Datasets:

mtc

/

pubmed-2shot-full-test

like 0

historically , ileal conduit formation following radical cystectomy has been the preferred type of urinary diversion . more recently , orthotopic bladder reconstruction has become increasingly popular , affording patients continence , maintaining as much normal voiding function as possible , with a more desirable body image and good quality of life [ 13 ] . a 71-year - old male had undergone a radical cystectomy and orthotopic neobladder formation 5 years previously , and was self - catheterising . he presented to the emergency department with a 24-h history of abdominal pain and distension . examination revealed a distended abdomen with some lower abdominal tenderness but no evidence of peritonism . relevant blood analysis revealed creatinine 354 mol / l , wcc 15.9 10/l and crp > 380 . an abdominal x - ray revealed dilated small bowel loops , and a ct showed moderate volume ascites and distal small bowel obstruction with the transition being a thickened small bowel loop lying next to the neobladder ( fig . 1 ) . figure 1:ct scan showing transition point of dilated bowel lying adjacent to the neobladder . conservative management was instituted ( catheter , nasogastric tube ) for presumed adhesional obstruction , and the patient was admitted under the care of the general surgical team . the urology team were contacted in light of the ct findings , and as the patient had not improved over a 24-h period , a decision was made to proceed with an exploratory laparotomy . at surgery , there was a large amount of turbid urinary ascites , and the offending loop of small bowel seen on the ct was found to be stuck to a 5 mm perforation in the neobladder , at the junction of the afferent limb and the pouch . the patient made a good recovery , creatinine normalized to 95 mol / l , bowel function returned to normal and a cystogram at 10 days did not show any evidence of a leak . presenting features generally include fever and anuria , with abdominal pain being the main symptom . possible causes of spontaneous rupture include overdistension , adhesions causing tearing of the neobladder wall and blunt trauma . in the vast majority of cases , exploratory laparotomy and repair is required ; however , there have been two reported cases of successful conservative management [ 5 , 6 ] . in this case , a segment of ileum became adherent to the neobladder , leading to bowel obstruction . it is difficult to postulate whether the adhesion caused tearing of the neobladder , or spontaneous rupture occurred first leading to subsequent adherence of the ileum . this case highlights the importance of early urological input and a high index of suspicion of neobladder perforation in any such patient with abdominal symptoms , regardless of their nature .

orthotopic bladder reconstruction is becoming increasingly popular in patients who have undergone radical cystectomy . one of the rare complications is spontaneous rupture , which presents with various symptoms , but in particular , abdominal pain . we report a case of orthotopic bladder perforation in a patient who presented with the symptoms and signs of small bowel obstruction .

inadequate intracellular glucocorticoid activity , referred to as critical illness - related corticosteroid insufficiency , typically results in an exaggerated proinflammatory response . while there are large geographic variations in the prescription of glucocorticoids for sepsis , up to 50% of intensive care unit patients receive such therapy . despite over 30 years of investigation and over 20 meta - analyses , the use of glucocorticoids in patients with sepsis remains extremely controversial and recommendations are conflicting . the most important recent studies are that of annane and colleagues and the corticosteroid therapy of septic shock ( corticus ) study . both of these studies have important limitations : 24% patients received etomidate in the study by annane and colleagues , whereas 19% received etomidate in the corticus study . the benefit of steroids in the study by annane and colleagues may have been restricted largely to those patients who received etomidate . furthermore , only patients with ' refractory septic shock ' were enrolled in the annane study whereas , as a result of an overwhelming selection bias , only approximately 5% of eligible patients were enrolled in the corticus study . a more recent study found no benefit from a 7-day course of 40 mg of prednisolone in patients hospitalized with community - acquired pneumonia . in the study by annane and colleagues , patients received 50 mg of hydrocortisone intravenously every 6 hours for 7 days , whereas in the corticus study , patients received this dose for 5 days , followed by a tapering off over a further 5 days . recently , two longitudinal studies in patients with severe community - acquired pneumonia found high levels of circulating inflammatory cytokines 3 weeks after clinical resolution of sepsis . these data suggest that patients with severe sepsis may have prolonged immune dysregulation ( even after clinical recovery ) and that a longer course of corticosteroids may be required . the use of a continuous infusion of hydrocortisone has been reported to result in better glycemic control with less variability of blood glucose concentration . this may be clinically relevant as it has been demonstrated that an oscillating blood glucose level is associated with greater oxidative injury than sustained hyperglycemia . indeed , a number of reports indicate that glucose variability may be an independent predictor of outcome in critically ill patients . a continuous infusion of glucocorticoid may , however , result in greater suppression of the hpa axis . furthermore , the preferred glucocorticoid and the optimal dosing strategy in patients with septic shock remain to be determined . evidence - based medicine is defined as the use of the best current scientific evidence in making decisions about the care of individual patients . owing to the dearth of high - level evidence , it is not possible to make strong evidence - based recommendations on the use of glucocorticoids in patients with sepsis . therefore , at this juncture , it is useful to summarize what we know , what we think we know , and what we do not know in order to lay the foundation for future scientific exploration ; this information is summarized in table 1 . current knowledge concerning glucocorticoids in sepsis in summary , the risk / benefit ratio of glucocorticoids should be determined in each patient . a course ( 7 to 10 days ) of low - dose hydrocortisone ( 200 mg / day ) should be considered in vasopressor - dependent patients ( dosage of norepinephrine or equivalent of greater than 0.1 g / kg per minute ) within 12 hours of the onset of shock . steroids should be stopped in patients whose vasopressor dependency has not improved with 2 days of glucocorticoids . while the outcome benefit of low - dose glucocorticoids remains to be determined , such a strategy decreases vasopressor dependency and appears to be safe ( no excess mortality , superinfections , or acute myopathy ) . infection surveillance is critical in patients treated with corticosteroids , and to prevent the rebound phenomenon , the drug should be weaned slowly . at this time , glucocorticoids appear to have a limited role in patients who have sepsis or severe sepsis and who are at a low risk of dying . corticus : corticosteroid therapy of septic shock ; hpa : hypothalamic - pituitary - adrenal .

an intact hypothalamic - pituitary - adrenal ( hpa ) axis with effective intracellular glucocorticoid anti - inflammatory activity is essential for host survival following exposure to an infectious agent . glucocorticoids play a major role in regulating the activity of nuclear factorkappa- b , which has a crucial and generalized role in inducing cytokine gene transcription after exposure to an invading pathogen . severe sepsis is , however , associated with complex alterations of the hpa axis , which may result in decreased production of cortisol as well as glucocorticoid tissue resistance .

ictal paresis or inhibitory motor seizures are a relatively rare nonconvulsive manifestation of epileptic seizures characterized by an inability to initiate or continue movements usually with preservation of muscle strength and consciousness , , , , , , , , . here , we report an elderly female patient with dementia who manifested with severe and prolonged left hemiplegia . an 84-year - old female had convulsive seizures for the first time in her life out of sleep ( day 1 ) . on arrival at our emergency room , she had left clonic hemiconvulsions including the neck in association with conjugate deviation of the eyes to the left . the convulsion , sustained for more than 45 min as witnessed by her family , stopped following injection of diazepam and phenytoin ( pht ) . prior to the convulsion , she did not speak voluntarily because of dementia and was bedridden most of the time , although she had no hemiparesis . laboratory examinations were unremarkable , only showing slight leukocytosis and slight elevation of lactate dehydrogenase and ammonia . cerebrospinal fluid examination was also unremarkable . at 10 h after the admission ( day 2 ) , her consciousness recovered to the previous level , and she could keep her eyes open visually pursue objects around around her bed . however , she had left flaccid hemiplegia , bilateral symmetrical brisk deep tendon reflexes , and babinski signs . cranial diffusion - weighted mri demonstrated slightly high intensity in the right posterior quadrant ( fig . 1 ) , which did not indicate cerebral infarction in terms of signal intensity and distribution . electroencephalography recorded while she had left hemiplegia demonstrated continuous epileptiform discharges located mainly in the right parieto - occipital areas and occasionally evolving to the right central area , indicative of focal non - convulsive status epilepticus ( fig . 2 ) . tc - hexamethylpropylene amine oxime - single photon emission computed tomography showed markedly high blood perfusion in the right parieto - temporo - occipital areas ( fig . 1 ) . on the basis of the diagnosis of nonconvulsive status epilepticus manifesting with ictal paresis , intravenous pht and oral sodium valproate were administered . her left hemiplegia improved gradually , although seven days were needed to obtain full voluntary movements . in the present elderly patient with dementia , the ictal paresis consisted of severe complete flaccid hemiplegia and lasted for a week , whereas , in previous reports , paresis is usually described as mild , , , , , , , , . reported an elderly male whose ictal paresis , though in mild degree , prolonged for a week similar to that of the present patient . patients with dementia are known to be at increased risk of developing seizures and epilepsy , which may also be in association with seizure severity . therefore , age and preexisting dementia , as in the present patient , can be possible factors associated manifestation of severe ictal paresis . there are two postulated pathophysiologies of ictal paresis : epileptic activities in negative motor areas which are located anterior to the face region of the primary or supplementary sensorimotor areas may affect voluntary movements , and epileptic activities in the sensorimotor area may activate an inhibitory system , . considering the distribution of eeg and spect findings , it is most likely that the ictal paresis of our patient was caused by the latter mechanism . in summary , ictal paresis can be as severe as complete flaccid hemiplegia and can last as long as for a week , especially in elderly patients with preexisting dementia . careful clinical consideration of the possibility of ictal paresis is needed , as this is potentially a treatable condition .

we report an 84-year - old female who showed a rare manifestation of epilepsy , ictal paresis , a type of simple partial seizure presenting with focal motor dysfunction . while the patient exhibited severe left hemiplegia which lasted for a week , cranial diffusion - weighted mri demonstrated slightly high intensity in the right posterior quadrant , and electroencephalography ( eeg ) showed continuous epileptiform discharges located mainly in the right parieto - occipital area , strongly suggesting that the patient was in an ictal state . 99mtc - hexamethylpropylene amine oxime - single photon emission computed tomography ( hmpao - spect ) showed markedly high blood perfusion in the right parieto - temporo - occipital areas . considering the distribution of eeg epileptiform activities and hmpao - spect hyperperfusion , it is most likely that the ictal paresis of our patient was associated with epileptic activities at the sensorimotor area which caused either direct or indirect activation of an inhibitory system . careful clinical consideration of the possibility of ictal paresis is needed in elderly patients , especially in those with preexisting dementia , because paresis can be as severe as complete flaccid hemiplegia and can last as long as for a week .

solutions . several different solutions were used to simulate different states of contraction . relaxing solution ( ph 7.0 ) had a composition ( in mm ) of 10 mops , 64.4 k propionate , 5.23 mg propionate , 9.45 na2so4 , 10 egta , 0.188 cacl2 , 7 atp , and 10 creatine phosphate . activating solution consisted ( in mm ) of 10 mops , 45.1 k propionate , 5.21 mg propionate , 9.27 na2so4 , 10 egta , 9.91 cacl2 , 7.18 atp , and 10 creatine phosphate . glycerol solution consisted of half glycerol and half rigor solution , the latter containing ( in mm ) 50 tris ( ph 7.4 ) , 100 nacl , 2 kcl , 2 mgcl2 , and 10 egta . skeletal myofibril preparation . briefly , muscles were dissected bluntly from the backs of rabbits , along the length of the fibers . they were cut into thin strips and tied at both ends to a wooden stick in order to maintain their natural length . the prepared muscle strips were placed in glycerol solution and stored in a freezer at 20 c for long - term storage . to obtain myofibril bundles , the muscle strips stored in glycerol solution were transferred to rigor solution for 60 min and then cut into 2 mm segments across the fiber cross section . a tissue segment was diced using a blender ( sorvall omni mixer ) in 7 ml of rigor solution using the following protocol : twice 5 s at 1100 rpm , once 5 s at 2500 rpm , and once 1 s at 3100 rpm . the resulting myofibril bundles were typically about 50 m in diameter and several hundred micrometers long . eight myofibril bundles were probed both in relaxed and activated states to confirm the consistency of the data ( n = 8) . the dissected specimen was stored at 20 c in a 50/50 glycerol / rigor solution mixture for long - term storage . to prepare single myofibrils , the muscle tissue was washed in rigor solution and cut using a blender in 2 ml of rigor solution using the following protocol : once 5 s at 2500 rpm and once 10 s at 4000 rpm . the resulting myofibrils were typically 45 m in diameter and tens of micrometers long . ten single myofibril samples were probed in both activated and relaxed states for consistency ( n = 10 ) . the sr - ftir measurements were made using a nicolet magna 760 ftir bench and a nicolet nic - plan ir microscope with 15 and 32 objectives , at the advanced light source , lawrence berkeley national laboratory , infrared beamline 1.4.3 . myofibril bundle experiments were carried out with a 15 objective , while single myofibril experiments were carried out using a 32 objective . thirty - two scans of ir spectra were collected between 800 and 4000 cm at 4 cm resolution and averaged . sr - ftir spectra were initially collected to identify the chemical environment of relaxed muscle . to do this , a drop of myofibril bundle suspension was dispensed onto a caf2 window and then immersed in relaxing solution for 30 min on ice . to collect the sr - ftir spectra of activated muscle , activating solution was drop dispensed onto the myofibril bundle , and measurements were made after the specimen had visibly finished contracting . for obtaining spectral maps of myofibril bundles , a total of eight myofibril bundles were probed in both relaxed and activated states for consistency . for single honeybee myofibrils , 13 myofibrils were probed in both relaxed and activated states . second - derivative analysis was performed for enhancement of spectral resolution using the savitsky golay method . to minimize evaporation during data collection , the myofibril bundle was kept in a water - tight custom chamber with a tefon fitting .

