development, mainly due to poor efficacy or safety In the context of anti-infectious drug discovery, network analysis can be used to identify critical nodes in molecular networks which could represent novel drug targets M.tb strains that are resistant to all existing affordable drug treatments means that the development of novel, effective and inexpensive drugs is an urgent priority M.tb structural proteome. In this way, it is possible to identify putative new targets of existing drugs within the M.tb proteome, providing the basis for their repositioning to treat tuberculosis. Our drug-target interaction network, the TB-drugome, revealed not only that many existing drugs show the potential to be repositioned to treat tuberculosis, but also that some drugs show the potential to be multi-target inhibitors. This is beneficial since multi-target therapy is thought to be more effective than single-target therapy when treating infectious diseases M.tb proteins are potentially druggable and could therefore serve as novel drug targets in the fight against tuberculosis. We provide the TB-drugome (http://funsite.sdsc.edu/drugome/TB) for analysis by others.The continuing emergence of M.tb proteome, 284 of which have solved structures in the RCSB PDB . Although this approximates to only 7.2% structural coverage of the M.tb proteome, it is worth noting that there is likely to be a strong bias towards those targets being relevant to drug discovery. There are multiple structures available for many of these proteins , bringing the total of solved M.tb structures to 749 . By employing these thresholds, it is possible to discard unreliable models. ModBase was found to contain ‘reliable’ homology models for a total of 1,446 unsolved M.tb proteins (see ModBase http://www.accessdata.fda.gov/scripts/cder/ob/default.cfm) and by the European Medicines Agency (EMEA) (http://www.emea.europa.eu/htms/human/epar/a.htm), respectively. The names of the active ingredients of these drugs were extracted and mapped to compounds in three databases; PubChem (http://pubchem.ncbi.nlm.nih.gov/), DrugBank http://www.drugbank.ca/) and ChEBI (http://www.ebi.ac.uk/chebi/). After removing all nutraceuticals and prodrugs, InChI keys were used to map the remaining compounds to protein crystal structures in the PDB. Non-protein crystal structures such as DNA, RNA and ribosomes were excluded. 274 different drugs were identified bound to a total of 962 different protein binding sites . A full list of the approved drug binding sites used in this study is provided in the Supporting Information, Drugs approved for human use in the United States and Europe are listed in the U.S. Food and Drug Administration (FDA) Orange Book with the 962 binding sites of 274 approved drugs, in an all-against-all manner. While the binding sites of the approved drugs were already defined by the bound ligand, the entire protein surface of each of the 2,195 M.tb protein structures was scanned in order to identify alternative binding sites. For each pairwise comparison, a P-value representing the significance of the binding site similarity was calculated.The SMAP software was used to compare the binding sites of the 749 P-value. In order to identify pairs of similar binding sites that were from proteins with dissimilar global structures , the first chain of each PDB file was aligned using FATCAT, and those pairs with a significant P-value of less than 0.05 were discarded.FATCAT http://www.yworks.com/en/products_yed_about.html) was used to visualize the drug-target interaction network. M.tb protein names were taken from the NCBI Entrez protein database (http://www.ncbi.nlm.nih.gov/protein), to avoid inconsistencies in the naming of proteins in the PDB.yEd Graph Editor from yWorks computations. The GSMN-TB model contains 739 metabolites and 726 genes that are involved in 849 unique reactions. For those M.tb genes of interest that were also present in the GSMN-TB model, the single gene knockout tool was used to run essentiality prediction under conditions optimized for in vivo growth. If the resulting maximal theoretical growth rate was zero or close to zero, then a gene was predicted to be essential, whereas if it was the same as wildtype (0.050191 mmol/g DW/h), it was predicted to be non-essential. In order to simulate multiple gene knockouts, the reactions in which these genes were involved were constrained by setting their upper and lower bound values to zero. Note that this was only carried out for those reactions that could not be carried out by any other genes, i.e., those that were entirely dependent on the gene of interest.GSMN-TB M.tb that contains 828 metabolites and 661 genes which are involved in 939 reactions. In order to determine in vitro essentiality we used the COBRA Toolbox iNJ661 M.tb protein. eHiTS Lightning M.tb protein binding site, the aligned coordinates of the drug molecule were used to define the search space for docking that drug into the M.tb protein. The aligned drug molecule was used as the clip file with a default search space of 10Å3. As recommended by the manual, the eHiTS accuracy level was set to 6 (default  = 3), in order to increase the accuracy of the predicted binding poses. Following all docking, the binding pose with the lowest estimated binding affinity was selected for further investigation. For those proteins with cofactors , the cofactor was added as the last residue in the protein structure prior to docking.For those pairs of interest, molecular docking was used to predict the binding pose and affinity of the drug molecule to the k are two fitted parameters.The drug-target interaction network can be represented as a graph. The number of targets or drugs against their connectivity in the graph can be fitted to a power-law distribution, where:A protein graph was constructed for the drug-target network. Nodes represented proteins and edges were formed between two protein nodes if they were connected to the same drug. Then the fraction of the largest connected component (nLCC) of the protein was computed by dividing the number of proteins in the largest single linkage cluster by the total number of proteins in the graph. The nLCC values of drugs can be computed in a similar manner.Protein and drug binding profiles in the TB-drugome were hierarchically clustered using GenePattern 2.0 http://openbabel.org).The 2D fingerprint similarity of drugs was computed using OpenBabel 2.1.1 Click here for additional data file.Figure S2Fitting of the distribution of drug connections to a power-law distribution for the TB-drugome and a random network.(1.06 MB DOC)Click here for additional data file.Figure S3Fraction of the largest connected component (nLCC) in the network for the TB-drugome and a random network at different SMAP P-value thresholds.(0.05 MB DOC)Click here for additional data file.Figure S4The clustering coefficient of the TB-drugome derived from different fractions of structurally characterized drugs.(0.07 MB DOC)Click here for additional data file.Figure S5Predicted drug binding site and poses in adenylyl cyclase.(0.75 MB DOC)Click here for additional data file.Table S1Information about the approved drug binding sites used in the TB-drugome. This file contains information about the 274 approved drugs that were identified in the PDB. For each drug, its name, PDB ligand code, isomeric SMILES string and known targets are listed, and the PDB codes of the protein structures with which it has been crystallized are given.(0.09 MB XLS)Click here for additional data file.Table S2Cross-fold drug-target pairs in the TB-drugome (for solved M.tb structures only). This file contains a list of the cross-fold drug-target pairs with a SMAP P-value <1.0e-5, for solved M.tb structures only. For each pair, information about the drug and target structures is given, as well as the corresponding SMAP P-value (indicating the significance of the binding site similarity) and eHiTS energy score (from docking the drug into the predicted binding site in the M.tb protein).(0.08 MB XLS)Click here for additional data file.Table S3Cross-fold drug-target pairs in the TB-drugome (for M.tb homology models only). This file contains a list of the cross-fold drug-target pairs with a SMAP P-value <1.0e-5, for homology models of M.tb proteins only. For each pair, information about the drug and target structures is given, as well as the corresponding SMAP P-value (indicating the significance of the binding site similarity) and eHiTS energy score (from docking the drug into the predicted binding site in the M.tb protein).(0.15 MB XLS)Click here for additional data file.Table S4Information about the solved M.tb structures used in the TB-drugome. This file contains information about the M.tb proteins with solved structure(s) in the RCSB PDB that were used in the the TB-drugome. For each protein, the gene name (if available), gene accession number, protein name and corresponding PDB codes are given.(0.06 MB XLS)Click here for additional data file.Table S5Information about the M.tb homology models used in the TB-drugome. This file contains information about the reliable homology models of M.tb proteins from ModBase that were used in TB-drugome. For each homology model, the ModBase model code is given, as well as the gene accession number, gene name and description of the M.tb protein. N.B. Further information about each homology model can be found on the ModBase website.(0.24 MB XLS)Click here for additional data file.Table S6Parameters to fit the power law distribution for drug connections in the TB-drugome.(0.03 MB DOC)Click here for additional data file.Table S7Parameters to fit the power law distribution for target connections in the TB-drugome derived from the fraction of structurally characterized drugs.(0.03 MB DOC)Click here for additional data file.Table S8Parameters to fit the power law distribution for drug connections in the TB-drugome derived from the fraction of structurally characterized drugs.(0.03 MB DOC)Click here for additional data file.

Sparse literature documenting the location of pain at the onset of migraine attacks and during established headaches is available.A prospective study (2003–05) on 800 adult migraine patients , 2:1.1, 1.2.1 and 1.6.1) was conducted to document (a) sites of onset of pain and (b) location of pain during established attacks (in >50% occasions) through semistructured interviews.N = 800; M:F = 144:656 (1:4.56); age, 16–42 years ; duration of migraine, 1–18 years . 87% of the subjects were ethnic Bengalis from the eastern Indian state of West Bengal, Calcutta being the capital city.(on the basis of >50% headache spells): N = 800; 1.1:668 (83.5%); 1.2.1:18 (2.25%); 1.6.1:114 (14.25%).Unilateral onset was present in 41.38% of the patients; of these, 53.17% had eye pain; 8.16%, frontal pain and 38.67%, temporal pain. In 32.25% of the patients, bilateral/central location of pain, mostly bitemporal or at vertex was noted. Cervico-occipital pain onset was noted in 26.43% patients .In 47.4% of the patients, with unilateral ocular or temporal onset, pain remained at the same site. Pain became hemicranial in 32.9%. In most patients, unilateral frontal onset pain (55.5%) became bilateral or holocranial. Most bilateral ocular (69.4%) and temporal onset (69.7%) pains remained at the same location. However, most bifrontal (55.6%) and vertex onset (56.9%) pains subsequently became holocranial. Most occipital pains at onset became holocranial (45.3%), but cervical pains subsequently became either hemicranial (38.3%) or holocranial (36.2%).This study documents location of pain at the onset and during established headaches in migraine patients largely from a specific ethnic group. Migraine with aura appears to be rare among ethnic Bengalis in eastern India. More than half had onset pain bilaterally/centrally and in the cervico-occipital regions. Only 40.5% experienced only unilateral pain. Cervico-occipital migraine pain appears to be common in ethnic Bengalis. This notion has perpetuated through centuries, and a unilateral location of pain has been included in the diagnostic criteria of migraine by the International Headache Society (IHS) according to the International Classifications of Headache Disorders (ICHD-1 and ICHD-2) conducted in 1988 and 2004, respectively.14 Experieut aura).6 These aut aura). These obThe present study was carried out between September 2003 and December 2005 at the neurology outpatients department (tertiary care center) of a large general hospital (550 beds) in Calcutta in eastern India, which is largely dominated by ethnic Bengali population. We assessed a total of 1172 adult patients (>15 years of age) by using a semi-structured questionnaire; these patients were diagnosed with episodic migraine attacks and experienced at least 2 attacks of acute migraine every month during the preceding 6 months of enrollment and were not on any form of prophylactic medication for the same period. Diagnoses of migraine and migraine subtypes were made according to the ICHD-2 criteria available on the web in 2003 and later published in February 2004. The assessment was made through several stages.At the first visit, each patient was evaluated by one of the three participating consultants (authors) to confirm the diagnosis of migraine, identification of subtype and arranging relevant investigations to exclude secondary headaches as and when required (imaging performed in 162 patients and showed positive result in only two patients).During the second visit, one week (on average) later, each patient was evaluated using a semi-structured questionnaire by a trainee physician specifically assessing the site of location of the onset pain and its subsequent location during established attacks in the majority (>50%) of headache spells in the preceding six months. The patients were requested to place their hands at the sites of onset pain, indicate with their hands the subsequent spread of the pain (if possible) and finally the location of pain during the established phase of the headache. Descriptions of the terminologies associated with anatomical sites are presented at the end of this section.During a third visit, usually a month later, each patient was asked the same question regarding the location of pain by one of the authors (consultants) and the responses compared to those given in the interview by the trainees. In subjects in whom some discrepancies were noted between the two responses, the patients were offered the first responses and given the choice to be really specific. At this stage, patients (n = 102) providing grossly discrepant and vague responses were excluded from the study. Moreover, patients who failed to turn up for the second or third stage of interview (even after reminder) were excluded at this stage.Finally, all response sheets were carefully evaluated by the corresponding author and only the first 800 subjects providing consistent (or near consistent) responses to questions associated with pain localization both at the onset and during the established phase of headache, were included for analysis.The study includes only patients with episodic migraine and not those presenting with chronic migraine (ICHD-2 criteria). Pain in most of these patients was found to be rather poorly localized at the onset and during the ongoing headache phase.Description of terms used for anatomical sites for the location of pain:1.Ocular:Eye/Orbit2.Frontal:Unilateral – one side of forehead Bifrontal – whole of forehead3.Temporal:Unilateral/Bilateral temporal region4.Hemicranial:Unilateral temporal and parietal regions; may involve ipsilateral frontal/orbital regions and occasionally ipsilateral occipital area5.Vertex/Central:Center of the cranium6.Occipital:Back of head above hairline – generally both sided7.Cervical:Back of neck below hairline – generally both sided8.Holocranial:Whole forehead, temporal and parietal as well as central cranial area and occipital regionIt may be noted that, while noting the location of pain, especially at the onset, the area mostly affected was taken into account. For example, pain involving one side of forehead but extending slightly into the temporal region, had been designated as frontal onset and similarly vice versa. Indeed, this may be somewhat artificial, but this was necessary for simplifying the final analysis a little but maintaining its significance.The demographic and ethnic characteristics of the subjects are described in Our main observations were the following: migraine with aura is uncommon in Indian patients, especially amongst ethnic Bengalis in eastern India . ApproxThe present study was carried out among adult migrain patients attending the neurology outpatient department of a general teaching institution and comprised largely (87%) of subjects belonging to a specific ethnic origin . It appears that apparently no previous study on clinical aspects of migraine has taken into account the ethnicity of the subjects.Apart from Kelman's recent report, no otherThere are two important observations that deserve special attention. In Indian patients with migraine , only unilateral headache occurred in only 40.5% patients and true hemicranial headache occurred in only one-fifth of all the subjects on most (>50%) occasions of migraine attacks. These f10et al,[The location of migraine pain at the onset in the cervico-occipital region (noted in over a quarter of subjects in the present series) is noteworthy, especially the occurrence of predominantly cervical location in over 10% of subjects. This had not been adequately addressed to in the western literature, although Kelman did note this in a recent communication. Indeed, et al, but the Most migraine pains noted in the present series appeared to have an ‘anterior’ location, as noted in nearly all studies conducted in the West. This would be consistent with the generally agreed pathophysiology of migraine with trigeminovascular activation involving the first division of the trigeminal nerve. Kelman suggesteIt is expected that similar clinical studies associated with the location of migraine pain would be carried out in different geographic regions and in different ethnic groups to highlight global variability in the phenotypic expression of this common disorder.

Both chronic obstructive pulmonary disease (COPD) and tuberculosis (TB) primarily affect the lungs and are major causes of morbidity and mortality worldwide. COPD and TB have common risk factors such as smoking, low socioeconomic status and dysregulation of host defence functions. COPD is a prevalent co-morbid condition, especially in elderly with TB but in contrast to other diseases known to increase the risk of TB, relatively little is known about the specific relationship and impact from COPD on TB-incidence and mortality.All individuals ≥40 years of age, discharged with a diagnosis of COPD from Swedish hospitals 1987–2003 were identified in the Swedish Inpatient Register . Records were linked to the Swedish Tuberculosis Register 1989–2007 and the relative risk of active TB in patients with COPD compared to control subjects randomly selected from the general population was estimated using Cox regression. The analyses were stratified by year of birth, sex and county of residence and adjusted for immigration status, socioeconomic status (SES) and inpatient co-morbidities previously known to increase the risk of TB. COPD patients had a three-fold increased hazard ratio (HR) of developing active TB ) that was mainly dependent on an increased risk of pulmonary TB. In addition, logistic regression estimates showed that COPD patients who developed active TB had a two-fold increased risk of death from all causes within first year after the TB diagnosis compared to the general population control subjects with TB .This population-based study comprised of a large number of COPD patients shows that these patients have an increased risk of developing active TB compared to the general population. The results raise concerns that the increasing global burden of COPD will increase the incidence of active TB. The underlying contributory factors need to be disentangled in further studies. Chronic obstructive pulmonary disease (COPD) and tuberculosis (TB) are both diseases that mainly affect the lungs and are major causes of morbidity and mortality worldwide.Mycobacterium tuberculosis and eight million new cases of TB are reported every year One third of the world population is infected with The development of COPD results from a combination of polygenic inflammatory vulnerability and environmental factors, mainly tobacco smoke, leading to lung tissue remodelling and a non-reversible airflow limitation TB and COPD have common risk factors such as smoking and low socioeconomic status The study was approved by the Lund University Research Ethics Committee (590/2004 and 294/2007). Informed consent was not obtained since all information regarding individuals was made anonymous to investigators prior to analysis in accordance to Swedish regulations. Swedish health care is publicly financed and all inpatient care is provided independently of health insurance and the patient's financial status. A unique, lifelong ten-digit personal identity number assigned to each person living in Sweden provides the possibility of linking records in databases administrated by the following federal institutes: Centre for Epidemiology , Statistics Sweden, and The Swedish Institute for Infectious Disease Control.The Swedish National Inpatient Register, which was applied nationwide in 1987, includes individual information on all hospital discharges since 1964 with diagnosis coded according to The International Classification of Disease (ICD), Coding is performed by physicians at discharge and contra-signed by board-certified specialists. All records are controlled for general inadequacies and specific validation studies indicate that coverage is above 98% and that almost 90% of the diagnoses reported to the inpatient register are correct when compared with the original medical filesThe Total Population Register includes individual information on vital status, dates of immigration and emigration, county of residence, and country of birth.The Swedish National Population Censuses performed in 1980, 1985 and 1990 provide information on housing conditions and socioeconomic status (SES). Participation was mandatory and response rates were 99.0%, 99.2% and 97.5%, respectively. Individuals were classified into different socioeconomic index groups (SEIs) based on type of occupation, educational background and responsibility levels according to specific criteria defined by Statistics Sweden. Subjects with missing information were mainly old age pensioners, unemployed, disability pensioners, homemakers and studentsThe Tuberculosis Register: The Swedish Institute for Infectious Disease Control (SMI) monitors the epidemiology of infectious diseases in Sweden. All forms of TB have been notifiable according to law in Sweden since 1939. In 1969 a national tuberculosis register based on individual reports according to the communicable disease act was set up; since 1989 this register is administered by SMI. Reporting incident TB cases to the TB register is done in parallel by both the microbiological laboratories and clinicians when a patient is culture-positive. Clinically diagnosed TB is reported by clinicians only. The summarised statistics for the Tuberculosis Register during 1989–2007 is shown in because of COPD) or as secondary diagnosis . A total of 151,364 patients were identified, born 1880–1963, mean year of birth 1922. For each individual with a diagnosis of COPD, Statistics of Sweden randomly selected one control subject out of the general population from the Total Population Register matched for sex, year of birth, and county of residence during the year of first hospital discharge listing a COPD diagnosis.The Centre for Epidemiology identified all individuals 40 years of age or older with a hospital discharge diagnosis of COPD between 1987–2003 in the Inpatient Register according to the International Classification of Diseases, Ninth and Tenth revisions , either as a main diagnosis in the analysis by localisation. Individuals with more than one episode were counted only once. Follow up started one year after the first hospitalisation with COPD and on the corresponding date for control subjects to account for the fact that early TB symptoms may mimic COPD. Follow up ended with the first episode of TB, date of emigration, date of death or 31 December, 2007, whichever came first. A flow chart showing the principles of the study design is shown in Among the 151,364 COPD patients, 101 (0.07%) individuals were excluded because of data-irregularities. Another 27,357 (18.1%) COPD patients, who died during the first year after COPD diagnosis, were excluded since they had a follow-up time of less than a year. 749 (0.49%) COPD patients were excluded from the analysis because of TB or TB-sequelae prior to or during their first year of hospitalisation with COPD identified in either the Tuberculosis Register (n = 212) or the Inpatient Register (n = 537) 1987–2003 . 7,216 (4.8%) control subjects had a follow up time of less than a year, 162 (0.11%) control subjects were excluded because of TB or TB-sequelae prior to inclusion identified in either the Tuberculosis Register (n = 68) or the Inpatient Register (n = 94) 1987–2003.As controls were randomly selected from the background population, some of the COPD patients also appeared as control subjects with time. We excluded 2,528 (1.6%) who had been hospitalised with a COPD-diagnosis prior to inclusion. Another 3,935 (2.7%) control subjects were initially included in the analysis but censored by the date of the first hospitalisation listing COPD. Because of the matched design 7,290 (4.8%) COPD-patients lacking controls due to exclusions and 25,591 (16.9%) odd controls were excluded. Analysis was based on the remaining 115,867 case-control pairs. Baseline characteristics of the study populations are shown in Cox proportional hazards models were used to estimate hazard ratios (HR) of subsequent TB, comparing patients with COPD and control subjects. HRs were calculated separately for pulmonary, extra-pulmonary and pooled TB infections. All models were internally stratified by year of birth, sex and county of residence and subsequently adjusted for SES, co-morbidity and immigration status, dichotomised by birth in Sweden (yes/no). Co-morbidity was defined as prior hospital discharge diagnosis of diabetes mellitus, cardiac disease, alcohol liver disease or alcohol abuse, or silicosis, according to ICD-9 or ICD-10, as well as total number of hospitalizations and total duration of hospital stay. Interactions between COPD-status and age at inclusion, year of birth, sex, SES, immigration status, the level of diagnosis and prior hospitalization on outcome were tested by entering interaction terms to the fully adjusted COX model. Baseline predictors of TB among COPD patients were estimated using Cox regression stratified by year of birth among those born after 1915 who were not old age pensioners when the population censuses were performed. In the sub-population of patients with TB, logistic regression adjusted for sex and age at TB-diagnosis was used to estimate the OR of one-year all-cause mortality between COPD patients and control subjects. Proportionalities of hazards were assessed graphically and by testing for a non-zero slope in a generalised linear regression of the scaled Schoenfeld residuals as a function of time. All analyses were performed using STATA/SE .Among the 231,734 cases and controls, a total of 291 first episodes of TB occurred - 201 among COPD patients and 90 among the control subjects during 680,818 and 986,119 person-years of follow-up, respectively, as detailed in There was no evidence of effect modification by age at inclusion (p = 0.26), year of birth (p = 0.89) sex (p = 0.50), SES (p = 0.19), immigration status (p = 0.77) or the level of diagnosis (i.e. whether the COPD diagnosis was primary or secondary) (p = 0.13). A stratified analysis, restricted to those pairs of COPD-patients/controls where the control subject had been hospitalized prior to inclusion , thus using an in-patient control group yielded similar results, with an HR of 3.06 (95% CI 1.98–4.73). A subgroup analysis between this subgroup and the subgroup of pairs where the control had no prior hospitalization showed no significant difference between the groups, (p = 0.93 from likelihood ratio test for interaction). A sensitivity analysis was performed wherein control subjects who were later hospitalised for COPD were not censored, thus analysing them as both COPD patients and controls. This analysis yielded a similar result after stratification for age, sex, and county of residence, adjusted for co-morbidity, SES and immigration status, resulting in a HR of 3.0 (95% CI 2.3–3.9). An additional analysis was performed in the 35,497 excluded case-control pairs, in whom 412 TB cases occurred during 1989–2003 (310 in COPD-patients and 102 in controls). Conditional logistic regression yielded OR 2.9 (2.3–3.7) adjusted for immigration status.Pulmonary TB was seen in 175 COPD patients and 64 control subjects, corresponding to an HR of 3.7 (95% CI 2.9 to 5.1) when stratified by age, sex and county and adjusted for immigration status, co-morbidity and SES. Extra-pulmonary TB was seen in 44 COPD patients and 39 control subjects resulting in an HR of 1.7 (95% CI 1.0 to 2.6) stratified by age, sex and county and fully adjusted.Of the 291 patients who developed TB, 122 died within the first calendar year after the TB-diagnosis; 93 of the 201 COPD patients and 29 of the 90 control subjects. Median age at death was 79 years of age among COPD patients and 82 years of age among control subjects. COPD patients with TB had an odds ratio (OR) with respect to death of 2.2 (95% CI 1.3 to 3.9) adjusted for age at TB-diagnosis, compared to general population controls with TB. Cardiac disease and SES were the only covariates significantly associated with death in univariate analysis and none of the investigated co-morbidities, immigration status, sex nor SES covariates reached significance in multivariate analysis (data not shown). Estimation of the OR, with respect to death within two years after TB-diagnosis, yielded similar results.217 TB cases occurred among the 86,920 COPD patients born after 1915 who were not old age pensioners when the population censuses were performed. Hence missing information on SES was equal to being outside the workforce mainly as disability pensioner, unemployed, homemaker or student. Immigration status, sex and SES, all predicted the risk of TB in univariate analysis stratified by year of birth. In the multivariate model stratified for year of birth and adjusted for all of the above parameters, immigration status, sex and SES remained significant; see Previous studies have shown that COPD is a frequent co-morbid condition in TB patients The national, publicly-financed health care system ensures that the present study covers all patients hospitalised with COPD in Sweden during the observation period. However, COPD patients who were only treated as outpatients were not included in the analysis. The prevalence of physician-diagnosed COPD in Sweden is estimated to be around 5% Validation of the COPD diagnosis was not possible due to anonymisation of data prior to analysis, but there was no evidence for an effect modification by the level of diagnosis, suggesting that the diagnosis of COPD, whether primary or secondary, was equally accurate. Swedish validation studies of hospital discharge coding suggest a slight overlap between COPD and asthma A limitation of the present study is the inability to estimate the risk of exposure to TB, previous or current. In addition, it was not possible to identify individuals who suffered from latent tuberculosis infection or who were recently exposed to TB at the time of the study entry. Individuals identified as having had TB or TB-sequelae were excluded from analysis since pulmonary TB itself can lead to COPD Models were adjusted for the use of inpatient care at baseline and inpatient co-morbid conditions associated with COPD and previously known to increase the risk of active TB There is growing consensus that smoking increases the risk active TB-diseaseSmoking prevalence in Sweden as reflected in the control group has declined during the past decadesDespite the inability to control for smoking, our results are in line with previous studies. A case-control study of from England M Tuberculosis as well. In addition, patients suffering from COPD-exacerbations are often treated with oral corticosteroids, a well known risk factor for TB Apart from smoking, COPD patients suffer from conditions that could potentially increase the risk of active TB such as low body mass index There are some conflicting findings in the literature as to whether COPD is a risk factor for death from TB This population-based study, comprising a large number of COPD patients, shows that COPD patients have an increased risk of developing active TB compared to the general population. These results raise concern that the increasing global burden of COPD will further enhance the incidence of active TB especially in settings with a high burden of latent TB. The underlying contributory factors such as smoking, low body mass index, impaired muco-ciliary clearance, treatment with corticosteroids or impaired host defense functions need to be disentangled and evaluated in further studies.

The S atom is in a distorted tetra­hedral configuration. There are three intra­molecular C—H⋯O inter­actions forming five- and six-membered rings with graph-set motifs S(5) and S(6), respectively.In the title compound, C Å b = 9.3103 (3) Å c = 12.1754 (4) Å α = 76.061 (2)°β = 88.680 (1)°γ = 88.715 (2)°V = 919.46 (5) Å3 Z = 2 Kα radiationMo −1 μ = 0.20 mmT = 295 (2) K 0.30 × 0.20 × 0.16 mm Bruker Kappa APEX2 diffractometerSADABS; Sheldrick, 1996T min = 0.909, T max = 0.969Absorption correction: multi-scan (23200 measured reflections5739 independent reflectionsI > 2σ(I)4330 reflections with R int = 0.022 R[F 2 > 2σ(F 2)] = 0.042 wR(F 2) = 0.134 S = 1.05 5739 reflections254 parametersH-atom parameters constrainedmax = 0.28 e Å−3 Δρmin = −0.35 e Å−3 Δρ APEX2 used to solve structure: SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008PLATON (Spek, 2003SHELXL97.Data collection: 10.1107/S1600536808024756/bt2761sup1.cif Crystal structure: contains datablocks I, global. DOI: 10.1107/S1600536808024756/bt2761Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

Post translational modifications (PTMs) occur in the vast majority of proteins and are essential for function. Prediction of the sequence location of PTMs enhances the functional characterisation of proteins. Glycosylation is one type of PTM, and is implicated in protein folding, transport and function.We use the random forest algorithm and pairwise patterns to predict glycosylation sites. We identify pairwise patterns surrounding glycosylation sites and use an odds ratio to weight their propensity of association with modified residues. Our prediction program, GPP (glycosylation prediction program), predicts glycosylation sites with an accuracy of 90.8% for Ser sites, 92.0% for Thr sites and 92.8% for Asn sites. This is significantly better than current glycosylation predictors. We use the trepan algorithm to extract a set of comprehensible rules from GPP, which provide biological insight into all three major glycosylation types..We have created an accurate predictor of glycosylation sites and used this to extract comprehensible rules about the glycosylation process. GPP is available online at Most proteins do not perform their function without undergoing some form of post translational modification (PTM) . PTMs ocGlycosylation -4, a comN-linked glycosylation consists of the addition of a pre-assembled glycan chain to Asn. This occurs co-translationally and influences protein folding. After its addition, the glycan chain undergoes a maturation process, which can produce a glycan of the high mannose, hybrid or complex types. The sequence motif Asn-Xxx-Ser/Thr , or in sSeveral glycosylation predictors have been produced -10. WhilThe random forest algorithm is basedm of n rules (see methods), thus giving a comprehensible picture of an otherwise opaque machine learning algorithm.However, the models generated by random forest can be challenging to interpret. Therefore, we have employed trepan , an algo we apply the random forest algorithm implemented in weka [. We would like to interpret the models for the random forest algorithm, and thus gain some biological insight into glycosylation. Whilst random forest produces individual rules that are human readable, in the case of GPP for each of the three types of glycosylation there are ten models of ten trees each. There are redundancies and potentially even conflicts between the different models. We aggregate these models into a single decision tree using the trepan algorithm [In this paper, using the database of glycosylation sites OGLYCBASE version 6.00 , we anal in weka , combine in weka and to a in weka . We alsolgorithm , providiWe conduct the frequency analysis using the OGLYCBASE dataset. This was used, rather than O-unique, because it has a greater volume and range of sequences allowing statistically significant differences to the background to be more visible. There is also a wider range of sequences than O-unique and it is useful to observe whether there are trends across the whole spectrum of glycol-proteins i.e. is our method likely to be useful for predicting more than just the mammalian glycosylation sites found in O-unique. The consensus sequence for Asn glycosylation is clearly exhibited in the frequency table Table . The onlAround modified Ser residues there is known to be an abundance of Pro, Ser and Thr and the frequency analysis Table shows inModified Thr residues Table exhibit The pairwise patterns for each residue type were ranked by weight to identify those most likely to be found around modified residues. These patterns have significant frequencies around unmodified residues, as well as around modified residues. The weights of some patterns are very similar, especially those for Ser, and statistical fluctuations due to the relatively small size of the dataset mean that the rank order of these patterns may not be exact.Around Asn residues Table the consThe most significant pattern around Ser is Pro at the +3 position, which is in line with the frequency analysis. Other patterns include Pro Ser, Ile and Thr at various positions indicating that these amino acids may play a prominent role when linked with either Ser or Thr. Many of the patterns around Ser residues have similar weights, although Pro at +3 is markedly more significant.Whilst no consensus sequence has been shown for Thr, around Thr residues Table there arWe measured the prediction accuracy of GPP trained using the pattern weight and sequence only, and using additional structural information. For O-linked glycosylation sites the change in accuracy with additional information was minimal. For N-linked glycosylation an increase in accuracy was observed with the addition of predicted surface accessibility information. There was also a much smaller increase with the addition of predicted secondary structure information Table . The pre prediction servers . We convert this measure into a percentage. Calculating this measure for GPP, for Asn prediction, Sn = 87.2; for Ser, Sn = 81.3; for Thr, Sn = 87.5; and for the combined O-linked predictions, Sn = 84.4. GPP has a greater Matthews correlation coefficient for both N- and O-linked prediction . For N-linked sites they have a greater accuracy and sensitivity, but GPP has greater specificity and Matthews correlation coefficient, indicating EnsembleGly has a greater number of false negative predictions. For O-linked sites, GPP scores better for sensitivity, specificity and Matthews correlation coefficient. Chen et al. predict mucin glycosylation sites using k-spaced pairwise patterns and support vector machines. This method has some similarities with our own and the accuracy of the two methods is comparable. However, GPP is more accurate for both Ser and Thr predictions.Two more recent predictions servers, EnsembleGly by Caragea et al. and CKSATrepan identifies the consensus motif for Asn glycosylation figure as the mThe random forest algorithm was used to predict glycosylation sites, based on pairwise sequence patterns and the amino acid sequence. The program improved over the best prediction programs currently available, with significant increases in accuracy for the prediction of Thr and Asn glycosylation sites. Neither the addition of structural data, hydrophobicity information nor surface accessibility data improved the prediction accuracy of O-linked glycosylation, although N-linked glycosylation prediction is improved by the addition of surface accessibility data. However, it may be possible to improve prediction accuracy further through the inclusion of information on protein disorder and information on the orientation of membrane proteins. It may also be possible to increase accuracy by extending the initial data set, or by considering separately proteins whose PTM is catalysed by the same enzyme. Another option would be to produce prediction programs for each specific glycan type, or to classify each glycosylation site by type of glycan after prediction. Our use of the trepan algorithm allows us to extract comprehensible rules describing features characteristic of a glycosylation site.. The OGLYCBASE database contains both experimentally verified and putative instances of N-, O-, and C-linked glycosylation sites. It comprises 242 protein sequences and 2413 verified glycosylation sites. The C-mannosylation data were not considered in our investigations, because there are too few experimentally verified sites in the dataset. Although several enzymes catalyse the attachment of a glycan to Ser and Thr, we have considered all cases in our dataset, with the expectation that the sequence patterns surrounding the glycosylated residue may nevertheless be similar, or at the very least that the machine learning algorithms may be able to detect and learn different sets of patterns within the dataset. For training and evaluation of GPP by ten-fold cross-validation, we use the O-unique dataset. This is a subset of OGLYCBASE and was used for the training of NetOGlyc. It contains only mammalian proteins and is non-redundant. Our predictions were based on only those glycosylation sites that have been experimentally verified. Unverified sites can sometimes be unreliable and false results may confound the predictions. The information retained from the database consisted of the sequence, database reference and the location in the sequence of the modified residues that have been experimentally verified. The both datasets were then split into three, according to whether the modified residues are Ser, Thr or Asn. Within the O-unique dataset, the Ser data set contains 1219 instances (395 positive and 824 negative), the Thr dataset contains 1068 instances (370 positive and 698 negatives) and the Asn dataset contains 589 instances (200 positive and 389 negatives). After removing duplicate sequence windows from the OGLYCBASE datasets, the Ser dataset contains 7285 instances (349 positive 6936 negative) The Thr dataset contains 6389 instances (695 positive and 5694 negative) and the Asn dataset contains 3508 instances (261 positives and 3247 negatives). Each instance was considered as the potentially modified residue and seven residues on either side, to give a 15 amino acid sequence window. This choice of window size was based on previous work [The data for frequency analysis is taken from OGLYCBASE 6.00 availablσ, where σ is the standard deviation. The expected frequency of the residue i at position j was calculated as:After removing all duplicate sequence windows of size 15 from OGLYCBASE, we determined the frequency of each type of amino acid at each positioning the window. This was carried out for both modified and unmodified sites for the Ser, Thr, and Asn datasets and on all of these combined. The frequencies of the modified sites were considered to be significant if the difference between the expected frequency and the actual frequency was greater than 3Nmod is the number of sequence windows centred on modified residues, Nunmod is the number of windows centred on unmodified residues and Fij is the frequency of occurrence of residues i at position j in the unmodified windows. The standard deviation was estimated assuming a binomial distribution. We focus on frequent patterns in modified sequences, as there is no obvious reason to anticipate that strong negative sequence motifs have evolved to evade recognition by enzymes catalysing glycosylation.where The frequency of each possible unique pairwise arrangement of amino acids in the window was calculated. Patterns below a given frequency threshold were excluded from the final pattern set. To optimise the threshold for pattern exclusion a single data set was prepared for each residue type consisting of all positives and an equal number of negatives; the threshold was increased incrementally and each resulting pattern set was used for prediction. The thresholds that produced the best accuracy were used in the final prediction program. This gave thresholds of 22 for Asn, 31 for Ser and 15 for Thr.x, the pattern weight Wx is calculated as Fm/Fn where Fm is the frequency of modified sequence windows in which pattern x occurs and Fn is the frequency of unmodified windows in which this pattern occurs. Each sequence window is compared against all of the significant patterns for that type of glycosylation site. Based on the patterns found, the sequence is given a pattern weight Wseq.:Each pattern is given a weighting, to provide a measure of the probability that a sequence containing that pattern is a member of the modified class. For a pattern Wx is the weight of pattern x, and k is the number of patterns found in the sequence. The weight and the sequence window are presented in the form of a string of letters (the single letter code for amino acid representation) comprising the sequence window and a numerical value (the weight) making use of the capability of weka [where of weka to handlPredicted secondary structure information was combined with the pairwise pattern information described above. The program PsiPred was usedTP/(TP+FN) × 100, where TP is the number of true positive predictions and FN is the number of false negative predictions. Specificity, expressed as a percentage, is calculated as TN/(FP+TN) × 100, where TN is the number of true negative predictions and FP is the number of false positive predictions. The number of correctly classified instances is given as a percentage. We use the Matthews correlation coefficient [ and NetOglyc [Training of the prediction program has two main components. Firstly, a set of patterns is generated from the training data for each of the three types of glycosylation site. This is then used to provide a weighting to each instance in the dataset. Secondly, the random forest is trained on the data and associated weights. Multiple random forests (ten in this work) are trained, with each voting to determine the class of each test instance. Each of the random forests was trained using a data set comprising all positive instances from the cross validation fold and an equal number of randomly chosen negative instances, this dataset being generated from the training data. We use multiple forests to allow for as complete as possible representation of negative instances in the training data without the negatives completely overwhelming the positives in the dataset. The pattern sets were created from the entire training data within a cross validation fold. This entire procedure is summarised in figure fficient to compaNetOglyc glycosylWe use the number of correctly classified instances, the sensitivity and the specificity to compare our work with Oglyc .t test [Xi from method A and a set of results Yi from method B, each containing n data points, t is calculated as:In order to test the significance of the differences between the different methods of prediction, a paired t test was condX and Y, p is the probability of obtaining a value as large or larger than the observed t. If p is below 0.05 then the difference of means is significant at the 5% level. The t test was calculated using the R statistics package.where x1......Xn the probability of observing a class M isFor the purposes of comparison we also conducted the above procedure substituting the naïve bayes algorithm for random forest. The naïve bayes algorithm is based on Bayes rule, which states that for a given input vector M, in practice the conditional probabilities are not usually known and must be estimated from the data. For this reason the naïve bayes algorithm makes the assumption that the conditional probabilities are independent given the class in order to simplify equation 5 to:Whilst it is theoretically possible to estimate the probability for each class Although this is a rough approximation of the probability for a given class, the naïve bayes classifier has proven to be reasonably robust, because it only matters that the true class receives the highest probability, not that the probability itself is correct. We used the implementation of naïve bayes in weka . As a fum of n test. For each node in the tree there are n features. If m of these features are evident in a given instance, this instance is deemed to satisfy the m of n rule for this node. In practice here we find rules only with m = 1 and n < 3, i.e. simple predicates involving one or two possibilities. Nodes of the tree are expanded based on a priority calculated as the number of examples misclassified by the node. Those with highest priority are expanded first, since they have the most potential to increase the accuracy of the tree.Trepan is a method originally used to extract comprehensible rules from neural networks. Trepan uses an oracle function to represent the network and derives a decision tree from the classifications made by the oracle function. However, it can be used for rule extraction from any method that performs binary classification. We use here a modified version of trepan implemented in Matlab , with GPSEH conducted the experiments and wrote the manuscript. JDH conceived the study and assisted in writing the manuscript. All authors read and approved the final manuscript for publication.The frequencies of amino acids surrounding modified and unmodified Asn residues. Full tables containing all amino acids (as opposed to the partial data presented in Table Click here for fileThe frequencies of amino acids surrounding modified and unmodified Ser residues. Full table containing all amino acids (as opposed to the partial data presented in Table Click here for fileThe frequencies of amino acids surrounding modified and unmodified Thr residues. Full table containing all amino acids (as opposed to the partial data presented in Table Click here for fileThe complete decision tree covering all the rules for Asn glycosylation. Full decision tree, extending the subset shown in Figure Click here for fileThe complete decision tree covering all the rules for Thr glycosylation. Full decision tree, extending the subset shown in Figure Click here for fileThe complete decision tree covering all the rules for Ser glycosylation. Full decision tree, extending the subset shown in Figure Click here for file

Specific immunological unresponsiveness to alloantigens can be induced in vivo by treating mice with a donor alloantigen in combination with a non-depleting anti-CD4 antibody. This tolerance induction protocol enriches for alloantigen reactive regulatory T cells (Treg). We previously demonstrated that alpha-1,2-mannosidase, an enzyme involved in the synthesis and processing of N-linked glycoproteins, is highly expressed in tolerant mice, in both graft infiltrating leukocytes and peripheral blood lymphocytes.+CD4+ Treg when they encounter alloantigen in vivo. When alpha-1,2-mannosidase enzyme activity was blocked, Treg retained their capacity to suppress T cell proliferation in vitro but were unable to bind to physiologically relevant ligands in vitro. Further in vivo analysis demonstrated that blocking alpha-1,2-mannosidase in Treg resulted in the migration of significantly lower numbers to the peripheral lymph nodes in skin grafted mice following adoptive transfer, where they were less able to inhibit the proliferation of naïve T cells responding to donor alloantigen and hence unable prevent allograft rejection in vivo.In this study we have identified that alpha-1,2-mannosidase expression increases in CD25in vivo as it facilitates Treg migration to sites where they can regulate immune priming. Migration of Treg is central to their role in regulating in vivo immune responses and may require specific changes in N-glycosylation upon antigen encounter.Taken together, our results suggest that activation of alloantigen reactive Treg results in increased alpha-1,2-mannosidase expression and altered N-glycosylation of cell surface proteins. In our experimental system, altered N-glycosylation is not essential for intrinsic Treg suppressive capacity, but is essential Here we have investigated the hypothesis that alpha-1,2-mannosidase function and hence N-glycosylation, is required for Treg function and migration in vivo. We show that alpha-1,2-mannosidase function is not required for the suppressive capacity of Treg in vitro, but influences Treg adherence in vitro and migration in vivo. Defects in migration of Treg treated with kifunensine (KIF) that specifically inhibits the catalytic activity of alpha-1,2-mannosidase in vivo to sites where they can suppress T cell activation leading to tissue pathology, as demonstrated in this model by rejection of donor allografts.Achieving immunological tolerance to donor alloantigens without the need for long-term administration of immunosuppressive drugs is a major goal in transplantation. Regulatory T cells (Treg) comprise a subset of T lymphocytes that can suppress immune responses, control immune responsiveness to donor alloantigens, and have the potential to play a role in both inducing and maintaining transplant tolerance +CD4+ Treg with the capacity to prevent skin allograft rejection are generated following this 177/DST protocol in vivo, as shown in −CD4+ cells were purified from the spleens of these mice by FACS sorting and alpha-1,2-mannosidase mRNA was quantified by real-time PCR, normalized to CD3. +CD4+ cells 24h after DST. This increase is transient as expression returns to basal levels 3 days after alloantigen exposure, and is not observed in CD25−CD4+ cells.T cell-mediated processes including activation and homing are accompanied by changes in cell surface N-glycosylation which result in an N-glycan signature + and CD8+ T cells leads to dramatic remodeling of N-glycans +CD4+ Treg in vitro and quantified N-glycosylation with Phaseolus vulgaris leucoagglutinin (PHA-L) which binds specifically to tri- or tetra-antennary complex type N-glycans with β1-6 linked branching +CD4+ T cells purified from 177/DST pretreated mice were therefore stimulated polyclonally in vitro with CD3/CD28 beads to ensure uniform activation. −CD4+ cells (−CD4+: MFI 99 –v- 29). These data were verified using FACS sorted CD4+GFP+ Treg from Foxp3 knockin mice Activation of mouse splenic CD4KIF) had decreased surface N-glycan expression compared with cells treated with control PBS (Treg) (KIF –v-Treg: MFI 14 –v- 312). The decreased N-glycosylation was less pronounced in KIF-treated cells that were cultured for 24 h without anti-CD3/CD28 stimulation (KIF –v-Treg: MFI 66 –v-89) indicating that there is a faster turnover of N-glycosylated cell surface proteins in activated Treg.In order to assess whether blocking alpha-1,2-mannosidase activity with KIF corresponds with decreased Treg cell surface N-glycosylation, cells were incubated with KIF for 30 min and after washing were activated for 24 hours with CD3/CD28 beads. Treg incubated with KIF up to 1∶8 . Hence, inhibiting N-glycosylation does not decrease the ability of Treg to regulate in vitro, and may even increase their suppressive capacity.It is well established that N-glycosylation of T cells alters their function B10 APC or CD3/C B10 APC . MoreoveN-glycosylation of many cell-surface molecules orchestrates their ability to bind to their respective ligands. Indeed inhibition of alpha-1,2-mannosidase with an alternative inhibitor deoxymannojirimycin results in decreased adherence of human lymphocytes to endothelial cells KIF to bind to ligands of CD62L, VLA-4, and LFA-1 in an in vitro adherence assay . The decreased ability of TregKIF to bind to MADCAM was more pronounced . These data show that TregKIF bind less efficiently to certain physiologically relevant ligands in vitro.Our original identification of alpha-1,2-mannosidase levels associating with tolerance was identified in animals that had received a heart allograft ce assay . Treg weIn vivo CD62L recognizes specific ligands on the HEVs of axillary lymph nodes and is considered the homing receptor for secondary lymphoid tissues in vitro depends on its glycosylation KIF to bind axilliary LN sections in a modified Stamper Woodruff assay in vitro , suggesting that while inhibiting alpha-1,2-mannosidase impaired the ability of cells to bind to some ligands, the adherence of TregKIF to other ligands increases.in vitro . Virtual(Mel-14) . Interes−/− mice reconstituted with BM3 T cells can reject donor skin allografts in vitro differences in TregKIF adhesion translate to in vivo differences in homing.We have previously shown that T- and B-cell deficient CBA Rag1KIF generated following the 177/DST protocol were co-injected with 105 CFSE labeled effector BM3 T cells into CBA-RAG−/− mice. These mice received a B10 skin transplant one day later. 10 days post-transplant there were no significant differences in either the number or percentage of Treg and TregKIF in the mesenteric lymph nodes (MLN) and spleen and contralateral axillary peripheral lymph nodes (cALN) . The ability of BM3 T cells and CD25−CD4+ cells to home to the axilliary peripheral LN was not inhibited at this timepoint . Decreased TregKIF number in the dALN coincided with impaired ability of these cells to inhibit BM3 T cell priming of 25 days. Adoptive transfer of Treg at a 3∶1 ratio prevented rejection in 6 out of 8 animals with skin grafts maintained for >100 days . In agreement with previously published data +CD4+ T cells from mice pre-treated with 177/DST results in long term survival of these grafts in CBA-RAG-/- mice , 5 TregKIF resulted in long term survival in only 3 out of 15 mice, and the kinetics of rejection were similar to mice receiving effectors only (MST 19d). These data suggest that in most animals TregKIF cannot prevent B10 skin graft rejection by BM3 T cells or CD25−CD4+ cells. Incubation of BM3 T cells or CD25−CD4+ cells with KIF before adoptive transfer did not alter their kinetics of rejection (data not shown).To determine whether pre-treated Tregin vivo correlates with an increased expression of alpha-1,2-mannosidase in both graft infiltrating leukocytes and peripheral blood mononuclear cells in various animal models of tolerance, whereas decreased levels of alpha-1,2-mannosidase serve as an indicator of rejection We have previously shown that the induction of immunological unresponsiveness to alloantigens in vitro of mouse CD4+ splenocytes, which predominantly comprise CD25− cells, results in decreased levels of alpha-1,2-mannosidase mRNA Interestingly polyclonal activation in vitro with CD3/CD28.Correct N-glycosylation could be blocked in Treg by inhibiting alpha-1,2-mannosidase activity with KIF, which gives rise to exclusively to high mannose structures KIF maintained their ability to suppress effector cell proliferation in response to either polyclonal CD3/CD28 or alloantigen stimuli in vitro. Emerging data have identified several secreted Treg proteins that mediate their suppressor function. These include galectins which are proteins that can selectively kill effector T cells in vivo+ T cells when stimulated with plate-bound anti-CD3 and anti-CD28 antibodies KIFin vitro. The N-glycosylation of IFN-γ has been well characterized, and in the absence of correct N-glycosylation IFN-γ may have an altered binding capacity We and others have previously shown that inhibiting alpha-1,2-mannosidase results in altered T cell behavior KIF maintained their ability to bind to fibronectin which is mediated by VLA-4 and VLA-5 KIF to bind to ICAM-1 was reduced suggesting that correct N-glycosylation of LFA-1 may facilitate Treg binding to ICAM-1. Interestingly, blocking MAN2C1, which is another enzyme in the N-glycosylation pathway downstream of alpha-1,2-mannosidase, results in increased binding of Jurkat human T cells to ICAM-1 KIF to bind MADCAM in vitro was most pronounced. Lymphocytes interact with MADCAM via CD62L and α4β7 (CD103) in vitro results in altered CD62L binding to ligands In vivo CD62L recognizes specific ligands on the HEVs of ALN and is considered the homing receptor for secondary lymphoid tissues KIF was similar to Treg that were blocked with an anti-CD62L blocking antibody, suggesting that TregKIF may not be able to bind to HEV due to changes in N-glycosylation of CD62L. Interestingly TregKIF bound with high frequency to non-HEV ALN cells. Others have shown that inhibiting alpha-1,2-mannosidase function increases CD44 binding to hyaluronan (HA)Glycosylation of cell surface proteins is integral to the ability of cells to interact with other cells and ligands. Tregin vivo dramatically decreases migration of mouse T cells to ALN –/– mice reconstituted with TregKIF, suggesting that alpha-1,2-mannosidase and hence correct N-glycosylation of Treg is required for them to bind ALN HEV and exit the peripheral blood at these sites. Interestingly, the ability of TregKIF to home to the MLN and spleen was unaffected. CD62L on T cells binds to receptors such as MADCAM, GLYCAM and CD34 that express sialyl Lewisa and sialyl Lewisx epitopes. These epitopes are constitutively expressed on the HEV in ALN in vivo. Additionally, treatment of ALN with bacterial sialidases eliminates attachment of lymphocytes to the HEV whereas treatment of Peyer's patches do not KIF to the spleen and MLN we have not investigated chemotaxis in our study, but we cannot rule out that this may contribute to the homing impairment of TregKIF.Blocking CD62L + and CD8+ T cells are similarly dependent on CD62L expression for migration into lymphoid tissues −CD4+ T cells were detected in the ALN of reconstituted CBA Rag1−/−, suggesting that the requirement for N-glycosylation for homing may differ in these cells. This is supported by the finding that effector CD8+ T cells can home to reactive ALN in the absence of CD62L CD4+ T cell priming and hence skin graft rejection. Alpha-1,2-mannosidase may also be essential for homing of alloantigen reactive Treg to transplanted cardiac allografts in tolerant animals as the CD62L ligand, sialyl Lewis, is induced on the endothelium of heart allografts that are undergoing rejection Emerging data suggests that homing of Treg is essential for their function KIF undergo homeostatic proliferation and activation after reconstitution of CBA Rag1–/– animals. In this system, inhibition of alpha-1,2-mannosidase by KIF is transient, as by 15 days post-transplant normal numbers of TregKIF are present in the ALN and they have the correct N-glycan signature (data not shown). Interestingly CD25−CD4+ T cells pretreated with KIF have reduced numbers in the ALN at day 5 but this has reached control numbers by day 10. Given the finding that 1 out of eight, and 3 out of 15 animals reconstituted with TregKIF together with BM3 T cells or CD25−CD4+ cells respectively accept their grafts long-term, the fine balance between Treg and effector T cells in the dALN during the early immune response to the allogeneic skin graft may tip the balance from tolerance to rejection.During lymphoid reconstitution, homeostatic proliferation occurs + T cells also express alpha-1,2-mannosidase mRNA to a similar level as CD4+ T cells Treg are not the only immune cells to express alpha-1,2-mannosidase. Maturation of tolerogenic immature dendritic cells is accompanied by a more than 13 fold reduction in alpha-1,2-mannosidase mRNA, suggesting that the N-glycosylation of DCs coincides with their ability to stimulate an effector or tolerance response + and CD8+ T cells with MMF results in decreased adhesion and transendothelial cell migration Our findings may also have implications for the clinical immunosuppressive regimes currently employed. Mycophenolate Mofetil (MMF) is an anti-proliferative drug currently administered in some centers after transplantation. MMF treatment leads to a decrease in both the expression and glycosylation of some adhesion molecules by depleting guanosine nucleotides in vivo. Many groups are currently interested in expanding alloantigen-specific Treg ex vivo in order to return these cells to patients receiving an allograft in vivo to sites where they mediate suppression, regardless of their ability to suppress in an in vitro MLR.In summary, we have shown here for the first time that the N-glycan profile of Treg changes upon activation by alloantigen and is integral to their function −/−; H2k) mice were a gift from Dr. D. Kioussis . BM3 TCR-transgenic mice k+Kb as a transgene) were a gift from Prof. A.L. Mellor . BM3 mice were crossed to a CBA RAG−/− background for these studies, therefore all of their CD8+ T cells are specific for the MHC I Kb molecule. CBA.Ca and C57BL/10 mice were originally purchased from Harlan Olac. All mice were bred in the SPF facility, Biomedical Services, JR Hospital, Oxford. All experimental mice were sex- and age-matched aged between 6 and 12 wk at the time of the first procedure. All mice were bred and used in accordance with the Animals (Scientific Procedure) Act 1986 of the UK.CBA.Ca RAG-1 knockout and anti-CD8 (YTS 169) CBA mice received anti-CD4 mAb YTS177.9 (177) plus B10 (donor-specific transfusion (DST)) blood intravenously as previously described + cells were purified as previously described Spleens were harvested from mice and CD4−CD4+ responder T cells were isolated from LN and spleens of naive CBA, and CD25+CD4+ Treg were obtained from LN and spleens of either naïve or pre-treated mice. CD4+ cells were purified, as described previously + and CD25− cells were purified using a CD25 microbead kit, following manufacturer's instructions . Purity was determined by flow cytometry. Cells were typically >90% pure.CD25Cells were resuspended in PBS containing 1 µg/ml biotinylated PHA-L . Cells were then stained with anti-CD25-FITC, anti-CD4-APC (Insight Biotechnology) and streptavidin-PE (BD Biosciences), acquired by flow cytometry.KIF) or control PBS only (Treg). Cells were incubated at room temperature for 30 min.For pre-incubation with KIF , cells were resuspended in PBS+2% FCS (P.A.A. Laboratories GmBH) containing 40 µM KIF (Treg−CD4+ “responder” cells were purified from CBK mice. Responder cells were labeled with 5 µM CFSE (Invitrogen) as previously described b-biotin (BD Biosciences) followed by streptavidin-PE (BD Biosciences). Viability was determined using 7-AAD (BD Biosciences). Samples were acquired by flow cytometry. The total number of cells after 6 d was calculated by adding a fixed number of 6 mM synthetic fluorescent beads to each sample.CD254 cells / well were transferred to Maxisorp plates pre-coated with either 2.5% BSA (Sigma), bovine fibronectin (Sigma), 20 µg/ml rICAM1-Fc (R&D) or 20 µg/ml rMADCAM-1/Fc (R&D). Cells were centrifuged at 100 g for 1 min. After 45 min wells were gently washed 5× with PBS and resuspended in PBS. CellTitre Glo was added to the wells and samples were transferred to an opaque white 96-well plate (BD Biosciences). Values were measured using a luminometer . Standard numbers of CD25+CD4+ cells were measured in parallel to generate standard curves in order to determine the percentage adherence.Treg were incubated for 24 h with CD3/CD28 T Cell Expander beads. 2×10A modified Stamper-Woodruff protocol 5) were added and rotated over the sections for 45 min. Unbound cells were removed by washing in PBS. Treg bound to HEV were fixed by placing sections in cold 1.5% glutaraldehyde overnight. To block L-selectin binding, cells were pre-treated with Mel-14 antibody at 20 µg/ml for 30 min. Pretreated cells were rotated over the sections as described above. The number of CFSE-labeled cells bound to HEV was counted blind.Treg were cultured for 24 h with CD3/CD28 beads + hrIL-2 and were labeled with 5 µM CFSE. 100 µl of Treg (105 BM3 cells were adoptively transferred into CBA Rag1−/− mice along with 5×105 Treg. Unless stated, mice received a B10 skin graft 1 day later. At days 5, 10 or 15 post-transplant, a single-cell suspension was prepared from spleen, MLN, and draining or contralateral ALN. For analysis of BM3 tracking, cells were processed as previously described BM3 CD8 cells were purified and labeled with CFSE as previously described –/– mice were reconstituted i.v. with syngeneic fractionated T cells. One day after reconstitution, mice received a B10 skin graft as previously described T cell–deficient CBA Rag1

Thymidine phosphorylase (TP) first identified as platelet derived endothelial cell growth factor (PD-ECGF) plays a key role in nucleoside metabolism. Human TP (hTP) is implicated in angiogenesis and is overexpressed in several solid tumors. Here, we report the crystal structures of recombinant hTP and its complex with a substrate 5-iodouracil (5IUR) at 3.0 and 2.5 Å, respectively. In addition, we provide information on the role of specific residues in the enzymatic activity of hTP through mutagenesis and kinetic studies. In the presence of inorganic phosphate, it catalyzes the reversible cleavage of the glycosidic bond of pyrimidine 2′-deoxynucleotides, most likely through SN2-like transition state involving nucleobase, 2′-deoxyribose and phosphate. hTP has been found to play a role in the stimulation of chemotaxis and and BsPyNP (1BRW)] gave an insight into the topological similarity of the three PyNPs .The glycine rich loop described in EcTP The active site of hTP consists of residues His116, Ser117, Leu148, Arg202, Val208, Ile214, Lys221 and Val241. A total of six potential hydrogen bonds stabilize the binding of 5IUR in the active site of hTP . His116 Eleven hTP residues are involved in potential van der Waals interactions with 5IUR kcat of 8.2 s−1. Of the mutations on Lys115, His116, Tyr199, Arg202, Ile214 and Ser217, only four yielded some degree of enzymatic activity by means of targeted molecular dynamics suggest that this highly conserved residue might be important for the catalytic mechanism of TP [42]. Norman et al. hTP amino acid sequence possess only one tyrosine residue when compared to other members of the PYNP superfamily. It is quite interesting to note that this sole tyrosine residue is located at the active site cleft, although it does not form any hydrogen bond with the inhibitor. Among the different tyrosine mutations tested, Tyr199Leu and Tyr199Phe reduced the catalytic activity of hTP, while Tyr199Ala completely abolished it . It is pAlong with the previously characterized Arg202, also involved in the network of interactions that stabilize 5IUR in the active site cleft of hTP is Ser217. This residue was observed to be involved in reinforcing the molecules bound at the active site by means of hydrogen bonds Apart from the residues that interact with 5IUR via hydrogen bonds, a hydrophobic pocket lined by Leu148, Val208, Ile214 and Val241, contributes to the stabilization of the molecule by holding the ‘iodine’ atom in place. This is similar to the hTP–TPI complex in vivo. Mutational study has established that the angiogenic activity of hTP is dependent on its enzymatic activity. As hTP is directly involved in angiogenesis, inhibition of its enzymatic activity is thought to be of key importance in the inhibition of angiogenesis, which in turn will lead to cessation of tumor growth and metastasis. Inhibitors of hTP can act as anti-angiogenic agents, significantly reducing tumor growth by disrupting the thymidine salvage pathway, angiogenesis or metastasis. Several inhibitors have been designed for hTP and have mostly been tested in kinetic studies. Only one crystal structure of hTP in complex with a small molecule inhibitor has been reported to date (1UOU; Thymidine phosphorylase, providing pyrimidine nucleotides for DNA repair and replication, has also been shown to have angiogenic activity te 1UOU; . The pre

An intra­molecular O—H⋯N hydrogen bond generates an S(6) ring motif. The dihedral angles between the hydroxy­phenyl ring and the phenyl and benzene rings are 4.31 (8) and 6.60 (8)°, respectively. The dihedral angle between the phenyl and benzene rings linked by the azo group is 2.70 (8)°. The imino group is coplanar with the hydroxy­phenyl ring, as shown by the C—C—C—N torsion angle of −1.8 (2)°. The azo group is disordered over two position with refined site-occupancy factors of ca 0.87/0.13. In the crystal structure, mol­ecules are linked together by inter­molecular C—H⋯O inter­actions along the c axis and also are packed as one-dimensional extended chains down the b axis.The mol­ecule of the title compound, C Å b = 4.5475 (2) Å c = 12.0423 (4) Å β = 90.600 (2)°V = 1426.68 (10) Å3 Z = 4 Kα radiationMo −1 μ = 0.09 mmT = 100.0 (1) K 0.52 × 0.20 × 0.06 mm Bruker SMART APEXII CCD area-detector diffractometerSADABS; Bruker, 2005T min = 0.955, T max = 0.995Absorption correction: multi-scan (35506 measured reflections4662 independent reflectionsI > 2σ(I)3356 reflections with R int = 0.053 R[F 2 > 2σ(F 2)] = 0.071 wR(F 2) = 0.212 S = 1.08 4662 reflections220 parametersH atoms treated by a mixture of independent and constrained refinementmax = 0.88 e Å−3 Δρmin = −0.53 e Å−3 Δρ APEX2 (Bruker, 2005APEX2; data reduction: SAINT (Bruker, 2005SHELXTL (Sheldrick, 2008SHELXTL; molecular graphics: SHELXTL; software used to prepare material for publication: SHELXTL and PLATON (Spek, 2003Data collection: 10.1107/S1600536808027244/at2620sup1.cif Crystal structure: contains datablocks global, I. DOI: 10.1107/S1600536808027244/at2620Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

The point prevalence of depressive disorders in the elderly population in India varies from 13 to 25%. Since the World Health Organization (five) Well-being Index (1998 version) is simple and easy to administer, an attempt is made to evaluate the Indian version of this instrument to identify depression in the elderly Indian community.(1) To determine the prevalence of depression among the elderly population of rural areas of Udupi district, Karnataka, India. (2) To determine the validity and reliability of WHO (five) Well-being Index (1998 version) as a screening instrument to identify depressive disorders in elderly population in this Indian setting.P value<0.05 was considered statistically significant.This cross-sectional study was conducted over a period of eight months in the three taluks of Udupi, Kundapura, and Karkala; belonging to the Udupi district of South India. We selected 627 people in the age group of 60 years and above for the study. Simple random sampling, without replacement method, using the probability proportionate to size (PPS) technique was used. The WHO (five) well-being index (1998 version) was validated against the major International Classification of Diseases and Related Health Problems 10th Revision (ICD-10) depression inventory of mastering depression in primary care version 2.2. Proportions and their 95% confidence intervals were calculated and Kappa statistics was applied to determine the reliability of the screening instrument. k = 0.71.The prevalence of depression in elderly population was determined to be 21.7% (95% CI = 18.4 - 24.9). The Indian version of WHO-five well-being index (1998 version) showed a sensitivity of 97.0%, specificity of 86.4%, positive predictive value of 66.3% and an overall accuracy of 0.89. The Kappa statistics showed significantly high reliability of The Indian version of "WHO (five) Well-being Index (1998 version)" was found to be an effective instrument for identifying depression in elderly Indian community. The Indian aged population is currently the second largest in the world.[The future projections of global disability adjusted life years (DALYs) in the year 2020 show that in terms of global disease burden, unipolar major depression could become the second leading cause in the disease burden after ischemic heart disease, especially in high-income countries.2 A high he world. Communithe world.4Though depression is the commonest mental health problem in old age, very few community-based studies have been conducted in India to understand the problem. No similar study has been conducted in the past among the geriatric population in Udupi taluk of Karnataka state in South India and the WHO (five) Well-being Index (1998 version) was also never validated under an Indian setting before. Considering this background, we conducted a community-based mental health study in the rural area of Udupi taluk of Karnataka state in South India.This cross-sectional study was conducted for eight months in the three taluks of Udupi, Kundapura, and Karkala belonging to the Udupi district of South India. We selected 627 people in the age group of 60 years and above, who were permanent members of their respective households, for the study. Simple random sampling, without replacement method, using the probability proportionate to size (PPS) technique was used to select the respondents. Due to feasibility constraints and different on-going projects in other field practice areas of Kasturba Medical College, Manipal, only three villages were selected for this study.The sample size was estimated for finite population with the help of Expanded Position Indicator (EPI)-info version 5.0 for windows, statistical package. The total geriatric population (>= 60 years) in the three villages of Udayavara, Kadekar and Katapady was estimated to be 2259. Here, the confidence level was taken as 95%, prevalence rate of depression was 11.2%, required relative precision of the estimate was set at 20% and a non-response rate of 10% was included. Hence, the final sample size was determined as 627.If a designated house was found locked during the first visit and the eligible residents could not be contacted, even after two successive revisits, they were all excluded from this study.If a designated respondent was non-cooperative or had severe behavioral problems or cognitive impairment; or had severe hearing impairment or articulation disorder, any terminal illness or; if he could not be contacted during two separate revisits after the first, he was considered a non-respondent.et al. conducted in Europe (Germany) to compare the validity of the first (1995 version) and the second (1998 version) of the WHO-(five) Well-being Index suggested that due to its higher Loevinger coefficient (0.38) and Mokken coefficient , the second version (1998 version) was superior to the first version (1995 version) in detection of depressive disorders. The external validity ranked highly, as indicated by Receiver-operated-characteristic (ROC) analyses. WHO(five) scores were related to the absence or presence of depression.[A face sheet consisting of information regarding the household of the respondent was used for data collection. A semi-structured proforma containing information regarding the socio-economic status of the individual that was later estimated by the modified Udai Pareek Scale was alsopression. In this Cognitive Impairment was estimated by the 6 -cognitive impairment test (CIT) dementia test. Mastering depression in primary care Version 2.2 and the 6-CIT dementia test were translated into Kannada and Hindi by the researchers and back-translated into English by another expert, who was not acquainted with the original versions. The back-translation was subsequently compared with the original version by a psychiatrist for conceptual equivalence of the items. The validity of 6-CIT at a cut-off of 7/8 is as follows: Sensitivity - 78.57%, Specificity - 100%, Positive Predictive Value - 100% and Negative Predictive Value - 83.33%.[The investigator, along with three field ANMs (auxiliary nurse mid-wives), were trained by the psychiatrists on how to administer the questionnaires. The chief investigator also accompanied the ANMs during their field visits and personally supervised the data collection procedure throughout this project. All the study instruments were pre-tested to determine whether they optimally suited the field conditions. After informed verbal consent was obtained, a brief general health check-up of the respondent was conducted to establish a good rapport with him. All the questionnaires administered in the field were evaluated and rated on the spot; if a respondent became positive in any of the screening or diagnostic instruments, he was immediately handed over a referral slip and sincerely requested to visit the Psychiatry Out-Patient Department (OPD) of Kasturba Hospital, Manipal of Karnataka, at the earliest, for a free consultancy. The participants with obvious medical disorders were referred to the nearest Rural Maternity and Child Welfare (RMCW) home run by Kasturba Medical College, Manipal of Karnataka, for a free health check-up. The diagnoses generated by the instruments in the study were kept strictly confidential and reconfirmed following consultations with a senior faculty member of the department of psychiatry of KMC Hospital, Manipal, before arriving at a final ICD-10 diagnosis for data analysis.P value less than 0.05 was considered as significant.The collected data were tabulated and analyzed using the statistical package Statistical Package for Social Sciences (SPSS) version 10.0 for Windows. Findings were described in terms of proportions and their 95% Confidence Intervals. Kappa statistics was applied to study the reliability of the screening instrument. As part of the field survey, 487 households were visited and 627 individuals in the geriatric age group of 60 years and above were contacted. Among these 627 elderly people, we could interview only 609 for the assessment of depressive disorders (97.1%). Eighteen individuals, whom we could not interview due to various reasons, were categorized as non-respondents (2.9%). Majority (38.9%) of the non-respondents were unavailable at home during the first visit and could not be contacted later even after two successive home visits at a later date. Due to lack of practical skills in communication with the individuals suffering from severe hearing impairment and aphasia we were unable to interview them and they were also considered non-respondents.The baseline characteristics of the population surveyed revealed that 36.0% were males while 64.0% were females. Majority (52.6%) of them belonged to the age group of (60-69) years. Only 58.7% of the elderly were literates and majority (61.2%) belonged to the middle socio-economic status. Most of the people were Hindus (80.1%) followed by Christians (13.0%) and Muslims (6.9%) respectively. Among the study population, 56.3% of the individuals were married while 43.7% were unmarried / widowed/ separated; none of them were divorced.et al[et al.[et al[The overall prevalence of depressive disorders among the elderly of 60 years and above was found to be 21.7% 95% CI=18.4 - 24.9). The study findings were consistent with the observations made by Nandi DN et al West Ben.4 - 24.92x =11.522, df = 1, P>0.0001). This observation suggests that a proportion of depressed individuals were likely to suffer from concomitant dementia, which could not be identified in this cross-sectional study. Kay DW et al[It was found that the prevalence of significant cognitive impairment, suggestive of dementia, was higher among the depressed individuals (49.2%) as compared to the overall respondents (29.0%). The difference in prevalence of significant cognitive impairment among the depressed and not depressed individuals was found to be statistically significant Well-being Index (version 1998). The prevalence of depressive disorders was high among individuals whose status of positive well-being was poor (75.9%) as compared to those whose status was satisfactory (5.3%).As a follow-up of this study, nearly 90% of the individuals, who were tested to be positive by any of the screening instruments, were motivated and subjected to a thorough psychiatric evaluation at KMC Hospital, Manipal, and provided full treatment free of charge Table , 2.P=0.0001*). This was calculated under nonparametric assumption and for null hypothesis, where true area = 0.5.Since, the WHO (five) Well-being Index (1998 version) showed a good internal and external validity and reliability, this is a useful instrument for identifying elderly subjects with depression in Indian community.et al. showed that the WHO-5 has a good internal consistency and homogeneity, equivalent to the longer precursor versions of Well-being Index. This study was conducted in Europe (Germany) to compare the validity of the first (1995 version) and the second (1998 version) of the WHO (five) - Well-being Index.[A previous study by Bonsignore M ng Index.Due to its higher Loevinger coefficient (0.38) and Mokken coefficient , the second version (1998 version) seemed superior to the first version (1995 version) for detection of depressive disorders. The external validity ranked highly, as indicated by ROC analyses. WHO (five) scores were related to the absence or presence of depression. These results suggest that the second version (1998 version) may be preferred in the future as a screening instrument for depression. The WHO (five) Well-being Index (1998 version) is a useful instrument for identifying elderly subjects with depression. The results are restricted to an elderly population at risk for psychiatric disorders; the transferability to other samples needs to be assessed in future.et al,[A study was conducted by Awata S et al, to evaluIn this study, the prevalence of depressive disorders among the geriatric population was determined to be 21.7% (95% CI = 18.4 - 24.9). The prevalence rates of depression among the males and females were 19.9% and 22.6% respectively. Since, the Indian version of WHO (five) Well-being Index (1998 version) showed a good Internal and external validity and reliability for identifying depressive disorders in elderly population, this could be considered a useful instrument for identifying elderly subjects with depression in Indian community.