protein water interaction plays a crucial role in protein dynamics and hence function . to study the chemical environment of water and proteins with high spatial resolution , synchrotron radiation - fourier transform infrared ( sr - ftir ) spectromicroscopy was used to probe skeletal muscle myofibrils . observing the oh stretch band showed that water inside of relaxed myofibrils is extensively hydrogen - bonded with little or no free oh . in higher - resolution measurements obtained with single isolated myofibrils , the water absorption peaks were relatively higher within the center region of the sarcomere compared to those in the i - band region , implying higher hydration capacity of thick filaments compared to the thin filaments . when specimens were activated , changes in the oh stretch band showed significant dehydrogen bonding of muscle water ; this was indicated by increased absorption at 3480 cm1 compared to relaxed myofibrils . these contraction - induced changes in water were accompanied by splitting of the amide i ( c = o ) peak , implying that muscle proteins transition from -helix to -sheet - rich structures . hence , muscle contraction can be characterized by a loss of order in the muscle protein complex , accompanied by a destructuring of hydration water . the findings shed fresh light on the molecular mechanism of muscle contraction and motor protein dynamics .

surgical treatment for neoplastic lesions of the oral cavity often requires resection involving the mandible , floor of the mouth , tongue and also the palate . loss of mandibular continuity in consequence of surgical treatment leads to mandibular deviation and altered muscle function . the extent of deviation depends on the location and extension of the resection , the amount of soft tissue and innervations involvement and the presence of remaining natural teeth . a corrective device known as guide flange prosthesis it can be applied either immediate postoperatively as intermaxillary fixation or within 710 days after the resection as removable device , for restoring mandibular function . the earlier the guidance therapy is initiated in the course of treatment , the more successful is the patient 's definitive occlusal relationship . delays in the initiation due to extensive tissue loss , tight wound closure and other postsurgical morbidities , may result in an inability to achieve normal maxilla - mandibular relationships . it has been reported that fabrication of a provisional guide plane facilitates the fabrication of a definitive restoration . this mandibular deviation is mainly due to uncompensated influence of contralateral musculature particularly the internal pterygoid muscle and pull from the contraction of cicatricial tissue on resected side . uncoordinated masticatory movements due to deviated path of closure may result in eccentric occlusion , a disoriented masticatory cycle , facial disfigurement , distorted speech , dental or soft tissue trauma . several modalities to return the mandible to optimum maxilla - mandibular relationship have been described . these include intermaxillary fixation , vacuum formed pvc splints , mandibular guidance prostheses and a widened maxillary occlusal table using a double row of teeth . a mandibular guidance prosthesis can be defined as a maxillofacial prosthesis used to maintain a functional position for the jaws ( maxillae and mandible ) , improve speech and deglutition following trauma or / and surgery to the mandible or / and adjacent structures . a 29-year - old male patient shohaib aktar reported to the department of prosthetic dentistry , dr r ahmed dental college and hospital , kolkata , complaining of inability to grind food , dryness of the mouth and disfigured facial appearance following mandibular resection . extra oral examination revealed deviation of residual mandible towards right side and loss of functional occlusion on left side with predominant facial defect on right infraauricular region . intraoral examination reveals missing 25 , 26 , 27 , 28 , 35 , 36 , 37 , 38 . primary maxillary and mandibular impressions were made with alginate and poured with dental stone . both the cast are mounted using bite registration record . after mounting of the mandibular cast it was observed that the buccal surface of the mandibular teeth were almost 8 mm lingual to the palatal surface of the maxillary palatal cusps [ figure 1 ] . , additional wax was added on the left side of the prosthesis towards the palatal surface . the whole pattern was invested , dewaxing done and heat cure acrylic was packed and processed . the patient was recalled and the maxillary prosthesis was inserted and checked for retention and stability . the prosthesis is then modified to act as guidance prosthesis by the addition of self - cure acrylic resin to form a ramp or guide plane palatal to the maxillary teeth opposing the nonresected portion of the mandible [ figure 2 ] . the prosthesis was inserted and patient was given instruction regarding the maintenance of the prosthesis and was put on a regular follow - up . occlusal view of maxillary prosthesis with palatal ramp occlusion achieved with the prosthesis in place at maximum intercuspation ( lateral view ) rehabilitation is an essential phase of cancer care and should be considered from the time of diagnosis in a complete and comprehensive treatment plan . the most important objective is to re - educate the mandibular muscles to re - establish an acceptable occlusal relationship ( physiotherapeutic function ) for residual hemimandible , so that the patient could control adequately and repeatedly opening and closing mandibular movements . the guide flange provided a mechanical system which prevented the mandible from turning towards the resected side . for better results , prosthetic management can be combined with an exercise program , which can be started 2 weeks after surgery . the presence of teeth in both the arches is important for effective guidance and reprogramming of mandibular movements . the patient in this clinical report retained all his teeth , except those on the defect site . therefore , the patient had a better proprioceptive sense and was able to achieve the functional position after insertion of prosthesis . guidance prosthesis served as a training appliance till a cast partial denture can be fabricated for the patient . within 3 weeks this prosthesis helped the patient to get accustomed to close the mandible into the correct intercuspal position without the use of any external aid [ figure 3 ] . the success of mandibular guidance therapy varies and depends upon the nature of the surgical defect , early initiation of guidance therapy , patient co - operation , and other factors . this therapy is most successful in patients for whom the resection involves only bony structures , with minimal sacrifice of tongue , floor of the mouth , and adjacent soft tissues , the literature shows various types of cast metal guidance prostheses which are effective in managing the mandibular deviation . but such appliances are complex ; the technique is sensitive and costly and requires many patient visits . the acrylic guide flange prosthesis presented here is simple and cost effective method for managing the mandibular deviation . the number of patient visits is also less as compared to the cast metal guidance prosthesis .

mandibular resection following surgical treatment for neoplastic lesions of the oral cavity leads to numerous complications including altered mandibular movements , disfigurement , difficult in swallowing , impaired speech and articulation , and deviation of the mandible towards the resected site . various prosthetic methods are employed to reduce or minimize mandibular deviation and improve and restore the lost functions and esthetic , like maxillomandibular fixation , implant supported prosthesis , removable mandibular guide flange prosthesis , and palatal based guidance restoration . this clinical report describes the rehabilitation of a patient following segmental mandibulectomy using palatal ramp prosthesis .

a 48-year - old woman with no remarkable medical history presented with decreased visual acuity and metamorphopsia in her right eye , which had gradually progressed over several months . her best - corrected visual acuity ( bcva ) , measured on a snellen chart , was 0.5 , and her intraocular pressure , as determined on the goldmann applanation tonometer ( haag streit , bern , switzerland ) , was 14 mmhg . an examination of the fundus showed a well - defined , 4.9 by 5.2 mm , whitish - yellow and slightly elevated lesion in the posterior pole ( fig . fluorescein angiography and optical coherence tomography ( oct ) showed retinal pigment epithelial degeneration , macular edema and subretinal hemorrhage , suggesting choroidal neovascularization ( cnv ) ( fig . treatment was recommended using a combination of pdt with verteporfin and intravitreal bevacizumab ( avastin ) injections at 5-day intervals . two weeks later , the fluorescein angiography showed that the subretinal hemorrhage and leaking of the fluorescein dye had decreased and her metamorphopsia had improved . four weeks after starting treatment , her bcva had improved to 0.8 , and to 1.0 after 12 weeks . choroidal osteoma is a rare ossified tumor , first described in 1978 , found predominantly in healthy young women , and appears in a unilateral position in most patients . at presentation , subretinal fluid , hemorrhage and alterations in photoreceptors associated with cnv can reduce visual acuity , but the mechanism of cnv is unknown . treatments include pdt , intravitreal bevacizumab ( avastin ) or ranibizumab ( lucentis ; genentech inc . , south san francisco , ca , usa ) , laser photocoagulation and thermotherapy . these treatments are designed to conserve the fovea by decalcifying the osteoma , ultimately resulting in suppression of cnv . pdt was found to cause the regression of a subfoveal choroidal osteoma accompanied by cnv . the beneficial effects of pdt include not only improvements in visual acuity and metamorphopsia , but a reduction in the size of the cnv , as shown by oct , and a reduction in leakage during late stage fluorescein angiography [ 4 - 6 ] . in contrast , intravitreal injection of an anti - vascular endothelial growth factor ( vegf ) antibody was reported to be superior to pdt , and the latter was associated with poor visual outcome and the possible need for multiple re - treatments [ 7 - 9 ] . in patients with cnv due to age - related macular degeneration , treatment combinations of pdt and intravitreal anti - vegf injection have been tried . although these combination therapies have not proven to be superior to using either agent alone , it reduces the risk of multiple pdt , which may induce cnv recurrence by aggravating choroidal ischemia and subsequent over - expression of vegf . in addition , rishi et al . reported that combination therapy with pdt and intravitreal bevacizunmab appeared to be effective in the treatment of cnv secondary to toxoplasma retinochoroiditis . therefore , we utilized a combination of pdt with verteporfin and intravitreal bevacizumab ( avastin ) with our 48-year - old female patient who had presented with decreased visual acuity in her right eye due to cnv secondary to choroidal osteoma . two weeks later , we found that the subretinal hemorrhage had decreased due to the suppression of cnv . her bcva improved to 0.8 at 4 weeks and to 1.0 at 16 weeks , and there were no complications throughout the 16 week follow - up period . these results indicate that the combination of pdt with verteporfin and intravitreal anti - vegf injection could have a synergistic effect that could reduce the need for repeated injections in the treatment of choroidal osteoma with cnv , especially in cases of large sized , and those non - responsive to anti - vegf injections or pdt alone . larger studies with longer follow - up may reveal that the visual outcome with combination therapy could be better than pdt or anti - vegf alone .

choroidal osteoma is a benign ossified tumor that is found predominantly in healthy young women during their second and third decades of life . the lesions are white - to - cream or orange in color , are located in the peripapillary and macular areas , and are unilateral in most patients . the symptoms of choroidal osteoma include decreased visual acuity and metamorphopsia or scotoma corresponding to the location of the osteoma , but some patients have no symptoms . prognosis of vision varies according to tumor location , retinal pigment epithelial and sensory retinal degeneration , subretinal fluid and hemorrhage , and development of a subretinal neovascular membrane .

an intrapancreatic accessory spleen may be misdiagnosed as a nonsecreting neuroendocrine tumor of the pancreas . an accurate diagnosis is crucial since such an accessory spleen does not require surgical treatment . a 67-year - old woman in good general conditions with a family history positive for pancreatic cancer underwent a routine health check . physical examination was normal and laboratory tests revealed normal alpha fetoprotein and carcinoembryonic antigen but a slightly elevated tumor marker ca 19 - 9 ( 35 u / ml ; normal < 27.0 u / ml ) . additional laboratory tests such as chromogranin a , neuron - specific enolase , 5-hydroxyindoleacetic acid , pancreatic polypeptide and substance p were ordered and normal beside a slightly elevated pancreatic polypeptide level ( 437 pg / ml ; normal < 210 pg / ml ) . the patient also underwent a ct scan investigation which showed a 18 15 15 mm nodular lesion in the tail of the pancreas without any contrast enhancement ( fig . an additional octreotide scan was normal . because of the abnormal tumor markers ca 19 - 9 and pancreatic polypeptide , a neuroendocrine tumor was suspected , although the image appearances were not typical . due to this potentially malignant lesion intraoperatively , a dark red but soft tumor was found in the tail of the pancreas and the lesion was also confirmed by intraoperative sonography . postoperative histopathological examination revealed a completely intrapancreatic accessory spleen without any signs of a tumor ( fig . during the 5th week of gestation the spleen develops in the dorsal mesogastrium from mesenchymal cells that migrate between the leaves of the mesentery and coalesce . an accessory spleen may arise from isolated cells which rest separated from the main body of the spleen . in a large series of nonselected autopsy investigations an accessory spleen was found in 1030% [ 1 , 2 ] . in 1,000 consecutive patients undergoing contrast - enhanced abdominal ct scan an accessory spleen was present in 16% . in 80% the accessory spleen is located at or near the splenic hilum . differential diagnosis of a solid pancreas tumor includes pancreatic adenocarcinoma , pancreatic neuroendocrine tumor , solid and papillary epithelial neoplasms and metastasis . pancreatic endocrine tumors are rare ( < 10% ) and often localized in the head of the pancreas [ 4 , 5 ] . due to secretion of biologically active substances , 1553% of these tumors become symptomatic , all others remain initially silent . however 50% of these nonsecreting endocrine tumors only 11 cases of surgical resection of an intrapancreatic accessory spleen have been reported up to now . in most of these cases the intrapancreatic accessory spleen was misdiagnosed as a pancreatic tumor and patients underwent unnecessary surgery . most intrapancreatic accessory spleens are roundish and have a characteristic homogenous contrast - enhanced appearance on ct scan with well - defined margins . however , definitive diagnosis based on imaging can be difficult because ct scan , mri and ultrasound images of such intrapancreatic spleens are quite similar to those of hypervascular pancreatic tumors , as islet cell tumors and acinar cell carcinoma . using contrast - enhanced ultrasound , ota and ono demonstrated in the hepatosplenic phase that contrast medium is trapped by hepatic and splenic tissue , which may allow to distinguish an intrapancreatic spleen from other lesions . somatostatin receptor scintigraphy ( octreotide scan ) has a high sensitivity in detection of gastrointestinal neuroendocrine tumors ( 7095% ) . the presence of somatostatin receptors on the surface of lymphocytes within the splenic tissue , which also bind octreotide with a high affinity , may therefore mimic a neuroendocrine tumor [ 10 , 11 ] . diagnosed in three of five patients an intrapancreatic accessory spleen based on the findings of standard gadolinium - enhanced mri . however , they were not able to exclude other diagnoses with this investigation , including pancreatic neuroendocrine tumors , pancreatic adenocarcinomas , solid and papillary epithelial neoplasms , and metastasis . the only possibility to differentiate an accessory spleen from a neuroendocrine tumor are nuclear scintigraphic investigations as 99 m tc - sulphur colloid or tc - tagged heat - damaged red blood cells scintigraphies . these are investigations which are noninvasive , sensitive and specific for detecting splenic tissue [ 13 , 14 ] . in asymptomatic homogenous and well - circumscribed tumors in the pancreatic tail an accessory spleen has to be excluded before surgery . nuclear scintigraphies such as 99 m tc - sulphur colloid or tc - tagged heat - damaged red blood cells scintigraphies should be definitely routinely used in the preoperative evaluation of nonsecreting pancreatic lesions , particularly those which are located in the body and tail of the pancreas . these imaging modalities may provide the definitive diagnosis of an intrapancreatic spleen and therefore prevent patients from undergoing unnecessary major surgery .

in a large series of nonselected autopsy investigations an accessory spleen was found in 1030% . the second most common site is the pancreatic tail ( 17% ) . we report a case of intrapancreatic accessory spleen misdiagnosed as a nonsecreting neuroendocrine tumor of the pancreas . nuclear scintigraphy may provide the definitive diagnosis of an intrapancreatic spleen and therefore prevent patients from unnecessary major surgery .

a clear understanding of the anatomy of human teeth becomes an essential prerequisite for achieving success in endodontic treatment . the importance of developing a visual picture of the expected locations and number of canals in a particular tooth ca n't be overstressed . this report describes a failed endodontic therapy on a mandibular first molar with unusual root morphology . the canal in the distolingual root was left untreated during the treatment because no radiographic examination was performed as the patient was 1 month pregnant at that time . a 21-year - old female reported with pain and swelling in relation to lower right first molar . the patient had undergone root canal treatment for the same tooth one year before , when she was 1 month pregnant . she had no radiographic record as only apex locator was utilized to locate the canals at that time . on examination temporary restoration with zinc oxide eugenol was seen . an intra oral periapical radiograph ( iopr ) revealed 3 roots ; the first canal of the mesial root and a canal of one of the distal roots were found to be treated endodontically , as they were infraobturated , but the canal of the 2 distal root had not been treated . the most suitable treatment would have been to reobturate all canals and the treatment plan was explained to the patient but unfortunately the patient declined the suggestion . figure 1showing a rare third root in mandibular first molar . showing a rare third root in mandibular first molar . the report describes a failed case of 3 rooted mandibular first molar in which one canal of the extra root ( distolingual ) was left unobturated resulting in treatment failure . this report highlights the importance of having an understanding of variations in the normal tooth morphology . most mandibular first and second molars in caucasians have 2 roots , with 2 mesial and 1 distal canal . there is a mongolid variation in which there exists supernumerary distolingual root , the frequency of this trait ranges from 644% . the presence of a third root in the permanent first molar is the major variant in this group . the frequency of this trait is less than 5% in caucasians , african , eurasian and indian population . the 4 canal was left untreated during treatment because periapical radiography was not preformed as the patient was 1 month pregnant at that time . as pregnancy is an absolute contraindication to dental x - rays only the apex locator was utilized for diagnostic purpose , the presence of the extra root and fourth canal was therefore not diagnosed which ultimately resulted in treatment failure . hence it may be concluded that prior to starting the endodontic treatment the clinician must be aware of the anatomic variations in tooth pulp morphology and also the importance of preoperative radiographs ca n't be underscored . an apex locator although helpful in estimating the working length during root canal treatment , ca n't replace periapical radiography as it does n't provide the detailed information about root canal morphology that radiography does instead the use of advanced radiographic techniques like cone beam ct with a small fov exposition to reduce the x - ray exposition and shift sketch technique to diagnose this rare condition can be of great use in preventing any lapse in the diagnosis of this atypical condition .

anatomic variations are common in human dentition . a clear understanding of these variations is very important for success of endodontic treatment . a dentist should be aware of these anatomic variations as this can affect the treatment outcome . a case of endodontic therapy is presented in which inability to locate an anatomically rare supplemental canal of a three rooted mandibular first molar resulted in treatment failure . a 21-year - old female reported with pain and swelling in relation to lower right first molar . an intra oral periapical radiograph revealed 3 roots ; the first canal of the mesial root and a canal of one of the distal roots were found to be treated endodontically , which were infraobturated but the canal of the 2nd distal root had not been treated . the radiograph revealed periapical radiolucency and widening of periodontal space . prior to starting the endodontic treatment the clinician must be aware of the anatomic variations in tooth pulp morphology and also the importance of preoperative radiographs can not be underscored .

the syndrome of transient global amnesia ( tga ) , first described as such by fisher and adams in 1964 , is characterised by abrupt and temporary ( < 24 h ) disruption of anterograde memory without clouding of consciousness or focal neurological signs . patients typically present with repetition of the same questions or statements , followed by full recovery but without memory for the amnesic period . the pathophysiology of tga is uncertain , but probably involves transient hypoperfusion of memory - eloquent brain structures including the medial temporal lobe and hippocampus , as evidenced by sophisticated neuroimaging studies . despite its sudden onset , there is no evidence for an epileptic aetiology in tga , although misdiagnosis as epilepsy or stroke by clinicians unfamiliar with tga is not uncommon . a possible relationship to migraine , particularly in younger patients , has been noted . familial cases of tga have rarely been reported [ 7 , 8 , 9 , 10 , 11 , 12 ] . we present further familial tga cases , survey prior publications on this topic , and consider the possible aetiology of familial tga . a 54-year - old female had an episode of neurological disturbance of about 2.5 h duration after taking her dog for a walk . an eyewitness of the attack reported that the patient was repeatedly asking the same questions . she had little recollection of the episode after recovery but had a vague recollection of being fearful . she had a mild migraine tendency but was otherwise in good health and took no regular medication . neurological examination 1 month after the event was normal . as the patient was well , no further investigation ( brain mri , dopplers , eeg and blood tests for stress hormones ) was undertaken . based on the history , proposed diagnostic criteria for tga were felt to be fulfilled . the patient reported that in the family history , 2 maternal aunts had had similar symptoms at similar ages to herself and had both been diagnosed with tga . familial occurrence of tga has been reported on occasion ( table 1 ) [ 7 , 8 , 9 , 10 , 11 , 12 ] , but all prior reports have involved siblings , with only occasional definite or possible instances of parental involvement . prior accounts of familial involvement with more distant relatives , as in the current report , have not been identified . summing all the 22 patients in these 7 reports , there is a slight female preponderance ( f : m = 14:8 ) , with all episodes occurring in the 6th8th decades of life . although details are incomplete , at least 6 of these individuals ( 5 f , 1 m ) had a history of migraine , and 1 patient had migraine - type headaches immediately after two tga episodes . typical precipitating factors for tga ( physical exercise and emotional upset ) were recorded in 13/22 familial cases . no details on whether our patient had undertaken strenuous physical exertion whilst walking her dog were available some clinicians are of the view that tga is probably a migraine aura in most cases , in which case a familial tendency to tga would not be surprising . likewise , a female preponderance of cases , as noted in some prior surveys of tga [ 6 , 14 ] , might be deemed consistent with a migrainous aetiology . comorbidity with migraine has been noted in some of the reports of familial tga [ 9 , 10 ] , but only in some family members in other reports or not at all ; still other reports make no comment on migraine [ 8 , 11 ] . since migraine is a highly prevalent condition , it can not be assumed that the presence of this variable necessarily influences the occurrence of tga . it may be that in some families , a genetically determined migraine tendency may also predispose to attacks of tga . if this were the case , then it is perhaps surprising that familial tga is so rare when migraine is so common . other genetically influenced developmental factors , perhaps related to local blood vessel structure or innervation , which rendered the hippocampal blood supply particularly vulnerable , might predispose only certain families . if routine questioning of all tga patients about a family history of similar events proved positive , then these patients might be submitted to further investigation ( brain mri , dopplers , eeg and blood tests for stress hormones ) to address the proposed tga aetiologies .

following an episode of typical transient global amnesia ( tga ) , a female patient reported similar clinical attacks in 2 maternal aunts . prior reports of familial tga are few , and no previous account of affected relatives more distant than siblings or parents was discovered in a literature survey . the aetiology of familial tga is unknown . a pathophysiological mechanism akin to that in migraine attacks , comorbidity reported in a number of the examples of familial tga , is one possibility . the study of familial tga cases might facilitate the understanding of tga aetiology .

so , the prediction of liquefaction potential of soil due to an earthquake is an important step for earthquake hazard mitigation . there are various techniques available for the determination of liquefaction potential of soil in the literature [ 113 ] researchers used artificial intelligence ( ai ) techniques for the prediction of liquefaction susceptibility of soil [ 1425 ] . this article adopts cone penetration test ( cpt ) based minimax probability machine ( mpm ) for the prediction of seismic liquefaction potential of soil . many cpt tests were conducted after the earthquake . two models ( model i and model ii ) model i adopts cone resistance ( qc ) and cyclic stress ratio ( csr ) as input variables . qc and peck ground acceleration ( pga ) have been used as inputs of the model ii . in mpm , it is assumed that positive definite covariance matrices exist in each of the two classes . in mpm , the probability of misclassification of future data is minimized . in mpm , following optimal hyperplane is used for separating the two classes of points.(1)atz = ba , zrn;br in mpm , the following optimization problem is constructed : ( 2)max,b , a0constraint : infpr{atxb}infpr{atyb}where is called the worst - case accuracy . the above optimization problem ( 2 ) so , it takes the following form.(3)max,aconstraint :- b+atxatxa - b - atyatya the optimization problem ( 3 ) is written in the following form : minaatya+atxa(4)subjected to : at(x - y)=1the above optimization problem ( 4 ) is solved by convex programming technique . to develop the above mpm , non - liquefied sites are denoted by + 1 and liquefied sites are denoted by 1 . in mpm , training dataset is adopted to develop the model and a testing is employed to verify the developed mpm . this study adopts radial basis function k(xi , x)=exp-(xi - x)(xi - x)t22 ( where is width of radial basis function ) as kernel function for developing the mpm . the success of mpm depends on the choice of proper value of . this study adopts trial and error approach for the determination of the design value of . training and testing performance have been determined by using the following equation.(5)training / testing performance(%)=no of data predicted accurately by mpmtotal data100fig . 1 shows the effect of on training performance ( % ) for model i. it is observed from fig . 1 that the developed mpm gives best training performance at = 0.19 for model i. the developed mpm gives 100% training performance . tables 1 and 2 illustrate the performance of mpm for training and testing dataset respectively . 2 that the best training performance has been achieved at = 0.13 . the performance of mpm for training and testing dataset has been depicted in tables 1 and 2 , respectively . 3 plots the results of model ii . the generalization capability of developed model ii has been examined by the global datasets . these global datasets consists information about liquefiable and non - liquefiable soil of five earthquakes . two models ( model i and model ii ) have been tried to get best performance . this study shows that the developed mpm can predict liquefaction potential of soil based on qc and pga . geotechnical engineers can use the developed charts for the determination of seismic liquefaction potential of soil .