Given the decline in physical activity (PA) levels among youth populations it is vital to understand the factors that are associated with PA in order to inform the development of new prevention programs. Many studies have examined individual characteristics associated with PA among youth yet few have studied the relationship between the school environment and PA despite knowing that there is variability in student PA levels across schools.Using multi-level logistic regression analyses we explored the school- and student-level characteristics associated with PA using data from 2,379 grade 5 to 8 students attending 30 elementary schools in Ontario, Canada as part of the PLAY-Ontario study.Findings indicate that there was significant between-school random variation for being moderately and highly active; school-level differences accounted for 4.8% of the variability in the odds of being moderately active and 7.3% of the variability in the odds of being highly active. Students were more likely to be moderately active if they attended a school that used PA as a reward and not as discipline, and students were more likely to be highly active if they attended a school with established community partnerships. Important student characteristics included screen time sedentary behaviour, participating in team sports, and having active friends.Future research should evaluate if the optimal population level impact for school-based PA promotion programming might be achieved most economically if intervention selectively targeted the schools that are putting students at the greatest risk for inactivity. Participation in physical activity (PA) is an integral component of a healthy lifestyle as it is associated with a number of positive health benefits, such as reduced risk of several chronic diseases and improved cardiorespiratory fitness . Given tMany studies have examined individual characteristics associated with PA among youth . For insExamining the relationship between the school environment and PA is important since Canadian youth spend ~25 hours each week in school throughout the school year and because school-based PA can account for up to 40% of the total activity among youth populations . ConsistIn order to appropriately tailor and target PA interventions so that they are most likely to have impact, research is needed that simultaneously examines contextual and individual factors associated with PA. It has been suggested that this is particularly important within elementary school settings since much of the available evidence pertaining to school characteristics is garnered from secondary school settings . The purhttp://www.shapes.uwaterloo.ca/projects/PLAYON, and additional details about SHAPES and the PAM measures and their psychometric properties are available in print and being highly active . This suggests that school-level differences accounted for 4.8% of the variability in the odds of being moderately active and 7.3% of the variability in the odds of being highly active. Table There was significant between-school random variation identified for being moderately active . Conversely, a student was more likely to be moderately active if he/she attended a school that was in the action or maintenance phase for the indicator Use of PA as a reward, not as discipline [β = 0.34(0.15) and β = 0.64(0.22) respectively]. None of the indicators within the other three FHS categories or the overall FHS component scores were significantly associated with being moderately active.Univariate analyses identified that Supportive Social Environment was the only FHS category that had any school-level indicators significantly associated with a student being moderately active. A student was less likely to be moderately active if he/she attended a school that was in the action or maintenance phase for the indicator Student access to facilities and equipment outside of school hours [β = 0.68(0.28)]. In the Supportive Social Environment category, a student was less likely to be highly active if he/she attended a school that was in the maintenance phase for the indicator Special recognition of students who participate in school physical activities [β = -0.67(0.30)]. In the Community Partnerships category, a student was more likely to be highly active if he/she attended a school that was in the maintenance phase for the overall score for this category compared to a student attending a school that was in the initiation phase for the overall score [β = 0.51(0.23)]. The only FHS category which did not have any indicators significantly associated with a student being highly active was Instruction and Programs.Univariate analyses identified that indicators from three of the FHS categories were significantly associated with a student being classified as highly active. In the Healthy Physical Environment category, a student was more likely to be highly active if he/she attended a school that was in the maintenance phase for the indicator Use of PA as a reward, not as discipline. If a student attended a school that was in the action or maintenance phase for the indicator Use of PA as a reward, not as discipline, he/she was more likely to be moderately active than a similar student attending a school that was in the initiation phase for this indicator . There were no significant contextual interactions identified.The adjusted odds ratios are presented in Table Community Partnerships. If a student attended a school that was in the action or maintenance phase for the overall score for Community Partnerships, he/she was more than twice as likely to be highly active than a similar student attending a school that was in the initiation phase for this overall category score .The adjusted odds ratios are presented in Table During the additional exploratory analyses, one significant contextual interaction between a school-level characteristic and a student-level characteristic was identified. As shown in Figure Physical inactivity has an annual financial impact totalling ~$2.1 billion in Canada . As suchConsistent with research demonstrating that community coalitions can affect youth behaviour ,17,28,29In this study, we also identified that some students were more likely to be highly active as a function of both their individual behaviour and whether or not the school they attended had established community partnerships. As illustrated in Figure To the best of our knowledge, this is the first study to identify that students were more likely to be moderately active if they attended a school that used PA as a reward and not as discipline. It makes sense that if encouraging physical activity is the goal then physical activity experiences need to be made as positive and reinforcing as possible as opposed to allowing an association between physical activity and pain or punishment to be established . AdditioSedentary behaviours, such as screen time, are distinct from PA and do not necessarily replace time spent being active ,33. ThisUnlike research from a provincial survey of key school informants at the elementary and secoBehavioural theories consistently highlight the important role that influential social models surrounding youth can have on their behaviour ,41. In gThis study is subject to some limitations. Almost 50% of the data for BMI were missing, so we could not robustly understand the association between weight status and PA in this sample. Since no data on ethnicity or socioeconomic status are available within our measurement tools, it was not possible to examine how PA varied across ethnic groups or social economic strata. Our ecological data were from the school environment, and it is possible that characteristics from other ecological contexts may also be important to consider. Causal relationships can not be inferred from these cross-sectional data. Considering that these data were drawn from a convenience sample of schools, we can not infer that these results would be representative of the general student population in Ontario. Although data were based on self-reports, the measures in the PAM have been previously demonstrated to be reliable and valid , and honDeveloping a better understanding of the school- and student-level characteristics associated with PA among youth is critical for informing intervention programs and policies designed to promote PA among youth populations. We identified that even when controlling for individual student characteristics, the characteristics of the school a student attends were associated with his/her likelihood of being either moderately active or highly active. Moreover, youth in our sample were more likely to be highly active if they attended a school with established community partnerships. Future research should evaluate if the optimal population level impact for school-based PA promotion programming might be achieved most economically if intervention selectively targeted the schools that are putting students at the greatest risk for inactivity; that is, schools that are in the initiation phase for the FHS indicators measured in the SHES tools.The authors declare that they have no competing interests.SL conceptualized the research question, preformed the analysis, interpretation of the results and the writing of the manuscript. SM, GF and KA helped with the interpretation of results and writing of the manuscript. CB managed the PLAY-On project and contributed to the writing of the manuscript.

Eighty-five breast carcinomas from the same number of patients have been assessed immunohistochemically using the antiserum 21N for the presence of the c-erbB-2 protein. Twenty-two of the patients had evidence of advanced disease (tumour fixation or distant metastases) at presentation. Follow-up was for a median of 24 months. c-erbB-2 protein was detected in the majority of cells in 14 (16.5%) carcinomas, and to a lesser extent in a further six (7%) tumours. There was no relationship between staining and stage, node status or size but more poorly differentiated carcinomas had evidence of staining (36%) than well (17%) or moderately (14%) differentiated carcinomas (P = 0.02). There was a significant association between staining and mortality (P = 0.009) and recurrence (P = 0.0002). The relative risk of death for staining compared to no staining was 2.97 and the relative risk of recurrence for staining compared to no staining after similar adjustment was 3.85 . In this particular group of patients immunoreactivity for c-erbB-2 protein is an independent indicator of poor short-term prognosis.

Previously, ways to adapt docking programs that were developed for modelling inhibitor-receptor interaction have been explored. Two main issues were discussed. First, when trying to model catalysis a reaction intermediate of the substrate is expected to provide more valid information than the ground state of the substrate. Second, the incorporation of protein flexibility is essential for reliable predictions.Candida antarctica lipase B and a W104A mutant, (ii) enantioselectivity and substrate specificity of Candida rugosa lipase and Burkholderia cepacia lipase, and (iii) substrate specificity of an acetyl- and a butyrylcholine esterase toward the substrates acetyl- and butyrylcholine.Here we present a predictive and robust method to model substrate specificity and enantioselectivity of lipases and esterases that uses reaction intermediates and incorporates protein flexibility. Substrate-imprinted docking starts with covalent docking of reaction intermediates, followed by geometry optimisation of the resulting enzyme-substrate complex. After a second round of docking the same substrate into the geometry-optimised structures, productive poses are identified by geometric filter criteria and ranked by their docking scores. Substrate-imprinted docking was applied in order to model (i) enantioselectivity of The experimentally observed differences in selectivity and specificity of the enzymes were reproduced with an accuracy of 81%. The method was robust toward small differences in initial structures , although large displacements of catalytic residues often resulted in substrate poses that did not pass the geometric filter criteria. Pseudomonas diminuta phosphotriesterase [α-β barrel proteins and their metabolites [The number of protein structures available to researchers has grown exponentially over the last two decades and more than 50 000 experimentally determined structure entries are now held in the Protein Data Bank . Furtheresterase . Use of abolites . The docabolites , and docabolites . Especiaabolites -15. Theiabolites ,17: Upon1. The substrate has to be covalently docked to the enzyme in its tetrahedral intermediate state. While docking of molecules in their ground state allows predictions of the binding of that molecule to an enzyme, it does not allow to draw direct conclusions whether the molecule is converted by the enzyme or not. A docking method that aims to model enzymatic catalysis should reflect the molecular role of the enzyme in stabilising the transition-state . A tetra2. In addition, the docking pose of a putative substrate is essential. In order to be converted, the hydrogen bond network stabilising the intermediate has to be fully formed. Therefore, a simple geometric filter allows to distinguish between productive and non-productive substrate poses ,21.3. X-ray structures and structure models based on homology are often not in a conformation to accommodate putative substrates, because even small differences in structures can have a strong effect on molecular docking results . To overHere we introduce a strategy of substrate-imprinted docking, which uses the docking program FlexX ,35, geomCandida antarctica lipase B (CALB) was compared to a mutant (W104A) with altered enantioselectivity [R)-PEB and (S)-PEB) to model enantioselectivity.• The wild type of ectivity by dockiR/S)-2- to (R/S)-8-MDB) were docked into Candida rugosa lipase (CRL) to assess the capabilities of modelling lower enantioselectivities.• The enantiomers of 2- to 8-methyldecanoic acid butyl esters ((Burkholderia cepacia lipase (BCL) were compared by docking the enantiomers of 2-hydroxyoctanoic acid butyl ester ((R/S)-2-HOB) and 2- to 4-methylpentanoic acid pentyl esters ((R/S)-2-MPP, (R/S)-3-MPP, 4-MPP) in order to model enantioselectivity and substrate specificity.• CRL and Torpedo californica acetylcholine esterase (TcAChE) was compared to the human butyrylcholine esterase (huBuChE) by docking of acetylcholine (ACh) and butyrylcholine (BuCh) to model substrate specificity.• R)-PEB and (S)-PEB were docked into five X-ray structures of CALB and the five models of its W104A mutant. Experimentally, CALB shows a enantiopreference in transesterification toward the (R)-enantiomer of PEB with a very high E-value of 1 300 000 [R)-PEB were found. For the structure 1TCB no productive pose could be found by docking, which corresponds to a false negative result. For four structures no productive pose was found for the reaction intermediate of (S)-PEB, while a productive pose was found for 1LBT . Thus, the accuracy for the wild type without optimising the geometry is 80% – eight correct predictions, one false negative and one false positive.Tetrahedral reaction intermediates were covalently docked into CALB and its W104A mutant. During docking, the protein structure was assumed to be rigid, while the docked substrate was treated flexible. The docking procedure consists of three steps: (i) the construction of the putative substrates in their tetrahedral intermediate forms, (ii) the covalent docking into the active site, and (iii) the application of the geometric filter criteria for docked substrate poses. -PEB could be docked in a productive pose (Table S)-enantiomer of PEB no productive pose could be found for any of the five mutant structures. This corresponds to five false negative results, because experimentally the (S)-enantiomer of PEB is converted as efficiently as the (R)-enantiomer. Thus, the accuracy for the mutant without optimising the geometry is 40% – four correct predictions and six false negatives.The same docking procedure was performed with the five models of the W104A mutant. In four models (R)-PEB into 1TCB, while structures with inhibitor have a tendency to lead to false positives, such as docking of (S)-PEB into 1LBT. This is caused by small differences in the structures, which lead to large differences in docking scores, as previously observed for trypsin, thrombin, and HIV-1-protease [In previous studies , proteinprotease . To overprotease and to iR)-PEB into CALB wild type resulted in productive poses for all five CALB structures. In contrast, docking of (S)-PEB led only for one structure (1LBS) to a productive pose . Thus, the accuracy of substrate-imprinted docking increased to 90% as compared to 80% for conventional docking, and the deviation between the docking scores was slightly reduced from 2.0 kJ/mol to 1.7 kJ/mol [see Additional file R)-PEB into the X-ray structure 1TCB led to a false negative result, substrate-imprinted docking based on 1TCB led to a productive pose. Similarly, the productive pose upon docking of (S)-PEB into the X-ray structure 1LBT was not found upon substrate-imprinted docking, but a new false positive result was found (1LBS).To account for protein flexibility, protein-substrate complexes obtained by docking were subsequently optimised by energy minimisation. The resulting geometry-optimised structures of the protein are referred to as substrate-imprinted structures and were then used in a second round of covalent docking of the same substrate. The resulting poses were then analysed for the geometric filter criteria, the docking score, and the overlap volume Table . Dockingtructure LBS to a R)-PEB into substrate-imprinted mutant structures resulted in productive poses for all five structures. Similarly, substrate-imprinted docking of (S)-PEB also led to productive poses for all structures. This result for the mutant is in agreement with experimental observations and corresponds to an accuracy of 100% – ten correct predictions.The largest impact of substrate-imprinted docking was observed for the mutant W104A. Here, docking into rigid model structures failed in six out of ten cases. However, docking of (R)-PEB into the X-ray structure, while substrate-imprinted docking found a productive pose. However, these small conformational changes in the alcohol binding pocket -PEB in a productive pose. These changes in the alcohol binding pocket are in the same range as the overall conformational changes upon geometry optimisation (between 0.36 Å and 0.45 Å) for the CALB structures - or the (S)-enantiomer [R)-enantiomer [Tetrahedral reaction intermediates of 2- to 8-MDB were docked into seven CRL X-ray structures (two of those structures had a displaced histidine) in order to model enantiopreference. Similar intermediates of 2-HOB and 2- to 4-MPP were docked into the same CRL structures and seven BCL X-ray structures in order to model substrate specificity. It has been shown experimentally that 2- to 8-MDBs can be synthesised by CRL with E-values between 2.8 an 91, alternately preferring the (antiomer . 2-HOB ibout 20) , 4-MPP ibout 20) .R)-2-MDB productive poses could only be found for two structures, while for the (S)-enantiomer, a productive pose could only be found for one structure. Thus, productive poses for MDBs were only found in 42% of the cases and no enantiopreference could be observed in the docking results. The E-values CRL and 2- to 8-MDB are much lower than those observed in the case of CALB and PEB , and the synthesis of the less prefered enantiomer did still occur. Therefore, both enantiomers were considered to be experimentally validated substrates for CRL and BCL.Docking both enantiomers of 2- to 8-MDBs into CRL did most often result in predictions, that were either positive or negative for both enantiomers Table . Thus, nR)-enantiomer and the (S)-enantiomer could be found -enantiomer and five for the (S)-enantiomer (Table R)-2-HOB and six productive poses were found for the (S)-enantiomer. Thus, substrate-imprinted docking improved the identification of 2-HOB as a substrate for CRL and BCL from 64% to 75%, but did not result predictions that reflected the experimentally determined enantioselectivity (E ≈ 20).The capabilities of molecular docking to identify substrates and non-substrates were improved by using the method of substrate-imprinted docking. Docking 2- to 8-MDBs into substrate-imprinted CRL structures led to 58 productive poses Table . The twoer Table . When usS)-enantiomer and none for the (R)-enantiomer [see Additional file R)-enantiomer, and none for the (S)-enantiomer. No productive poses could be found for docking 3-MPP into substrate-imprinted CRL structures, three productive poses could be found for each enantiomer when docking 3-MPP into substrate-imprinted BCL structures. When docking 4-MPP into substrate-imprinted CRL structures, five productive poses were found. For the structures 1LPN and 1LPP, no productive poses were found. When docking 4-MPP into substrate-imprinted BCL structures, productive poses were found for all seven structures. Substrate-imprinted docking was therefore able to identify the substrates 4-MPP for CRL and BCL, and 2-MPP for CRL with an accuracy of 50%. However, while the recognition of 4-MPP as a substrate was improved by substrate-imprinted docking, the recognition of 2-MPP as a substrate was better by conventional docking. The non-substrates 3-MPP for CRL and BCL and 2-MPP for BCL were correctly modelled with an accurracy of 76%. Thus, substrate-imprinted docking can, in the case of MPPs and CRL/BCL, differentiate between substrates and non-substrates with an accurracy of 66%, while conventional docking only achieved an accurracy of 44%.Docking 2-MPP into substrate-imprinted CRL structures resulted in two productive poses for the had been resolved with inhibitors, the TcAChE structure that had been resolved without inhibitor led to productive poses. Similarly, the huBuChE structure that had been resolved in complex with a choline ligand (1P0M) did not lead to productive poses, as well as one of the structures that was resolved with an inhibitor.To improve predictability of substrate specificity, substrate-imprinted docking was applied. Docking ACh into substrate-imprinted TcAChE structures led to five productive poses Table . It was Substrate-imprinted huBuChE structures led to productive poses for ACh and BuCh in three out of four cases. The substrate-imprinted structure 1P0M did not lead to a productive pose for any of the substrates. Thus, substrate-imprinted docking into TcAChE and huBuChE achieved an overall accuracy of 80% , while docking into structures that had not been optimised to fit the docked substrates only achieved an accuracy of 50%. In addition to the higher accuracy, substrate-imprinted docking resulted in lower docking scores and a smaller spread of docking scores of true positive results [see Additional file It has been shown that substrate specificity and enantioselectivity of lipases and esterases are a consequence of a delicate balance between enthalpic and entropic contributions . While sBeside the energy minimisation used in substrate-imprinted docking in order to optimise the structure of the substrate-enzyme complex, there are other more computational intensive methods like molecular dynamics or simulated annealing available that could be employed for the optimisation. However, clashes between atoms can easily be relaxed by a simple energy minimisation. In fact, such a minimisation is performed in many molecular dynamic protocols prior to the simulation itself for the purpose of relaxing such clashes. Furthermore, observed structural changes upon ligand binding are dominated by small motions ,52, whicDespite these limitations, substrate-imprinted docking can achieve a high predictive accuracy. As for other docking methods, the choice of the protein structure used for docking is crucial. Lipase structures which are adequate for substrate-imprinted docking must have an accessible substrate binding site and a functional orientation of the side chains in the active site. In the AChE X-ray structure 1VXR and the two CRL X-ray structures 1LPN and 1LPP, the catalytic histidine is considerably displaced by the bound inhibitors. Therefore, for all substrates these structures led to non-productive poses due to a failure of the geometric filter criteria. In contrast to other docking methods, substrate-imprinted docking is robust for other differences in protein structures: X-ray structures of free proteins and inhibitor complexes showed the same predictive accuracy. If the three X-ray structures with a displaced histidine are removed from the dataset, the accuracy of the method is 81%. Thus, substrate-imprinted docking allows to model substrate specificity and in some cases enantioselectivity of lipases and esterases with a good accuracy and with moderate computational and manual effort. The stereoselectivity could be accurately modelled for CALB, where the E-value was very high, while it was not possible to accureately model the stereoselectivity for CRL and BCL, where E-values were lower.Docking reaction intermediates covalently into enzymes without accounting for flexibility did yield poor results, as can be seen in the results of the conventional docking. Likewise, it has been demonstrated by others, that performing an energy minimisation of ligand-protein complexes without applying filter criteria increased the number of false positives . Thus, amaximum overlap volumes in the second round of docking as compared to the first round of docking , and by applying geometric filter criteria that will discard all non-productive poses, even if they have a good score.The conformational changes upon geometry optimisation of the substrate-protein complex often result in a widening of the binding pocket and can lead to false positive docking results in the substrate-imprinted docking approach. It can be argued, that the structures are optimised in a way that would fit any putative substrate used for imprinting whether a substrate or not, resulting in an increase of false positive predictions. This risk of false positives could reduces the ability of substrate-imprinted docking to discriminate between substrates and non-substrates. Previously, it has indeed been shown that energy minimisation of kinase-inhibitor complexes followed by scoring with Autodock resulted in an increase of false positives , thus a S)-PEB with 1LBS). This false positive could be identified by analysing the RMSD in the alcohol binding pocket . In this complex, the side chains of W104 and T42 have been displaced by more than 1 Å, and the backbone of T40 and G41 is twisted by almost 90°, thereby displacing the backbone oxygen by 2.1 Å -PEB and (S)-PEB) the RMSD of the alcohol binding pocket was in the range of 65% and 121% of their total all-atom RMSD (Table S)-PEB) and one mutant complex (1LBSW104A/(R)-PEB), although they were true negatives or positives. Thus, a RMSD exceeding 130% of the overall RMSD can indicate an unreliable optimised structure, which often leads to false predictions. However, this additional analysis also rejects some correct predictions.For CALB and its W104A mutant, the accuracy of docking into the substrate-imprinted structures increased from 60% to 95% when docking into substrate-imprinted structures, and only one false positive result occurred as compared to docking into the X-ray structures (33%). Therefore we think that the applied docking parameters and filter criteria are suitable to prevent false positives.One major effect of substrate-imprinted docking is the reduction of false negatives. When docking into TcAChE and huBuChE, the number of false negatives is reduced from ten to four by substrate-imprinted docking. In X-ray structures and homology models, the orientation of side chains is not optimised, thus resulting in clashes with docked molecules . Therefoϵ can not interact with the catalytic serine. With the histidine being unable to form a hydrogen bond to the serine Oγ, the docking pose did not pass the geometric filter criteria and was considered to be non-productive.False negative results happen for two reasons. Either no pose for the substrate is found or none of the poses pass the geometric filter criteria. Two false negative results (ACh and BuCh docked into 1P0M) that occurred with both, the substrate-imprinted and the non-optimised structures, are examples for the first case and occurred due to clashes between substrate and protein in the binding pocket. The false negative that occurred with the substrate-imprinted and the conventional docking (ACh docked into 1VXR) is an example for poses that did not pass the geometric filter criteria. In these structures, the binding pocket has adopted a conformation that allows substrate binding, but not in a productive orientation, due to the orientation of the catalytic histidine. In 1VXR, the catalytic histidine has been displaced by the co-crystallised inhibitor , which wThe false negative predictions for the huBuChE can be identified by analysing the RMSD of the choline pocket. A comparison of the overall RMSD and the RMSD of the choline pocket after the geometry optimisation revealed that the choline pocket formed by W82, G115, G116, E197, H438, and G439 showed a considerably higher or lower RMSD than the rest of the protein. The all-atom RMSD of the whole protein after geometry optimisation ranged from 0.48 Å to 0.52 Å for huBuChE X-ray structures . The process consists of five steps:1. As protein structure, X-ray structures of free enzymes or inhibitor complexes are suitable, as well as reliable homology models. However, it is crucial that the side chains of the catalytic serine and histidine are in a functional orientation.maximum overlap volume. Productive poses are selected by geometric filter criteria and the docking score.2. Substrates are covalently docked in a tetrahedral intermediate form at an elevated 3. The geometry of the selected complexes is optimised by unconstrained energy minimisation.4. In order to assess the reliability of the optimised structures, the deviation of the structure of the substrate binding site in respect to the overall deviation of the protein during energy minimisation of the complex can be evaluated. Structures where the difference between these deviations is larger than 30%, often led to false positive or false negative predictions.5. The relaxed protein structure is used for a second round of substrate docking using more stringent docking parameters. Productive poses are again selected by geometric filter criteria and the docking score.The method seems to be most accurate for modelling substrate specificity and less accurate for modelling enantioselectivity. Substrate-imprinted docking was able to model the differences in substrate specificity of CRL and BCL, and TcAChE and huBuChE, and differences between the enantioselectivity of CALB wild type and its W104A mutant. For CRL and BCL, enantioselectivity could not be reliably modelled.Substrate-imprinted docking was reproducible and robust toward different X-ray structures of the same protein. Because it combines good accuracy with a moderate computational and manual effort, it is most suited to screen enzyme and mutant libraries with selected substrates.. Two CALB structures , six CRL structures and four BCL structures had been resolved with a bound inhibitor. From the six selected TcAChE structures, three had been resolved in complex with a large inhibitor , two with a small inhibitor , and one without any inhibitor (1QIM). ¿From the four huBuChE X-ray structures, one had been resolved with a non-covalently bound product molecule (1P0M) and three had been resolved in a covalent complex with a small substrate analogous inhibitor . Experimentally, the structures 1VXR, 1LPP, and 1LPN contain inhibitors that caused a very large displacement of the catalytic histidine. These three structures can therefore be considered to be not suited for modelling of catalytic activity, despite having a bound inhibitor, but were included in this study to better assess whether substrate-imprinted docking can correct these structural artefacts or not. Models for the W104A mutant of CALB were created by changing W104 to alanine in the X-ray structures of the wild type using the Swiss-Pdb viewer [).X-ray structures of CALB , CRL , BCL , TcAChE , and huBuChE were retrieved from the Protein Data Bank [b viewer and seleb viewer , while kb viewer , implemeγ at the ester carbon. while the proton of the serine is transfered to the histidine.Protonation states of titrateable residues at pH 7 [see Additional file γ-Cβ-fragment of the catalytic serine.Substrate esters were constructed as tetrahedral reaction intermediates of the lipase-catalysed ester hydrolysis Fig. , includiγ and Cβ atoms form the base fragment and are superimposed on the Oγ and Cβ atoms of the catalytic serine. Up to 50 different conformations of the base fragment are allowed during this superimposition, and the torsion angle of the bond between Oγ and Cβ is sampled in a 10° range, according to the default settings of FlexX. The maximum overlap volume parameter in FlexX sets a limit for the overlap between the protein and a ligand atom. The allowed average overlap from every ligand atom is 0.4 * maximum overlap volume. Poses that exceed any of these values are automatically discarded. During every single conventional docking, the maximum overlap volume was gradually increased in 0.5 Å3 steps from 2.5 Å3 to 7.5 Å3. Docking with gradually increasing maximum overlap volumes is necessary, because the incremental construction algorithm of the ligand used by FlexX [maximum overlap volume, but not at a larger maximum overlap volume, and vice versa. The superimposed atoms of the base fragment and hydrogen atoms are not taken into account in overlap tests, nor is the base fragment considered when clashes between ligand and protein are calculated. The generated substrate poses are classified into productive and non-productive poses by the geometric filter criteria and ranked by score. The geometric filter checks for:(a) the existence of hydrogen bonds between the backbone N-H-groups of the two oxyanion hole residues and the oxyanion of the substrate, (b) a hydrogen bond between a side chain N-H-group of the catalytic histidine and the Oγ of the substrate, and (c) a hydrogen bond between a side chain N-H-group of the catalytic histidine and the oxygen of the alcohol moiety of the substrate - and (S)-MPP). This complex is optimised by energy minimisation (200 steps steepest decent followed by 800 steps conjugate gradient). A new, substrate-imprinted protein structure is extracted from the optimised complex by removing all substrate atoms except for the Oγ and Cβ atoms that form the side chain of the catalytic serine. A second round of docking follows, where the same substrate that was used in the first round of docking is covalently docked into the optimised structure. The maximum overlap volume parameter is set more stringent in this second docking than in the first docking, and is gradually increased in 0.1 Å3 steps from 2 Å3 to 3.5 Å3. All generated substrate poses are scored and classified into productive and non-productive poses as described for the conventional docking. A productive pose with a negative score was considered to model a substrate that is converted by the enzyme, while the absence of such a pose was considered to correspond to a fake substrate, that is not converted by the enzyme.Substrate-imprinted docking consists of a first round of docking by FlexX, a geometry optimisation, a second round of docking, and a final classification and scoring of the resulting poses . The procedure starts with a X-ray structure and a putative substrate. Stereoisomers of one compound are treated as separate substrates. The putative substrate is covalently docked into the X-ray structure of the enzyme. During this first docking, the γ and Cβ of the catalytic serine and defining a bond between the Cβ of the substrate and the Cα of the catalytic serine. Atom types and parameters of the AMBER ff99 force field [γ and Cβ atoms that form the serine side chain, all atoms that belong to the substrate were removed from the optimised complex. These structures were referred to as substrate-imprinted structures.In its docked pose, the substrate partially overlaps with the catalytic serine. A substrate-protein complex with the substrate covalently bound to the catalytic serine was created by removing the Oce field were usece field after abce field ,65. Protce field . The sysce field with a mce field and the Burkholderia cepacia lipase; BuCh: butyrylcholine; CALB: Candida antarctica lipase B; CRL: Candida rugosa lipase; HOB: hydroxyoctanoic acid butyl ester; huBuChE: human butyrylcholine esterase; MDB: methyldecanoic acid butyl ester; MPP: methylpentanoic acid pentyl ester; PEB: 1-phenylethyl butyrate; RMSD: root mean square deviation; TcAChE: Torpedo californica acetylcholine esterase.ACh: acetylcholine; BCL: PT and ST carried out docking and geometry optimisation for TcAChE. PBJ conducted the homology modelling and carried out docking and geometry optimisation for all other enzymes. JP was involved in designing and overseeing the study. All authors have read and approved the final manuscript.docking_scores. The tables presented here provide the exact docking scores for the conventional and substrate-imprinted docking experiments performed for this study.Click here for fileSupplementary Table. Docking of methylpentanoic acid pentyl estersClick here for filecharge_and_protonation. This file lists the total charge of the proteins used and the protonation states of the residues during docking and energy minimisation.Click here for file

Mucinous ovarian carcinoma have a poorer prognosis compared with other histological subtypes. The aim of this study was to evaluate, retrospectively, the activity of chemotherapy in patients with platinum sensitive recurrent mucinous ovarian cancer.The SOCRATES study retrospectively assessed the pattern of care of a cohort of patients with recurrent platinum-sensitive ovarian cancer observed in the years 2000–2002 in 37 Italian centres. Data were collected between April and September 2005. Patients with recurrent ovarian cancer with > 6 months of platinum free interval were considered eligible.Twenty patients with mucinous histotype and 388 patients with other histotypes were analyzed. At baseline, mucinous tumours differed from the others for an higher number of patients with lower tumor grading (p = 0.0056) and less advanced FIGO stage (p = 0.025). At time of recurrence, a statistically significant difference was found in performance status . About 20% of patients underwent secondary cytoreduction in both groups, but a lower number of patients were optimally debulked in the mucinous group (p = 0.03). Patients with mucinous cancer received more frequently single agent platinum than platinum based-combination therapy or other non-platinum schedules as second line therapy (p = 0.026), with a response rate lower than in non-mucinous group . Median time to progression and overall survival were worse for mucinous ovarian cancer. Finally, mucinous cancer received a lower number of chemotherapy lines (p = 0.0023).This analysis shows that platinum sensitive mucinous ovarian cancer has a poor response to chemotherapy. Studies dedicated to this histological subgroup are needed. Mucinous carcinoma of the ovary accounts for 5–10% of all primary epithelial ovarian cancer . HoweverStudy of an Ovarian Cancer cohort Recurred After first-line Treament: a rEstrospectivy Survey) study was planned to retrospectively assess the pattern of care of patients with recurrent platinum-sensitive ovarian cancer observed in Italy in the years 2000–2002 [The SOCRATES longer than 6 months were considered eligible for the study. The patients were observed in the years 2000–2002 in 37 Italian centres. Data were collected between April and September 2005. Four-hundred-ninety-three patient files were screened and 408 were considered eligible and analyzed in the present study.The descriptive analysis of the data has been performed in 2 different subgroups identified according to histology: mucinous cancer and non-mucinous cancer. No central pathology assessment of the cancer samples was done.Clinical, pathological and treatment characteristics at initial diagnosis, as well as at recurrence, including surgical and medical treatment (up to 6 lines of chemotherapy) of the recurrence were considered. Response rate was calculated considering RECIST or Ca 12Overall survival was defined as the time elapsed between recurrence diagnosis and the date of death or the date of last follow-up information for live patients. Time to progression and overall survival were described y the Kaplan-Meier product limit method .p < 0.05.Differences among baseline variables were analyzed by the Student t test and Wilcoxon rank test for quantitative variables, and by the Mantel Haenszel test and the Chi-square method for the qualitative variables. Differences were considered statistically significant when ® statistical software.All analysis was done using SASp = 0.0056) and stage at diagnosis was less advanced (p = 0.025)Mucinous tumors were diagnosed in 20 patients, as compared with 388 patients with other histological subtypes table . Median The main characteristics of the patients at time of recurrence are shown in table About 20% of patients underwent secondary cytoreduction in both groups, with a lower number of patients optimally debulked in the group of patients with mucinous cancer (p = 0.03). The majority of patients with mucinous tumours had increased CA 125 levels at recurrence (85%).Details on second-line chemotherapy are shown in the table In the mucinous cancer group responses were obtained with carboplatin, cisplatin, and carboplatin/paclitaxel . Among patients treated with non platinum-agents, no response was observed at second line, while responses were achieved in third-fourth line with paclitaxel (1/2 patients), topotecan (1/4 patients) and cyclophosphamide (1/1); no activity was observed with liposomal doxorubicin (0/4 patients) and gemcitabine (0/1 patient).This retrospective study indicates that recurrent mucinous ovarian cancer has a lower response rate to chemotherapy and a worst prognosis compared to non-mucinous subtypes. Moreover, patients receive less chemotherapy lines for recurrence as compared to other histotypes and when undergo secondary cytoreduction, this is less effective. At our knowledge, this analysis describes for the first time the response rate to second line chemotherapy in patients with platinum sensistive mucinous ovarian cancer. At baseline, the only main characteristic differentiating mucinous from non-mucinous tumour was the lower grade of the cancer, according to what previously observed . AlthougMucinous carcinomas of the ovary includes 5–10% of ovarian carcinomas, although recent refinements in the interpretation of the histological features of noninvasive and metastatic mucinous carcinomas suggest that this may be an overestimate . Clinica"in vitro", that the frequency of extreme drug resistance to chemotherapeutic agents differs significantly among histological subtypes of epithelial ovarian cancer. These authors demonstrated that mucinous ovarian cancer cells are more frequently resistant to cisplatin, but less frequently resistant to topotecan and doxorubicin compared to papillary serous tumors [The rarity of the disease is the main reason of the paucity of literature data regarding the activity of chemotherapy in this entity. Cloven have shos tumors , howeverIn a case-controlled study Hess showed, Platinum-sensitive recurrent ovarian cancer is usually treated with carboplatin/paclitaxel or carboplatin/gemcitabine, based on the trials showing superiority of combination chemotherapy versus single agent carboplatin ,16. In oHere we report for the first time some responses to paclitaxel, topotecan and cyclophosphamide, while no response was observed with liposomal doxorubicin and gemcitabine. Overall the response rate to non-platinum agents was quite poor.A possible limitation of our report is the retrospective nature of the analysis: therefore, survival data should be interpreted with caution. Another weakness of the study may be the lack of a central pathology review, to confirm these were mucinous ovarian cancers versus metastatic malignancies of gastrointestinal origin. However, the differential diagnosis between gastrointestinal and ovarian cancer is a major problem at time of initial diagnosis. In fact, in the case of our series of recurrent ovarian cancer this limitation may be less important since it is likely that during the disease free interval the potential presence of a primary gastrointestinal cancer would have been diagnosed. Moreover, a worse performance status was found in patients with mucinous tumors: however, due to the small number of patients, no definite conclusions can be drawn regarding the potential effect of performance status on the poor survival of patients with mucinous tumors."in vitro" drug response assays could be very useful to select patients that are likely to be resistant to traditional chemotherapy for whom to suggest an alternative, experimental treatment.Conventional parameters used to predict the clinical behaviour of advanced ovarian cancer may not adequately correlate with prognosis in mucinous carcinoma. Several studies have shown that mucinous ovarian cancer has a different pattern of expression of some molecular factors compared to the other subtypes. It is possible that a better understanding of tumour biology may help in determining which patients with mucinous ovarian cancer would benefit from traditional chemotherapy or should receive alternative chemotherapy agents. Several studies have shown that RAS mutations are prevalent in ovarian cancers of mucinous histology but not in tumors of non-mucinous histologies ,19. On tIn conclusion, we showed that mucinous ovarian cancer has a poor response to chemotherapy in the recurrence setting along with a worst prognosis. Responses to platinum re-treatment are less frequent than in non-mucinous cancer, while anecdotal responses occur with non-platinum agents. Studies with alternative chemotherapy combinations are mandatory in this histological subgroup.The authors declare that they have no competing interests.SP, GF, GS, PS participated in the design of the study; GM performed the statistical analysis. SP conceived of the study, and participated in its design and coordination. FO, GC, DK, AV, LM, FG, LM, RL, EB, DGA, MB, AVL, RS, GM, DP, AM significantly contributed to data collection. All authors read and approved the final manuscript. Additional co-authors and participating institution are listed in the additional file The pre-publication history for this paper can be accessed here:participating institutions and co-authors.Click here for file

One-sentence summary for table of contents: Training should include theoretical consideration of biocontainment principles, practical hands-on training, and mentored on-the-job experience. Construction of several new Biosafety Level 4 (BSL-4) laboratories and expansion of existing operations have created an increased international demand for well-trained staff and facility leaders. Directors of most North American BSL-4 laboratories met and agreed upon a framework for leadership and training of biocontainment research and operations staff. They agreed on essential preparation and training that includes theoretical consideration of biocontainment principles, practical hands-on training, and mentored on-the-job experiences relevant to positional responsibilities as essential preparation before a person’s independent access to a BSL-4 facility. They also agreed that the BSL-4 laboratory director is the key person most responsible for ensuring that staff members are appropriately prepared for BSL-4 operations. Although standardized certification of training does not formally exist, the directors agreed that facility-specific, time-limited documentation to recognize specific skills and experiences of trained persons is needed. A few such laboratories have been in existence for decades, primarily in Australia, Russia, South Africa, the United Kingdom, and the United States; these have had, in most instances, an exceptional history of safety in handling these most dangerous pathogens. However, construction of new facilities, including 2 national laboratories on academic campuses in the United States, and the expansion of existing US facilities, has resulted in public concern and Congressional inquiries regarding the safety of these laboratories and the qualifications of those persons working in them has ultimate responsibility for the BSL-4 facility housed within his or her institution, it is the BSL-4 laboratory director that senior leadership relies upon to ensure that this unique facility operates safely and securely. The BSL-4 program director oversees all personnel working in the containment laboratory, ensures proper training and qualifications for the work to be undertaken, ensures that all regulatory requirements are addressed, and is responsible for maintaining a safe and efficient work environment. The BSL-4 laboratory director often also serves as the lead scientist for investigations involving highly pathogenic organisms, sets priorities and coordinates activities within the facility, and frequently serves as the technical spokesperson for the program. The BSL-4 laboratory director grants final approval for personnel to operate independently in the BSL-4 laboratory. His or her efforts are complemented by those of the institutional biosafety officer or manager, who plays an important role as an independent advisor to the institutional director to ensure the safe and secure operations of the program, and the building engineer, who manages the complex mechanical infrastructure necessary to enable safe handling of highly dangerous pathogens. The BSL-4 laboratory director works in close partnership with these professionals to ensure smooth operation of the MCL. Each person has distinct responsibilities and, in most instances, a parallel reporting chain that ensures that problems are brought to the level of the institutional director or the academic dean for resolution.Persons seeking access to a BSL-4 laboratory come from many different backgrounds, but they must all share common traits of having an aptitude for work with infectious agents and an appreciation of the need for careful adherence to safety standards and protocols. Medical examinations, security checks, and clearances are required before a person can handle select agents; some laboratories require vaccinations before a person can begin work with an infectious agent (licensed vaccines are not widely available for most BSL-4 pathogens.) There is a need to remain flexible in the selection of persons for BSL-4 training, recognizing that some persons rapidly acquire the skills needed to work safely in the BSL-4 laboratory, while others may never gain complete confidence of the MCL director and will always be required to work in partnership with a more experienced person. Prior work at a BSL-3 laboratory is generally considered a strong asset but is not an absolute requirement before being cleared to work in a BSL-4 laboratory. What is essential is that the person must be properly trained in the techniques he or she will be using in the BSL-4 laboratory.In addition to core scientific staff, there is an ongoing need for BSL-4 laboratory support personnel to service equipment, maintain the building, conduct inspections, and assist in specific technical activities such as the care and use of laboratory animals. These persons also require specialized training and approval to operate independently.Formal training in preparation for work in a BSL-4 laboratory should consist of 3 elements: didactic or classroom-style theoretical preparation, one-on-one practical training in the facility, and mentored on-the-job training . TheoretBSL-4 laboratory orientation training assumes that the person has already mastered all procedures for safe and secure handling of infectious agents at the BSL-2 and ideally BSL-3 levels. This training generally involves individualized orientation within the facility provided by an experienced staff member or dedicated training officer. It may begin while the laboratory is shut down for annual recertification and maintenance or while it is operational. Training would involve use of entrances simply designed to demonstrate how one enters and exits the suite, general orientation on the use of air hoses, working within biologic safety cabinets or glove boxes, storage and record keeping of pathogens, clean-up and decontamination following procedures or spills, solid and liquid waste management, use of autoclaves and other specialized equipment, communications with others inside and outside of the BSL-4 facility, and other general procedures.Finally, the person under consideration is assigned a dedicated mentor and is introduced to working with live pathogens in the BSL-4 laboratory under the mentor’s close supervision. This stage of training is basically open ended; the length of time and number of entries into the facility will vary greatly depending upon the skills of the person and his or her ability to master all procedures necessary for independent work. Final decision of when a person is allowed independent access is subjective and based on an assessment by the mentor and laboratory director; it is usually discussed only after the person has had extensive experience working in the facility. The time required to gain full independent access may also vary depending upon the kind of work that person will be undertaking. For example, persons not likely to be directly handling infectious material, such as safety officers, building engineers, or maintenance staff, may be offered limited independent access sooner than a person who will be handling live pathogens routinely. Partial or limited access may also be granted to a person for independent access only during normal duty hours. Laboratory procedures that involve animals or sharp instruments represent the greatest risk and consequently require special training and experience; these procedures should be mastered at lower containment levels before a person is permitted to undertake these activities under BSL-4 conditions. Most standard operating procedures for animal manipulation require that at least 2 persons be present, regardless of their experience level. Some laboratories require a final oral or written examination before granting a person independent access, which may be administered by the safety officer. However, the ultimate decision as to who is allowed independent access to the BSL-4 laboratory is made by the BSL-4 laboratory director.A typical mentor will be an experienced person who has earned full unrestricted access to the laboratory and has the clear confidence of the laboratory director. Although there are no set time or formal educational requirements to become a mentor, mentors should have extensive practical experience working under BSL-4 laboratory conditions.All laboratories should have developed a process for reevaluation of all persons working in the BSL-4 laboratory to ensure that their knowledge and skills remain current. This process may be an annual refresher course or periodic formal or informal review and training and may be augmented by orientation sessions as new equipment is introduced into the facility. Ensuring that senior program staff members are regularly present in the laboratory is important for maintaining consistent safety, security, and scientific standards.The need to document that a person has completed appropriate training has been discussed extensively. It is evident that a tacit internal certification exists in BSL-4 facilities currently operating and this takes the form of approval to work independently. This certification may be more formally captured in a specific document or may be a checklist signed by the approval authority. A more broadly applicable documentation system could provide evidence of consistency in training, demonstrate recognized capabilities with certain tasks such as for animal handlers, and provide a mechanism to gauge the number of persons working in the field.At present, those working in BSL-4 laboratories in the United States need security clearance and approval to handle select agents, must have completed the extensive training program described above, must have medical examinations, and must be known by the program director. Each BSL-4 laboratory is, however, unique and every program director should demand that all persons entering their facility be well prepared and knowledgeable of all safety and security procedures required of that facility. Although standardized documentation of training does not formally exist, there would be merit in developing an internationally agreed-upon facility-specific, time-limited document to recognize the specific skills and experiences of a person. Such documentation would have the added benefit of facilitating collaborations and personnel exchanges among BSL-4 laboratories.Directors of most North American existing and proposed BSL-4 laboratories agreed upon a framework for training of BSL-4 laboratory staff, including scientific, technical, and support personnel such as animal handlers, building engineers, and maintenance workers. Independent access to the BSL-4 facility would be granted at the discretion of the BSL-4 program director after successful completion of training in the theory of biocontainment principles, practical hands-on suit training, and extensive supervised work with infectious agents under the tutelage of a well-experienced mentor. Periodic reassessment of skills and ongoing refresher training would be a routine aspect of continuing education for all BSL-4 staff. The need for documentation of training that would be time-limited and specific for a given facility was also discussed. Such formal documentation could facilitate collaborations and personnel exchange between BSL-4 facilities and help to better certify the national BSL-4 workforce. The framework proposed could serve as a model for BSL-4 workforce development globally.

Tracheal stenosis is a known complication of prolonged intubation. It is difficult to treat and traditional surgical approach is associated with significant risk and complications. Recurrent stenosis due to granulation tissue necessitates repeated procedures. We describe a case of short web-like tracheal stenosis (concentric membranous stenosis less than 1 cm in length without associated cartilage damage) managed by a minimally invasive thoracic endoscopic approach. Topical application of Mitomycin C, a potent fibroblast inhibitor reduces granulation tissue formation and prevents recurrence. MacEwen first reported endotracheal intubation for anesthesia in 1880 . DespiteAlthough there have been reports of successful treatment of tracheal stenosis with steroid regimens ,5, the mA 30-year-old Malaysian woman who had bilateral upper lobe lung bullae underwent bullectomy in May 2008 for rapidly enlarging bullae causing respiratory compromise. Post-operatively, she was intubated for 6 days. Upon trial of extubation at day 6, she developed shortness of breath. She was re-intubated for another 5 days before extubation was successful and she was discharged 20 days post operatively.She was well for the next one month until July 2008 when she developed a sudden onset of shortness of breath and stridor. Intubation attempt with a 4 mm endotracheal tube was unsuccessful leading to emergency tracheostomy. Flexible bronchoscopy in the operating room revealed a membranous web-like concentric stenosis without cartilage involvement 3 cm below the vocal cords. Bronchoscopy through the tracheostomy showed normal distal airways. A neck CT scan confirmed the presence of a short segment tracheal stenosis (less than 1 cm) [figure In August 2008, she underwent rigid bronchoscopy using a 12 mm Dumon rigid tracheal tube. This was followed by examination using a small diagnostic flexible bronchoscope via the rigid bronchoscope. A pin hole stenosis of the trachea 3 cm distal to the vocal cords was noted with areas of granulation tissue. We failed to pass the flexible bronchoscope through the stenosis.Initially argon plasma coagulation (APC) was used to devitalize the granulation tissues surrounding the stenosis. Rigid forceps and cryoprobe were used to remove the necrotic tissues. The APC and cryo probes were inserted through the side-port of the Dumon rigid bronchoscope instead of through the working channel of the flexible bronchoscope to minimize damage to the working channel of the flexible bronchoscope. Bougies was then used to dilate the stenotic area in incremental size to a final size of 1 cm. Pledgets soaked with diluted Mitomycin C (concentration 0.2 mg/ml) were introduced using rigid forceps through the rigid bronchoscope to the raw surface of the mucosa and direct pressure applied via the rigid forceps figure . HemostaIntravenous dexamethasone 8 mg tds was given for 3 days. At 2 weeks, a flexible bronchoscopy showed a patent airway and she was weaned off the tracheostomy tube after she tolerated spigotting for 48 hours [figure Repeat flexible bronchoscopy was done at 1 month figure and thenThere is no significant worsening of the narrowing between 1 month and 4 month. She did not complain of stridor or difficulty in breathing and was back to work.The optimal treatment of tracheal stenosis remains undefined. Traditionally, tracheal stenosis has been managed by thoracic and othorhinolaryngology surgeons. Endoscopic procedures are usually performed as a bridge to definitive surgical intervention. With the development of interventional pulmonology field in the last 20 years, definitive management of tracheal stenosis using minimally invasive endoscopic methods became a possibility. Collaboration between pulmonologists and surgeons has become increasingly important to help define the best method of management for these patients.Streptomyces caepitocus acts as a bifunctional alkylating agent cross-linking DNA thereby inhibiting DNA synthesis. Both in vitro and in vivo, Mitomycin C has been proven to be a potent inhibitor of human fibroblasts at concentrations of 0.04 mg/L. It has been used with some success in inhibiting the vigorous granulation response noted after airway injury in animal models and pediatric patients. It has also been used in ophthalmology to treat glaucoma and pterygium.Endoscopic treatment had been shown to be useful, especially in patients who are deemed high risk and too unwell for reconstructive surgery. One of the main drawbacks of endoscopic treatment and surgery is the risk of recurrence of trachea stenosis due to granulation and fibrotic tissue. Studies have shown that most of the recurrence of tracheal stenosis occurs within one to three months after the procedure ,14, and In this case, we describe a successful management of a short web-like tracheal stenosis via rigid bronchoscopy by interventional pulmonologists with collaboration from othorhinolaryngology surgeons. APC appears to be an effective coagulation method. The use of APC prior to granulation tissue removal allows for easy control of bleeding. The application of cryoprobe to remove granulation tissues also minimizes trauma to the trachea.Nd:YAP laser would be an interesting alternative to APC for coagulation but it was not available to us at the time. The presence of othorhinolaryngology surgeons during the procedure who have a good knowledge of local airway anatomy allows identification of structures which are distorted by granulation tissues. This prevents the formation of false tract and accidental perforation of the trachea.In skilled hands, the use of a suspension laryngoscope would be an alternative to rigid bronchoscope in this case. Suspension laryngoscope is ideal if the lesion is either at the vocal cords or just below the vocal cords (subglottic). However, suspension laryngoscope needs to be used with a caveat that there may be a higher risk of irritation and injury to the vocal cords during insertion of surgical instruments to reach the target area which was 3 cm below the vocal cords. Furthermore, the use of a suspension laryngoscope will require jet-ventilation in order to ventilate the patient. The use of rigid bronchoscope allows us to introduce surgical instruments multiple times to the target area with minimal risk of irritating or injuring the vocal cords.The application of topical Mitomycin C is made possible with the rigid forceps which allows application of sufficient force to the airway mucosa to allow proper application of Mitomycin C. It is important to apply Mitomycin C with sufficient force and contact time to allow Mitomycin C to work. With a contact time of 8 minutes, there is evidence of only minimal granulation tissue or scar tissue after 4 months. Topical Mitomycin C also appears to be safe and there is no detectable myelosuppression.Topical Mitomycin C is a useful adjunct in the management of short concentric membranous stenosis which does not involve the cartilage. It reduces granulation tissue and prevents recurrence. Further randomized controlled studies are necessary to explore the possibility of this treatment method in the algorithm for the management of tracheal stenosis. This may obviate the need for invasive reconstruction surgery and repetitive procedures.Written informed consent was obtained from the patient for publication of this case report and accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journalThe authors declare that they have no competing interests.JLW prepared the final copy of the manuscript. STT performed rigid bronchoscopy and the initial bougie dilatation. BS prepared mitomycin C and reviewed articles on the dosage and safety of mitomycin C before application. CLL applied mitomycin C and guided the team on the anatomy of the tracheal stenosis. MR was responsible for the administration of general anaesthesia to the patient during the procedure. ARJA initiated the idea of rigid bronchoscopy and mitomycin C application, supervised the whole procedure and reviewed the final manuscript. All authors have read and approved the final manuscript

India, in many ways, is shining today. It has transformed in to an economic powerhouse and is slated to become the third largest economy in the world. It has taken giant strides toward alleviating poverty and eliminating caste and gender inequality. Sadly, this economic progress has not percolated down to the other domains, including medical care. For us, concerned with the care of children with cancer, the state of pediatric oncology in the country today leaves a lot to be desired.Progress in Pediatric Oncology is one of the biggest success stories in oncology in the last millennium. The 5-year survival for all pediatric cancers is now 75–80%. However,Pediatric oncology as a specialty was virtually nonexistent in the early 1980s in India. Most children were treated, often unsuccessfully, by adult oncologists in a few cancer centers or by self-trained pediatricians in medical colleges. There was lack of good quality pediatric cancer units (PCU) and multidisciplinary or protocol based care. There were only a handful of pediatric oncologists, who were usually trained abroad. The first dedicated pediatric cancer unit was started in Tata Memorial Hospital in 1985. In a nat6The foundation of pediatric oncology research is accurate knowledge of epidemiology of childhood cancers in the country. Unfortunately, there is a real paucity of epidemiologic data on pediatric cancers in India. There was virtually no data on incidence or distribution of pediatric cancers until 1982, when the National Cancer Registry Program (NCRP) was started. From six registries and coverage of less than 2% of the population, the NCRP has expanded to 18 registries and more than 5% coverage. However,Our country lacks a culture of organized clinical research exemplified by virtual absence of good prospective published studies on epidemiology, biology or outcome of childhood cancers. Of late, this trend is changing with some good publications. The benefits of arsenic in pediatric APML and high-dose cytarabine in T- acute lymphoblastic leukemia (T-ALL) are examples of important clinical observations by Indian centers.18Worldwide, the outcome of pediatric cancers has improved through adoption of uniform guidelines and systematic enrolment of patients on prospective multicentric clinical trials conducted by national cooperative groups. However,56The pediatric oncology education has three key target groups and goals:Provide formal pediatric hematology–oncology training fellowships to postgraduate students in order to create a pool of academically oriented pediatric oncologists.Provide practical short-term training to interested pediatricians for shared care in satellite centers.To educate primary care practitioners and pediatricians in the early diagnosis and prompt referral of childhood cancers.There was no formal fellowship program in pediatric haematology–oncology until 2008. Recently, a few institutions have started offering fellowships or degrees under the aegis of national board or other reputed universities. The commencement of programs such as DM in Pediatric Hematology–Oncology in reputed institutions like the Post Graduate Institute of Medical Education and Research is an excellent beginning that other large centers need to emulate. For shared care, an important initiative is the National Training Program in Practical Pediatric Oncology (NTP-PPO) initiated by Pediatric Hematology Oncology (PHO) Chapter of the Indian Academy of Pediatrics (IAP) to impart practical training to interested clinicians. For sensThe future strategy should focus on all the three aspects of pediatric oncology. To strengthen pediatric oncology service, the best way forward is through optimal utilization of existing infrastructure by creation or augmentation of PCUs at university hospitals and regional cancer centers, equipped with necessary diagnostic and therapeutic facilities. These PCUs should be linked to satellite centers with pediatricians trained in shared care. To promote pediatric oncology research, an important initial step would be the creation of a national childhood cancer registry that could generate data related to the epidemiology and end-results like the Surveillance Epidemiology and End Results (SEER) program in US. This registry could collate the prospective data gathered through nationwide usage of IndiaPOD along with NCRP. The most important step would be the establishment of a national pediatric oncology research group. A proposal by PHO to create InPOG (Indian Pediatric Oncology Group) is under active consideration. The focus of InPOG should be cost-effective and logistically feasible protocols for Indian children rather than blindly imported western protocols. To fund nationwide efforts of InPOG, a childhood cancer foundation or “alliance of the stakeholders” comprising parents, volunteers, physicians, and other health professionals is urgently needed. International collaborations to facilitate training of personnel, exchange of knowledge and development of local clinical and laboratory research units will play a vital role in the evolution of InPOG.Finally, in order to foster pediatric oncology education, postgraduate students should be exposed to the exciting and gratifying aspects of this field. This could, for example, happen through short-term rotation in a PCU. The INTPPO program should evolve into a 3-month structured training program at good centers from a 2-day workshop module at present. Lastly, Promote-Pediatric should focus on large scale national coverage of primary care providers through Indian Medical Association and Indian Academy of Pediatrics for maximum impact.In conclusion, pediatric oncology in India needs a concerted, collaborative and multidimensional effort to reach international standards. This is also important in order to meet its obligation to ensure the fundamental right of each child to receive good quality health care and chance of cure as stated below by Ponte di Legno group on the right of children with leukemia: “All subscribers to this memorandum, representing the majority of the Childhood Leukemia Treatment Consortia, herewith emphasize the right of all children in the world to full access to the essential treatment of ALL and other cancers, and call upon all authorities concerned to recognize and support all measures that promote this.” Lastly, “No child should die in the dawn of life”

The family history of cancer in children treated for a solid malignant tumour in the Paediatric Oncology Department at Institute Gustave-Roussy, has been investigated. In order to determine the role of germline p53 mutations in genetic predisposition to childhood cancer, germline p53 mutations were sought in individuals with at least one relative (first- or second-degree relative or first cousin) affected by any cancer before 46 years of age, or affected by multiple cancers. Screening for germline p53 mutation was possible in 268 index cases among individuals fulfilling selection criteria. Seventeen (6.3%) mutations were identified, of which 13 were inherited and four were de novo. Using maximum likelihood methods that incorporate retrospective family data and correct for ascertainment bias, the lifetime risk of cancer for mutation carriers was estimated to be 73% for males and nearly 100% for females with a high risk of breast cancer accounting for the difference. The risk of cancer associated with such mutations is very high and no evidence of low penetrance mutation was found. These mutations are frequently inherited but de novo mutations are not rare. © 2000 Cancer Research Campaign

Explanations for the current worldwide financial crisis are primarily provided by economists and politicians. However, in the present work we focus on the psychological-cognitive factors that most likely affect the thinking of people on the economic stage and thus might also have had an effect on the progression of the crises. One of these factors might be the effect of prior beliefs on reasoning and decision-making. So far, this question has been explored only to a limited extent.We report two experiments on logical reasoning competences of nineteen stock-brokers with long-lasting vocational experiences at the stock market. The premises of reasoning problems concerned stock trading and the experiments varied whether or not their conclusions—a proposition which is reached after considering the premises—agreed with the brokers' prior beliefs. Half of the problems had a conclusion that was highly plausible for stock-brokers while the other half had a highly implausible conclusion.The data show a strong belief bias. Stock-brokers were strongly biased by their prior knowledge. Lowest performance was found for inferences in which the problems caused a conflict between logical validity and the experts' belief. In these cases, the stock-brokers tended to make logically invalid inferences rather than give up their existing beliefs.Our findings support the thesis that cognitive factors have an effect on the decision-making on the financial market. In the present study, stock-brokers were guided more by past experience and existing beliefs than by logical thinking and rational decision-making. They had difficulties to disengage themselves from vastly anchored thinking patterns. However, we believe, that it is wrong to accuse the brokers for their “malfunctions”, because such hard-wired cognitive principles are difficult to suppress even if the person is aware of them. The Economist titled an article on the future of the financial markets “Greed—and Fear” and the Frankfurter Allgemeine Zeitung, the leading newspaper in Germany, under the rubric “glossary of the crises” entitled an article on the most popular explanations for the crisis with a single word: Gier .Beginning in 2007 and continuing through the years 2008 to 2010 the finical markets around the world experienced the first crisis of the new millennium. The crunch was caused by a subprime mortgage crisis in the United States and many malfunctions of the financial systems around the globe. The result of the crash was that between January and October 2008, stock owners in the U.S. had suffered about $8 trillion in losses and losses in other countries have averaged about 40% . How could that happen? In the media mainly economists and politicians voice their opinion on the causes of and possible solutions for the crisis and try to explain the breakdown, for instance, as a result of a globalized world or attribute it to greediness and moral irresponsibility of the people in charge. In support of the latter assertion, While in the public discourse greed and immorality are very popular psychological concepts to explain the financial breakdown, other psychological factors that probably caused or, at least, triggered the crises are almost completely neglected.In the present work we focus on the cognitive factors that most likely affect the thinking of people on the economic stage and thus might also have had an effect on the progression of the crises. The main assumption of the paper is that fatal decisions and inappropriate actions on the finical market can also be caused by the “natural” and almost “hard-wired” limitations of the human cognitive system. An important factor in this context might be the effect of prior knowledge and existing beliefs. Experts in a certain domain typically possess domain-specific skills and knowledge that distinguish them from novices and less experienced people in the domain. As a consequence they typically solve problems more quickly and more accurately than laymen However, prior knowledge and existing beliefs can also be a drawback in reasoning and decision-making. When we are an expert in a specific domain and we are convinced that something is true, we often have serious problems in changing our mind in situations where what we think is true is actually wrong. It is difficult to detect the inconsistency of our prior experiences and knowledge with the current situation and it also proves hard to revise our beliefs in order to take a new piece of information into account. Findings from cognitive brain research also provide evidence that reasoning with knowledge-related problems is implemented in other brain areas than reasoning with abstract materials with no meaningful content One of the most impressive findings in this context is the belief bias Goel and Dolan The present contribution explored how stock-brokers perform when they are confronted with problems that evoke a clash between their prior beliefs and what would be a logically valid inference. Particularly, we were interested in problems where a conflict occurred between what the brokers have known to be true as a general rule for calculating stock prices and what a logically correct inference would be.The experiments reported here were done in accordance with the Declaration of Helsinki and followed the ethical requirements of the German Psychological Association (DGPs). No extra ethical approval was required for this study, since the material was harmless and dealt with work content of stock-brokers. Participants were informed that their data is treated anonymously and that they could terminate the experiment at any time without providing any reason. All participants provided informed written consent.Nineteen experienced stock-brokers (with the majority having over ten years of experience on the trading floor), working in large finance companies on the Frankfurt stock market, were tested. Their age ranged between 24 and 65 years.http://www.boerse-frankfurt.de/DE/index.aspx?pageID=44&NewsID=99). Neutral problems were included as controls. The main question of interest was ‘what goes on in the mind of a stock-broker when a conclusion is logically correct, but conflicts with what the stock-brokers believes to be a correct deduction or is logically incorrect but highly plausible ?’The experiment was conducted on a laptop computer that presented the problems and recorded participants' responses. The stock-brokers judged the validity of 24 logical inference problems concerning sales transactions and calculating stock prices top. ThiAs a control, a group of 19 meteorologists from the German Meteorological Service was tested. They were matched to the group of stock-brokers. They were all naïve with respect to the stock exchange market. All provided informed written consent.Inference problems, task, and procedure were identical to Experiment 1.Overall, almost half of the problems were solved incorrectly . A 3×2 ANOVA was run to test our hypotheses that there should be a main effect of validity and–most importantly–an interaction between validity and plausibility. This analysis indeed revealed a significant main effect of Validity, F = 15.684, p<.001, indicating that stock-brokers made more errors in evaluating invalid than valid problems, and a significant Validity × Plausibility interaction, F = 16.951, p<.001  = 0.014, p = .986 n.s.). To further test our hypotheses concerning the effect of plausibility on reasoning we then performed paired-samples t-tests as post-hoc tests. These showed that with valid problems, stock-brokers made significantly more errors when the content was implausible than when it was plausible , t (18) = −5.43; p<.01; r = 0.79. With invalid problems, however, stock-brokers made more errors when the content was plausible than when it was implausible , t (18) = 4.15; p<.01; r = 0.69. This shows that the stock-brokers were biased towards accepting logically invalid inferences as valid if the inference was ‘economically’ plausible left.A 3×2 ANOVA detected a main effect of Validity, F  = 6.94, p = .017, reflecting a higher error rate with invalid than with valid problems. No significant effect of Plausibility emerged, F = 0.084, p = .92 n.s.. Also, there was no significant Validity × Plausibility interaction, F = 0.032; p = .969 n.s.. In other words, no bias towards accepting logically invalid inferences as valid –if the inference was ‘economically’ plausible– occurred right.The two experiments only differed in having different groups of participants. The participants of Experiment 1 were experienced stock-brokers, whereas the participants in Experiment 2 served as controls. It is important to see that this actually is not a variation in expertise in the sense that we compared experts to low-experienced stock traders as it is often done in the field of expertise research. In fact, the participants in Experiment 2 primarily served as controls to make sure that the pattern of results in Experiment 1 (stock-brokers) was not caused by other variables in our experimental materials. However, in both experiments, validity and plausibility were used as within-subjects factors and we demonstrated that stock-brokers show a decrement in performance with implausible compared to the plausible inferences, whereas the control group was not affected by the conclusions' plausibility. We did not treat the experiments as a single study with the two different groups of participants as a between-subjects factor, because a conjoint analysis would result in problems with the inhomogeneity of variance. However, a direct interaction between the two groups of participants (brokers and controls) and the different sorts of problems would provide additional support for our account. Therefore, we computed a post hoc ANOVA with “plausibility” as a within-subjects factor and the two experiments as a between-subjects factor. In this way, it is possible to estimate whether the pattern of performance is different for brokers and control participants. We conducted –in spring 2008, just before the current financial crises started– a study on logical reasoning at the stock market. In particular, we predicted that stock-brokers should show a belief bias whenever there was a conflict between logicality and plausibility. In contrast, we predicted that people with no special experience at the stock market (our control group were meteorologists) should not be sensitive to the implausibility of the reasoning problems' content and thus should not show a belief bias.Our findings support our hypotheses. Stock-brokers were guided more by prior knowledge and existing beliefs than by logic and rational decision-making. In fact, they often tended to draw logically invalid inferences in favour of their existing beliefs. Thus, they had difficulties to disengage themselves from vastly anchored thinking patterns and instead demonstrated the well-known belief bias How are our results related to different reasoning theories? Our experiments were not designed to test competing reasoning theories and so the following thoughts must be taken with caution. However, there are three possible explanations for why stock-brokers show such a belief bias and thus a strong tendency to deviate from the rules of logic.(1) The classical heuristics-and-biases program (2) Our findings are also in line with dual-process theories of reasoning. They explain belief biases in reasoning due to the involvement of different cognitive processes and imply a specific relation between logic and human reasoning. Evans (3) What we believe might be the most promising explanation is the theory of preferred mental models The main motivation for our study was to explore the interaction between prior beliefs and logical reasoning. Our sample consisted of a group of experienced stock-brokers (and a control group) and the task was to evaluate inferences concerning stock trades. Our main finding was a strong belief bias. Stock-brokers were strongly biased by their prior knowledge. Lowest performance was found for decisions in which the problems caused a conflict between logical validity and prior knowledge. Stock-brokers tended to make logically invalid inferences rather than give up their existing beliefs.We think that these findings also have some implications for the current financial crisis. Of course, such transformations from the psychological lab into the real world are highly speculative and in fact it is questionable whether individuals' belief biases can cause aggregate effects on a macroeconomic level. On the other hand, we also believe that Cognitive Psychology should not completely abandon to apply experimental findings to the real world and to improve our understanding of it. So, our interpretation of the study is that, amongst others, also psychological mechanisms exist that can help us understand some aspects of financial breakdowns. “Greed” probably is a less important factor than many people think. In fact, research from Cognitive Neuroscience has shown that reasoning with familiar and unfamiliar problems is related to specific patterns of brain activity and the belief bias can be seen as a conflict between brain areas in which either domain-general or knowledge-driven reasoning strategies are implemented

Mycobacterium tuberculosis in the CSF, for the diagnosis of TBM patients.Tuberculous meningitis (TBM) is one of the common clinical manifestations of extra-pulmonary tuberculosis. It is difficult to diagnose due to a lack of rapid, sensitive, and specific tests. Newer methods, which are easy and reliable, are required to diagnose TBM at an early stage. Thus our aim was to evaluate the polymerase chain reaction (PCR) technique, using primers directed against the IS6110 gene, for the detection of 6110 PCR method using a specific pair of primers designed to amplify the insertion sequence, IS6110, in the M. tuberculosis genome was used to analyze CSF. A total of 80 CSF samples from different groups of patients were studied .An in-house ISPCR gave a sensitivity of 91.4% and specificity of 75.9% for the diagnosis of TBM in patients with TBM confirmed by culture. In 16 clinically diagnosed, but unconfirmed, TBM cases PCR was positive in 10 (62.5%) cases. There were seven (24.1%) PCR-positive cases among the 29 patients with non-TBM and non-infectious neurological disease.6110 PCR assay is valuable in the rapid diagnosis of tuberculous meningitis.We conclude that the performance of an in-house IS Tuberculosis (TB) is one of the major causes of morbidity and mortality worldwide. India has about 1.8 million new cases of TB annually, accounting for a fifth of new cases in the world – a greater number than in any other country . DelayedM. tuberculosis from CSF takes 4–6 weeks and leads to a delay in diagnosis [M. tuberculosis antigen and antibodies, T cell based assay for IFN gamma estimation (ELI SPOT), adenosine deaminase assay [Confirming the clinical suspicion of TBM has always been problematic. Acid-fast bacilli (AFB) staining of cerebrospinal fluid (CSF) has a very low sensitivity . Althougiagnosis ,8. Analyiagnosis . In the iagnosis for demose assay ,12, and se assay ,14. HoweM. tuberculosis specific DNA sequences have been evaluated in different laboratories including MBP-64, 65 kDa antigen and IS6110 [M. tuberculosis in clinical samples differs greatly among the different laboratories ranging from 50–90% and 60–100%, respectively [M. tuberculosis genome makes it an attractive target for PCR amplification, as it could contribute to a higher degree of sensitivity of the assay [6110 sequence for the diagnosis of tuberculosis [6110 based PCR assay to detect M. tuberculosis DNA in CSF samples of TBM and non-TBM cases in our Institute.Rapid techniques based on nucleic acid amplification such asPCR have been reported to be more sensitive and specific as they attempt to detect specific DNA sequences from the organism under investigation. Several d IS6110 . The reld IS6110 . The obshe assay ,17. Severculosis ,14. In oCSF samples from a total of 80 patients were analysed. These consisted of confirmed and clinically suspected TBM patients, n = 51, patients with other infections , and control subjects with non-infectious neurological disorders, n = 17. Patients for this study were admitted to the Neurology Department of Central India Institute of Medical sciences (CIIMS), Nagpur between September 2005 and December 2006. All patients were above the age of 20 years and had given written consent for the study. CSF samples for ADA estimations and other tests were obtained before starting any specific treatment in all cases of neurological disorders including viral, bacterial, and mycobacterial meningitis. The Institutional Ethics Committee of Central India Institute of Medical Sciences, Nagpur, approved the study. To establish a diagnosis of meningitis, 2–5 ml of CSF was withdrawn from patients using a lumbar puncture. CSF was then subjected to routine biochemical and pathological analysis including Gram, India ink, and AFB staining and culturing. Diagnosis of TBM and non-TBM was based on criteria described below.M. tuberculosis in CSF by staining and/or culture.A: Clinically confirmed cases (n = 35): Confirmed by the presence of B: Clinically suspected patients (n = 16): This group had negative cultures with all of the following observations:a: Sub-acute or chronic fever with features of meningeal irritation such as headache, neck stiffness and vomiting, with or without other features of CNS involvement.b: CSF samples showing raised protein levels, and/or decreased glucose (CSF: blood glucose ratio < 0.5), and/or pleocytosis with lymphocytic predominance.c: Good clinical response to anti-tuberculous drugs.A: Pyogenic meningitis (n = 5):Confirmed cases (n = 2): Presence of pathogenic bacteria in CSF by staining and/or culture.Clinically suspected (n = 3): This group included the culture negative cases with all of the following observations:a: Fever and/or signs of meningeal irritation , stroke, or head injury and who have received antibiotics), or high fever and/or signs of meningeal irritation with or without CNS manifestations (patients who received broad-spectrum antibiotics).b: CSF findings showing increased proteins, decreased glucose (CSF: blood glucose ratio < 0.2), and/or pleocytosis with a predominance of polymorphonuclear cells.c: Good clinical response to road-spectrum antibiotics.B: Viral meningitis patients (n = 7): This group included suspected patients with the following observations:a: Acute onset of fever and symptoms and signs of meningeal irritation.b: CSF samples showing mild increase in protein, glucose levels often normal, and pleocytosis, predominantly lymphocytic.c: No clinical evidence for extra cranial tuberculosis.All other patients who had no evidence of CNS or extra CNS bacterial or viral infections were grouped in the non-infectious/control group. Patients included in this group had chronic headache and hypertension n = 10, head injury n = 2, paraparesis, dementia, myelopathy, acute cerebellitis, and epilepsy, n = 1 each.CSF samples (0.5 ml) were inoculated into 5 ml BioFM liquid media and incubated at 37°C. All culture samples were examined twice a week for 6 weeks. The positivity of culture was defined by the growth of mycobacteria in the liquid media.DNA was extracted according to the CTAB-phenol chloroform extraction method. Briefly, 0.2 ml of CSF was centrifuged at 10,000 rpm for 10 min. The supernatant was discarded and the pellet suspended in 567 μl of TE buffer , 30 μl 10% SDS and 3 μl proteinase K (20 mg/ml), mixed and incubated at 37°C for 1 h. After incubation, 100 μl of 5 M NaCl and 80 μl of high-salt CTAB buffer was added and mixed followed by incubation at 65°C for 10 min. An approximate equal volume (0.7–0.8 μl) of chloroform-isoamyl alcohol (24:1) was added, mixed thoroughly and centrifuged for 4–5 min in a microcentrifuge at 12,000 rpm. The aqueous viscous supernatant was carefully decanted and transferred to a new tube. An equal volume of phenol: chloroform-isoamyl alcohol (1:1) was added followed by a 5 min spin at 12,000 rpm. The supernatant was separated and then mixed with 0.6 volume of isopropanol to get a precipitate. The precipitated nucleic acids were washed with 75% ethanol, dried and re-suspended in 100 μl of TE buffer.37Rv strain provided by Colorado State University, Fort Collins, USA, (Contract No 1-A1-40091). Negative control included PCR grade water.In each independent PCR assay, test results were compared with the results for one positive and one negative control. The positive controls included the DNA of HM. tuberculosis was done using a specific pair of primers designed to amplify an insertion sequence IS6110 in the M. tuberculosis complex and the expected band size was about123-bp. The sequence of these primers, T4 and T5, are: 5'-CCT GCG AGC GTA GGC GTC GG 3' and 5' CTC GTC CAG CGC CGC TTC GG 3' respectively. A 50 μl reaction contained 10× assay buffer , 10 mM dNTP's , 10 pmole of each primer , 2.5 units Taq DNA Polymerase and 5 μl of extracted DNA. Amplification was carried out in a thermal minicycler , which involved 40 cycles of denaturation at 94°C for 2 min, annealing of primers at 68°C for 2 min, and primer extension at 72°C for 1 min. The amplification products were separated on 2% agarose gels, visualized on a UV- light transilluminator and photographed.Identification of 6110 sequence of M. tuberculosis by PCR. M represents 100 bp DNA ladder. Lane 1 (L1) represents the positive control DNA (M. tuberculosis strain H37Rv). L2, L4, L6 show clinically positive TBM samples, and L3 and L5 represent non-TBM samples. L7 is a negative control.Figure 6110 PCR assay in the TBM and non-TBM CSF samples are shown in Table 6110 PCR assay was positive in 91.4% (32/35) of confirmed TBM cases. However, in the clinically diagnosed TBM patients, but not confirmed by culture, the sensitivity of IS6110 PCR assay was 62.5% (10/16) . In non-infectious control group PCR was found to be positive in 4 samples and a specificity of 79.3% (PPV = 85.3%) as compared to PCR showing 82.4% sensitivity (NPV = 71%) and 75.9% specificity (PPV = 85.7%), cases of confirmed TBM and in 62.5% (10/16) cases of clinically diagnosed TBM which were negative for mycobacterial culture, but had a clinical index of suspicion for TBM.The characteristic of the ISstandard . The preetal used a DNA extraction protocol involving CTAB detergent, which enhances PCR positivity in CSF samples [M. tuberculosis makes the isolation of target DNA difficult [6110 element and therefore, infection with an IS6110 negative strain cannot be ruled out [6110 PCR has shown enhanced sensitivity and specificity as a single step PCR assay [Our results show agreement with some previous studies, which showed 85–98% sensitivity ,25,26 an samples . We haveifficult . There huled out -33. OtheCR assay ,34. NestCR assay ,36. HoweCR assay .6110 PCR assay was useful in terms of sensitivity (82.4%) and specificity (75.9%) as compared to culture results showing 68.6% sensitivity and 79.3% specificity in overall TBM and non-TBM cases . In our study, the two PCR positive cases of viral meningitis also had a positive TB culture, which suggests they could be classified as case of mixed meningitis. Mixed bacterial meningitis involving mycobacteria and other bacteria have also been described earlier .PCR was also positive in four cases of non-infectious non-TBM group, which were actually diagnosed for chronic headache (two cases), epilepsy and myelopathy myelitis (one each). One reason for such false positive results could be cross contamination with the amplified DNA product in the laboratory. This is a well-recognized problem in other laboratories . In spitDespite the improved sensitivity and specificity of PCR technique, AFB and culture remain an important technique for diagnosing TBM. In this study, if the PCR method had been accepted as the only diagnostic criteria, it would have missed three culture confirmed cases.In a meta-analysis of in-house and commercial protocols used in the diagnosis of TBM, the results revealed that commercial tests had an increased specificity but low sensitivity (56%). This was in stark comparison to the substantial variability of the test results seen whenever an in-house protocol was used . Also th6110 PCR is a rapid and cost-effective diagnostic test for TBM that shows good sensitivity and specificity. This can be adopted as a method of choice for the diagnosis of mycobacterial infections in cases where suspicion is high, in combination with other clinical criteria.Our study made it evident that in-house ISThe author(s) declare that they have no competing interests.PSD carried out the study design, data collection, data interpretation, literature search, and manuscript preparation; RSK and HJP participated in the preparation of the manuscript, data interpretation, and study design; SSR and KJN contributed in collection of samples and data interpretation, GMT provided assistance in preparation of the manuscript, data interpretation, study design, and funds collection; and HFD supervised the study design, data interpretation and manuscript preparation. All authors have read and approved the final version of the manuscript.