the evaluation of liquefaction potential of soil due to an earthquake is an important step in geosciences . this article examines the capability of minimax probability machine ( mpm ) for the prediction of seismic liquefaction potential of soil based on the cone penetration test ( cpt ) data . the dataset has been taken from chi chi earthquake . mpm is developed based on the use of hyperplanes . it has been adopted as a classification tool . this article uses two models ( model i and model ii ) . model i employs cone resistance ( qc ) and cyclic stress ratio ( csr ) as input variables . qc and peak ground acceleration ( pga ) have been taken as inputs for model ii . the developed mpm gives 100% accuracy . the results show that the developed mpm can predict liquefaction potential of soil based on qc and pga .

the incidence of paediatric forearm fractures is increasing worldwide despite the falling overall injury rate . flexor digitorum profundus ( fdp ) entrapment in forearm fractures is a recognized complication but in the 20 cases reported in the literature so far the recognition of the problem occurred following fracture resolution [ 28 ] . we report a case of entrapment of the ring finger fdp at the musculotendinous junction in a 12-year - old male with a both - bone greenstick forearm fracture , and review the literature surrounding this unusual complication . a 12-year - old male patient sustained a closed midshaft both - bone forearm fracture of their non - dominant arm from a fall on a trampoline ( figs 1 and 2 ) . anatomical reduction was achieved with a manipulation under anaesthesia ( mua ) , but it was noticed that there was a mechanical block to extension of the ring finger . the radius and ulna were therefore approached through separate incisions and it was discovered that the fdp was entrapped at the ulna fracture at the level of the musculotendinous junction . following release the fingers regained a full range of motion and the patient went on to heal without further complication ( figs 3 and 4 ) . figure 1:pre - operative lateral radiograph showing dorsally angulated both - bone forearm greenstick fracture . figure 2:pre - operative anteroposterior ( ap ) radiograph showing level of fracture at the junction of proximal two - thirds and distal one - third . pre - operative anteroposterior ( ap ) radiograph showing level of fracture at the junction of proximal two - thirds and distal one - third . the origin of the ringer finger fdp fibres are almost exclusively from the volar aspect of the ulnar , whereas the origin of the fibres going to the index and middle fingers is the interosseous membrane . the fibres to the little finger do arise from the ulna but from the medial side with a fibrous attachment that is more linear , whereas the ring finger origin is over a wide surface area . of the 20 reported cases , all were diagnosed at follow - up , ranging from 2 days to 16 years [ 28 ] . two patients ( 10% ) were successfully managed within a few days of the initial mua by repeated mua . however , 18 ( 90% ) eventually required surgical intervention with exploration of the ulna fracture following failed conservative management with hand therapy . in cases of early surgical intervention ( days ) muscle was released from the fracture site but if the diagnosis was delayed scar tissue was encountered at the fracture site , which was released subperiosteally . a pre - operative diagnosis of mild volkmann 's ischaemic contracture made in 5 ( 25% ) yet at surgery none of the 20 patients had any evidence of muscle necrosis . cullen et al . has described the complications that can occur with intramedullary fixation of these injuries , including muscle entrapment , thereby making it essential to examine the fingers following the use of intramedullary nails . radiographic union of the fracture associated with ulna cortical defect and lack of active finger extension is pathognomonic of entrapment at the fracture site and such cases should be explored surgically . sub - clinical or mild volkmann 's ischaemic contracture is a recognized complication of closed forearm and other fractures . however , this report highlights the importance of considering a diagnosis of muscle entrapment in cases of flexion contracture , particularly in the absence of other signs or symptoms of compartment syndrome . the inability to extend the fingers following closed reduction should be regarded as a definite indication to surgically explore the fracture site . this and other case studies support the idea that fdp is more likely to be entrapped at the ulna and the level can be surprisingly proximal . in our own experience the problem was recognized following closed manipulation and was surgically corrected immediately . however , the literature is consistent in that in all cases there was either no mention of finger range of motion post - operatively or that the problem was not recognized until follow - up . this may be due to a lack of awareness of entrapment as a potential complication of midshaft forearm fractures . to our knowledge , this is the first case report of surgical exploration at the time of the initial manipulation to rectify entrapment . flexion contractures secondary to fdp entrapment can be avoided , first by awareness of this potential complication , and secondly by careful examination of the fingers after closed treatment of a forearm fracture . following closed manipulation or intramedullary fixation of forearm fractures , it is essential to document examination of the ipsilateral fingers in order to exclude entrapment . if entrapment is diagnosed then it should be managed surgically as conservative measures have not been shown to be effective . surgery can be expected to yield excellent results even in cases of delayed diagnosis , but failure to make the diagnosis may lead to chronic morbidity . there are no conflicting interests and there has been no financial support for this work .

entrapment of the flexor digitorum profundus ( fdp ) is a recognized complication of paediatric both - bone forearm fractures . although a rare complication , it is usually missed at the time of initial fracture management resulting in the need for corrective surgery . an attempted closed manipulation followed by immediate surgical correction of fdp entrapment in our hospital prompted a review of the evidence on this underreported problem . a comprehensive english language literature search was performed using embase , medline and pubmed . twenty cases have been reported in the literature and all were diagnosed post - operatively ( range 2 days16 years ) . eighteen cases ( 90% ) required surgical correction . five cases ( 25% ) were initially diagnosed as mild volkmann 's contracture yet at surgery no case was found to have evidence of previous muscle ischaemia . although subclinical or mild volkmann 's ischaemic contracture is a recognized complication of closed forearm fracture , this report highlights the importance of considering a diagnosis of muscle entrapment in cases of flexion contracture .

for the last two years , nucleic acids research has published a special issue devoted to web servers . this web server issue highlights bioinformatics servers that are provided to the research community using internet technologies . this issue represents a rich repository of resources that are freely accessible , ready to use , and have been subjected to rigorous peer review . in the 2005 web server issue the scope of the server applications described in this issue covers diverse ground and is hosted on servers in many different locations around the world . among the tools included are those for text mining ( 1,2 ) , sequence feature detection ( 3,4 ) , predicting aspects of protein 3d structure ( 5,6 ) and performing expression analyses ( 7,8 ) . combined with the annual database issue ( 9 ) , these special issues at nucleic acids research represent a valuable directory of resources for the global life sciences research community . starting in 2005 , nucleic acids research has teamed with the ubc bioinformatics centre at the university of british columbia ( ubc ) to ensure that all of the urls and a short description from the web server issue are listed in the bioinformatics links directory , a curated listing of bioinformatics resources . the bioinformatics links directory ( ) is a community resource that contains a directory of freely available tools , databases and resources for bioinformatics research organized within categories familiar to a biologist . all servers from the web server issue , as well as other selected resources , are categorized within the directory . table 1 displays a summary of web servers from this issue organized within the bioinformatics links directory classification scheme . this scheme organizes links under 11 top level categories ( dna , protein , rna , other molecules , expression , sequence comparison , model organisms , human genome , education , literature and computer related ) to enable quick and easy access to listings of relevant servers . for an online version of this listing of the 2005 nucleic acids research web server issue servers , the bioinformatics links directory highlights web resources by providing a short synopsis for each link , placing links within descriptive biological categories , providing relevant pubmed citations , and identifying links as servers from the nucleic acids research web server issue . the bioinformatics links directory is fully searchable and can be browsed through the biological categories . the bioinformatics links directory is a community - driven resource and aims to offer a useful resource that is more than just a search engine . therefore , the sites listed in the directory are suggested by the research community , are carefully selected and are curated by experts . individuals who know of a resource that should be listed in the bioinformatics links directory should suggest the url here : summary of servers from the nucleic acids research 2005 web server issue in the bioinformatics links directory listed by category a complete listing of these urls can be accessed online at .

the bioinformatics links directory is an online community resource that contains a directory of freely available tools , databases , and resources for bioinformatics and molecular biology research . the listing of the servers published in this and previous issues of nucleic acids research together with other useful tools and websites represents a rich repository of resources that are openly provided to the research community using internet technologies . the 166 servers highlighted in the 2005 web server issue are included in the more than 700 links to useful online resources that are currently contained within the descriptive biological categories of the bioinformatics links directory . this curated listing of bioinformatics resources is available online at the bioinformatics links directory web site , . a complete listing of the 2005 nucleic acids research web server issue servers is available online at the nucleic acids web site , , and on the bioinformatics links directory web site , .

research with arabidopsis has allowed dissection of the events taking place following treatment with baba . in summary , the stress encountered determines the events following it , and the treatment with baba can potentiate ( prime ) the most appropriate to counteract it . for example , bacterial infection by pseudomonas syringae pv tomato ( pst ) dc3000 and attack by the fungal pathogen botrytis cinerea are both combatted through potentiation of salicylic acid ( sa)-dependent defenses , while defense against plectosphaerella cucumerina is obtained through an enhanced callose deposition depending on a functional abscisic acid ( aba ) signaling pathway . baba does not usually induce directly defense responses , but primes the plant to react faster and/or stronger to a given stress . interestingly , the priming state induced by baba can also be transmitted to the descendants of a plant via its seeds . baba perception involves an aspartyl - trna synthetase , and this could be interpreted as a first clue to the possibility that baba might play a natural role in a plant 's physiology . the recent discovery of baba as natural molecule synthesized by plants and induced by stress sheds new light on the research presented until now , and many phenomena known up to date have to be seen and interpreted in the light of this new finding . in particular , baba seems now to possess the features of a novel plant stress hormone . the finding of endogenous baba in plants raises 2 questions : a ) is the amount of baba produced by plants comparable to main plant stress hormones ? and b ) how do the temporal dynamics of its induction relate to those of hormones ? in this addendum , we will try to answer these questions . in our last paper we measured the levels of baba in a. thaliana plants before and after exposure to several biotic and abiotic stressors . unstressed columbia-0 plants at the age of 5 weeks showed a basal level of baba in leaves usually lower than 10 ng / g of fresh weight ( fw ) . if we compare with sa , which can be found , as the free form , in amounts between 30 and 500 ng / g fw in unstressed a. thaliana leaves , baba can be considered less present than sa . however , the molecular weight of baba is the lowest when compared , for example , to sa , aba , jasmonic acid ( ja ) or indole-3-acetic acid ( iaa ) . therefore , in comparison to aba and ja , which are similarly found in amounts lower than 10 ng / g fw , or iaa , which is present in amounts around 20 ng / g fw , the basal amount of baba in a. thaliana leaves can be considered in line with , or in some cases higher than these hormones . how and how much do plant hormones vary in similar circumstances ? by making comparisons with the literature it is possible to observe , for example , that aba has been reported to accumulate during the first 48 hours after p. cucumerina infection with a similar pattern to baba . in that study , report that aba levels increased about 2.5fold after 48 hours of infection , and the aba peak was reached at that time point . in our study , baba similarly accumulated 2.5-fold after 48 hours , although it kept increasing up to 5-fold after 72 hours . in a different study with p. cucumerina , sa and ja have also been reported to increase , but neither hormone was found to increase over 2-fold after 48 hours . during pst dc3000 infection , baba showed a continuous increase over time until reaching 15-fold the control value after 48 hours , whereas in a study by gao et al . both aba and in addition to p. cucumerina and pst dc3000 infection , we also tested the levels of baba after infection with a virulent strain of hyaloperonospora arabidopsidis . interestingly , 3 d of infection with this biotrophic pathogen were not enough for baba to significantly accumulate , as similarly reported by other authors for free sa . finally , salt stress led baba to increase already after 24 hours of treatment , whereas ellouzi et al . report on aba accumulation in leaves of a. thaliana after 3 d of nacl treatment to the roots . in conclusion , although the biologic role of the endogenous production of baba during stress has still to be clarified , its levels in planta and its temporal dynamics suggest , along with its outstanding efficacy in inducing resistance , that baba may be a novel plant ( priming ) hormone . the authors are grateful to all the colleagues which contributed to establishing the methodology to measure baba .

abstractthe capacity of -aminobutyric acid ( baba ) to induce resistance in plants against biotic and abiotic stresses has been known for more than 50 y. in the beginning reports were mainly descriptive of the phenomenon , but it became clear with the discovery of baba insensitive mutants in arabidopsis that there was definitely a genetic basis underlying baba - induced resistance . the study of these mutants , along with the use of regular hormone mutants , allowed establishing the defense pathways activated upon defense induction . to date it is clear that baba potentiates the defense pathway more appropriate to counteract the upcoming stress situation , through a phenomenon termed priming . interestingly , plants possess a receptor for baba , but up to recently there was a general consensus on the fact that baba was a xenobiotic molecule . the development of an accurate non - destructive assay for measuring aminobutyric acid isomers in planta and the finding of plant - produced baba , thus seems to represent the missing link for the discovery of a novel plant hormone . differences and similarities with some of the classical plant hormones are presented here .

bisphosphonate ( bp ) is a potent anti - resorptive agent and was proven to be effective in prevention and treatment of osteoporosis through many randomized prospective studies . reported nonunion after low - energy injury among patients who took bp for several years for treatment of osteoporosis . bone biopsy revealed lack of viable osteoblasts , osteocytes , and osteoclasts in the specimen . fractures were caused by minor injuries and were associated with periosteal callus at the lateral femoral cortex . as the number of reports of this type of fracture increased , the american society of bone and mineral research ( asbmr ) organized a task force team and reported the results on two occasions ( fig . however , in most of the cases , aff occurs in the patients who are taking or who took bp for several years for treatment of osteoporosis or other metabolic bone diseases . it is difficult to estimate the incidence of aff due to its low occurrence in bp users . the estimated incidence of aff is 5 to 100 per hundred thousand patient - years . it is time to declare that bp is the causative agent of aff although bp decreases the incidence of hip and vertebral fractures significantly . the incidence of aff increases significantly when the patient takes bp for 4 years or more than 4 years . prodromal symptoms such as dull pain and tenderness over the lateral aspect of the thigh are noted in 40% to 70% of the patients . it is recommended to check for prodromal symptoms if the patients are taking bp for more than 4 to 5 years . it is necessary to take a simple radiogram of the femur if aff is suspected . simple radiogram often reveals a beak or flare like periosteal and/or endosteal callus in the lateral femoral cortex . sometimes , the so - called ' dreaded black line ' can also be detected in the lateral cortex . if the simple radiogram appears looks normal even though the patient complains of prodromal symptoms , then bone scan or magnetic resonance imaging ( mri ) examination can identify tiny lesions in the lateral aspect of the femur . in korea , dual energy x - ray absorptiometry ( dxa ) examination of axial bone is performed every year to obtain reimbursement from national insurance . we may occasionally detect a tiny periosteal callus in the lateral aspect of the femoral cortex ( fig . 2 , 3 ) . bp should be stopped immediately after aff is diagnosed and calcium and vitamin d ( 1,000 to 2,000 iu ) should be administered . daily subcutaneous injection of recombinant human parathyroid hormone ( pth ; 1 - 34 ) is recommended if the patient can afford it . prophylactic femoral nailing is indicated when the dreaded black line is visible in the lateral femoral cortex , especially in the subtrochanteric area . however , excessive femoral bowing , which is often associated with aff , is an obstacle during femoral nailing . 4 ) delayed healing is reported in 28% of the cases , but the real incidence seems to be higher . in order to prevent delayed union or nonunion , restoration of correct anatomical alignment is recommended after intramedullary nailing . minor malreduction , which is acceptable in cases of ordinary fracture , occasionally causes nonunion and metal failure in aff . daily subcutaneous injection of recombinant human pth ( 1 - 34 ) is also recommended after surgical fixation . careful examination of the contralateral femur is recommended because of the high incidence of bilateral lesions .

bisphosphonate ( bp ) is a useful anti - resorptive agent which decreases the risk of osteoporotic fracture by about 50% . however , recent evidences have shown its strong correlation with the occurrence of atypical femoral fracture ( aff ) . the longer the patient takes bp , the higher the risk of aff . also , the higher the drug adherence , the higher the risk of aff . it is necessary to ask the patients who are taking bp for more than 3 years about the prodromal symptoms such as dull thigh pain . simple radiography , bone scan , and magnetic resonance imaging ( mri ) are good tools for the diagnosis of aff . the pre - fracture lesion depicted on the hip dual energy x - ray absorptiometry ( dxa ) images should not be missed . bp should be stopped immediately after aff is diagnosed and calcium and vitamin d ( 1,000 to 2,000 iu ) should be administered . the patient should be advised not to put full weight on the injured limb . daily subcutaneous injection of recombinant human parathyroid hormone ( pth ; 1 - 34 ) is recommended if the patient can afford it . prophylactic femoral nailing is indicated when the dreaded black line is visible in the lateral femoral cortex , especially in the subtrochanteric area .

carbohydrate antigen 19 - 9 ( ca 19 - 9 ) has recently been developed of digestive tract malignancies . the ca 19 - 9 antibody has been obtained by immunizing mice with human colorectal cell line . the tumor marker ca 19 - 9 is a sensitive marker for pancreatic and hepatobiliary malignacies . the highest frequency of elevated serum ca 19 - 9 level is found in patients with pancreatic cancer . occasionally reported in other primary neoplasms , it is most often associated with the gastrointestinal tract . to the best of our knowledge , no patient with an extremely high serum ca 19 - 9 level resulting from a gastric adenocarcinoma has been reported previously . a 76-year - old man presented with right upper abdominal pain and loss of appetite . on admission , laboratory findings for white and red blood cells and platelet count were normal ; the biochemical parameters were also within normal limits . the serum level of carcinoembryonic antigen was 3.3 ng / ml ( cut - off 5.0 ng / ml ) , and the serum level of ca 19 - 9 was extremely high at 7,080 u / ml ( cut - off 37 u / ml ) . abdominal computed tomography scan showed a 5 6 cm tumor occupying the antrum and no liver metastasis . multiple biopsies showed moderately differentiated tubular adenocarcinoma of the stomach . during laparotomy , no ascites , evidence of enlargement , the tumor was removed by sharp dissection and a distal gastrectomy with d2 lymph node dissection was performed ( fig . pathological review of the resected specimen showed a poorly differentiated non - solid - type adenocarcinoma of the stomach with positive lymph node metastasis for all lymph nodes ( 21/21 lymph nodes ) ( fig . the resected specimen was evaluated as borrmann type iii , stage iiib ( pt3 , pn2 , pm0 ) . immunohistochemical study showed that ca 19 - 9-positive cells were present in the tumor ( fig . 2c , d ) . the patient was treated with 4 courses of systematic chemotherapy with cddp and ts-1 . the serum ca 19 - 9 level decreased to 4,070 ng / ml 2 months after surgery . eight months later , ascites in the abdominal cavity was observed on an abdominal computed tomography image . the serum ca 19 - 9 concentration increases to the greatest extent in patients with pancreatic cancer or cholangiocarcinoma . ca 19 - 9 resembles carcinoembryonic antigen in colorectal carcinoma and various different gastrointestinal adenocarcinomas . the expression of ca 19 - 9 has been studied in normal and malignant gastrointestinal tissues . the antigen was found by immunoperoxidase staining in 4080% of carcinomas from the gallbladder , stomach , pancreas , and colon . the association of elevated ca 19 - 9 levels with gastric carcinoma has been presented in a case report and in other studies . elevated serum levels of ca 19 - 9 have been described in 1530% of patients with gastric cancers , but these patients had multiple liver metastases . elevated ca 19 - 9 levels have been significantly correlated with lymph node metastasis , vascular invasion and liver metastasis . our patient had an exceptionally elevated ca 19 - 9 level , with a serum level over 7,000 ng / ml , and a stomach cancer without liver metastasis or peritoneal dissemination as determined by laparotomy ; at the time of death , the patient 's serum ca 19 - 9 was over 120,000 ng / ml . a high serum ca 19 - 9 level in a patient with gastric cancer is extremely rare .

carbohydrate antigen 19 - 9 ( ca 19 - 9 ) is a sensitive marker for pancreatic and hepatobiliary malignancies . the highest frequency of elevated serum ca 19 - 9 levels is found among patients with pancreatic cancer . ca 19 - 9 has recently been demonstrated to be a marker of digestive tract malignancies . we report the case of a patient with a gastric cancer and a very high serum ca 19 - 9 level . during laparotomy , a large mass was found in the antrum . a distal gastrectomy with d2 dissection of the lymph nodes was performed . histological examination , including immunohistochemistry , revealed an adenocarcinoma of the stomach producing ca 19 - 9 . to the best of our knowledge , no patient with an extremely high serum ca 19 - 9 level resulting from a gastric adenocarcinoma has been reported previously .

holoprosencephaly is a complex brain malformation resulting from incomplete cleavage of the prosencephalon , occurring between the 18 and the 28 day of gestation , with an estimated incidence of 1/16,000 live births and 1/250 conceptuses . three ranges of increasing severity are described : lobar , semi - lobar , and alobar holoprosencephaly . although hydrocephalus can occur during pre- or postnatal development we report here a case of hydrocephalic holoprosencephaly who developed csf ascites following a ventriculoperitoneal shunt ( vp shunt ) and discuss the possible factors involved in this development . a five month - old male child presented with complaints of enlarging head size and poor feeding . a diagnosis of holoprosencephaly was established on performing a ct scan of the head [ figure 1 ] . following this , the patient became symptomatically better after the shunt and a repeat ct scan of the head showed the shunt tip in situ [ figure 2 ] . one month after the shunt , the child presented with progressive distension of the abdomen and decreased feeding . on examination , he was found to have a grossly distended abdomen , fluid thrill and sluggish bowel sounds . the head circumference was 47 cm . a ct scan of the head revealed enlarged the shunt to still be in situ . ct of the abdomen also showed gross ascites without any evidence of loculated fluid collection or lymphadenopathy [ figure 3 ] . under ultrasound guidance , the shunt was exteriorized from the abdominal end , following which abdominal distension decreased and there was improvement in feeding . a new vp shunt was done with the shunt valve upgraded to a medium pressure valve . following this procedure , plain ct scan of the head showing agenesis of bilateral cortical structures seen in alobar holoprosencephaly , along with associated hydrocephalus plain ct scan of the head showing the shunt tip in situ with good visualization of sulcul space , suggestive of a well - functioning shunt contrast ct of the abdomen showing the marked ascites in the abdominal cavity csf ascites has been defined as the accumulation of excess csf within the peritoneal cavity. it is a rare complication of the ventriculoperitoneal ( vp ) shunt . the exact cause of csf ascites is still not clear . on review of literature , various possible mechanisms have been described : i ) excessive csf production in a cases of choroid plexus papilloma may cause csf ascites after vp shunt due to imbalance between csf production and peritoneum absorption . iii ) chronic inflammatory conditions like tuberculosis , peritoneal inflammation by multiple shunt revisions , or allergy to shunt material decrease the absorptive capacity of peritoneum , leading to csf ascites . iv ) csf ascites has also been reported in optic nerve gliomas and in craniopharyngioma . [ 812 ] v ) in brain tumors , especially in astrocytoma , increased vascular permeability can cause microvascular extravasation of plasma into the peritoneal cavity and cause ascites . despite all these postulated mechanisms , no satisfactory explanation has been given to date , and most of the reported cases have unknown etiology . holoprosencephaly is a birth defect that occurs during the first few weeks of intrauterine life . there is incomplete or absent division of the embryonic forebrain ( prosencephalon ) into distinct lateral cerebral hemispheres . variable degrees of facial deformities , mental retardation , epilepsy , or abnormalities of other organ systems such as the cardiac , skeletal , genitourinary , and gastrointestinal may be present . the reason for hydrocephalus remains unclear in alobar hloprosencephaly , and the formation of csf ascites in our case offers an insight into the possible mechanisms involved in the formation of hydrocephalus in these patients . we hypothesize that that the primary problem lies in excessive csf production , which may be actually excacerbating the holoprosencephaly by preventing the growth of the cortical mantle , besides leading to csf ascites , as seen in our case . the cause of excessive csf production may also have a molecular basis and it may be possible that the genes responsible for causing holoprosencephaly may also be responsible for upregulating the csf production . although we achieved a satisfactory short - term outcome in our patient by upgrading the opening pressure of the shunt valve , this may not be desirable as it may lead to chronic hydrocephalus in these patients . patients with holoprosencephaly can develop hydrocephalus , the etiology of which remains to be elucidated . research into the molecular change which occurs at genetic level may shed light on the etiopathogenesis of hydrocephalus in these patients .

holoprosencephaly is usually associated with microcephaly , although macrocephaly is not uncommonly seen . however , the cause of hydrocephalus in holoprosencephaly remains ill - defined . here , the authors report a case of csf ascites following ventriculoperitoneal shunt placement in a five month - old child with alobar holoprosencephaly , and hypothesize that the excessive csf production which occurs in this condition may be responsible for the formation of csf ascites . further research is required to assess whether the gene responsible for holoprosencephaly is also responsible for upregulating csf production in patients with concomitant hydrocephalus .