Isobaric Tags for Relative and Absolute Quantitation (iTRAQ™) [Applied Biosystems] have seen increased application in differential protein expression analysis. To facilitate the growing need to analyze iTRAQ data, especially for cases involving multiple iTRAQ experiments, we have developed a modeling approach, statistical methods, and tools for estimating the relative changes in protein expression under various treatments and experimental conditions.This modeling approach provides a unified analysis of data from multiple iTRAQ experiments and links the observed quantity (reporter ion peak area) to the experiment design and the calculated quantity of interest (treatment-dependent protein and peptide fold change) through an additive model under log transformation. Others have demonstrated, through a case study, this modeling approach and noted the computational challenges of parameter inference in the unbalanced data set typical of multiple iTRAQ experiments. Here we present the development of an inference approach, based on hierarchical regression with batching of regression coefficients and Markov Chain Monte Carlo (MCMC) methods that overcomes some of these challenges. In addition to our discussion of the underlying method, we also present our implementation of the software, simulation results, experimental results, and sample output from the resulting analysis report.iQuantitator's process-based modeling approach overcomes limitations in current methods and allows for application in a variety of experimental designs. Additionally, hypertext-linked documents produced by the tool aid in the interpretation and exploration of results. Recent advances in instrumentation, reagents, and techniques for high throughput proteomics are making it possible to simultaneously identify and compare disease, development, and treatment-related changes to the level of protein expression . In mostThe isobaric Tag for Relative and Absolute Quantitation (iTRAQ™), has seen increased application in quantitative proteomics . This teEach iTRAQ experiment produces tens of thousands of spectra , several thousand identified peptides, and hundreds of identified proteins. Bioinformatic tools and statistical methods are essential to the interpretation of these data. Several data management and analysis tools have been developed to analyze these data, such as ProQuant, and ProteinPilot, software supplied by the manufacturer of the iTRAQ reagents, and a number of freely available tools. The software packages i-Tracker and TandWhile early iTRAQ-based studies focused on comparisons to a common reference, a variety of experimental designs have now been suggested and willWe report on the development and application of a new software tool, iQuantitator, designed to facilitate the analysis and reporting of results from iTRAQ experiments. This tool employs a model-based approach to describe sources of variation in the observed data and Bayesian inference to estimate the parameters of interest and their uncertainty, supports inference across multiple iTRAQ experiments addressing a common hypothesis, allows both protein and peptide-level treatment-effect analysis, and produces a hypertext-linked and searchable electronic report in the Portable Document Format (pdf).In the software described here, statistical inference employs a model that links experimental observations to the technical and experimental sources of variation and provides the basis for the inference of treatment-dependent changes in protein and peptide expression. We adapt our recently reported model for the analysis of iTRAQ data in whichpi), are considered as a batch. While it is important to understand which sources of variation explain the observations, we are primarily interested in the inferred values of those effects that include an interaction with treatment, specifically, the protein by treatment interaction effect . It is these parameter values that indicate treatment-dependent changes in protein expression. In Equation (1), we note that peptides are considered to be uniquely assigned to a protein as indicated by the notation j(i), indicating that peptide j is always associated with protein i. In cases where a peptide could be assigned to more than one protein, it is eliminated from consideration prior to analysis.This approach provides a framework for constructing models. For each study, the model must be tailored to capture the pertinent sources of variation and experimental effects of interest. In our previous efforts and those of Oberg, this model was analyzed using ANOVA, where the parameters are structured into batches that explain the sources of variation in the observed reporter ion peak area. All of the parameters associated with an effect of the model, for example protein effects (Ntreatment -1) × (Nprotein + Npeptide) and these parameters must be estimated from the Nspectra × Nchannel reporter ion intensities. In addition to the large number of parameters and the resulting computational costs, the inference method must contend with missing data. Within an experiment, many proteins are identified by a single peptide and the peptide and protein effects for that protein cannot, using traditional ANOVA techniques, be estimated independently. Additionally, the limited overlap in proteins identified in replicate iTRAQ experiments results in proteins that may not be observed in all experiments. In the experiments reported by Oberg [Examination of the model reveals the computational challenges discussed by Oberg and colleagues . The modby Oberg , nearly by Oberg reportedParameter inference in iQuantitator employs computational methods developed using the Bayesian statistical framework. Applying Bayes theorem, the probability density of the model parameters conditioned on the observed data can be written as the product of the likelihood, the prior densities of the parameters, and integration constant. The joint posterior density of the parameters is obtained by integrating the likelihood over the prior densities. When a closed form solution of this integral is unavailable, computational methods such as Markov Chain Monte Carlo (MCMC) can be used . The Marxi be the ith observed reporter ion peak area, assumed distributedThe Gibbs sampler implemented in iQuantitator was designed to exploit the structure of the model. Let aw are parameters of the model and Si are the set of parameter indices associated with peak area i. In our case, the set Si gives the indices of the parameters, one from each batch, that sum to give the mean of the distribution of xi and aw ∈ {p|r|f|g|v|b|s|h}. The prior distributions for the aw are given bywhere B(w) gives the batch to which parameter w is assigned are updated so that computational effort in the precision update is reduced.Within a batch, the update of a parameter depends only on the observed reporter ion peak areas assigned to the associated factor level. Since each observation is assigned to only one parameter within a batch, during each iteration of the algorithm, all parameters assigned to a given batch are updated in parallel. For each batch, the software computes all of the sums in Equation (2) in one pass through the data, forming partial sums as needed. Once completed, all parameters in the batch are updated followed by updates to the batch hyperprior parameters iQuantitator is available as an installable package for the freely-available R statistical computing environment and, through scripting, can be tailored to a variety of iTRAQ study designs. The package includes a collection of R functions for structuring input files, a Gibbs sampler designed for this application, and an R/latex script used to construct hypertext-linked reports. To make use of the package, users create an R script that specifies the input files, defines the experiment, gives the statistical model and the comparison of interest, and specifies the results file names. The software is intended for use by statisticians and analysts familiar with experimental design and statistical modeling. The processing flow of a typical iQuantitator application is illustrated in Figure 2For each study, the user specifies the study design indicating the treatment group and sample identifier for each channel within each iTRAQ experiment Figure . For eacloadMSMSSummary function. In addition to the study design and a list of associated MS/MS summary files, the user may also specify contaminating proteins and protein modifications to be eliminated prior to analysis. The protein and modification filters are specified as lists of regular expressions [confthreshold argument to loadMSMSSummary, and a count of spectra below threshold is provided in the summary report. Additionally, spectra assigned to more than one protein, unidentified spectra, and spectra with out-of-range data are also eliminated. The remaining data is restructured as a table with one row per reporter ion peak containing, in addition to the log transformed peak area, the descriptors of that peak . Additionally the software constructs a summary of the input data including: the number of spectra, unique proteins and unique peptides; the number of spectra eliminated during filtering or due to missing data; and the number of spectra observed for each reported peptide within each experiment.Data import and filtering is implemented in the ressions , one expprocessiTRAQ function. The user supplies a statistical model, specific to the experimental design, relating log-transformed reporter ion peak areas to the treatment effects of interest and other sources of variation. The user-supplied model, expressed in a restricted version of the R formula grammar, is specified so as to capture both the comparisons of interest and the sources of variation that interfere with those comparisons. The user may also specify parameters controlling the Gibbs sampler and prior distributions for the model parameters. The Gibbs sampler, implemented as a C library function, is used to draw samples of the model parameter vector from its joint posterior distribution. The sampling process produces a large table, with one row per monitored parameter (approximately twice the sum of the number of unique peptides and unique proteins) and number of columns equal to the number of samples retained (thousands of columns). The user-specified thinning and burn-in parameters control the number of MCMC iterations between stored samples and the number of samples discarded at the beginning of the sampling process, and can be used to reduce this table to a reasonable size. Monitoring flags for each factor allow data collection to be selectively bypassed for nuisance parameters. To assess convergence, MCMC variable trace plots can be generated and MCMC diagnostics can be applied to the sampled parameters using existing R packages [To identify treatment-dependent, differentially expressed proteins, iQuantitator employs Bayesian inference using Gibbs Sampling as described above. This step is implemented within the packages and funcsummarizeiTRAQ function. Although the software draws samples from the joint posterior distribution for all of the parameters in the model, we focus our statistical summary only on those parameters associated with the treatment effects. In particular, we focus on the protein-treatment interaction factor, and the peptide-treatment interaction factor, typically specified in the model. For each parameter within these effects, the software estimates, using samples collected from the MCMC algorithm, the mean, median, standard deviation, and 2.5th and 97.5th percentiles. These values are exponentiated to give both point estimates (mean and median) and credible intervals (2.5th and 97.5th percentiles) for the protein and peptide fold change due to treatment. The protein and associated peptide summary statistics are organized into a hierarchical data structure. Additionally, the software builds a map of identified peptides along the associated protein sequence. The protein accession number is used to locate the protein sequence in a user-supplied protein database file (in FASTA format). The sequence is then included in the resulting data structure.For each parameter of interest, iQuantitator computes summary statistics giving a point estimate and credible interval from which the fold change estimate and its uncertainty can be determined. This step is performed in the utils package. Sweave processes a user-supplied script containing both latex and R code and merges the output of the R code with the latex to create a .tex file suitable for document production. The resulting .tex file is then converted into a Portable Document Format (.pdf) file using the pdflatex processor. The iQuantitator package includes a default Sweave script that can be used as is or modified to change the form, content, or organization of the resulting report. The document is structured to provide both graphical and numerical summaries of the results with hypertext links providing quick access to document sections containing detailed analyses containing formatted versions of the experiment description, statistical model, data summary, and protein and peptide treatment effect summary data structures. This step utilizes the Sweave automatic report generator, a component of the R Software was developed using version 2.6.2 of the R Statistical Computing Environment .A set of simulated data sets was produced to further investigate the performance of iQuantitator. Two sets of four tests simulating studies with single iTRAQ runs and one set of two iTRAQ experiments from a single study were generated using a simulator developed in our laboratory for testing inference methods. Biological, treatment, and technical variation can be set as desired to construct simulated protein expression profiles for individual samples. The simulator models the peptide composition of proteins, inserts post-translational modifications and treatment-dependent modifications, models loading errors, labeling efficiency, fractionation of peptides, MS intensities, peak selection logic, and reporter ion measurement noise. The resulting output is converted, via an R script, into files satisfying the input requirements of iQuantitator. For this study, the simulator was configured to draw from a pool of 5000 proteins composed of peptides from a pool of 850,000. The peptides were randomly assigned modifications with a probability of 0.05. Both loading error and tagging efficiency were set to model ideal conditions and the peptides were distributed across 14 first dimension fractions and 400 second dimension fractions. Peak selection was limited to peptides in the m/z range 800 to 3500 and only the 10 most intense peaks in the simulated mass spectrum were processed in simulated MSMS. A peak was not reinterogated if already appearing in any of the 30 previous fractions. The ion suppression model was set as to minimize the effects of suppression and treatment, biological and technical noise were added to the output. Each simulation run modeled samples from four subjects, two each from two treatment groups. Channels 1 and 3 were assigned to subjects from treatment group 1 and channels 2 and 4 to subjects from treatment group 2. Each experiment dataset contained approximately 1050 unique proteins, 4800 unique peptides, and 7000 spectra .in situ with warm phosphate buffered saline, excised from the embryo and cut in half, then rinse blotted dry, flash frozen in liquid nitrogen. Pooled hearts from the two stages were cryo-pulverized , then homogenized in 5 mM bicine, pH 9.3 using a ground glass mortar and pestle , and centrifuged at 700 × g for 10 min at 4°C. The cytosolic fraction was obtained by centrifugation of the low-speed supernatant at 150,000 × g for 90 min at 4°C . Experiments were conducted in compliance with guidelines established by the Institutional Animal Care and Use Committee (IACUC) of the Medical University of South Carolina for the utilization of embryonated eggs prior to 18 days of age.In addition to the simulated cases, we applied iQuantitator to a biological sample collected as part of an on-going study of embryonic heart development in chickens. Fertile chicken eggs were incubated at 37°C in a humidified atmosphere with hourly rotation for 10 to 14 days and staged according to the criteria of Hamburger and Hamilton (HH) (1951). Hearts from HH stage 36 (n = 72) and HH stage 39 (n = 24) were perfused One hundred micrograms of total protein from each aliquot were labeled with each of the 4-Plex iTRAQ reagents according to the manufacturer's standard protocol. Briefly, the aliquots were denatured with a sodium dodecyl sulfate solution, reduced with tris-2-carboxyethyl phosphine (TCEP), and alkylated by adding s-methyl methanethiosulfonate (MMTS). The aliquots were digested with 10 μg of trypsin (Applied Biosystems) each. Ten μL of 1 M tetraethyl ammonium bicarbonate buffer (pH 8.5) were added to ensure proper pH during labeling. After labeling, the four aliquots were combined and fractionated by strong cationic exchange (SCX) chromatography on a Waters 600-MS HPLC system connected to a Waters 484-MS UV detector. A PolySULFOETHYL A™ column was used. Solvent A was 10 mM KH2PO4, 25% acetonitrile (ACN), pH 2.9; solvent B was similar to A but with the addition of 1 M KCl. A 45 minute gradient from 5% to 50% B, followed by 20 minutes at 50% B provided acceptable separation of the peptides. The flow rate used was 250 μL/minute, and the elution of peptides was monitored by UV at 220 nm. Fractions were collected every 5 minutes. Fractions were dried and stored at -20°C until further use. SCX fractions containing peptides were further fractionated by C18 nano-reversed phase chromatography on an Ultimate-Switchos- Probot system . The peptides were first loaded using the Switchos system on a C18 PepMap 100 pre-column (5 mm × 300 μm I. D) (LC Packings) using 2% ACN, 0.1% trifluoroacetic acid (TFA) at 40 μL/minute. After 20 minutes of desalting, the peptides were eluted from the pre-column onto a C18 PepMap 100 column (150 mm × 75 μm I. D.) (LC Packings) using the Ultimate system at 200 nL/minute. Solvent A was 2% ACN, 0.1% TFA; solvent B was 85% ACN, 5% 2-propanol, and 0.1% TFA. An 80 minute gradient from 5% B to 50% B, followed by 30 minutes at 50% B was used. Peptide elution was monitored at 214 nm. The eluant from the reversed-phase HPLC separation was mixed at a 1:2 (eluant: matrix) ratio with a solution of α-cyano-4-hydroxy-cinnamic acid being continuously delivered from the syringe pump of the Probot system. The mixture was spotted on stainless steel MALDI plates (Applied Biosystems) in a 24 × 24 pattern. Spots were collected every 10 seconds during peptide elution of the reversed phase chromatography run. Typically, two plates were collected for each SCX fraction. Six mass calibration spots were manually spotted on the perimeter of the plate, and two mass accuracy verification spots were manually placed on the top center and bottom center of each plate. Matrix-assisted laser desorption ionization mass spectrometry (MALDI-MS) analyses was performed on a 4700 Proteomics Analyzer tandem time-of flight (TOF) mass spectrometer (Applied Biosystems). One MS spectrum was acquired for each spot in positive reflector mode; subsequently the 15 most intense precursors from each spot were selected for tandem MS/MS sequencing. For peptides eluting in more than one spot, the interpretation method was set up to minimize repetition of the MS/MS data collection on the same precursor. MS/MS spectra were collected starting with the least abundant peptide in each fraction to maximize data quality. The raw MS/MS data were filtered using a signal-to-noise ratio of 15 and searched using GPS Explorer software (version 3.6) and Mascot (version 2.1). iTRAQ labeled N-terminal and Lysine, and MMTS labeled cysteine were selected as fixed modifications, while oxidation of methionine and iTRAQ labeled tyrosine were used as variable modifications. A 70% confidence cut-off was used at the peptide level. The Gallus gallus protein database used for the search was extracted from the NCBI non-redundant database downloaded from the NCBI website on May 4, 2005. The MS/MS summary report containing peptide sequence, Mascot scores, protein assignment to each peptide, iTRAQ reporter areas (corrected for isotopic impurity based on the certified purity supplied by the manufacturer with each batch of reagents), and other information used in this study were generated using the GPS Explorer software.Tandem MS summary reports comparing stage 36 and stage 39 chicken hearts and containing 15,813 MSMS spectra were processed using iQuantitator. Of those spectra, 14,488 lacked a high confidence identification, and 42 were eliminated due to disallowed modifications (iTRAQ-modified tyrosines) leaving 1,283 spectra with high confidence identifications from 438 unique proteins and 970 peptides. Using iQuantitator, 200,000 samples were collected from the Markov chain following a burn-in period of 40,000 updates. The samples were thinned by a factor of 20 leaving 5,000 samples from which summary statistics were collected. For each protein and each associated peptide, mean, median, and 95% credible intervals were computed for each of the protein- and peptide-level treatment effects.We find that the model-based approach implemented here results in a smaller mean square error in the estimated log fold changes . Resulting estimates are, thus, conservative. In the model used in this study, the prior distribution is given a 0 mean with an unknown precision, thus indicating a prior preference for the null hypothesis. The prior specification can be adjusted to relax this preference as desired. We also note that in cases where the data is noisy and the resulting estimates in precision are small, the shift tends to increase. This effect is evident in Equation (2) which gives the rule for updating the model effects. The update mean is a sum of the prior mean and the mean estimated from the data, weighted by the prior precision and the model precision. With noisy data, the prior precision can tend to dominate, driving the estimate toward the prior mean (0 in this case) and thus underestimating the magnitude of the expression change. We find that with proper selection of prior parameters, the disadvantage of the null shift tends to be balanced by the improved accuracy in the expression change estimate. Adjustment of the prior specification can be used to control this balance.Embryonic development is an excellent model system for evaluating a continuum of protein expression dynamics as no extrinsic manipulations are required to affect change - it is a highly integrated melody of natural processes, which minimizes experimenter-related error. While early embryonic events proceed rapidly, the later phases of development are largely characterized by overt growth of organs and tissues that approximate their more mature counter parts Martinsen (2005). We chose to compare the chick heart cytosol proteome of HH stage 36 vs 39 embryos as this time difference coincides primarily with a 3-4 fold increase in muscle mass. There are also more subtle, but critical changes in the conduction system and valvular structure, with the potential for detecting tissue specific isoform expression that would allow for assessing the detection limits of the iTRAQ methodology. However, the results of the HH stage 36 vs. 39 comparison showed little difference in the heart cytosolic protein composition aside from constituents in the blood, possibly reflecting expansion of the coronary network.To facilitate further understanding of the performance of the software described here, we also compared estimates derived using log space averaging to the estimates provided by iQuantitator. In this experiment, two samples from each of two treatment groups were processed, ratios for each of the two control treatment pairs were computed for each reported spectrum with identification meeting the search criteria (see Methods). Each set of ratios was normalized to the median of the set. For each protein the log-space average of the normalized ratios for all spectra assigned to a given protein is computed providing a single log-ratio average for each identified protein. Figure We report here on the development and application of a new software tool, iQuantitator, designed to facilitate analysis and reporting of iTRAQ data. The tool's model-based approach, inference using the Bayesian framework, customized Gibbs Sampler, and R-based hypertext-linked report generator aid in the analysis of iTRAQ data for a variety of experimental designs.gj(i), c represents the log difference between protein i's treatment-dependent change in expression and that of associated peptide j(i). When a single peptide identifies a protein, the relative expression estimate is shared between gj(i), c and ri, c. When peptides within the sample provide consistent estimates of the associated protein, the protein-level estimate for proteins identified by a single peptide tend to follow the peptide estimate and the posterior estimate of gj(i), c tends toward 0. In cases where the peptide-level estimates of relative expression differ significantly from the associated protein-level estimates, as in our simulated cases involving protein modifications, the tendancy is for a more pronounced shift toward conservative estimates of relative expression. Difference in estimates for proteins identified by a single peptide and those identified by more than one peptide can be seen in Figure Experiments involving multiple iTRAQ runs present a number of challenges including limited coverage overlap across runs, proteins identified by single peptides, and proteins appearing in a single experiment. The statistical and computational approach employed here attempts to address many of these problems without requiring special handling. As noted above, the approach used here allows for information sharing across levels of a given model effect (termed a "batch"). For example, the treatment-dependent protein relative expression estimate is based on both the information specific to that protein and the variation in relative expression over all proteins. This sharing of information is evident in Equation (2), the update rule for model parameters. Within the model, the term High-throughput proteomics is a complicated process involving chemical modification, instrumentation, and information processing. An objective of this effort has been the development of an approach that links the biological parameters of interest (protein expression levels) to the observed quantities (reporter ion peak areas) through a model that represents the sources of variation in the experimental process. The development of a model-based inference approach eases the adaptation of the software to changing experimental designs and processes. iQuantitator employs statistically-motivated inference for parameters of a model derived from the experimental process. As such, the sources of variation accounted for in the model are evident and the exponentiated value of each parameter has a clear meaning. The model includes both protein and peptide-level treatment effect estimates allowing for the identification of proteins whose expression changes in a treatment-dependent manner as well as for peptides differentially expressed relative to the associated proteins. The model can be adapted to a variety of experimental designs, can accommodate more than one treatment group, is not restricted to a single reference channel, and can merge information across experiments.While a variety of web-based tools have been developed, we choose to consider presentation of results using an electronic document (e-Document) based on the Portable Document Format. Hypertext linking both within the document and to web resources provides many of the features of a web-based interface in a single file that can be easily distributed and viewed with a variety of document readers. The document structure chosen here allows the user to drill down from protein-level data with graphically depicted expression changes and associated uncertainty to the supporting peptide data with summaries across multiple iTRAQ experiments. The entire document is bookmarked and searchable using the capabilities of the user's PDF reader. We believe that many additional features could be included in the e-document report through the use of embedded scripting (Javascript) and forms. Additionally, the design of the package allows other reporting interfaces to be incorporated. The Sweave package used here can also generate HTML using a similar approach and existing interfaces between R and common database engines allow the possibility of pushing results directly to a data management system.Rapid advances in high-throughput proteomic technologies are requiring comparable advances in modeling, statistical methods, and visualization. iQuantitator's process-based modeling approach overcomes limitations in current methods and allows for application in a variety of experimental designs and meaningful integration of data across experiments. Additionally, inference in the Bayesian framework and an efficient Gibbs Sampler overcomes estimation problems noted by other researchers. iQuantitator is available from the authors as an installable R package.Project name: iQuantitatorOperating system(s): Platform independentProgramming language: R, COther requirements: The R software for statistical computing (version 2.6.2 or later), pdflatex (for hypertext-linked report generation)License: GNU GPLAny restrictions to use by non-academics: NoneAn installable R package including all source code [see Additional File The authors declare that they have no competing interests.JHS designed and implemented iQuantitator. ELK proposed requirements for the reports, provided biological samples, and interpreted the results. EGH designed the statistical model. KLS supervised all MS sample processing and recommended features for the report. SCW collected MS data. JHS, ELK, KLS, and SCW contributed to writing the manuscript and all authors read and approved the manuscript.Installable R package file for iQuantitator. This archive contains a single file that can be installed under the R statistical computing environment. Installation procedures and usage are described in Additional File Click here for fileiQuantitator-generated output from the analysis of the chicken heart data. This document provides an example of the iQuantitator output for the data collected from the comparison of stage 36 and stage 39 embryonic chicken hearts.Click here for fileiQuantitator Installation and Usage Manual. A step-by-step introduction to the installation and use of iQuantitator based upon the sample data and scripts provided here.Click here for fileMSMS summary data from the embryonic chicken heart comparison. A text file, exported from the MSMS summary report generated using the Applied Biosystems software that is the primary input for iQuantitator.Click here for fileR Script used to create Additional File Click here for fileExample-specific FASTA file. An archive containing a FASTA-formatted protein sequence file with a subset of the protein sequence database used by iQuantitator, sufficient to support the example provided here.Click here for file

Quantitative multi-elemental analysis by inductively coupled plasma (ICP) spectrometry depends on a complete digestion of solid samples. However, fast and thorough sample digestion is a challenging analytical task which constitutes a bottleneck in modern multi-elemental analysis. Additional obstacles may be that sample quantities are limited and elemental concentrations low. In such cases, digestion in small volumes with minimum dilution and contamination is required in order to obtain high accuracy data.We have developed a micro-scaled microwave digestion procedure and optimized it for accurate elemental profiling of plant materials (1-20 mg dry weight). A commercially available 64-position rotor with 5 ml disposable glass vials, originally designed for microwave-based parallel organic synthesis, was used as a platform for the digestion. The novel micro-scaled method was successfully validated by the use of various certified reference materials (CRM) with matrices rich in starch, lipid or protein. When the micro-scaled digestion procedure was applied on single rice grains or small batches of Arabidopsis seeds , the obtained elemental profiles closely matched those obtained by conventional analysis using digestion in large volume vessels. Accumulated elemental contents derived from separate analyses of rice grain fractions closely matched the total content obtained by analysis of the whole rice grain.e.g., breeding programmes aiming at improvement of the micronutrient density in edible plant parts. Compared to existing vial-in-vial systems, the new method developed here represents a significant methodological advancement in terms of higher capacity, reduced labour consumption, lower material costs, less contamination and, as a consequence, improved analytical accuracy following micro-scaled digestion of plant samples.A high-throughput micro-scaled method has been developed which enables digestion of small quantities of plant samples for subsequent elemental profiling by ICP-spectrometry. The method constitutes a valuable tool for screening of mutants and transformants. In addition, the method facilitates studies of the distribution of essential trace elements between and within plant organs which is relevant for, Fe and Zn, in vegetable food products is an important trait and large resources are devoted to improvement of the content and bio-availability of essential micro-nutrients in crops by bio-fortification [The concentration of essential plant nutrients must be maintained within certain concentration ranges in plant tissues. Analysis of the elemental composition is accordingly an important tool for diagnosis of nutritional disorders. Even before nutritional imbalances arise, changes in the elemental composition may constitute an important physiological indicator of plant responses to environmental parameters . Also wification -4.Development of new genotypes of crop plants with improved stress tolerance and nutritional quality requires information about the genes and molecular processes underlying elemental transport and homeostasis in plants. Mutants and transformants of the plant model species Arabidopsis constitute a valuable tool for this purpose . HoweverQuantitative elemental analysis by ICP-spectrometry requires a complete digestion of solid samples in order to degrade the matrix components and obtain a homogenous liquid phase. The digestion of samples is usually the most time consuming step, thus constituting a bottleneck for high-throughput analysis and screening of large sample sets. Furthermore, when the amount of sample is limited and/or the elements of interest are present in trace or ultra-trace concentration, one of the main analytical challenges is to perform a rapid and thorough digestion in small volumes with minimum dilution and contamination -9.3 and H2O2, most biological samples can be completely digested in closed vessels except if they have a high content of silicates. In such case, hydrogen fluoride must be added [3/H2O2 digestion may not always provide a full recovery of elements such as Fe, Al and Se. Consequently, certified reference materials with a matrix comparable to the sample should always be included in the sample sets analysed.Plant samples consist of an organic matrix that may cause analytical bias and block the sample introduction system if not fully decomposed. The most commonly used methods for destruction of organic matter are based on high-temperature-oxidation (dry ashing) or wet digestion in vessels using strong acids with or without the addition of oxidizing solvents. Wet digestion is usually carried out in a pressurised system using closed vessels heated in a microwave oven or autoclave -14. Systbe added -18. It iThe typical vessel volumes 50-120 ml) used in most conventional microwave rotors are too large for optimal digestion of small sample quantities . In addi ml used -18 g l-1) makes ICP-MS an ideal choice for analysis of digested plant samples. The use of micro-nebulization (<100 μl min-1) decreases the sample consumption so that the required volume of sample is reduced and simultaneous analysis of many elements made possible [Several analytical methods can be applied for elemental quantification of biological samples, including inductively coupled plasma-mass spectrometry (ICP-MS) and ICP-optical emission spectrometry (ICP-OES) ,25. The possible ,27. ICP-The objective of the present work was to develop a high-throughput digestion method for multi-elemental analysis of plant samples available in small quantities. A commercially available 64-position rotor accommodating disposable glass vials, originally designed for microwave-based parallel organic synthesis was usedThe micro-scaled digestion method was validated using certified reference materials of durum wheat flour, apple leaves and bovine muscle, representing matrices differing in starch, lipids and protein contents. An accuracy better than 90% of the true value was achieved for the essential plant nutrients Cu, Fe, K, Mg, Mo, Mn, P, S and Zn, as well as for the elements Cd, Se and Al. Further validation of the developed micro-scaled digestion method was obtained by analysis of single rice seeds and their sub-fractions . Finally, it was shown that the elemental composition of small batches of Arabidopsis seeds could be accurately determined.viz. apple leaf (CRM 1515), durum wheat flour (CRM 8436), and bovine muscle (CRM 8414). Beside differences in matrix composition, the three reference materials varied in elemental composition, spanning several decades of concentrations.The efficiency of the developed micro-digestion procedure was evaluated for three very different certified reference materials, In apple leaves, very good agreement with the certified values was obtained for K, Ca, Mg, P, Al, Mn, Zn and Cu down to the lowest sample quantity of 1 mg . Following micro-scaled digestion of 1 mg, there was a tendency to underestimate the concentration of several elements, but the difference was always <15% Fig. .Single, unpolished rice grains of three genotypes, on average weighing 21.6 ± 0.3 mg, were micro-scale digested without prior milling and analysed for their composition of essential macro- and micro-nutrients. The single grain analysis of Mg, P, S and K was accurate when compared to the corresponding results from macro-scaled analysis of finely pulverized grains of the same cultivars an outer layer , constituting about 13% of total seed weight, (ii) the endosperm (~84% of seed weight) and (iii) the embryo, accounting for only ~2% of the seed weight. The individual fractions were subsequently analysed for Zn, Fe, P and S, which are all essential elements in human nutrition. The first two of these elements are particularly important due to their low bioavailability, causing human malnutrition on a global scale. The latter two elements are major constituents of phytic acid and proteins, respectively, potentially involved in Fe and Zn binding in the rice grain.Rice grains of the same three cultivars as used for the single grain analysis were fractionated into , Problems with overestimation of the S concentration also appeared in the micro-scaled digestion of 1 mg Arabidopsis seeds was shown to satisfactorily match that obtained by analysis of whole rice grains Fig. . The goondosperm . The thrThe micro-scaled digestion method made it possible to analyse single rice grain as evidenced by the good match between single seed concentrations and those obtained by analysis of a large batch of milled rice grain Fig. . The eleA micro-scaled method was developed which enables digestion of small quantities of plant samples for subsequent elemental profiling by ICP spectrometry. The method is based on a commercially available 64-position microwave rotor accommodating closed glass vials which are capable of withstanding sufficiently high temperatures and pressures to ensure digestion of even fairly recalcitrant plant tissues. The advantages of the new method compared to existing vial-in-vial methods are:• The glass vials fit commercially available multi-position microwave rotors and standard ICP auto samplers, thereby enabling direct measurements without time consuming liquid transfer between vessels and without the accompanying risks of contamination.• The glass vials allow fast and direct microwave heating and temperature control by IR sensors present in state-of-the-art microwave ovens, ensuring correct temperature readings and uniform thermodynamic conditions during the digestion. In contrast, the vial-in-vial procedure uses thermal convection, very often with water as ballast between the microwave bomb/liner and the vial to increase the thermal conductivity. This increases the heat capacity significantly and prolongs the time needed to heat the digestion units.• Due to the low heat capacity of the vials they can be rapidly cooled which prevents loss of volatile elements before uncapping and facilitates a faster handling time.• The glass vials are closed with polytetrafluoroethylene (PTFE) lip-seals in polyetheretherketone (PEEK) screw caps ensuring a thermo stabile and sealed digestion unit at elevated temperatures. In contrast, the PTFE screw threads used in most vial-in-vial systems are less stable.• The design of the lip seals prevents explosions because they are only able to withstand a certain pressure.• The current procedure allows a more cost- and labour-effective sample digestion because the glass vials are cheap and disposable. This eliminates time-consuming acid-based cleaning procedures between analytical runs and allows many samples to be prepared in advance.The new method constitutes a valuable tool for high-throughput screening of e.g. mutants, transformants and breeding lines. In addition, the method facilitates studies of the distribution of essential trace elements between and within plant tissue fractions, which is highly relevant in relation to breeding programmes aiming at improved micro-nutrient density in edible plant parts.The following certified reference materials (CRMs) were used: NIST 8436 , NIST 1515 and NIST 8414 . All of these were purchased from US Department of Commerce, National Institute of Standards and Technology, Gaithersburgh, MD, USA.Oryza sativa L. cvs TSN1, Hom Nang Nouan and Kai Noi Leung) was supplied by the International Rice Research Institute (IRRI) as part of the Lao-IRRI Rice Research and Training Project and the EU-FP6 project META-PHOR . The two last genotypes represent traditional Laotian varieties and the first a high yielding variety. Seeds of Arabidopsis were wild type (Col 0). Before analysis, rice grains and Arabidopsis seeds were rapidly rinsed 3 times in Milli-Q water and subsequently freeze dried at 0.5 mbar for 24 h .Brown rice grain (The rice grains were sectioned into three main tissue fractions: (1) The bran layers , (2) the embryo (including the scutellum) and (3) the endosperm. First, the embryo was gently loosened and removed by use of the tip of a scalpel. To separate the bran and the endosperm, a polishing process was performed by high speed shaking in a ball mill (Retsch MM301). The mill was operated at 30 Hz for 120 s and mounted with a rack containing micro-centrifuge tubes with 200 mg of acid washed quartz sand and 4 rice grains. The mixture of sand and abraded material from the grain was collected as bran layers. The remains of the grain (endosperm) were washed three times with milli-Q water to remove surface dust and dried.® 15 × 46 mm, Cap 13-425). A mixture of 125 μL 30% H2O2 and 250 μL 65% HNO3 was added to each vial containing ≤ 5 mg material, while the double volume of reagents was used for the higher sample quantities. To ensure tightness and stability at elevated temperatures, the vials were closed with special PEEK screw caps and disposable PFTE lip-type seals and analysed directly in the vial.Using a high-accuracy balance (Mettler Toledo MT5), between 1 and 20 mg of the three certified reference materials were weighed and transferred to digestion tubes consisting of disposable standard glass vials were analysed by ICP-OES equipped with a Meinhard nebulizer and a cyclonic spray chamber. The RF Power was 1400 W and nebulizer and auxiliary flows 0.65 and 0.2 l min-1. Sample flow was set at 1.5 ml min-1. ICP-OES data was processed using Winlab 32 .Multi-elemental analysis of samples weighing ≤ 5 mg was performed using ICP-MS equipped with a PFA micro-flow nebulizer. ICP-MS chromatographic data were processed using Plasma Chromatographic Software v. B-03-07 . The ICP-MS was tuned in standard mode (no reaction/collision gas used) to achieve a sensitivity higher than 18000, 36000 and 18000 cps ppbThe authors declare that they have no competing interests.THH, KHL, DPP and PP carried out the experimental work. SHU and JKS conceived the study and devised the experimental design. THH, SHU and JKS wrote the manuscript. All authors read and approved the final manuscript.

Lack of knowledge and skills, and negative attitudes towards patients with disabilities, may adversely affect the services available to this group and negatively affect their health outcomes. The objective of this paper is to describe the development and initial implementation of a curriculum for teaching medical students to care for patients with disabilities.We followed the six-step approach for developing curricula for medical education: general needs assessment, specific needs assessment, defining goals and objectives, determining the educational strategies, planning the implementation, and developing an evaluation plan.The curriculum has well defined goals and objectives covering knowledge, attitudes and skills. It employs both traditional and non-traditional teaching strategies. The implementation is planned over the four-year medical school curriculum in collaboration with a number of academic departments and specialized community-based agencies. The curriculum evaluation includes an attitudinal survey which is administered using a controlled design (pre- and post- exposure to the curriculum). The initial implementation of the curriculum has been very successful.We have developed a longitudinal curriculum to teach medical students to care for people with disabilities. A rigorous evaluation of the impact of the curriculum is needed. The Americans with Disabilities Act of 1990 defines "disability" as physical or mental impairment that substantially limits one or more of the major life activities of the individual. It is eThe Surgeon General acknowledged in his 2005 "Call to Action" on the 15th anniversary of the Americans with Disabilities Act that, for too long, we provided lesser care to people with disabilities. Indeed,According to a recent report of the Institute of Medicine titled "Future of Disability in America," barriers to receiving health care are not only physical , but they are also and perhaps more importantly related to the knowledge and attitudes of health care providers. In factHealth care providers appear to lack the necessary education and training to care for patients with disabilities. Medical students are often uncomfortable interacting with patients with disabilities,16. A suThere is evidence that certain educational interventions such as early and frequent encounters with people with disabilities improve medical students' knowledge, attitudes and skills necessary for caring for these people,17,20,21We followed the six-step approach for developing curricula for medical education designed by Kern, Thomas, Howard and Bass: (1) problem identification and general needs assessment; (2) needs assessment of targeted learners; (3) goals and objectives; (4) educational strategies; (5) implementation; and (6) evaluation and feedback.First, we conducted a general needs assessment through a review of the published literature and reports by national and international agencies on the need for improving both care and teaching relating to disabilities.Second, we conducted a specific needs assessment with medical students and medical educators at the State University of New York (SUNY) at Buffalo. The needs assessment consisted of formal and informal discussions with third-year medical students during their Family Medicine clerkship rotation and with Family Medicine residents. We also held formal discussions with the directors of the introduction to clinical medicine course , with directors of clerkships and with the residency program directors of Family Medicine, Internal Medicine, Pediatrics, and Physical Medicine and Rehabilitation. The discussions addressed the faculty's perceived need for, and willingness to integrate, our proposed curriculum into their rotations and/or courses.http://www.people-inc.org, Aspire of Western New York http://www.aspirewny.org, and the Western New York Independent Living Project, Inc. http://wnyilp.org). We subsequently held formal meetings and discussions with the agencies' administrators, physicians, nurses, social workers and staff. We also held similar discussions with people with disabilities and family members of people with disabilities.We also conducted a specific needs assessment with community-level stakeholders. We thus established contact with the three major community-based agencies specializing in health and social services for people with disabilities building the required knowledge, (2) instilling the appropriate attitudes, and (3) fostering the needed skills to care for people with disabilities. Table buildingThe educational strategies include both traditional teaching strategies such as didactic sessions and less traditional strategies such as encounters with families of patients with disabilities:School-based education: consists of didactic teaching and encounters with standardized patients with disabilities.• Community-based experiences: include encounters with patients with disabilities, meetings with families of patients with disabilities, presentations by patient advocates, and visits to the specialized community agencies serving people with disabilities.• Clinical experiences: consist of precepted clinical experiences in local clinics which provide primary care and integrated services for patients with disabilities.• Research experiences: consist of mentored research opportunities relating to people with disabilities. One particular area of interest is the provision of community-based primary care services for people with disabilities.• Table • First year: a lecture presentation about the history of disabilities and society followed by small seminar group encounters with patients with disabilities and their families are integrated in the Introduction to Clinical Medicine course. The topic of discussion in the small seminar groups is "things that have been helpful and hurtful in our interactions with the health care system." Students also have presentations by patient advocates. Students may also participate in a Family Medicine summer research internship focusing on topics related to provision of health care for people with disabilities.• Second year: a lecture presentation on clinical skills for interviewing and examining patients with disabilities is integrated in the second-year Introduction to Clinical Medicine course. Following the presentation, the students participate in an objective standardized clinical encounter (OSCE) in which selected people with disabilities are trained as standardized patients. Both the lecture and the OSCE activity are developed with the Department of Physical Medicine and Rehabilitation.• Third year: curriculum activities are integrated within the Family Medicine and Internal Medicine Clerkship rotations. During the Family Medicine rotation, the students participate in a half-day seminar on the social context of caring for patients with disabilities. Topics include models for addressing disability in society, economic and social organization of care for people with disability, and issues of consent and guardianship. This seminar is in cooperation with a local organization which provides social and medical services for people with disabilities. During this rotation, students spend one day in a precepted clinical experience in a facility which provides primary care for patients with disabilities. During the Internal Medicine rotation, students experience a didactic presentation on common medical concerns of patients with disabilities.• Fourth year: students may choose to participate in a four-week elective in primary care for patients with disabilities. This elective includes a variety of experiences including clinical encounters with patients, meetings with their families, meetings with patient advocates, and participation in the activities of specialized community-based agencies. Students may also enroll in a four-week mentored research elective.Our curriculum evaluation includes an attitudinal survey which is administered using a controlled design (pre- and post- exposure to the curriculum). The intervention group is a class of medical students at our university while the control group is a class of medical students at another medical school in our state. We administered the attitudinal survey to both groups before the start of the curriculum, and we will administer it a second time after the completion of the curriculum. We have developed this attitudinal survey instrument for specifically measuring attitudes about people with disabilities. The development process started with an extensive review of the literature to identify existing instruments. We then adapted these instruments guided by input from local professionals with expertise in disabilities. The tool is currently being validated.In addition to the attitudinal survey, we are assessing individual elements of the curriculum. We are asking students to complete a reflective piece following the small seminar group encounters with patients with disabilities and their families and following their third-year precepted clinical experience. The following are excerpts from the reflective pieces completed by students following the small seminar group encounters with patients with disabilities and their families:• "Interaction of students with real life patients early on in their medical education helps eliminate many stereotypes and prejudices...This will benefit students when they come across patients in their medical career."• "We met a young woman with cerebral palsy...I felt myself quiet down with my questions. I didn't want to offend her by questioning her abilities...we relaxed and I was able to address her directly...this provided a valid time for introspection on our own beliefs of how we react to a particular situation."• "...don't assume anything about people with disabilities when you initially meet them."• "I was particularly struck by Dr. X., the physician who sustained a traumatic brain injury as a medical student...when he entered our room, I immediately jumped to certain conclusions...what a perfect example of the ease with which we make assumptions unless we train ourselves not to."• "This was the first step in opening our eyes to the necessity of being able to fully understand what it means to care for those that may have an impaired ability to care for oneself."• "Getting the opportunity to talk to a disabled patient and hear her voice her concerns regarding how doctors treat her made me realize how important it is to treat them the same as you would treat any other patient."We also use the OSCE in our evaluation process. Students participating in the research electives receive summative and formative feedback from their research mentors. Students participating in the fourth-year elective receive multi-source ("360-degree") evaluation by their clinical preceptors, the support staff, their peers, and patients.We have developed a longitudinal curriculum to teach medical students to care for people with disabilities using the six-step approach of Kern, Thomas, Howard and Bass for curriculum development. The curOur curriculum received federal funding from the U.S. Department of Health and Human Services, Health Resources and Services Administration in June 2008 and is currently being implemented. Although the current first-year class will be the only class to experience the entire curriculum, we have been implementing elements of this curriculum with the current third-year class as well. Students currently in the second year of medical school will experience the activities in their third and fourth years. The second-year OSCE activity is still in its planning stages, which is why the second-year class has not participated in this activity.Introducing new material into the medical school curriculum needs to be done with sensitivity to the perception that a new "special interest" will supplant existing elements, and excessively burden those responsible for delivering the existing curriculum. For that purpose we have secured a "buy-in" during the needs-assessment portion of the project. In the implementation phase, we are taking care not to overburden any one course or rotation with too many activities related to our curriculum. Faculty members have been very receptive and cooperative in incorporating elements of the curriculum.Students in the first-year clinical skills course participated in the lecture presentation about the history of disabilities and society followed by small seminar group encounters with patients with disabilities and their families. The session was very informative and personal, providing an opportunity for the students to meet real-life patients with real-life struggles. As a result of the session, the students were able to examine and reflect on their own attitudes about disability. In the third year, students participating in the Internal Medicine Clerkship have been participating in the one-hour presentation on common medical concerns of patients with disabilities.Students in the Family Medicine Clerkship have been attending a half-day seminar on the social context of caring for patients with disabilities and have been spending one day in a precepted clinical experience in a facility which provides primary care for patients with disabilities. Student reflections on their experiences have been informative. While students noted many similarities with their other clinical experiences, they also noted a number of unique aspects. For example, in relation to the specialized community-based facility, students commented that: the facility was more comprehensive and better run than other clinics; every patient had an accompanying advocate who used detailed records for the patient, making the physician's history taking easier; physical examinations were tailored to meet the individual needs; and more time was allotted for each patient. Most students indicated they would likely treat patients with disabilities in the future, having spent time in this clinic. One student stated, "before this experience, I had reservations about disabled patients, but I am now more comfortable with working with them in the future."We believe that the major strength of this curriculum is the introduction of students to caring for patients with disabilities early in their career. By integrating the elements of the curriculum into other primary care-oriented courses and clerkships, students perceive caring for patients with disabilities as a natural part of patient care in general. Also, we feel that the lessons and experience gained in caring for patients with a particular disability will be transferable not only to patients with various disabilities, but also to fostering professionalism in the compassionate, competent care of all patients.A highly gratifying part of developing and implementing the curriculum has been the partnerships fostered with the specialized community-based agencies caring for patients with disabilities, People Inc. and Aspire of Western New York. There is a great mutual appreciation in that we have given them access to medical students so as to instill in these young physicians the knowledge, attitudes, and skills necessary to care for their patients who have disabilities. In turn, we have appreciated their expertise and their contribution to the development and implementation of the curriculum.The challenges involved in this curriculum are mostly related to its implementation in the field. Full implementation involves coordinating clinical experiences in the community, as well as training people from the community to come in and work with the students. Each of the agencies and groups with whom we interact has its own agenda and its own logistical and financial constraints. Clarifying these agendas and working within these constraints is essential for successful implementation of the program.We hope that the longitudinal curriculum to teach medical students to care for people with disabilities will inspire other educational institutions to implement similar educational initiatives. We are willing to make elements of our curriculum available to the community of medical educators working in this area. We also aim to advance the field by developing and validating outcome measurement tools and subsequently conducting experimental work to evaluate the real impact of our curriculum.The authors declare that they have no competing interests.ABS: substantial contributions to research design, the acquisition, analysis and interpretation of data; drafting the paper; approval of the submitted and final versions. DM: substantial contributions to the interpretation of data; revising the paper critically; approval of the submitted and final versions. EAA: study design, data analysis and interpretation, revising the paper critically; approval of the submitted and final versions.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1472-6920/9/78/prepub

Various perinatal factors, including birth weight, birth order, maternal age, gestational age, twin status, and parental smoking, have been postulated to affect breast cancer risk in daughters by altering the hormonal environment of the developing fetal mammary glands. Despite ample biologic plausibility, epidemiologic studies to date have yielded conflicting results. We investigated the associations between perinatal factors and subsequent breast cancer risk through meta-analyses.We reviewed breast cancer studies published from January 1966 to February 2007 that included data on birth weight, birth order, maternal age, gestational age, twin status, and maternal or paternal smoking. Meta-analyses using random effect models were employed to summarize the results.We found that heavier birth weights were associated with increased breast cancer risk, with studies involving five categories of birth weight identifying odds ratios (ORs) of 1.24 for 4,000 g or more and 1.15 (95% CI 1.04 to 1.26) for 3,500 g to 3,999 g, relative to a birth weight of 2,500 to 2,599 g. These studies provided no support for a J-shaped relationship of birthweight to risk. Support for an association with birthweight was also derived from studies based on three birth weight categories and two birth weight categories . Women born to older mothers and twins were also at some increased risk, but the results were heterogeneous across studies and publication years. Birth order, prematurity, and maternal smoking were unrelated to breast cancer risk.in utero exposures reflective of higher endogenous hormone levels could affect risk for development of breast cancer in adulthood.Our findings provide some support for the hypothesis that Intrauterine environmental exposures to endogenous or exogenous hormones, notably estrogens, may influence the subsequent development of breast cancer in offspring . During Here we review the epidemiologic studies that have assessed the association between perinatal factors and breast cancer risk in daughters. A meta-analytical approach was applied in order to clarify further the possible role played by the intrauterine environment in the etiology of breast cancer.The data retrieved for the systematic review were based on searches of all published papers, letters, abstracts, and review articles on birth weight, birth order, maternal age, gestational age, twin status, and maternal or paternal smoking and breast cancer using the MEDLINE database from January 1966 through February 2007. We used keywords combining text words, with terms for six perinatal factors combined with terms for breast cancer ; three categories ; and two categories . Birth order was examined using two different categorical schemes: 1 (referent) versus ≥2; and 1 (referent), 2 to 4, and ≥5. Maternal age was classified into three categories: <25 years old (referent), 25 to 29 years old, and ≥30 years old. Gestational age was also analyzed in two ways: ≤36 weeks versus ≥37 weeks (referent); and ≤32 weeks versus ≥33 weeks (referent). To examine twin status, three classification schemes were employed: twin versus singleton (referent); monozygotic twin (or sister twins if zygosity was not reported) versus singleton (referent); and dizygotic twin (or sister-brother twins if zygosity was not reported) versus singleton (referent). Maternal or paternal smoking was considered as follows: no smoking during pregnancy (referent) versus smoking during pregnancy. If the criteria utilized in an article were slightly different from our criteria, then we included the data and described the difference in a footnote.ORs and 95% confidence intervals (CIs) were recalculated from published frequency tables of individual studies using the Mantel-Haenszel common OR estimate. However, the reported OR (95% CI) was used when the published studies did not provide further details as to the frequencies of the exposure variables. If the manuscript reported the results after performing a stratified analysis, then we re-calculated the crude OR by combining across strata. A random-effects model was used to obtain summary ORs and 95% CIs.Heterogeneity was assessed by heterogeneity test using Cochran Q statistics . PublicaWhen significant heterogeneity or publication bias was found, we performed subgroup analyses by study design (case-control study versus cohort study), and the source of information (data linkage versus self-report) to assess the impact on between-study variations (heterogeneity). Many of the large-scale studies, especially cohort studies, were published after 2000; thus, we classified publication years into before 2000 versus 2000 or later in order to assess publication biases associated with small study sizes. Few studies focused on either Asians or African-Americans, and so it was not possible to examine ethnicity effects. All statistical analyses were conducted using STATA .We identified 34 studies that assessed the association between birth weight and breast cancer risk Table : 19 caseP_Q test > 0.05 for all categories). In the five-category meta-analysis, ORs were 1.11 (95% CI 0.90 to 1.33) for birth weight <2,500 g, 1.11 (0.99 to 1.25) for 3,000 to 3,499 g, 1.15 (1.04 to 1.26) for 3,500 to 3,999 g, and 1.24 (1.04 to 1.48) for ≥4,000 g relative to the referent category of 2,500 to 2,999 g. In the three-category meta-analysis, ORs were 1.06 (95% CI 0.98 to 1.14) for 3,000 to 3,999 g and 1.15 (1.01 to 1.31) for ≥4,000 g relative to the referent category of <3,000 g. In the two-category meta-analysis, ORs were 1.09 (95% CI 1.02 to 1.18) for the category of >3,000 g relative to the referent category of ≤3,000 g .Among 34 studies of birth weight and breast cancer, we selected studies that employed the same categories of birth weight. To evaluate whether a J-shaped relationship existed, we grouped birth weight into more than three categories. The findings of meta-analysis of eight studies that utilized five categories of birth weight and 11 studies that used three categories are shown in Figures P value by the mean difference of birth order ). There was no difference in risk for women of birth orders 2 to 4 (OR 0.97 [95% CI 0.91–1.03]).For the meta-analysis, we included 14 studies (13 case-control studies and one cohort) that used two birth order categories: 1 (referent) and ≥2. There was significant heterogeneity across all studies (We identified 28 studies (22 case-control and six cohort) that assessed the association between maternal age and breast cancer risk Table . Seven sP_Q test < 0.01 for 25 to 29 years and for ≥30 years). Heterogeneity was also present across case-control studies and studies published after 2000 (P_Q test < 0.01). The ORs (95% CI) were 1.18 (1.05 to 1.11) for 25 to 29 years and 1.23 (1.07 to 1.15) for ≥30 years across all studies.In our meta-analyses, we included the 18 studies that reported categorical data and examined three age categories that assessed the association between prematurity and breast cancer risk (Table P-Q test = 0.55), whereas we found no association between prematurity (≤36 weeks) and risk , and the association was not significant (OR 1.20 [95% CI 0.74 to 1.95]).There was no significant heterogeneity across studies (turity ≤3 weeks anWe examined 13 studies (eight case-control and five cohort) that assessed the association between twin status and risk Table . Most stP-Q test = 0.13), and the meta-analysis of 13 studies examining twin status (without regard to zygosity) found an OR of 1.22 (95% CI 1.01 to 1.11). There was no evidence of any publication bias (P-Egger test or P-Begg test >0.1). There were little evidence of heterogeneity (P-Q test > 0.1 for monozygotic or dizygotic twins), and breast cancer risk was not significantly increased among either monozygotic (OR 0.95 [95% CI 0.85 to 1.07]) or dizygotic (OR 1.17 [95% CI 0.99 to 1.37]) twins, albeit based on limited statistical power. In subgroup analysis by study design, cohort studies identified significantly increased risk (OR 1.23 [95% CI 1.00 to 1.11]) for breast cancer in twins versus singletons, with no study heterogeneity (P-Q test = 0.07). Case-control studies showed no association with twin status (OR 1.39 [95% CI 0.91 to 1.12]). There was no evidence of any publication bias (P-Egger test or P-Begg test > 0.05) among the case-control or cohort studies. In subgroup analysis by study design and zygosity, there were no heterogeneity in studies (P-Q test > 0.1). In subgroup analysis by study year, significant heterogeneity by publication year was identified (P = 0.01), and the OR (95% CI) for studies published before 2000 was 1.06 (0.97 to 1.47), whereas the OR (95% CI) for studies published in 2000 or later was 1.27 (1.03 to 1.58).The Q test for heterogeneity was not significant . The meta-analysis for maternal smoking . Twin status was associated with 1.2-fold higher risk for breast cancer relative to a singleton birth. Although we found some evidence of increased risk associated with older maternal age , there were heterogeneous findings across study designs.Most studies identified an increased risk for breast cancer with heavier birth weight, with the association being particularly strong for premenopausal or early-onset breast cancers ,22,29,30Although some studies identified a J-shaped relationship between birth weight and breast cancer risk ,35,37,45in utero exposuresto factors such as insulin-like growth factor-I or estrogens [Although the mechanisms underlying the association between high birth weight and breast cancer risk remain unclear, it has been suggested that heavier birth weights may result from increased strogens -76. Thesstrogens ,77. Howestrogens ,79. One strogens . FurtherOur analysis found no association of breast cancer risk with birth orders between 2 and 4, but we did note a somewhat reduced risk associated with higher birth orders (at least 5), although the results were heterogeneous across studies. Biologically, pregnancy estrogen levels appear to be higher during first pregnancies and decline in successive pregnancies . FurtherIn our meta-analysis, we found some evidence that having been born to an older mother was associated with higher breast cancer risk, although the results were heterogeneous across studies. Our data failed to support the previous studies that suggested a J-shaped relationship between maternal age and breast cancer risk. It was previously suggested that older maternal age may have an adverse effect on the primordial mammary gland of their daughters because of altered hormonal profiles or may lWe observed no association between prematurity and breast cancer risk. Biologically, women having abruptio placentae or an extremely premature birth (<32 week) have been shown to have elevated levels of human chorionic gonadotropin and α-fetoprotein, which could inhibit the differentiation of stem cells in human breast tissue cells . GestatiTwin pregnancies are associated with an approximate doubling of estrogen levels compared with singleton pregnancies ,87. DizyStudies of parental smoking, especially maternal smoking, and daughter's breast cancer risk have yielded inconsistent results. Biologically, maternal smoking, rather than paternal smoking, has a greater impact on the fetus. In the meta-analytic results, both factors failed to exhibit a significant association with risk. Some studies have reported that maternal smoking in pregnancy reduces serum estrogen levels ,92. A reThese meta-analyses are based on results from studies involving heterogeneous designs and methodology. We did note between-study heterogeneity for the associations of birth order, maternal age, and twin status. To resolve the heterogeneous findings, we considered the influence of study design and the date of study publication on the results by subgroup analyses. However, heterogeneity in studies could only be explained partially.Effects of maternal age, birth order, prematurity , and maternal smoking were found to be heterogeneous across study designs, but birth weight and twinning were comparable. Self-reported measures of perinatal factors may be vulnerable to misclassification biases, with differential or nondifferential effects ,95. BecaOur findings may be somewhat inflated because of our dependence on crude rather than adjusted ORs or RRs. A possible misclassification bias for zygosity might have resulted in studies that used sex as a proxy for zygosity . Becausein utero, thereby increasing the subsequent risk of breast cancer. Findings of an increase in breast cancer risk among daughters exposed to diethylstilbestrol in utero supports this hypothesis [in utero may be involved in the subsequent development of breast cancer, further biologic data are needed to elucidate the relationship fully.It has been hypothesized that certain perinatal factors, including birth weight and order, twin pregnancies, prematurity, maternal age, and smoking, may reflect higher estrogenic environments pothesis ,98. Althpothesis -74 throupothesis ,99,100. CI = confidence interval; OR = odds ratio; RR = relative risk.The authors declare that they have no competing interests.SKP collected and selected the all of breast cancer studies, analyzed the data in the study, drafted the manuscript, critically revised the manuscript for important intellectual content, and takes responsibility for the study concept and design, the integrity of the data, and the accuracy of the data analysis. DK participated in design of the study, drafting of the manuscript and interpretation of results, and critically revised the manuscript for important intellectual content. KAM was responsible for the study concept and design, interpreted the findings, and revised the manuscript for important intellectual content. MGC participated in the interpretation of the data and revision of the manuscript. YK was involved in data analysis and revision for important intellectual content. KYY contributed to interpreting the findings and critically revised the manuscript for important intellectual content. LAB led conception and design of the study, the analysis and interpretation of the findings, and revision to the manuscript, and obtained part funding for this research. All authors read and approved the final manuscript.

Tumor-stroma reaction is associated with activation of fibroblasts. Nemosis is a novel type of fibroblast activation. It leads to an increased production of growth factors and proinflammatory and proteolytic proteins, while at the same time cytoskeletal proteins are degraded. Here we used paired normal skin fibroblasts and cancer-associated fibroblasts (CAF) and primary and recurrent oral squamous cell carcinoma (SCC) cells to study the nemosis response.Fibroblast nemosis was analyzed by protein and gene expression and the paracrine regulation with colony formation assay. One of the normal fibroblast strains, FB-43, upregulated COX-2 in nemosis, but FB-74 cells did not. In contrast, CAF-74 spheroids expressed COX-2 but CAF-43 cells did not. Alpha-SMA protein was expressed in both CAF strains and in FB-74 cells, but not in FB-43 fibroblasts. Its mRNA levels were downregulated in nemosis, but the CAFs started to regain the expression. FSP1 mRNA was downregulated in normal fibroblasts and CAF-74 cells, but not in CAF-43 fibroblasts. Serine protease FAP was upregulated in all fibroblasts, more so in nemotic CAFs. VEGF, HGF/SF and FGF7 mRNA levels were upregulated to variable degree in nemosis. CAFs increased the colony formation of primary tumor cell lines UT-SCC-43A and UT-SCC-74A, but normal fibroblasts inhibited the anchorage-independent growth of recurrent UT-SCC-43B and UT-SCC-74B cells.Nemosis response, as observed by COX-2 and growth factor induction, and expression of CAF markers α-SMA, FSP1 and FAP, varies between fibroblast populations. The expression of CAF markers differs between normal fibroblasts and CAFs in nemosis. These results emphasize the heterogeneity of fibroblasts and the evolving tumor-promoting properties of CAFs. Tumor microenvironment plays a major role in cancer progression and fibroblasts are known to be key components of the tumor stroma. Recently it has been suggested that stromal fibroblasts initially inhibit early stages of carcinogenesis and later under the paracrine influence of the transformed epithelia become activated leading to promotion of cancer growth. The dependence of carcinomas on stromal fibroblasts decreases as the cancer progresses, partly through a switch in epithelial cells from paracrine to autocrine regulation Nemosis, a phenomenon of fibroblast activation is the sixth most common malignancy worldwide and the overall patient survival is poor. This is mainly due to high rates of cancer recurrence and local invasion, partly caused by p53 gene mutations, which can be found in more than 70% of HNSCCs Based on the previous results that under the influence of malignant cells normal nemotic fibroblasts start to resemble CAFs, the objective of this work was to study the nemosis response of autologous skin and cancer-associated fibroblasts, to compare the expression of CAF markers between these fibroblasts strains and their fate in nemosis and to investigate how these different fibroblast populations influence the patient-matched oral SCC cells. Our study shows that both normal and cancer-associated fibroblasts show variation between individuals, seen as varying basal CAF expression levels and different growth factor responses in nemosis, and have a differential impact on the SCC cells. The behaviour of the studied CAF markers in nemosis followed the general nemosis response: cytoskeletal α-SMA and FSP1 were downregulated and proteolytic FAP was upregulated. The only exception was one of the CAF strains that upregulated FSP1 in nemosis. Major systematic differences between normal and cancer-associated fibroblasts were the decreased basal levels of growth factors in CAFs and the capability of nemotic CAFs to start to regain the α-SMA expression and the increased FAP expression in nemosis compared to their normal counterparts.First we wanted to investigate the expression of the previously used nemosis marker COX-2 in the four fibroblast populations. There was no basal expression of COX-2 in any of the fibroblast strains, and it was not induced in monolayer culture. However, when cultured as spheroids the normal fibroblasts FB-43 started to express COX-2 after 48 hours , but thiin vitro are considered to be in a state resembling wound healing. Both CAF strains expressed α-SMA, CAF-74 slightly more than CAF-43. Interestingly, also the normal FB-74 cells expressed α-SMA, but no protein expression was detected in the other normal fibroblast cell strain FB-43. Time-dependent downregulation of α-SMA was seen in spheroids but not in the monolayer cultures, caused by the degradation of cytoskeleton in these fibroblasts going through nemosis. This is in line with previous results by Bizik et al. We also looked at the protein levels of vimentin and α-SMA in these cells. All four fibroblast populations expressed vimentin in equal amounts, as expected, since fibroblasts Since the protein levels of α-SMA varied between different fibroblast populations, we decided to investigate also the expression of other widely used CAF markers FSP1 and FAP. Gene expression pattern of these three genes in the fibroblasts grown as spheroids for 0, 24, 48 and 72 hours was analyzed using quantitative real-time PCR. Q-PCR was chosen as the method over immunoblotting because of its higher sensitivity. GAPDH was used as a reference gene that the expression of target genes was normalized to, after which relative fold expression ratios were calculated. The basal expression level of α-SMA, FSP1 and FAP was significantly lower (P<0.01) in CAF-43 cells than in normal FB-43 fibroblasts . HoweverNemosis response of the CAF markers between these fibroblast populations showed also variation. The α-SMA level was drastically downregulated in spheroids, reflecting the protein levels and indicating the decomposition of cytoskeleton in these spheroids. This was also true for FB-43 cells, for which we could not detect protein expression. Differing from the normal fibroblasts, the CAFs started to regain the α-SMA expression at 72 hours; when compared to normal fibroblasts the increase was statistically significant (P<0.05) . FSP1 mRThe other hallmark of nemosis is the increased production of several growth factors, including VEGF, HGF/SF and FGF7 (KGF). Therefore we used Q-PCR to study the expression levels of these genes in the four fibroblast populations. Both CAF strains had lower basal expression levels of VEGF, HGF/SF (P<0.05) and FGF7 (P<0.01) mRNA compared to the paired normal fibroblasts . When grAnchorage-independent growth of UT-SCC carcinoma cell lines was tested using the soft-agarose assay. During the three-week observation period all four carcinoma cell lines formed colonies, but clear difference between primary and recurrent tumor cell lines was seen . When cuThe UT-SCC colony formation results were in line between cells obtained from the two individuals; however, there was variation between individuals when observing closely the underlying monolayer fibroblast cultures. Spontaneous spheroid formation was seen in the underlying monolayer culture of FB-43 and CAF-43 fibroblasts when co-cultured with both 43A and 43B SCC cells . FB-74 aTo elucidate the reason for the different behavior of the fibroblast strains on monolayer cultures, and particularly the slow growth rate of CAF-74 cells, we performed senescence-associated beta-galactosidase staining. SA-β-gal activity is the most commonly used marker for cellular senescence. Premature stress-induced senescence is caused by oxidative stress, DNA damage and oncogene activation Primary carcinomas are considered to be unorganized organs that are composed of various cell types, including cancer cells, fibroblasts and other mesenchymal cells, and cells related to immunity and vasculature. The tumor-stroma microenvironment leads to fibroblast activation and paracrine signaling between fibroblasts and cancer cells The objective of this work was to investigate the nemosis response of patient-matched normal and cancer-associated fibroblasts, and to study the expression pattern of CAF markers and their behaviour in nemosis. Only one of the normal fibroblast strains (FB-43) and one of the CAFs (FB-74) induced COX-2 in nemosis. This is in contrast with previously published results, where COX-2 induction has been considered a hallmark feature of nemosis. However, in those studies fibroblasts have been from neonatal origin and here we have used fibroblasts obtained from adults. This conflicting result therefore indicates that COX-2 should not be solely used to measure nemosis response, but other markers, such as the profile of secreted proteins, should be investigated as well.The other key feature of nemosis is the time-dependent degradation of cytoskeleton. On protein level three of the fibroblast strains expressed α-SMA, surprisingly also the normal skin fibroblasts FB-74. The other normal fibroblast strain FB-43 did not express α-SMA at the protein level. However, when measuring the mRNA levels with the more sensitive Q-PCR method, all four fibroblast populations showed α-SMA expression and this was downregulated in nemosis. The time-dependent downregulation on both protein and mRNA level is in line with previous results on nemosis, indicating the decomposition of the cytoskeleton. Interestingly the CAFs started to regain the α-SMA mRNA expression at 72 h, the difference was significant when compared to their normal counterparts. In contrast to our results, a study by Shannon et al. We investigated also the mRNA levels of two other CAF markers, FSP1 and FAP. In nemosis FSP1 levels decreased in FB-43, FB-74 and CAF-74 spheroids, but increased in CAF-43 cells. The third investigated CAF marker FAP was upregulated in nemosis, more in CAFs than in normal fibroblasts, the difference was significant with the 43 fibroblast strains. With all three CAF markers the nemosis response followed the pattern of decreased expression of cytoskeletal genes (α-SMA and FSP1) and increase in proteolytic gene expression (FAP). Clearly different response was seen with CAF-43 cells where, instead of downregulation of FSP1, the levels increased in nemosis.The heterogeneity of fibroblasts becomes evident when looking at the basal levels of the CAF marker expression; CAF-43 cells had lower levels of all three markers, CAF-74 had less α-SMA, slightly more FSP1 and over 10-fold more FAP. These results also emphasize that α-SMA, the most commonly used CAF / myofibroblast marker, should not be used solely to define activated fibroblasts.Another hallmark of nemosis is the induction of growth factors. It has been shown that oral fibroblasts produce significantly more FGF7 and HGF/SF when compared to skin fibroblasts Based on these results it seems that the capability of normal and cancer-associated fibroblasts to produce these growth factors in nemosis is somewhat related to the extent they are needed in cancer progression. The dependence of tumors on stromal fibroblasts, and particularly on the growth factors they produce, decreases in the course of tumor progression. Epithelial cells require FGF7 to break the epithelial polarization. FGF7 is only expressed by stromal cells and its receptor FGFR2IIb only by epithelial cells, indicating the role FGF7 in the beginning of tumor progression It has been well established that CAFs, but not normal fibroblasts, are capable to promote tumor progression The observed spontaneous spheroid formation of FB-43 and CAF-43 in monolayer cultures is in line with the results from Kankuri et al. in vitro model of fibroblast activation, may have its in vivo counterpart in cancer-associated fibroblasts and is a valuable tool in studying the variations between fibroblasts obtained from different individuals. Nemosis response, particularly of the CAF markers α-SMA and FAP, could therefore be used as a prognostic marker to predict the stromal reaction of tumors.In conclusion, this study clearly demonstrates that fibroblasts obtained from different individuals vary in gene expression and behavior and that the expression of CAF markers differs between normal fibroblasts and CAFs in nemosis. Both normal and cancer-associated fibroblasts modulate tumor cells, normal fibroblasts by inhibiting the growth of invasive SCC cells and CAFs by further enhancing the growth of primary SCC cells. Nemosis, an All used cell strains had been previously established 2 atmosphere in Dulbecco's modified Eagle's medium (DMEM) and supplemented with 5% fetal calf serum (FCS) (Invitrogen), 0.3 mg/ml glutamine, 100 µg/ml streptomycin and 100 U/ml penicillin. Fibroblast spheroids were formed as described previously 5 cells/ml) were plated on agarose-coated U-bottom 96-well plates . Monolayer cultures were plated at the same density either on flat-bottomed 96-well plates (for immunoblotting) or on 6-cm dishes (for Q-PCR) . Cells were harvested at 24 h, 48 h and 72 h. As zero-hour time point the single cell suspension at the time of seeding was used. Fibroblasts were used till passage number 20 and UT-SCC cell lines till passage number 55.All cell populations were cultured at +37°C in 5% COThe samples were harvested in 2× sample buffer (125 mM Tris (pH 6.8), 4% sodium dodecyl sulfate (SDS), 0.01% bromophenol blue, 10% β-mercaptoethanol, 10% glycerol) and equal amounts of protein from each sample were resolved by 10% SDS-PAGE. Proteins were transferred to nitrocellulose membrane and blocked with 2.5% non-fat powdered milk in TBS .The following primary antibodies were used: rabbit polyclonal anti-COX-2 , rabbit polyclonal anti-GAPDH , mouse monoclonal anti-α-SMA , mouse monoclonal anti-vimentin 65EE3; and mousThe samples for Q-PCR were harvested in RNAprotect Cell Reagent and total RNA was extracted according to the manufacturer's instructions using RNeasy Plus Mini kit . Using the SuperScript VILO cDNA synthesis kit (Invitrogen) 500 ng of RNA from each sample were reverse-transcribed according to the manufacturer's instructions. Real-time quantitative PCR was done using DyNAmo Capillary SYBR Green Quantitative PCR kit with a LightCycler Instrument . Primer sequences are listed in 4 fibroblasts / ml or 5×104 SCC cells / ml. In order to determine the role of paracrine signaling between fibroblasts and carcinoma cells the assay was modified so that fibroblasts (2.5×104 fibroblasts / ml) were first plated in wells as a monolayer and incubated for 24 hours. Medium was aspirated and bottom agarose was laid on top of semi-confluent cells and allowed to solidify, after which the top agarose with or without SCC cells (5×104 SCC cells / ml) was overlaid. The plates were cultured at +37°C in 5%-CO2 incubator for 3 weeks without further feeding. The formed colonies were scored by calculating number of colonies in ten random views of 10× magnification in duplicate using an inverted microscope (Olympus CKX41) and photographed (Olympus DP12).The colony formation assay was based on method described by Zheng et al. 2, 5 mM K3Fe(CN)6, 5 mM K4Fe(CN)6 in 40 mM phosphate buffer, pH 6) over night. Images of random views were captured at 4× magnification and the blue cells, indicating senescence, were calculated.Senescence-associated beta-galactosidase activity was stained as described by Dimri et al. t-test.All experiments were done in duplicates and repeated three times. The mean and SEM of all three experiments are shown. GraphPad Prism software was used to calculate statistical significance that was determined by unpaired Student's