molluscum contagiosum is a double - stranded dna virus , which is the cause of benign , infectious disease of the skin that is characterized by dome - shaped papules with a central dell or depression clinically . in patients with altered or impaired immunity such as atopic dermatitis , after long term corticosteroid and immunosuppressive therapy use , sarcoidosis , leukemias , wiskott - aldrich syndrome and especially with acquired immune deficiency syndrome , atypical lesions of molluscum contagiosum may occur , often reaching a large size on an unusual site that can also mimic a wide spectrum of other conditions . the presence of giant molluscum contagiosum in immunocompetent patients is rare , and in some reviews it was reported to be a clue for hiv infection in both the pediatric patient group and adult patients . this rare infection must be kept in mind in patients who have solitary pink nodular lesions for a short time , especially on face and anogenital region . a 27-year - old male was admitted to our outpatient clinic with a 4-month history of a 1.5 cm in diameter , asymptomatic , pink nodular lesion on left temporal region ( figure 1 ) . dermoscopic examination revealed white - yellow structureless area in the center of the of lesion and increased linear vascularity on the periphery ( figure 2 ) . histopathologically epidermal hyperkeratosis , acanthosis , widespread viral cytopathic effect and intracytoplasmic inclusion bodies were seen ( figure 3 ) . his laboratory tests for immunsuppresssion , including complete blood counting , immunoglobulins and hiv serology were totally normal . molluscum contagiosum ( mc ) is a common infectious disease of the skin characterized by pearly dome - shaped papules with a central dell or depression located on the face , arms , legs and anogenital region , caused by the molluscum contagiosum virus . the virus replicates in the epidermis and enters the skin from a small skin defect leading to impaired skin barrier function or from contaminated items , such as towels or clothes . specific lesions of mc are usually smaller than 5 mm and less than 20 in number [ 14 ] . although it is known to be a disease of childhood , rarely it can be seen in adults . due to the characteristic appearance of the lesions , specific treatments or therapies are usually not administered for molluscum contagiosum infection in immunocompetent individuals , as lesions will resolve within time . dermoscopy of mc reveals a central pore or umbilication in association with polylobular white to yellowish amorphous structures , which are surrounded by linear , fine , corona - like telangiectasias this apperance may change in atypical cases , especially in atypical localizations . giant mc is a rare nodular variant of molluscum contagiosum , which is 0.51 cm or more in diameter . this clinical presentation may mimic basal cell carcinoma , furuncle , intradermal nevus , amelanotic melanoma , kerathoacanthoma and viral warts . these lesions are rare in healthy children or adults and may accompany altered immunity , such as atopic dermatitis , corticosteroid and immunosuppressive therapy , sarcoidosis , leukemias , wiskott - aldrich syndrome and acquired immune deficiency syndrome . atypical lesions of molluscum contagiosum may occur often and reach large size with extensive distribution on unusual body parts . in our patient there are only a few case reports of giant molluscum contagiosum occurring in immunocompetent patients in the literature . there are also only a few case reports of molluscum contagiosum on the scalp in immunocompetent patients one newborn and one elderly patient . cryotherapy , 10% koh application , trichloroacetic acid , imiqumod , systemic cimetidin , intralesional 5-fu and bleomycin and total excision are the main treatment options . we present this case to present giant molluscum in differential diagnosis of soft , slowly growing tumoral lesions with atypical presentation .

molluscum contagiosum is a benign cutaneous viral infection which is caused by double- stranded dna poxvirus . it affects mainly children and young adults and usually presents with single or multiple umblicated papules or nodules on face , arms , legs and anogenital regions . it may present in atypical size and clinical appearance in patients with altered or impaired immunity and rarely in immuncompetent patients . herein we present an immuncompetent young adult patient with isolated giant molluscum contagiosum , which was mimicking epidermoid cyst clinically .

at the end of their pgy-2 year in june 2012 , 12 prospective chief residents underwent a half - day training session using a curriculum customized by program leadership called lead ( leadership , education , advocacy and development ) . the training included several topics presented by two former full - year pgy-3 chief residents serving in administrative roles , as well as residency program leaders including the chairperson , program directors , and core faculty . session themes included communication , motivation , delegation , feedback , team - building , task completion , clinical teaching , running meetings and career success . in addition , based on self - identified interest or faculty evaluation , some residents were assigned additional roles as directors for the following boards : conference curriculum , continuity clinic , recruitment , community advocacy / esprit de corp , and transition to residency . each of these groups worked closely with faculty members to design strategies for the upcoming year . additionally , each chief met with core faculty early in the month during which they were chief ( an elective or outpatient clinic rotation , in most cases ) to review the chief resident curriculum . each third - year chief received a $ 500 stipend ( one - twelfth of the annual department budget for chief residents ) . after the rotating chief and leadership curriculum was implemented , survey questionnaires were sent to all 29 internal medicine residents in the program at the end of each month to evaluate each chief resident 's performance . these questionnaires were adapted from published literature using a previously evaluated reference model ( 1 , 5 ) ; respondents utilized a 010 scale for each question . the rotating chief for any given month was excluded from participating in the group surveys ; however , he or she was asked to participate in a separate set of surveys that evaluated his or her leadership capacities as demonstrated throughout the chief rotation . all other participating residents evaluated the rotating chief on his or her performance throughout the rotation . thirteen valid junior resident responses were obtained for the chief resident evaluation survey : eight from pgy-1 and five from pgy-2 . the data from the pgy-1 respondents yielded similar means to that of the pgy-2 class , so the two classes were merged for final analysis . junior residents reported that the chief residents elicited input from others ( 6.8 ) , were committed to the team ( 6.8 ) , resolved conflict ( 6.7 ) , ensured efficiency , organization and productivity of the team ( 6.7 ) , participated actively ( 7.0 ) , and managed resources ( 6.6 ) . pgy-3 ( n=16 ) responses provided higher averages on all the above measures ( table 1 ) . the pgy-3 class ( n=9 ) also gave higher ratings of the chiefs teaching skills than did the junior residents ( n=7 ) . rating of chief residents by postgraduate year of rater self - evaluation by the chief residents ( n=5 ) revealed that they rated their ability in leadership low ( mean 6.0 , sd 1.2 ) ; they also reported low comfort with being chief resident ( mean 5.8 , sd 0.8 ) . they were more comfortable running a morning report ( mean 8.4 , sd 1.5 ) or noon conference ( mean 7.6 , sd 1.5 ) than a quality improvement study ( mean 6.8 , sd 1.1 ) . additionally , pgy-1 and -2 residents appeared to be more critical of the leadership and teaching skills of the third - year chief residents than were their own pgy-3 cohorts . first , the responses from the pgy-3 class were self - ratings and may have inherent bias . second , the study was performed at a single internal medicine program , and may thus have limited generalizability to other residency programs . hypothesis testing was not applied to this data due to a lack of power to detect a statistically significant difference . despite these limitations , we suggest that there may be a role for introducing a rotating pgy-3 chief curriculum in residency programs that do not have pgy-4 chief residents . it may be worthwhile to explore on a larger scale whether obtaining input from junior residents would correlate with the success of elected chief residents . interestingly , 86% of family medicine programs utilize input from residents in the selection of chief residents ( 7 ) . it may be useful to extend the study to include internal medicine residency programs that have both pgy-4 and pgy-3 chiefs , and to gather data on the selection processes of chiefs as well as quantitative ratings of the chiefs productivity , leadership , resident satisfaction , and other metrics that would help other programs determine how to improve selection of , and role definition for , chief residents . the feasibility of accomplishing this through a rotating pgy-3 chief residency curriculum was explored at one small program , and larger studies are indicated .

introductionthe role of the internal medicine chief resident includes various administrative , academic , social , and educational responsibilities , fulfillment of which prepares residents for further leadership tasks . however , the chief resident position has historically only been held by a few residents . as fourth - year chief residents are becoming less common , we considered a new model for rotating third - year residents as the chief resident.methodsonline surveys were given to all 29 internal medicine residents in a single university - based program after implementation of a leadership curriculum and specific job description for the third - year chief resident . chief residents evaluated themselves on various aspects of leadership . participation was voluntary . descriptive statistics were generated using spss version 21.resultsthirteen junior ( first- or second - year ) resident responses reported that the chief residents elicited input from others ( mean rating 6.8 ) , were committed to the team ( 6.8 ) , resolved conflict ( 6.7 ) , ensured efficiency , organization and productivity of the team ( 6.7 ) , participated actively ( 7.0 ) , and managed resources ( 6.6 ) . responses from senior residents averaged 1 point higher for each item ; this pattern repeated itself in teaching evaluations . chief resident self - evaluators were more comfortable running a morning report ( 8.4 ) than with being chief resident ( 5.8).conclusionthe feasibility of preparing internal medicine residents for leadership roles through a rotating pgy-3 ( postgraduate year ) chief residency curriculum was explored at a small internal medicine residency , and we suggest extending the study to include other programs .

refractive surgery was initially used to treat asymmetric or unilateral high myopia in children with ablyopia , who where refractory to conventional treatments such as spectacles , contact lenses , or traditional patching or penalization therapy . these studies showed that laser - assisted in situ keratomileusis ( lasik ) and photorefractive keratectomy ( prk ) could be performed safely and effectively in children.15 however , these studies only treated older children , mostly over the age of eight years . one of the limiting factors that did not allow younger children to be treated was the need for general anesthesia . despite reporting successful treatment , these authors also reported the limited effects on the final visual outcomes , attributed to the fact that they were treating children outside the amblyogenic ages . this is especially true if children fail the current established treatment such as spectacle correction , contact lenses , and patching or penalization . anisekonia due to retinal disparity in children with significant anisometropia , greater than three diopters , is a major problem in a child that can not wear contact lenses.6 corneal refractive surgery offers on the corneal plane treatment , aiding in the anisekonia . initial studies aimed at treating the anisometropia by correcting the difference in the refractive disorders . other studies have used refractive surgery in children to treat bilateral high myopia7 and accommodative esotropia.810 both lasik and prk have been used in children as young as two years of age.71112 lasek ( laser subepithelial keratomileusis ) has also been used with good success.1213 topical anesthesia with self - fixation can be employed in older , cooperative children.351415 premedication with anxiolytic agents such as midozolam or diazepam has also been used.1416 in young children , general anesthesia with iv sedation or laryngeal mask can be used.17 the first refractive study in children was published in 1995.2 prk , although effective initially , has been hampered by corneal haze . corneal haze has been reported at a rate as high as 25% and has been associated with failure to comply with longer term steroid regimen postoperatively.2716 in one study , severe corneal haze was found in 2.5% of the patients in two month and in 7 % after seven months , especially in high myopic treatments.16 in one study , a three - year follow - up on a cohort of patients treated with prk , with myopia up to - 15d and hyperopia up to + 5d , found stable refraction and improvement in visual acuity and stereopsis , with minimal corneal haze.11 myopic regression after prk in children was noted at a level as high as 69% of the patients , with a shift toward myopia at a rate of 1d per year.18 this was attributed to an axial myopic shift related to normal growth patterns of the eye and partly to the more rapid healing response observed in children . persistent corneal haze formation in lasik is seldom seen in children and adults , and has been reported in one child.4 lasik flap complications have been reported , including epithelial ingrowth , wrinkles , diffuse lamellar keratitis , and free flaps , at a rate similar to adult lasik surgery.41419 despite early flap - related complications numerous studies have shown lasik to be safe and effective even in children as young as two years of age.41420 visual acuity outcome data is limited , given the younger age of children and ongoing treatment of amblyopia . authors report the desired postoperative outcomes with patients remaining orthophoric , with residual refractive error of less than 0.375 with regression of 1.19d after one year.11421 pediatric refractive surgery based on the current available data appears to be safe and effective . current indications for refractive surgery include anisometropia , bilateral high myopia , and accommodative esotropia . corneal haze is certainly a major concern in children receiving surface ablation , especially in high myopic treatments . initial reports on the use of phakic intraocular lenses may be a good alternative in these cases.2223 in lasik , surgery flap complication rates , although appear similar to those in adults , is still a concern . myopic regression is seen with both procedures , whether it is secondary to aggressive healing or natural growth of the eye is still to be determined . prospective controlled clinical trials are still needed to better demonstrate long - term safety and efficacy .

with the advent of corneal refractive surgery using excimer laser technology , treatment for corneal and refractive disorders have advanced tremendously and become very precise and predictable . the use of these techniques in the treatment of corneal and refractive disorders in children , especially during the amblyogenic ages , would be invaluable . numerous reports on refractive surgery in children have demonstrated that it can be performed safely and efficaciously in the pediatric population . however , controversy still exists whether it should be done in this population . we explore the available published data to address this controversy .