Breast cancer (BC) is a major public health problem, with rising incidence in many regions of the globe. Although mortality has recently dropped in developed countries, death rates are still increasing in some developing countries, as seen in Brazil. Among the reasons for this phenomenon are the lack of structured screening programs, a long waiting period between diagnosis and treatment, and lack of access to health services for a large proportion of the Brazilian population.Since 2004, an intervention study in a cohort of women in Southern Brazil, denominated Porto Alegre Breast Health Intervention Cohort, is being conducted in order to test the effectiveness and cost-effectiveness of a model for BC early detection and treatment. In this study, over 4,000 women from underserved communities aged 40 to 69 years are being screened annually with mammography and clinical breast examination performed by a multidisciplinary team, which also involves nutritional counseling and genetic cancer risk assessment. Risk factors for BC development are also being evaluated. Active search of participants by lay community health workers is one of the major features of our program. The accrual of new participants was concluded in 2006 and the study will last for 10 years. The main goal of the study is to demonstrate significant downstaging of BC in an underserved population through proper screening, attaining a higher rate of early-stage BC diagnoses than usually seen in women diagnosed in the Brazilian Public Health System. Preliminary results show a very high BC incidence in this population , despite a low prevalence of classical risk factors.This study will allow us to test a model of BC early diagnosis and treatment and evaluate its cost-effectiveness in a developing country where the mortality associated with this disease is very high. Also, it might contribute to the evaluation of risk factors in a population with a different ethnic background from that studied in developed countries. If our model is proven effective, it may be replicated in other parts of the globe where BC is also a major public health problem. Breast cancer (BC) incidence rates have increased significantly worldwide, and today is the most common non-skin cancer in women in almost all parts of the globe. The incidence is higher in the United States and Northern Europe, intermediate in Southern and Eastern Europe and South America, and lower in Asia .Although BC incidence rates are still increasing in developed countries, BC mortality rates have declined in recent years in these nations, what can be explained by greater breast cancer awareness, by the guarantee of health care access and by the adoption of public policies towards early tumor detection. In countries who have successfully implemented nationwide mammography screening programs, such as the United Kingdom , the NetIn contrast, in Brazil and other developing countries, both mortality and incidence rates have steadily increased in recent years. For example, the age-standardized mortality (ASM) related to BC in Brazil has grown from 10.74 per 100,000 women in 2000 to 12.32 in 2005 , which pThe State of Rio Grande do Sul presents the second highest breast cancer incidence rate in the country, with an estimated rate of 85.50 new cases per 100,000 women in 2008 – a number comparable to the USA and North Europe. The State's capital, Porto Alegre, has an even higher BC incidence rate, with 119.72 new cases per 100,000 women projected for the current year [In Brazil, approximately 75% of the population has access to health care only through the Brazilian Public Health System (PHS) , which iIn Brazil, the current national recommendation for breast cancer screening calls for mammography at two-year intervals, targeted at women between the ages of 50 and 69 years . These rAlthough the government guideline containing these recommendations has been published in 2004, there is not actually a national screening program, since there is no provision of financing nor training of health care professionals capable to provide service to all eligible women between ages 50 and 69 years. In the areas of the city of Porto Alegre included in this project, there used to be no mammographic reference service. Women with breast symptoms used to be referred to the city central area, where they were offered the services of a breast specialist necessary for diagnostic procedures and treatment, with very long waiting times for each step of the process. A national survey conducted in 2003 confirms the lack of a structured screening program in the country, showing that 49.7% of women above the age of 50 have never been submitted to a mammography, and, among those who had done the exam, 18% did it more than 2 years ago .Considering the above, the Associação Hospitalar Moinhos de Vento, in a partnership with the City Health Department of Porto Alegre and a non-profit organization (Breast Institute of Rio Grande do Sul), initiated a prospective breast cancer screening study, denominated Porto Alegre Breast Health Intervention Cohort (NMPOA – Núcleo Mama Porto Alegre). The two primary objectives of this project are:(1) To test the effectiveness of a centrally structured mammography screening and early treatment program, based on active women search, close contact with the BHU, promoting a multidisciplinary and humanized care for an underserved population from a developing country;(2) To verify the profile of breast cancer risk factors in the sample studied, evaluating the frequency and possible contribution of established risk factors and attempting to identify new ones.A secondary objective of the study is the estimation of the cost-effectiveness of such a program.The NMPOA project is a breast cancer screening and early treatment program, with evaluation of risk factors for breast cancer in an intervention cohort. From April 2004 through March 2006, 9,218 women aged 15 years or older visiting one of the 19 participating BHUs from Porto Alegre were evaluated in a cross-sectional study, which included: (1) an entry form questionnaire regarding risk factors for breast cancer – including family history (FH) of cancer – and presence of breast symptoms, and (2) breast examination by a trained professional . All patients with breast complaints or an abnormal physical exam were referred to NMPOA for further evaluation. Women between 40 and 69 years of age were invited to participate in the screening cohort. Women without symptoms and outside the targeted age group were advised to attend the BHU once a year for physical examination. Figure The accrual was done at the participating BHUs both actively and passively (women that attended the BHU for any reason being invited to the project). Although women from all ages above 15 could be enrolled in the cross-sectional study, the main emphasis was the invitation of women between the ages of 40 and 69 years, since that would be the group which would enter the screening cohort. The total number of women between 40 and 69 years old in the region was approximately 16,000, according to the most recent national census (year 2000), and the accrued number was about 4,000 in this age range.The screening program is based on annual mammographies in women between the ages of 40 and 69 years, which are always preceded by physical examination performed by a breast surgeon or a trained nurse. One of the main features of the program is its close control of the frequency of visits, based on a computer system that generates monthly reports on the due dates of all participants. The close contact and continuous feedback to the BHUs professionals guarantees that this strategy is put into practice with maximum effort, in order to achieve optimal adherence to the screening program.The proposal of the NMPOA project includes the performance of all clinical, imaging and pathology exams, as well as clinical visits and surgical treatment, in the same center. The health care approach is multi-disciplinary, including nurses, breast surgeons and a nutritionist. All mammographies are performed on the same day of the clinical visit, and they remain stored at the center. This integration of screening, diagnosis and treatment in the same center is an effort to shorten the time of delivery of appropriate treatment in each newly diagnosed breast cancer case.All mammographic exams done at NMPOA are interpreted only by radiologists who are specialized in breast cancer and follow rigorous international standards of quality control. The radiologist classifies mammographies using density and risk criteria, purposed by the BI-RADS (Breast Imaging Report and Data System) classification . Women wThe imaging screening consists of mammograms in patients older than 40 and ultrasound starting at an age 10 years younger than the relative's age when diagnosed with BC, not starting before the age of 25 .Participants of the cross-sectional study older than 18 years answering positively to at least one of the FH questions described below were referred to genetic cancer risk assessment. If the risk assessment yielded moderate or high genetic risk (estimated lifetime breast cancer risks greater than 20% or a family history suggestive of a hereditary breast cancer syndrome), the participant was invited to attend clinical visits and imaging screening at the NMPOA center, being followed by breast physicians and geneticists every six months. The main goals of the genetic evaluations are to determine: (1) the prevalence of a first-degree FH of cancer and characterize the type of cancer, age at diagnosis and relationship of the cancer-affected relative to the proband; (2) the lifetime breast cancer risk estimates in women attending the cohort and reporting a family history of breast and other cancers; (3) the prevalence of hereditary breast cancer phenotypes in a population-based sample of women in Latin America; (4) the contribution of germline mutations in known breast cancer predisposition genes among women from the cohort reporting a FH of cancer and fulfilling criteria for the clinical diagnosis of a breast cancer predisposition syndrome. Preliminary reports on the results of the genetic evaluation have been published elsewhere .BRCA mutations, such as early-onset, bilateral or male breast cancer, multiple primary cancers of the breast and ovary, first-degree or multiple-case family history of breast or ovarian cancer. In addition, a question about FH of BC and/or colon cancer was included due to a previous suggestion of a higher than expect prevalence of such association in cancer genetic clinics of Porto Alegre.The questions regarding FH in the cross-sectional study focused on features that have been associated with an increased likelihood of clinically significant Additional risk factors evaluated in the cross-sectional study included smoking, obesity, alcohol consumption and history of breast diseases. Current smokers were defined as those who smoked at least one cigarette per day; never smokers those who have never tried a cigarette in their life; and former smoker were defined as those who had stopped smoking for at least one year. Educational level of the participants was also inquired, and was measured by the years of schooling.For the approximately 4,000 already registered women in the annual mammographic screening, a complete clinical form was filled when they joined the cohort, containing gynecological-obstetric data (such as number of pregnancies and hormone use), family history, medical history and physical exam, which includes anthropometric measurements and breast examination. Every time the participant returns for clinical evaluation and annual mammography, the answers are updated, since many of these risk factors are dynamic. BI-RADS data from all mammographies, including density score, are also stored. If a tumor is diagnosed, all data concerning staging, pathology report, hormone receptors and both surgical and oncological treatment are registered.Participants who do not wish to continue in the screening program are requested to fill a form with the motive of withdrawal. This is also being recorded, in order to understand reasons for non-compliance, a major problem in Brazil ,18-22.For the patients who need complimentary investigation , as well as in women who undergo surgical and oncological treatment for cancer, length between each step of care is been recorded. We intend to compare these data with other national registries in the PHS in orderThe best parameter to show the effectiveness of our program would be breast cancer associated mortality. However, considering the very long breast cancer related death survival in asymptomatic women , and taking into account the well established relationship between tumor staging and survival , we chosIn search of an adequate comparison value, we considered that the staging of all breast cancers diagnosed during the study period in our city in a similar population would be suitable. These data are available upon request in the City Health Department. The total number of women between 40 and 69 years today in Porto Alegre is 247,000 , of whicThe proportion of cases at or below stage I in the NMPOA cohort and the same proportion in the city will be compared by the Fisher's exact test. Continuous variables, like the time frames between the steps of care, will be compared with Student's t-test. We are also planning to perform a cost-effectiveness analysis of this intervention, in which a Markov model will be employed.This project was approved by the ethical review board (ERB) of the City Health Department and of Associação Hospitalar Moinhos de Vento. The genetics project was also approved by the ERB from Hospital de Clínicas de Porto Alegre, where all biological material are stored. All subjects were provided a copy of the written consent before study entry and were assured of their anonymity and confidentiality of data collected.The screening cohort has already enrolled 4,037 women. Considering the number of women registered in the cross-sectional study who are reaching the age of 40 and will enter the cohort until the year 2014, this number will probably reach 4,500 until the end of the project.Table There were 1286 women who responded positively to one of the high genetic risk questions in the cross-sectional study, 902 of whom were further referred to genetic cancer risk assessment sessions. Of these, 214 had a pedigree suggestive of a hereditary breast cancer predisposition syndrome. Preliminary results from the genetic evaluation have been published elsewhere .Incidence of cancer so far has been 117 cases per 100,000 person-years , a number very similar to the number of cases predicted in the city for the year 2008, 119 cases per 100,000 women. Compliance to the annual screening has been approximately 60% so far, and the rate of participants who had their last mammogram not more than 2 years ago is almost 80% . Although we cannot be sure about the total number of women reached by the active and passive search, this number suggests a low adherence to preventive health care in this population. This is in accordance with national data, which showed that almost 50% of women above 50 years old have never done mammography, and almost 10% had done their last exam three or more years before .The incidence of breast cancer in this population is high, being comparable to developed countries and largely exceeding the Brazilian average incidence of 51 cases per 100,000. The cancer rate becomes quite intriguing when we confront it with the baseline data of our cohort: the majority of breast cancer risk factors in this population have a low prevalence , fostering the idea that unknown risk factors might be playing a major role in this region and reinforcing the importance of understanding the distribution of breast cancer risk factors in different populations. The incidence of cancer observed so far in the screening cohort suggests that this sample is representative of our city.Our longitudinal collection of risk factor data, especially the genetic risk factors, is very important for an accurate measurement, since this factor can change over time, as new information about cancer development in relatives of the patient becomes acknowledged. The design and sample size of our study will probably be sufficient to respond the primary question of our study, regarding the effectiveness of the model. However, we recognize that the correlation of risk factors and breast cancer will probably be underpowered. Nevertheless, we believe that our study can contribute with others in the field, and, in a pooled analysis through meta-analytic techniques, help us understand the high incidence of the disease in a large area in our country.We consider that the high rate of compliance so far is one the main strengths of your study. This is achieved by patient education, with information about the importance of the screening program, and intense contact with the BHUs, with provision of lists of patients who should come next month. We also supply transportation for women with very low financial resources, what helps to keep attendance. Every three or four months, we select a region with important problems of attendance and provide a special bus to take them to the PABHC.This project aims to establish a model of breast health attention directed to underserved women that rely only on health care provided by the public sector. The prompt access of women in our study to the reference service, as well as the clinical exam done by a specialized professional and high quality mammography are fundamental issues for early diagnosis of breast cancer. This is a major step to reduce breast cancer mortality worldwide.ASM: Age-standardized mortality; BI-RADS: Breast Imaging Report and Data System; BC: Breast cancer; BHU: Basic healthcare unit; ERB: Ethical review board; FH: Family history; HRT: Hormone replacement therapy; OC: Oral contraceptives; NMPOA: Núcleo Mama Porto Alegre ; PHS: Public Health System.The authors declare that they have no competing interests.MC was responsible for study design and manuscript review, and also participated in the manuscript drafting. RR was responsible for manuscript drafting and data analysis. BW, PAP, DD, PK, LF, JF, MG and PP participated in the study design. AB, PAP, JZ, JG and GS participated in data collection and were involved in patients' care. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:

CD154 gene. In the present work we investigated whether specific allele variants of the microsatellite in the 3' UTR of the CD154 gene might modulate the risk of RA. The study, in a case-control setting, included 189 patients and 150 healthy controls from the Canary Islands, Spain. The 24CAs allele was less represented in female patients than in controls 0.556, 95% confidence interval (CI) 0.372 to 0.831) but not in males (0.414 versus 0.408), and only when homozygous . We also verified that CD154 association with RA was independent of human leukocyte antigen (HLA) phenotype. A further functional study showed that after stimulation anti-CD3, CD154 mRNA was more stable in CD4+ T lymphocytes from patients with RA bearing the 24CAs allele than in patients without the 24CAs allele . However, a lower percentage of CD154+CD4+ T lymphocytes was seen in freshly isolated peripheral blood mononuclear cells from patients carrying 24CAs alleles , and also in CD4+ T lymphocytes stimulated with anti-CD3 . These results were concordant with the smaller amounts of CD154 mRNA isolated from stimulated T lymphocytes with 24CAs alleles. The CD154 microsatellite therefore seems to affect the expression of the gene in a complex manner that implies not only mRNA stability. These data suggest that the CD154 microsatellite contributes to the regulation of mRNA and protein expression, although further studies will be necessary to elucidate its role in disease predisposition.CD40–CD154 interaction is an important mediator of inflammation and has been implicated in T helper type 1-mediated autoimmune diseases including rheumatoid arthritis (RA). Linkage studies have shown association of markers in the proximity of the Rheumatoid arthritis (RA) is a chronic relapsing inflammatory condition of unknown etiology . The disTwin and family studies provide evidence to support the involvement of both genetic and environmental factors in the etiopathogenesis of RA ,7. Epide+ T cells from patients with RA have an increased expression of CD154 /. The number of CD154 mRNA molecules, quantified as indicated above, was then corrected for the proportion of CD4+ cells in each sample and expressed as molecules per μg of total RNA in CD4+ T lymphocytes, assuming equal RNA content between T cell subtypes. For the determination of mRNA half-lives (t1/2), fractions of CD154 mRNA remaining after the addition of ActD were plotted against time after ActD addition. After exponential adjustment of curves, mRNA half-lives were calculated as the time in which the fraction of mRNA remaining decreased to 50% of the initial amount.Expanded T cells, once they were resting, were restimulated with anti-CD3 plus anti-CD28 for 6 or 24 hours as mentioned above. Then, 10 μg/ml actinomycin D , a transcriptional inhibitor, was added to the culture and aliquots of cells were collected at different time points for RNA extraction. Total RNA was isolated by the guanidinium thiocyanate method by using the Trizol reagent (Gibco) and tran® software . The percentage of CD154-positive cells was calculated by subtracting overlaid CD154 and isotype control (Ig) histograms. Mean fluorescence intensity (MFI) was quantified on a linear scale as the ratio of the geometric mean of the CD154-phycoerythrin antibodies against the irrelevant anti-mouse-IgG-phycoerythrin antibodies of total CD4+ T cells.Freshly isolated PBMCs or stimulated T cell suspensions were washed and stained with anti-human CD45, CD3, CD14, CD4, CD69, CD25, and CD154 mAbs . Labeled cells were then analyzed in a FACSort flow cytometer with the CellQuestApoptotic cells in culture were detected by staining with fluorescein isothiocyanate (FITC)-labeled annexin-V (Roche Diagnostics) and propidium iodide (Sigma-Aldrich). After 15 minutes in the dark, cells were analyzed by flow cytometry. Cell viability was measured as the percentage of cells that were negative for both annexin-V and propidium iodide.PBMCs were stimulated with anti-CD3 plus anti-CD28 for three days, subsequently pulsed with 60 μM bromodeoxyuridine (BrdU) (Sigma-Aldrich), and harvested 18 hours later. The incorporation of BrdU was measured by staining with an FITC-conjugated anti-BrdU antibody (BD Biosciences) and analyzed by flow cytometry.2 method, using the Yates or Bonferroni correction or Fisher's exact test when appropriate. The strength of association between RA and alleles of CD154, DRB1 and DQB1 was estimated by using odds ratios (ORs) and the exact limits of the 95% confidence intervals (CIs). Estimation of the statistical power for the comparison of allele frequencies was performed with the STPLAN software. The arcsin approximation of the binomial distributions of allele frequencies was used with a two-sided test and with α fixed at 0.05. To examine interactions between variables associated with RA we conducted a multivariate analysis with a binary logistic regression model. Surface expression levels of CD154 mRNA and CD154 protein were compared by using the non-parametric Mann–Whitney test. The statistical package SSPS for Windows v. 10 was used. P < 0.05 was considered statistically significant.Allele and genotype frequencies and carrier rates were calculated in patients with RA and in controls, and no deviations from Hardy–Weinberg equilibrium in controls were confirmed by comparison of observed and expected genotype frequencies . Differe2 test (pc = 0.34). However, comparison of the frequencies of each allele between patients and controls showed differences for the 24CAs allele and the 26CAs allele . Because CD154 is located on the X chromosome, we compared allele frequencies between patients and controls in males and females separately. We observed statistical differences in the 24CAs allele frequency in females but not in males (0.41 versus 0.41). Similarly, differences were found in the 26CAs allele in females but not in males (0.03 versus 0.06). These data suggested a possible disease-protective role for the 24CAs variant in females. However, for the 26CAs allele, its contribution to disease predisposition does not seem to be relevant because of the low incidence in both patients and controls.Overall, allele frequencies in patients with RA than in healthy controls , whereas X/X cases were more frequent (P = 0.042) than in healthy controls, indicating that the 24CAs allele seems to protect from RA when homozygous.Next, we studied genotype frequencies in females, and we found a lower frequency of the s Figure . We thenHLA-DRB1, which includes the DRB1*04 and DRB1*01 alleles. To confirm whether the observed 'CD154 association' could be influenced by HLA phenotype, we typed DRB1 and DQB1 genes in our patients and controls by low-resolution PCR-SSO techniques. Patients with RA from the Canary Islands showed higher allele frequencies of DR4 and DQ3 , confirming the association of these variants with RA previously described in Spaniards [Epidemiological studies show a strong association of MHC region with disease predisposition, being related to the presence of 'shared epitopes' of paniards ,41.CD154 was associated with RA independently of the presence of DR4 and that CD154 microsatellite to sites regulating mRNA stability [CD154 mRNA half-life. This gene is located on the X chromosome, so we selected homozygotic patients with RA to assign the phenotype to a single allele; these individuals were then stratified by genotype. It is known that activation of peripheral T lymphocytes in patients with RA can fluctuate, affecting to the degree of apoptosis or response to mitogens in vitro. To avoid this heterogeneity, we first used PHA, anti-CD28 and IL-2 to stimulate PBMCs from 20 patients. After 1 week in culture, homogeneous cellular populations were obtained with more than 95% of resting CD3+ lymphocytes, as confirmed by CD69 staining. The CD4/CD8 ratio of these cells did not differ between 24CAs and non-24CAs patients . Anti-CD3 stimulation for 24 hours or more has been shown to specifically stabilize the normally unstable CD154 mRNA, augmenting its half-life notably [CD154 mRNA was determined by quantitative competitive reverse transcriptase-mediated PCR.Because of the proximity of the tability ,32, we c notably . We therCD154 mRNA between 24CAs (t1/2 49.7 ± 17.4 minutes (mean ± SD)) and non-24CAs alleles in comparison with a threefold increase in non-24CAs mRNA t1/2 (109 ± 39 minutes); P = 0.009) Figure . After 2) Figure . In conts Figure .CD154 mRNA molecules in CD4 T lymphocytes after 6 hours of stimulation with anti-CD3 plus anti-CD28 was significantly lower in patients with 24CAs (6.181 ± 2.908 molecules (mean ± SD) of CD154 mRNA per μg of total RNA in CD4 T lymphocytes) than in those with non-24CAs alleles . The same occurred after 24 hours of stimulation with anti-CD3 plus anti-CD28 .However, if the number of molecules was compared instead of mRNA decay, the total number of CD154 microsatellite could affect protein expression in RA T lymphocytes, as we had previously described in healthy donors [24CAs or non-24CAs alleles. As shown in Table 24CAs alleles displayed a higher percentage of CD19+ B lymphocytes (P = 0.018) and of activated CD25+CD4+ T lymphocytes (P = 0.036) but, surprisingly, a lower percentage of CD154+CD4+ T lymphocytes (P = 0.033). The MFI was also higher in patients with RA who were homozygous for non-24CAs alleles (4.44 ± 1.02 versus 3.22 ± 1.10), although differences did not reach statistical significance (data not shown).We next tried to assess whether the y donors . First, +CD4+ lymphocytes, reaching a maximum at 48 hours in both groups, but it was lower in patients with 24CAs alleles than in those with non-24CAs alleles (median 29.4% of CD154+CD4+ lymphocytes versus 47.6%) .To assess the influence of the microsatellite in the kinetics of surface expression of the CD154 protein, PBMCs from both groups of homozygous patients with RA were stimulated with anti-CD3 plus anti-CD28 for 24 hours or more, to allow mRNA stabilization and thus favor protein surface expression. Initially, we verified that there were no differences between groups in the numbers of apoptotic or proliferating cells, or of contaminating monocytes (data not shown), and the activation of anti-CD3-stimulated lymphocytes was confirmed in all samples by staining for CD69 and CD25 and by flow cytometry analysis (data not shown). We observed an increase in the percentage of CD154CD154 gene with RA in females from the Canary Islands. The 24CAs allele is less represented in patients than in controls, the difference being significant in women but not in men, and this gene variant protects from RA when homozygous. Different immunogenetic associations in male and female patients with RA have been described previously [CD154 association with disease susceptibility. In line with this, recent data have shown that CD154 expression could be modified by hormones such as estrogens [In the present study we describe the association of the microsatellite in the 3' UTR of the eviously -46, altheviously or, altestrogens and prolstrogens .HLA-DR4 and HLA-DQ3 is associated with RA in the Canary Islands population, in agreement with previous studies in Spaniards [CD154 association against RA is independent of HLA phenotype. These results differ from those previously obtained in Germans by Gomolka and colleagues [21CAs allele is a risk factor for patients with RA who are DR4-DR1-. Different allele frequencies between northern and southern Europe have been described for a variety of gene polymorphisms and probably contribute to the observed discrepancy, although there are other methodological reasons that also could explain the disparity of the results. Comparisons in the German population were not performed separately in men and women, and phenotype rather allele or genotype frequencies were used. Our data arranged in that way result in a similar overall distribution of phenotype frequencies to that reported by Gomolka and colleagues in both controls and patients with RA. Similarly, in our cohort 18% of DR4-DR1- patients with RA bear a 21CAs allele, compared with only 0.5% of DR4- DR1- in controls. However, we excluded the analysis of minor alleles because the small number of individuals with those alleles did not permit reliable statistical comparisons to be made.We also demonstrate that, although paniards ,44, CD15lleagues , who desCD154 microsatellite and predisposition to RA was sustained by the differential expression of the gene variant associated with RA. Regulation of mRNA stability is important in controlling the expression of this gene, and the microsatellite lies close to sites of binding of protein complexes that modulate mRNA stability [24CAs alleles displayed different behaviors in relation to mRNA decay rates and compared the 24CAs mRNA with the other alleles. In agreement with previous studies [CD154 mRNA was more labile after 6 hours of stimulation with anti-CD3 than after 24 hours, but mRNAs with 24CAs alleles had greater half-lives than the mRNAs from the other alleles after 6 and 24 hours of stimulation with anti-CD3.We wished to see whether the association that we had found between the tability ; CA repetability , as welltability -53. We c studies ,54, we c24CAs CD4 T cells expressed more CD154 after 48 hours of stimulation with anti-CD3/anti-CD28. Because staining for CD154 produced single-peaked histograms overlapping the negative control histograms, it is difficult to provide a precise description of CD154 distribution across CD4 T cells in terms of the percentage of positive cells and the mean MFI of the positive population. Staining of a Jurkat cell line with the same antibody resulted in two peaks, with a clear separation of CD154-positive and CD154-negative subpopulations. Dilution of the anti-CD154 antibody to mimic low CD154 expression changed the shape of the histogram to form a single peak overlaid with the control peak. In this situation, the percentages of positive cells calculated by subtracting positive and negative histograms did not reflect the true fraction of positive cells and changes according to the quantity of antibody added (data not shown). Thus, the dimly stained CD4 T cells from patients with RA in our 'in vitro' assay seem to be reflecting a low density of CD154 on the surface, and the percentages of positive cells obtained probably do not reflect the true CD154-positive fraction of cells but still provide a rough measure of CD154 quantity in the CD4 T cell population.Regarding protein expression, non-+ cells but not in the MFIs. However, data on these two results look similar and both seem to provide an expression of the higher content of CD154 in non-24CAs CD4 T cells. Ultimately, what is relevant is that this differential CD154 expression may be meaningful 'in vivo', affecting the response of the immune system to autoantigens, and hence the probability of developing autoimmunity. In this regard, it is interesting that a higher CD154 protein expression in people with the non-24CAs allele has been consistently found in a variety of situations with similar differences between people with 24CAs and non-24CAs genotypes , supporting the idea that CD154 microsatellite alleles influence the expression of this gene after TCR engagement. Nevertheless, it is important to note that this higher CD154 expression in non-24CAs refers to average values, and individual percentages and MFIs substantially overlap between 24CAs and non-24CAs. We lack several replications of a single individual to estimate the variation inherent in the assay, but it is likely that a significant amount of the scattering in the data is produced by interindividual variations in several genes other than CD154 that also influence the expression of this gene after T cell activation.Statistical analysis showed significant differences in the percentages of CD154Results in protein expression seem to contrast with results on mRNA stability. However, there are some concerns about the comparison of mRNA and protein results because different sources of cells were used for each experiment. Direct comparison of these results should be taken with caution, because different proportions of T cell subsets could have distinct kinetic patterns of CD154 expression. Furthermore, times of stimulation in the analysis of mRNA and protein expression match at only one time point (24 hours), so these experiments cannot be paralleled.24CAs allele, although conferring more stability on its mRNA, finally seems to result in a lower CD154 protein expression after activation. This means that the microsatellite alleles are associated not only with mRNA half-life, which seems plausible because of its location in the 3' UTR, but with other factors that probably affect the transcription of the gene and that result in a lower percentage of T cells expressing this protein on the surface after stimulation of the TCR. Although very speculative, this could be related to the NF-κB enhancer located near the microsatellite, which has been shown to have a crucial effect on transcription of the gene [Taking the results together, the the gene . ChangesThese results therefore seem to agree with the known pattern of CD154 expression, because it has been shown that the greatest level of CD154 expression after T cell activation occurs at a time when the mRNA is being rapidly degraded and that expression is controlled by both transcriptional mechanisms and message stability [CD154 gene and, if so, what are the exact mechanisms by which different alleles lead to a different expression of the gene.More studies will be necessary to confirm the association of this microsatellite marker with RA, to establish more accurately whether the association occurs through a direct effect in the expression of the The present results and our previous data showing CD154 association with systemic lupus erythematosus in Canary Islanders suggest that CD154 may commonly contribute to the pathophysiological process and common immunogenetic mechanisms underlying both autoimmune diseases, thus being in agreement with the hypothesis of the 'common genetic origin' of autoimmune diseases ,56.CD154 with RA in females from the Canary Islands. Differences found in mRNA decay according to CD154 genotypes suggest that this polymorphism may contribute to the regulation of mRNA expression, although further assays will be necessary to elucidate its role in disease predisposition. Additional studies from other series of patients will be required to confirm this genetic association.In the present study we report the association of the microsatellite in the 3' UTR of ActD = actinomycin D; APC = antigen-presenting cell; BrdU = bromodeoxyuridine; CI = confidence interval; FITC = fluorescein isothiocyanate; HLA = human leukocyte antigen; IL = interleukin; mAb = monoclonal antibody; MFI = mean fluorescence intensity; MHC = major histocompatibility complex; NF = nuclear factor; OR = odds ratio; PBMCs = peripheral blood mononuclear cells; PCR = polymerase chain reaction; PHA = phytohemagglutinin; RA = rheumatoid arthritis; SSO = sequence-specific oligonucleotides; TCR = T-cell antigen receptor; Th = T helper type; UTR = untranslated region.The authors declare that they have no competing interests.TM-D and IL-F designed the study, performed the experiments, analyzed and discussed the results and prepared the manuscript. These authors contributed equally to this work, and the order of authorship is arbitrary. GP-C participated in the analysis and interpretation of the results and in manuscript preparation. IR-F, CE, and AN participated in the collection of clinical data, in the recruitment of patients and in the discussion of results. SR participated in the analysis and interpretation of the results. FS and MJC performed genotyping of the control group. AG-S participated in the collection of samples. JAV contributed to the discussion. PP-A coordinated the study, participated in its design, oversaw all aspects of the laboratory work and participated in manuscript writing and discussion. All authors read and approved the final manuscript.An Excel containing data on the allelic frequencies of CD154 microsatellite in patients and controls.Click here for file

There is a high incidence of diarrhea in traveling populations. Norovirus (NV) infection is a common cause of diarrhea and is associated with 7% of all diarrhea related deaths in the US. However, data on the overall prevalence of NV infection in traveling populations is limited. Furthermore, the prevalence of NV amongst travelers returning to Europe has not been reported. This study determined the prevalence of NV among international travelers returning to Germany from over 50 destinations in and outside Europe.Stool samples of a total of 104 patients with a recent (< 14days) history of international travel were tested for the presence of NV genogroup (GG) I and II infection using a sensitive and well established quantitative RT PCR method. 57 patients experienced diarrhea at the time of presentation at the Department of Infectious Diseases & Tropical Medicine. The remaining 47 patients had no experience of diarrhea or other gastrointestinal symptoms for at least 14 days prior to their date of presentation at our institute.In our cohort, NV infection was detected in 15.7% of returning travelers with diarrhea. The closer to the date of return symptoms appeared, the higher the incidence of NV, ranging as high as 21.2% within the first four days after return.In our cohort, NV infection was shown to be frequent among returning travelers especially in those with diarrhea, with over 1/5 of diarrhea patients tested positive for NV within the first four days after their return to Germany. Due to this prevalence, routine testing for NV infection and hygienic precautions may be warranted in this group. This is especially applicable to patients at an increased risk of spreading the disease, such as healthcare workers, teachers or food-handlers. An increased incidence of diarrhea can be detected in traveling populations . In induJudging by two studies carried out in 2002 and in 2008 the economic and human impact that NV spread by travelers has on European public health systems appears to be substantial. As withRT-PCR methods have been recognized as the gold standard of NV detection -12. A reFresh stool samples from 104 recently (< 14days) returned travelers with and without diarrhea were collected from August 2006 through May 2008 at the Department of Infectious Diseases and Tropical Medicine in Munich, Germany.Sample preservation was performed as previously reported for NV preservation from stool -21, creaSamples were tested for NV genogroups I and II following a standard qRT-PCR protocol at the 'State Department for Health and Food Safety' as previously published . Qiagen Ethical clearance for the study was sought through the Ethical Committee of the Medical Faculty at Ludwig-Maximilians University, Munich, Germany. Clinical and laboratory data was used only in the case that patients had provided written informed consent to participate in this study or after written informed consent was obtained from the legal caretakers in the case of minors.Statistical evaluation was carried out using SPSS 13.0 for Windows "student version" as well as standard applications of Microsoft Excel Version 2003.Of the 104 patients included in this study 55 were male. Sex was evenly distributed between patients with and without diarrhea . The study included patients from 4 to 80 years of age (mean 37.8 ± 14.7 yrs) without significant differences between patients with and without diarrhea . The mean duration of the journey was comparable in patients with and without diarrhea (p = 0.949 one-way Anova test) with 69 and 71 days, respectively. , and one in the group of patients without diarrhea 2.1%). Of the 10 cases of NV detected, eight were caused by GGII viruses alone, one was a coinfection with GGI and GGII and one case was an infection caused by GGI alone. As expected, the difference in the number of NV infections proved significant when comparing patients with and without diarrhea (p = 0.019 by chi-square test). Both sexes were equally likely to be infected . (tab. .1%. Of tOf the nine positively tested patients that suffered diarrhea the following symptoms in addition to diarrhea were reported to the observing physician: fever (2), abdominal cramping (2), nausea (4), vomiting (2), headache (2) and myalgia (2).Patients in this study visited a total of over 50 destinations. Traveling modality was shown to influence the odds of infection. All patients with diarrhea and 20 patients without diarrhea provided information as to their traveling modalities. Overall, 28 patients (36%) had taken part in a back-packing/adventure trip, 19 (25%) had participated in a packaged holiday, 13 (17%) had been on a business trip and eight (10%) were visiting friends and family. All other patients that gave information as to their way of traveling had either traveled as missionaries or exchange students. Comparing traveling modalities within the group of recently returned travelers with diarrhea, the backpacking trip was associated with the highest risk of a positive NV test result, when compared to other forms of traveling (OR = 4.923). The business trip carried the second highest risk of infection (OR = 1.429), and those who had traveled on a packaged holiday carried the lowest risk of a positive test result (OR = 0.304). and patients without diarrhea 5.3 ± 3.5 days to present at our clinic for the first time after returning to Germany. These time spans are comparable for both groups (p = 0.330 One-way Anova test). . As the largest part of patients at our clinic possesses a clinical history of recent travel, a cut-off point was established to define patients whose symptomatic NV infection was unlikely to be linked to travel. This cut-off point was chosen at 14 days after return from the last international journey and NV infections in patients that presented to the clinic 14 days or more after their return were considered to be unrelated to travel. This choice was based on the maximum incubation time reported for NV that was estimated at 130 hours and the It was a special interest of ours to identify those diarrhea patients at highest risk for NV among the inhomogeneous group of returning travelers. The Department of Infectious Diseases and Tropical Medicine routinely collects data on the mode of traveling of patients. Hence, we could observe participants in backpacking/adventure trips to be the most likely to have contracted NV infection when compared to other returning travelers with diarrhea (OR = 4.923). Having traveled on a packaged holiday lowered the likelihood of NV when experiencing diarrhea (OR = 0.304). We also consider it remarkable for 30.1% of returnees from India suffering diarrhea to have been tested NV+, even though we are fully aware of the fact that the scale of this investigation does not allow any conclusions as to the likelihood with which NV affects visitors to specific destinations.A prevalence of NV of 21.2% among diarrhea patients within the first four days after their return from an international journey may be sufficiently high to warrant routine testing for NV in this group. Recent studies suggest that NV is continuously shed for an average of 28 days after symptoms subside , even thThe authors declare no existing conflict of interests. No third party funding has been used in the generation of the presented data.All authors have read and approved of the final manuscript and have contributed to the presented work as follows. NA carried out the sample collection, sample testing, statistical analysis and drafted the manuscript. NA also participated in study design. CH carried out the sample testing while HC provided machines, reagents and facilities for sample testing. TL conceived of the study and participated in its design and coordination. TL also contributed to the drafting of the manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2334/10/131/prepub

Traditional comparative morphological analyses and subsequent three-dimensional reconstructions suffer from a number of drawbacks. This is particularly evident in the case of soft tissue studies that are technically demanding, time-consuming, and often prone to produce artefacts. These problems can partly be overcome by employing non-invasive, destruction-free imaging techniques, in particular micro-computed tomography or magnetic resonance imaging.Here, we employed high-field magnetic resonance imaging techniques to gather numerous data from members of a major marine invertebrate taxon, the sea urchins (Echinoidea). For this model study, 13 of the 14 currently recognized high-ranking subtaxa (orders) of this group of animals were analyzed. Based on the acquired datasets, interactive three-dimensional models were assembled. Our analyses reveal that selected soft tissue characters can even be used for phylogenetic inferences in sea urchins, as exemplified by differences in the size and shape of the gastric caecum found in the Irregularia.The main focus of our investigation was to explore the possibility to systematically visualize the internal anatomy of echinoids obtained from various museum collections. We show that, in contrast to classical preparative procedures, magnetic resonance imaging can give rapid, destruction-free access to morphological data from numerous specimens, thus extending the range of techniques available for comparative studies of invertebrate morphology. For centuries, comparative zoomorphological analyses have formed the backbone of phylogenetic inferences. Data on the external and internal morphology of specimens were obtained by dissecting and sectioning selected representative species. These traditional procedures are technically demanding as well as time-consuming and irretrievably alter or even destroy the specimen. Further complications arise from the difficult three-dimensional (3D) reconstruction of the structures observed. Artefacts, for example deformation or compression of histological slices, and the problematic alignment of sections make 3D reconstructions a laborious and often highly subjective procedure. The problems encountered are further aggravated by the logistic challenges that arise when comparative studies on selected species of a whole taxon are to be carried out. For example, in case of sea urchins , some species are deep-sea dwellers or confined to remote regions of the world. It is therefore a considerable problem to obtain these animals in a freshly fixed state. Understandably, the desirable use of specimens from museum collections is usually not permitted for invasive and destructive analyses.The application of non-invasive imaging techniques such as micro-computed tomography or maPsammechinus miliaris and showed that members of this taxon are likely to be suitable for detailed MRI studies. These studies yielded imaging results comparable to manual dissection and were correlated with histological data. To achieve better resolved images of the complex internal anatomy of sea urchins, the application of higher magnetic field strengths was proposed [The feasibility of MRI studies to reveal soft tissue characteristics of invertebrates was demonstrated by studies on crabs ,13, squiproposed . HoweverStrongylocentrotus purpuratus [For systematic analyses, however, sea urchins appear particularly suitable. Like sea stars or sea cucumbers, they are part of a major deuterostome taxon, the Echinodermata, which shares a common ancestor with diverse groups such as acorn worms (Enteropneusta), tunicates (Tunicata), and vertebrates (Vertebrata) . Owing tn, 1857) .Sea urchins are spherical, oval or flattened free-moving echinoderms covered with spines. Their soft tissue anatomy is characterized by a dominant digestive tract, a varying number of gonads, and the highly specialized water vascular system with its external appendages, the tube or ambulacral feet. The space between the major organ systems is composed of the main body cavities that are filled with coelomic fluid . TherefoThe purpose of our study was to explore the possibility of generating high-resolution 3D MRI datasets from selected specimens of a major invertebrate taxon. For the first time, a non-invasive imaging technique is employed for systematic comparative analyses. We show that MRI permits the rapid acquisition of digitized morphological data on a broad scale and the construction of 3D models that can be made interactively accessible on the Web. In addition, our approach can be employed to compare the internal anatomy of sea urchins to evaluate such datasets for evolutionary inferences.Psammechinus miliaris , a common species in the North Sea, were used in order to establish imaging and contrasting protocols for broader systematic analyses. Living specimens of P. miliaris were made available through the Biologische Anstalt Helgoland, Germany (BAH). Several dozen sea urchins were kept in the aquarium facilities of the Institut für Biologie, Freie Universität Berlin, Germany, for subsequent scanning and contrasting experiments.Initially, freshly fixed as well as museum specimens of 3 using different imaging protocols with specimens of almost identical size. This analysis showed that although slight differences in anatomical makeup did occur, localization, arrangement and overall shape of the internal organs did not differ significantly. In the specimens depicted d Figure and 1B, d Figure , while tP. miliaris and the same imaging protocol, we found that the application of the contrast agent resulted in enhanced contrast, although some thin-walled structures, such as the ampullae or the oesophagus, became less visible on image quality. Using the same specimen of e Figure and 1D. Strongylocentrotus dröbachiensis , Sphaerechinus granularis , Schizaster lacunosus , and Brissopsis lyrifera ). Their state of preservation was surprisingly good and seemed mainly to depend on the mode of collection, the fixation mode, and the subsequent preservation in alcohol. Following the dissections, MRI experiments using freshly fixed and museum specimens of P. miliaris were carried out. Structures visible in the freshly fixed specimen were dissected in order to assess the state of preservation after decades or even more than a century of alcohol conservation of specimens in natural history collections worldwide, MRI studies were carried out using selected species of the 14 currently recognized echinoid subtaxa (orders). In three cases, freshly fixed animals were employed for the analysis and P. miliaris) as well as two irregular sea urchins and Echinocyamus pusillus ) are presented here as interactive videos 3 and represent the current state-of-the-art in high-field MRI at a field of view of up to (3.3 cm)3. In E. metularia that caused artefacts by altering the homogeneity of the magnetic field inside the MRI instrument.The full datasets from two 'regular' sea urchins or two huge (E. cyclostomus) gut loops, filled with debris and detritus, and an axial complex running straight down from the madreporic plate to the adoral part of the oesophagus (E. cyclostomus). In addition to soft tissues, the delineation of calcareous structures caused by the signal-providing surrounding fluids and tissues adds some information on hard-part anatomy to the virtual sections as well.In s Figure and E. ps Figure , the secAlthough several specimens of the echinoid taxon missing in our study, the Echinothurioida (or leather urchins), were found in museum collections, their shape prevented successful soft tissue imaging. These sea urchins possess a flexible calcite endoskeleton as well as specialized internal muscles that contract when the animal is fixed, resulting in a pancake-like shape of the organism. For a reliable comparison of internal structures it would be necessary to scan specimens prior to contraction of these powerful muscles.The 3D reconstructions presented here are limited to the major soft tissue structures identifiable in all datasets, if present in the respective species Figure and 4C–EStomopneustes variolaris . The specimen of ) Figure shown hes Figure , depictes Figure and irres Figure sea urchs Figure and 4B.Echinolampas depressa Gray, 1851 and Rhyshown in ). A compE. metularia. This widely distributed Indo-Pacific species possesses a moderately thick calcite endoskeleton, large primary and short secondary spines. Its internal organization is characterized by the presence of five bushy Stewart's organs, five stalked gonads and a short intestine. The drawing presented in Figure Cidaris cidaris (= Dorocidaris papillata) , where he depicts the newly discovered organs that were later named after him. A comparison of his drawing with the digital model in Figure E. metularia 3 with specimens ranging from 5 mm to 3.4 cm in size. Therefore, in terms of resolution, our data is comparable to results derived from manual dissection techniques in combination with stereomicroscopic observation. Susceptibility artefacts were primarily seen in the sediment-feeding irregular species, with the gut content being the source of these artefacts ). What sediment component is causing which type of artefact needs to be determined in mineralogical studies on freshly fixed specimens. The effects of the contrast agent made it possible to reduce the negative effects of these artefacts in some cases s Figure and 1D, in vivo analyses of invertebrates where, in contrast to μCT techniques that are based on X-rays, the living specimen is not harmed during the scanning process. Extensive morphological or developmental studies can thus be carried out, although anaesthetic substances may have to be applied to reduce movement artefacts during the long scanning times that are needed for high-resolution datasets and 3D reconstructions. Another very important advantage of non-invasive imaging techniques in general is the fact that the digitally acquired image stacks do not have to be manually aligned, as is the case with digital pictures from histological or electronmicroscopical sections. Although these datasets can be used to generate highly resolved digitized 3D models of invertebrates as well and later putting them back into alcohol for storage. No detrimental effects of this procedure were noted during our studies. Apart from morphological studies on fixed specimens, MRI can also be used for example, ,48), theexample, as well example, algorithin vitro staining possibilities are available for MRI studies, although some substances (for example manganese) can be used for in vivo staining [3. In addition, in the case of sea urchins, the 3D models generated [Encope michelini Agassiz, 1841 [In spite of the many positive features, a number of negative aspects are currently inherent to morphological studies of small animals using MRI. The achievable resolution is comparatively low, and results derived from the reconstruction of internal structures are currently comparable only to manual dissection. Furthermore, an exact outline of how future experiments on other invertebrate taxa should be performed can only be partially derived from our study, since imaging results of fixed specimens depend on several factors, some of them still not fully understood . Another drawback is the fact that only limited staining . A furthn, 1857) and Encoiz, 1841 , presentiz, 1841 .On the other hand, the access to MRI instruments does not appear to be a limiting factor. There are currently more than 1000 experimental small animal MRI instruments worldwide available for pre-clinical imaging. Since all high-field MRI scanners consist of super-conducting electromagnets, overnight and weekend scans as performed during this study would permit an optimal use of this resource.Cidaris cidaris [Arbacia punctulata [Paracentrotus lividus [Echinus esculentus Linnaeus, 1758 [Sphaerechinus granularis [Spatangus purpureus Müller, 1776 [Echinocardium cordatum [Despite the existence of extensive fossil, morphological and molecular datasets for this taxon, comparatively little systematic knowledge has been gathered on the internal anatomy of sea urchins. However, some authors have greatly extended our knowledge about the internal anatomy of selected, readily available sea urchin species such as s, 1758) , Arbaciak, 1816) , Paracenk, 1816) ,57, Echik, 1816) , Spatangt, 1777) , not to Furthermore, the results were sometimes biased by prevailing morphological hypotheses. For example, recent histological studies as well The feasibility of comparative morphological studies using MRI is further exemplified by our description of the highly variable shape and size of the gastric caecum found in the Irregularia Figure . Our finAlthough for some organs high intraspecific variability was detected, in particular in the case of organs with a development-dependent size and shape such as the gonads Figure and 1F, A number of imaging techniques allow for non-invasive morphological studies on whole specimens. However, only a few of them are able to achieve resolutions that permit detailed morphological analyses in small animals. Confocal laser scanning microscopy (CLSM), in combination with the autofluorescence of the crustacean or insect cuticula, can be used for 3D reconstructions of minuscule body parts or whole specimens -66. The in vitro as well as in vivo [3 have been achieved on whole specimens, although, technically, resolutions in the nanometre scale are within reach. However, whether these new μCT methods can compete with the ability of MRI to display soft tissue at high resolutions still needs to be evaluated. Our own preliminary studies to generate images of internal organs performed on several sea urchin museum specimens , Mespilia globulus , and Moira atropos ) using a desktop high-resolution μCT scanner at the Max-Planck-Institut für evolutionäre Anthropologie, Leipzig, Germany were not successful, although these μCT datasets can be used for the reconstruction of hard tissue structures. 3D models based on this data will be made available on the DigiMorph website [In contrast to CLSM, μCT has already become a standard tool for detailed non-invasive studies of whole specimens, especially in studies on fossils . It is b in vivo ,7,68-70 in vivo ). Using website .These results demonstrate that complementary imaging techniques should ideally be used for comparative morphological analyses, an approach commonly referred to as multimodality.Our results extend the use of MRI in invertebrate morphology to a systematic approach using museum specimens of a major marine invertebrate taxon, the sea urchins (Echinoidea). MRI can be employed for the rapid, non-destructive and unbiased acquisition of digital morphological data, and the creation of interactive 3D models accessible both within a publication and via the Web. The revelation of the internal anatomy of echinoid museum specimens at a resolution comparable with manual dissection extends our knowledge of soft tissue characters, permitting phylogenetic inferences.All specimens analyzed belong to the taxon Echinoidea (sea urchins), one of the five subtaxa of the Echinodermata . The museum specimens were mostly fixed in formalin and all were conserved in alcohol, although in some cases the exact mode of fixation could not be determined. For MR scanning, the museum specimens had to be lowered down to distilled water in a gradual alcohol series. Specimens that were obtained in living state were fixed in a 7% formaldehyde solution. For MR scanning, the freshly fixed specimens were kept in this solution. Results derived from specimens scanned in alcohol and formalin did not appear to differ significantly.The specimens where placed either inside a custom-built Plexiglas chamber (Berlin), inside a 50 ml Falcon tube (Berlin), or inside NMR tubes with diameters between 5 and 20 mm (Würzburg), depending on the size of the specimen. On some specimens spines had to be dressed for tight fit inside the tubes. Magnevist, a gadolinium-based non-selective contrast agent, was added at a final concentration of 2 mM. This concentration had been employed successfully in preliminary studies (results not shown). The addition of the contrast agent to the museum specimens was discussed beforehand with the curators who judged the risk to the specimens' integrity as negligible. Prior to scanning, samples were degassed at 50 mbar. The freshly fixed specimens used in this study will be deposited as voucher material at the ZMB. Museum specimens will be stored in separate jars for potential later re-scanning. Table 2 lists detailed information on every museum and freshly fixed specimen used in this study.1H-resonance frequency of 300 MHz . The system consisted of a 160 mm horizontal bore magnet, a shielded gradient set with an inner diameter of 90 mm, and a maximum gradient strength of 300 mT/m. A 1H-radio frequency linear transmit/receive birdcage resonator with an inner diameter of 38 mm was used for excitation and signal detection. The images described here were acquired at around 18°C. Data acquisition and image processing were carried out with Paravision 4.0.Experiments were conducted at the Berlin NeuroImaging Center, Charité – Universitätsmedizin Berlin, Germany on a 7 T Pharmascan 70/16 AS rodent scanner with a 1H-resonance frequency of 750 MHz on a Bruker Avance 750WB NMR spectrometer . The system consisted of an 89 mm vertical bore magnet, a shielded gradient set with an inner diameter of 40 mm, and a maximum gradient strength of 1 T/m. A 20 mm linear birdcage resonator and a 5 mm linear bird cage resonator were used. The images described here were acquired at around 18°C. Image processing was carried out with Paravision 3.0.2 and involved zero filling to a (512)3 matrix prior to Fourier transformation.Experiments were conducted at the Physikalisches Institut, Würzburg, Germany at 17.6 T with a Scanning protocols employed a 3D gradient echo imaging sequence (FLASH) with parameters depending on the specimen size with 7.2 Megapixels. The acquired images were processed using Adobe Photoshop CS2 9.0.3D image reconstruction and visualization were performed by converting the generated MRI data (DICOM standard) into an 8-bit TIFF image sequence (ImageJ 1.38w) and by using 3D imaging software . Segmentation was carried out manually by using the brush tool in the amira Image Segmentation Editor. In some cases structures on every other slice were labelled, with subsequent 'interpolation' of structures on intervening slices, followed by a check and correction of segmentation results if necessary. Detection of borderlines and organ designations were performed based on literature, our own histological data and previously acquired MRI data ,32.Operations were carried out on a desktop PC . Image processing was performed using Adobe Photoshop CS2 9.0 and Adobe Illustrator CS2 12.0.1. The movies were produced using the ImageJ 1.38w QuickTime export function. The individual 3D structures were saved as Wavefront files and imported into Adobe 3D Toolkit 8.1.0, where they were reassembled and transformed into an interactive 3D PDF. The 3D model was embedded into this publication using the Adobe 3D Toolkit according to the procedures described in .3D: three-dimensional; BAH: Biologische Anstalt Helgoland, Germany; CAS: California Academy of Sciences, San Francisco, USA; CLSM: confocal laser scanning microscopy; μCT: micro-computed tomography; FOV: field of view; MRI: magnetic resonance imaging; NHM: Natural History Museum, London, UK; NMR: nuclear magnetic resonance; USNM: National Museum of Natural History, Washington DC, USA; ZMB: Systematische Zoologie am Museum für Naturkunde, Berlin, Germany.AZ designed and coordinated the experiments, carried out the dissections, prepared specimens and carried out scanning and 3D modelling. CF and SM prepared and scanned specimens. TB supervised the experiments. All authors contributed to writing the manuscript and approved of the final version.Table 1 – Scanning parameters for specimens used in this study.Click here for fileTable 2 – List of specimens used in this study.Click here for fileEucidaris metularia . Resolution: (81 μm)3.Video 1 – MRI dataset of Click here for filePsammechinus miliaris . Resolution: (44 μm)3.Video 2 – MRI dataset of Click here for fileEchinoneus cyclostomus Leske, 1778. Resolution: (86 μm)3.Video 3 – MRI dataset of Click here for fileEchinocyamus pusillus . Resolution: 20 × 18 × 18 μm3.Video 4 – MRI dataset of Click here for fileEucidaris metularia can be interactively accessed. The 3D model is based on the virtual MRI sections seen in Video 1. In order to view the 3D model please install (or upgrade to) Adobe Reader Version 7.1 or higher.3D model – 3D PDF version of the entire article. By clicking anywhere onto Figure Click here for file

EHP 117:316–324; Kundi][.Mobile phone use worldwide has exploded in the past decade, with many countries fast approaching a usage prevalence of 100%. Even as mobile phone use grows exponentially, questions remain regarding the health impact of frequent exposure to the electromagnetic fields (EMFs) associated with mobile phone use. A review of 33 peer-reviewed epidemiologic studies suggests that a number of study design issues may result in an underestimate of the relative risk of brain tumors among mobile phone users Recall bias is a widely cited concern that could lead to biased risk estimates in case–control studies of ipsilateral exposure ; the review author notes that cancer patients may tend to either attribute their disease to their mobile phone use or to dismiss a relationship between the two. But ipsilateral risks also carry greater biologic plausibility, since one 2008 study showed that nearly 99% of the total electromagnetic energy deposited in the brain is absorbed at the side of the head where the phone is held during calls. According to the author’s analysis, more than half of mobile phone users among cases and none among controls would have to incorrectly identify which ear they usually hold their phone to in order to nullify the observed increased risk.Another source of potential bias concerns the comparison groups used. In the widely cited Interphone study, a case–control study spanning 13 countries, the unexposed group included people who used cordless phones. However, according to the author, cordless and mobile phones users receive about the same EMF exposure, and cordless phones are generally used for longer periods of time than mobile phones. This may help explain why Interphone has consistently reported either no effect or even a protective effect of mobile phone use.Finally, methods of data acquisition, which have differed substantially between Interphone and other studies, may also introduce bias. Memory performance may be altered in patients with aggressive gliomas, malignant brain tumors that have been associated with mobile phone use in some studies. The author also suggests that exposure assessment may be biased if conducted by phone interviews (as in the Interphone study) compared with the mailed questionnaire method.According to the review author, results of the research to date suggest an association between mobile phone use and glioma risk that falls in the range of magnitude delineated for passive smoking and lung cancer. Confidence in a causal relationship is bolstered by two key findings: longer latencies are associated with higher risk estimates, and living in a rural area—where mobile phones typically radiate at higher intensities—also is associated with elevated risk. Even a modest cancer risk could have major public health implications because of the vast number of mobile phone users. On the other hand, as this review points out, the individual risk perspective is less dramatic: in industrialized countries, the prevailing life-time brain tumor risk is 4–8 per 1,000, and thus individual risk is still low if mobile phone use increases the risk even 50% to 6–12 per 1,000.

Synaptic interactions between neurons of the human cerebral cortex were not directly studied to date. We recorded the first dataset, to our knowledge, on the synaptic effect of identified human pyramidal cells on various types of postsynaptic neurons and reveal complex events triggered by individual action potentials in the human neocortical network. Brain slices were prepared from nonpathological samples of cortex that had to be removed for the surgical treatment of brain areas beneath association cortices of 58 patients aged 18 to 73 y. Simultaneous triple and quadruple whole-cell patch clamp recordings were performed testing mono- and polysynaptic potentials in target neurons following a single action potential fired by layer 2/3 pyramidal cells, and the temporal structure of events and underlying mechanisms were analyzed. In addition to monosynaptic postsynaptic potentials, individual action potentials in presynaptic pyramidal cells initiated long-lasting (37 ± 17 ms) sequences of events in the network lasting an order of magnitude longer than detected previously in other species. These event series were composed of specifically alternating glutamatergic and GABAergic postsynaptic potentials and required selective spike-to-spike coupling from pyramidal cells to GABAergic interneurons producing concomitant inhibitory as well as excitatory feed-forward action of GABA. Single action potentials of human neurons are sufficient to recruit Hebbian-like neuronal assemblies that are proposed to participate in cognitive processes. We recorded the first connections, to our knowledge, between human nerve cells and reveal that a subset of interactions is so strong that some presynaptic cells are capable of eliciting action potentials in the postsynaptic target neurons. Interestingly, these strong connections selectively link pyramidal cells using the neurotransmitter glutamate to neurons releasing gamma aminobutyric acid (GABA). Moreover, the GABAergic neurons receiving the strong connections include different types: basket cells, which inhibit several target cell populations, and another type called the chandelier cells, which can be excitatory and target pyramidal cells only. Thus, the activation originating from a single pyramidal cell propagates to synchronously working inhibitory and excitatory GABAergic neurons. Inhibition then arrives to various neuron classes, but excitation finds only pyramidal cells, which in turn, can propagate excitation even further in the network of neurons. This chain of events revealed here leads to network activation approximately an order of magnitude longer than detected previously in response to a single action potential in a single neuron. Individual-neuron–activated groups of neurons resemble the so-called functional assemblies that were proposed as building blocks of higher order cognitive representations. A novel study on connections between human neurons reveals that single spikes in pyramidal cells can activate synchronously timed assemblies through strong connections linking pyramidal cells with inhibitory and excitatory GABAergic neurons. Functional characterization of microcircuits of the cerebral cortex of rodents, carnivores, and to some extent, monkeys has been propelled by simultaneous multiple recordings from synaptically connected neurons combined with anatomical and molecular analysis of the recorded cells providing direct experimental analysis of neural connections –5. In thRecent in vivo experiments in rodents showed that individual neurons of the cerebral cortex can effectively initiate movements and moduWe set out to record the first interactions between identified human pyramidal cells and their postsynaptic target neurons in order to characterize the saliency of single cells and the contribution of unitary signals to the triggering of compound network events. Our recordings reveal that single spikes of pyramidal neurons are followed, not only by monosynaptic excitatory postsynaptic potentials (EPSPs), but also by complex event sequences with a stereotyped series of polysynaptic potentials. We then show some of the underlying network mechanisms that sequentially combine the pathway-specific effectiveness of glutamatergic excitation followed by a concomitant and bimodal GABAergic wave of events composed of inhibitory and excitatory effects.n = 30), frontal (n = 22), and parietal (n = 6) cortices of 58 nonepileptic patients aged 18 to 73 y i solution for discriminating GABAergic and glutamatergic events containing (in mM) 126 K-gluconate, 4 KCl, 4 ATP-Mg, 0.3 GTP-NA2, 10 HEPES, 10 phosphocreatine, and 8 biocytin . Presynaptic cells were stimulated with brief (2–10 ms) suprathreshold pulses delivered at >7-s intervals, to minimize intertrial variability. Membrane properties of human neurons or polysynaptic events did not show significant changes for up to 20 h after slicing, but recordings included in the analysis were arbitrarily terminated 15 h after slice preparation. Traces shown are single sweeps or averages of 50–100 consecutive episodes. Data are given as mean ± standard deviation (S.D.), Mann-Whitney U-test, paired t-test (pharmacology), and Kolmogorov-Smirnov test was used to compare datasets; differences were accepted as significant if p < 0.05.All procedures were performed according to the Declaration of Helsinki with the approval of the University of Szeged Ethical Committee. Human slices were derived from material that had to be removed to gain access for the surgical treatment of deep-brain tumors from the left and right frontal, temporal, and parietal regions with written informed consent of the patients (aged 18–73 y) prior to surgery over the last 4 y. Anesthesia was induced with intravenous midazolam and fentanyl . A bolus dose of propofol (1–2 mg/kg) was administered intravenously. To facilitate endotracheal intubation, the patient received 0.5 mg/kg rocuronium. After 120 s, the trachea was intubated and the patient was ventilated with a mixture of OVisualization of biocytin and correlated light and electron microscopy was performed as described ,40. ThreFigure S1(A) Firing patterns of the pyramidal cell and the basket cell and their responses to hyperpolarizing current pulses.(B) Action potentials in the pyramid (red) evoke subthreshold EPSPs and EPSPs eliciting action potentials in the basket cell (blue).(C) Light microscopic reconstruction of the pyramidal cell (red) and the basket cell (blue).(D) Route of the presynaptic pyramidal axon to the six electron microscopically verified synapses formed on the dendrites of the basket cell.(E) Correlated light (insets) and electron microscopic (E1–E5) identification of the six synaptic junctions (arrows on electron micrographs) between the axon (a) of the pyramidal cell and dendrites (d) of the basket cell. Numbering of synapses correspond to panel (D).(9.10 MB TIF)Click here for additional data file.

Adrenal myelolipoma is an unusual, benign and biochemically inactive tumor that is composed of mature adipose and hematopoietic tissue. It is usually diagnosed accidentally and nowadays much more frequently because of widespread use of ultrasonography, computed tomography (CT) and magnetic resonance imaging. Adrenal myelolipoma is usually unilateral and asymptomatic, though known to be associated with obesity, hypertension, endocrinological disorders and some malignancies. We report herein two cases of right-sided giant adrenal myelolipoma diagnosed by multidetector-row CT. One patient was symptomatic because of a large mass in the right upper abdomen, which on imaging with CT was seen to be right adrenal myelolipoma. Another patient had a large left side Bochdalek hernia and right adrenal myelolipoma was incidentally discovered on CT. Myelolipoma is an uncommon tumorlike lesion composed of a variable mixture of hematopoietic elements and mature fat that resembles bone marrow. The term1145A 52-year-old man with a history of hypertension presented with the complaint of pain in right upper abdomen for last 15 days. He was afebrile and well built. On per-abdomen examination, a bimanually palpable mass was noticed in the right lumbar region. Ultrasonography revealed a hyperechoic mass measuring 15 cm on the lateral aspect of right kidney displacing it medially. CT study of abdomen was performed with an MDCT for the evaluation of the mass in right upper abdomen. MDCT revealed a large (16 cm×12 cm) mass in the retroperitoneum on the superior and lateral aspects of right kidney which was displaced inferiorly and medially Figures . The masA 48-year-old man being evaluated for hypertension was advised a chest X-ray by the treating physician, which showed stomach bubble in the left chest. CT was performed after oral ingestion of barium to look for a diaphragmatic hernia. MDCT with coronal reformation showed a large defect in the posterolateral left hemidiaphragm with stomach, small intestine, spleen and colon inside the left hemithorax Figures and 6. AAdrenal myelolipomas have been somewhat of medical curiosity as they are uncommon, benign and usually asymptomatic. They are1Adrenal myelolipoma is mostly discovered on imaging for unrelated reasons and constitutes 10–15% of adrenal incidentalomas. Occasionally, patients present with abdominal pain secondary to hemorrhage, tumor necrosis or mechanical compression; other rare presenting symptoms include hematuria and abdominal mass.157 Four d514Bochdalek hernia is an extension of intra-abdominal contents into the chest due to posterolateral defects in diaphragm, predominant on the left side. Usually diagnosed in the first few weeks of life due to respiratory distress in neonates, Bochdalek hernias are mostly asymptomatic in adults. MDCT enhances the detection of diaphragmatic defects with its multiplanar reformations and delineates the contents which may include fat, retroperitoneal structures or intraperitoneal contents, although the latter two conditions are exceedingly rare. These hernias are incidental imaging findings in adult being evaluated for chest or abdominal pathologies. We reporUS, CT and MRI are effective in diagnosing more than 90% of adrenal myelolipomas based on identification of fat, with CT being the most sensitive.61011 US 61056105Management of adrenal myelolipomas should be individualized. The asymptomatic small lesions less than 4 cm should be followed up with US or CT. Surgery is indicated when the patient is symptomatic, when the lesion is more than 5 cm in size due to rare chances of rupture, or if malignancy is suspected. The laparoscopic approach seems to be gaining ground for the management of adrenal tumours including myelolipomas. However, this procedure is not indicated for masses larger than 10 cm or with adhesions and infiltration of the surrounding structures.13We conclude that MDCT helps in the preoperative diagnosis of giant adrenal myelolipoma depicting the tumor and its origin very well.

Propionibacterium acnes (P. acnes). Systemic therapies for acne target P. acnes using antibiotics, or target the follicle with retinoids such as isotretinoin. The latter systemic treatment is highly effective but also carries a risk of side effects including immune imbalance, hyperlipidemia, and teratogenicity. Despite substantial research into potential new therapies for this common disease, vaccines against acne vulgaris are not yet available.Acne vulgaris afflicts more than fifty million people in the United State and the severity of this disorder is associated with the immune response to P. acnes. The importance of sialidase to disease pathogenesis is shown by treatment of a human sebocyte cell line with recombinant sialidase that increased susceptibility to P. acnes cytotoxicity and adhesion. Mice immunized with sialidase elicit a detectable antibody; the anti-sialidase serum effectively neutralized the cytotoxicity of P. acnes in vitro and P. acnes-induced interleukin-8 (IL-8) production in human sebocytes. Furthermore, the sialidase-immunized mice provided protective immunity against P. acnes in vivo as this treatment blocked an increase in ear thickness and release of pro-inflammatory macrophage inflammatory protein (MIP-2) cytokine.Here we create an acne vaccine targeting a cell wall-anchored sialidase of P. acnes-associated diseases.Results indicated that acne vaccines open novel therapeutic avenues for acne vulgaris and other P. acnes, a gram-positive bacterium, is strongly associated with acne vulgaris. Isotretinoin, 13-cis-retinoic acid, is a vitamin A-derived retinoid that has been widely prescribed for systemic treatment of severe acne. However, the teratogenicity of isotretinoin is well documented P. acnes prevents colonization by more harmful bacteria for 18 h. After the co-culture, unbound bacteria were extensively washed three times with PBS. Dead sebocytes stained with trypan blue were counted on a hemocytometer. The colony forming unit (CFU) of P. acnes incorporated with sebocytes was determined by spreading serial dilutions of aliquots of trypsinized sebocyte suspension in 0.01% (w/v) Triton-X on agar plates to quantify CFU/cell. The adherence of P. acnes to sebocytes was visualized by staining with Accustain Gram stain kit .An immortalized human sebocyte line SZ95 was obtained as a gift from Dr. Zouboulis CC in the Departments of Dermatology and Immunology, Dessau Medical Center, Dessau, Germany. Sebocytes were cultured in Sebomed Basal medium , supplemented with 5 ng/ml human recombinant epidermal growth factor , 10% (v/v) heat-inactivated fetal bovine serum, at 37°C under atmosphere of 5% (v/v) CO6) were incubated with recombinant sialidase (10 µg/ml) at pH 6.0 for 2 h. The sebocytes were washed with PBS three times and fixed with 1% formaldehyde in PBS for 5 min at room temperature. After washing, the cells were incubated at 37°C for 15 min with 10 µg/ml of biotinylated MAA lectin I , which was prepared with 1% (w/v) bovine serum albumin (BSA) in PBS. The bound biotin was reacted with 1.5 µg/ml of a streptavidin-streptavidin-fluorescein isothiocyanate (FITC) conjugate , which was incubated in 1% (w/v) BSA in PBS at 37°C for 10 min. After trypsinizing, the fluorescence intensities of the cells were analyzed with a flow cytometer .Sebocytes for nine weeks . P. acnes was killed by heat at 65°C for 30 min or ultraviolet (UV) at 7,000 mJ/cm2. Anti-serum raised against killed P. acnes was collected one week after the third boost. Each group (n = 4) and each experiment was performed in triplicate. 10% SDS-PAGE was used for western blot analysis. All experiments using mice were conducted according to institutional guidelines.Female ICR mice approximately 3-months-old were used for vaccination. Recombinant sialidase or GFP was dissolved in PBS and mixed with an equal volume of complete or incomplete Freund's adjuvant. For the first vaccination, 50 µg of recombinant protein in complete Freund's adjuvant was injected subcutaneously into the dorsal skin. Two weeks later, 50 µg of recombinant protein in incomplete Freund's adjuvant was intraperitoneally injected for second boost. One week after the second boot, serum containing immunoglobulin G (IgG) antibody was harvested for western blot analysis. Serum was diluted 1∶10,000 for the reaction. To obtain antiserum against P. acnes was subcutaneously injected in the central portion of the left ear of sialidase- or GFP- vaccinated mice. 20 µl of PBS was injected into the right ear as a control. After injection, ear thickness was measured using a micro caliper and recorded periodically until ear swelling had nearly subsided (71 days). The P. acnes-induced change in ear thickness was calculated as % of that in PBS-injected ears. To assess the effect of vaccination on P. acnes growth, ears injected with PBS or live P. acnes in sialidase- or GFP-immunized mice were excised and homogenized at eight days after injection. P. acnes from homogenized ears were grown on agar plates for CFU counting.Live P. acnes injection for three days. The concentrations of MIP-2 and TNF-α in the tissue chamber fluid were determined with sandwich enzyme-linked immunosorbent assay (ELISA) kits according to the provided protocols.ICR mice were anesthetized with 10 mg of ketamine and 1.5 mg of xylazine per 100 g of body weight. The tissue chamber consisted of closed ploytetrafluoroethylene Teflon cylinders with 12 regularly spaced 0.1 mm holes. The tissue chamber was sterilized by soaking in 70% ethanol overnight. The sterile tissue chamber was then implanted subcutaneously under abdominal skin and maintained in the mice for 7 days to ensure the chamber was fully integrated with the subcutaneous environment. For histological observation, an implanted tissue chamber was cross-sectioned, stained with haematoxylin and eosin (H&E) , and viewed on a Zeiss Axioskop2 plus microscope . Fluids in the tissue chamber were drawn by pecutaneous aspiration before and after in vitro neutralization assays, P. acnes (2×106 CFU) was pre-treated with 2.5 % (v/v) of anti-sialidase or -GFP serum in the medium at 37°C for 2 h before being added to sebocyte (2×105) cultures for 18 h. Complement in the serum was deactivated by heating at 56°C for 30 min. Sebocyte death induced by P. acnes was determined with p-Nitrophenyl phosphate disodium (pNPP) according to the method of Martin and Clynes pNPP for 1 h at 37°C. The absorbance of the pNPP reaction was measured at OD405 nm. As a baseline, sebocytes killed with 0.1% (v/v) Triton-X were also assayed. Sebocyte death induced by P. acnes cytotoxicity was calculated as (the OD405 difference without and with P. acnes treatment)/(the OD405 difference without P. acnes and with Triton-X treatment)×100 %. For IL-8 detection, P. acnes (1.5×108 CFU) pre-treated with anti-sialidase or anti-GFP sera was added into sebocyte (3×106) cultures for 8 h. After centrifuging to remove bacteria, the concentrations of IL-8 in the culture medium were determined by ELISA assays (R & D Systems Inc.).For t-test was used to assess the significance of independent experiments. The criterion p<0.05 was used to determine statistical significance.Data are presented as mean±standard error (SE). The Student P. acnes. The PCR products were inserted into a pEcoli-Nterm 6xHN plasmid and expressed in E. coli [E. coli BL21 (DE3)]. After IPTG induction, over-expressed sialidase-6xNH fusion protein from E. coli was detected by SDS-PAGE with Coomassie blue staining at approximately 53.1 kDa molecular weight . An internal peptide of sialidase is presented was added to human SZ95 sebocyte cultures for 2 h to remove the sialic acids on the surface of sebocytes. Surface sialic acids were quantified by flow cytometry using biotinylated Maackia Amurensis (MAA) lectin I and FITC conjugate. The fluorescence of MAA labeled-sialic acids in sialidase-treated sebocytes was reduced by approximately 69% (6 cells) were exposed to live P. acnes (5×107 CUF) overnight. Live P. acnes induced approximately 15∼20% cell death in PBS (vehicle)- or GFP-treated sebocytes, whereas sialidase-treated sebocyte cell death was significantly higher, at 33.5±1.8 % , significantly increased the association of P. acnes with sebocytes along with Freund/(in)complete adjuvants were challenged with live P. acnes (107 CFU) three weeks after vaccination. One ear of each mouse was subcutaneously injected with 25 µl of P. acnes (107 CFU) and the other ear was injected with 25 µl of PBS as a control. Injection of P. acnes induced ear swelling by more than 50% when mice were immunized with sialidase inoculation. Three days after P. acnes inoculation, tissue chamber fluids containing pro-inflammatory cytokines were drawn by percutaneous aspiration and the levels of MIP-2 . These results suggest that a vaccine targeting sialidase effectively suppresses P. acnes-induced production of the pro-inflammatory cytokine MIP-2 in the mice.Induction of pro-inflammatory cytokines also plays a key role in the progression of acne vulgaris. To determine whether sialidase immunization alters the level of er model to colleof MIP-2 and . P. acnes pre-incubated with anti-GFP serum caused 29.3±3.4% of the sebocytes to undergo cell death, while pre-incubation with anti-sialidase serum dramatically reduced P. acnes-induced sebocyte death to 4.5±1.8% (P. acnes in vitro. It has been shown that sebocytes expressed Toll-like receptor 2 (TLR2) and secreted cytokine IL-8 once they were stimulated with P. acnesP. acnes-induced IL-8 production in human sebocytes. Sebocytes stimulated with P. acnes that was pre-incubated with anti-GFP or anti-sialidase serum released IL-8 at the amount of 2.49±0.10 or 1.76±0.08 ng/ml, respectively P. acnes exhibit an increased susceptibility to E. coli lipopolysacharride (LPS) induced sepsis and P. acnes specific sialidase instead of killed P. acnes as the immunogen may be more specific and reduce the chance of side effects. There are at least five sialidases [sialidase B (gi|50843035); cell wall anchored sialidase (gi|50843035); sialidase A precursor (gi|50842172); putative sialidase (gi|50843278) and sialidase-like protein (gi|50843043) in P. acnes genome. Although creation of P. acnes with sialidase mutation or over-expression may directly address the role of sialidase in the virulence of P. acnes, it may be a challenge to genetically alter all sialidases in individual P. acnes. However, developing a novel compound to block the enzyme activities of all sialidases in P. acnes may be of value Inactivation of P. acnes-induced ear inflammation in sialidase- or GFP-immunized mice were excised for homogenization eight days after bacterial challenge (data not shown). P. acnes from the homogenized ears were extracted and quantified on agar plates. The number of P. acnes in sialidase-immunized mice was not significantly different with that in GFP-immunized mice, indicating that sialidase immunization did not change the growth of P. acnes. Considering the data, the sialidase-based acne vaccine presented in this article may decrease P. acnes-induced inflammation without affecting the balance of body microflora.Our data has demonstrated that a sialidase-based acne vaccine provided protective effects on ammation . Ear thiP. acnes a fact that has encumbered the development of anti-acne vaccines and drugs targeting P. acnes infection P. acnes-induced ear swelling and production of pro-inflammatory cytokines in tissue chambers may provide an alternative animal model for evaluating the potency of acne vaccines. Our data indicates that tissue chamber fluid contains various immune cells, including macrophages (CD11b+), neutrophils (Gr-1+), natural killer cells (CD49b+) and T cells (CD3+) (data not shown), suggesting an influx of immune cells into an implanted tissue chamber. In addition, IgG against P. acnes was detectable in tissue chamber fluids (data not shown) when tissue chambers were implanted into heat killed P. acnes-immunized mice. This result indicated that antibodies are able to migrate into tissue chambers to interact with injected P. acnes. By growing cells in a dermis-based cell-trapped system (DBCTS) and inserting into a tissue chamber, we successfully created a tissue microenvironment in vivoP. acnes by TLR2 induces the activation of pro-inflammatory pathways In vivo priming of mice with P. acnes also results in elevated serum levels of TNF-α P. acnes inoculation may reflect a difference in host response between the tissue microenvironment (tissue chamber) and the systemic environment (serum).Most animals including mice do not produce sufficient triglycerides in sebaceous glands to harbor P. acnes. Antibodies against sialidase provoked in vaccinated mice effectively suppressed the P. acnes-induced inflammation establishing therapeutic acne vaccines that may benefit patients with severe acne and (ii) comparing the potency and side effects of sialidase-based vaccines with current medicines.Overall, we present a novel vaccine targeting cell wall anchored sialidase of ammation and 5 anebocytes , implicaFigure S1P. acnes. The gene expression of sialidase was determined by real-time quantitative PCR using specific primers as described in P. acnes served as a template. The gene of triacylglycerol lipase known as a pathogenic factor of P. acnes was used as a positive control. A pGEM-T Easy Vector inserted with PCR products was performed to estimate the number of expressed genes. The level of gene expression of sialidase and triacylglycerol lipase was normalized to that of 16SrRNA gene.Quantitative analysis of the sialidase transcript in (0.56 MB TIF)Click here for additional data file.Figure S2P. acnes. ICR mice were vaccinated with UV-killed P. acnes as described in P. acnes lysates that had been run on a 10% SDS-PAGE. Sialidase and GFP were not immunoreactive to serum obtained from mice immunized with UV-killed P. acnes.Detection of immunogenicity of sialidase in mice vaccinated with UV-killed (0.33 MB TIF)Click here for additional data file.Text S1(0.02 MB DOC)Click here for additional data file.