fibromatosis colli ( fc ) also known as sternocleidomastoid tumor , a self limiting lesion , presents as a firm to hard , immobile , fusiform swelling in the lower or middle portion of the sternocleidomastoid muscle and usually appears within the first few weeks of life . birth injury is supposed to play an important role in the pathogenesis , which is otherwise debatable as some of the cases do not have any history of birth injury . as the treatment of fc is usually conservative and avoids surgical procedures by employing physiotherapy , the diagnostic , noninvasive technique of fine - needle aspiration cytology ( fnac ) becomes important . fc has to be differentiated from congenital lesions , inflammatory lesions , neoplastic conditions both benign and malignant and other forms of infantile fibromatosis that may occur at that site . fc can be differentiated from other forms of infantile fibromatosis on the basis of the clinical features such as age , site , infiltrative pattern , and cytological features such as bland - appearing fibroblasts , degenerative , atrophic skeletal muscle , and muscle giant cells without inflammatory cells in a clean background.[26 ] in contrast to other forms of fibromatosis , a noninvasive , conservative management is usually the line of treatment for fc in most of the cases . fnac is a noninvasive method of diagnosis of fc that is thus useful in its management . we report here a case of a one month - old child with fc diagnosed by fnac and treated conservatively . a one month - old , male child delivered by forceps was being treated for right sided erb 's palsy in the physiotherapy department . at the time , a 22 cm , firm to hard swelling was noticed in the left side of the neck at the anterior aspect of the sternocleidomastoid muscle along with restricted mobility . the sheets of cells showed streaming in foci and the cytoplasm was eosinophilic with plump nuclei . also seen were atrophic skeletal muscle fibers and regenerating muscle giant cells [ figure 2 ] . single and sheets of spindle - shaped cells with atrophic muscle fibers ( h and e , 400 ) atrophic skeletal muscle fibers and regenerating muscle giant cells ( h and e , 400 ) fc is a self - limiting , benign tumor of infancy , presenting shortly after birth . the cause of the growth is debatable , but is usually associated with difficult or assisted labor and breech deliveries . birth injury resulting in ischemia may be the likely cause but it may also be probable that the growth is the cause rather than the effect of abnormal labor . another theory is that the growth is a peculiar , hamartomatous process that is unrelated to birth injury or vascular impairment . clinically , fc has to be differentiated from congenital lesions such as branchial cleft cysts , thyroglossal duct cysts , inflammatory lesions like tuberculous lymphadenitis , benign neoplastic conditions like hemangioma , cystic hygroma , lipoma , and malignant neoplasms like neuroblastoma , rhabdomyosarcoma , and lymphoma . a simple the cytomorphological features of fc are distinct with bland - appearing fibroblasts and degenerative , atrophic skeletal muscle in a clear background without any evidence of inflammation or hemorrhage . large numbers of mature and immature skeletal muscle fibres , muscle giant cells ; numerous , plump fibroblasts ; and collagen have been found along with a number of bland , bare nuclei in the background . [ 26 ] other infantile fibromatosis which tend to resemble fc can be differentiated on the basis of clinical features such as age , site , and infiltrative pattern and also , based on certain cytological features . cytologically , fc is differentiated from nodular fasciitis by the pleomorphism of proliferating fibroblasts and myofibroblasts with ovoid or kidney - shaped nuclei . bi- and multinucleated forms may be seen in a myxoid background along with inflammatory cells . other infantile fibromatoses can be differentiated on the basis of clinical features such as age , site , and infiltrative pattern and based on cytological features including collagen fragments and spindly nuclei . fc can be diagnosed by fnac , a noninvasive procedure , with newer , nonsurgical treatment procedures resulting in the regression of the lesions in 90% of cases .

fibromatosis colli is a peculiar , benign fibrous growth of the sternocleidomastoid that usually appears during the first few weeks of life and is often associated with muscular torticollis . fibromatosis colli ( fc ) is seen in children born after difficult , prolonged labor , assisted delivery , and breech deliveries . clinically , fc has to be differentiated from congenital lesions , inflammatory lesions , and neoplastic conditions both benign and malignant that may occur at that site . fine - needle aspiration cytology ( fnac ) is a simple technique that will help in excluding the above conditions and also in avoiding surgical procedures . fibromatosis colli also resembles other forms of infantile fibromatosis , but its behavior , microscopic appearance , and its treatment distinguish it from other forms of infantile fibromatosis . in contrast to other forms of fibromatosis , a noninvasive , conservative management is usually the line of treatment for fc in most of the cases . fnac is a noninvasive method of diagnosis of fc that is thus useful in its management . we report here a case of fibromatosis colli diagnosed by fnac .

infectious adenitis has been rarely reported in neonates , 40 cases of neonatal suppurative parotitis and only 17 cases of isolated submandibular sialadenitis have been reported in english literature . we describe a 18 days old neonate with suppurative parotitis associated with submandibular abscess , which was treated by incision and drainage . the present case report is about an 18 days old full term female neonate presented to our department with swelling in parotid and submandibular area on left side for 6 days . the local examination revealed a swelling about 5 cm 4 cm in size in parotid area extending down to submandibular and submental area . overlying skin was erythematous and swelling was fluctuant [ figure 1 ] . left parotid and submandibular abscess further examination revealed that upon pressing the swelling , purulent material was extruding through the floor of the mouth [ figure 2 ] . the base line investigation were done which showed leucocytosis - 18,000/l with neutrophillis - 80% , kidney and liver function tests were normal , incision and drainage of the abscess was done about 30 - 40 ml of frank pus was drained . patient was already put on amoxicillin + clavulanate ( 15 mg / kg orally every 12 h ) . after two weeks and then at 1 month of discharge from hospital , baby had completely recovered . suppurative parotitis is usually unilateral and may progress to abscess formation . among salivary glands ; the involvement of parotid gland is more common than submandibular gland . . the risk of parotitis in premature babies may be related to dehydration leading to stasis in the salivary gland ducts due to reduced secretions . most common mode of spread is tracking of oral flora in a retrograde fashion into gland , although gland may get invaded with bacteria through the blood stream . decreased salivary production and stasis , dilatation of ducts through scaring or obstruction by stone , variation in ductal structure may lead to retrograde flow from oral cavity . another potential cause of transmission of bacteria is during the breast feeding and a through contaminated formula , as in the present case infant was breast fed , but the mother had no signs of mastitis , as the history of maternal mastitis can act as a source of bacterial invasion as described by tapsz et al . breast feeding can not be considered as a risk factor for suppurative parotitis as there are more chances of contamination with formula feeds . as in our case the history of initial appearance of swelling and erythema were in the preauricular area which then progressed subsequently to involve the submandibular and submental area . examination with ultrasound is readily available , cheap , noninvasive and useful for diagnosis and differential diagnosis and excluding abnormality of stenosis of the duct , siolith . purulent drainage from stensen 's duct is diagnostic of the suppurative parotitis as is demonstrated in our case . in a report of spigel et al . , the most common pathogen was s. aureus , which was found in 55% of the patients . in our patient , the main stay of the treatment is to use antibiotics to cover the causative organism i.e. , s. aureus . however as our baby had large fluctuant swelling we decided to do the incision and drainage of the abscess . we found that after incision and drainage antibiotics had to be given for 1 - 2 days and the hospital stay was also reduced by 4 - 5 days . although incision and drainage is less frequently used in this modern antibiotics era but it has still got a very important role in frank abscess formation as in our case . incision and drainage also helps to isolate the organism and appropriate antibiotic needed in case of some residual purulent material remains in the abscess cavity . although the parotitis is very rare in neonates as described it should be suspected in neonates with erythematous preauricular swelling . delay in diagnosis and treatment may lead to involvement of surrounding glands as in our case . and in case of frank purulent nature of the abscess treatment should be incision and drainage which the promptly decreases the burden of septic focus , duration of antibiotic therapy and hospital admission .

suppurative involvement of salivary gland in neonates is a rare disorder . parotid gland being the most commonly involved . we described a case of suppurative parotitis leading to abscess formation and subsequent involvement of the submandibular gland . incision and drainage of the abscess was performed , most of the purulent material was drained . symptoms and signs resolved within 2 days . pus culture grew staphylococcus aureus

a 4-year - old female patient from parents of consanguineous marriage presented to our dental op with a chief complaint of missing teeth in the upper and lower front jaw region and unaesthetic appearance since birth . patient has undergone surgery 2 years back for bowed legs and her walk has improved . on general examination , she showed stunted growth [ figure 1 ] and polydactyly in both the hands [ figure 2 ] and right leg with dysplastic nails . in the left leg the third and the fourth toes showed syndactyly [ figure 3 ] . her brother who was 19 years old also had similar problem with stunted growth [ figure 1 ] , polydactyly [ figure 2 ] in both the hands , syndactyly [ figure 3 ] of the left fourth and fifth toe with missing anterior teeth . polydactyly of the hands polydactyly of the feet on intraoral examination of the girl showed partial hare lip [ figure 4 ] with obliteration of upper labiogingival sulcus , the mandibular arch showed multiple , high frenal attachments [ figure 5 ] . the boy also showed partial hair lip [ figure 4 ] , missing anterior teeth with multiple high frenal attachments [ figure 5 ] . the girl 's wrist joint anteroposterior view shows that the fourth and fifth metacarpals are fused on both sides with decreased bone density in the metacarpals [ figures 7 and 8 ] . orthopantamograph of the boy and girl reveals missing maxillary and mandibular anterior teeth , conical mandibular laterals [ figure 9 ] . chest radiograph - posteroanterior view the boys hand wrist radiograph shows fusion of fourth and fifth metacarpals on both sides anteroposterior view of feet shows decreased bone density in tarsal and metatarsal bones ellis van creveld syndrome or chondroectodermal dysplasia syndrome is an uncommon disease inherited as an autosomal recessive trait with the incidence of 1:244,000 of the total population . chondrodystrophy is the most consistent clinical feature which is due to a defect in ossification that results in short stature and limb shortening which is more striking in the distal rather than proximal extremities . polydactyly is always present with typical postaxial hexadactyly of the hands and in few cases feet . the signs of ectodermal dysplasia is usually limited to nails , teeth , and gums . partial harelip , maxillary alveolar clefts , abnormal tooth shape ( conical teeth ) , size ( micro / macrodontia ) , structure ( enamel hypoplsia ) , number ( missing teeth / fused teeth ) , site of implantation ( disorderly arranged and irregular spacing ) , multiple labial frenum , obliteration of the labiogingival sulcus are all pathognomonic and should be used in primary diagnosis . cardiac defects are found in 5060% of patients with a common atrium and persistent atrioventricular canal being the most common defects . patient ductus arteriosus , ventricular septal defects and atrial septal defects could also be present . radiological features comprise a narrow thoracic cage and wide , spade - like anterior ends . the differential diagnosis of ellis van creveld syndrome includes thoracic dysplasia of jeune , weyers acrofacial dysostosis , k / c kusick - kaufman syndrome , thoracic cage deformity , chondrodysplasia punctata , asphyxiating thoracic dystrophy . ellis van creveld syndrome or chondroectodermal dysplasia of the siblings showed bilateral ploydactyly , partial hare lip , multiple labial frenum , obliteration of the labiogingival sulcus , partial anodontia , conical teeth with stunted growth all of which are pathognomonic for the dignosis . the management of patients with evc requires a multidisciplinary approach which includes many specialties such as the pulmonologist , cardiologist , orthopedician , oral and maxillofacial surgeon , pediatrician , pedodontist , prothodontist , and radiologist along with oral and maxillofacial radiologist . this case reportenlightens the awareness of evc syndrome though very rare is still a possibility . the authors certify that they have obtained all appropriate patient consent forms . in the form the patient(s ) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity , but anonymity can not be guaranteed . the authors certify that they have obtained all appropriate patient consent forms . in the form the patient(s ) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity , but anonymity can not be guaranteed .

ellis van creveld syndrome or chondroectodermal dysplasia is a rare autosomal recessive disorder presenting several skeletal manifestations and congenital heart malformations . ellis van creveld syndrome comprises of a tetrad of clinical manifestations of chondrodysplasia , polydactyly , ectodermal dysplasia , and cardiac defects . here , we are presenting a very rare case of ellis van creveld syndrome in siblings .