Scoparia dulcis L. against carbon tetrachloride-induced acute liver injury in mice.The present study was aimed at assessing the hepatoprotective activity of 1:1:1 petroleum ether, diethyl ether, and methanol (PDM) extract of in vitro antioxidant activity using 1, 1-Diphenyl-2-picrylhydrazyl scavenging assay.The PDM extract and standard, silymarin were tested for their antihepatotoxic activity against CCl4-induced acute liver injury in mice. The hepatoprotective activity was evaluated by measuring aspartate aminotransferase, alanine aminotransferase, alkaline phosphatase, and total proteins in serum, glycogen, lipid peroxides, superoxide dismutase, and glutathione reductase levels in liver homogenate and by histopathological analysis of the liver tissue. In addition, the extract was also evaluated for its P < 0.05) and changes in liver histopathology. The above results are comparable to standard, silymarin . In the in vitro 1, 1-diphenyl-2-picrylhydrazyl scavenging assay, the extract showed good free radical scavenging potential (IC 50 38.9 ± 1.0 μg/ml).The extract at the dose of 800 mg/kg, p.o., significantly prevented CCl4-induced changes in the serum and liver biochemistry (Scoparia dulcis L. possesses potential hepatoprotective activity, which may be attributed to its free radical scavenging potential, due to the terpenoid constituents.The results of the study indicate that the PDM extract of Scoparia dulcis linn (family: Scrophulariaceae) is a glabrous under shrub with small white flowers, commonly found on wastelands and fallow fields. This plant is widely used in the indigenous system of medicine for treating liver ailments.[Herbal drugs play a major role in the treatment of hepatic disorders. A number of medicinal plants and their formulations are widely used for the treatment of these disorders.2 In addiailments.4in vitro free radical scavenging activity.Phytochemical screening of the plant revealed the presence of three different types of diterpenoids; labdane-type, scopadulcic acids A B C, and scopadiol; scopadulan-type, scopadulcic acids A and B, and scopadulciol; and aphidicolin-type, scopadulin. It is alSilymarin was a gift sample from Micro Laboratories, Hosur, India. Aspartate amino transferase (ASAT) and alanine amino transferase (ALAT), alkaline phosphatase (ALP) and total proteins (TP), and superoxide dismutase (SOD) and glutathione reductase (GSHR) kits were from RANDOX Laboratories Ltd., United Kingdom. All other chemicals and reagents used were of analytical grade.Scoparia dulcis L. was prepared using PDM, as reported earlier.[The terpenoid extract of earlier. The wholThe PDM extract was analyzed for the presence of phytochemicals by qualitative analysis. It was tThe assay was carried out in 96 well microplates. An extract of 100 μl, and the standard was serially diluted with double distilled water. To all the wells (except for blank) 100 μl of DPPH (100 mM) solution was added and incubated at room temperature for 20 minutes. The absorbance was measured at 490 nm using ELISA reader (BIORAD-550).Swiss albino mice (25-30 g) were procured from an in-house animal facility of J.S.S. College of Pharmacy, Ootacamund. The animals were housed under standard conditions of temperature (22 ± 3°C) and relative humidity (30-70%) with a 12:12 light: dark cycle. The animals were fed with standard pellet diet and water ad libitum. The Institutional Animal Ethics Committee (IAEC) approved the protocol .in vivo antihepatotoxic activity of the PDM extract was carried out against CCl4-induced hepatotoxicity in Swiss albino mice. Thirty-six male Swiss albino mice (30-35 g) were randomized into six groups of six each. Groups 1 and 2 received 0.5% CMC, at a dose of 10 ml/kg, p.o. and served as the normal and control groups, respectively. Groups 3 to 5 received PDM extract at a dose of 50, 200, and 800 mg/kg, p.o., respectively. Group 6 received standard, silymarin 100 mg/kg, p.o. All the groups received assigned treatments for a period of seven days. On day seven all animals except Group 1, received intraperitoneal injection of 50% CCl4 in liquid paraffin (2 ml/kg). Twenty-four hours after CCl4 injection, all the animals were anesthetized using pentobarbitone . The abdominal artery was isolated and about 0.5 ml of blood was collected by using a 24 gauge hypodermic needle. The blood was allowed to clot for 30 minutes at room temperature and the serum was separated by centrifugation at 2500 rpm for 15 minutes and used for biochemical estimations.The After collection of the blood, the liver was removed from each mouse and washed several times with normal saline. Part of the liver was taken for biochemical estimations and the remaining tissue was preserved in 10% v/v formal saline buffer for histopathological analysis.The activities of serum aspartate aminotransferase (ASAT), alanine aminotransferase (ALAT), alkaline phosphatase (ALP), and total proteins (TP) were analyzed using commercial kits, to assess the acute hepatic damage caused by CCl4.The liver tissue was suspended in 10% w/v ice-cold 0.1M phosphate buffer (pH 7.4), cut into small pieces, and the required quantity was weighed and homogenized using a teflon homogenizer. The homogenate was used for the estimation of enzymic, and non-enzymic antioxidants like superoxide dismutase (SOD), glutathione reductase (GSHR), and lipid peroxide level.The liver tissue was collected and immediately fixed in 10% formalin, dehydrated in gradual ethanol (50-100%), cleared in xylene and embedded in paraffin. Sections (4-5 μm) were prepared and then stained with hematoxylin and eosin (H and E) dye for photomicroscopic observations.P < 0.05.The data was represented as mean ± S.E.M. Results were analyzed statistically by one-way ANOVA followed by Dunnett's multiple comparison test using Prism software (Version 4). The minimum level of significance was set at The qualitative phytochemical analysis of the PDM extract showed the presence of terpenoids and phytosterols. The HPTLC densitometric chromatogram of the PDM extract, at 254 nm, showed nine well-resolved peaks .The PDM extract scavenged DPPH radicals in a dose-dependent manner . The extP < 0.05). Standard silymarin at a dose of 100 mg/kg, p.o. also significantly prevented all these changes induced by CCl4 (P < 0.05) [P < 0.05).The PDM extract showed dose-dependent protection against CCl4-induced liver injury. The extract at the highest dose employed, , significantly prevented carbon tetrachloride-induced elevation in serum ASAT, ALAT, ALP, and TP levels and significantly prevented the decrease in SOD, GSHR, and glycogen, and elevation in lipid peroxide levels in the liver tissue ( < 0.05) . The extThe histopathological analysis of the liver tissue also revealed dose-dependent protection against CCl4-induced changes in the liver histology, such as fatty degeneration, lymphatic infiltration, and necrosis. The maximum protection was seen at a dose of 800 mg/kg, p.o. Standard silymarin also showed protective activity against CCl4-induced changes in liver histopathology .in vitro DPPH free radical scavenging activity [in vitro and in vivo antioxidant activities, as has been reported by previous studies.[In the present study the PDM extract has shown dose-dependent hepatoprotective activity against CCl4-induced acute liver injury. The extract at the highest dose employed showed maximum protection against CCl4-induced changes in serum biochemistry, liver antioxidant enzymes, liver peroxide levels, and histopathology. The above activity was comparable to standard, silymarin , Table 2activity , Table 1 studies.–12 The h studies. The hepaScoparia dulcis L has been reported to contain three different types of diterpenoids; labdane-type, scopadulcic acids A B C, and scopadiol; scopadulan-type, scopadulcic acids A and B, and scopadulciol; aphidicolin-type, scopadulin.[The opadulin. The phytopadulin.–16 The fScoparia dulcis L. possesses potential hepatoprotective activity against CCl4-induced acute liver injury and this may be attributed to its free radical scavenging potential, by the terpenoid content.The results of the present study indicate that the PDM extract of

In conflict tasks such as the Stroop, the Eriksen flanker or the Simon task, it is generally observed that the detection of conflict in the current trial reduces the impact of conflicting information in the subsequent trial; a phenomenon termed conflict adaptation. This higher-order cognitive control function has been assumed to be restricted to cases where conflict is experienced consciously. In the present experiment we manipulated the awareness of conflict-inducing stimuli in a metacontrast masking paradigm to directly test this assumption. Conflicting response tendencies were elicited either consciously (through primes that were weakly masked) or unconsciously (strongly masked primes). We demonstrate trial-by-trial conflict adaptation effects after conscious as well as unconscious conflict, which could not be explained by direct stimulus/response repetitions. These findings show that unconscious information can have a longer-lasting influence on our behavior than previously thought and further stretch the functional boundaries of unconscious cognition. Masked priming studies have revealed a plethora of effects of masked stimuli on behavior and brain activity, highlighting an important role of unconscious information in guiding day-to-day behavior correspondence effectn–1 influenced cognitive control mechanisms on trial n , in such a way that the correspondence effect on trial n was smaller when trials were preceded by an incongruent trial compared to a congruent trial; here referred to as conflict adaptation.This phenomenon was elegantly illustrated by Kunde These results are generally interpreted by assuming that, following the detection of conflict, PFC-driven cognitive control processes resolve conflict and increase future performance by increasing top-down control over sensory processes However, recently, we Here we test whether conflict adaptation can also be triggered unconsciously. In Kunde's experiment All procedures were executed in compliance with relevant laws and institutional guidelines and were approved by the ethics committee of the Psychology department of the University of Amsterdam. Subjects gave written informed consent before experimentation.Fifty-eight volunteers participated in a battery of tests (2 h) including the one described in the current paper (½h) for course credits or financial compensation. Non-overlapping results from this dataset have been published elsewhere weakly masked condition), or its visibility was sharply reduced (strongly masked condition). Thus, four conditions were created: 1) weakly masked incongruent trials, 2) weakly masked congruent trials, 3) strongly masked incongruent trials, and 4) strongly masked congruent trials. Participants performed four blocks, each containing 160 trials . Total trial duration was 1400, 1500, 1600 or 1700 ms . Before the experiment participants practiced the task briefly . Performance feedback was presented after each block .Stimuli were presented against a white background at the centre of a 17-inch VGA monitor (frequency 70 Hz.), which was viewed from a distance of approximately 90 cm . A blue prime arrow was presented for 14 ms or 129 ms, followed by a blank interval (29 ms), and then by a target arrow that instructed participants to respond as quickly and accurately as possible to its direction . ParticiAfter the main task, participants performed a two-alternative forced-choice discrimination task on the primes . Stimulus and trial timing was exactly the same as in the main task, except that a pair of choices was presented left and right of fixation after each trial. Participants were asked to determine as accurately as possible whether a left-pointing or right-pointing prime was presented in the preceding trial. Before administrating this task, participants were told that left and right pointing primes were presented equally frequently and were instructed to consider this in giving their response. Accuracy was important in this task, not the speed of responding. Upon responding a new trial started.n (congruent vs. incongruent), masking strength in trial n (weakly masked vs. strongly masked), prime–target correspondence in trial n-1 and masking strength in trial n-1 RTs <100 and >1000 were excluded from the analysis. Mean RTs on correct trials and square rooted accuracy rates were entered into an ANOVA with within-subjects' variables of prime–target correspondence in trial t(41)  = 5.46, p<0.001).The two-alternative forced-choice discrimination task administrated after the main task revealed that 42 out of 58 (72%) participants were unable to perceive the strongly masked primes, as evidenced by chance-level performance . Because we cannot ascertain that the other 16 participants were truly unable to perceive the strongly masked primes consciously, they were excluded from further analyses. For the remaining 42 participants the percentage correct for weakly masked primes was 91.8% (SD = 12.6) vs. 54.8% (SD = 5.7) for strongly masked primes. Although prime discrimination was close to 50% when strongly masked, on a group level, it was significantly above chance-level  = 355.3; p<0.001) and also slower after experiencing conflict in the previous trial  = 216.8; p<0.001). Furthermore, participants responded slower after a conscious prime in trial n-1  = 157.1; p<0.001) and faster on trials with a conscious prime in trial n  = 116.8; p<0.001).Mean RTs and error rates of all factorial combinations of the included variables are presented in n was smaller when trials were preceded by an incongruent trial than when trials were preceded by a congruent trial  = 78.8; p<0.001). This demonstrates conflict adaptation irrespective of prime awareness. Crucially, follow-up analyses revealed significant conflict adaptation effects for all possible combinations of masking strength in trial n-1 and masking strength in trial n . However, conflict adaptation was stronger when trials were preceded by a weakly masked prime (conscious) than by a strongly masked prime (unconscious), as reflected in a 3-way interaction between prime-target correspondence in trial n, prime-target correspondence trial n-1 and masking strength in trial n-1  = 17.1; p<0.001). Finally, we observed a 4-way interaction between prime-target correspondence in trial n, prime-target correspondence trial n-1, masking strength in trial n-1 and masking strength in trial n  = 6.0; p = 0.019), indicating that conflict adaptation was largest when conscious primes in trial n-1 were followed by conscious primes in trial n.As expected, the size of the correspondence effect in trial n, F  = 140.8; p<0.001). Furthermore, participants made more errors when trial n-1 contained an unconscious prime  = 46.4; p<0.001) and more errors when trial n contained a conscious prime  = 133.3; p<0.001). They made less errors after experiencing conflict in the previous trial  = 61.5; p<0.001).The error analyses mirrored the RT analyses reported above. Participants made more errors on incongruent than on congruent trials was smaller when trials were preceded by an incongruent trial than when trials were preceded by a congruent trial  = 58.9; p<0.001). Follow-up analyses revealed significant conflict adaptation effects for all possible combinations of masking strength in trial n-1 and masking strength in trial n  = 9.6; p = 0.004). Finally, conflict adaptation was largest when conscious primes in trial n-1 were followed by conscious primes in trial n as reflected in a 4-way interaction between prime-target correspondence in trial n, prime-target correspondence in trial n-1, masking strength in trial n-1 and masking strength in trial n  = 7.5; p = 0.009).Again, the size of the correspondence effect in trial change trials), whereas in a second subset only trials with direct stimulus/response repetitions were included . The correspondence effect for RTs and errors as a function of prime-target correspondence in trial n-1, masking strength in trial n-1 and masking strength in trial n and dataset (repeat versus change) is depicted in n, prime-target correspondence in trial n-1 and dataset for RTs  = 2.6; p = 0.11) as well as error rate  = 0.21; p = 0.65). Although, two-choice experiments do not allow a full-proof test against low-level priming effects these additional analyses as well recent other studies [e.g. 29] suggest that conflict adaptation cannot be fully explained by low-level priming effects.It is controversial whether these conflict adaptation effects are truly due to regulatory changes in cognitive control or whether they reflect mere lower-level priming effects n-1 was due to incidental visibility of the primes, we performed several additional analyses. First, we correlated the conflict adaptation effect for all trials with an unconscious prime in trial n-1 with detection performance across participants to check whether both measures were related. Conflict adaptation (RTs or error rates) did not correlate with detection performance . Additionally, we selected the 50% (21 participants) worst detection performers (mean percentage correct = 50.1%) and tested conflict adaptation across these “poor detectors”. For this group, conflict adaptation effects were highly similar compared to the whole group. Crucially, conflict adaptation for trials preceded by strongly masked (unconscious) primes were still significant for RTs  = 5.5, p = 0.030; prime n unconscious: F  = 4.5, p = 0.047) and error rates  = 5.4, p = 0.031; prime n unconscious: F  = 3.3, p = 0.085). Also, conflict adaptation after conscious (weakly masked) primes remained significant for RTs and error rates irrespective of masking strength in trial n . These results further suggest that conflict adaptation effects can be induced by strongly masked primes that cannot be perceived consciously.To rule out the possibility that conflict adaptation triggered by strongly masked primes in trial n was sharply reduced after incongruent compared to congruent trials in trial n-1 (for response times as well as error rates). Crucially, conflict adaptation was also present after unconsciously induced conflict. These findings suggest that participants engender a more cautious response strategy and increase cognitive control after the experience of conscious, but also unconscious conflict-inducing stimuli.We report that unconsciously induced conflict can elicit conflict adaptation in the next trial. In a masked priming experiment, we focused on behavioral adaptations following conflict resulting from incongruent trials compared to behavioral adaptations after trials on which no conflict was experienced . Conflicting response tendencies were elicited either consciously (weakly masked primes) or unconsciously (strongly masked primes). We replicated the standard conflict adaptation effect for conscious conflict; the correspondence effect in trial Generally, conflict adaptation is interpreted by assuming that, following conflict, cognitive control processes subserved by the PFC resolve conflict and increase future performance by increasing top-down control over perceptual processes Interestingly, using a similar design, Kunde Although speculative since we did not obtain any neural measures here, recent studies did observe relatively long-lasting neural activations elicited by masked (unconscious) words in a masked priming paradigm, up to approximately one second In sum, we show that unconsciously experienced conflict-inducing stimuli can trigger conflict adaptation (under specific conditions). These results add to the growing body of literature suggesting that unconscious information can influence high-level cognitive control functions, such as inhibitory control

The crystal structure features supra­molecular chains mediated by O—H⋯O hydrogen bonds, which propagate in the a-axis direction. A C—H⋯O inter­action consolidates the chains. Disorder was resolved for one of the isopropyl groups with a 0.60 (2):0.40 (2) occupancy ratio for the two components.In the title compound, C Å b = 15.931 (3) Å c = 18.273 (4) Å V = 1696.2 (6) Å3 Z = 4 Kα radiationMo −1 μ = 0.20 mmT = 173 K 0.31 × 0.15 × 0.06 mm Rigaku AFC12/SATURN724 diffractometerABSCOR; Higashi, 1995T min = 0.790, T max = 1Absorption correction: multi-scan (6049 measured reflections3391 independent reflectionsI > 2σ(I)3248 reflections with R int = 0.027 Standard reflections: 0 R[F 2 > 2σ(F 2)] = 0.049 wR(F 2) = 0.117 S = 1.04 3391 reflections211 parameters1 restraintH-atom parameters constrainedmax = 0.48 e Å−3 Δρmin = −0.43 e Å−3 ΔρAbsolute structure: Flack 1983, 1354 FrFlack parameter: −0.11 (13) CrystalClear used to solve structure: SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008DIAMOND (Brandenburg, 2006publCIF (Westrip, 2009Data collection: 10.1107/S160053680905260X/hb5270sup1.cif Crystal structure: contains datablocks global, I. DOI: 10.1107/S160053680905260X/hb5270Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

Acute urinary retention (AUR) is one of the most significant, uncomfortable and inconvenient event in the natural history of benign prostatic hyperplasia (BPH). The immediate treatment is bladder decompression using urethral or suprapubic catheterization. Several factors have been identified that are associated with or precipitate AUR. It is useful to classify AUR as BPH-related or not, than spontaneous or precipitated when the initial management is considered. Use of prophylactic 5 a-reductase inhibitors can prevent AUR in men with BPH having moderate to severe lower urinary tract symptoms and large prostate size. Alpha blockers can prevent AUR in symptomatic BPH patients and also facilitate catheter removal following episodes of spontaneous AUR. Anticholinergics can be safely combined with alpha blockers in symptomatic BPH patients without increasing the risk of AUR. Surgical treatment carries a higher rate of morbidity and mortality in men presenting with AUR compared to those presenting with symptoms alone. Urgent prostatic surgery after AUR is associated with greater morbidity and mortality than delayed prostatectomy. Alpha blockers mainly help to delay the surgery and may avoid surgery altogether in a subgroup of patients. TURP remains the “gold standard” if a trial without catheter fails. Alternative minimally invasive procedures can be considered in poor-risk patients, but its value is yet to be established. Acute urinary retention (AUR) represents one of most significant and painful events in the natural history of benign prostatic hyperplasia (BPH). Up to a third of patients undergoing surgical treatment for BPH present with acute urinary retention (AUR). Acute urTen per cent of men in their seventies and 30% in their eighties will have AUR within the next five years. Men withet al. reported from a large database of 165,527 men who presented with AUR, how the incidence of primary and recurrent AUR changed in England between 1998 and 2003. The incidence of primary AUR was 3.06/1,000 men yearly. The incidence of AUR decreased from 3.17/1,000 men yearly in 1998 to 2.96/1,000 men yearly in 2003. Surgical treatment following spontaneous AUR decreased from 32% in 1998 to 26% in 2003. This trend coincided with a 20% increase in the rate of recurrent AUR. The slight decrease in the incidence of primary AUR suggests that the shift away from surgical treatment of BPH has not resulted in an increase in the AUR. The increase in recurrent AUR suggests that the observed decrease in surgery after AUR might have put more men at risk for AUR recurrence.[Cathcart et al. reported that at one year, 85% of men had undergone surgical intervention following an episode of AUR.[et al. analyzed data from 5,792 men with BPH-related symptoms on medical management and reported that prior AUR is a strong predictor of recurrent AUR with a hazard ratio of 3.75% (95% CI 1.58 to 8.89).[Men who experience an episode of AUR are at higher risk for subsequent episodes of AUR. The likelihood of a second episode of AUR following a Trial without catheter (TWOC) ranges from 38-56%. It depends on the post void residual urine (PVR), prostate size and the time interval between catheter insertion and the TWOC. Klarskove of AUR. Because to 8.89).Broadly, the causes of AUR can be classified into three categories; any event which increases the resistance to the flow of urine, interruption of bladder innervation and any situation which causes the bladder to over-distend. The precise mechanism which precipitates AUR in BPH has not been fully described. The following factors were thought to be responsible for the occurrence of AUR in BPH.et al. reported a higher incidence of prostatic inflammation in men with AUR than in those having LUTS only (54.7% vs. 28.9%).[Prostatic inflammation may be an important predictor of disease progression, especially the first occurrence of AUR. Tuncel . 28.9%). In the M. 28.9%). Almost a. 28.9%).Spiro and colleagues found evidence of infarction in 85% of prostates removed for AUR versus only 3% in prostates of men having surgery for LUTS. ProstatiIn a prospective controlled clinico-pathological study comparing 35 patients who presented with AUR secondary to BPH and 35 patients with only refractory LUTS, those presenting with AUR had a significantly higher epithelial component (71% vs. 60%) than patients with LUTS only. Differential epithelial/stromal growth may predispose to infarction through effects on the vascular supply which may result in AUR. This may help to explain why finasteride, which mainly acts on epithelial tissue, can decrease the incidence of AUR.It is commonly thought that constipation will precipitate an episode of urinary retention, whilst published evidence that this occurs in adults in the absence of bladder outlet obstruction, neurological disease or fecal impaction is scarce. In the Alfuzosin in Acute Urinary Retention (ALFAUR) study a careful history of bowel habits was taken from 363 men presenting with AUR related to BPH. A history of constipation did not influence whether or not a trial of voiding was successful. Therefore a history of constipation, as opposed to fecal impaction, should not affect how AUR is to be managed. But it may provide an indicator of how the patient will fare in the longer term in terms of need for surgery and recurrent AUR.et al., AUR was found to be associated with increasing age and an intravenous infusion > 750 ml. The combination of suppressed consciousness and fluid infusion lead to the development of AUR. Postoperative AUR occurs whether or not BPH is present.[It is accepted that anesthesia, analgesia, intravenous fluids and pain may lead to the development of postoperative AUR. In a study by Hawa present.Acute urinary retention may develop following genitourinary diagnostic procedures, such as cystoscopy, biopsy of the prostate and ureteroscopy. Rigid cystoscopy precipitates AUR by causing irritation to lower genitourinary tissues and hematuria. Flexible cystoscopy has now replaced rigid cystoscopy, it causes less trauma and irritation and fewer cases of AUR. Prostatic biopsies performed using large Tru-cut needles under digital control result in significant trauma to the prostate leading to swelling, hematoma and hematuria which may in turn result in AUR. When prostatic biopsies are performed under TRUS guidance using much smaller biopsy needles AUR is extremely rare. Acute urThe neurological impact of a stroke is associated with impaired bladder emptying which may manifest as AUR. Anecdotal evidence supports that alcohol ingestion can precipitate AUR. The mechanisms involved are likely to be a combination of neurological suppression and fluid overload. Alcohol ingestion and CVA may lead to AUR in the presence or absence of BPH.Urinary tract infection in the male may complicate or precipitate AUR. Urinary tract infection may arise as a complication of poor bladder emptying secondary to BOO. A full assessment of voiding function is required when a man presents with AUR and UTI.et al. demonstrated that tolterodine could safely be taken in combination with an alpha blocker in patients with urodynamically proven BOO, without the development of AUR.[et al. have demonstrated that anticholinergic use in BPH patients leads to a small increase in the post-void residual (PVR) without significantly increasing the risk of AUR.[Specifically, cholinergic antagonists and alpha-adrenergic agonists may precipitate urinary retention by inhibiting detrusor contractility and enhancing bladder outlet resistance, respectively. Medications administered for depression, allergies, Parkinson's disease and overactive bladder have anticholinergic properties. Alpha-agonists are a common component of over-the-counter cold remedies. A study by Athanasoupolos t of AUR. Reynard k of AUR. Both theA population-based prospective case-control study of men >45 years to examine the role of NSAID use in AUR in the Netherlands documented that compared with nonusers of NSAIDs current users of NSAIDs had a 2.02-fold higher risk of AUR. Patients who recently started taking NSAIDs at a dose equal to or higher than the recommended daily dose had the highest risk for AUR . Past use of NSAIDs was not associated with increased rate of AUR. NSAIDs are known to have a direct effect on prostaglandin synthesis which plays an important role in contractions of the detrusor muscle.The factors which are considered as predictors of AUR in BPH can be divided into baseline and dynamic variables. Baseline variables are age, severe LUTS, low peak urinary flow rate, increased post-void residual urine volume (PVR), enlarged prostate, high serum PSA levels and previous conservatively managed AUR. The dynamic variables are worsening of IPSS >4 points, bothersome score > 3 points during treatment, increasing PVR, no response to alpha blockers. These dynamic variables can be actively monitored during the treatment period to predict the occurrence of AUR and assess the need for BPH surgery.When dealing with a case of AUR in adult men, the use of the terms ‘precipitated’ or ‘spontaneous’ may be confusing if not qualified properly. It is very important to assess whether or not BPH is implicated in the etiology. In the vast majority of cases, AUR appears simply related to the natural history of BPH. If BPH is thought to be present, then the management is likely to involve a trial without catheter following administration of an alpha blocker. The presence of a factor that is considered to have precipitated or provoked the episode of AUR may influence the outcome in the longer term but there is little evidence that it alters the likelihood of a successful trial of voiding. Consequently, spontaneous and precipitated AUR may be considered to be the same when they are BPH-related, as the approach to initial management need not be altered.There is high variability among countries in real-life practice, in terms of duration of catheterization, hospital admission, management after a failed trial without catheter (TWOC) and emergency or delayed surgery.et al. compared the outcome for three years after catheterization in 86 consecutive patients. Of the 30 patients catheterized perurethrally, 40% had a UTI . Seventeen per cent of the patients catheterized urethrally developed urethral strictures, compared with none in the SPC group. A TWOC in seven of 11 patients who had been catheterized urethrally proved unsuccessful. Suprapubic catheterization was associated with less UTI (18% vs. 40%), less urethral stricture (0% vs. 17%), avoided urethral and bladder neck damage. Another advantage of the SPC is that the catheter can be clamped rather than removed while undergoing a TWOC, which avoids re-catheterization in case of failures. But SPC resulted in higher pain, hematuria and blockage of catheter.[In a survey of 410 consultant urologists in the UK, urethral catheterization was used most often (98% of cases), with suprapubic catheter (SPC) only being used in failures for the management of AUR. In anothcatheter. The compIn a comparative trial between indwelling catheter (IDC) vs. clean intermittent self-catheterization (CISC), the CISC group had a higher rate of spontaneous voiding than the IDC group (56% vs. 25%). The incidence of UTI was 32% in the CISC and 75% in the IDC group. After TURP, 20% in the CISC group had a UTI, compared with 69% in the IDC group. The majoet al randomized men with AUR into three groups: in-and-out catheterization and dependent catheter drainage for two or seven days. On catheter removal, 44%, 51% and 62%, respectively, voided successfully. Patients who had retention volumes of >1300 mL benefited most from prolonged catheterization.[Djavan rization. But prolAfter catheterization, patients may be hospitalized or sent home and reviewed in the outpatient clinic. Country-specific differences in the percentage of patients hospitalized for AUR were found in a ‘real-life’ practice study conducted in various parts of the world. Most men presenting with AUR were hospitalized in France (69%) and Russia (80%), whereas few were admitted to the hospital in Mexico (22%), Denmark (25%) or the Netherlands (27%). In the r2O), a drained volume of < 1L at catheterization, an identified precipitating factor and prolonged catheterization are usually associated with a greater success rate of TWOC. Nevertheless, catheterization for > three days is associated with significantly higher comorbidity and double the rate of prolonged hospitalization than in men catheterized for < three days. There is increasing evidence that immediate treatment by bladder decompression can effectively be followed by a TWOC, which involves removing the catheter after one to three days, allowing the patient to void successfully in 23-40% of cases and surgery, if needed, to be performed later.In the UK survey, 73.9% of men catheterized for AUR had a trial without catheter (TWOC), usually after two days of catheterization, while only 2.9% had immediate surgery. With failure of TWOC, 68.7% were re-catheterized with delayed surgery and 11.7% had a subsequent further TWOC later. In the French survey also, TWOC was standard, being used in 72.8% of cases after a median of three days of catheterization. If the TWOC failed most men (57.5%) were re-catheterized and had elective surgery. Some factors influence the success of a TWOC; lower age (< 65 years), high detrusor pressure . Among 3228 patients treated with IR-alfuzosin for three years, the incidence of AUR with alfuzosin was only 0.3% vs. 2-3% in the watchful waiting group. Emberton M ectively.et al showed that alfuzosin, when administered for two consecutive days in patients with AUR, was associated with a significantly higher rate of successful voiding after removing a catheter (on the second morning of treatment) than was a placebo (55% vs. 29%).[Several trials have been conducted assessing the ability of alpha blockers to improve the outcomes of TWOC (secondary prevention of AUR). McNeill vs. 29%). In the Aet al. compared the rates of AUR and prostate surgery in BPH patients treated with the two currently available 5ARIs, dutasteride and finasteride. After controlling for background covariates, dutasteride-treated patients were 49.1% less likely to experience AUR than patients treated with finasteride (P=.0207). Patients treated with dutasteride were also less likely to undergo prostate-related surgery, (1.4% of dutasteride-treated patients and 3.4% of finasteride-treated patients).[5-alpha reductase inhibitors reduce the prostate size by acting on the epithelial component of the BPH. In a double-blind, randomized, placebo-controlled trial which studied 3040 men with moderate to severe LUTS and enlarged prostate glands who were treated daily with 5 mg of finasteride or placebo for four years, AUR developed in 99 men (7%) in the placebo group and 42 men (3%) in the finasteride group. There was 57% reduction in risk with finasteride. In a laratients).et al., from a retrospective analysis of 341 patients reported the incidence of AUR in BPH patients receiving alpha blockers alone and combination of alpha blocker and a-alpha- reductase inhibitor. In the alpha blocker group 17.7% patients and 12.1% in the combination group experienced AUR (P < 0.05).[The MTOPS trial is the largest and longest clinical study of medical therapy for BPH to date. A total of 3047 men were randomized to receive placebo, finasteride, doxazosin or combination therapy for a mean of 4.5 years. The reductions in risk of AUR in the finasteride, doxazosin and combination groups were 68%, 35% and 81%, respectively. The risk reductions for surgical intervention in the finasteride, doxazosin and combination groups were 64%, 34% and 67%, respectively. The MTOPS study hence confirmed that combined medical treatment significantly reduces the risk of progression to AUR and the need for surgical intervention in BPH patients. Kim CI < 0.05).Acute urinary retention was once considered an absolute indication for prostatectomy. A report by the National Prostatectomy Audit Steering Group offers a unique look at the outcomes of prostate surgery in men with AUR. In five UK healthcare regions, 3966 prostatectomies were performed in 56 hospitals by 103 surgeons. The 1242 patients presenting with AUR were older and had larger glands and more comorbidities. The patients with AUR had an excess risk of death at 30 days and at 90 days after surgery . In addition, the risk of intra- and perioperative complications was higher in the AUR group. It has also been found that immediate prostate surgery is associated with increased perioperative complications than delayed surgery in patients presenting with AUR. But bacterial colonization of a urinary catheter is significantly greater after three days of catheterization and can result in major morbid events such as fever and possible progression to bacteremia. Hence in BPH patients presenting with AUR, it is essential to delay the surgical treatment by initially offering TWOC following the use of alpha blockers.et al. prospectively assessed 58 patients with AUR using the International Prostate Symptom Score and pressure-flow studies at a median (range) of 24 (13-60) days after the episode of retention and before transurethral resection of the prostate. It was found from the study that absence of bladder instability, inability to void during the pressure-flow study and a maximal detrusor pressure of < 20 cmH2O are associated with a poor outcome after prostatectomy. Hence in patients with AUR, pressure-flow studies undertaken after a period of adequate bladder rest are useful in predicting the surgical outcome.[Some patients with AUR due to BPH do not have successful outcome after prostatectomy and require either a chronic indwelling urethral catheter or clean intermittent catheterization. To investigate the utility of “late” pressure-flow studies in predicting the outcome of prostatectomy for AUR, Dubey outcome.Human prostate tissue produces endothelin and in the presence of smooth muscle, contractions have been observed which are not inhibited by a-blockers. Recently, a new orally active endothelin antagonist was found to inhibit endothelin-induced prostatic contractions in a dose-dependent way.et al., to treat 17 patients with BPE, 15 of whom had AUR. The mean peak urinary flow rate increased from 2.0 mL/s before placement to 12.9 mL/s afterward, during a mean follow-up of seven months. Combined therapy comprising a bioabsorbable self-reinforced poly L-lactic acid (SRPLLA) urethral stent and finasteride was studied in 11 men with AUR who were treated as outpatients. All of them had a suprapubic catheter inserted and the SR-PLLA stent was placed cystoscopically. The patients were allowed to attempt to void spontaneously after two days. All patients voided spontaneously within two weeks. There was a steady improvement in urinary flow rates up to nine months, followed by a slight impairment after the bioabsorption of the stent. During the mean (range) follow-up of 24 (23±26) months only three patients required surgical treatment. The bioabsorbable stent keep the bladder outlet open till the time finasteride starts to reduce the size of the prostate.[Patients with AUR are often elderly men with several coexisting diseases, which multiply the risks of surgery. Alternative modes of treatment for AUR thus need to be studied. A thermosensitive nitinol (Memokath H) urethral stent was used in the study reported by Kiyota prostate.

A sedentary lifestyle increases the risk of developing cardiovascular disease, obesity, and diabetes. This phenomenon is supported by recent studies suggesting a chronic, low-grade inflammation status. Endotoxin derived from gut flora may be key to the development of inflammation by stimulating the secretion of inflammatory factors. This study aimed to examine plasma inflammatory markers and endotoxin levels in individuals with a sedentary lifestyle and/or in highly trained subjects at rest. Methods: Fourteen male subjects were recruited. Blood samples were collected after an overnight fast (~12 h). The plasmatic endotoxin, plasminogen activator inhibitor type-1 (PAI-1), monocyte chemotactic protein-1 (MCP1), ICAM/CD54, VCAM/CD106 and lipid profile levels were determined.Endotoxinemia was lower in the highly trained subject group relative to the sedentary subjects (p < 0.002). In addition, we observed a positive correlation between endotoxin and PAI-1 , endotoxin and total cholesterol , endotoxin and LDL-c and endotoxin and TG levels . The plasma levels of MCP-1, ICAM/CD54 and VCAM/CD106 did not differ.These results indicate that a lifestyle associated with high-intensity and high-volume exercise induces favorable changes in chronic low-grade inflammation markers and may reduce the risk for diseases such as obesity, diabetes and cardiovascular diseases. A sedentary lifestyle increases the risk of developing cardiovascular disease and diabetes ,2, as weIn recent years, it has been hypothesized that the microbial ecology in humans could be an important factor in energy homeostasis -10. LipoLeuwer et al. have shoWhereas limited data have been presented on the increased levels of endotoxin in pathological conditions such as obesity, diabetes and fatty liver, to date, no studies have compared sedentary and highly trained subjects. Therefore, the objective of the present study was to correlate the plasma levels of endotoxin and inflammatory markers between sedentary and highly trained subjects. We hypothesized that individuals that performed large amounts of exercise (moderate/high intensity and long duration) would demonstrate lower levels of endotoxin and inflammatory markers compared to sedentary subjects.Fourteen healthy, non-smoking men participated in this study. The subjects were sedentary (n = 7) or highly trained athletes in cycling (n = 7) . The physical and training characteristics of both groups have been described previously by Lira et al. [®, São Paulo, Brazil). LDL cholesterol was calculated according to Friedewald et al. [A catheter was inserted in a brachial vein to collect venous blood samples. The blood samples (10 ml) were immediately transferred into two 5-ml vacutainer tubes containing EDTA for plasma separation. The tubes were centrifuged at 3000 × g for 15 minutes at 4°C, and plasma samples were stored at -80°C until analysis. Triglycerides and total cholesterol were assessed using commercial enzymatic kits test, which is a quantitative test for Gram-negative bacterial endotoxin . Gram-negative bacterial endotoxin catalyzes the activation of a proenzyme in the LAL. The initial rate of activation is directly determined by the concentration of endotoxin. The activated enzyme catalyzes the splitting of p-nitroaniline (pNA) from the colorless substrate Ac-lle-Glu-Ala-Arg-pNA. The pNA released was measured photometrically at 405-410 nm following termination of the reaction. The correlation between the absorbance and the endotoxin concentration is linear in the range of 0.1-1.0 EU/ml. For the purposes of this study, all samples were run in duplicate within the same plate; therefore, no interassay variability was observed.E. coli origin) was used to generate a standard curve with the chromogenic LAL test kit from Cambrex according to the manufacturer's instructions.To assess the recovery of endotoxin within the assay, known concentrations of recombinant endotoxin (0.25 and 1.00 EU/ml) were added to diluted plasma to determine whether the expected concentration correlated closely with the actual observed value and whether there were any variations due to reactivity with plasma contents. Lyophilized endotoxin software, and the significance level was set at p < 0.05.The subjects demonstrated similar heights, body masses, and body mass indices Table . The weeTable In addition, positive correlations between endotoxin and PAI-1 (r = 0.88; p < 0.0001 - Figure The results of the present study indicate that endotoxin levels may be associated with the lifestyle of the subject. Highly trained subjects that performed large amounts of exercise demonstrated lower levels of plasmatic endotoxin than did the subjects with a sedentary lifestyle. In addition, the plasma PAI-1, total cholesterol, LDL-c and TG concentrations were positively correlated with endotoxin levels. Previous studies have demonstrated that endotoxin levels are elevated in some conditions, such as obesity, diabetes and cardiovascular and fatty liver diseases.Systemic low-level inflammation has been suggested to be a cause and a consequence of pathological processes associated with the production of local pro-inflammatory molecules functioning as an important biological driver . In the The data presented herein demonstrate for the first time that highly trained subjects show lower endotoxin levels compared to sedentary subjects.Creely et al. found thMany studies -16 have The protective effect of regular exercise against diseases associated with chronic inflammation may be, to some extent, ascribed to an anti-inflammatory effect that reinforces anti-inflammatory responses. Indeed, it has been suggested and demonstrated by Pedersen's group that cytokines and other peptides are expressed and released by contracting muscle fibers, and they function in a paracrine or endocrine manner and are classified as "myokines" . In a prStarkie et al. demonstrAnother factor of interest in the present study was the correlation between the lipid profiles and endotoxin levels. These interrelations may contribute to the development of cardiovascular diseases and fatty liver. Alvarez and Ramos observedThe limitations of this study include the relatively small numbers of subjects in each of the groups and the lack of subjects with cardiovascular and other diseases.In summary, our results indicate that sedentary subjects present a favorable state that leads to hypertriglyceridemia and hypercholesterolemia accompanied by high endotoxin levels. In contrast, the performance of highly trained subjects and large amounts of exercise significantly reduced the possibility of risk for cardiovascular diseases.The authors declare that they have no competing interests.FSL, JCR, GDP, HAS, ECC, MCS, LCC, MTM, ARD, LMO and RVTS participed the sample collected, assess samples, design of the study and performed the statistical analysis, and writing of paper. All authors read and approved the final manuscript

Protein conformation and protein/protein interaction can be elucidated by solution-phase Hydrogen/Deuterium exchange (sHDX) coupled to high-resolution mass analysis of the digested protein or protein complex. In sHDX experiments mutant proteins are compared to wild-type proteins or a ligand is added to the protein and compared to the wild-type protein (or mutant). The number of deuteriums incorporated into the polypeptides generated from the protease digest of the protein is related to the solvent accessibility of amide protons within the original protein construct.In this work, sHDX data was collected on a 14.5 T FT-ICR MS. An algorithm was developed based on combinatorial optimization that predicts deuterium exchange with high spatial resolution based on the sHDX data of overlapping proteolytic fragments. Often the algorithm assigns deuterium exchange with single residue resolution.With our new method it is possible to automatically determine deuterium exchange with higher spatial resolution than the level of digested fragments. In the solution-phase Hyrdogen/Deuterium ex-change (sHDX) experiment, protein surface accessibility is probed by exchange of labile hydrogen for deuterium. Simply speaking, hydrogens located at solvent exposed sites exchange at a higher rate with deuteriums from the solution than others. From these exchange rates one can therefore deduce information about protein solvent accessibility and thus protein conformation.D2O solvent on the conformation of proteins. Sheu et al. [D2O versus H2O. This small compaction of the conformation occurs when the pep-tide is fully deuterated (which is never observed in the sHDX experiments). Since sHDX monitors the incorporation of deuterium over time the resulting slight compaction of the structure is minimized. Other methods used for the study of protein/protein interaction or protein conformation such as cross-linking [There is controversy surrounding the effect of u et al. used mol-linking or hydro-linking -6 resultkD). Solution-phase HDX with mass spectrometry analysis has higher sensitivity and is not limited by molecular weight, but sHDX is hampered with a major difficulty. One only obtains exchange data for peptic fragments and assigning exchange rates to single residues has to be done by manual interpretation.NMR spectroscopy has been the gold standard for determination of protein structure, but it has limitations on protein solubility and molecular weight [Another method utilizes hydroxyl radical reactions with alkyl otein(s) ,6. The mExchange of labile hydrogens for deuteriums (sHDX) as a probe of protein surface accessibility does not change the conformation of the protein. Advantages of MS over NMR and X-ray crystallography structural determination are the ability to work at low concentration and high molecular weight.D2O. Solvent accessible hydrogens are exchanged with deuterium. The exchange is quenched (greatly slowed) by dropping the pH to between pH 2.3 and pH 2.5 and lowering the temperature to approximately 0°C. The protein complex is digested with a protease that is active under quench conditions (such as pepsin) and on-line liquid chromatography is performed directly to the FT-ICR MS. Deuterium in corporation is monitored by the increase in mass of each peptic fragment as the deuterons are added.The experiment is initiated by dilution of the protein solution into a biological buffer made with These data sets are large, often with many over-lapping proteolytic fragments. From these data, the exchange rate is easily determined for the same peptic fragments from the protein and the protein/protein complex all oth manual in residues of a protein from1 to n, beginning at the N-terminal residue and ending at the C-terminal residue. The set of peptic fragments resulting from the digestion of the protein is captured by a set ℱ of integer intervals := {k ∈ ℕ | i ≤ k ≤ j}, for two positive integers i, j with i ≤ j, representing the endpoints of the corresponding fragment. In other words, the peptic fragment represented by spans residues i, i+1, ..., j. Furthermore, K denotes the number of different classes of exchange rates, arising from the discretization of the experimentally measured deuterium uptake rates [K distinct classes of exchange rates, to which we simply refer as colors in the following, are represented by set K and identify in the following the colors by their respective number. The experimentally found bulk information of how many residues within each fragment ∈ ℱ fall into each of the exchange rate categories is given by "requirement" integers i, j) ∈ ℱ and each color k ∈ bk of "requirements" with respect to color k, indexed by fragments from, ℱ the right hand side for color k. In our experimental data, exactly three different colors are distinguished , i.e. K = 3. However, our method is not restricted to this case.In this section, we present our mathematical model for the assignment of exchange rates to residues. A brief overview of the introduced terms and symbols can be found in Table ke rates . The K dThe mathematical notion introduced above is illustrated in Figure n}, representing the residues of the protein, that complies with the constraints imposed by the "requirements" π : {1, ..., n} ↦ i ≤ l ≤ j : π(l) = k}| = i, j) ∈ ℱ and all possible colors k ∈ feasible.Determining the exchange rate of single residues from the experimentally found data for the peptic fragments then translates into finding a "consistent" assignment of colors from i, j) and over-lap, if they share at least one common residue, i.e. ∩ ≠ ∅. The partition of the set of fragments ℱ into a maximum number of subsets, such that no two fragments from different subsets overlap, defines independent subproblems; an assignment of exchange rates to the residues spanned by the fragments of one subset does not affect the solution of a subproblem corresponding to any other subset of fragments.We say that two fragments ∈ ℱ with respect to color k is defined as the surplus, respectively the shortage, of residues in that are assigned color k, compared to the number of such residues suggested by the experimental data. That is,However, data collected in real experiments usually contain some noise, such that no feasible assignment of exchange rates as defined above exists. Therefore, the goal is to compute all assignments that minimize the total sum of errors. Here, the error of an assignment and thus the objective is to minimize the sum of this deviations over all fragments and colors, i.e.π* of the exchange rates slow, medium and fast, with respect to objective (2). Under this assignment, fragment 3 contributes an error of 1 both w.r.t. color yellow (medium exchange rate)and color red (fast rate) to the total error of 17, while it satisfies the requirement for color green In Figure In the following, we present different approaches to tackle the assingment problem that we have derrived from the mathematical abstraction mentioned before.First, we formulate the idealized version of the problem assuming error-free experimental data as an integer linear program (ILP). That is, we give an ILP whose feasible solutions correspond one-to-one to the feasible assignments of colors to residues.π : {1, ..., n} ↦ k ∈i ∈ {1, ..., n} indicates whether residue i is assigned color k or not, i.e.Let k and let We denote by i ∈ {1, ..., n}. Conversely, every 0-1 assignment to variables x satisfying i ∈ {1, ..., n} corresponds to an assignment of colors to residues. A 0-1 assignment to x corresponds to a feasible color assignment π, if and only if furthermore i, j) ∈ ℱ and k ∈ Since every residue is assigned exactly one color, it must hold k (or not) to residues in fragment (see equation (1)) to the context of 0-1 assignments to variables xk, the problem of minimizing (2) becomesNow consider the problem of computing an assignment with minimum total error. Translating the definition of the error that we make when assigning color Concerning the formulation of a minimum sum of absolute values in terms of a linear objective function and linear constraints, observe that k ∈ i, j) ∈ ℱ, the integer linear program we are looking at isHence, after introducing a variable basic-ILP.We refer to this integer linear program as n} into a minimal number of parts, such that for each element p ∈ f ∈ F either p ⊆ f or p ∩ f = ∅. In other words, no fragment starts or ends within such a part. Therefore, from an assignment π we can derive further assignments π' exhibiting the same total error, by simply permuting the colors within these parts, i.e. if i, j ∈ p for p ∈ π is e1, than π' with π' (i) = π (j), π' (j) = π (i) and π' (l) = π (l) for l ≠ i, j has total error e2 with e2 = e1. We call two assignments equivalent, if one can be obtained from the other by iteratively applying this rule.In our experiments, it turns out that finding a single solution is very fast, whereas enumerating all solutions takes quite some time due to their large number. This large number can be explained as follows: Recall that k ∈ p ∈ A be the |ℱ| × |f ∈ ℱ and p ∈ In order to enumerate equivalent solutions only once, we modify our integer linear program as follows: For k and by k. In matrix notation the constraints are then of the formWe denote by k ∈ for all P is the vector that contains |p| for each component p ∈ improved-ILP. We compute all solutions within a certain error bound by following basically the same approach as described above. However, the number of solutions now is just a fraction of the number of solutions of the original basic-ILP yielding a significant speed-upwhere Although there is commercial software for integer programming which quickly solves instances of reasonable size, there is no algorithm that is guaranteed to find an optimum solution in polynomial time, since integer programming is NP-complete in general. However, the problem of assigning exchange rates to residues in a way that is conform with the experimentally found bulk data exhibits a certain combinatorial structure. In the next section, we exploit this fact to derive an exact polynomial-time algorithm for the case of two colors and use it as a building block for approximation algorithms for more than two colors subsequently.K = 2 and thus p ∈ First, let us consider the special case of two colors, i.e. F is the vector of fragment sizes. We may get rid of half of the constraints by the following observation. Let b := max {b1, F - b2} and y be an arbitrary feasible solution with minimum total error y. We may rename the error variables e1 and e2 component-wise according to b and where f ∈ ℱ with For each b and which is integral if which is equivalent to (multiplying the objective function by -1 and introducing slack variables)M be the matrix of the equality constraints, i.e.We will show next that this LP is a Minimum Cost Circulation Problem. To this end, let M such that each column contains exactly one +1 and one -1, as follows. We add the dummy constraint 0 = 0 at the end and subtract from each row its predecessor. The resulting matrix, say p ytwo arcs corresponding to the constraint 0 ≤ p y≤ |p| and for each fragment the arcs and as depicted in Figure Note that this matrix has the column-wise consecutive-ones property. By row operations like in Gaussian elimination, we can easily transform ℱ|) arcs . As a maFor three or more colors the complexity is open. The totally unimodularity of the constraint matrix is destroyed, i.e. there are instances with fractional vertices, e.g. the one from Figure K = 2) from previous section as a subroutine to provide solutions that approximate (without performance guarantee) a coloring, i.e. an assignment of colors to residues, with minimum total error for instances with arbitrary but fixed number of colors. The general idea is to reduce the problem to the 2-color case by merging all but one color, say color i, to a single color and solve the resulting problem by an algorithm for the minimum cost circulation problem, as described in the section about the Combinatorial Approach. We remove residues colored i by the obtained solution and solve the coloring problem on the remaining residues using K - 1 colors recursively.We present an algorithm that uses our combinatorial approach for the 2-color case Our approach works as follows. Consider an arbitrary color k in an optimal solution to this problem will be colored k in the final solution too, the assignment of the remaining colors k} to the remaining residues is computed recursively.Residues assigned color k in the recursive computation can be arbitrary. Nevertheless, they might lead to solutions of different total error. As we have only three different colors in our experimental data, we evaluate all six orderings and return the best solution found.Note that the order in which colors are selected to be the next fixed color In the next section we present a Lagrangian relaxation method to compute, based on our combinatorial approach for the 2-color case, a bound on the minimum total error, which is exploited in a branch-&-bound manner to determine all optimal colorings.Lagrangian relaxation approach for the problem, which is particularly suit-able for finding all optimal solutions. It is based on the improved-ILP formulation:In this section we propose a P is the vector that contains the length of parts in k ∈ yk satisfying (9) and (10) under the objective (8), that are linked by constraints (11). Therefore, dualizing the linking constraints (11), with Lagrangian multipliers λ, splits the problem into an independent problem for each color k ∈ where λTP in the objective function and replacing error variable e by e + ē we have to determine, for every color k ∈ Neglecting the constant term -f is tight. Note that we have to enforce e or ē (or both) will be zero for each fragment f. Similar as for linear program (5), its dual is given by (omitting the color superscript k):Note that we added constraint (14) to enforce This linear program differs from LP (7) only in the right-hand sides of the equality constraints.We applied our methods to process data from typical biochemical experiments. We report our results for four proteins: Calcium-binding protein (Cabin), Cytochrome P450 (CytoC), FK506 binding protein(FKBP), with two different digests (pepsin and XIII), and myoglobin. As a preprocessing step, the single fragments were analyzed with our integer linear programming based technique , except The instances have between 74 and 152 residues and between 18 and 49 fragments. The solutions with a minimal number of errors could be computed in less than 0.11 seconds for all instances. Computing all solutions with a minimal number of errors, from 96 up to almost 20 million in number, took less than 7 minutes, where the running time greatly depends on the number of solutions . The erA structural view on the results for FK506 and myoglobin is given in Figure In our solutions, the resolution is significantly increased compared to the input data, i.e., the length of fragments obtained from the sHDX experiments. The parts are typically small . If there is a binary variable which was not fixed so far (i.e. not set to 0 or 1), one such variable y-variable. The errors are determined straight forward. If there is a solution without error this approach yields a solution within the running time of Bellman-Ford. On the other hand, the Successive Shortest Path algorithm maintains similar node potentials such that the arc-weights remain non-negative. Since the total excess is bounded by |We may use any algorithm that solves the Minimum Cost Circulation problem, e.g. Cycle Canceling or Successive Shortest Path (see for furta minimum cost circulation problem(right-hand side is 0), we have to solve the more general minimum cost flow problem [cycle-canceling algorithm and the successive shortest path algorithm, as well as variants of them, like the capacity scaling algorithm [Instead of problem where thlgorithm . In our lgorithm to solvelgorithm .We improve the resulting bounds by the subgradient optimization method described in the following and incorporate the overall approach into a branch-&-bound algorithm as the lower bounding scheme.v(IP (λ)) denote the optimal value of IP (λ). Then for any vector λ of Lagrangian multipliers, the (non-differentiable) Lagrangian functionLet provides a lower bound on the minimum total error. To benefit from the sharpest possible bound in the branch-&-bound framework we are interested in solving the Lagrangian dual problemλℓ+1 for ℓ = 0,1, ..., of the Lagrangian multipliers by moving in the direction of a subgradient with "step length" ℓμ:We apply the subgradient method to obtain near-optimal Lagrangian multipliers. Following the approach by Held and Karp we iteraIP(ℓλ). The step length is computed according to formulawhere UB is a previously computed upper bound on z* and θ is a step size parameter assuming values in {x ∈ ℝ | 0 <x ≤ 2}. In the experiments it turns out, that initializing the vector of Lagrangian multipliers λ0 to the length P of the corresponding intervals in θ: We start with θ0 = 2 and half θℓ whenever the best Lagrangian bound v(IP(λ)) found so far has not increased in a certain number of iterations. As soon as the step size scalar falls below a specified threshold or the number of iterations exceeds a certain limit (which is adaptive with respect to the depth of the branch-&-bound node), we branch on a variable h = 10 Lagrangian solutions. Since we aim to find all optimal colorings, we also branch on variables that are integral. Incorporating the Lagrangian approach as a lower bounding scheme into a branch-&-bound frame work gives an alternative algorithm that does not depend on commercial software packages.where The entire sHDX experiment was automated with a LEAP robot .μL loop to either a 1 mm × 50 mm C5 column (Phenomenex) or a Pro-Zap Pro-sphere HP C18 HR 1.5u 10 mm × 2.1 mm (All-tech). A rapid gradient 2% B to 95% B in 1.5 min was used to elute peptides. The eluent was post-column split and infused by microelectrospray ionization into a custom built 14.5 T LTQ FT-ICR mass spectrometer. The extraction of the peptic fragments and their deuterium uptakes from these data was done by an in-house analysis package [Automation of the experiment reduces human error and reduces deuterium for hydrogen back-exchange. All time points where interlaced and performed in triplicate to ensure experimental reproducibility. After digestion, the protein digest was injected from a 10 package . Then we package or a newA current limitation for implementation of this software is back exchange of deuterium-to-hydrogen during the separation of the samples. It has been reported that different peptides have a different percentage of back exchange due to the sequence of amino acids ,27. FurtHMZ, JT, and MRE performed the H/D exchange experiments and analyzed the data to yield the rate constant distributions from which the subsequent residue assignments were made. EA, SC, CE, and AK developed the mathematical model, performed the computational experiments and drafted the manuscript. AMB initiated and identified the mathematical approach. AGM participated in the design and coordination of the study and in preparation of the manuscript. All authors read and approved the final manuscript.

Given that treatments for chronic lymphocytic leukaemia (CLL) are palliative rather than curative, evaluating the patient-perceived impacts of therapy is critical. To date, no utility (preference) studies from the general public or patient perspective have been conducted in CLL. The objective of this study was to measure preferences for health states associated with CLL treatment.This was a cross-sectional study of 89 members of the general population in the UK (England and Scotland). Using standard gamble, each participant valued four health states describing response status, six describing treatment-related toxicities based on Common Toxicity Criteria, and two describing line of treatment. The health states incorporated standardized descriptions of treatment response , swollen glands, impact on daily activities, fatigue, appetite, and night sweats. Utility estimates ranged from 0.0, reflecting dead, to 1.0, reflecting full health.Complete response (CR) was the most preferred health state , followed by partial response (PR), 0.84; no change (NC), 0.78; and progressive disease (PD), 0.68. Among the toxicity states, grade I/II nausea and nausea/vomiting had the smallest utility decrements (both were -0.05), and grade III/IV pneumonia had the greatest decrement (-0.20). The utility decrements obtained for toxicity states can be subtracted from utilities for CR, PR, NC, and PD, as appropriate. The utilities for second- and third-line treatments, which are attempted when symptoms worsen, were 0.71 and 0.65, respectively. No significant differences in utilities were observed by age, sex, or knowledge/experience with leukaemia.This study reports UK population utilities for a universal set of CLL health states that incorporate intended treatment response and unintended toxicities. These utilities can be applied in future cost-effectiveness analyses of CLL treatment. Chronic lymphocytic leukaemia (CLL) is a progressive form of leukaemia characterised by an accumulation of abnormal lymphocytes that have lost the ability to undergo apoptosis (programmed cell death). These lymphocytes accumulate in the lymph nodes, liver, spleen, blood, and bone marrow and compromise the activity of cell mediated and humoral immunity with loss of immune memory. Consequently, patients with CLL typically experience recurrent infections, some of which can be serious . CLL preWith the exception of blood and marrow transplantation, CLL is an inherently incurable condition and treatments are therefore focused on controlling symptoms and optimising health-related quality of life . Thus, qde novo utility study in CLL.To date, no utility studies from the patient or general population perspective have been conducted in CLL ,10. WhilHTA agencies generally prefer that generic measures such as the EQ-5D are used to estimate utilities incorporated into cost-effectiveness evaluations . HoweverLittle work in the area of preference-based utilities has been conducted that captures both the intended clinical response and unintended toxicities associated with treatment. Measurement of preferences for health states characterizing cancer-specific states associated with treatment can be particularly valuable in order to help clinicians and decision-makers better understand the balance between the physiological and psychological benefits of treatment versus the negative impact of these treatments on daily life . The purp) of achieving full health with a corresponding chance (1-p) of being dead. The p probabilities are varied using a ping-pong approach until the respondent is indifferent between the two options. The interviewer used a chance board with a probability wheel using 2-color pie charts to illustrate the different probabilities.A cross-sectional study was performed to elicit utilities for CLL health states among, as suggested by the UK National Institute for Health and Clinical Excellence, members of the general public . Four trStudy participants were recruited from the general population in the UK, including both England and Scotland, in March 2009. Each interviewer recruited 15-25 laypeople in the U.K. (England and Scotland) through word-of-mouth as well as through a panel of laypeople who had previously volunteered to be participants for research studies. Eligible participants were residents of England or Scotland, aged 18 or over, and capable of giving informed consent. The interviews were conducted in-person, and the participants completed a demographic questionnaire and, prior to beginning the standard gamble exercise, they were asked to order the health states from most preferable to least preferable. All participants provided informed consent and received compensation of 25GBP for their time. This study was approved by the Independent Investigational Review Board and complied with the tenets of the Declaration of Helsinki.The health states were designed to describe the functional and patient-centred impacts of CLL and it treatment, rather than clinical descriptions of the disease, in line with published guidelines for health state development . Developet al [et al [The following domains were described, enabling balanced descriptions across the health states: cancer description, "cancer of the blood"; treatment response category; swollen glands in neck, armpits, or groin; limitations in performing daily activities; level of fatigue; appetite; and trouble sleeping because of night sweats. These domains are those that previous researchers have identified as important in CLL. In a review of the burden and outcomes associated with leukaemia, for example, Redaelli et al reportedl [et al found thl [et al ,19 also complete response state was based on the complete absence of symptoms; partial response represented a ≥ 50% reduction in symptoms; no change meant that the disease was stable ; and progressive disease indicated that symptoms were worsening.In all, four CLL treatment-related response states, six toxicity-related health states, and two health states reflecting the impact of undergoing a second or third course of treatment were developed health state. NC was selected to pair with the toxicities as opposed to PR given that this is a more conservative approach; if the toxicities were coupled with PR, for example, it is possible that respondents would not rate them as poorly as they would if they were coupled with NC because they may be more accepting of an aggressive therapy if they know that the treatment is working.With respect to the toxicity states, these were identified based on common toxicities experienced with bendamustine and chlorambucil, and draft descriptions were developed using the Cancer Therapy Evaluation program's Common Terminology Criteria version 3.0 . BecauseThe draft health states were refined after iterative review by four independent clinicians. Draft health states were tested in five Scottish CLL patients recruited through the CLL Support Association, a web-based support group based in the UK, and final revisions were made based on their feedback. The states were developed to be easily comprehensible from the general public's perspective and gender-neutral. During the interview, the health states were labelled using symbols, as opposed to numerical identifiers, to avoid imposing any hierarchical order among them.p of full health at the point where the respondent was indifferent between staying in the health state and taking the gamble. Utility scores range from 0.0, reflecting being dead, to 1.0, reflecting full health. A decision rule was implemented for eliminating illogical responses. Specifically, participants who had at least three illogical responses were eliminated from all analyses. Utilities were summarized using means, standard deviations, medians, 95% confidence intervals (95% CI), and standard errors (SE). Utility decrements for toxicities were generated by subtracting the utility for the base case (no change) from the utility of the toxicity state (each of which was described in association with no change). Although the study was not powered to test for differences in utilities between subgroups, exploratory analyses were made comparing utilities by region (England vs. Scotland), age group, sex, and whether or not the respondents were knowledgeable about leukaemia using the Student's t-test. All statistical analyses were conducted using SAS v9.0.This study was designed to collect data from 93 people; this was not determined or based on a formal power analysis because there was no specific hypothesis to test. Demographic data were summarised by means and standard deviations for continuous variables, and proportions for categorical variables. Means were calculated for the rank orderings of the health states. For each health state, the respective standard gamble utility equalled the probability In total, 93 respondents were recruited from the UK, including 62 from England and 31 from Scotland. Of these, four respondents (4.5%) provided at least three illogical responses , and they were excluded from the analysis. Thus, 89 participants, 59 from England and 30 from Scotland, were included in the final analysis. In comparison to the demographic distributions of the target adult populations in Scotland and in England & Wales based on the 2001 UK census , fewer ifull health and complete response had the first and second highest mean rankings, respectively, among the health states, followed by partial response and no change, respectively. The grade 1/2 toxicity health states were ranked higher than the grade 3/4 toxicity health states, and no change plus grade 3/4 pneumonia was ranked the worst.As expected, complete response was most preferred (utility = 0.91), followed by partial response (utility = 0.84), followed by no change (utility = 0.78) and progressive disease (utility = 0.68), respectively. The number of treatment attempts required in CLL was associated with different utility weights. Specifically, the utility for second-line therapy (0.71) was lower than that found for no change (0. 78), and the utility for third-line treatment was lower than that of progressive disease (0.68).Table no change plus toxicities were less preferred than the no change base state, and the no change plus grade 3/4 (more severe) toxicity health states had lower utilities than the no change plus grade 1/2 (less severe) toxicity health states. Of all of the health states, no change plus grade 3/4 pneumonia was the least preferred (utility = 0.58). Table complete response, partial response, progressive disease, and no change, as applicable.The health states that comprised A comparison of utility data between England and Scotland showed that utility weights reported by Scottish respondents were higher than those reported by English participants for most of the health states Table . NeverthThis study yielded general population utilities for a universal set of CLL health states. In future studies, these utilities can be useful in the evaluation of CLL treatments from the general public perspective and can be applied to clinical trial data. Specifically, one can map the health status of individual patients from a clinical trial to the health states from this study, assign the corresponding utility weights, and use these to compute quality-adjusted life expectancy . The useThere are similarities between the utilities obtained in this study and those estimated by the Wessex Committee, which were intended for use in a study of fludarabine relative to cyclophosphamide plus doxorubicin plus prednisolone (CAP) . SpecifiPreviously, Lloyd et al and BeusWe attempted to recruit respondents according to the distributions of age and sex of the target populations in England and Scotland. We had a slightly lower percentage of respondents from 18-24 years of age (8% vs. 13%) and a slightly higher percentage of respondents who were in the older age group (> 60 years of age) (29% vs. 26%). In addition, the study sample had attained higher levels of education relative to the general population. Given that our study did not find age or sex to be predictors of utility-based preferences, it is unlikely that we would have observed different results with a more representative sample. Moreover, differences in respondent age or other demographic variables have not previously been shown to be reliable predictors of health state utilities .Respondents in Scotland had slightly higher utilities across the health states relative to those in England. The reason for this difference in preferences is unknown, but may be attributable to cultural factors. Observing regional differences in utility weights is consistent with findings from previous research. For example, studies using the EQ-5D have shown substantial inter-country differences in utilities, including studies focusing on patients with cancer ,28-30. Iet al [We intentionally did not include a health state domain focusing on how worried the patient would be in the health state. Instead, we allowed the respondents to weigh their own emotional reactions to the health states. Preferences for health states can vary substantially across individuals, and subjects may vary considerably in their emotional reactions. This variability in emotional impacts was demonstrated by Bertero et al , who fouet al . For thiet al [In addition, our study did not consider health states with multiple toxicities. Several recent studies have explored the estimation of utilities given this scenario. Dale et al and Fu aet al recommenWe believe we have conducted a rigorous study eliciting utilities for CLL health states using the widely used standard gamble approach and assessing the perspective of individuals from the general population. Utility techniques mainly vary in that the values can be obtained by individuals currently experiencing the state of interest versus indirectly via a description of that state, called a vignette, as was performed in this study. With respect to the use of vignettes, the valuation might come from patients, clinicians or the public; and the health state description might come from qualitative research with patients, condition-specific patient reported outcome measures or a descriptive state classification system like the EQ-5D or Health Utilities Index (HUI) . BecauseAlthough HTA agencies prefer that utility data from generic measures be used in cost-effectiveness analyses, they acknowledge that such data may not be applicable or available. In such cases, the SMC is willing to accept data from other sources including surveys involving "direct measurement of utilities for appropriate disease/condition health states. This should use time trade-off or standard gamble methods of utility elicitation". NICE acAlthough the utility data in this study are not based on a measure used in conjunction with a trial in CLL, we believe that one should be able to map the health states or vignettes in this study directly to those observed in such trials. Specifically, the descriptions of treatment response within the health states were based on the standard clinical criteria used to classify treatment efficacy in CLL clinical trials . With reThe study reports general population health state utilities from the UK, including both England and Scotland, for a universal set of CLL states, including potential clinical outcomes and toxicities associated with various treatments. This study employed a rigorous process for the development of standardized health states that incorporated both intended treatment responses and unintended events. The utilities generated in this study can be applied in future cost-utility analyses of treatments for CLL.This study was sponsored by Napp Pharmaceuticals, Limited.KMB, JG, AO, and SBJ participated in the conceptualization, design, and execution of the study. KMB and JG performed the statistical analysis and drafted the manuscript.JD, ML, and DM provided clinical expertise to inform the content of the health states valuated in the study. All authors read and approved the final manuscript.CLL Health States. This file contains the complete set of health state descriptions that participants valuated in the study. These include four CLL treatment-related response states, six toxicity-related health states, and two health states reflecting the impact of undergoing a second or third course of treatment.Click here for file

A new method for rapid genome-wide μChIP-chip from as few as 1,000 cells. Genome-wide location analysis of histone modifications and transcription factor binding relies on chromatin immunoprecipitation (ChIP) assays. These assays are, however, time-consuming and require large numbers of cells, hindering their application to the analysis of many interesting cell types. We report here a fast microChIP (μChIP) assay for 1,000 cells in combination with microarrays to produce genome-scale surveys of histone modifications. μChIP-chip reliably reproduces data obtained by large-scale assays: H3K9ac and H3K9m3 enrichment profiles are conserved and nucleosome-free regions are revealed. Ratio data were randomized 20 times to evaluate the probability of false positives, and each peak was assigned a FDR score. Normalization and peak detection were performed by Nimblegen in accordance with their protocols. This process uses a cut-off range of 90% to 15%, with higher cut-offs corresponding to more stringent peak detection, as reflected in the FDR calculation. The Nimblegen protocol was recently evaluated as part of a comprehensive study that objectively analyzed the performance of a number of commercially available ChIP-chip array platforms and signal detection algorithms [Signal intensity data were extracted from the scanned images of each array using NimbleScan software. Loggorithms , and fou2 ratios were scanned in genome order with a ten-probe window. The highest ten-probe average was used as the amplification value for the promoter. Promoters represented by less then ten probes were not included in the analysis.For scoring the promoters before correlation analysis, we assigned an amplification value to each promoter by applying the Maxfour algorithm with a ten-probe window . For eac2ChIP or μChIP. If the offset corresponded to the exact location of a probe within a specific tiled region, values were directly measured; if not, values were linearly interpolated from the values of the two flanking probes [Metagene analysis of promoter occupancy was performed essentially as described . Genes wg probes . Genes s2ChIP DNA samples and whole μChIP inputs were mixed with Quant-iT working solution to a final volume of 200 μl, incubated for 2 minutes and analyzed by the Quant-iT DNA HS program on a Qubit fluorometer.Because the NanoDrop spectrophotometer does not allow accurate quantification of minute amounts of non-amplified ChIP DNA, we used a Qubit fluorometer and a Quant-iT dsDNA HS kit for quantification. Ten percent of Q2 values of enrichment relative to input DNA.Immunoprecipitated DNA from three independent ChIPs was analyzed by duplicate qPCR (AdditioChIP: chromatin immunoprecipitation; FDR: false discovery rate; H3K9ac: acetylated lysine 9 of histone H3; H3K9m3: trimethylated lysine 9 of histone H3; μChIP: microChIP; qPCR: quantitative PCR; TSS: transcription start site; WGA: whole-genome amplification.JAD designed the study, performed experiments, contributed to analysis design, made figures and wrote parts of the manuscript. AHR performed bioinformatics analyses, made figures and wrote parts of the methods. PC designed the study, wrote the manuscript, made figures and supervised the work. All authors read and approved the final manuscript.2ChIP and μChIP. Additional data file The following additional data are available with the online version of this paper. Additional data file Steps behind the equation formulated to estimate, using qPCR, chromatin fragment length after a given sonication regime of 1,000 cells.Click here for file2ChIP and μChIP.DNA recovery from QClick here for fileTechnical comparison between μChIP-chip and a previously published protocol.Click here for fileTroubleshooting guide for μChIP-chip.Click here for fileChIP qPCR primers used in this study.Click here for file

Inhaled nitric oxide (iNO) is one of the most promising therapies used in neonates. However, little information is known about its impact on the developing brain submitted to excitotoxic challenge.We investigated here the effect of iNO in a neonatal model of excitotoxic brain lesions. Rat pups and their dams were placed in a chamber containing 20 ppm NO during the first week of life. At postnatal day (P)5, rat pups were submitted to intracranial injection of glutamate agonists. At P10, rat pups exposed to iNO exhibited a significant decrease of lesion size in both the white matter and cortical plate compared to controls. Microglia activation and astrogliosis were found significantly decreased in NO-exposed animals. This neuroprotective effect was associated with a significant decrease of several glutamate receptor subunits expression at P5. iNO was associated with an early (P1) downregulation of pCREB/pAkt expression and induced an increase in pAkt protein concentration in response to excitotoxic challenge (P7).This study is the first describe and investigate the neuroprotective effect of iNO in neonatal excitotoxic-induced brain damage. This effect may be mediated through CREB pathway and subsequent modulation of glutamate receptor subunits expression. Brain injury in the premature infant is a problem of major importance. Approximately 10 percent of the survivors from very preterm birth later exhibit cerebral palsy (CP) and an additional 25 to 50 percent exhibit cognitive, attentional, and/or behavioral deficits. These neurologic disabilities observed relate in considerable part to cerebral white matter injury Glutamate accumulation may be a mechanism common to many risk factors for CP. Glutamate, the major excitatory neurotransmitter, acts via several groups of receptors, namely, N-methyl-D-aspartate (NMDA) receptors, alpha-3-amino-hydroxy-5-methyl-4-isoxazole (AMPA) receptors, kainate receptors, and metabotropic receptors (mGluRs). Excessive activation of glutamate receptors may cause cell vulnerability, in part as a result of intracellular calcium influx Despite considerable advances in our understanding of the pathophysiology of brain damage during development, therapeutic options are still extremely limited. Inhaled nitric oxide (iNO) is one of the most commonly used therapies, promising but also controversial, in neonatal intensive care units. This molecule is thought to have only a local effect, limited to the vascular tone of the lungs, and has been proposed to treat pulmonary hypertension-related hypoxemia and chronic lung disease. However, increasing experimental and clinical evidences suggest that iNO could also have an impact on the developing central nervous system Here, we describe the neuroprotective effect of iNO in neonatal excitotoxic-induced brain damage. This effect appears to be mediated through pAkt-pCREB pathway and subsequent modulation of glutamate receptor subunits expression.Full details of the study have been approved by Robert Debré research council review board; the approval number is 2009-02. All experiments were carried out in compliance with the ethical rules of INSERM.2 for postnatal days (P) 0 to 7. The concentration of NO and NO2 was monitored using the iNOvent system .Twenty-four hours before delivery, pregnant female rats were placed in a normoxic, normocapnic gas chamber containing either 5 or 20 ppm inhaled NO and <1 ppm NOP5 rat pups of both sexes were used for this study. Ibotenate , NMDA (Tocris) and S-Willardiine (Tocris) were diluted in phosphate buffer saline (PBS). Ibotenate activates NMDA and metabotropic glutamatergic receptors while S-Willardiine activates both AMPA and kainate receptors. Ibotenate (10 µg), NMDA (4 µg) or S-Willardiine (15 µg) was injected intracerebrally on P5 to rat pups, as previously described In a first set of experiments, P5 rat pups were intracerebrally injected with PBS. Pups treated with intracerebral PBS injections had minimal lesions, mostly consisting of needle tracks, as previously reported At least 12 animals of each treatment group were killed by decapitation 5 days after the injection, and the brains were processed as previously described Rat pups were sacrificed by decapitation 5 (P10) or 25 (P30) days after the excitotoxic challenge. Brains were fixed immediately in 4% formalin and remained in this solution for 5 days. Following paraffin embedding, we cut 16-µm thick coronal sections. Every third section was stained with cresyl-violet. The size of neocortical and white matter lesions can be defined by the length on three orthogonal axes: the lateral-medial axis , the radial axis , and the fronto-occipital axis . In previous studies In each experimental group, we studied 6 to 10 pups in three separate experiments. Immunolabeling with the primary antibodies listed in 2 grid, in at least 4 sections per animal, and 6 or more animals per group.Immunoreactive cells were counted in the white matter underlying the cortex (+2.16 to −0.36 mm from the bregma) in animals sacrificed on P10. Cells were counted within a 0.25 mmhttp://rsb.info.nih.gov/ij/). Nonspecific background density was measured at each brain level in an area devoid of pCREB immunostaining, and subtracted from the values for the cortex.The optical density of pCREB-immunoreactive cells was measured in the cortical plate in coronal sections (+2.16 to −0.36 mm from the bregma). At least 4 sections each from 6 to 10 animals per group, sacrificed on either P1 or P7, were examined. Optical density was measured at 20× magnification using a computerized image analysis system to quantitate VEGF and cAMP Response Element Binding Protein (CREB) phosphorylated at S133 levels in the whole brain samples according to the manufacturer's instructions.All data were reported as means ± S.E.M. Analysis of variance was performed with age and groups as the factors, and the Newman-Keuls post-hoc test was used. Statistical tests were run on GraphPad Prism version 4.00 .-Willardiine developed cortical lesions and periventricular white matter cysts in all cases. The cortical lesion was typically characterized by neuronal loss in all neocortical layers and almost complete disappearance of neuronal cell bodies along the axis of excitotoxin injection. In P5 rats, iNO 20 ppm induced a significant neuroprotection of both the cortical plate and the developing white matter against ibotenate- or NMDA-induced lesions and microglial activation (ED-1) when analyzed 5 days after the insult. Glial cells counts were performed within external capsule around white matter cyst see . To analBecause excitotoxicity and genetic regulation of glutamate-receptor expression are known to play a key role in brain damage Finally, we explored a potential signaling pathway acting as a common modulator of glutamate-receptor expression in response to iNO. We hypothesized that CREB/Akt signaling pathway might be involved as CREB is recognized to bind the CRE sequence in the promoter of several glutamate receptor genes We demonstrated here that iNO exposure during the first week of postnatal life significantly reduced the lesion size in an excitotoxic-induced brain lesions rat model. This effect appears to be associated with early downregulation of pCREB expression and subsequent downregulation of several glutamate receptors subunits.in vitroIt is now well established that NO is a physiological mediator of the central nervous system. The role of NO in developing brain remains poorly understood, but it seems to be involved in the regulation of cerebral blood flow, and in memory acquisition. In fact, NO appears to be a double-edged sword, simultaneously neurotoxic and neuroprotective. Numerous experimental studies demonstrated the deleterious effects of nitrogen reactive species accumulation in ischemic-reperfusion cerebral injury through depletion of energy, lipid peroxidation, protein nitrosylation, DNA alterations and increased permeability of the blood brain-barrier −/−−/−In the other hand, endogenous NO could also result in contradictory effects, probably as a function of the intracellular redox state in vivoIn contrast to the numerous studies focused on endogenous NO, almost no data was available on the experimental effect of exogenous inhaled NO. Extrapulmonary effect of iNO on reduction of myocardial infarction size and improved left ventricular systolic function have been shown in a murine model Clinically, the impact of iNO on the development of the central system remains controversial. For many years, iNO was feared to increase the incidence of intracranial haemorrhage in critically ill preterm neonates, because NO was demonstrated to increase bleeding time and inhibit platelet aggregation It is conceivable that a downregulation of glutamate receptors could reduce the lesion size induced by glutamate agonists. Here, we found that iNO-induced neuroprotection was associated with an early downregulation of pCREB expression and downregulation of several glutamate receptors subunits. CREB activates gene transcription in response to elevation of intracellular cAMP levels which in turn phosporylates CREB at Ser133. Phosphorylated CREB binds to the cAMP response element (CREs), represented by the palindromic consensus sequence TGACGTCA found in the 5′ flanking region of target genes In conclusion, this study is the first to describe and to investigate the neuroprotective effect of iNO in neonatal excitotoxic-induced brain damage. This effect appears to be associated with changes in VEGF-pAkt-pCREB and glutamate receptor subunits expression. Further preclinical studies are needed to confirm the ability of iNO to induce neuroprotection in other animal models of perinatal brain damage.File S1Primary antibodies used for immunohistochemistry and western blot analyses.(0.04 MB DOC)Click here for additional data file.

Less is known about the dynamics of other intracellular ions. The present study investigated the intracellular source of zinc (Zn2+) that has been reported to play a role in cell signaling.Changes in ionic concentration have a fundamental effect on numerous physiological processes. For example, IP2+ indicators, we showed that intracellular regions of Zn2+ staining co-localized with the endoplasmic reticulum (ER). The latter was identified with ER-tracker Red, a marker for ER. The colocalization was abolished upon exposure to the Zn2+ chelator TPEN, indicating that the local Zn2+ fluorescence represented free Zn2+ localized to the ER in the basal condition. Blockade of the ER Ca2+ pump by thapsigargin produced a steady increase of intracellular Zn2+. Furthermore, we determined that the thapsigargin-induced Zn2+ increase was not dependent on extracellular Ca2+ or extracellular Zn2+, suggesting that it was of intracellular origin. The applications of caged IP3 or IP3-3Kinase inhibitor (to increase available IP3) produced a significant increase in intracellular Zn2+.In primary cultured cortical cells (neurons) labeled with intracellular fluorescent Zn2+ is sequestered into thapsigargin/IP3-sensitive stores and is released upon agonist stimulation.Taken together, these results suggest that Zn As such, Zn2+ levels are normally tightly regulated, limiting the extent of cytosolic labile (or free) Zn2+ concentrations [2+ are several orders of magnitude less than that of Ca2+ [2+ may act as a cellular messenger in physiological and cytotoxic signaling, and the changes in Zn2+ homeostasis have a fundamental effect in cell function [2+ to precede cell death or neurodegeneration in response to cytotoxic stress [2+-mediated signaling pathways or Zn2+-induced cytotoxicity, it is important to determine the source(s) of intracellular free Zn2+ in response to specific stimuli or injury.Zntrations ,2. For e of Ca2+ . Zn2+ mafunction ,5. Many c stress ,7. To ch2+ from the cytosol by means of sarcoplasmic/endoplasmic reticulum Ca2+-ATPase (SERCA) or so-called endoplasmic Ca2+ pump [2+ can be released into the cytosol upon a variety of stimuli including inositol 1,4,5-trisphosphate (IP3). It is IP3 that mobilized Ca2+ from the ER Ca2+ store following interaction with specific IP3 receptors (IP3R). A commonly used tool in studying Ca2+ homeostasis is thapsigargin, a plant derived compound that specifically inhibits SERCA activity [2+ into the ER, thapsigargin causes these stores to become depleted and thereby raise the cytosolic Ca2+ concentration.The endoplasmic reticulum (ER) is an intracellular organelle that has been shown to sequester Caa2+ pump . This seactivity . By bloc2+ homeostasis are not well established, available data support that, like Ca2+, intracellular Zn2+ levels are determined by the interaction of membrane Zn2+ transporters and cytoplasmic Zn2+ buffers [2+, particularly, if thapsigargin can trigger the release of Zn2+. This possibility is supported by recent evidence that Zn2+ can be released from intracellular sources upon stimulation [2+ is released from thapsigargin-sensitive and IP3R-mediated stores.While the mechanisms responsible for regulating Zn buffers ,10. The mulation -13. Our 2 and the fetuses were removed and placed in ice-cold Hank's Balanced Salt Solution without Ca2+ or Mg2+ (HBSS). The brains of fetuses were removed and placed into cold HBSS for further dissection. Using a dissecting microscope and blunt dissection, the meninges were gently separated away. The cerebral cortex was then removed and each cortical hemisphere was cut into four pieces and trypsinized in HBSS at 37°C. Following trypsinization, cells were separated by trituration through the opening of a fire polished Pasteur pipette. The suspensions were then passed through a 70 μm cell strainer. The dissociated cells were added to the bottom of 35mm glass-bottomed petri dishes previously coated with polyethyleneimine diluted 1:1000 in borate buffer. The cortical neurons were then allowed to attach to the surface at 37°C, 5% CO2 in 2 ml of MEM solution supplemented with 10% (v/v) heat-inactivated fetal bovine serum. After 3-6 hrs, solutions were replaced with fresh supplemented MEM which was later replaced (24 hrs) with Neurobasal medium supplemented with 2% B-27.Pregnant Sprague-Dawley rats (E17-E18) were anaesthetized with CO4, 1 Na2HPO4, 25 Glucose, 20 HEPES, 1 Na-Pyruvate; pH adjusted to 7.4. Cortical cells grown in glass-bottomed petri dishes were washed with fresh HEPES medium. The cells were then incubated at 37°C for 30 min with ER-Tracker Red and Newport Green or ZinPyr-1 . Cells were incubated with 10 μM of the specified fluorescent Zn2+ indicator either alone or in conjunction with ER-Tracker red for 30 min then were washed 3x with fresh HEPES medium and placed into a custom 35mm stage adapter and continuously perfused with fresh HEPES medium on the stage of a Zeiss LSM 510 microscope. Cultures were examined using a Plan-Neofluar 100x/1.3 NA oil immersion objective. For ER-Tracker Red excitation was done with a HeNe Laser line of 543nm and an LP560nm emission filter. Newport Green and ZinPyr-1 were imaged using an Argon Laser line of 488nm for excitation and a BP505-550nm emission filter. Separate fluorescent channels were employed for each indicator, and channels were scanned sequentially to minimize crosstalk. Cells were imaged by serial z-scans progressively from bottom to top, in increments of 500 nm. Colocalization of ER-Tracker Red and Newport Green or ZinPyr-1 was measured using Zeiss software [All imaging experiments were performed in HEPES medium containing the following (in mM): 130 NaCl, 5 KCl, 8 MgSOsoftware . Colocal3Rs we used the membrane-permeable UV light-sensitive caged IP3 analogue, ci-IP3/PM benzyl-myo-inositol 1,4,5-trisphosphate-hexakis(propionoxymethyl)ester [3 and Newport Green for 30 min at 37°C, then washed and incubated for an additional 30 min to allow for complete de-esterification.To directly activate IPGermany) ,16. Cell3 was photoreleased by flashes of 364 nm light focused uniformly throughout the field of view.IP3K inhibitor N2-(m-trifluorobenzyl),N6-(p-nitrobenzyl)purine , N,N,N',N'-tetrakis (2 pyridylmethyl) ethylenediamine (TPEN) , the InsP3 receptor blocker 2-aminoethoxydiphenyl-borate (2-APB), were applied by bath application in HEPES medium.Thapsigargin , the IP2+ indicators and examined under basal conditions showed consistent regions of elevated fluorescent intensity in the soma and processes, and particularly in a region that was identified as the endoplasmic reticulum by a fluorescent marker for the organelle. The elevated levels of Zn2+ were seen to represent labile or free Zn2+ because they were sensitive to both low and high affinity fluorescent Zn2+ indicators Newport Green (KDZn2+ ≈ 10-6M) Figure and ZinP) Figure . Before of Ca2+ ,18. Fluo1 Figure . Both fl2+ release from thapsigargin-sensitive stores, cells incubated with Newport Green were exposed to thapsigargin, which inhibits SERCA pump. The application of thapsigargin depletes the ER Ca2+ stores in cells and raises cytosolic Ca2+ concentration. The experiments above suggested that Zn2+ may be also transported into and sequestered in ER. If this was true, the accumulation of Zn2+ by blocking SERCA with thapsigargin should also produce Zn2+ signals. Indeed, exposure to thapsigargin resulted in a gradual increase of cytosolic or intracellular Zn2+ . Next, we examined the contribution of extracellular Ca2+ on thapsigargin-induced elevation of intracellular Zn2+. We found that the removal of extracellular Ca2+ had no effect on the thapsigargin-induced Zn2+ rises located on regions of the ER. When IP3 binds to and activates IP3Rs, the channel portion of the receptor opens and Ca2+ is released from the ER to the cytosol. The experiment was therefore performed utilizing ci-IP3/PM, a cell-permeable form of caged IP3 to directly induce Zn2+ release [2+ fluorophore Newport Green and caged IP3, IP3 uncaging resulted in a rapid increase in intracellular Zn2+, which persisted for 30 s and followed by a roughly exponential decay -tetrakisphosphate P4) by the enzyme InsP3 3-kinase (IP3-3Kinase or IP3-3K) [3-3K has been shown to elevate intracellular levels of IP3 by halting its conversion into InsP4 [3 signaling on intracellular Zn2+ dynamics, N2-(m-trifluorobenzyl),N6-(p-nitrobenzyl)purine, a membrane-permeable inhibitor of IP3-3K was employed to confirm the results observed using the caged IP3. Upon bath application of the inhibitor, Newport Green fluorescence showed a gradual, significant increase . Inhibit3,4,5)P4 . Here, te Figure &5D, sup2+ in ER-like storage, and Zn2+ is released into the cytosol in a thapsigargin- and IP3-sensitive manner. These findings suggest a new model of intracellular Zn2+ homeostasis where cellular organelles like the ER act as sites of intracellular Zn2+ storage.The major findings of the present study are the following: Neuronal cells maintain a substantial concentration of Zn2+ levels can be determined by the interaction of membrane Zn2+ transporters and cytoplasmic Zn2+ buffers [2+ has been found to be in the range of a few hundred micromolars [2+ is, however, protein bound or sequestered into organelles, which results in free cytosolic Zn2+ concentrations being in the picomolar to nanomolar range [2+ fluorescence between ER-like lumen and cytosolic space . Cols Figure that may2+ is buffered by the abundant luminal resident chaperone protein calreticulin which binds Ca2+. Although calreticulin was first identified as a Ca2+ binding protein [2+ with multiple binding sites [2+ also binds with several other luminal proteins [2+, recent work indicates that mitochondria take up cytosolic Zn2+ and that Zn2+ accumulation leads to a loss of mitochondrial membrane potential . There function . It rema2+ trafficking remain elusive, there is little doubt that the intracellular free Zn2+ level must be maintained within a physiological limit. Zn2+ has been shown to activate a number of protein kinases such as protein kinase C, CaMKII, TrkB, Ras and MAP kinase [2+ may lead to either Zn2+-induced toxicity or Zn2+ deficiency-induced apoptosis [2+ in response to stimuli, and is likely to play an important role in the regulation of intracellular levels of Zn2+.While the mechanism(s) that govern ZnP kinase -43. On tpoptosis . TherefoThe authors declare that they have no competing interests.CS carried out the fluorescence imaging experiments, analysed data, and participated in the experimental design and the preparation of manuscript. YL conceived of the study, and participated in its design, and drafted and prepared manuscript, and coordination. All authors read and approved the final manuscript.

PKA is a ubiquitous, multi-subunit cellular kinase that regulates a number of different physiological responses in response to cAMP, including metabolism, cell division, and cardiac function. Numerous studies have implicated altered PKA signaling in cardiac dysfunction. Recently, it has been shown that mice lacking the catalytic β subunit of PKA (PKA Cβ) are protected from age-related problems such as weight gain and enlarged livers, and we hypothesized that these mice might also be resistant to cardiomyopathy.Angiotensin II (ang II) induced hypertension in both PKA Cβ null mice and their WT littermates. However, PKA Cβ null mice were resistant to a number of ang II-induced, cardiopathological effects observed in the WT mice, including hypertrophy, decreased diastolic performance, and enlarged left atria.The Cβ subunit of PKA plays an important role in angiotensin-induced cardiac dysfunction. The Cβ null mouse highlights the potential of the PKA Cβ subunit as a pharmaceutical target for hypertrophic cardiac disease. PKA is a ubiquitous cellular kinase that is involved in regulating a vast number of different cellular processes. Several studies have implicated altered PKA signaling in cardiomyopathy ,2. For ePKA is a tetrameric protein, consisting of two regulatory subunits and two catalytic subunits. Binding of cAMP to the regulatory subunits releases the catalytic subunits, which are then free to interact with and phosphorylate downstream targets. There are four isoforms of the regulatory subunit and three types of catalytic subunits ,8. C57/BCardiac hypertrophy is an increase in the mass of the heart in response to and to compensate for an increased workload. In the face of continued stress, hypertrophied diastolic and eventually systolic properties of the left ventricle become impaired, leading to decompensation and heart failure . Angiote5-angiotensin II for 28 days. Blood pressures were measured before and after angiotensin treatment using the Coda-6 VPR tail cuff system [PKA Cβ null mice lack expression of all PKA Cβ isoforms . Mice wegton CT) ,15 on cogton CT) . Non-invPrevious experiments have shown that insertion of subcutaneous saline pumps into mice, using our method does not produce any cardiovascular effects (data not shown). Four weeks of treatment with pumps containing angiotensin II caused a systolic and diastolic blood pressure increase of 25 and 50%, and 35 and 36%, for WT and PKA Cβ null mice, respectively figure . SignifiWe show that disruption of the PKA catalytic subunit Cβ protects mice from angiotensin II-induced cardiac hypertrophy and dysfunction. In this study, a low dosage of angiotensin II (ang II) was used to effectively induce hypertension in WT, C57BL/6J mice and their PKA Cβ null littermates. After being challenged for 4 weeks with ang II, both genotypes showed a similar hypertensive response. In spite of similar systolic and diastolic blood pressure increases in response to ang II compared to WT, Cβ null mutants displayed smaller hearts and improved cardiac function in 4 of 5 echocardiographical parameters measured including left ventricular mass index, fractional shortening, ratio of early to late diastolic filling, and ratio of aortic to left atrial diameter. Only mass performance index showed no difference between genotypes. The role that ang II plays in the renin-angiotensin system (RAS) is known to be pivotal in the regulation of blood pressure . ResistaIt has been known for some time that the β-adrenergic (β-AR)/adenylyl cyclase/PKA pathway, which is central to stimulating cardiac function, is dysfunctional in heart failure . That β-+ channel in the sarcolemma, the ryanodine receptor (RyR2), and phospholamban in the sarcoplasmic reticulum (SR) [Other potential roles for PKA in protection against cardiac hypertrophy and dysfunction are numerous and diverse. Cyclic AMP signaling regulates a vast number of cellular processes, including cellular growth . Specifilum (SR) ,20. Therlum (SR) ,42, supplum (SR) . Finallylum (SR) . HDACs plum (SR) .This study shows a clear role for the β catalytic subunit of PKA in ang II-induced cardiomyopathy. Not only does it illustrate the usefulness of the PKA Cβ null mouse for the study of the role of PKA signaling in heart disease; it also highlights the potential of the PKA Cβ subunit as a pharmaeutical target in the treatment of cardiac hypertrophy and dysfunction.The authors declare that they have no competing interests.WCL conceived the study. KLB performed the echocardiography and Doppler analyses. LCE was responsible for the study's design and coordination, performed the statistical analyses of the data, and drafted the manuscript. All authors read and approved the final manuscript.

Recent studies have demonstrated a role for spinal p38 MAP kinase (MAPK) in the development of chronic inflammation and peripheral arthritis and a role for GABA in the inhibition of p38 MAPK mediated effects. Integrating these data suggests that GABA may play a role in downregulating mechanisms that lead to the production of proinflammatory agents such as interleukin-1, interleukin-6, and matrix metalloproteinase 3 – agents implicated in the pathogenesis of rheumatoid arthritis (RA). Genetic studies have also associated RA with members of the p38 MAPK pathway.We propose a hypothesis for an inefficient GABA signaling system that results in unchecked proinflammatory cytokine production via the p38 MAPK pathway. This model also supports the need for increasing research in the integration of immunology and neuroscience. The impact of an immune response on the nervous system has long been apparent, with multiple sclerosis (MS), myasthenia gravis (MG), and neuropsychiatric manifestations of systemic lupus erythematosus serving as examples. While neuroendocrine modulation of the immune system has been appreciated, the influence of the nervous system on immune responses is not well understood. The complex characters of a coordinated immune response and the nervous/endocrine communication systems of the body complicate research in this area; however, relationships between the nervous and immune systems are essential for proper function. Any entity would be compromised if its defense and communication systems did not interact – humans are no exception.Rheumatoid arthritis (RA) is a common systemic inflammatory condition leading to symmetric, chronic synovial inflammation, erosions, and joint destruction in some patients. Its etiology is unclear but may result from an environmental trigger in the context of genetic predisposition. There is literature precedent for neuroendocrine involvement in RA pathogenesis includinA recent article reported that inhibiting spinal cord p38 MAP kinase (MAPK) reduced joint inflammation in the rat model of RA by an unknown mechanism . SomaticProinflammatory cytokine production via p38 MAPK appears to be dependent on tumor necrosis factor-alpha (TNF-α) since administration of etanercept (TNF inhibitor) blocks proinflammatory effects in rats . If spinMAPK14 on Chromosome 6p21.3. Its alpha and gamma isoforms are implicated in pathways leading to chronic inflammation [STAT4), which has been recently associated with susceptibility to RA [p38 MAPK is an important intermediate in prostaglandin release. Prostaglandins can modulate an inflammatory response and sensitize neurons to pain. Activation of spinal N-methyl-D-aspartic acid (NMDA) receptors results in release of prostaglandins and mediators of thermal hyperalgesia. p38 MAPK inhibition downregulates this process , providiammation . p38 MAPty to RA , other mWe propose a model in which gamma-aminobutyric acid (GABA), the primary inhibitory neurotransmitter of the CNS, may downregulate p38 MAPK activity to reduce peripheral production of proinflammatory cytokines in joints affected by RA.Afferent pain signals contribute to the CNS propagating an inflammatory response that may influence the development of peripheral arthritis . CrosstaB receptors are metabotropic and produce prolonged inhibitory signals, which make a more likely candidate for impacting a chronic inflammatory response. They differ from ionotropic GABA receptors that utilize fast synaptic transmission. The GABAB receptor is a heterodimer with subunits encoded by GABBR1 and GABBR2. GABBR1 is encoded in the Major Histocompatibility Complex (MHC) extended class I region (6p21.3) [HLA-DRB1 alleles (MHC class II) contribute strongly to RA susceptibility, possibly due to their role in presenting arthritogenic peptides, GABBR1 polymorphisms are not in linkage disequilibrium with these alleles (within publicly available HapMap data) as is expected given the 3 Mb distance between the two loci. Thus, observed genetic association to this region suggests a potentially independent role for GABBR1 in genetic susceptibility to RA. GABBR1 polymorphisms have not been experimentally characterized in RA patients but computational analyses suggest that some may influence alternative splicing [GABBR1 encodes multiple isoforms and missense mutations [GABA may reduce inflammation, or, conversely, deficient GABA function may contribute to uncontrolled inflammation. Such deficient function could likely occur at a specific GABA receptor. GABA(6p21.3) , an areasplicing or protesplicing . GABBR1 utations that areutations further GABBR1 and MAPK14 are both encoded on 6p21.3, their expression may be regulated together, which is common for functionally related genes in or near the MHC [GABBR1 polymorphism may impair downstream inhibition of p38 MAPK. Other molecules are known to influence p38 MAPK function in an arthritic state, including map kinase family members (such as ERK1/2) and NFκB [Since the MHC ,20. SincWithin that complex system, we propose a potential mechanism that may contribute to chronic inflammation in RA Figure . A.) WheGABBR1, may allow p38 MAPK to proceed unchecked and worsen RA.There are mechanisms that can negatively regulate this pathway. An inhibitory signal to the spinal cord (ex. GABA) may downregulate p38 MAPK and limit proinflammatory cytokine production . This coA2M) [Recent genetic evidence and functional studies in animals suggest a neurological component to RA pathogenesis and need for additional study. More insight into RA pathogenesis could also improve understanding of neurological conditions. Proinflammatory cytokines, which exacerbate synovial damage in RA, are present in excessive levels in neurodegenerative diseases . UnderstA2M) . A2M is A2M) . A2M is A2M) , causingIn summary, inhibition of p38 MAPK can limit joint inflammation , and GABOne difficulty in establishing these links (i.e. relating GABA to immune system physiology) is assembling the resources and expertise needed to evaluate a neuroimmunological question. While many researchers are focused on neuroscience or immunology, few laboratories have the experience to combine an understanding of neuronal/glial molecular pathways and rheumatic/autoimmune diseases. Furthermore, researchers in these areas do not frequently collaborate. We would encourage additional work on the role of spinal cord receptor signaling on the development of RA, and we hope that suggesting a role for GABA in the development of RA will not only encourage the further integration of basic immunology into clinical neuroscience but encourage the incorporation of basic neuroscience into clinical immunology.The author(s) declare that they have no competing interests.JMK, LBH, and SLB prepared, read, and approved the final manuscript.

Management of high risk obstetric patients.The present study was conducted to evaluate the primary causes of the admission of obstetric patients to Intensive Care Unit (ICU), the presence of co-morbid diseases, outcome of such patients, their survival rate as well as the factors which contribute to the maternal mortality.A retrospective study was conducted in the Department of Obstetrics and Gynaecology and Anaesthesiology/ICU of our Institute.Sixty-one obstetric patients, who were admitted to ICU between 20 December 2006 and 31 January 2010, were evaluated for various factors responsible for their admission as well as their outcome.P value <0.05 was considered significant.At the end of study, the data were arranged systematically and subjected to statistical analysis using nonparametric tests and Majority of the 61 patients admitted in ICU were referred from the peripheral health centers, smaller nursing homes/hospitals and some even without proper primary care and mainly comprising uneducated and rural population. Hemorrhage, pregnancy induced hypertension, cardiac diseases, respiratory insufficiency and sepsis were the main causes for admission. A total of 18 patients among 61 died during their ICU stay in the hospital.In the developing countries, high risk pregnancy should be managed at peripheral centers with proper facilities, antenatal visits and timely referral. The intensive care help should be reserved for very high risk pregnancies with co-morbid diseases. Maternal mortality is still on the higher side in developing countries like India in spite of so much of advancements in obstetrical critical care over the last few years. MaternalA major drawback in developing countries like India is the severe shortage of intensive care facilities as compared to the number of critically sick population. Obstetricians nowadays are facing new challenges, especially at tertiary care hospitals and at higher referral centers. This acquires all the more important dimensions in the background of extremely low ratio of Intensive Care Unit (ICU) specialists doctors/staff to manage such high risk patients. In most of the developing countries like India, majority of the population is distributed in the rural areas. The intellectual level of such rural patients and their relatives, their customs and traditions, lack of tertiary care facilities at villages, lack of transportation modes, as well as their financial status are the main contributory factors that account for the late admission of these patients to critical care units.4 By the The higher admission rates of obstetric patients to critical care units are largely confined to urban population which is mainly due to their education level, awareness, realization of value of human life, changing social attitudes and sound financial condition. The increased awareness about the criticality of certain obstetric conditions among urban masses has further propelled the early admission of patients to tertiary care centers. With increasing load of critical obstetric patient, the role of obstetrician has become all the more challenging and dynamic and they have to keep themselves well acquainted with the ever changing needs of critically ill obstetric patients. As a resThe ICU of our institute is 12 bedded and well equipped with all modern gadgets and state of the art ventilators. The hospital is being run by a charitable trust and provides the most sophisticated tertiary care services to people of around 80–90 villages, at a very nominal cost. The hospital has synchronized its obstetric and other health services with national rural health mission and other government programs to provide free services to the rural obstetrical patient, which has come as a boon for these poor patients.This study is aimed at a retrospective review of the obstetric patients who were admitted to ICU, the primary causes for their admission, the presence of co-morbid diseases, outcome of such patients, the types of various treatment regimens, their survival rate as well as the factors which contribute to the maternal mortalityAfter obtaining the approval of the Ethics committee of our institute, we undertook the retrospective study of obstetric patients who were admitted to ICU for one cause or another between 20 December 2006 and 31 January 2010. The following conditions were stressed in our study:primary indication of admission to ICU,gestational age of the patients,number of pregnancies,associated risk factors,system/organ involvement,types of treatment administered,total stay in ICU andoutcome of the disease process.The patient profile comprised 61 obstetric patients who were treated in ICU, irrespective of their gestational age, covering the postpartum period of 42 days as well. Mechanical ventilatory support became essential for 43 of these patients, while rest of the patients were treated without ventilatory support. Besides, the symptomatic and supportive treatment was carried out in close association with anesthesiologists and intensivists, on a patient to patient basis. During the stay in ICU, all the relevant investigations were carried out for diagnostic and therapeutic purposes, which ranged from routine to specialized tests. The ICU treatment comprised mechanical ventilation, monitoring of vital parameters, electrolyte and metabolic correction, parenteral and enteral nutrition, blood, platelets and plasma transfusion, hemodialysis and management of co-morbid diseases.P value <0.05 was considered significant.Strict and vigil monitoring was done for all patients during their stay in ICU, which included heart rate (HR), electrocardiogram (ECG), non-invasive and invasive blood pressure, end tidal carbon dioxide, pulse oximetry, central venous pressure monitoring, temperature, etc. At the end of the study, all the statistical data including patient demographics, indications for ICU admission, associated risk factors, organ involvement and patient outcome were organized systematically and subjected to statistical analysis with nonparametric tests like chi-square test. During the specified period of the study, 6895 was the total number of deliveries that were recorded from the obstetrical ward, including the 61 obstetrical patients who were admitted in ICU. Most of the ICU admissions were unbooked cases which were referred from the peripheral health centers, smaller nursing homes/hospitals and some even without proper primary care.The demographic profile of the patients is shown in P < 0.05) as majority of patients were multigravida (73.77%). The referral of critically sick obstetric patients from other smaller hospitals was again a clinically higher significant entity (P < 0.001) as 90% of the cases were not registered. Educational status of these patients was another determinant which on statistical analysis revealed significant values (P < 0.05) as majority of these patients were either illiterate (46%) or had a very meagre education (33%). The financial well being of these patients followed the similar patterns as that of education as majority of our patients (74%) were below poverty line with an income of less than Rs. 2000 per month (P < 0.001). Also, 84% of the patients who got admitted in critically sick condition hailed from rural area, while only 16% of the population comprised urban society, which again turned out to be a highly significant value (P < 0.001) on statistical analysis.The average mean age of these patients was 26.78±5.64 with a median value of 29 and a range of 19–38 years of age. There was a statistically significant correlation with regard to the gravida status (The most common reasons for admission to ICU are shown in The most common primary indication for admission to ICU was hemorrhagic shock (46%) followed by respiratory insufficiency(29%). Heart disease and cardiovascular instability was responsible for 13% of total obstetrical ICU admission, while neurologic disorders accounted for rest (12%) of the admissionsThe most common underlying disorder for admission to ICU was haemorrhage, both antepartum and postpartum combined (40%), followed by pregnancy induced hypertension and eclampsia (23%) . Sepsis From P < 0.05). A large number (53%) of patients did require the ionotropic support for the maintenance of hemodynamics. The total period of stay of all these obstetric patients in ICU ranged from minimum 1 day to maximum 21 days, with a median value of 6 days. We could not save 18 patients out of a total 61, many of whom had developed multiorgan failure [Airway protection became necessary in 70% of the patients who were intubated and subsequently given mechanical ventilation, which on statistical analysis turned out to be a significant value ( failure .P < 0.05) with progressive involvement of multiple organs as shown in the above table. Mortality rate increased to 44% with three, 75% with four and 100% deaths with five or more organs getting involved in the disease process. The most commonly involved organ system was CVS, followed by pulmonary tree, hematological system, nervous system, renal, hepatic and other organs. The hepato-renal involvement proved to be highly fatal.Only two patients succumbed to their disease that had just a single organ involvement while binary organ dysfunction led to the deaths of 23% of the patients. Mortality increased significantly (The ratio of maternal mortality to morbidity is a very good health predictor of health care delivery system. The study has thrown light on one very basic factor, that is, if high risk obstetric patients are managed at tertiary hospitals with all the advanced clinical facilities and equipment, maternal mortality and morbidity can be reduced to a large extent. Our present study has found quite a similar pattern with other such studies indicating the criteria for admission to ICU.79–11 In 7The patients exhibiting the clinical picture of pre-eclampsia/ eclampsia, pulmonary edema, seizures, aspiration, congestive cardiac failure, etc. invariably did require ventilatory support in addition to the supportive treatment for the clinically presenting symptoms. The intervention strategies designed for the treatment of our patients were quite comparable with the methodologies employed by other authors.The infrastructure for intensive care treatment in our country is still at infancy stage due to acute shortage of ventilators and specialist doctors/staff. Ignorance and poor financial status are some of the other responsible factors. The absence of uniform specialist medical service and lack of proper medical facilities have immensely contributed to increasing the risk to our obstetric patients, which otherwise would have been properly managed at tertiary care health centers with timely interventions from the beginning itself. The government may have launched so many programs aiming at safe motherhood and child survival, but they are poorly implemented at the grass root level, the reasons for which are many but are out of scope for discussion in this article.Had the patients undergone ultrasonography examination at appropriate health centers, few disorders like placenta accreta/ percreta, ectopic rupture and heterotopic pregnancy could have been timely diagnosed. The major reasons for ICU admission like hemorrhage, hypertensive disorders and heart diseases would have been prevented had the proper treatment been started during mid pregnancy. The hemorrhagic disorders most commonly occurred as a result of uterine atony due to prolonged or obstructed labor, retained products as well as due to iatrogenic causes, reflecting our poor obstetrical rural infrastructure and facilities and all these results are quite consistent with those of other such studies.81516 Pro81511117This study has again found the already present limitations in our health infrastructure pointing toward the improper obstetric care, untimely referral system, customs and traditions, lack of awareness, negligence in implementation of national programs and so on. The timely referral of such patients to tertiary care centers with ICU facilities does improve the outcome of obstetric patients.21There is no absolute scoring pattern which can be applied to assess the severity of critically ill obstetric patients because some methods underestimate while others overestimate the severity of such patients and it is mainly because of grossly altered physiological state due to pregnancy.2223 Thou22The results have thrown light on some very significant aspects in our study, which are the educational level and poor economic status of the patients, as large number of ICU admissions comprised either uneducated or poorly educated patients as well as patients belonging to poor economic strata. The socioeconomic status, educational level and antenatal visits can greatly predict the effects on obstetric complications and outcome. Most of 34The pregnant patients with co-morbid diseases like hypertension and cardiovascular diseases, respiratory diseases, hepato-renal involvement, any systemic disease should be carefully monitored and regularly followed up and must be properly educated during the antenatal visits about the potential complications. Improvement is required at the peripheral health centers for proper antenatal care, early treatment/advice for related medical conditions and timely referral of high risk pregnancies to the tertiary care centers for advanced treatment. The national programs concerned with safety of mother and child have to be re-strengthened at the grass root level. Involvement as well as awareness of masses, in the background of local customs and traditions, is an essential pre-requisite to decrease the figures of maternal mortality and morbidity. More fellowship programs should be started to involve the doctors of various specialties into the mainstream by imparting them the knowledge and the essentials of intensive care, which will at least tide over the acute shortage of specialist intensive doctors and staff. Lucrative incentives should be provided to the specialists who are posted in rural centers. Regular visits by the health officials are required for the adequate upgradation and maintenance of health facilities in these centers. The work should be visible not only in the census but in reality as well. Adequate training centers should be opened for education of paramedical and other health workers. Advanced diagnostic facilities should be provided in such a manner at a particular center that it covers the maximum population of not only that region but also the surrounding areas as well.After considering all the causes and consequences of this major issue, we conclude that high risk pregnancy should be managed at peripheral centers with proper facilities and timely referral. The intensive care resources should be reserved for very high risk pregnancies with co-morbid diseases especially related to cardiovascular, respiratory and hepato-renal diseases. The role of government agencies acquires significant dimensions and efforts should be made by the government to involve the corporate sectors, non government organizations and other agencies in delivering better obstetric health care, especially at peripheral health centers.

Life scientists need help in coping with the plethora of fast growing and scattered knowledge resources. Ideally, this knowledge should be integrated in a form that allows them to pose complex questions that address the properties of biological systems, independently from the origin of the knowledge. Semantic Web technologies prove to be well suited for knowledge integration, knowledge production (hypothesis formulation), knowledge querying and knowledge maintenance.We implemented a semantically integrated resource named BioGateway, comprising the entire set of the OBO foundry candidate ontologies, the GO annotation files, the SWISS-PROT protein set, the NCBI taxonomy and several in-house ontologies. BioGateway provides a single entry point to query these resources through SPARQL. It constitutes a key component for a Semantic Systems Biology approach to generate new hypotheses concerning systems properties. In the course of developing BioGateway, we faced challenges that are common to other projects that involve large datasets in diverse representations. We present a detailed analysis of the obstacles that had to be overcome in creating BioGateway. We demonstrate the potential of a comprehensive application of Semantic Web technologies to global biomedical data.The time is ripe for launching a community effort aimed at a wider acceptance and application of Semantic Web technologies in the life sciences. We call for the creation of a forum that strives to implement a truly semantic life science foundation for Semantic Systems Biology.http://www.semantic-systems-biology.org/biogateway.Access to the system and supplementary information can be found at Systems Biology aims to offer a holistic view of the way in which biological systems work. Systems Biology is an integrative biology, and is already instrumental in rationalising the exploitation of the so-called "-omics" technologies. These technologies are producing massive amounts of biological data which are often stored in disparate, specialised repositories that may not always abide by common standards for data formats –3. This A powerful integration of available biological data and knowledge needs an efficient information retrieval and management system. Semantic Web technologies are designed to meet this challenge, and the Semantic Web promises an infrastructure that comprises machine understandable content and therefore a World Wide Web consisting of linked data instead of documents alone. Indeed, computational systems based on a semantic integration of raw data and ontological relationships will provide a sophisticated framework to interrogate and retrieve pertinent information. Integrated knowledge resources may even allow the deployment of advanced computational reasoning approaches in orderWe are witnessing a growing acceptance of Semantic Web technologies for knowledge integration in the life sciences. This is illustrated by the existence of a W3C special interest group (SemantiSemantic Systems Biology (SSB), a form of systems biology in which new hypotheses concerning a biological system are generated through queries and reasoning on integrated data, as opposed to being generated through a mathematical model. We believe that Semantic Systems Biology may provide a powerful complement to the mathematical model-based Systems Biology.To explore the potential for Systems Biology we constructed BioGateway , a systei.e. no information is lost) and to facilitate querying. The ONTO-PERL suite is a Perl API that can be used to programmatically manipulate ontologies in OBO format. ONTO-PERL offers the possibility of translating an ontology in OBO format to any of the following representations: RDF, XML, OWL, DOT, GML, XGMML and SBML. Such translations are required to accommodate the different semantics of the languages in the mapping process [A suitable data representation is necessary to share and uniformly query the RDF integrated repository. Although different means exist to translate ontologies in the Open Biomedical Ontologies Format (OBOF) to several representations , there i process , which i process .The proposed mapping from OBO to RDF Table has undeBioGateway is a system based on an RDF store that combines information from various resources :The entire set of candidate OBO Foundry ontologies ;The complete collection of annotations included in the Gene Ontology Annotation (GOA) files ;A minimised version of the NCBI taxonomy (includiA subset of SWISS-PROT (includiThe Cell Cycle Ontology (CCO) .All the imported data sources, when converted to RDF graphs, share a basic URI:http://www.semantic-systems-biology.orge.g. each protein from SWISS-PROT, each taxon from the NCBI taxonomy, and each OBO term) has a URI of the form:This means that each resource . A consistent list of relation types was manually created for BioMetarel. As a rule, we chose to include a verb in every relation type name, conjugated as the third person singular in the present tense. The application of this rule predominantly involved the addition of the verb is. As a consequence, we can return triples in the form of a pseudo-grammatical sentence such as: blood is located in vein. This rule also prompted us to transform names such as anatomical_relation to: is anatomically related to, and surrounding to: surrounds. In fact, the meaning of several poorly named relation types became clearer by adhering to this style.BioMetarel holds thThe most straightforward use of BioMetarel is to connect the unique identifiers of the relation types with their user-friendly names. However, we observed that the inclusion of the full BioMetarel in each graph interfered with some specific queries, such as the listing of all the resources of a graph. It is more convenient for querying and exploring a graph when an RDF graph relates only to a single topic. We therefore created a lightweight subontology of BioMetarel called Biorel. This subontology contains only relation types, with no metaclasses and metarelations between relation types. This made Biorel more suitable for inclusion in every RDF graph in BioGateway. An example of a query over this scaffold is shown in Figure Having such a relation infrastructure implemented in BioGateway allowed us to build a consistent RDF scaffold for other resources, such as GOA associations together with the evidence codes. All that needed to be done to create the integrated graph was to consistently use appropriate identifiers for the predicates in the RDF triples. The integration of OBO Foundry ontologies with respect to the classes did not pose problems since these are given different identifiers in different ontologies, and they are orthogonal as a design principle.Queries). In summary, the integration of data in BioGateway has been achieved based on the use of BioMetarel, the use of the same URIs for equivalent resources in the data sources , and the orthogonality of OBO ontologies with respect to the classes.A small ontology named Metaonto was created in the OBO format for the mapping between the names of the OBO ontologies and the prefixes they use in their unique identifiers. The mapping is helpful for users who want to explore the OBO Foundry with queries in BioGateway. Meta-information such as the names of the RDF graphs, what the graphs are about, and characteristics of the relation types are accessible as results of the so-called "ontological queries" . This resulted in an RDF model that is adequately suited for querying, especially in terms of performance. During this process we have paid attention to several quality constraints:Quick results: A relatively quick query answer is always a desirable feature for any system. A query builder wants to see a quick and sound answer on a small query pattern or on a small part of the data before he launches into a heavier query. Therefore, we have systematically tested the response time with a suite of queries. This quality constraint turned out to be our biggest challenge during the development of the system. The query performance is dependent on different factors, making the subject difficult to investigate. In particular, disk access and the caching of earlier results, as well as seemingly unimportant details in the query itself can have a profound impact on the query performance, resulting in differences of one to two orders of magnitude in query time. For this reason, we removed any unnecessary chains in the RDF translations to allow short queries and to avoid inhibitive bottlenecks in the performance. The idea to provide the data in both singular and composed graphs was also inspired by performance issues. Demanding queries can now be targeted to the relevant parts of the data. Due to these optimisations, most queries described in this paper return an answer within one second, and the chance of getting an answer on a more complex query within a reasonable time are also better.Human readable output: As RDF works with URIs, many outputs from SPARQL queries might be difficult to comprehend. We tried to avoid such outputs as much as possible by creating labels for all the terms and all the relation types that can be used to present the results to the user.Good practice: RDF is a Semantic Web standard that implies good design practices [ractices as it peWhile defining the specifications of the RDF translations for each of the integrated resources, we also developed a library of queries that were used to test performance (see Section: SSB (short for Semantic Systems Biology) was defined to gather all the resources accessible as graphs from BioGateway . That is, if resources A, B and C are related via part_of (A part_of B part_of C), a third triple A part_of C is created. This operation was done for the candidate OBO ontologies, CCO and BioMetarel, thus allowing transitivity in queries to be exploited with little impact on the performance of BioGateway.Transitive closure is an important feature in biomedical knowledge representation, especially when it concerns partonomy . In addie.g. " is the term leptotene part of the term meiosis?", see Figure if a protein P is located in L, and L is part of C and C is a D, then P is located in D".Transitive closure provides a scaffold for being able to reach other terms from a given term of the candidate OBO foundry ontologies, CCO and BioMetarel.The pipeline additionally generates the transitive closure graphs might exploit the information that is contained in the relations connecting the terms. The OBO Foundry has a policy of using a small set of shared relations for the different ontologies; the implementation of the policy is, however, far from complete. In order to create a self-contained ontology file, all relation types need to be included in the same file, with a name and a unique identifier. This has led to redundant sections for the relations of the 44 imported OBO candidate ontology files with several inconsistencies. Some relations with the same unique identifiers had different names (e.g. part_of and is_part_of). This complicates their usage, and in particular, the process of building queries over different resources that should ideally share the same relation. Moreover, the identifiers cannot serve to communicate with users, as some of them were not meant to be humanly readable, such as BSPO_0000095 , which extends the relations that are used in the OBO Foundry ontologies.The relations play a key role in the integration of different data sources. Many interesting queries or DESCOntology ). We thehas function, is located in, and participates in for the GO molecular functions, GO cellular components and GO biological processes, respectively.We used the relations of the OBO Foundry to integrate the various data sources, including those that were not OBO-formatted. The GOA-associations essentially consist of relations between proteins in UniProt and terms in the Gene Ontology (GO). These relations were easily mapped to the OBO relation types: OBO foundry principles checking). The periodic reassembly of BioGateway can therefore be exploited for quality control and the curation of the entire OBO Foundry. In addition, individual ontology engineers may find their uploaded ontology in the system, and launch dedicated queries designed for quality control.The integration of all the ontologies into the OBO Foundry allows for the detection of many engineering flaws, particularly ontologies that may be hard to find in a systematic way using other tools , as well as syntactical correctness (e.g. OBOF specification compliance) and logical completeness (e.g. is_a completeness). Three of these principles can easily be checked by using BioGateway:The ontologies include textual definitions for all terms.The ontology uses relations that are unambiguously defined following the pattern of definitions laid down in the OBO RO.The ontology must be orthogonal to other ontologies already lodged within OBO.The OBO Foundry proposes 10 principles to which OBO bio-ontology engineers should commit . That seIn particular, the orthogonality principle, that forbids the use of terms with the same name but likely with different meanings in disparate ontologies, might be difficult to check with any other tool. The following query looks for terms which have an identical name in the human disease ontology (DOID) and mouse pathology ontology (MPATH):http://www.semantic-systems-biology.org/>BASE <http://www.w3.org/2000/01/rdf-schema#>PREFIX rdfs: <http://www.semantic-systems-biology.org/SSB#>PREFIX ssb: <SELECT ?common_name ?term_id_1 ?term_id_2WHERE {   GRAPH <human_disease> {      ?term_id_1 a ssb:DOID.      ?term_id_1 rdfs:label ?common_name.   }   GRAPH <mouse_pathology> {      ?term_id_2 a ssb:MPATH.      ?term_id_2 rdfs:label ?common_name.   }}The answer to the previous query highlights the term named "hyperplasia" as a repeated term. The two other listed principles can be checked in a similar way.is_a relationship. This can return the root terms of the ontology, but unfortunately most of the returned terms are just orphans that miss any outgoing is_a relationship. Many candidate OBO Foundry ontologies are not is_a complete. This may be due to the use of some ontology editors (e.g. OBO-Edit) that hide the terms in the hierarchy that have an outgoing relationship. In BioGateway, one can easily trace these terms.We have also created a query to find all the terms that have no outgoing The visualisation of triple-based resources poses a special challenge. It is necessary to develop and deploy new interfaces to manipulate, query and visualise this knowledge in an intuitive way. An SPARQL browser (still under development) enables one to query and visually explore the results obtained using BioGateway, and can be accessed from the SSB website. With this interface, users can define SPARQL queries to be launched over the resources integrated within BioGateway. The SPARQL endpoint could also be customised (by default it points to the SSB endpoint) Figure . After ename, parameters that can be changed and function; the rest constitutes the query itself (note the use of transitivity).SPARQL queries can be executed against the BioGateway triple store. Many sample queries are available at the website. For example, the following SPARQL query retrieves human proteins that are located in the nucleus. The metadata about this query are presented in the first five lines at the top (lines starting with # are not interpreted by the query engine): # NAME: get_proteins_in_nucleus# PARAMETER: GO_0005634: the nucleus# PARAMETER: 25.H_sapiens: the GOA graph for human# FUNCTION: returns all the human proteins that have the# nucleus as annotated locationhttp://www.semantic-systems-biology.org/BASE <>http://www.w3.org/2000/01/rdf-schema#PREFIX rdfs: <>http://www.semantic-systems-biology.org/SSB#PREFIX ssb: <>SELECT ?protein ?sublocation ?protein_idWHERE {   GRAPH <25.H_sapiens> {      ?protein_id ssb:located_in ?sublocation_id.      ?protein_id rdfs:label ?protein.   }   GRAPH <gene_ontology_edit_tc>{      ?sublocation_id rdfs:label ?sublocation.      ?sublocation_id ssb:is_a ?sublocpart_id.      ?sublocpart_id ssb:part_of ssb:GO_0005634.   }}BioGateway provides a library of optimised, easily customisable SPARQL queries that make the resources easily accessible to both laymen users and experts, although even SPARQL experts will not easily find their way through RDF resources with which they are not acquainted. Therefore, we tried to reflect the basic query requirements in the library. This makes BioGateway accessible with a single click, and is a building block for future applications.biological queries and a section with ontological queries. The biological queries are designed for use by biomedical scientists, and draw on the most relevant part of the KB. Some examples of biological queries read as follows:Queries, a query that returns all the human proteins that are located in the nucleus is discussed.Get the proteins with a specific function/location/process for any of the annotated organisms. For example, in Section: Get the information on the function, location, process and associated disease for a given protein.Get the proteins that are involved in the "psoriasis" disease.The library was split into a section with ontological queries shows how SPARQL can be used to explore BioGateway, particularly the OBO ontologies. This set of queries is intended for users who are interested in ontology engineering. Any future applications that build on the results of SPARQL queries will certainly benefit from the availability of basic navigation-type queries such as get neighbourhood, get the root of an ontology, get the hierarchy to the root, get graphs, etc. These queries explore the typical network structure of RDF models. In contrast, the ontological queries show the RDF semantics that are available in BioGateway, such as subsumption, transitivity and the composition of relations. Some examples of ontological queries read as follows:Query the OBO Foundry: search on names and get their unique identifiers.Get all the neighbouring terms of a given term.etc. of a given OBO term.Get all the properties, such as definition, synonyms, The set of Combining regular RDF graphs with transitive closure graphs. All the queries in the library were provided with a name, its function and a list of parameters that can be customised in a query. By properly using prefixes, an SPARQL query can be written in such a way that a parameter only needs to be replaced in one fixed place. All the queries in the library were written in this way.Both sections of the library help to make BioGateway a workbench for creating SPARQL queries. The results of a query can often be used to copy-and-paste as a parameter in other queries. We further elaborate on this idea in the Section: One of the ontological queries in the library is designed to find the closest common ancestor in the hierarchy of an ontology for two given terms:# NAME: get_common_ancestor# PARAMETER: GO_0002617: the first query-term# PARAMETER: GO_0034125: the second query-term# FUNCTION: returns the closest common ancestor-term in the# hierarchy for two given termshttp://www.semantic-systems-biology.org/BASE <>http://www.w3.org/2000/01/rdf-schema#PREFIX rdfs: <>http://www.semantic-systems-biology.org/SSB#PREFIX ssb: <>PREFIX term1_id: <SSB#GO_0002617>PREFIX term2_id: <SSB#GO_0034125>SELECT distinct ?common_ancestor ?common_ancestor_idWHERE {   GRAPH <SSB_tc> {      term1_id: ssb:is_a ?common_ancestor_id.      term2_id: ssb:is_a ?common_ancestor_id.      OPTIONAL {         term1_id: ssb:is_a ?direct_child.         term2_id: ssb:is_a ?direct_child.         GRAPH <SSB> {            ?direct_child ssb:is_a ?common_ancestor_id.         }      }      ?common_ancestor_id rdfs:label ?common_ancestor.   }   FILTER(!bound(?direct_child))}SSB_tc that is generated by the pipeline, see Section: BioGateway architecture). In fact, the query might be reduced to: find all the ancestors of both terms that do not have any descendants that are ancestral to both terms. To find all the terms that are ancestors of both terms we need the transitive closure graph, as in that form all the ancestors are directly linked to their descendants. Two triples in the query are enough to retrieve their id:For this query, we need both the regular RDF ontology and its transitive closure )e.g. genomic sequences) in different species. Comparison of these features allows the formulation of hypotheses with respect to the functions of genes and their products, as well as the localisations of gene products and the processes in which they are involved. BioGateway enables an innovative way of exploring such similarities by taking into account the stored annotations across the different organisms under consideration. The following simple query shows how this potential use can be exploited to retrieve all the proteins that have the same function (GO_0005216: ion channel activity), are located in the same cellular compartment (GO_0005764: lysosome), and participate in the same process (GO_0006811: ion transport) in any of the organisms of the repository:Comparative bioinformatics has yielded important new hypotheses by identifying and comparing similar features . Not surprisingly, some of the entries are ortholog proteins (such as KCNE1_HUMAN and KCNE1_MOUSE). Some simple modifications, such as using an OPTIONAL clause over the first triple, may find that many other proteins (such as VATM_DICDI in D. discoideum) also share the same location and process.The query returns 11 proteins fulfilling the conditions of same function, location and process found in four organisms and retrieve (e.g. SPARQL) knowledge. Although there are still limitations with respect to the representation of some types of information and it may prove difficult to model complex scenarios (such as expression data from microarray experiments), these standards have been shown to accommodate information that can be queried to gain further biological insights [The life sciences community is becoming aware of the need for standards to communicate and store data and metadata , 37, 38.insights –41.To demonstrate the utility of such standards, we built BioGateway, an RDF triple store that integrates different life sciences knowledge resources. We have shown that the use of the Semantic Web technologies makes data integration straightforward, and also allows for the enabling of flexible and fine-grained information retrieval from KBs. At the same time, we experienced some problems such as considerable upfront investment in the creation of content in RDF and performance issues while querying either very large triple stores and/or using complex queries. Other projects –46 have From our reflection upon our own experience and other similar initiatives, we identified the problems that remain to be solved in order for the Semantic Web to become a reality in Life Sciences:A universal resolvable mechanism for identifying biological entities is vital for a Life Sciences Semantic Web . The proe.g. microformats [Most biological information is either not semantically codified or it has been semantically codified with a poor axiomatisation . This inoformats , GRDDL [oformats , RDFa [5oformats ).e.g. Protégé [e.g. FaCT++ [e.g. OWL API [e.g. OpenLink Virtuoso) for the Semantic Web have advanced over the last few years, they still fall short of constituting an established and robust technology, especially in regard to their utility and reliability. On the language side, however, OWL is evolving quickly and many new features have appeared in OWL 2 [Even though ontology editors , reason. FaCT++ ), APIs ( OWL API ) and plain OWL 2 , increasmiddleware level (e.g. reasoners), that allows for the development of concrete applications such as BioGateway, scalability and visualisation (formerly relatively neglected) are becoming key aspects while developing these technologies to support the popularisation of the Semantic Web (e.g. the LarKC project aims to overcome reasoning limitations with vast amounts of data [Academia and industry are combining efforts to bolster the development of reliable and sound Semantic Web technologies. Although research advances are more clearly appreciated at a of data ).The aforementioned difficulties were succinctly summarised in the title of the panel discussion during the recent SWAT4LS workshop : "If theWhile building BioGateway, the choice of RDF, as opposed to using OWL, resided mainly on the benefits obtained while adequately combining a set of data, a given set of queries and a query engine (OpenVirtuoso in our case). Such a combination of elements impacts many aspects, such as the speed of answers, inferencing capabilities and scalability. Some projects such as Wolfram Alpha , that aiEncourage and facilitate the creation of semantic bio-content.Develop best practices that will be commonly accepted for such content creation.Collect and index such content.Agree upon, and encourage a mechanism for identifying biological entities.Facilitate the communication between the semantic technology developers and the life scientist: the users of such technology.The problems observed during the development of BioGateway and other RDF stores can only be addressed at the community level. Therefore, we make a public call for the creation and development of a Semantic Systems Biology community with the following aims:Orthogonality: avoid duplications of efforts;e.g. definition, function, has evidence, etc.);A defined set of RDF tags (e.g. purl.org);A unique identifier per resource, plus an ID resolution ;Identify a list of prospective resource applications ;e.g. visualisation);Tooling .This community should have objectives beyond those of the OBO Foundry: it should build upon the best of OBO and exploit it in a standardised platform with emerging Semantic Web qualities. As a first step towards such a community, we have built the Semantic Systems Biology wiki . We vente.g. HCLS IG, NeuroCommons [We strongly feel that this is the appropriate moment to establish such a community to bolster and extend the current efforts .BioGateway is built using an automated pipeline implemented in Perl (the source code is available at the SSB website ). This pThe following public resources are integrated under the BioGateway umbrella:Candidate OBO foundry ontologies ;NCBI taxonomy (FTP site );GOA files .Metarel, Biorel and Metaonto were manually created using OBO-Edit . MetarelResults). In the course of conversion, any relations present in the ontologies were omitted .The conversion of GOA, SWISS-PROT and NCBI files to RDF was performed with the newly developed ONTO-PERL modules GoaToRdf, SwissProtToRdf and NcbiToRdf, respectively. The Ontology module from ONTO-PERL was used for converting ontologies from the OBO format to RDF. This conversion has been optimised, as compared to the originally published version of ONTO-PERL to minimise the number of blank nodes for the sake of query performance are expanded so that explicit relations to its ancestors are added and the partonomic relation (part_of). This was done for all OBO ontologies, CCO and BioMetarel.To increase the utility of the RDF representation, transitive closures were added programmatically with the use of the Ontolome module from ONTO-PERL . During lgorithm ). This gSSB graph including all individual graphs, the SSB_tc graph containing all the transitive closures, the OBO graph comprising all the OBO candidate ontologies and the GOA graph combining all the GOA graphs. A copy of the Biorel graph was added during the upload to each of the graphs (except Biorel and BioMetarel).The RDF files were uploaded into the Virtuoso server using the Perl DBI module , the ODBA web interface for querhttp://www.netthreads.co.uk.The SPARQL Browser , a web a

The pattern of pediatric stroke displays ethnic and geographical variations. There are few reports from black Sub-Saharan Africa, although relevant data are important in prevention, clinical diagnosis, treatment and prognostication.To describe subtypes, risk factors, localization, age and gender distribution of pediatric stroke in the black Kenyan population.Retrospective cross-sectional study in a single regional referral and teaching hospital.Data were analyzed by SPSS version 13.0 for Windows and presented in tables and bar and pie charts.The study was performed at the Kenyatta National Hospital, a level-6 regional referral health facility with an annual pediatric in-patient turnover of about 40,000 patients. Files of patients aged 1 month to 18 years over a period of 5 years were analyzed for stroke subtypes, localization, risk factors, age and sex distribution. Only those files with complete information were included.Thirty-two of the 712 stroke patients (4.5%) were pediatric. The male:female ratio was 1.7:1. Ischemic stroke comprised 56.3% (n = 18). Mean age was 7.7 years . The most common sites were cortical (51%), lacunar (41%) and brain stem (8%). The most common risk factors were connective tissue disorders (28.1%), heart disease (25%), human immunodeficiency virus (9.4%) and infection (9.4%).Pediatric stroke is not uncommon in the Kenyan population. The risk factor profile comprising connective tissue disorders and infection differs from that reported in other populations, inviting large community-based studies. Pediatric stroke is an important cause of mortality and morbidity.2 Its pat3This was a retrospective study performed at the Kenyatta National Hospital (KNH), a level-6 Eastern and Central African regional referral and teaching hospital in Nairobi, Kenya, with a total pediatric patient population of about 40,000 per year. Ethical approval for the study was granted by the Kenyatta National Hospital/University of Nairobi Ethics and Research Committee (KNH/UoN-ERC). Files of patients aged between 1 month and 18 years with a diagnosis of stroke, seen between January 2004 and December 2008, were retrieved from the hospital registry. Patients were categorized into male and female, and each was sex divided into five year age groups. Only files with complete data were included. Each file was analyzed for presentation, mode of diagnosis, stroke subtype, localization, risk factors and outcome. These data were analyzed using SPSS version 13.0 for Windows and presented by means of tables and bar and pie charts.Thirty-two cases of pediatric stroke out of 712 (4.5%) were retrieved in a pediatric inpatient population of about 200,000 over the study period. Twenty of these (62.5%) were males while 12 (37.5%) were females. Male predominance reduced with age such that by 16–18 years, females exceeded males. Mean age was 7.7 years, with the peak occurring in the 6–10-year age group .Ischemic and hemorrhagic strokes comprised 18 (56.3%) and 14 (43.7%), respectively. Of these, 17 (53.1%) were cortical types, distributed as eight frontoparietal, four parietal, three temporal, one occipital and one frontal. The remaining 15 cases (46.9%) were subcortical types, located in the basal ganglia (5), internal capsule (4), thalamus (4) and brain stem (2).The most common modes of presentation in younger children (below 5 years) were focal weakness (2), seizures (2), altered mental status (1) and mixed symptoms (3). In older children, it was mixed symptoms (11), hemiparesis (5), altered mental status (3) and other focal neurologic signs, such as aphasia and visual disturbance (5). Nine cases (28.1%) were diagnosed clinically while 23 (71.9%) were confirmed by computed tomography (CT) scan.The major risk/comorbid factors were connective tissue disorders (28.1%), congenital heart disease (25.0%), human immunodeficiency virus (HIV) infection (9.4%), other infections (9.4%) and sickle cell disease (6.3%). In two cases (6.3%), there were multiple comorbid conditions while in five cases (15.6%) no risk/comorbidity was determined . ThirteeThe estimated prevalence of 16 per 100,000 is higher than the 1.29–13.0 per 100,000 reported in other populations.[The mean age of 7.7 years observed in the present study is comparable to 7.7 years reported for an American population, but high8As in the literature reports,11 ischemThe most common cause of ischemic stroke among black children is reported to be sickle cell disease. ObservatThese studies reveal that risk factors vary between countries and ethnic groups, suggesting that environmental factors interact with genetic predisposition to determine the overall risk. This implies that there is a need for the evaluation of population-specific factors. A notable observation of the current study is the high prevalence of connective tissue disorders comparable to the Singaporean population. The connHIV was implicated in 9.4% of the cases in the present study. HIV/AIDS increases the risk of both ischemic and hemorrhagic stroke after correcting for other cardiovascular risk factors.20 This i22Observations of the current study reveal that infection was implicated in 9.4% of the cases. This appears to be commensurate with reports that infectious burden index is associated with increased risk of all strokes. In over Pediatric stroke is not uncommon in the Kenyan population. Its characteristics resemble those reported for Caucasian and Asian populations. This risk factor profile comprising connective tissue disorders and infection differ from those reported for other populations, inviting large community-based studies.

The high linear energy transfer, alpha-particle-emitting radionuclide astatine-211 (211At) is of interest for certain therapeutic applications; however, because of the 55- to 70-microm path length of its alpha-particles, achieving homogeneous tracer distribution is critical. Hyperthermia may enhance the therapeutic efficacy of alpha-particle endoradiotherapy if it can improve tracer distribution. In this study, we have investigated whether hyperthermia increased the cytotoxicity of an 211At-labelled monoclonal antibody (MAb) in tumour spheroids with a radius (approximately 100 microm) greater than the range of 211At alpha-particles. Hyperthermia for 1 h at 42 degrees C was used because this treatment itself resulted in no regrowth delay. Radiolabelled chimeric MAb 81C6 reactive with the extracellular matrix antigen tenascin was added to spheroids grown from the D-247 MG human glioma cell line at activity concentrations ranging from 0.125 to 250 kBq ml(-1). A significant regrowth delay was observed at 125 and 250 kBq ml(-1) in both hyperthermia-treated and untreated spheroids. For groups receiving hyperthermia, no increase in cytotoxicity was seen compared with normothermic controls at any activity concentration. These results and those from autoradiographs indicate that hyperthermia at 42 degrees C for 1 h had no significant effect on the uptake or distribution of this antitenascin MAb in D-247 MG spheroids.

Human Africa trypanosomiasis is a centuries-old disease which has disrupted sub-Saharan Africa in both physical suffering and economic loss. This article presents an update of classic chemotherapeutic agents, in use for >50 years and the recent development of promising non-toxic combination chemotherapy suitable for use in rural clinics. Trypanosoma brucei subgroup, T. b. gambiense (West African or Gambian form) and T. b. rhodesiense (East African or Rhodesian form). The parasites are transmitted by the tsetse fly between humans and reservoir domestic and wild animals. In the early-stage of the disease, the parasite is found in the bloodstream and lymphatic system. In the later, central nervous system stage, cerebrospinal fluid, and neural tissue become infected. Symptoms of early-stage include fever, chills, headache, and lymphadopathy. In the later CNS stage, severe headaches, insomnia, progressive mental deterioration, psychiatric manifestations, and tremors are common, finally culminating in coma and death [Human African Trypanosomiasis (HAT) or African trypanosomiasis has been endemic in sub-Saharan Africa for thousands of years. Currently approximately 50 million people are at risk for this disease in an area of 10 million square kilometers [nd death . The surnd death . The gennd death . This im The attention paid to developing chemotherapy for HAT has lagged behind that for other tropical diseases . The ageDifluoromethylornithine is the only new useful addition to this list for treatment of late-stage since the early 1950s , 8. A reT. b. gambiense infection, but is less effective against T. b. rhodesiense infection, and is ineffective against late-stage disease [μM range, we now know that this internal concentration is achievable via uptake through the P2 nucleoside–pentamidine transporter, and two other recently discovered transporters HAPT1 and LAPT1 [Pentamidine is a water-soluble aromatic diamidine that has been in use since the 1930s. It is effective against early-stage disease , 11. Dos disease . African disease , 13. Rec disease . Many st disease , 11. Pen disease . Althougnd LAPT1 , 15. Othnd LAPT1 , 11. T. b. gambiense and T. b. rhodesiense. Berenil has also been used in combination with melarsoprol for the late-stage disease. Mechanistically, like pentamidine, berenil has also been linked to kinetoplast DNA binding at the minor groove and cleavage of minicircle DNA. As with pentamidine, berenil may also interfere with RNA editing and trans-splicing [Diminazene aceturate (Berenil) is an aromatic diamidine developed by Hoechst as treatment for bovine trypanosomiasis; however, its apparent low incidence of adverse reactions and significant therapeutic activity has led some physicians in endemic countries to use it extensively. It is effective against early-stage splicing . Berenilsplicing . Althougsplicing , 15. ThiT. b. rhodesiense. Suramin does not penetrate the blood-brain barrier and is not used for CNS-stage disease. It was first used in 1922, developed from the closely related azo dyes, trypan red, and trypan blue [T. b. brucei and also other enzymes, including those of the pentose phosphate pathway [Suramin is a sulfonated naphthylamine, which has been used successfully against early-stage sleeping sickness caused chiefly by pan blue , 10. Surpan blue . Suramin pathway . p- aminophenylarsenoxide was complexed with dimercaptopropanol (British Anti-Lewisite) to form a less-toxic complex, merlarsoprol. Until 1990, this was the only agent available for treatment of late-stage CNS disease both of East African and West African origin. It is usually given as two to four series of three daily I.V. injections, or a single daily injection for 10 days [μM) levels rapidly lyse. Because the bloodstream forms are intensely glycolytic, any interruption of glycolysis or interference with redox metabolism should produce this effect. Thus a series of reports has detailed melarsoprol inhibition of trypanosome pyruvate kinase , phosphofructokinase , and fructose-2,6-bisphosphatase . It is likely that the rapid inhibition of fructose 2,6,bis-phosphate production is a key factor in halting glycolysis through downregulation of pyruvate kinase [ Melarsoprol is an arsenical resulting from the efforts of Ernst Freidheim in the late 1940s. His initial compound, melarsen oxide, 10 days . It is i 10 days , 17. Alte kinase . Other se kinase , 18. Thee kinase . Howevere kinase , 13. Alte kinase . T. b. gambiense sleeping sickness. DFMO is an enzyme-activated irreversible inhibitor of ornithine decarboxylase (ODC), the initial enzyme in the polyamine synthetic pathway. This agent was initially developed as an antitumor agent by Merrell-Dow in the late 1970s and underwent extensive clinical trials before testing against trypanosomes, after initial testing in mouse model T. b. brucei infections [T. b. brucei and T. b. gambiense, but not to all strains of T. b. rhodesiense [. The reason for this selectivity is not completely evident, although it is not due to uptake of DFMO, because it enters by passive diffusion, not transport [T. b. rhodesiense isolates have an ODC with a shorter half-life than T. b. gambiense, which could result in lowered susceptibility to DFMO. Also levels of AdoMet are highly elevated in DFMO-treated susceptible T. b. rhodesiense strains, but less so in refractory isolates [ DFMO is the most recently developed agent for late-stage fections . DFMO wafections , 23. Thefections , 24 The fections . DFMO rafections . Trypanofections . Morpholfections . DFMO isdesiense . The rearansport , 29. Iteransport have fouisolates . This elisolates . Trypanoisolates , 32. Beyisolates .T. b. brucei, DFMO was curative in combination with many new agents as well as clinically-used trypanocides, including suramin and melarsoprol [Eflornithine is the only new agent developed in 58 years for clinical use of second stage HAT. With relatively minor and irreversible side effects as compared to melarsoprol, it is superior in efficacy to melarsoprol , 34. In arsoprol , 36. In arsoprol . Recent arsoprol , 34. Becarsoprol showed tarsoprol . In anotarsoprol , 20 and arsoprol . In addiarsoprol ).Trypanosomiasis causes complex public health and epizootic problems in many developing countries in Africa. Control programs concentrating on the eradication of vectors and drug treatment of infected people and animals have been in operation in some areas for decades. Considerable progress has been made in a number of regions, but the lack of agreement on the best approach to solving the problem of African trypanosomiasis, combined with a paucity of resources, stands in the way of effective control. Individuals can reduce their risk of becoming infected with trypanosomes by avoiding tsetse fly-infested areas, by wearing clothing that reduces the biting of the flies, and by using insect repellants. Chemoprophylaxis with suramin or pentamidine can be effective, but it is not clear which populations should use this as a preventive measure. No vaccine is available to prevent the transmission of the parasites.

Brucellosis may cause serious infections in healthy individuals living in countries that are endemic for the infection. However, reports of brucella infections in immunocompromised hosts are relatively rare.Brucella melitensis bacteremia during their follow up at the Armed Forces Hospital in Riyadh. The first patient developed B. melitensis bacteremia during the transformation of his myelodysplasia into acute myeloid leukemia. The second patient developed B. melitensis bacteremia while his acute lymphoblastic leukemia was under control. Interestingly, he presented with acute cholecystitis during the brucella sepsis. Both brucella infections were associated with a marked reduction in the hematological parameters in addition to other complications. The bacteremic episodes were successfully treated with netilmicin, doxycycline and ciprofloxacin.Reported here are two patients with acute leukemia who developed Brucellosis can cause systemic infections, complicated bacteremia and serious morbidity in patients with acute leukemia living in endemic areas. These infections may occur at the presentation of the leukemia or even when the leukemia is in remission. Nevertheless, the early diagnosis of brucellosis and the administration of appropriate antimicrobial therapy for sufficient duration usually improves the outcome in these immunocompromised patients. In patients with malignant disorders, infections are major causes of morbidity and mortality. In such patients, the risk of infection is usually related to the intensity and the duration of cytotoxic chemotherapy and immunosuppressive treatment . The maiB. melitensis bacteremia during their follow up at the Armed Forces Hospital in Riyadh Saudi Arabia, are reported and the literature is reviewed.Brucellosis, the commonest zoonotic infection worldwide, can affect healthy individuals and immunocompromised patients living in countries that are endemic for the infection -5. Two p9/L, Hb: 35 g/L and PLT: 106 × 109/L. The blood film revealed neutropenia with dysplastic changes and the bone marrow biopsy (BMB) showed a hypercellular marrow with dysplastic changes involving the three hematopoietic cell lines. After establishing the diagnosis of myelodysplastic syndrome (MDS), the patient was given supportive measures to correct his anemia and he was discharged.A 57 year old Iraqi male from Rafha refugee camp was transferred to Riyadh Armed Forces Hospital (RAFH) with pancytopenia for further evaluation and management. He had been experiencing anemic manifestations for two months but no associated bleeding or fever. Physical examination revealed pallor, no external lymphadenopathy or palpable abdominal organomegaly and normal cardiovascular and neurological systems. The complete blood count (CBC) showed: WBC: 1.7 × 109/L with neutrophils of 0.3, Hb: 50 g/L and PLT: 12 × 109/L. The renal and the hepatic profiles were all within normal limits. The blood cultures grew: B. melitensis sensitive to ciprofloxacin, netilmicin, and tetracycline but resistant to trimethoprim-sulphamethoxazole (TMP/SMZ). The brucella agglutination antibody titer was highly elevated (1:20480). A repeat BMB showed dysplastic changes and 20% myeloblasts, i.e. evidence of transformation into acute myloid leukemia (AML). For the brucella bacteremia (BB), the patient received IV netilmicin 5 mg/kg three times per day and oral doxycycline 200 mg twice daily for one week. A few days after starting these antibiotics, the fever and the backache subsided. Then netilmicin was replaced by oral ciprofloxacin 500 mg twice daily and the patient was continued on oral doxycycline. After controlling the brucella sepsis, the patient was commenced on an induction course of chemotherapy composed of daunorubicin 50 mg/day IV for 1 day and cytosine arabinoside 100 mg/m2/day IV for 5 days. After successful management of both the BB and the leukemic transformation of MDS, the patient was discharged on ciprofloxacin and doxycycline for a total duration of 5 weeks.Nine months later, the patient was readmitted with high fever, rigors and low backache of one week duration. His physical examination did not reveal any new abnormality. CBC showed: WBC: 1.6 × 10Four months later, the patient was readmitted with a new AML transformation of his MDS and severe bronchopneumonia. Cultures of the blood, the sputum and the bronchoalveolar lavage fluid were all negative. There was no clinical or microbiological evidence of recurrence of the brucella infection. However, he received IV netilmicin, ciprofloxacin and amoxicillin but unfortunately he responded poorly to the antimicrobials given and despite receiving full supportive care, he deteriorated further and died.Hemophilus influenzae bronchopneumonia and Campylobacter bacteremia which were all managed successfully.A 54 year old Saudi male, with history of chronic relapsing brucellosis for 15 years, was diagnosed to have acute lymphoblastic leukemia [ALL] at MD Anderson Cancer Centre in the USA. He achieved the first complete remission (CR) of his leukemia after receiving an induction course of chemotherapy composed of cyclophosphamide, daunorubicin, vincristine, L-asparaginase and intrathecal methotrexate. Three years later, the patient had a central nervous system (CNS) relapse of his leukemia followed by a bone marrow relapse which were treated with intrathecal chemotherapy and three courses of systemic chemotherapy. Subsequently, the patient achieved the third CR of his ALL, but he developed a number of complications including hyperbilirubinemia, generalized pigmentation, pancreatitis, paralytic ileus and hepatic failure. He also developed several infections including staphylococcal bacteremia, 9/L (neutrophils: 1.04), Hb: 113 g/L and PLT: 22 × 109/L and the blood film showed no blast cells. The BMB showed a hypocellular marrow with no evidence of leukemia. An abdominal ultrasound showed an acutely inflamed and distended gall bladder. Blood cultures grew B. melitensis, sensitive to ciprofloxacin, netilmicin and doxycycline. The brucella agglutination antibody titer was elevated . The acute cholecystitis was managed conservatively with bowel rest, IV fluids and analgesics. The BB was treated with IV netilmicin 15 mg/kg/day in three divided doses and oral doxycycline 200 mg twice daily for 3 weeks and then the IV netilmicin was replaced by oral ciprofloxacin 500 mg twice daily. After controlling the acute cholecystitis and the BB, the patient was discharged on oral ciprofloxacin and doxycycline for three more weeks. Thereafter the patient had regular follow up at the hematology outpatient clinic and no further recurrence of his brucellosis has been encountered.Five years after the diagnosis of ALL, the patient was readmitted to RAFH with fever for 5 days and abdominal pain of one week duration. Physical examination revealed an unwell middle aged male, generalized pigmentation, a tinge of jaundice, no palpable lymph nodes, a clear chest and normal cardiovascular and neurological systems. The abdomen was distended with tenderness in the epigastrium and the right hypochodrium. The liver and spleen were impalpable, the bowel sounds were positive and there was no ascites. CBC showed: WBC: 2.1 × 10Brucella abortus (B. abortus), B. suis, B. canis and B. melitensis can cause systemic infections which may affect any body organ [Brucella species are small Gram-negative, aerobic and non-motile intracellular coccobacilli that can be isolated from the genitourinary tracts of many wild and domestic animals . The humdy organ ,6-8. Ovedy organ . Severaldy organ . Unfortudy organ . Brucelldy organ ,9. The ody organ . TransmiThe clinical manifestations of brucellosis and BB are variable and may include fever, rigors, anorexia, malaise, weight loss, backache, bony pains, arthritis and arthralgias and hepatosplenomegaly -8,10-13.Brucellosis may cause a wide range of hematological abnormalities including anemia, leucopenia, thrombocytopenia, pancytopenia, bleeding diathesis and disseminated intravascular coagulation (DIC) ,8,10-12.BB develops in 38 to 90% of patients infected with brucella and most of the patients with BB have positive brucella serology ,7. BB maAlthough a presumptive diagnosis of brucellosis can be made by demonstrating high or rising antibody titers to brucella antigen, the isolation of the organism from blood, bone marrow or tissue cultures provides the only definitive evidence of the infection . BecauseDifferent antibiotic regimens have been employed in the treatment of brucellosis including the following in various combinations: TMP/SMZ, rifampicin, doxycycline, ciprofloxacin, gentamicin and streptomycin ,7,8,13. Brucellosis is one of the leading infections causing pyrexia of unknown origin (PUO) in some parts of the world . In patiIn comparison with the few reported cases of acute leukemia and brucellosis, our patients demonstrated the following peculiar features: (1) The development of BB not only at the presentation of leukemia but also when leukemia was in remission. (2) The profound reduction in blood indices caused by the BB was reversible once an appropriate therapy had been administered. (3) Despite their depressed immunity, both patients were able to mount rather brisk immunologic responses to the BB reflected by the greatly elevated agglutination antibody titers.Brucella infection should always be included in the differential diagnosis of febrile neutropenia, pancytopenia and even acute abdomen in immunocompromised hosts living in geographic areas that are endemic for brucellosis. Specific investigations including blood cultures for brucella and brucella serology should be taken and appropriate antimicrobial therapy should be initiated promptly.The author(s) declare that they have no competing interests.Both authors participated, from the clinical and laboratory point of view, in the management of the patients presented as inpatients during their hospitalizations and at the outpatient clinic during their follow up. Both authors read and approved the final form of the manuscript.

Insulin and insulin-like growth factors (IGFs) are putative regulators of cell proliferation and differentiation during lens development. Transgenic mice that overexpress IGF-1 in the lens have been previously described. To further understand the ocular functions of this growth factor family, the in vivo effects of insulin expression on lens development were investigated using transgenic mice.Expression of insulin receptor (IR) and IGF-1 receptor (IGF-1R) in mouse lens was examined by reverse-transcriptase-polymerase chain reaction (RT-PCR) and in situ hybridization. Transgenic mice that overexpress insulin in the lens were generated using two different promoters: a fiber-cell specific αA-crystallin (αA) promoter and a modified αA-promoter linked to the chicken δ1-crystallin enhancer . The δenαA promoter is active in both lens epithelial and fiber cells. The lens phenotypes were analyzed by histology and immunohistochemistry. Protein expression was examined by western blotting.Normal mouse lenses express both the insulin receptor (IR) and the IGF-1 receptor (IGF-1R), and their expression is highest at the lens periphery where the germinative and transitional zones are located. In transgenic mice, insulin expression in the lens induced cataract formation. The severity of the cataracts reflected the level of transgene expression, independent of the type of promoter used. In severely affected families, the spherical shape of the lens was altered and the lenses were smaller than normal. Histological analysis showed no evidence of premature differentiation of the anterior epithelial cells. In contrast to the IGF-1 mice, insulin transgenic mice exhibited an anterior shift in the location of the germinative and transitional zones, leading to a reduction of the lens epithelial compartment. Additional alterations included expansion of the lens transitional zone, variable nuclear positioning in the lens bow region, and inhibition of fiber cell denucleation and terminal differentiation.Elevated intraocular insulin does not enhance proliferation nor induce differentiation of mouse lens epithelial cells. Since an increase in IGF-1 causes a posterior shift of the lens geminative and transitional zones, while an increase in insulin causes an anterior shift of these zones, our results suggest that these two growth factors may work together to control the location of this structural domain during normal lens development. Our data also suggest that increased insulin-signaling activity in the lens can antagonize the endogenous signals that are responsible for fiber cell maturation and terminal differentiation. The lens is a highly organized and polarized tissue. Growth and development of the lens depend on proper spatial regulation of cell proliferation and differentiation -3. The cGrowth factors have been implicated as regulators of cell proliferation and differentiation during lens development ,3. Gain-Insulin and IGF-1 act through two related cell surface receptors, insulin receptor (IR) and IGF-1 receptor (IGF-1R) . These tGene knockout experiments have provided further evidence that IR and IGF-1R have overlapping yet diverse functions in embryonic development ,32. MiceLens epithelial cells in explants respond to either IGF-1 or insulin in a similar fashion . To gainNM_010513), sense (5'-GAG GAC TGT CAT CTC CAA CC-3') and antisense (5'-CGA TTC TTT CAC GCA TAC TTG C-3') primers were used to amplify a 778 base pair (bp) cDNA fragment. For mouse IR (GenBank NM_010568), the sense (5'-GAA GAT CAC CCT TCT TCG AG-3') and antisense (5'-CAG TGA GTC TCT CTG GAC AG-3') primers generated a fragment of 736 bp. PCR products were run on a 2% agarose gel and stained with ethidium bromide for visualization under ultraviolet (UV) light. The PCR fragments were cloned into the pCRII-TOPO cloning vectors and sequenced to verify their identities. These plasmids were also used to generate riboprobes for in situ hybridization to detect the expression patterns of IR and IGF-1R in the mouse lens.All animals were used in accordance with the Association of Research in Vision and Ophthalmology (ARVO) Statement for the Use of Animals in Ophthalmic and Vision Research, which is comparable to the animal care guidelines of the Institute of Laboratory Animal Research. Wild type (FVB/N) mouse lenses were obtained at embryonic day 15.5 (E15.5) or at birth (P0), and homogenized in TRI REAGENT to extract total RNA, following the manufacturer's instructions. Reverse transcriptase-polymerase chain reaction (RT-PCR) was performed on 10 ng total lens RNA using the OneStep RT-PCR kit from Qiagen . For mouse IGF-1R , dehydrated in a series of increasing concentrations of ethanol, cleared in xylene, and embedded in paraffin. Sections were cut at 5 μm, de-waxed with xylene, rehydrated with a series of decreasing concentrations of ethanol, and processed for hematoxylin and eosin (H&E) staining, in situ hybridization, or immunohistochemistry.35S-labeled riboprobes were synthesized in vitro from linearized pCRII-TOPO plasmids containing the cDNA for either IR or IGF-1R. After overnight hybridization, the slides were washed, digested with RNase A, and washed again to remove unhybridized probes. Slides were coated with Kodak NTB-2 emulsion and exposed at 4 °C for a week. After developing the slides in the Kodak D-19 developer, the sections were counterstained with hematoxylin. The bright- and dark-field images were captured by a CCD camera.The procedure for in situ hybridization was described previously . BrieflyPregnant females were injected intraperitoneally with 100 ng of 5-bromo-2'-deoxyuridine and 6.7 ng of fluoro-deoxyuridine per gram of body weight. After 1 h, mice were sacrificed and embryos were collected for BrdU immunohistochemistry, as described previously .2O2 as a substrate (Sigma). Sections were counterstained with hematoxylin.Immunostaining was performed as previously described ,41. BrieNewborn mouse lenses were isolated and homogenized in RIPA buffer containing 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, 0.02% sodium orthovanadate, and 2 mM DTT in PBS. Protease inhibitors and phosphatase inhibitors were added freshly each time. After centrifugation at 10,000 rpm for 5 min, the supernatant was removed and an aliquot was taken for protein determination using the BCA method . For cryLens epithelial cells in explant cultures respond to both insulin and IGF stimulation, implying that these cells express receptors and signaling components for these growth factors ,13,43. IThe two types of promoters used in this study were the mouse αA-crystallin promoter (αA) and a modified αA-promoter linked to the δ1-crystallin enhancer (δenαA). In the two αA-insulin transgenic families (OVE441 and OVE442), transgene mRNA was detected only in the lens fiber cells . In contTransgenic mice from each family except LR20 had visible cataracts when they opened their eyes at postnatal day 14 (P14). Mice from family LR20 eventually developed cataracts at 4 months of age. In situ hybridization showed that the transgene was weakly expressed in this family (data not shown). In the families with the highest levels of transgene expression, OVE442 and LR22, the eyes were microphthalmic.The transgenic lenses from families OVE442 and LR22 were compared to those of wild type mice . NewbornHistological analysis showed that the severity of the lens defects correlated with the transgene expression level . DisruptThe anterior shift of the lens transitional zone suggested that insulin overexpression might affect cell proliferation and differentiation in the transgenic lenses. BrdU labeling was performed to detect the lens cells in S-phase of the cell cycle . In wildTo assess the differentiation state of the transgenic lens, crystallin expression patterns and levels were examined in wild type and OVE442 transgenic mice . We founDuring later stages of differentiation, fiber cells lose their nuclei (denucleate) and intracellular organelles to form the organelle-free zone (OFZ) at the lens core . HistoloTo examine whether intracellular organelle degradation was also affected in the transgenic lenses, sections were stained for cytochrome c oxidase (COX) subunit I and protein disulfide isomerase (PDI), which are markers for mitochondria and endoplasmic reticulum (ER), respectively ,45. The Insulin exerts its biological activity through activation of the insulin receptor (IR). In many different cell types, IR activation turns on downstream signaling pathways involving Ras and PI3K, which subsequently activate the Akt kinase and/or the Raf-MEK-ERK cascade. To explore insulin-activated signaling in the mouse lens, we analyzed the phosphorylation levels of ERK and Akt by western blot analysis . The levIncreased phospho-ERK levels in the transgenic lenses were further examined by immunohistochemical staining . In the Shc and IRS-1 are two receptor adaptor proteins. These adaptor proteins bind to the activated receptors at tyrosine docking sites, are phosphorylated and, in turn, recruit SH2-domain-containing signaling molecules such as Grb2 and the p85 regulatory subunit of PI3K ,47. ImmuLens epithelial cells in explants can respond to insulin and IGF stimulation ,12,48, sIn both the insulin and IGF-1 transgenic mice, fiber cell maturation was perturbed and the transitional zone was expanded. An interesting difference was the location of the lens germinative and transitional zones. In the IGF-1 mice, the lens epithelial compartment was expanded and the germinative zone was localized more posterior than in the wild type lens . In contIt has been shown that one role of Shc in cells is to promote the formation of a Shc-Grb2-SOS complex, which can activate the Ras-Raf-MEK-ERK kinase cascade . PreviouIn most of the transgenic families (except LR20), fiber cell differentiation was disrupted by insulin overexpression. Fiber elongation was incomplete and cell nuclei, mitochondria, and ER were retained in the central fiber cells. Our data suggest that insulin signaling may antagonize the endogenous signals that are required for late-stage fiber differentiation. At present, the molecular mechanisms that regulate fiber cell terminal differentiation, such as denucleation and organelle degradation, have not been defined. Apoptosis-related proteins may have a role in this process ,53. It wIn summary, we have demonstrated that insulin overexpression in the lens is not sufficient to initiate epithelial-to-fiber cell differentiation, but it can alter lens growth and fiber cell maturation. Combined with the previous study of the IGF-1 transgenic mice, our data suggest that insulin and IGF-1 could have overlapping yet distinct functions in lens development. We propose that, during lens development, neither IGF-1 nor insulin is a differentiation inducer. Instead, they function as modifiers of fiber cell morphology. The balance between IGF-1 and insulin signaling in the lens may help to finely tune lens growth and maturation. Additionally, our study suggests that fiber cell terminal differentiation requires downregulation of insulin-activated signaling pathways. Elevated ERK activity may antagonize the endogenous apoptotic-like or proteolytic activities that are involved in late stage fiber cell differentiation.

Complex deformities following septic arthritis of the shoulder in infancy are mild and therefore rarely reported. A 12 year old girl presented with shortening of upper extremity right side, with dislocation of shoulder and with entire extremity rotated to 180 degrees. The palm faced posteriorly and the olecranon anteriorly. Arthrodesis of shoulder and unifocal lengthening of humerus was achieved with three 4 mm cannulated cancellous screws and an ilizarov frame. A lengthening of 9 centimeters was achieved and regenerate healed at 12 months. At 10 years follow-up she is able to perfom her activities of daily living. Complex deformities following septic arthritis of the shoulder in infancy are mild and therefore rarely reported. Deformities are often combinations of various degrees of shoulder dysplasia, progressive humeral shortening, angular deformities of the humerus and subluxation of the glenohumeral joint or rarely dislocations. Even the most unsightly deformities may not produce severe functional limitations and treatment is often sought for cosmetic improvement. Guidelines for management of these complex problems are few and each case poses a challenge to the surgeon.We report the successful management of a rare delayed presentation of septic shoulder sequelae in a pre-adolescent girl who presented with a combination of global instability of the shoulder with progressive humeral shortening.A 12-year-old girl presented with a complex deformity with progressive shortening involving her right dominant upper extremity. The mother gave a history of hospitalization for fever and pain in the right upper limb at 6 months of age. There was no history of trauma or surgery on the shoulder joint. The child had adapted to carry out the daily chores with her left hand. She had stopped schooling, as her writing speed and clarity with her left hand was impaired. Activities of personal hygiene were managed well.A thorough examination ruled out congenital deformity. There was a scar along the posterior axillary fold healed with secondary intention. The affected humerus was shortened by 16 cm without angular deformities. The shoulder was dislocated with the head situated inferior and posterior to the glenoid cavity rotating the entire extremity through almost 180°. The palm facing posteriorly and the olecranon anteriorly. Attempts to position the arm across the chest actively exaggerated the deformity .The humeral head was enlarged but easily reducible. This significantly improved the disability by placing the hand in front of the chest. The elbow joint and the hand were normal with wasting of upper limb. There was no neurovascular abnormality.Plain roentgenograms showed a dislocated glenohumeral joint with enlarged humeral head and a small dysplastic glenoid fossa. The humeral shaft was short and thin, condyles were dysplastic, but the elbow joint was normal. There were no angular deformities.A clinicoradiological correlation revealed two components of the deformity, instability as major cause of functional impairment and humeral shortening that led to the cosmetic deformity.We decided to correct the deformity by combining shoulder arthrodesis with humeral lengthening as a single-stage procedure. The obstacles were dysplasia of the shoulder that decreased the area of contact at the glenohumeral joint, small girth of the humeral shaft, quality of bone, type of fixation, and the soft tissue constraints during lengthening. We formulated the following surgical plan. The patient was kept in the lateral position. Arthrodesis of the shoulder was performed through the deltoid splitting approach, with three 4 mm cannulated cancellous screws (two across the joint and one to transfix the acromion). An Ilizarov frame was constructed to provide unifocal lengthening of the humerus and stabilization of the arthrodesis site. Five 3.5 mm Schanz pins were inserted, two in the scapular spine, two in the proximal humerus, and one in the distal humerus. The distal humeral fixation was augmented with two 1.5 mm wires. A frame was assembled with 180° half-ring for the scapula and the proximal humerus and a 5\8 ring for the distal humerus. Osteotomy was performed just distal to the deltoid tubercle .The elbow range of movement exercises were encouraged as soon as the pain subsided. The distraction was commenced one week after the surgery at the rate of 0.25 mm four times a day. Roentgenograms were taken twice weekly for one month and then once monthly for three months. Uniform column of regenerate was observed. There was no distraction at the arthrodesis site, which went on to good fusion. A lengthening of 9 cm was achieved . There wA lengthening of 9 cm was achieved and the cyst and the regenerate healed uneventfully at 12 months. The patient was advised to wear a functional humeral brace for two years and resume light, controlled activities. She started to use right hand for combing hair, scrubbing her body, cooking and writing . At 10 yComplex deformities arising from neglected septic arthritis pose a challenge. These cause severe functional and cosmetic impairment in the lower limbs. However, disability in the upper limbs even with severe deformities could be minimal and hence delay the presentation. Treatment is sought more often for cosmesis.1

Pulmonary artery stump thrombosis is a recognized complication after pneumonectomy. However, to our knowledge, there is only one case report of delayed development of this complication. We report the case of a 68 year-old man who presented with chest pain nearly ten years after undergoing a right pneumonectomy for lung cancer. Workup identified a pulmonary artery stump thrombosis. Due to the acute onset of his symptoms, the patient was anticoagulated, and his chest pain resolved. While the literature suggests that anticoagulation is not generally required for stump thromboses, we highlight features of this case that may indicate an increased risk of clinically important sequelae. Taking previous reports into account, we argue that a specific subset of patients with stump thrombosis may benefit from systemic anticoagulation. The prevalence of pulmonary artery stump thrombosis after pneumonectomy is approximately 12%. These auA 68-year-old man presented to the emergency department (ED) complaining of intermittent pleuritic chest pain for one week. His medical history included non-small cell lung cancer, treated with right pneumonectomy and chemotherapy nearly ten years prior, chronic obstructive pulmonary disease (COPD), requiring home oxygen, hypertenstion, and prior tobacco use. Ten weeks before presenting to our hospital he was diagnosed with new onset paroxysmal atrial fibrillation. Warfarin was prescribed, which he did not take. Six weeks prior to admission he had been admitted for a COPD exacerbation, requiring intubation.Upon presentation to the ED, a contrasted chest CT was performed which revealed a large thrombus in the right pulmonary artery stump with no evidence of pulmonary emboli Figure . Venous The patient was hemodynamically stable with a blood pressure of 120/82 mmHg and in atrial fibrillation at a rate of 83 beats per minute. He was admitted to a medical floor and anticoagulated with heparin and warfarin and his chest pain improved. In the following weeks he was hospitalized with an admission diagnosis of "COPD exacerbation" two more times. Despite the treatment goal of long-term anticoagulation, his INR was subtherapeutic at each of these admissions. A review of the patient's medical records from the four years prior to identification of the stump thrombus showed only a single previous admission for COPD exacerbation six weeks prior to his presentation to the ED.The incidence and natural history of pulmonary artery thrombosis remain poorly elucidated. Controversy exists in the literature whether or not a right pulmonary artery stump is at greater risk of a thrombus than a left stump. Additionally, the role of anticoagulation remains unclear.For anatomic reasons, the vascular stump is longer after a right pneumonectomy than after a left pneumonectomy.,5 TherefOnly small numbers are available with which to estimate the incidence pulmonary embolism (PE) in patients with a documented post-pneumonectomy stump thrombosis. Kim et al. noted a PE in 1 of 18 such patients 5.6%); similarly, Kwek and Wittram found PE in 1 of 11 (9.1%). This incidence seems reassuringly low, especially since PE's are detected as an incidental finding on 4–5.7% of chest CT's performed on inpatients. [%; similaKwek and Wittram introduced the concept of defining the shape of a stump thrombus as either convex or concave. Both patients in their series in whom new thrombi were identified, including the lone patient with PE and the patient with pulmonary hypertension, had convex thrombi. They also found that the maximal length of the convex thrombi was greater than the concave ones. Their findings suggest that convex thrombi are more acute and possibly less stable. It is important to note, though, that two of three patients with convex thrombi who had follow-up CT scans had either a resolution or a decrease in the size of their thrombus, even without anticoagulation.Thomas et al. reported the case of a patient with a pulmonary artery stump thrombosis found ten years after right pneumonectomy with previously negative scans. Chronic microemboli were noted in the remaining lung, which led to pulmonary hypertension. This led the authors to advocate for chronic prophylactic anticoagulation. In our review of their patient's CT scan, the thrombus appears convex.Likewise, our patient had a convex thrombus that developed many years after a right pneumonectomy and occurred during a period of decline in the patient's clinical condition. An echocardiogram done during his evaluation demonstrated moderate right hypokinesis that appeared worse compared to an earlier echocardiogram done. We postulate that the worsened right hypokinesis may have contributed to the development of his thrombus by causing low pulsatile flow, increasing stasis in the stump.Our patient died two and a half months after the CT scan diagnosed a new stump thrombosis. On his last admission he was markedly hypoxic in the Emergency Department with an arterial blood oxygen pressure of 57 mmHg, despite the use of a 100% non-rebreather mask. Autopsy was not obtained, so the specific cause of his death remains unknown. We do know, however, that the patient had a convex pulmonary artery thrombus that was certainly not present on a previous contrast CT scan eighteen months prior and was not felt to be present on a non-contrast CT scan three months earlier. While non-contrasted CT scans are limited in their ability to reveal thrombi, we have a subsequent non-contrasted CT that shows an increased area of attenuation in the stump which was clearly not present on the scan done immediately before his hospitalizations. Clinically, his COPD, which had been stable, not requiring hospitalization for at least four years became significantly worse, requiring multiple hospitalizations and intubation. Based on this case, together with our review of the literature, we suggest that anticoagulation should be considered for convex stump thrombus or a new stump thrombus in the context of declining pulmonary status.The authors declare that they have no competing interests.MJ: Provision of care of patient, collection and assembly of data, review of the literature, manuscript writing; UF: collection of data; SM: provision of care of patient, review of the literature; NS: Collection and assembly of data, review of the literature, manuscript writing. All authors read and approved the final manuscript.The patient provided verbal consent to the authors to report his case and presentation. The patient expired prior to manuscript preparation and provision of written consent.

A retrospective detailed study of 272 cases of breast carcinoma treated by radical mastectomy was published by Hamlin (1968). An extended analysis of the material for 258 of these cases is now reported.Data for 21 prognostic factors from 258 patients have been subjected to multiple regression analysis to determine the independent effect and thus the relative importance of each factor. The findings confirm previous single factor analyses and demonstrate that nine of the factors are independently associated with survival.Mathematical manipulation of the information obtained in this analysis allowed a risk score to be allotted to each patient. Grouping of patients by the prediction scores is found in this series to be more closely related to survival than is clinical staging of the same patients.

An artemisinin-based combination therapy, artesunate (AS) plus sulphadoxine-pyrimethamine (SP), was compared to SP monotherapy to provide evidence of further treatment options in southern Mozambique.Plasmodium falciparum malaria were randomly allocated SP (25/1.25 mg per kg day 0) or AS/SP . Allocation was concealed, but treatment was open-label except to microscopists. The primary objective was the relative risk of treatment failure, which was assessed using World Health Organization response definitions modified to a 42-day follow-up.Between 2003 and 2005, 411 patients over one year and 10 kg with uncomplicated dhfr/dhps mutation increased the relative hazard of failure compared to fewer mutations and baseline axillary temperature increased the relative hazard of failure by 50% for each °C increase .Of the 411 subjects enrolled, 359 (87.3%) completed the follow up period . A survival analysis including 408 subjects showed that the polymerase chain reaction-adjusted cure rates were 90.4% and 98.0% (95% CI 94.8%–99.3%) for SP and AS/SP respectively. Multivariable analysis showed that treatment with AS/SP decreased the relative hazard of treatment failure by 80% compared to SP and age over seven years decreased the relative hazard of failure by 70% , when compared to younger age. However, having a quintuple While both treatments were efficacious, AS plus SP significantly decreased the relative hazard of treatment failure compared to SP monotherapy Artesunate plus sulphadoxine-pyrimethamine, but not sulphadoxine-pyrimethamine monotherapy, met the current WHO criteria of >95% efficacy for policy implementation.NCT00203736 and NCT00203814 Malaria is responsible for a large health burden, including an estimated 19% of deaths among children under five years of age [Plasmodium falciparum malaria varies throughout the country according to the season, other environmental factors, and the use of vector control measures. A treatment policy with effective anti-malarials is a key component of malaria control programmes and data regarding resistance of parasites to anti-malarial drugs are now a critical factor in drug policy decision-making. While chloroquine was the national policy in Mozambique for the treatment of uncomplicated malaria as recently as 2003, evidence of its poor efficacy throughout Africa since the 1980s signalled a need for alternative anti-malarials [falciparum malaria provided the partner drug is efficacious. ACT deliverers a more rapid cure compared to non-ACT, reducing gametocyte carriage , and delaying the development of anti-malarial resistance [Mozambique evaluation in Namaacha and Matatuine Districts, Maputo Province, during 2002 and data showed that a combined polymerase chain reaction (PCR)-adjusted cure rate exceeded the 80% level considered for it to be combined with other anti-malarials to sustain its useful therapeutic life [dhfr) and dihydropteroate synthetase (dhps), mutation across all study sites was 5–6% throughout the study period [[There was clear evidence that ACTs substantially reduced treatment failure, recrudescence and gametocyte carriage but this had not been reported for Mozambique . Howevertic life ,9. The p period [, Raman JThis multi-centre, open-label, parallel-group RCT was conducted in Maputo Province, Southern Mozambique in four public-sector health facilities in two phases: initially Catuane and Namaacha (2003), thereafter Boane and Magude (2004–2005) Figure . There hP. falciparum infection by rapid diagnostic test . Patients diagnosed with P. falciparum parasitaemia up to 500,000 asexual parasites/μml blood (on thick Giemsa-stained smear) and with axillary temperature greater than or equal to 37.5°C (or history of fever within the previous 24 hours) were suitable for inclusion. Patients receiving folate or anti-malarials within seven days were excluded. Also excluded were patients with danger signs or severely ill, those with a history of G6PD deficiency or allergy to the study (or related) drugs, or those with serious underlying disease [Male and non-pregnant, non-breastfeeding female patients with malaria symptoms, that were older than one year of age and weighed more than 10 kg, were invited to give informed consent prior to screening for disease ,13.®. Roche, Gauteng, South Africa) or AS/SP (Table Eligible subjects were randomized to treatment with SP monotherapy (Fansidara) Table . Subjectin vivo therapeutic efficacy of anti-malarials, with extension to a 42 day follow-up due to the long elimination half-life of SP [®), clinical signs and symptoms to capture adverse events, and concomitant medications [The visit schedule was based on the WHO protocol for assessment of fe of SP ,15. Afteications . A fingeP. falciparum DNA extracted from these dried samples based on variations in three highly variable proteins was used to determine if treatment failure was due to a re-infection or recrudescence of the original infection [dhfr and dihydropteroate synthetase, dhps genes were detected using nested PCR and restriction endonuclease cleavage [Asexual parasite density was calculated using the number of asexual parasites and assuming 8,000 leukocytes/μl blood. Genotyping of nfection ,18. Infecleavage . DigestiThe primary study objective was to compare the risk of treatment failure between the treatment groups, adjusted for baseline characteristics. A secondary outcome compared the rate of parasite clearance between groups.Response to treatment was classified according to WHO definitions for low to moderate malaria transmission intensity areas, modified for a 42-day follow up ,15. SubjKey fields were verified by a study monitor and double-entered into an MS Access 2000 database. Laboratory data were recorded electronically. Data were imported into Stata/IC 10.0 when outcomes, time-to-event indicators and explanatory variables were programmed.Major protocol violations were defined as subjects: i) missing days 1, 2, 3 of the ACT arm or days 2,3 of the monotherapy arm; ii) taking folic acid or a concomitant medication with anti-malarial activity ; iii), whose day 42 visit was more than three days late; and iv) taking an incorrect dose or repeat dose for vomiting. Data were not censored for missed visits as it was assumed intensive AE monitoring would detect malaria symptoms or treatment. Missing data fields were dropped where appropriate and subjects lost to follow-up after day 0 were automatically dropped from the time-to-event analyses. An attempt was made to follow all subjects to day 42 despite protocol violations.Sample sizes were calculated assuming an adequate clinical and parasitological response (ACPR) of 75% for SP and 90% for AS/SP indicating 100 per treatment group in each phase of the study .Time-to-event outcomes, which were considered the most appropriate for the data, were analysed using Kaplan Meier (KM) survival methods and Cox's Proportional Hazards Regression. This allowed data up to the point of loss to follow-up or withdrawal to be included and for the relative hazard to approximate the relative risk.KM distributions and survival curves for the two treatment groups were compared using a log rank test. Should model diagnostics suggest hazards were not proportional, parametric models were applied . Time toThe study was approved by the Ethics Committees of the Mozambican Ministry of Health and the University of Cape Town prior to commencement, and conducted in accordance with the South African Clinical Trials Guidelines 2000 . Staff mSubject disposition is shown in Figure dhfr/dhps mutation increased the relative hazard of failure 3.2 fold compared to fewer mutations. The proportional hazard assumption was satisfied overall; however there was an accelerated time to failure (approximately 6-fold) for subjects with a quintuple mutation compared to subjects with fewer mutations suggesting that early treatment failure is particularly associated with presence of a quintuple mutation. When the analysis was repeated after excluding or censoring for major protocol violations , results confirmed those found above.From the survival analysis, Figure The ACT group had faster parasite clearance rates compared to the SP monotherapy group (log-rank p = 0.001) Figure . Multiva3-105 parasites per asexual life cycle, compared to 10-103 for SP) [The aim of this study was to provide evidence to Mozambican health policy-makers regarding efficacy of SP with or without AS as treatment for uncomplicated malaria. In a survival analysis, both drug regimens were effective, however adding artesunate improved outcomes significantly with regard to clinical and parasitological cure, and peripheral parasite clearance time. These results are consistent with the literature, that suggests combining AS with SP improves efficacy, provided efficacy of SP is sufficiently high . In addiSubjects aged over seven years had a 70% lower risk of treatment failure than those seven and under, and were 30% more likely to clear parasites faster (the latter association was only found when protocol violators were removed). These findings are consistent with the knowledge that immunity to malaria infection increases with age . Howeverdhps) and dihydrofolate reductase (dhfr) enzymes respectively. Resistance to SP develops due to accumulation of point mutations in genes that encode these enzymes. The presence of 5 mutations, 3 in the dhfr gene (S108N/N511/C59R) and 2 in the dhps gene (A437G/K540E) are associated with treatment failure [st line treatment of uncomplicated malaria (AQ-SP replaced with AS-SP) and as intermittent preventive treatment for pregnant women (SP in 2007).Sulphadoxine and pyrimethamine are anti-folates that inhibit the dihydropteroate synthetase protocol violators, results were very similar. Including data from non-adherent subjects or those taking prohibited concomitant medications is useful for assessing the effect of these common practices on treatment response. AS courses shorter than three days are not recommended due to their lower efficacy and the increased likelihood of anti-malarial drug resistance emerging if combined with the more slowly eliminated SP . SP may,dhfr 164 mutation, associated with high-level pyrimethamine resistance found in neighbouring Malawi [This study found that, while both SP monotherapy and in combination with AS were effective, the ACT was far superior, supporting its current use in Mozambique as the national policy for the treatment of uncomplicated malaria. However, it is recognized that combinations with SP may have a limited useful life due to the spread of parasite resistance, and inadequate drug levels young children achieve. It is also possible that SP efficacy has declined since this study due to the national implementation of SP as an intermittent preventive treatment policy for pregnant women during 2007. Of further concern is the presence of the g Malawi .The authors declare that they have no competing interests.EA participated in study design, coordinated the study, conducted the statistical analysis and drafted the manuscript, TC managed the Mozambique study teams, YC provided medical expertise to the study teams, FL participated in study design, calculated sample sizes and supervised the statistical analysis, JR conducted molecular analyses, AB supervised analysis and reporting. KIB, Principal Investigator of the South East African Combination Anti-malarial Treatment (SEACAT) Evaluation, conceived of, and designed the study, and contributed to the analysis. All authors read and approved the final manuscript.

G) of thermal denaturation.An important aspect of protein design is the ability to predict changes in protein thermostability arising from single- or multi-site mutations. Protein thermostability is reflected in the change in free energy (ΔΔWe have developed predictive software, Prethermut, based on machine learning methods, to predict the effect of single- or multi-site mutations on protein thermostability. The input vector of Prethermut is based on known structural changes and empirical measurements of changes in potential energy due to protein mutations. Using a 10-fold cross validation test on the M-dataset, consisting of 3366 mutants proteins from ProTherm, the classification accuracy of random forests and the regression accuracy of random forest regression were slightly better than support vector machines and support vector regression, whereas the overall accuracy of classification and the Pearson correlation coefficient of regression were 79.2% and 0.72, respectively. Prethermut performs better on proteins containing multi-site mutations than those with single mutations.The performance of Prethermut indicates that it is a useful tool for predicting changes in protein thermostability brought about by single- or multi-site mutations and will be valuable in the rational design of proteins. G) of denaturation can be altered by single- or multi-site mutations; the change in ΔG (ΔΔG), an indication of the change in protein thermostability, has been determined for many mutated proteins by the thermal denaturation method and standard deviation vector S = for all of the structural feature vectors Wj were calculated.(5) All of the residues in the wild-type protein were mutated via single site saturation mutagenesis by Modeller 9.7 . It was Z = of Prethermut consisted of 58 elements and represented a combination of the two vectors . The element values (v and y) of vector V and Y were calculated as follows:(6) The final input vector G) and the regression methods RFR and SVR were employed to train and test the robustness of the method, because these methods have been successfully used in many aspects of computational biology [In this study, the classification methods RF and SVM RF. The RF is an ensemble machine learning methodology originated by Leo Breiman . The bas(2) RFR. The RFR is built in a fashion similar to the classifier in RF , but the(3) SVM. SVM is used to identify the optimal hyperplane that separates two classes of samples ,40. SVM y = f(X), which is based on a finite number of samples [(4) SVR. In comparison with SVM, the objective of SVR is to estimate an unknown continuous valued function samples ,42. The samples , and res samples .http://www.r-project.org/). To implement SVM and SVR, we used LIBSVM http://www.csie.ntu.edu.tw/~cjlin/ with an RBF kernel. The parameters of SVM or SVR were selected with the LIBSVM parameter selection tool http://www.csie.ntu.edu.tw/~cjlin/libsvmtools/.The RF and RFR algorithms were run in the R programming environment and true negatives (TN) were identified as the positive and negative samples, respectively. False positives (FP) were negative samples identified as positive, and false negatives (FN) were positive samples identified as negative. The quality of the classification was determined based on sensitivity (TP/(TP+FN)), specificity (TN/(TN+FP)), overall accuracy (Q2), and the Matthews correlation coefficient (MCC). The Q2 and MCC were calculated as follows:Mutant proteins with a value of ΔΔG was evaluated by Pearson's r, calculated as follows:The regression quality for predicting the absolute value of ΔΔr is Pearson's r, and N, X, and Y are the number of data, experimental ΔΔG value, and predicted ΔΔG value, respectively.where Project name: Prethermuthttp://www.mobioinfor.cn/prethermutProject home page: Operating systems: LinuxProgramming language: PerlRequired prerequisite programs: Perl version 5.6 or higher; Foldx 3.0; Modeller v9.7 or higher.License: GNU General Public License. This license allows the source code to be redistributed and/or modified under the terms of the GNU General Public License, as published by the Free Software Foundation. The source code for the application is available at no charge.Any restrictions to use by non-academics: NoneJT wrote the code of Prethermut. NW and YF supervised the work. JT, NW, and XC were involved in the preparation of the manuscript. All authors read and approved the manuscript.Table S1. Selected structural features and the contribution of these features. Table S2. Prediction performance of Random Forests with different tree number.Click here for file

Beta-carotene (BC) has recently been found to possess potent anti-tumour activity in chemically induced rat liver carcinogenesis. In the present study, attempts have been made to understand the basic cytogenetic and molecular mechanism of the anti-tumour effect of BC by monitoring its effect on rat liver chromosomal aberrations (CAs) and DNA chain breaks during the early preneoplastic stage of diethylnitrosamine (DEN)-induced hepatocarcinogenesis in male rats. DNA chain breaks, however, can be detected with great sensitivity by exposing crude cell lysates to alkaline solutions and monitoring the rate of strand unwinding so that one strand break per chromosome can easily be detected. Supplementary BC, in basal diet (120 mg kg[-1]), was given to rats 15 days before carcinogenic threat with DEN. Under these experimental conditions, BC was found to afford a unique protection against DEN-induced CAs 96 h after DEN injection. Long-term treatment with BC also triggered a protective effect on induction of CAs 15, 30 or 45 days after DEN treatment, which was maximal on structural aberrations followed by numerical and physiological types. BC treatment for 15 days before DEN injection was found to offer a significant (P < 0.001) protection in the generation of single-strand breaks compared with DEN control. Thus, BC ranks as a potential chemopreventive agent for the future so far as chemical rat liver carcinogenesis is concerned.

If the outcomes of the recent COAG meeting are implemented, Australia will have a new set of benchmarks for its health system within a few months. This is a non-trivial task. Choice of benchmarks will, explicitly or implicitly, reflect a framework about how the health system works, what is important or to be valued and how the benchmarks are to be used. In this article we argue that the health system is dynamic and so benchmarks need to measure flows and interfaces rather than simply cross-sectional or static performance. We also argue that benchmarks need to be developed taking into account three perspectives: patient, clinician and funder. Each of these perspectives is critical and good performance from one perspective or on one dimension doesn't imply good performance on either (or both) of the others.The three perspectives can each be decomposed into a number of elements. For example, patient assessed value is influenced by timeliness, cost to the patient, the extent to which their expectations are met, the way they are treated and the extent to which there is continuity of care.We also argue that the way information is presented is important: cross sectional, dated measures provide much less information and are much less useful than approaches based on statistical process control. The latter also focuses attention on improvement and trends, encouraging action rather than simply blame of poorer performers. The Council of Australian Governments (COAG) communiqué issued after its 20 December 2007 meeting provided a serious challenge for the yet to be established National Health and Hospitals Reform Commission (NHHRC) in specifying terms of reference which included a requirement that:by April 2008, the Commission will provide advice on the framework for the next Australian Health Care Agreements (AHCAs), including robust performance benchmarks in areas such as (but not restricted to) elective surgery, aged and transition care, and quality of health care.At the same meeting COAG established a Working Group on Health and Ageing as a Commonwealth-state officer level group that to some extent parallels both the role and timelines of the Commission. The Working Group's indicative forward work plan for 2008, as endorsed by COAG, includes:Consideration of a Commonwealth/State agreement across the full range of health and wellbeing issues, including outcomes, measures of progress and accountability arrangements.Developing performance measures for the health sector is complex; getting them agreed between Commonwealth and states when a considerable amount of funding is at risk will be an even greater challenge. Developing a performance measurement or benchmarking framework includes a number of steps. The first step for the NHHRC is a framework for the AHCAs. Performance measures within that framework then need to be developed and agreed.There are a number of choices about frameworks for the health system. As Simon and LindThe first task of developing a framework and consequential performance measures is thus to determine what our mind map of the health system will be, that is how to define and describe the health care system. Conventional approaches to this task are typically influenced by the history and constraints of analytical approaches and by the current characteristics of the system. In the former case Weaver for instThe critical difference between the institutional and the population approaches is the identification of needs for care co-ordination, with the then Labor Government's response being to sponsor the coordinated care trials . This frA second choice that is implicitly made in decisions about descriptions and measures of the health care system is whether to emphasise cross-sectional descriptions and static performance of systems, such as the number of patients treated or beds open, or de-emphasise these and emphasise measures of the dynamics of the system. Static measures predominate, as if the body were to be described only by its anatomy and not its physiology. A systems dynamic approach emphasises the stocks and flows of a system and the reality that the stocks are affected by the flows and both have to be modelled, designed and measured . This apBenchmarking is about evaluation and 'valuing'. This requires a third choice about what 'value' attributes will be highlighted in the design of the performance system. This is as critical as the choice of the health system framework.The health care system is characterised by multiple products with the 'value' of each of those products being characterised along multiple dimensions. In the case of acute care, for example, value can be measured from the perspective of each of the three players: the patient, clinicians, and the funder . These perspectives may overlap but often do not, and are sometimes in open conflict ,9. Thus Each dimension of this cube incorporates in turn a number of distinct elements and thus might itself be regarded as multi-dimensional. This provides the framework with the additional attraction of scalability: the three dimensions may be scaled to examine an individual subcomponent or to view the progression from the characteristics of an individual patient, through aggregation at clinical service or hospital level up to whole populations.A patient's journey through the health care system provides a useful framework for identifying some of the elements that contribute to patient assessed value and which might be the subject of performance benchmarks. Kenagy et al, in a article describing the journey of one of its authors, use the term 'service quality' for this perspective on value . Criticacontinuity of care in the transitions including the transition from primary care to acute care (and back again), from acute care to any necessary long stay care and so on. The focus should be on the patient's experience e.g. to what extent is the patient asked to repeat information at different stages of the journey? To what extent are diagnostic tests repeated by different providers? To what extent does a patient stay in an acute hospital facility inappropriately prior to relocating to a residential aged care facility?• A patient's journey involves a number of separate providers. The quality of this journey is measured in large part by how effectively the transitions are managed from a patient perspective i.e. to what extent is there timeliness of access and this is typically measured in terms of waiting times. The policy focus has been on waiting times for elective surgery, but waiting times for the whole journey are important. In Sweden for example a benchmark described as 0-7-90-90 has been promulgated, based on a zero wait for access to a call centre, no longer than a 7 day wait to be seen for a primary care consultation, no longer than a 90 day wait for a secondary care consultation and no longer than 90 day wait for treatment to be commenced, including any necessary hospital admission .So the choice of the framework, measures and associated benchmarks in the new Australian Health Care Agreements is not a technocratic or value neutral process. It involves choices on what will be measured, prioritising some aspects of 'value' over others. In the context of a system with responsibilities for different parts of the system resting with different levels of government, deciding which areas of the system will be subject to benchmarking is a quintessentially political act: what benchmarks will relate to performance of states and territories and what (if any) benchmarks will be developed for processes for which the Commonwealth is accountable?But the problem will not be solved by allowing every interest to have its indicator. Too many COAG indicators will effectively vitiate any accountability process by overwhelming reviewers with too many data elements. On the other hand, as Nienaber and Wildavsky point out, too few indicators will inevitably mean that some important areas for accountability will be neglected. Consolidating multiple indicators does not solve this issue as assigning weights associated with each component of the composite indicator involve the same value or political choices, with the added risk of loss of transparency . DevelopThis balance also needs to be evaluated and displayed using a framework that makes transparent not only the interrelationships among these diverse perspectives but the inevitable compromises that are part of any optimised health care delivery system. We suggest that the 'value cube' framework has such potential and the capacity to graphically represent the global return on investment of health care funding in a scalable form. In essence this approach can concisely define and demonstrate value in healthcare by showing whether clinical intervention(s) produce the desired patient outcome(s) efficiently and effectively. This need for this type of analysis will assume increasing importance with the increasing implementation of 'pay for performance' funding models -49.So where do we go? The way forward may require more time than allowed the NHHRC and the Working Group as there are two tasks which both need to be completed well: one to develop a framework and appropriate, technically-sound measures and the other to build acceptance of the approach. Unfortunately these are not separate and distinct tasks as participation in design may be necessary for acceptance. The goal here is widely accepted technically sound benchmarks, within a short time frame. A formidable task! The compromise may be to develop an interim list of benchmarks in the short term with a clear agenda, process, time frame and funding to develop better measures, benchmarks and reporting approaches over a more realistic time frame.MW developed the original idea of the value cube which has been refined in the writing of this paper. Both authors contributed to writing and approved the final manuscript.

There is a controversy regarding the existence of a socio-economic gradient for cerebral palsy. Perinatal emergencies and preterm birth increase the risk for the offspring to develop cerebral palsy. The aim of this study was to investigate the association of socio-economic indicators with cerebral palsy (CP) and the role of perinatal health as mediator of this association.Register study of a national cohort of 805,543 children born 1987–93, including 1,437 children with cerebral palsy that were identified in hospital discharge data from national registers. Socio-economic indicators of the household were taken from the Census of 1985. Logistic regression and chi-square analyses of linearity were used to test hypotheses.There was a linear association between the incidence of CP as well as of major perinatal indicators and the socio-economic status (SES) of the household of the mother (p < 0.001). Children in households with low SES had a higher odds ratio of CP (OR 1.49 [95% C.I. 1.16–1.91]) compared with high SES after adjustment for demographic confounders. This OR decreased to 1.36 (1.05–1.71) after adjustment for perinatal indicators with preterm birth as the most important mediating variable.This study suggests that there is a continuous socio-economic gradient for CP in Sweden. Further studies in more complete populations of children with cerebral palsy are needed to confirm this. Perinatal complications seem to mediate some of this gradient. Many European societies report considerable socio-economic differences in child health . Sweden Cerebral palsy (CP) is a common cause of severe disability in children. There is conflicting evidence in the literature regarding socio-economic differences in families that give birth to children that develop CP . The onlPreterm birth, low birth weight and perinatal health problems, such as intrapartal emergencies with birth asphyxia, have been linked to the development of CP ,8. In thThis study was based on Swedish national registers held by the National Board of Health and Welfare and Statistics Sweden. These registers can be used for statistical reports by government agencies and are also open for researchers after ethical approval by the responsible bodies. This study was approved for two reasons: Firstly, the study was conducted on behalf of the National Board of Health and Welfare, and thus according to the Swedish regulations studies commissioned by the National Board of Health and Welfare does not need an ethical approval. Secondly, all analyses were made on a totally anonymous dataset where all personal identifiers, such as the Swedish national registration number, names or addresses had been ereased.All children born in Sweden during 1987–93 were identified in the Swedish Medical Birth Register (SMBR) was defined as < -2SD according to the growth chart developed by Marsal et al . 'Low ApThe socio-economic status (SES) and housing situation of the household of the mother and the maternal and paternal country of birth were identified in the Swedish Population and Housing Census in November 1985, thus prior to any gestational health problem involving the children in the study. Country of birth of the parents was categorised as Swedish, European, non-European and mixed (=one Swedish-born and one foreign-born parent). If one parent was born in Europe outside of Sweden and the other in a non-European country the category of the mother was used to categorise the child. SES was defined according to a classification used by Statistics Sweden, which is based on occupation but also takes educational level of occupation, type of production and position at work of the head of the household into account . Social th revision of the WHO International Classification (ICD-9) [th revision of the WHO International Classification of Diseases (ICD-10) [CP in this study was defined as having been discharged from a hospital after one year of age with CP as a main or contributory diagnosis according to the Swedish Hospital Discharge Register of 1988– (ICD-9) during 1(ICD-10) during 1(ICD-10) .Chi-square tests of linearity were used to examine associations of SES and domicile with the outcome variables. Multivariate analyses were conducted using unconditional logistic regression with CP not caused by severe head injury or malformation as the outcome variable. 689 individuals with an extremely high or extremely low birth weight in relation to their gestational age and/or length were excluded from the multivariate analysis as probable coding errors in the register.Year of birth was entered as a continuous variable in the regression models in accordance with a continuously decreasing secular trend. A summarised "asphyxia" variable was created with children having at least one of three perinatal risk factors . The six category SES variable Table was summIn the first regression model CP was analysed in relation to SES only. In all other models maternal age, sex and year of birth of the child and the geographic location of the home (residency) were added as demographic confounders. In models 3–5 the three major perinatal variables were analysed separately in relation to SES while all variables were included in the final model 6. The SPSS software package, version 12.0, was used in all statistical analyses.There were 1,437 children discharged from hospital at least once with a diagnosis of CP during 1987–2002, indicating a cumulated hospital incidence of CP of 1.78 per 1000 in the cohorts born 1987–93 during this time period. There were 0.03 children per 1000 with CP associated with severe head injuries, 0.21 per 1000 with CP associated with a malformation syndrome leaving 1.55 per 1000 with an "unspecified" CP, 1.79 in boys and 1.29 in girls.There was a linear association of unspecified CP with SES Table . In all The incidences of extreme preterm birth, small for gestational age and asphyxia were found to increase with decreasing SES Table . The ratIn a multivariate analysis the odds ratio for unspecified CP of low SES compared to the highest SES category was 1.49 after adjustment for demographic confounders Table ; Model 2This study of a national cohort in Sweden demonstrates a considerable socio-economic gradient for cerebral palsy. Children in households with a low SES had a 50% higher risk than those in the highest SES category of being admitted to a hospital with a diagnosis of CP. Perinatal risk factors, particularly extreme preterm birth and asphyxia were associated with unspecified CP in this study. These indicators had a significant linear association with SES and seemed to mediate approximately 25% of the increased odds ratios associated with low SES.The single most important perinatal risk factor in this study, accounting for two thirds of the variation associated with perinatal risk in Table An exaggerated role of perinatal factors as such may also create an exaggerated role of these factors as mediators for the influence of SES on CP. This and the considerable socio-economic risk not attributable to perinatal risk factors makes it necessary to look for alternative mediating pathways for this influence. These mechanisms could include infections, nutritional factors and other mechanisms during the pregnancy that may predispose the infant to hypoxia because of placental damage as well This study demonstrates a socio-economic gradient for cerebral palsy. A similar conclusion by Sundrum et al in a study population in west Sussex in the UK has beenIn the only other Swedish study of socio-economic differences in CP up to date, Lagergren found a The use of hospital discharge data to identify children with cerebral palsy is a source of possible bias and error in this study. Firstly, the quality of a hospital diagnosis of cerebral palsy has not been evaluated in Sweden. Thus, it is possible that our results were attenuated by children misclassified as having cerebral palsy when in fact they did not.Secondly, the live birth incidence of cerebral palsy has been estimated to 2.2/1000 in cohorts born 1990–93 in southern Sweden and 2.4 Socio-economic categorisation of households with small children is not an easy task. Parents of small children are often in a transitional period on the labour market or students. Thus the validity of the socio-economic position defined by SES in the Census of 1985 in cohorts born 1987–93 is probably quite low, causing an underestimation of the "true" socio-economic gradient.The major strength of this study is the large study population made possible by the wide coverage of the Swedish national registers. To our knowledge this is the largest cohort of children with cerebral palsy in a study of socio-economic risk factors. The identification and exclusion of children with CP related to severe head injuries and gross malformation avoided some possible pitfalls in the analysis, since these cases probably have particular risk factor profiles .In summary this study suggests the existence of a continuous socio-economic gradient prior to birth in families where the offspring develop CP in Sweden. Perinatal complications seem to mediate some of this gradient. Further investigations are needed to confirm our findings in more complete study populations and to identify the mechanisms that explain the considerable residual socio-economic variation.The authors declare that they have no competing interests.AH came up with the idea of this study inspired by KTJ, designed the study, made all analyses and wrote the first draft of the manuscript. KTJ created the theoretical framework for the analysis and participated in the interpretation of the data and the writing of the article. Both authors read and approved the final version of the articleThe pre-publication history for this paper can be accessed here:

A 60-year-old female presented with a large, gradually increasing swelling on her lower back, present since the last five years. The swelling was slightly tender, firm and nodular. There was no history of hypertension, diabetes, or tuberculosis. The mass was excised and sent for histopathological examination.Histopathology: The cut section showed grey-white and brown-lobular areas with infiltrating margins in the subcutaneous tissue [s tissue . MultiplThe sections studied showed mostly uniform, spindle-shaped cells, arranged in a storiform pattern. The nuclei were oval to elongated and regular, but at places showed pleomorphism, hyperchromasia and irregularly clumped chromatin. Few mitotic figures and occasional bizarre cells were also seen, with minimal inflammatory infiltrates. A deep extension of tumour cells was seen in the subcutaneous fat. There was a thinning of the overlying epidermis Figures – 4.Dermatofibrosarcoma protuberans (DFSP) was first described by Darrier and Ferran in 1924, as a progressive and recurrent dermatofibrosarcoma. It is co123The cause of DFSP is not known, although cytogenetic studies have shown tumor cells with chromosomal anomalies. Over 95% of the DFSP tumors have the chromosomal translocation t(17:22). The translocation fuses the collagen gene (COL1A1) with the platelet-derived growth factor gene. The tumor cells express the fusion gene. The resultant fusion protein is processed into a potent growth factor.Enzinger and Weiss developed a classification of soft tissue sarcomas on the basis of the histological appearance of the normal tissue. However, the World Health Organisation (WHO) classifies fibrous histiocytoma as a benign tumor and DFSP as an intermediate malignant tumor of fibrohistiocytic origin. There arHistologically, DFSP should be differentiated from lesions, such as, benign and malignant fibrous histiocytoma, atypical fibrosarcoma, dermatofibrosarcoma, infantile myofibromatosis, nodular fasciitis, keloid, myxoid liposarcoma and neural tumors; all of which may have similar pathological findings.357–9 Imm35Surgical excision is the treatment of choice. Long-term follow-up is needed, as one-third of the cases develop recurrence after five years.2 When th235The preferred therapy for DFSP is wide radical surgical excision. The technique should include resection of a 3 cm margin of skin beyond the borders of the tumor and should include the fascia and even the muscle tissue, if necessary.589 Radio589Late presentation, aggressive local invasion, regional lymph node involvement and distant metastases herald poor prognosis in addition to some histological features such as, increased mitotic figures, increased cellularity, DNA aneuploidy, TP53 gene expression and fibrosarcomatous change.The tumor presents a diagnostic challenge because of its rarity and its histological variants. Despite locally aggressive behaviour, this tumor infrequently metastasizes, and hence, it should be clearly distinguished from the conventional sarcomas. The correct diagnosis and treatment of choice offer a significant improvement in the cure rate, cosmetic advantage and patient's suffering.

When cyclophosphamide (CY) (100-120 mg kg(-1)) was administered intravenously (i.v.) to normal F-344 rats, oliguria occurred over the 5-day observation period. Conversely, in rats bearing matrix metalloproteinase-9 (MMP-9) producing 13762NF mammary adenocarcinoma (MTLn3 clone), polyuria occurred chiefly during the first 24 h after CY treatment. In parallel with urine volume, a decrease in the urinary excretion of N-acetyl-beta-D-glucosaminidase (NAG) was observed during the first 5 days after CY treatment in normal rats, but it increased in MTLn3-bearing rats. No elevation in blood urea nitrogen (BUN) or serum creatinine (Cr) values was observed for either group. Both urine volume and urinary excretion of NAG after CY treatment were lower in rats bearing the MTC clone (lower production of MMP-9) than for those bearing the MTLn3 clone. In the case of treatment with cisplatin ), urine volume, urinary NAG excretion and BUN and serum Cr values all increased in normal rats and were all found to be higher in MTLn3-bearing rats than in normal rats. The diuretic response to these drugs in tumour-bearing (TB) rats may be associated with MMP-9 produced by the tumour cells. This report suggests that the nephrotoxicity due to anti-cancer drugs may change when the drugs are used for the treatment of patients bearing a MMP-9-producing tumour.

The aim of the present cross-sectional study was to assess possible associations between osteopontin (OPN), and thrombin-cleaved OPN, and nephropathy and coronary artery disease (CAD) in patients with type 2 diabetes mellitus (T2DM).Plasma levels of OPN, N-half OPN, and high-sensitivity C-reactive protein (hsCRP) were determined in 301 diabetic patients with (n = 226) or without (n = 75) angiographically documented CAD , as well as in 75 non-diabetic controls with normal angiography. The estimated glomerular filtration rate (eGFR) was calculated in all patients.P < 0.01). T2DM patients in whom OPN levels were greater than the median value had higher serum creatinine levels, a greater prevalence of mild or moderate renal insufficiency, a higher incidence of CAD, and lower eGFR than T2DM patients in whom OPN levels were the same as or lower than the median value. However, there were no differences in these parameters when patients were stratified according to plasma N-half OPN levels. Furthermore, there was a significant correlation between OPN, but not N-half OPN, and the severity of nephropathy and CAD in diabetes. After adjustment for potential confounders and treatments, multiple linear regression analysis demonstrated an independent association between OPN, but not N-half OPN, and eGFR. Multivariate logistic regression revealed that higher OPN levels conferred a fourfold greater risk of renal insufficiency and CAD in patients with T2DM.Plasma levels of OPN and hsCRP were significantly higher in patients with T2DM compared with controls. In addition, there was a higher occurrence of moderate renal insufficiency and lower eGFR in patients with T2DM (all The results of the present study demonstrate that there is an independent association between plasma levels of OPN, but not N-half OPN, and the presence and severity of nephropathy and CAD in diabetes. Micro- and macro-vasculopathies, such as nephropathy and coronary artery disease (CAD), respectively, are common in diabetes and constitute the major causes of death for these patients ,2. Proin2-terminal fragment of OPN, causing inflammation in an RGD-independent manner [Structurally, OPN contains several cell-interacting domains, as well as protease-cleavage sites, that may be important in regulating its activity. These domains include: (i) an arginine-glycine-aspartate (RGD)-containing domain that interacts with cell surface integrins αvβ3, αvβ1, αvβ5, and α8β1, promoting the migration and/or growth potential of lymphocytes, macrophages, endothelial cells, and vascular smooth muscle cells; and (ii) a cryptic serine-valine-valine-tyrosine-glutamate-leucine-arginine (SVVYGLR)-containing domain cleaved by thrombin that interacts with α9β1, α4β1, and α4β7 integrins and mediates cell adhesion to the NHt manner ,21,22. Pt manner -25. Throt manner , as wellt manner , highligt manner , in the The study protocol was approved by the Ruijin Hospital ethics committee. Written informed consent was obtained from all patients prior to their inclusion in the study.The present study was performed on 301 consecutive diabetic patients (171 men and 130 women) undergoing angiography for suspected CAD or percutaneous coronary intervention (PCI) between June 2005 and October 2007. Patients with concomitant valvular heart disease, cardiomyopathy, acute renal failure, acute and chronic viral or bacterial infections, asthma, tumors, or connective tissue diseases, and those undergoing coronary artery bypass surgery or on dialysis, were excluded from the study. In addition, patients with acute coronary syndrome, in-stent restenosis or those with symptomatic heart failure were excluded from the study. Patients with type 1 diabetes mellitus were identified on the basis of C-peptide measurements and were also excluded from the study. T2DM was diagnosed using the following criteria: (i) fasting plasma glucose levels ≥7.0 mmol/L on two occasions; (ii) two 2-h postprandial plasma glucose readings ≥11.1 mmol/L after a glucose load of 75 g; (iii) two casual glucose readings ≥11.1 mmol/L; or (iv) treatment with oral hypoglycemic drugs or parenteral insulin. The clinical characteristics and risk factors for CAD were recorded for each patient. Almost all T2DM patients were receiving antidiabetic treatment and most were taking statins and angiotensin-converting enzyme (ACE) inhibitors or angiotensin receptor blockers (ARBs).Seventy-five consecutive non-diabetic patients who underwent coronary angiography for suspected CAD but had normal coronary arteries served as the control group. The professional activities and diet styles of the control group were matched with those of the diabetic patients. Liver and renal function tests were normal.To elucidate the relationship between OPN or N-half OPN and nephropathy or CAD in diabetes, T2DM patients were divided into two groups, those with higher than median plasma values of OPN (235.0 ng/mL) and N-half OPN (25.0 pmol/L) and those with median or lower plasma values of OPN and N-half OPN. This was done because the distribution of plasma values of OPN and half-OPN is not normal.Selective coronary angiography was performed using a femoral or radial artery approach by cardiologists blinded to the study protocol. Significant CAD was diagnosed visually if the narrowing of the luminal diameter of a major epicardial coronary artery was ≥50%. Patients with significant CAD were further classified into those with one-, two-, or three-vessel disease depending on the number of coronary arteries involved. A ≥50% narrowing of the left main coronary artery was considered as two-vessel disease.2, respectively.Blood samples were collected from all patients before coronary angiography and after an overnight fast. Plasma OPN level was determined with a commercially available ELISA kit according to its protocol, which only detects full-length OPN. The sensitivity for OPN was 3.33 ng/ml with an intra- and inter-assay CV of <5% and <10%, respectively. Plasma levels of N-half OPN were measured using an ELISA kit . In brief, 1:2 diluted testing samples were incubated in the N-half OPN antibody pre-coated wells at 37°C for 1 h. Following washing, 100 uL of labeled OPN antibody solution was added into each well and incubated for 30 min at 4°C. After washing, tetramethyl benzidine was used as a coloring agent, and the absorbance at 450 nm was measured with an automatic ELISA reader . The intra- and inter-assay coefficients of variation (CV) were <5% and <8%, respectively, with a sensitivity 3.09 pg/L. Furthermore, plasma levels high-sensitivity C-reactive protein (hsCRP) were determined . Estimated glomerular filtration rate (eGFR) was calculated using the formula of the Modification of Diet in Renal Disease study group . Mild, mP ≤ 0.05 was considered significant.All statistical analyses were performed using SPSS for Windows 13.0 . Unless indicated otherwise, data are presented as frequencies or percentages for categorical variables and as the mean (±SD) or median (interquartile range) for continuous variables. For categorical clinical variables, differences between groups were evaluated with the Chi-squared test. For continuous variables, normal distribution was evaluated with the Kolmolgorov-Smirnov test. Variables that were not normally distributed were log transformed when necessary. Comparisons between groups were made using analysis of variance for variables with a parametric distribution. Correlations were evaluated by calculating Spearman's correlation coefficient. Multiple linear regression analyses with eGFR and OPN as dependent variables were used to assess independent relationships. A multivariate logistic regression model was constructed to assess the independent determinants for a moderate decrease in eGFR, CAD and either of the two in diabetic patients. Two-sided Compared with non-diabetic controls, T2DM patients were older, had higher systolic and diastolic blood pressures, higher triglyceride and fasting glucose levels, and lower high-density lipoprotein-cholesterol levels. More diabetic patients were receiving treatment with statins and ACE inhibitors or ARBs than controls Table .P < 0.001), hsCRP (P < 0.001), and creatinine (P < 0.01) levels, were more likely to have moderate renal insufficiency (P < 0.01), and had a lower eGFR ; mild renal insufficiency 78.8% vs. 63.6%, respectively (P < 0.01); and moderate renal insufficiency 21.9% vs 11.2%, respectively (P < 0.05)); in contrast, eGFR was higher in T2DM patients with OPN levels below the median . However, there was no difference in the percent of N-half OPN in T2DM patients with normal, mild and moderate renal insufficiency (P = 0.65).Serum creatinine and occurrence rate of mild or moderate renal insufficiency were higher in T2DM patients with OPN levels greater than the median compared with those with OPN levels lower than the median , but differences were not found for patient groups stratified according to N-half OPN values , but not with N-half OPN levels .Patients with OPN concentrations greater than the median value had a higher incidence of CAD than those with OPN levels below the medium value . After adjusting for age, the associations between plasma OPN and hsCRP remained significant. However, N-half OPN did not correlate with other variables in this study.In T2DM patients, there was a positive correlation between plasma OPN levels and hsCRP (P = 0.002). In a similar analysis, when OPN was used as a dependent variable in Model B after adjustment for several potential confounding variables, independent associations were found between OPN and N-half OPN, hsCRP, and eGFR for OPN in the diabetic cohort cleavage induce enhanced adhesion compared with the effects of full-length OPN. This appears to be due mostly to increased activity of the RGD site, perhaps an indication of conformational change resulting in higher affinity binding . In a moType 2 diabetes is an independent risk factor for cardiovascular diseases and a CAD equivalent . Its comThere are several limitations to the present study. First, the present study was a cross-sectional design; thus, our results reflect only the association between OPN or N-half OPN levels and prevalent rather than incident atherosclerosis. Second, all subjects in the present study were scheduled for coronary angiography and/or PCI, and are thus likely to be more typical of a high-risk patient group than the healthy population at large.In conclusion, the present study indicates that plasma concentrations of OPN, but not N-half OPN, are independently associated with the presence and severity of nephropathy and CAD in T2DM patients. Approaches involving the inhibition of OPN signaling may prove valuable therapeutic strategies for the prevention of diabetic complications and improved patient outcomes.The authors declare that they have no competing interests.XY contributed to the study design, collected the data, contributed to the discussion, and wrote the manuscript. LL, WW, LW, QZ, RZ, and QC collected the data. MS, KF reviewed/edited the manuscript. WS contributed to the study design, discussion, and reviewed/edited the manuscript. All authors have read and approved the final manuscript.

Understanding the contribution of the dermis in skin aging is a key question, since this tissue is particularly important for skin integrity, and because its properties can affect the epidermis. Characteristics of matched pairs of dermal papillary and reticular fibroblasts (Fp and Fr) were investigated throughout aging, comparing morphology, secretion of cytokines, MMPs/TIMPs, growth potential, and interaction with epidermal keratinocytes. We observed that Fp populations were characterized by a higher proportion of small cells with low granularity and a higher growth potential than Fr populations. However, these differences became less marked with increasing age of donors. Aging was also associated with changes in the secretion activity of both Fp and Fr. Using a reconstructed skin model, we evidenced that Fp and Fr cells do not possess equivalent capacities to sustain keratinopoiesis. Comparing Fp and Fr from young donors, we noticed that dermal equivalents containing Fp were more potent to promote epidermal morphogenesis than those containing Fr. These data emphasize the complexity of dermal fibroblast biology and document the specific functional properties of Fp and Fr. Our results suggest a new model of skin aging in which marked alterations of Fp may affect the histological characteristics of skin. Chronological aging is described as a time-dependant biological process leading to gradual changes in the structure and functions of all tissues that compose an organism. These modifications tend to decrease the capacity for adaptive responsiveness and wound healing, and therefore enhance its susceptibility to disorders and death. The genetic program that determines life span and aging is investigated using models of different species, including yeasts (Saccharomyces cerevisiae), worms (Caenorhabditis elegans), insects (Drosophila melanogaster), and mammals (Mus musculus) Skin represents a valuable model to study aging in humans, since it is widely affected by this process and is easily accessible. Modifications related to aging are particularly visible in human skin, which becomes wrinkled, lax, dry, and irregularly pigmented over time in vitroin vitro the biology of fibroblast aging and senescence, at the cellular and molecular levels. Alterations of fibroblast properties, associated with aging or senescence, have been studied either in long-term cell cultures in vitro expansion may all more or less participate to the in vivo age-related changes of the skin.Human fibroblasts can be isolated from various connective tissues, including skin A wide diversity of characteristics have been reported for fibroblasts derived from different tissues The aim of the present work was to investigate the age-related modifications of distinct human dermal fibroblast populations and their possible implication in skin aging. Fibroblasts were obtained from the superficial layer of the dermis, named “papillary dermis”, and from the deeper dermal layer, named “reticular dermis”. Matched pairs of papillary (Fp) and reticular fibroblasts (Fr), derived from donors of different ages were studied and analyzed for cellular morphology, secretion of growth factors and cytokines, production of matrix proteases, growth characteristics, and their capacity to promote epidermal morphogenesis.Samples of human mammary skin (sun-protected skin areas) were obtained from adult Caucasian women, after plastic surgery. Informed consent was obtained before tissue collection, according to European guidelines. Age of donors ranged from 19 to 74 years. After removing the subcutaneous tissue, skin samples were sliced according to depth using a dermatome. The upper part of skin samples (from the surface to a 0.3 mm depth) contained the epidermis and the papillary dermis. The deeper part of skin samples (depth >0.7 mm) corresponded to the reticular dermis. Quality of full skin samples and sections was monitored by histological analysis. Collagen fibers were stained with Sirius red . The epidermis was separated from papillary dermis by dissection, after treatment with 0.25% trypsin for 1.5 hours at 37°C .2. After migration of fibroblasts outward dermal explants, these cells were amplified in culture and stored in liquid nitrogen as frozen aliquots until use. Match pairs of Fp and Fr were used for the different investigations at the same early passage.For the preparation of papillary (Fp) and reticular fibroblasts (Fr), pieces of deep and superficial dermis were placed in culture in MEM supplemented with 10% fetal bovine serum (FBS) , penicillin-streptomycin (20 U/ml) , and glutamine (2 mM) , and maintained at 37°C in a 90% humidified atmosphere containing 5% COThe keratinocytes used in this study were from the epidermis of a single skin sample from a 28 years old donor. Epidermal pieces were dissociated by incubation in 0.25% trypsin for 1.5 hours at 37°C . Keratinocytes were plated on a feeder-layer of growth-arrested 3T3 murine fibroblasts, and amplified according to the method described by Rheinwald and Green 4 cells/cm2 in duplicate 60 mm culture dishes in a medium composed of MEM supplemented with 10% fetal bovine serum (FBS) , penicillin-streptomycin (20 U/ml) , and glutamine (2 mM) . Culture medium was renewed every 3 days after fibroblast plating. To minimize the quantities of endogenous cytokines, growth factors, matrix metalloproteinases (MMPs) and tissue inhibitor of metalloproteinases (TIMPs) present in the medium, cultures were maintained in the presence of a low serum concentration (1%) the 3 last days before the analysis of secretion profiles of Fp and Fr (from day 6 to day 9). At day 9, supernatants from Fp and Fr cultures were sampled and processed for the quantification of cytokines, MMPs, and TIMPs by ELISA: interleukin-6 (IL-6), monocyte chemoattractant protein-1 (MCP-1), vascular endothelial growth factor (VEGF), keratinocyte growth factor (KGF), MMP-2, MMP-3, TIMP-1 and TIMP-2 , MMP-1 . Background concentrations of cytokines, MMPs and TIMPs present in the culture medium containing 1% FCS in the absence of cells were found very low, often below the detection threshold of quantification assays. When detectable, these values were deduced from concentrations measured in cell supernatants. Values were then normalized according to cell numbers counted in the respective cultures and expressed in pg/ml (cytokines) and ng/ml (MMPs and TIMPs) per 1×105 cells.Samples of Fp and Fr were plated at a density of 1×105 cells/ml. The respective cell samples were analyzed for size and granularity . Results were referred to viable cells, discriminated from dead cells by 7 AAD staining .Morphological characteristics of young and old Fp and Fr were analyzed by flow cytometry . Cultures of Fp and Fr from 3 matched pairs of young and 3 of old donors were trypsinized 7 days after plating, and re-suspended in PBS supplemented with 0.2% bovine serum albumin (BSA) at 4×102 wells at a density of 1×104 cells/cm2, and cultured in a medium composed of MEM supplemented with 10% FBS , penicillin-streptomycin (20 U/ml) , and glutamine (2 mM) . Cell counts were performed at days 7, 14, and 21 after culture initiation. Cellular expansion values corresponded to numbers of cells counted after 7, 14 and 21 days of culture divided by the number of cells initially plated.Previously amplified fibroblasts in primary culture were plated in triplicates into 10 cm2. Medium was completely renewed every 4 days. Cultures were fixed in ethanol (70%) and stained with Eosin and Methylen Blue . Colonies were counted and photographed under an inverted microscope coupled with a CCD camera . The area occupied by cells in individual colonies was scored using Image J software . Colony counts were based on the analysis of triplicate dishes. Colonies were classified according to the surface occupied by cells and separated into 3 groups: large colonies (>1.5 mm2), colonies of intermediate size (0.5–1.5 mm2), and small colonies (<0.5 mm2). Correspondence between the surface of colonies and cell numbers was determined by cell counting on micro-photographs of fixed colonies.Fibroblasts from the different individual samples were plated at the low density of 100 cells per 100 mm diameter culture dish . Cultures were performed for 12 days in a medium composed of MEM supplemented with 10% fetal bovine serum (FBS) , penicillin streptomycin (20 U/ml) , and glutamine (2 mM) , and maintained at 37°C in a 90% humidified atmosphere containing 5% CO6 cells per sample of reconstructed dermis) were embedded into a bovine type I collagen gel . Diameters of each dermal equivalent (lattice) were measured using a millimeter scale during the 4 days of lattice contraction. Thereafter, keratinocytes (5×104 cells per sample of reconstructed epidermis) were seeded onto the lattices, stuck to the bottom of 60 mm diameter Petri dishes. Cultures were maintained for 1 week immersed in a medium composed of MEM supplemented with 10% FBS , Epidermal Growth Factor (EGF) (10 ng/ml) , Hydrocortisone (0.4 µg/ml) , and Cholera Toxin (0.1 nM) . Complete epidermal stratification and full differentiation was obtained 1 week after raising the system at the air-liquid interface. During the whole process of skin reconstruction, cultures were maintained at 37°C, in a fully humidified atmosphere containing 5% CO2.Reconstructed skins were prepared as previously described Transplantation of human reconstructed skin samples onto immunodeficient athymic mice were performed using a previously published procedure Samples of human and reconstructed skin were fixed in paraformaldehyde, dehydrated, and embedded in paraffin. Histological examinations of tissue sections were performed after hematoxylin-eosin-saffron (HES) staining, using a Leica DMR light microscope . Thicknesses of spinous, granular and cornified layers, as well as total nucleated cell layers, were measured by image analysis using the image J software .Samples of reconstructed skin were embedded in Tissue-Tek and frozen in liquid nitrogen, and cut into 5 µm thickness sections . Filaggrin was stained using a mouse monoclonal antibody , revealed using a FITC-conjugated rabbit anti-mouse polyclonal antibody . Nuclei were stained using propidium iodide . Stained tissue section were observed and imaged under fluorescence microscope .Cell samples were plated on glass slides in micro-culture chambers , and cultured for 3 days in MEM / 10% FBS. Microphotographs of cultured cells were taken under light microscopy . For immunofluorescence labeling, cells were fixed in 4% paraformaldehyde , washed in TBS, and permeabilized in TBS-Tween 0.5% . Vinculin was stained using a mouse FITC-conjugated monoclonal antibody . Actin filaments were stained using TRITC-conjugated phalloidin . Stained cultured cells were observed and imaged under fluorescence microscope .Correlation between concentrations of secreted cytokines, MMPs, TIMPs and donor age were estimated by linear regression. Correlation coefficient (R) and statistical significance (P) were considered acceptable when values were R>0.5 and P<0.05, respectively. For the other studies, differences between experimental groups were analyzed using the ANOVA mixed model. Differences were considered as statistically significant when P values were <0.05. When necessary, data were transformed in logarithm to satisfy conditions of normality and homogeneity. When variances were unequal, ANOVA was run on rank-transformed data.The process used to generate Fp and Fr samples is schematized in The age-related characteristics of human skin are illustrated by the representative histological sections of mammary skin biopsies obtained from a young (19 yr) and an old (74 yr) adult donor and older donors were examined by flow cytometry, according to the morphological parameters of size (forward scatter) [FSC] and granularity (side scatter) [SSC]. Dot plots corresponding to Fp and Fr from a typical young donor (19 yr) and SSC Papillary and reticular fibroblasts (Fp and Fr) isolated from skin samples from 3 young and 3 old individuals , were studied for their respective growth rate in short-term culture. Mean cumulative expansion curves indicated that, in the young age group, Fp exhibited a higher growth rate than Fr , in part2) were characterized by a low fibroblast density, whereas cell density was markedly higher in large size colonies (area >1.5 mm2). Cell density was intermediate in medium size colonies. Correspondence between colony area (mm2) and fibroblast number indicated that small size, medium size, and large size colonies contained respectively 2.66×102±0.61×102, 1.86×103±0.45×103, and 4.65×103±0.27×103 fibroblasts and 4 old donors indicated that the colony-forming efficiency (CFE) of Fp was significantly higher than that of Fr, whatever the age of donors . This diroblasts . Analysiroblasts . In partTo investigate differences in the capacity of Fp and Fr from young and old donors to contract a collagen gel, cells were embedded into type I collagen, and the diameter of dermal equivalents (lattices) was measured from day 1 to day 4 after culture initiation. In the young age group, the diameters of the lattices containing Fr cells were significantly lower than those containing Fp cells at each time point of the study (p<0.05), indicating a higher rate of lattice contraction of Fr. Differences were particularly important at day 1: diameter of lattices containing Fp and Fr were 2.506 cm±0.068 and 1.928 cm±0.078, respectively. Differences in the lattice retraction rate between Fp and Fr became less important with increasing age. At day 1, diameter of lattices containing Fp and Fr were respectively 2.264 cm±0.035 and 1.976 cm±0.078 (p<0.05). Differences were still significant at days 2 and 3, but not at day 4. In general, the lattice contraction capacity of Fr did not change with age , whereasThe effect of Fp and Fr from young and old donors on skin reconstruction was evaluated in a reconstructed skin model comprising a dermal and epidermal equivalent. Keratinocytes from the same batch were seeded onto dermal equivalents containing either Fp or Fr from young or old donors. Histological sections revealed that young Fp were more potent to promote epidermal morphogenesis than Fr of similar age. Epidermis reconstructed on lattices containing young Fp had more cell layers and was fully differentiated , whereasin vitro, similar reconstructed skin samples were grafted onto nude mice. Grafting confirmed that young Fp were more potent to promote the development of a correctly stratified and differentiated epidermis (in vivo conditions only, young Fp promoted the formation of rete-ridge structures in the grafted reconstructed skin samples. Rete-ridge structures were not observed in grafted skin samples containing old Fp (To complete the observations performed pidermis than Fr pidermis . In addig old Fp or old Fg old Fp . It had Well known characteristics of skin aging in humans are a reduction of thickness We found that Fp exhibit a higher growth rate in culture than Fr, which is in agreement with previous reports Analysis of protein secretion by the two fibroblast populations led to a similar conclusion. Most of the secreted proteins were equivalent in young and aged Fr with the exception of MCP-1, which was found down-regulated in Fr from aged donors. On the contrary, protein secretion by Fp was widely affected by aging. Whereas the growth potential of Fp decreased with age, secretion levels of the growth factor KGF, the metalloproteinases MMP-1, MMP-2, MMP-3, as well as the metalloproteinase inhibitors TIMP-1 and TIMP-2, was all increased in old compared to young Fp. Thus, the levels of different protein secretion, which were globally lower in young Fp compared to the young Fr appeared similar in Fp and Fr samples from older donors. A general increase in MMP production by dermal fibroblasts with age is described in previous reports in vitro model of cell aging, a decrease of the growth potential Our comparative studies of Fp and Fr performed at the global level of cell populations have revealed some differences in biological properties of the two fibroblast populations. However, analyses of cell morphology by flow cytometry and evaluation of colony-forming efficiency in culture have revealed that fibroblast samples from the two tissue localization present a broad heterogeneity. We routinely observed a higher proportion of fibroblasts with small size cells and low granularity in Fp samples compared to Fr samples. Dermal fibroblasts are for long known to produce clones with heterogeneous characteristics in low density cultures The preferential evolution of the Fp population throughout aging may have important consequences on the biology of papillary dermis. In particular, reduction of the growth capacity of Fp may contribute to their decline in the papillary dermis of aged skin. Moreover, modifications of their secretion profile may have a wide impact on the biology of the tissue. Indeed, cytokines, growth factors, and MMPs/TIMPs, secreted by fibroblasts are involved in the regulation of a variety of biological processes, including inflammation Recent reports have shown that dermal fibroblasts play a key role in the regulation of epidermal morphogenesis Based on these results, different hypotheses can be proposed to interpret the age-related changes of the dermal fibroblast populations in the context of skin aging. The Fp population may be progressively lost throughout aging, and be replaced by Fr. This hypothesis is comforted by previous results obtained in a reconstructed skin model, where fibroblast from the deeper dermis migrate to the upper dermis to replace superficial fibroblasts killed after UVA exposure In conclusion, our results shed a new light on the distinct properties of Fp and Fr, their modifications during aging and possible implications on skin aging. In particular, our investigations, performed at the cellular and tissue levels, revealed that the cell population defined as Fp is a central actor in this complex process. As summarized in the schema presented in

Dictyostelium amoebae to form stalk cells in culture. To better define its role in normal development, we examined the phenotype of a mutant blocking the first step of DIF-1 synthesis, which lacks both DIF-1 and its biosynthetic intermediate, dM-DIF-1 (des-methyl-DIF-1). Slugs of this polyketide synthase mutant (stlB−) are long and thin and rapidly break up, leaving an immotile prespore mass. They have ∼ 30% fewer prestalk cells than their wild-type parent and lack a subset of anterior-like cells, which later form the outer basal disc. This structure is missing from the fruiting body, which perhaps in consequence initiates culmination along the substratum. The lower cup is rudimentary at best and the spore mass, lacking support, slips down the stalk. The dmtA− methyltransferase mutant, blocked in the last step of DIF-1 synthesis, resembles the stlB− mutant but has delayed tip formation and fewer prestalk-O cells. This difference may be due to accumulation of dM-DIF-1 in the dmtA− mutant, since dM-DIF-1 inhibits prestalk-O differentiation. Thus, DIF-1 is required for slug migration and specifies the anterior-like cells forming the basal disc and much of the lower cup; significantly the DIF-1 biosynthetic pathway may supply a second signal - dM-DIF-1.The polyketide DIF-1 induces Dictyostelium cells become partitioned into the prestalk and prespore lineages toward the end of aggregation hexan-1-one) . DIF-1 admtA− mutant.DIF-1 is made from a 12-carbon polyketide, which is successively chlorinated and methylated to give the final molecule Kay, 19. The DmtdmtA− mutant. However, they differ in their detailed phenotypes, consistent with each gene having additional functions unrelated to DIF-1 signaling mutant in which DIF-1 biosynthesis is blocked at the start of the pathway, so that no intermediates can accumulate stlB polyno acids . StlB hano acids . It is tstlB− and related mutants in more detail than previously, thus confirming that DIF-1 is required for slug migration and crucially for the formation of the lower cup and basal disc of the fruiting body.We have analyzed the phenotype of Dictyostelium discoideum strain Ax2 was maintained in HL-5 medium. LacZ transformants of wild-type background were grown in HL-5 medium containing 10 μg/ml of G418, whereas the medium for the stlB knockout strain, HM1154, contained both blasticidin (10 μg/ml) and G418 (10 μg/ml), and that of the double knockout mutant of dmtA and stlB both blasticidin (10 μg/ml) and hygromycin (30 μg/ml). Cells were developed on 1.5% agar (Difco) either unbuffered or with phosphate buffer . The timing of tip formation was determined using cells plated at 1.5 × 106 cm− 2 on 1.8% L28 agar (Oxoid) containing KK2 , 2 mM MgSO4, and 0.1 mM CaCl2.stlB gene knockout construct was created by the in vitro transposition method as described was used to create a stlB− knockout vector . The cell suspension was allowed to develop on a sheet of filter paper (Whatman 50) or nitrocellulose filter (pore size 0.45 μm Millipore) placed on 1.5% non-nutrient agar with or without 100 nM DIF-1. LacZ staining was performed as described . NeutralD. mucoroides spores PKS , was selected for detailed study here. After synthesis by StlB, the DIF-1 polyketide is chlorinated and then methylated to produce DIF-1, with methylation catalyzed by the DmtA methyl transferase (dmtA (referred to as the methyltransferase null), and a newly created double mutant, in which stlB was disrupted in the HM1030 background , were compared as appropriate. All mutants are in the Ax2 (referred to as wild-type strain) background and all grow normally in axenic medium. The strains used in this study and their genotypes are summarized in The backbone of DIF-1 consists of a 12-carbon polyketide produced by the steely B (tlB) PKS . Severalnsferase Fig. 1)stlB) PKSPKS null and methyltransferase null strains develop in a very similar way and the differences from wild-type strain give a common DIFless phenotype. Aggregation is similar to wild-type cells, except that methyltransferase null mutant is delayed in tip formation .dimA− mutant, which is unable to respond to DIF-1 .The methyltransferase null strain (HM1030) was previously reported to develop more slowly than wild-type strain and we fThe expression kinetics of prestalk and spore marker genes ecmA, ecmB, and spiA were similar between wild-type and the PKS null mutant by RT-PCR (data not shown). The proportion of prestalk cells in the mutants was assessed after disaggregation to single cells using the classical ‘Takeuchi’ antibody against prespore cells . Non-staThe wild-type strain had a lower proportion of prestalk cells than previously reported for slugs , which mTo try and pin down a more specific defect in prestalk cell differentiation, reporters derived from the promoter of the prestalk ecmA gene were used. The intact promoter drives lacZ expression in the entire anterior prestalk region, as well as in scattered anterior-like cells in the prespore region. The prestalk region is slightly shorter in the PKS null mutant, consistent with the reduced proportion of prestalk cells and previous findings for the methyltransferase null mutant. This defect is corrected by developing the mutant on DIF-1 agar A–C.The prestalk zone can be divided into an anterior pstA and a posterior pstO region by the expression of lacZ driven by subfragments of the ecmA promotor are not obviously explained by the reduced number of prestalk cells, we examined the morphology of the fruiting body in more detail.The basal disc supports the stalk and forms from a separate group of anterior-like cells that gather where the base of the stalk will form, and eventually vacuolate . The basdimA− and mybE− DIF-insensitive mutants but not in the PKS null mutant . The lower cup of cells supporting the spore mass is also reduced or lost in the PKS null mutant, and to a lesser extent in the methyltransferase null mutant fruiting bodies. Thus, formation of the basal disc, and to a considerable extent the lower cup, depends on DIF-1.The most striking feature of the PKS null mutant fruiting body is the near complete absence of a basal disc. This is a common feature of DIF-1 signaling mutants also found in The basal disc is a morphologically distinct part of the fruiting body, lending it stability. It forms from anterior-like cells in the prespore zone, not from the anterior prestalk zone but the mrrA, and this is dependent on MybE, which in turn is DIF-1-responsive , plus an unknown number of types of anterior-like cells in the posterior . The wea reality . What is36Cl− suggest that dM-DIF-1 is roughly equimolar with DIF-1 in pretip mounds has a role in cell-type proportioning. Genetically, the delayed tip formation by the methyltransferase null mutant and its reduced number of pstO cells compared to the PKS null mutant can be ascribed to a build up of dM-DIF-1, or possibly one of the other biosynthetic intermediates, and we find that dM-DIF-1 inhibits pstO cell differentiation in slugs. The same genetic argument also suggests that dM-DIF-1 can partially induce the anterior-like cells that form the basal disc. Earlier metabolic labeling experiments with Dictyostelium (The logic of prestalk cell diversification remains unclear. At one extreme, it might be proposed that each prestalk cell type has its own inducer, and cell type proportions are regulated by a feedback interaction with prespore cells as seen with DIF-1 . In thisostelium .

The frequency of drug prescription errors is high. Excluding errors in decision making, the remaining are mainly due to order ambiguity, non standard nomenclature and writing illegibility. The aim of this study is to analyse, as a part of a continuous quality improvement program, the quality of prescriptions writing for antibiotics, in an Italian University Hospital as a risk factor for prescription errors.The point prevalence survey, carried out in May 26–30 2008, involved 41 inpatient Units. Every parenteral or oral antibiotic prescription was analysed for legibility and completeness . Eight doctors (residents in Hygiene and Preventive Medicine) and two pharmacists performed the survey by reviewing the clinical records of medical, surgical or intensive care section inpatients. The antibiotics drug category was chosen because its use is widespread in the setting considered.Out of 756 inpatients included in the study, 408 antibiotic prescriptions were found in 298 patients . Overall 92.7% (38/41) of the Units had at least one patient with antibiotic prescription. Legibility was in compliance with 78.9% of generic or brand names, 69.4% of doses, 80.1% of frequency of administration, whereas completeness was fulfilled for 95.6% of generic or brand names, 76.7% of doses, 83.6% of frequency of administration, 87% of routes of administration, 43.9% of dates of prescription and 33.3% of physician's signature. Overall 23.9% of prescriptions were illegible and 29.9% of prescriptions were incomplete. Legibility and completeness are higher in unusual drugs prescriptions.The Intensive Care Section performed best as far as quality of prescription writing was concerned when compared with the Medical and Surgical Sections.Nevertheless the overall illegibility and incompleteness (above 20%) are unacceptably high. Values need to be improved by enhancing the safety culture and in particular the awareness of the professionals on the consequences that a bad prescription writing can produce. Adverse drug events (ADEs), usually defined as injuries caused by the use of a drug, are a major health concern for the patient in most clinical settings.It has been estimated that ADEs account for approximately 5% of all hospital admissions, occur during 10–20% of hospitalisations and are responsible for 7–9% of hospitalisation days.[Some ADEs are caused by errors called medication errors that have similar consequences as well as lowering patient satisfaction. Chart reIf we consider harm caused by any error, medication error is the fourth most frequent category among all sentinel events collected by the Joint Commission between January 1995 and June 2008 after wrong site surgery, suicide and op/post op complication.A medication error can occur at any step of the medication use process: prescribing, transcribing, dispensing and administering. Prescribing and administering errors are the two most frequent types of medication errors, but while 48% of the former can be intercepted, only 2% of the latter are intercepted.. The repA broad definition of prescribing error includes errors in decision making and errors in prescription writing. PrescribThe aim of this study is to analyse, as a part of a continuous quality improvement program, the quality of prescription writing for antibiotics, in an Italian University Hospital. We did not analyse the appropriateness of the molecule choice, but we evaluated the completeness and legibility of information present in the clinical records as risk factors for prescription errors.The study, a point prevalence survey, took place between 26–30 May 2008 in a North-Eastern University hospital. All 41 inpatient Units were involved, except for ophthalmology and dermatology since their antibiotic use, when present, is mainly topical, an administration route not considered in this survey.For study purpose Units were grouped together in medical, surgical and intensive care sections, as follows:• Medical section: cardiology, haematology, infectious diseases, internal medicine, nephrology, neurology, oncology, pediatrics, post acute care, pulmonology, radiotherapy, rheumatology, pain control, nursery.• Surgical section: general surgery, maxillofacial surgery, plastic surgery, vascular surgery, heart surgery, vertebral (spine) surgery, neurosurgery, urology, gastroenterology, orthopedics and traumatology, obstetrics, gynecology, otorhinolaryngology.• Intensive Care section: anesthesia and intensive care unit, medical intensive care unit, neonatology, coronary unit.The surveyors looked at the clinical record, both nursing and medical data, of the inpatients present in ward at 8.00 AM on the day of the survey. In the hospital different formats exist for recording drug prescriptions. A healthcare worker (HCW) was in charge of giving information to the surveyors in case the clinical record was not clear enough. All antibiotic prescriptions for parenteral or oral use were included in the survey. Every Unit was surveyed in one single day. Patient's age, gender and number of admitted patients were recorded. For those patients who had any parenteral or oral antibiotic prescriptions we collected further information: antimicrobial agent, dose, date of prescription, prescriber signature, frequency of administration, route of administration, indication for given therapy or target for prophylaxis in medical records and presence of microbiological culture before therapy. When the indication was surgical prophylaxis it was specified whether it was single dose or lasting ≤ 24 h or > 24 h.Each prescription was analysed for: legibility and completeness . Each item was classified as compliant when it was filled in and legible; if partially compliant it was classified as non compliant. The total completeness and legibility were calculated considering all the specific items.The Anatomical Therapeutic Chemical (ATC) classification system was used to class the antibiotics.The adopted definition of completeness was "having all necessary parts or components" while the one adopted for legibility stated "easily readable by someone who is not familiar with the context examined".Eight doctors (residents in Hygiene and Preventive Medicine) and 2 pharmacists performed the survey. They gave each patient an identifying code, so that the data collected were anonymous.A meeting was held before starting the survey so that the surveyors could analyse the items on the form and standardize data collection with the aim of reducing the inter operator variability. To this end pairs of surveyors were created to visit each ward, too.This observational study was performed in agreement with the local ethical committee in compliance with the Italian law.Data were processed using the software program SPSS version 12.0. The statistical analysis was performed using the Chi-Square, non parametric k-sample and 2-sample (Mann Whitney) tests assuming as significant a p value ≤ 0.05.Out of 756 patients included in the study, 408 antibiotic prescriptions were found in 298 patients . Overall, 39.4% of patients used antibiotic and 92.7% (38/41) of the Units had at least one patient with antibiotic prescription. Table Antibiotic prescriptions from the medical section were significantly higher than prescriptions from the surgical section (p = 0.019), whereas the mean number of prescriptions per observed patient proved to be significantly higher in intensive care section (p = 0.008) and medical section (p = 0.04) compared to the surgical section.For 165/408 (40.4%) prescriptions the indication was prophylaxis both medical and preoperatory; the remaining 243/408 (59.6%) had a therapeutic indication.Of the 243 therapeutic prescriptions overall 55.6%(135/243) had a previous written request for a microbiological culture without differences among different areas.Written reasons for prescribing antibiotic were found in 58.1%(237/408) of the prescriptions, more frequently for therapeutic indication 166/237 (70%) than for prophylaxis 71/237 (30%); in the remaining cases it was necessary to request information from the medical or nursing staff.In medical section written reasons for using the antibiotic were present in 65.2%(144/221) of prescriptions, in surgical section in 46.2%(60/130) and in intensive care section in 57.9%(33/57) of the cases.Prescriptions for perioperative prophylaxis in the surgical section were for more than 24 hours in 87.7% (79/90) of the cases.To obtain a global view of legibility and completeness in the hospital antibiotic prescriptions we analysed drug name, dose and frequency and route of administration, prescription date and signature classified by section [see Additional file A more detailed analysis showed that the legibility versus illegibility of the drug's name was higher in the medical section than in the other two sections (p = 0.003). Intensive care completeness was significantly higher than the other two as far as dose (p < 0.001), frequency of administration (p = 0.035) and prescription date (p < 0.001) are concerned.In the medical and intensive care sections the route of administration was completed in a significant greater portion of the prescriptions than in the surgical section (p < 0.001 and p < 0.035 respectively). Overall 23.9% of prescriptions were illegible and 29.9% of prescriptions were incomplete.The distribution of legibility and completeness by antibiotic category is shown in additional file The study highlights the need to pay attention to antibiotic prescription writing: in fact 1 in 4 prescriptions were not fully completed or were illegible. We think this is a field that could be improved, particularly for some items, like dosage legibility prescription, date and physician's signature.We found a widespread use of antibiotics: almost all Units (92.7%) on the day of the survey had at least one patient with an antibiotic prescription.This is not unusual in acute care hospitals as reported in other studies.,12 Such Our study focused attention on formal quality characteristics that is part of the medication error risk. Certainly this risk should be evaluated hospital by hospital and, eventually in each department or Unit, possibly adopting proactive methods like the Health Failure Mode Effect Analysis (HFMEA).Nevertheless, we think that data presented in this paper can serve to increase health care workers' awareness of drug use safety, and specifically of written communication, i.e. how to fill in clinical documentation precisely.Monitoring these aspects is quite simple since based on existing clinical documentation. We performed a hospital wide survey but this is not strictly necessary in a routine program since a few cases per Unit would be enough to show attitudes and behaviours of the professional teams.If any hospital quality and safety oriented team would adopt the same methodology it should involve some professionals to read prescriptions: no specific training is required but the recommendation that professionals are different from those of the observed Units.In fact doctors and nurses have to use this information to decide on further clinical actions: if they are not able to find or read and understand written prescriptions, they can immediately realise the risks related to patient safety.Through this methods we can detect also the use of acronyms that we know are a risk factor when different professionals do not share their meaning, or worse, they are misinterpreted..Our data show that Intensive Care Units have some characteristics we should consider:• patients with antibiotic prescriptions and mean number of prescriptions per observed patient are higher than in the other sections because of the expected severity and typology of inpatients;• they show the best performance in terms of completeness in all items, except for the signature of the physician that remains unfulfilled. These data may mirror the fact that the Intensive Care Units are selected settings where the patient safety culture is more widespread because they often have to deal with critical situations like emergencies. The diffusion of risk reduction strategies such as protocols or checklists in these settings have long been appreciated and are more frequently used in these sections.Written reasons for antibiotic prescriptions cover approximately half of the cases (58.1%), more frequently if the indication is therapeutic. Microbiological cultures are requested before starting the therapy in a percentage slightly over the half as well (55.6%). In our opinion both aspects should be improved and they must be part of a wider quality improvement program related to antibiotic use appropriateness.We found that perioperatory prophylaxis lasting > 24 h was high (87.8%) in spite of the international guidelines recommending a short or ultra short first choice prophylaxis, leaving to a limited number of selected patients the possibility to extend it over one day . This fiLegibility and completeness are higher in unusual drugs prescriptions.In general, there are consistent differences in legibility and completeness when different chemical principles are concerned but we cannot compare all these percentages, because, in the case of specific drugs (i.e. Antimycotics for systemic use), we analysed only one hospital and the performance can be influenced by a limited number of Units prescribing that chemical principle.Further important but simple directions that come out as priorities from this survey are the necessity to print prescriptions and the need to record the route, dose and frequency of administration of the drug. The lack of prescription date and doctor's signature were the most critical areas in terms of prescription completeness, both were absent in more than 50% of the prescriptions.We think that a systematic use of feedback together with the adoption of formats where spaces for prescription date, signature of the physician and route of administration are more emphasised would simplify the prescriber's task.It is reported that computerized physician order entry and computerised physician decision support, in fact, significantly reduce prescription errors improving drug safety . NeverthThis study analysed only the legibility and completeness as risk factors for prescription errors but despite this, we think it has an operative relevance and it is essential in improving quality of healthcare and reducing errors.A limit of the study is that only some of the risk factors in prescription writing can be detected through chart review, thus for instance the potential error of omission is an aspect that cannot be detected through this methodology but could be considered for further studies that involve the direct observation of the professionals.The paper addresses an important issue of antibiotic safety that reflects a global problem. In fact this is not only a problem in Italy but also in other hospitals around the world. It would be also interesting to include in a further study numerous hospitals. The magnitude of this problem could be even more severe in the less resourced countries such as Africa and Asia.The findings confirm that there is a problem that needs to be attended to and serve to sensitise stakeholders in health delivery about this issue.The survey confirms the extensive use of antibiotics in an acute care hospital.Written reason for the use of an antibiotic is poor as is the request for microbiological culture in case of therapeutic indication.Overall legibility is good in more than three out of four cases, while completeness is poor mainly concerning the date of prescription and the signature of the physician.The feedback of the objective data to the Units is a great opportunity to improve the awareness of safety and to stress the need for accuracy in prescription writing. As the measurements are objective they can be repeated to monitor trends over time.Since several easily identified risk factors are associated with a large proportion of medication prescribing risk factors, an intervention is needed to enhance the safety culture in all settings by improving clinical documentation and through enhanced the professional awareness of potential medication errors related to bad prescription writing.The authors declare that they have no competing interests.All authors have substantially contributed to the research. Specifically CL, BS conceived the idea for the study, and PA, AL, LC, TMG, participated in its design. All authors were involved in data collection and CL, PA, AL performed the analysis and interpretation of data and the statistical analysis. CL, PA, AL, LC, QR have been involved in drafting the manuscript and BS and TMG critically revised it. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:Legibility and completeness of antibiotic prescription by section (n. 408 prescriptions). the data provided represent the legibility and completeness of antibiotic prescription in the medical section, surgical section and intensive care section.Click here for fileDistribution of legibility and completeness of prescribed drugs for antibiotic category (n. 408 prescriptions). the data provided represent the legibility and completeness of antibiotic prescription related to antibiotic type.Click here for file

Drosophila genomes to study the power of comparative genomics metrics to distinguish between protein-coding and non-coding regions. First, we study the relative power of different comparative metrics and their relationship to single-species metrics. We find that even relatively simple multi-species metrics robustly outperform advanced single-species metrics, especially for shorter exons (≤240 nt), which are common in animal genomes. Moreover, the two capture largely independent features of protein-coding genes, with different sensitivity/specificity trade-offs, such that their combinations lead to even greater discriminatory power. In addition, we study how discovery power scales with the number and phylogenetic distance of the genomes compared. We find that species at a broad range of distances are comparably effective informants for pairwise comparative gene identification, but that these are surpassed by multi-species comparisons at similar evolutionary divergence. In particular, while pairwise discovery power plateaued at larger distances and never outperformed the most advanced single-species metrics, multi-species comparisons continued to benefit even from the most distant species with no apparent saturation. Last, we find that genes in functional categories typically considered fast-evolving can nonetheless be recovered at very high rates using comparative methods. Our results have implications for comparative genomics analyses in any species, including the human.Comparative genomics of multiple related species is a powerful methodology for the discovery of functional genomic elements, and its power should increase with the number of species compared. Here, we use 12 de novo gene predictors and the search for unusual gene structures.Comparing the genomes of related species is a powerful approach to the discovery of functional elements such as protein-coding genes. Theoretically, using more species should lead to more discovery power. Many questions remain, however, surrounding the optimal choice of species to compare and how to best use multi-species alignments. It is even possible that practical limitations in the sequencing, assembly, and alignment of genomes could effectively negate the benefit of using more species. Here, we used 12 complete fly genomes to study a variety of metrics used to identify protein-coding genes, including methods that analyze only the genome of interest and comparative methods that examine evolutionary signatures in genome alignments. We found that species over a surprisingly broad range of phylogenetic distances were effective in comparative analyses, and that discovery power continued to scale with each additional species without apparent saturation. We also examined whether comparative methods systematically miss genes considered fast-evolving, and studied how performance is influenced by genome alignment strategies. Our results can help guide species selection for future comparative studies and provide methodological guidance for a variety of gene identification tasks, including the design of future The recent availability of complete genome sequences from many closely related species has enabled the use of comparative genomics for systematic gene identification. In practice, the discovery power of comparative genomics is intrinsically linked to specific methods for extracting information from from multi-species alignments. Numerous such methods have been developed for gene identification, capturing diverse signals that distinguish protein-coding genes from non-coding regions. These signals are found in the primary sequence of the target genome (e.g. nucleotide frequencies and codon usage biases) and also in the distinctive evolutionary signatures of protein-coding regions (e.g. favoring synonymous vs. non-synonymous substitutions) that only become apparent when informant species are used for comparison.In this paper, we study the discovery power of diverse discriminative metrics that capture comparative genomics as well as single-species evidence. Given a region of the genome and, when available, its alignment across multiple species, discriminative metrics produce a score that indicates how likely the region is to be protein-coding. Similar to previous studies of the performance of single-sequence metrics The goals of our study are twofold. First, we seek to determine the relative power of different metrics, their independence, and the power obtained by combining them. Such metrics can be applied to assess and correct existing gene annotations de novo gene structure predictors with multiple informants led to mixed results Second, we seek to understand how discovery power scales with the phylogenetic distance and number of species compared. On one hand, increasing either distance or number of species should, in principle, provide more signal and therefore increased discovery power Drosophila genomes To address these two goals, we have assembled a large benchmark dataset consisting of tens of thousands of coding and non-coding sequences aligned across twelve recently sequenced We evaluate both well-known methods for gene identification as well as several metrics that we have developed. These metrics are briefly summarized here and in AK/SK ratio Most initial efforts at comparative gene identification used a single informant genome to support the annotation of a target genome dN/dS test observes biases towards synonymous codon substitution using a statistical test based on maximum likelihood phylogenetic algorithms ad hoc strategies to efficiently combine their respective pairwise scores; lastly, a baseline multi-species sequence conservation metric measures the largest fraction of species having the same nucleotide in each column , averaged across the alignment.We also selected several metrics that use multi-species alignments: the k-mers in coding sequences, simultaneously for several different k-mer sizes k-mer frequencies using a discriminative approach based on Fisher linear discriminant analysis We also included several single-sequence metrics in our benchmarks to compare them to the comparative methods. Since previous studies have benchmarked many single-sequence metrics extensively Drosophila melanogaster, and 39,181 random intergenic regions with the same length and strand distribution in the fruit fly tion see . These pspecificity as it is defined in binary classification problems: the fraction of true negatives that are correctly classified as negative. This differs from the common usage of the term in the gene prediction field to refer to the fraction of the examples classified as positive that are true positives. Additionally, we use the term false positive rate to mean 1-Specificity, or the fraction of true negatives incorrectly classified as positive.)For each metric, we scored all the 49,903 regions in our test set and then measured its ability to correctly classify them as coding or non-coding. We used four-fold cross-validation to train and apply the metrics that require training data. We evaluated the performance of each metric by examining receiver-operator characteristic (ROC) curves showing its sensitivity and specificity at different score cutoffs. is the average of the false negative rate and the false positive rate at the cutoff where this average is minimized; intuitively, this is the “elbow” of the ROC curve. This represents the fraction of examples that are incorrectly classified (if the positive and negative classes are the same size), at a single point on the ROC curve.The area above the curve (AAC) is the area lying above the ROC curve in the unit square. Although it lacks a simple interpretation, the AAC summarizes more information about classification performance over all sensitivity/specificity regimes, providing a measure complementary to MAE.The dN/dS test vs. 0.065 for Z curve). Different metrics were preferable at different sensitivity/specificity tradeoffs. For example, the CSF and dN/dS metrics achieved the highest specificity (99.9% for CSF) even at fairly high sensitivities (85.2%). RFC tended towards higher sensitivity and lower specificity than CSF and dN/dS.We first compared the overall performance of the metrics . All of D. ananassae; we investigate different pairwise informants below), and found similar trends according to MAE and AAC error, and they exhibited generally lower sensitivity. CSF and AK/SK were, however, able to achieve higher specificity at a moderate sensitivity tradeoff. For example, at 80% sensitivity, CSF had a nearly ten-fold lower false positive rate than Z curve (0.15% and 1.39%); the specificity of CSF exceeded Z curve at less than 85% sensitivity, compared to 93% sensitivity at Z curve's MAE point.We also compared the pairwise metrics, using the best pairwise informant (r trends . For exadN/dS test and 0.056 MAE for Z curve). In the shorter length range of 121–180 nt, the best comparative metric resulted in 60% lower error than the best single-sequence metric (0.029 MAE for CSF and 0.073 MAE for Z curve). Different comparative methods were also preferred at different lengths. For example, CSF strongly outperformed the dN/dS test on the shortest sequences (≤60 nt), while they performed comparably on longer sequences.We next assessed each metric's discriminatory power for different sequence length categories . All of While each of the metrics we studied exhibited unique performance characteristics, some measure similar fundamental lines of evidence, and thus may tend to err on the same examples. We investigated the independence of the metrics, indicated by how differently they rank the exons in our test set, using a dimensionality reduction technique called multidimensional scaling MDS; see . This andN/dS test and CSF behaved very similarly, while RFC was clearly distinct. The sequence conservation metric was separate from each of these, while TBLASTX clustered with CSF and dN/dS. The four single-sequence metrics formed two additional clusters distinct from the comparative metrics. These findings agree with intuition: CSF and the dN/dS test both observe the distinctive biases in codon substitutions in protein-coding sequences, while RFC observes patterns of insertions and deletions that are essentially orthogonal to codon substitutions, and the single-sequence metrics observe compositional biases and periodicities that are ignored by the comparative metrics.We found that the dN/dS test remain the methods of choice for the highest specificity, the hybrid metrics achieved higher overall performance.The relative independence of several of the metrics suggests that combining them could lead to higher performance. We selected five metrics representing each of the MDS clusters and combined them using cross-validated linear discriminant analysis (LDA). As expected, the hybrid metric outperformed any of its inputs: by MAE error, the LDA hybrid resulted in 27% lower error than its best input metric (0.040 MAE for LDA vs. 0.055 for CSF). The hybrid metric demonstrated much higher sensitivity than any of its input metrics , and higWe next investigated how strongly the performance of the comparative methods depends on genome sequence alignments. We compared the above results, based on MULTIZ local similarity-based alignments, with the corresponding results based on the synteny-anchored Mercator/MAVID alignments. Overall, the two alignments led to highly concordant results, with similar trends in the performance of the metrics relative to each other and across different sequence lengths. There were, however, some notable differences in their absolute levels of performance.We expected the local alignment approach to give higher sensitivity than the synteny-anchored alignments, since it should be better able to align exons that have undergone rearrangements Overall, the Mercator/MAVID alignments led to somewhat lower sensitivity without a clear specificity advantage, and this was reflected in worse MAE and AAC error statistics . We therD. melanogaster. We applied each metric to pairwise alignments of D. melanogaster with D. erecta, D. ananassae, D. pseudoobscura, D. willistoni, and D. grimshawi, each representing various clades within the genus Drosophila make effective pairwise informants for gene identification in D. melanogaster, while the mosquito and honeybee, the next most closely related species with fully sequenced genomes, are likely to be too distant for this application. These findings are consistent with a previous smaller-scale study of comparative gene identification power in flies We conclude that a broad range of species within the genus Drosophila (see phylogeny in melanogaster subgroup (5 species including D. melanogaster), the melanogaster group (6 species), the melanogaster and obscura groups (8 species), the subgenus Sophophora (9 species), and finally all 12 species of the genus Drosophila.We next investigated the effectiveness of increasing numbers of informant species on the metrics that can use multiple informants. We evaluated each metric using subsets of the available species corresponding to increasingly broad clades within the genus Drosophila informants led to similar or slightly worse performance than closer species, adding informants at increasing distances led to a clear trend in higher classification performance. The dN/dS test, RFC, and the sequence conservation metric each showed a smooth progression of increasing performance with each successively larger group of informant species. For example, starting from the four informants within the melanogaster subgroup, the dN/dS test achieved an MAE of 0.103. With the addition of each successive group of informants, the MAE was reduced relatively by 35%, 43%, 48%, and finally by 52%. CSF showed a similar trend through the subgenus Sophophora, but did not clearly benefit from the subsequent addition of the final three informants of subgenus Drosophila. In all cases, the improvement with multiple species was most pronounced for short exons , and RFC, using its simplistic vote-tallying scheme, with all twelve species (4.1 sub/site). The baseline sequence conservation metric never outperformed Z curve, although its performance also increased with additional species. With a sufficient number of informants, the multi-species metrics surpassed single-sequence metrics according to MAE . This almelanogaster subgroup together yielded worse performance than pairwise analysis with the best pairwise informant, D. ananassae. In contrast, all of the informant clades that combined D. ananassae with more distant species led to better performance than any pairwise analysis. This affirms our earlier conclusion, based on a pairwise analysis with D. erecta, that the species within the melanogaster subgroup are sub-optimal informants for the metrics we studied, presumably because they are too closely related to D. melanogaster. Indeed, the neutral distance of D. ananassae from D. melanogaster is 1.0 substitutions per neutral site, while the total independent branch length provided by the four melanogaster subgroup informants is only 0.4 sub/site.In most cases, the four informants of the It is well-known that genes in certain categories of biological function tend to be faster-evolving We found that all of the functional categories we investigated had very high detection rates . For exaInstead, comparative metrics had the most difficulty detecting genes of unknown function. Three GO terms indicating unknown function had only 67%, 61%, and 60% detected genes. In fact, of the genes that were not detected at this cutoff, 85% were of unknown function or lacked any GO term, compared to 49% of all the genes in our dataset. These trends held for all of the comparative metrics and cutoffs we investigated .Overall, these results indicate that comparative methods using the twelve fly genomes were able to detect the vast majority of genes in all of the functional categories we investigated . They had much greater difficulty detecting genes of unknown function, which may be under less selective constraint overall Drosophila are comparably effective pairwise informants for D. melanogaster, in agreement with theoretical predictions. We showed that adding more species to comparative analysis progressively increased genome-wide discovery power, for a variety of different methods. Contrary to expectation, we found no evidence that synteny-anchored alignments lead to appreciably higher specificity, and no evidence that comparative methods systematically fail to detect genes in functional categories typically considered fast-evolving.In this paper, we investigated discriminative metrics for distinguishing protein-coding sequences from non-coding sequences. We found that multi-species comparative methods outperform single-sequence metrics, particularly on short sequences (≤240 nt). On the other hand, the pairwise comparative methods we studied achieved higher specificity, but did not outperform advanced single-sequence metrics overall. We showed that several comparative and single-sequence metrics can be combined into a more powerful hybrid metric. We found that a broad range of species within the genus dN/dS test, and RFC; excluding the baseline sequence conservation metric), none strictly outperformed the others. RFC tended towards lower specificity but higher sensitivity than CSF and the dN/dS test. CSF was more effective than the dN/dS test on the shortest exons, but they performed comparably overall, and both achieved near-perfect specificity at moderate sensitivity tradeoffs. We developed CSF as a simpler alternative to the computationally expensive phylogenetic algorithms upon which the dN/dS test is based, and we consider it successful in this respect, considering its comparable results and its much faster total compute time .Among the three multi-species comparative metrics we studied and towards more distant species (between D. grimshawi and A. gambiae), but these distances were not explored in the currently sequenced genomes. This range is comparable to the distance from human of the opossum (0.8 sub/site), chicken (1.1 sub/site), and lizard (1.3 sub/site), suggesting that species more distant than the eutherian mammals and sequence alignments generated by MAVID http://rana.lbl.gov/drosophila/wiki/index.php/Alignment.We used “Comparative Analysis Freeze 1” assemblies of the twelve We obtained FlyBase release 4.3 annotations from the following web site:ftp://ftp.flybase.net/genomes/Drosophila_melanogaster/dmel_r4.3_20060303/gff/.D. melanogaster and community annotations for the 11 other species We estimated branch lengths in the phylogenetic tree for the flies shown in based onWe randomly sampled 2,734 of the 13,733 euchromatic genes in FlyBase annotation release 4.3, and then selected all 10,722 non-overlapping exons of all transcripts of those genes. We chose this strategy of randomly sampling genes and selecting all exons of those genes, rather than directly sampling exons, to facilitate studying how the power of each metric varies across different functional categories of genes. Although not by design, the length distribution of sequences in our test set is very similar to the length distribution of exons in the genome . Each known exon was evaluated in its annotated reading frame.D. melanogaster euchromatic chromosome arms, and ensuring that the resulting region did not overlap an annotated coding exon. We also chose only regions consisting of at least 50% nucleotide characters (as opposed to Ns). The codon reading frame for the non-coding regions was always set arbitrarily to 0 . We removed in-frame stop codons in D. melanogaster from the non-coding regions (the length of each control region matched the corresponding exon after removing stop codons). All the regions in the dataset were selected without regard to how well they were aligned in either genome alignment set we used.For each known exon in our dataset, we selected four non-coding regions of the same length and strand. We selected each of these regions by randomly choosing a start coordinate in the BDGP Release 4 assembly of the The coordinates, sequences, and alignments of our dataset are available for download .CSF and the single-sequence metrics (except for Fourier transform) require training to estimate parameters. To avoid overfitting, we trained and applied them using four-fold cross validation: we randomly partitioned the dataset into four subsets, and then generated scores for each subset by training on the other three subsets. We then combined the scores for the subsets to obtain scores for the entire dataset. We applied the other metrics directly to each sequence.We computed ROC curves for each metric by choosing 250 cutoffs representing quantiles of the score distribution over the entire dataset, and at each cutoff, evaluating sensitivity and specificity when sequences scoring above the cutoff are considered positively classified, and sequences scoring less than or equal to the cutoff are negatively classified. Some metrics failed to produce a score for some sequences; for example, comparative metrics produced no score for sequences in which no alignment was present. These sequences were regarded as negatively classified at all cutoffs, reflecting a non-coding default hypothesis. Our ROC curves may therefore underestimate the sensitivity or overestimate the specificity that each comparative method would exhibit if given perfect alignments of all orthologous elements.We computed the MAE as the highest average sensitivity and specificity among the 250 points on the ROC curve, and the AAC by trapezoidal integration over these points.AK/SK, we used the method of Nei and Gojobori D. melanogaster and the informant.To estimate Drosophila species. We obtained these genome assemblies We used the blastall program in NCBI BLAST 2.2.15 dN/dS test by using PAML 3.14 dN/dS = 1 or dN/dS estimated by maximum likelihood. Each multiple sequence alignment was pre-processed to make it acceptable to PAML as follows: gaps in the D. melanogaster sequence were removed, ends were trimmed so that the sequence only contains complete codons, and in-frame stop codons were changed to gaps in the informant sequences. Additionally, rows (informant species) with more than 50% gapped positions were removed, to reduce the computational cost of marginalizing over such heavily gapped rows.We carried out the PAML was then run twice on each alignment, once with fix_omega = 1 and once with fix_omega = 0. The other paramaters, common to both runs, were runmode = 0, seqtype = 1, CodonFreq = 2, model = 0. The tree was specified as shown in melanogaster subgroup informants.For practical reasons, PAML was not allowed to run for more than one hour on any individual alignment. Cases in which PAML exceeded this time limit, where no informant sequences remained after preprocessing, or otherwise failed were regarded as negatively classified at all cutoffs. This occurred in only 70 of 49,903 cases with 12 flies and 242 of 49,903 cases with the A and B, where kA is the target codon that aligns to the informant codon kB at position k in the target codon sequence (position 3k in the in-frame target nucleotide sequence). CSF assigns a score to each codon position k where: (1) kA and kB are both un-gapped triplets, (2) kA is not a stop codon, and (3) kA≠kB. CSF then sums these scores to obtain an overall score for the sequence.The CSF metric is based on estimates of the frequencies at which all pairs of codons are substituted between genes in the target species and the informants a,b) is a log-likelihood ratio indicating how much more frequently that substitution occurs in coding regions than in non-coding regions. Each likelihood compared in this ratio is derived from a Codon Substitution Matrix (CSM), whereThe score assigned to a codon substitution (CCSM) and one for which the training data is alignments of random non-coding regions (NCSM). The score that CSF assigns a codon substitution is thenThe entries of the CSM are estimated for each target and informant by counting aligned codon pairs in training data, and then normalizing the rows to obtain the desired conditional probabilities. We train two CSMs, one for which the training data is alignments of known protein-coding genes , a pairwise score between the target and each informant wass computed as the percentage of target nucleotides that aligned in the same reading frame in the informant (taking the largest such percentage out of the three possible reading frame offsets). With multiple informant species, each species votes +1, −1, or 0 based on a species-specific cutoff on the pairwise RFC score: +1 if the score is above, −1 if the score is below, or 0 if there was no sequence aligned. These votes are then summed to obtain an overall score for the region. The cutoff for each species is chosen by examining the typically bimodal distribution of the score between known coding and non-coding regions, and usually ranges between 70% and 80%.We applied the RFC metric exactly as previously described The pairwise sequence conservation metric is simply the percent identity between the target and informant sequences (as a fraction of the target sequence length). For multiple alignments, we assigned a score to each target nucleotide column corresponding to the largest fraction of species having the same nucleotide in that column , and averaged these scores across the columns of the alignment.The Fourier transform metric is an aggregate measure of the three-base periodicities of each nucleotide character in coding sequences For each nucleotide, a three-base periodicity is then calculated by computing the magnitude of the discrete Fourier transform (DFT) of its indicator sequence at 1/3 frequency, e.g.The overall score of the sequence is then computed by summing the contribution of each nucleotide periodicity normalized by the length of the sequence,We found that the discriminative performance of this metric is identical to that obtained by computing the signal-to-noise ratio of the 1/3 frequency component of the DFT ia be the amino acid translation of codon i. The metric utilizes codon usage vectors C and N for coding and non-coding sequences, where iC is the likelihood of codon i conditional on amino acid ia in coding regions, and iN is the corresponding likelihood for non-coding regions. iC is estimated from training data by determining the ratio of the number of times codon i occurs in-frame to the total number of times amino acid ia occurs in-frame; iN is estimated similarly with an arbitrary frame. To evaluate a given sequence, a total log-likelihood ratio LLR is computed by summing i in the sequence. LLR is positive if the codon bias in the given sequence is more similar to the coding regions in the training set than to the non-coding regions, and negative otherwise.Let depth = 6. We found a choice of width = 6 improved discrimination over the default setting. The coding ICM was trained with the default period = 3 while the non-coding model was constrained to period = 1. In the testing step, the coding and non-coding ICMs were used to score the sequences using the glimmer3 program with the linear and multifasta options. The ICM metric score was computed as the log-ratio of the coding and non-coding likelihoods.We used Glimmer 3.02 The Z curve score for a sequence of DNA is a linear combination of 189 frame-specific mono-, di-, and tri-nucleotide occurrence frequencies We created hybrid metrics by combining the pre-computed scores of the input metrics using linear discriminant analysis (LDA) and a support vector machine (SVM). In both cases, prior to combination, the scores of each input metric were normalized to have zero mean and unit variance across the entire dataset. The normalized scores from each input metric were then used as feature vectors representing each sequence in the dataset.light 4.00 We trained and applied the hybrid metrics using four-fold cross-validation. We applied LDA with default settings in MATLAB. For SVM, we used SVMS = cor, where iR is the vector of ranks of the known exons according to the scores computed by metric i. For example, if the known exons are ordered in some way E1, E2, E3, and metric i assigns them scores iM = , then iR = Multidimensional scaling (MDS) takes a high-dimensional matrix of pairwise similarities between items , and assigns each item to a point in a low-dimensional space , such that the distance between any two points approximately represents the dissimilarity of the corresponding items. We applied MDS to generate the visualization in Figure S1D. ananassae as the informant species. Pairwise comparisons using the metrics we studied did not in general outperform the best single sequence metric (Z curve), although CSF and KA/KS achieve higher specificity.Comparison of pairwise comparative metrics with (0.17 MB PDF)Click here for additional data file.Figure S2D. melanogaster nucleotides were aligned to an informant nucleotide (as opposed to gaps). The total branch lengths for the species aligning to each region were computed by taking the corresponding subtree of the neutral tree shown in Comparison of alignment depth provided by MULTIZ and Mercator/MAVID alignments. Shown on each plot is the cumulative proportion of regions in our dataset that have a certain number of species aligned (top) and the total branch length of those species (bottom), in the MULTIZ (red) or Mercator/MAVID (blue) alignments. For each region, an informant species was considered to align if at least 50% of the (0.23 MB PDF)Click here for additional data file.Figure S3Comparison of discovery power provided by MULTIZ and Mercator/MAVID alignments. (Top) The MULTIZ alignments lead to higher sensitivity than the Mercator/MAVID alignments. The Mercator/MAVID alignments can lead to slightly higher specificity, but only at low sensitivities (<60%). (Bottom) The two alignments overall lead to concordant sets of detected exons, with >93% of exons detected in either alignment detected in both alignments. Although the MULTIZ alignments have higher overall sensitivity, the Mercator/MAVID alignments do uniquely allow the detection of ∼1.5% of exons. (0.31 MB PDF)Click here for additional data file.Figure S4Pairwise discovery power for RFC with different informants. More closely related species tend to yield higher sensitivity, while more distant species yield higher specificity.(0.15 MB PDF)Click here for additional data file.Table S1Gene detection rates within Gene Ontology (GO) categories. Each entry shows the percentage of genes with at least one exon detected at a fixed exon sensitivity cutoff for each metric.(0.08 MB XLS)Click here for additional data file.Text S1Information about access to test dataset coordinates, sequences, and alignments, and metric score data.(0.03 MB DOC)Click here for additional data file.

A similar increase in cell adhesion/migration is observed in cells with reduced levels of BIG1 or other H3K4MT subunits. Third, knockdown of mDpy-30, BIG1, or the RbBP5 H3K4MT subunit increases the targeting of β1 integrin to cell protrusions, and suppression of H3K4MT activity by depleting mDpy-30 or RbBP5 leads to increased protein and mRNA levels of β1 integrin. Moreover, stimulation of cell adhesion/migration via mDpy-30 knockdown is abolished after treating cells with a function-blocking antibody to β1 integrin. Taken together, these data indicate that mDpy-30 and its interacting proteins function as a novel class of cellular adhesion/migration modulators partially by affecting the subcellular distribution of endosomal compartments as well as the expression of key adhesion/migration proteins such as β1 integrin.We have previously shown that a subset of mDpy-30, an accessory subunit of the nuclear histone H3 lysine 4 methyltransferase (H3K4MT) complex, also localizes at the trans-Golgi network (TGN), where its recruitment is mediated by the TGN-localized ARF guanine nucleotide exchange factor (ArfGEF) BIG1. Depletion of mDpy-30 inhibits the endosome-to-TGN transport of internalized CIMPR receptors and concurrently promotes their accumulation at the cell protrusion. These observations suggest mDpy-30 may play a novel role at the crossroads of endosomal trafficking, nuclear transcription and adhesion/migration. Here we provide novel mechanistic and functional insight into this association. First, we demonstrate a direct interaction between mDpy-30 and BIG1 and locate the binding region in the N-terminus of BIG1. Second, we provide evidence that the depletion or overexpression of mDpy-30 enhances or inhibits cellular adhesion/migration of glioma cells Covalent modifications of histones are crucial for the modulation of chromatin structure and function. One form of histone modification is the methylation of histone H3 lysine 4 residues (H3K4), which is enriched near the transcription start sites of actively transcribed genes in both yeast and mammals (1). H3K4 methyltransferases (H3K4MT) methylate H3K4, and the majority of mammalian H3K4MTs consist of one catalytic subunit and several common accessory subunits, including Ash2L, RbBP5, WDR5, and mDpy-30 C. elegansOur group has recently shown that a pool of mDpy-30, a protein originally identified as an essential component of the dosage compensation machinery in For the characterization of siRNAs and lentiviral expression constructs, see the supplementary information , S2, S3.in vitro. Consistent with the above analysis, we detected direct binding between mDpy-30 and the BIG1 N-terminal fragment spanning the DCB, HUS and Sec7 domains (residues 2–888)), but not between mDpy-30 and the Sec7 domain (residues 700–888) or DCB domain (residues 2–244) alone (We have shown that BIG1 recruits mDpy-30 to the TGN 4) alone .The crystal structure of the C-terminus of mDpy-30 shows that it forms a dimer with a topology reminiscent of the dimerization and docking (DD) domains of the regulatory subunits of PKA To further confirm the essential role of AKAP sequence in the binding between BIG1 and mDpy-30, we investigated whether the expression of a GFP-AKAP affected the BIG1/mDpy-30 association. Indeed, the expression of this fusion in HeLa cells prevented co-immunoprecipitation of BIG1 with mDpy-30 . As a coWe conclude from this ensemble of experiments that the N-terminus of BIG1 binds directly to mDpy-30. The AKAP sequence of BIG1 is critical for this interaction, but the association between BIG1 and mDpy-30 is likely further strengthened by the presence of an integral DCB/HUS dimerization region of BIG1 that encompasses the putative AKAP sequence. This conclusion is consistent with the observation, based on the published crystal structure Using the EGFP fusions of various Rab proteins, we previously reported that Rab11 and Rab4 become enriched near cell protrusions after the depletion of mDpy-30 To test whether mDpy-30 depletion indeed causes CIMPR to be targeted to a recycling compartment at the protrusions, we conducted a colocalization study between internalized CD8-CIMPR and Rab4 or Rab11 in HeLa cells depleted of mDpy-30. Due to the background associated with the Rab antibodies as well as their overall weak staining, we instead expressed the EGFP fusion of Rab4b and Rab11. As shown in Since the formation of cell protrusions is the first step towards migration, we wondered whether mDpy-30 also regulates the subcellular distribution of integrins, a protein family that plays a key role in cell adhesion/migration. To test this possibility, we examined the impact of depleting mDpy-30 on the trafficking of β1 integrin, which is widely expressed and has the capacity to control cell adhesion/migration on many extracellular matrix (ECM) substrates by forming a functional heterodimer with multiple α integrins There are at least two possible explanations for the above observations. The first is that the depletion of mDpy-30 causes a change in the trafficking of β1 integrin, either through redirection to a new compartment, or through redistribution along the normal pathway. The second is that mDpy-30 knockdown changes the location of the trafficking compartments themselves, without altering β1 integrin trafficking. In order to distinguish between these two possibilities we performed a quantitative colocalization analysis between internalized β1 integrin and EGFP-Rab4b or EGFP-Rab11. This investigation revealed that internalized β1 integrin displayed significant colocalization with EGFP-Rab11, and to a slightly lesser extent with EGFP-Rab4b, both of which was not affected by mDpy-30 knockdown . When coWe next assessed whether the population of internalized β1 integrin which accumulated at the protrusions of mDpy-30 knockdown cells represented activated β1 integrin, a form of β1 integrin with higher ligand binding activity Polarized trafficking of integrins has been known to mediate cell adhesion/migration Since productive cell migration requires an optimal level of adhesion, these observations indicate that mDpy-30 plays either an inhibitory or stimulatory role in the migratory pathway. To address this question, we investigated how different levels of mDpy-30 expression impacted the ability of U251 cells to migrate across a polycarbonate membrane insert towards chemoattractants present in serum. Based on the result of a pilot time-course experiment , we chosTo gain insight into which subset of mDpy-30 (nuclear or cytoplasmic) modulates cell trafficking/adhesion/migration, we conducted expression studies on two of its differently localized interacting proteins. In one experiment, we assessed the role of BIG1, which recruits mDpy-30 to the TGN. Mimicking our observations from when mDpy-30 siRNAs were used, knockdown of BIG1 caused an accumulation of internalized CD8-CIMPR and β1 iGiven the well established function of the H3K4MT complex in transcription, we then explored whether mDpy-30 and its nuclear interacting proteins modulate the expression of the β1 integrin gene. Indeed, overexpression of mDpy-30 caused the level of β1 integrin protein to decrease . On the The above studies suggest that mDpy-30 and its interacting proteins modulate the subcellular distribution and expression of β1 integrin, as well as cell adhesion/migration. To investigate whether the altered spatial distribution and expression of β1 integrin might contribute to the enhanced adhesion/migration, we assessed the influence of mDpy-30 knockdown on the adhesion in the presence of a functional blocking antibody of β1 integrin Several implications become apparent through our studies. To begin, we have seen that mDpy-30 and its interacting partners can affect cell adhesion/migration, behaviors which are important for numerous physiological and pathological conditions. With this in mind, mDpy-30 and its associated proteins may regulate these processes by controlling the endosomal recycling and expression of key adhesion/migration proteins such as β1 integrin, thus presenting new pharmacological targets. In this regard, recent evidence suggests that CIMPR, the molecule which we have previously shown to be regulated by mDpy-30, might also have a role in cell migration CACCAAATCCCATTGAATT, siRNA2: AAACGCAGGTTGCAGAAAA; QIAGEN), mDpy-30 siRNA3-4 , RbBP5 siRNA1-2 , BIG1 siRNA1-2 , Rab4A siRNA , Rab4B siRNA , Rab11A siRNA , Rab11B siRNA . The non-targeting control siRNAs were obtained from QIAGEN (AllStars Negative Control siRNA) or Dharmacon (On-Target Plus siRNA Control).For lentivirus-mediated overexpression of mDpy-30, mDpy-30 cDNA was cloned into pWPI (Addgene). For the EGFP fusions of Rab4b and Rab11, Rab4b and Rab11 cDNAs were cloned into pEGFPC2 (Clontech). The antibodies used in this study are: rabbit anti-BIG2 (Dr. C. Jackson), mouse anti-HA , rabbit anti-HA(ICL), mouse anti-CD8 (Chemicon), rabbit anti-VPS26 (Abcam), mouse anti-CIMPR (BioLegend), mouse anti-β1 integrin , mouse anti-activated β1 integrin , rabbit anti-Rab4 (Abcam), and rabbit anti-Rab11 (Invitrogen). Alexa 488-conjugated Phalloidin was used to stain F-actin . The small interference RNAs (siRNAs) used in this study are: mDpy-30 siRNA1-2 were cultured in Advanced D-MEM medium (GIBCO) supplemented with 4% fetal bovine serum, 2 mM glutamine and 1X penicillin-streptomycin (Cellgro). The same medium was used to grow HeLa cells infected with lentiviral particles and HeLa CD8-CIMPR or stable cell lines except that puromycin (3 µg/ml) and G418 (100 µg/ml) were added, respectively, for maintenance purposes. When needed, cells were transfected with DNA using FuGENE HD (Roche) or siRNA using Lipofectamine RNAiMAX (Invitrogen), and the effects of transfection were investigated 24 (for DNA) or 48 hr (for siRNA) after the transfection, respectively. All siRNAs were used at a concentration of 20 nM.2HPO4, 7.11≤pH≤7.13) was added into the mix dropwise under agitation by vortexing to allow precipitation (5 min at room temperature). 2.25 ml of the precipitate was then added dropwise into the cells while mixing gently by rotating the plate. After the medium was replaced with fresh pre-heated medium 14–16 hr post-transfection, supernatant was harvested 3 times every 12 hr and kept at 4°C over the collection period. Finally, the collected supernatants were pooled, centrifuged for 5 min at 1500 rpm, filtered with a 0.22 µm filter, and stored at −80°C in aliquots. To infect cells, U251 were trypsinized, resuspended in the medium containing polybrene , and allowed to attach to the dish at a confluence of 60–80%. The medium was then removed and kept aside and the virus stock was added with appropriate amount of fresh medium if needed. After letting the virus adsorb for 30–60 min, the medium containing polybrene was added back to the cells. Infected cells were then split and maintained in regular medium until use.HEK293T cells were maintained in DMEM medium containing 10% fetal bovine serum and 1X penicillin-streptomycin (Cellgro) until they reached 70% confluence. Two hours before transfection, the medium was replaced with fresh medium preheated at 37°C. For transfection of cells grown on one 15 cm dish, pMD2G , psPAX2 , and either pWPI or pWPI-mDpy-30 were mixed in a 50 ml conical tune, followed by the addition of 0.1X TE , water (350 µl), and 2.5 M calcium chloride (113 µl). After briefly mixing, 1140 µl of 2XHBS and 1 mM PMSF, and cleared by centrifugation at 4°C. Cell lysates were quantified using the Non-interfering Protein Assay Kit following the manufacturer's instruction (G-Biosciences) and then denatured in SDS-PAGE loading buffer. An equal amount of total protein per sample was then loaded into each well, separated by SDS-PAGE electrophoresis and transferred to Immobilon 0.45 µM PVDF membranes (Millipore) using a Semi Dry Electroblotting System (Owl). Membranes were incubated with appropriate primary antibody for 1 hr in 1∶1 mixture of Odyssey blocking buffer (Odyssey) and PBS supplemented with 0.1% Tween-20, washed with PBS supplemented with 0.1% Tween-20 (three times for 5 min each), incubated with appropriate secondary antibody (Odyssey) for 30 min in 1∶1 mixture of Odyssey blocking buffer and PBS supplemented with 0.1% Tween-20 and 0.01% SDS, washed again with PBS supplemented with 0.1% Tween-20 (three times for 5 min each) followed with PBS for 5 min, and dried in the dark. Fluorescence quantification was performed on an Odyssey Infrared Imaging System. The same procedure is used for the analysis of histones except that histones were prepared from cells with a Histone Preparation Mini Kit (Active Motif).Transfected cells were solubilized in ice-cold NP-40 lysis buffer and cleared by centrifugation at 4°C. After incubating the supernatant with a primary antibody for overnight followed by protein G-Sepharose (Invitrogen) for 4 hr at 4°C, immunoprecipitates were collected by brief centrifugation. The sepharose beads were washed four times in ice-cold lysis buffer and the bound proteins were eluted with SDS-PAGE sample buffer at 90°C for 10 min.E. coli and purified to homogeneity by glutathione affinity followed by size exclusion chromatography . DCB-HUS-Sec7 from human BIG1 (a.a. 2-888) was expressed in baculovirus-infected Sf21 cells as described E. coli and purified to homogeneity as previously described GST-mDpy-30 was expressed in E. coli strain BL21 for expressing the corresponding GST-BIG1 fusion proteins. Purification of fusion proteins was carried out using a GST-Bind Kit(Novagen) and the amount of proteins bound to resins were determined using SDS-PAGE and Coomassie staining after elution. For pull-down, resins were mixed with an equal amount of HeLa crude cell lysates and the amount of mDpy-30 pulled down was assessed using western blot analyses.BIG1 fragments were PCR amplified and cloned into pGEX4T2 (Pharmacia). The plasmids were utilized to transform an Cells or transfected cells were fixed , permeabilized , blocked (in Blocker Casein in PBS (Pierce) containing 5% goat serum, 20 min), incubated with primary antibody in the blocking buffer (2 hr), washed , incubated with fluorophore-conjugated secondary antibody in the blocking buffer (1 hr), washed , incubated in PBS containing 1 ug/ml 4′,6-diamidino-2-phenylindole , and washed . Immunostained cells were allowed to air dry, mounted, and examined with Olympus IX-81 microscope.For the kinetics analysis, HeLa-CD8-CIMPR or HeLa cells were blocked and incubated with anti-CD8 or anti-β1 integrin antibody at 0°C to label the surface proteins. After wash, cells were transferred into pre-warmed (37°C) culture medium to allow internalization to proceed for indicated periods of time. For the steady-state analysis, anti-CD8, anti-β1 integrin or anti-CIMPR antibody was added to the culture medium for 45 min at 37°C before fixation to enhance the internalization signal by allowing continuous labeling and internalization. In instances when an acid wash was conducted to remove surface-bound antibody, labeled cells were incubated in ice-cold stripping buffer for 2–3 mins at 0°C, followed by several washes with ice-cold PBS before fixation.SlowFade Gold antifade reagent (Invitrogen). Our secondary antibodies were conjugated to either Alexa488 or Rhodamine Red-X . A MediaCybernetics Evolution QEi monochrome digital camera mounted to the Olympus microscope and the InVivo acquisition software version 3.2.0 (MediaCybernetics) were used to capture images and analyze the microscope images. Finally, to crop the images for publication we used Adobe Photoshop and Illustrator software packages.An Olympus IX-81 microscope with a PlanApo 60x oil TIRFM objective (1.45 aperture) was used in the epi-fluorescence studies. All microscopy was performed at room temperature. Slides were mounted in Images of the cells were captured with an Olympus Fluoview 500 Laser Scanning Confocal Microscope with a 40X Planapochromat lens, N.A. 1.3. Two laser lines were used, at 488 nm and 543 nm to excite the fluorochromes. Sequential color images capture was used to collect images. To record the distribution of label from apical to basal portions of the cell, z-series were captured of the cells at 0.5 micron steps. Data analysis was performed using Image Pro 6.3.560 nm was measured.The experiment was conducted on an ECM array (Cell Biolabs) or BIOCOAT cellware (BD) 48-well plates using a colorimetric assay. In brief, cells grown in normal culture medium were dissociated using TrpLE (GIBCO) or Cellstripper (Cellgro), washed once with serum-free Advanced D-MEM medium (GIBCO), re-suspended in the same medium, and finally counted with a hemocytometer. Approximately 100,000 cells were added into each well and allowed to adhere for 45 min at 37°C. After aspirating the medium from each well, cells were washed 5 times with PBS to remove unattached cells and incubated with Cell Stain Solution for 10 min. Following the removal of Cell Stain Solution, cells in each well were again washed 5 times with water and allowed to dry in air. Extraction Solution was then added into each well and the plate was placed on an orbital shaker for 10 min. Finally, Extraction Solution was transferred to a new tube and the ODThe experiment was carried out with a Cell Migration Kit (Cell Biolabs). In brief, cells were dissociated, counted, and re-suspended as described above. Approximately 200,000 cells in serum free medium were added into the top chamber of each well, and serum containing medium was added to the lower chamber. Cells were then incubated at 37°C to allow them to migrate across the 8 µm porous membrane towards the lower chamber. After various periods of time, the serum free medium was aspirated from the inside of the insert and the non-migratory cells on the interior of the insert were removed by wet cotton-tipped swabs. The insert was transferred to a clean well containing Cell Stain Solution for 10 min and washed three times in water. After allowing the insert to air dry, the migratory cells were counted under a microscope. The haptotaxis assay was carried out using a CyotoSelect Cell Haptotaxis Assay kit (Cell Biolabs) with a Collagen I coated membrane. The experiment was performed as described above.Total RNA from cells treated with a non-targeting control, or the appropriate siRNA were isolated using an RNeasy Plus Mini Kit (QIAGEN) and quantified with a nanodrop spectrophotometer (Thermo Scientific). cDNA was synthesized by reverse-transcription using the iScript-Select cDNA Synthesis Kit (Bio-Rad) with a nonspecific oligo (dT) primer and qPCR was performed in triplicate for each sample using the iCycler iQ Real-Time PCR System (Bio-Rad). Approximately 100 bp of the cDNA of choice were amplified using two independent sets of primers targeting distinct areas of the mRNA. Fluorescein was included in each reaction to provide a background baseline. Four sets of primers targeting the cDNA sequences of several “house-keeping” gene products were included to determine whether the effects seen were specific to β1 integrin. They are as follows: GAPDH, GPI (3′), HMBS and HPRT1.Figure S1Characterization of siRNAs against mDpy-30 and RbBP5 in U251 cells. We have previously characterized these siRNAs in HeLa cells using western blot analyses and immunofluorescence assays. To assure the effectiveness of mDpy-30 and RbBP5 siRNAs in U251 cells, we transfected cells with a control non-targeting siRNA (QIAGEN) or each individual siRNA and then examined the knockdown efficiency using western blotting. An equal amount of the total protein was loaded into each lane and GAPDH was used as a loading control.(0.90 MB EPS)Click here for additional data file.Figure S2Characterization of siRNAs against BIG1 in HeLa and U251 cells. HeLa or U251 cells were transfected with a control non-targeting siRNA (QIAGEN) or each of the two different siRNAs against BIG1 . The knockdown efficiency of each siRNA was assessed using western blotting or immunofluorescent staining. An equal amount of the total protein was loaded into each lane and GAPDH was used as a loading control. Scale bars: 10 µm.(8.92 MB EPS)Click here for additional data file.Figure S3Characterization of the lentiviral particles expressing mDpy-30. U251 cells were infected with control or mDpy-30-expressing lentiviral particles for 6 days. The lentiviral vector pWPI contains a constitutively expressed GFP allowing the quantification of the infection efficiency; approximately 80% of cells (more than 500 cells scored for each group) remained infected at day 6 when the adhesion/migration assays were carried out. The overexpression efficiency of mDpy-30 was examined using western blotting. An equal amount of the total protein was loaded into each lane and GAPDH was used as a loading control. Scale bars: 10 µm.(7.61 MB EPS)Click here for additional data file.Figure S4Impact of mDpy-30 depletion on the protrusion-targeting of β1 integrin in U251 cells. The β1 integrin endosomal trafficking analysis was performed as described in (5.79 MB EPS)Click here for additional data file.Figure S5The time course study illustrating the influence of mDpy-30 knockdown on U251 cell adhesion. The adhesion was quantified 20, 40 and 60 min after plating using an ECM array according to the protocol described in “(0.92 MB EPS)Click here for additional data file.Figure S6The time course study testing the effect of mDpy-30 depletion on the migration of U251 cells. The migration was assessed 2, 4 and 6 hr after seeding using a transwell chamber according to the protocol described in “(0.47 MB EPS)Click here for additional data file.

ADP (10 μM) evoked increases in intracellular calcium that were essentially abolished by the P2Y1 receptor antagonist MRS2179 (10 μM), responses were also absent in preparations from P2Y1 receptor deficient mice however UTP (100 μM) evoked calcium rises were unaffected. ADP also evoked a robust increase in extracellular signal-regulated protein kinase (ERK) phosphorylation that was of similar magnitude in the cultures from wild type and P2Y1 receptor deficient mice. These results suggest that ADP acts through P2Y1 receptors to mediate an increase in intracellular calcium but not to stimulate ERK phosphorylation in the spinal cord.Mixed neuronal and glial cell spinal cord cultures from neonates express ADP sensitive P2Y P2Y receptors are a family of G-protein coupled nucleotide receptors, and several of the eight subtypes to remove any extracellular dye and maintained at room temperature. Coverslips were mounted in a perfusion chamber on the stage of a Fluoview FV300 confocal microscope and were continuously perfused with extracellular solution. The argon laser excitation of the dye was at 488 nm and the emissions were captured at wavelengths greater than 510 nm by Olympus Fluoview v4.2 software at a frequency of 0.5 Hz for a continuous time period of 280 s. Agonist application was via a U-tube Spinal cord cultures were ester loaded with a calcium sensitive dye, Fluo-3 acetoxymethyl ester for 30 min at 37 °C in a humidified incubator. The coverslips were then washed in extracellular solution . The samples were then mixed with sodium dodecyl sulphate sample buffer (containining β-mercaptoethanol) at a ratio of 1:1 and denatured for 5 min at 95 °C prior to loading on a 10% sodium dodecyl sulphate polyacrylamide gel. The protein was then transferred onto a nitrocellulose membrane and subsequently blocked with blocking medium overnight at 4 °C. Nitrocellulose membranes were then incubated in 5% blocking medium containing either anti-phospho-ERK antibody at a dilution of 1:1000 or anti-non-phosphorylated ERK antibody at a dilution 1:1000. Immunoreactive bands were visualised by incubation of nitrocellulose membranes with anti rabbit peroxidase conjugate at 1:1500 for 2 h at room temperature and then detected with chemiluminiscence and recorded onto hyperfilm . Western blots were analysed using Image J, NIH, USA—Total RNA was isolated from either intact spinal cord or spinal cord using the RNeasy Mini Kit . The RNA was treated with DNase I (Sigma) to remove any DNA contamination. Half of the purified RNA was reverse-transcribed to cDNA using SuperScript II-reverse transcriptase , and the remainder of the RNA was used as a negative control to ensure that there was no genomic contamination. The primers have been described previously t-test with a p-value of <0.05 considered as significant. Data are expressed as mean ± standard error of the mean.Statistical tests were preformed using an unpaired n = 576 cells from 4 coverslips). We have previously used calcium imaging to look at P2Y receptor signalling in mouse superior cervical ganglia n = 120 cells from 12 coverslips) and glial cells . Responses were not sustained and generally decayed during the time-course of application .Spinal cord cells cultured from neonates for 3–7 days contained both neuronal and glial cells that could be distinguished by their morphology and staining with glial fibrillary acidic protein; approx 43% of cells were glia and 57% neuronal and 17% of glial cells (2/4 receptor agonist UTP (100 μM) in cultures from P2Y1 receptor deficient mice were the same as for WT for neurons and glial cells indicating that Gαq coupled receptor calcium signalling was not affected in the P2Y1 receptor deficient mouse . Responsnt mouse . Taken t1 receptor stimulation has also been reported to mediate ERK phosphorylation in recombinant 1 receptor deficient mice. Surprisingly ADP (10 μM) evoked similar levels of ERK phosphorylation in WT and P2Y1 receptor deficient cultures . Amplification of RNA for ADP sensitive P2Y12&13 receptors raised the possibility that these may contribute to the ERK phosphorylation. AR-C66931MX 12 and P2Y13 receptors with a reported pA2 of 8.7 at P2Y12 receptors and 0.01 μM reduced ADP responses by ∼80% at recombinant P2Y13 receptors (see review 12 receptors) had no effect on ADP evoked ERK phosphorylation indicating that P2Y12 receptors did not mediate the ERK phosphorylation. AR-C66931MX may have complex actions at P2Y13 receptors, possibly dependent on cell type, and has been described as an activator of P2Y13 receptor dependent high density lipoprotein endocytosis in hepatocytes 13 receptor. Thus it remains to be determined whether the P2Y13 receptor, or a novel ADP sensitive receptor, mediates the ADP evoked ERK phosphorylation in the spinal cord.Of the currently eight identified P2Y receptor genes ADP is an agonist at Gαq coupled P2Y