in this commentary we discuss the study of scannapieco and colleagues published in a recent issue of critical care . ventilator - associated pneumonia ( vap ) frequently occurs in icus , with reported incidences ranging from 9% to 27% . it is a leading cause of morbidity and , possibly , of mortality . as a result , colonization of the upper respiratory tract generally precedes the occurrence of vap , most probably because of a reduced capacity to clear pathogens and/or an increased adherence of micro - organisms to the respiratory tract . prevention of oropharyngeal colonization has been achieved with topically applied non - absorbable antibiotics ( referred to as selective oropharyngeal decontamination with antibiotics ( ab - sod ) ) or with topically applied chlorhexidine gluconate ( chx - sod ) . ab - sod was associated with reduced incidences of vap in various studies [ 4 - 6 ] , and recently also with a better 28-day survival in a large dutch multi - center study . in that study , ab - sod was equally effective in improving patient outcome as selective decontamination of the digestive tract ( sdd ) , which combines ab - sod with intestinal decontamination and 4 days of intravenous cefotaxim . the occurrence of resistance as a result of ab - sod or sdd , however , remains of concern , especially in countries with endemic levels of antimicrobial - resistant bacteria ( amrb ) . therefore , simply replacing antibiotics with antiseptics for oral decontamination might offer an effective and safe measure for icu patients , even in settings with high levels of amrb . indeed , chx - sod appeared effective in reducing vap incidence in several studies [ 8 - 13 ] . however , the regimens used were not always carefully described and concentrations and dosing frequencies varied from 0.12% chx twice daily to 2% chx four times a day . in addition , patient populations varied widely : from mixed icu populations to surgical icu patients and patients undergoing cardiac surgery . furthermore , nasal application of chx was used in one study and chx was combined with colistine in another , and in one study effects were compared to historic controls . moreover , all individual studies published so far have been underpowered to demonstrate effects of chx - sod on patient survival . in a recently published systematic review and meta - analysis , chx - sod was associated with a significant reduction in vap incidence of 44% , although the studies were very heterogeneous , which precludes firm conclusions about its protective effects . no reductions in overall mortality , duration of mechanical ventilation or length of stay could be demonstrated . in their article , scannapieco and colleagues aimed to determine the optimal frequency of chx - sod to prevent vap in trauma icu patients . the study contains a control group ( 49 patients ) and two intervention groups receiving chx 0.12% either once ( 47 patients ) or twice daily ( 50 patients ) . they conclude that the number of staphylococcus aureus in dental plaque was reduced in both intervention groups , but no significant reductions were observed in the total number of respiratory pathogens or incidence of vap . estimated reductions in colonization were 25% and 30% in the ' twice - daily ' and ' once - daily ' groups , respectively . the odds ratio for developing vap was 0.54 ( 95% confidence interval 0.23 to 1.25 ) for patients receiving chx - sod , which is remarkably similar to the pooled estimate from the most recent meta - analysis . although this may suggest a beneficial effect of chx - sod , it can not be demonstrated by a study of this sample size . in summary , the evidence that both ab - sod and chx - sod reduce vap incidence in icu patients is accumulating . the optimal frequency and concentration for chx - sod remains to be demonstrated . from scannapieco and colleagues ' study we can conclude that twice daily is not necessarily better than once daily , but maybe a four times daily regimen with 2% instead of 0.12% chx does make a difference . what we need now are well - designed and adequately powered studies to evaluate the effects of these measures on length of icu stay and survival . if these effects were demonstrated , chx - sod would offer a very cheap and ( ecologically ) safe infection prevention measure in patient populations increasingly suffering from infections caused by amrb . ab : antibiotics ; amrb : antimicrobial - resistant bacteria ; chx : chlorhexidine ; sdd : selective decontamination of the digestive tract ; sod : selective oropharyngeal decontamination ; vap : ventilator - associated pneumonia .

ventilator - associated pneumonia ( vap ) is a common cause of morbidity , antibiotic use , increased length of stay and , possibly , increased mortality in icu patients . colonization of the oropharyngeal cavity with potentially pathogenic micro - organisms is instrumental in the pathogenesis of vap , and selective oropharyngeal decontamination ( sod ) with antibiotics ( ab - sod ) or antiseptics , such as chlorhexidine gluconate ( chx - sod ) , has been associated with reduced incidences of vap . in a recent issue of critical care scannapieco and colleagues investigated differences in oropharyngeal colonization between mechanically ventilated patients receiving oropharyngeal decontamination with 0.12% chx - sod either once or twice daily compared to placebo . chx - sod was associated with a reduction in staphylococcus aureus colonization , but the study was underpowered to demonstrate a reduction in vap incidence . we urgently need well - designed and adequately powered studies to evaluate the potential benefits of chx - sod on patient outcome in icus .

its antinociceptive effects are mediated by a combination of -opioid agonist effects , and norepinephrine and serotonin reuptake inhibition , and it can suppress opioid withdrawal . first marketed in the 1970s , tramadol was said to have a low - abuse potential.[25 ] however , its abuse liability and diversion were soon recognized , with several reports on physical dependence.[612 ] the largest series of tramadol - dependence was reported from a study in sweden , comprising of 104 patients , where the majority were women . in another series 97% of the abusers had a history of abuse of other substances . association with seizures at therapeutic and toxic doses has been reported , as has been the abuse among occupations like physicians and air force personnel . in india , because of the laxity in drug regulation implementation , opioids are often available over - the - counter ; increasing the risk of opioid misuse . however , we could trace only one case report of tramadol - dependence from india . we present a series of seven cases seeking treatment at our centre for tramadol - dependence . the seven cases with tramadol - dependence , diagnosed as per icd-10 , sought treatment at the drug de - addiction and treatment centre , department of psychiatry , pgimer , chandigarh [ table 1 ] . the dose of tramadol , taken on a regular basis , ranged 50 mg to 1500 mg per day . the reported reasons for initiation of tramadol included , as an alternate to other opioids , to counter opioid withdrawal , and being prescribed for headache and opioid detoxification . six of the seven patients had been using other opioids at some point in their lives . four subjects , treated as inpatients and started on oral opioid antagonist naltrexone 50 mg / day , showed poor treatment compliance . one patient , who had earlier relapsed while taking oral naltrexone , was prescribed an oral buprenorphine as an opioid - type analgesic , which exerts its effects through multiple receptor systems , tramadol carries a dependence producing potential . this needs to be taken into consideration when detoxifying the patient from other opioids . in three of our patients , initiation of tramadol use had begun with a prescription of tramadol for detoxification ; they were not able to taper the doses of tramadol as per prescription . thus , tramadol is used by opioids - dependent subjects as a substitute for the unavailable harder drugs . detoxification of our patients was done largely with oral clonidine and non - steroidal anti - inflammatory drugs ( nsaids ) , as reported by some , but not others who used the buprenorphine naloxone combination and methadone for tramadol - detoxification . apart from those patients with medical disorders using tramadol ; the drug has the potential for abuse by opioids - dependent subjects . given the easy availability of tramadol from pharmacies in india and some other countries , its abuse and diversion may become a bigger challenge in the future . there is a need to effectively regulate the distribution of this medication , and apply the appropriate safeguards , to prevent diversion . it emphasizes the need for caution before prescribing tramadol to patients , especially those who are opioids - dependent , and to apprise the drug regulatory authorities of such occurrences , for proper scheduling and issue of warnings .

tramadol is an atypical , centrally acting , synthetic analgesic , acting through opioid and non - opioid systems . we present a series of seven cases , all men , who sought treatment at our centre for tramadol - dependence . the majority were using other opioids at some point in their lives . their tramadol use had begun with a prescription of tramadol for opioid detoxification , for headache and body pains , and as an alternative to injectable opioids . the doses of tramadol used varied from 50 to 1500 mg per day . all subjects reported an experience of euphoria with tramadol use . four patients were put on naltrexone , but had poor compliance . this case series underscores the need for caution , while using tramadol in substance - dependent patients .

osteosarcoma ( os ) is an aggressive primary bone malignancy with a high propensity for pulmonary and skeletal metastases . metastases at other sites are rare . unlike other malignancies such as carcinoma breast , colorectal , head and neck malignancies , lymphoma , and melanoma where the role of fluorine-18 fluorodeoxyglucose ( f-18 fdg ) positron emission tomography / computed tomography ( pet / ct ) for restaging evaluation is established , the role is yet , we wish to demonstrate the ability of f-18 fdg pet / ct scan to detect unusual sites of disease recurrence . a 26-year - old young gentleman , a diagnosed case of os of right femur was treated with neoadjuvant chemotherapy followed by wide excision of the mass with prosthesis insertion . the patient had a disease free interval of 6 years following which he presented with a lump over the anterior abdominal wall . fine - needle aspiration cytology of the lump was suggestive of disease recurrence [ figure 1 ] . restaging f-18 fdg pet / ct revealed metastatic deposit in right paraspinal muscle at the level of c1 vertebra , muscle deposit in right arm , subcutaneous nodules in anterior abdominal wall , right lateral chest wall , left arm , serosal deposit over ascending colon and pancreatic deposit in addition to the pulmonary and bone metastases . no evidence of active disease was noted in the periprosthetic region at the operated site [ figure 2 ] . the patient was started on metronomic chemotherapy . fine - needle aspiration cytology of the anterior abdominal wall lump - h and e stained slides revealed hypercellular smear showing markedly pleomorphic/ sarcomatous cells including giant cells amidst stroma consistent with osteogenic sarcoma ( 200 ) . insert : a large sarcomatous cell with a pleomorphic nucleus and moderate cytoplasm ( 100 ) maximum intensity projected image ( a ) revealed multiple foci of increased fluorodeoxyglucose uptake which on correlative fused axial images corresponded to subcutaneous anterior abdominal wall deposit ( b ) , muscle deposit in right arm ( c ) , pancreatic deposit ( d ) , serosal deposit over ascending colon ( e ) , sternal ( f ) , and pulmonary metastases ( g ) . osteosarcoma is the most common nonhematolymphoid primary bone tumor arising from malignant transformation of primitive mesenchymal cells that produce osteoid or immature new bone . the peak incidence is seen in the second decade of life with slight male preponderance . although it can affect any bone , it has a predilection for metaphyses of long bones . the 5-year overall survival rate for primary localized os is about 75% compared to 25 - 50% in cases with lung or bone metastases . tumor site , size , metastases at presentation , response to chemotherapy , and surgical remission are some of the known independent prognostic factors . however , recurrence after 5 years is very rare and seen only in 5% of cases . lungs and bones are the common sites of disease recurrence . the unusual sites of recurrence reported in english literature are kidney , brain , muscle , subcutaneous tissue , stomach , duodenum , and penis . patients with pulmonary recurrence have a better prognosis as compared to those with extrapulmonary involvement . fluorine-18 fdg pet / ct has established the role in staging , assessment of treatment response , and restaging of various malignancies . the whole body survey of f-18 fdg pet / ct provides a one - stop shop for evaluation of local disease as well as detecting sites of distant metastases . in a systematic review on the role of f-18 fdg pet / ct in staging and restaging of oss , quartuccio el at suggested that f-18 fdg - pet and pet / ct is superior to bone scintigraphy and conventional imaging methods in detecting bone metastases ; while spiral ct is superior to f-18 fdg - pet for detection of pulmonary metastases from os . they recommended that combination of f18-fdg pet / ct with conventional imaging methods is a valuable tool for staging and restaging of os . though os are known to recur at local site or involve the lungs and bone , rarely they can also involve unexpected soft tissue sites such as muscle , subcutaneous tissue , anterior abdominal wall , serosal , and pancreatic deposits , respectively , as exemplified by our case . detection of multiple atypical sites of recurrence of os on f-18 fdg pet / ct in a single patient after 6 years of disease free interval makes our case unique . this case further emphasizes the potential role of whole body f-18 fdg pet / ct imaging in restaging of os and provides an impetus to conduct further prospective multicenter trials to validate the role of f-18 fdg pet / ct in restaging of os . the present case underscores the ability of f-18 fdg pet / ct to detect unusual sites of recurrence .

osteosarcoma ( os ) is the most common nonhematolymphoid primary bone malignancy characterized by osteoid or new bone formation . lungs and bones are the most common sites of metastases . we report a case where unusual sites of the soft tissue recurrence from os were detected on restaging fluorine-18 fluorodeoxyglucose positron emission tomography / computed tomography scan done post 6 years of disease free interval .

foreign body aspiration ( fba ) is one of the most common and lethal problems which accounts for 7% of life threatening accidents in children aged 13 years . however , often it may remain undetected due to atypical history or misleading clinical and radiological findings . delayed diagnosis may occur when parents under appreciate the symptoms or when physicians overlook clinical and radiological findings . the diagnosis and removal of the object become much more difficult in such cases . here , we report a case of bronchiectasis due to long - term retained foreign body left lower lobe lung which was initially thought to be as postpulmonary tuberculosis ( tb ) sequel . a 17-year - old girl was referred to our hospital with chief complaints of recurrent hemoptysis for 1 year with fever off and on . although the history of occasional mild hemoptysis was present for the last 5 years , its frequency gradually increased to as many as 5 times in a month . the patient was referred to our institute from a government medical college hospital for surgery . chest x - ray and contrast - enhanced computed tomography chest confirmed the diagnosis of medial basal segment bronchiectasis of the lower lobe of left lung [ figures 1 and 2 ] . in spite of sputum negative for acid fast bacilli ( afb ) , the patient had been given a full course of antitubercular therapy on daily basis for 6 months 5 years ago . bronchial artery embolization was also done for her persisting symptoms 6 months prior to her referral to our institute . finally , the decision of surgery was taken as there was no improvement in her symptoms . mild to moderate adhesions was found intraoperatively , and finally , left lower lobectomy was performed . histopathological report of the postoperative specimen of the left lower lobe lung revealed foreign body with nonspecific changes . retrograde history from the parents revealed the occurrence of fba ( small piece of plastic whistle ) long back approximately 10 years ago when the patient was about 7 years old . positive history further added to the diagnosis of the left lower lobe bronchiectasis as a complication of long - standing retained foreign body in lung . the postoperative course was uneventful , and the rest of the lung expanded completely [ figure 3 ] . preoperative contrast enhanced computed tomography chest showing left lower lobe lung bronchiectasis postoperative chest x - ray showing expanded left lung zhijun et al . in their therapeutic experience from 1428 patients with pediatric tracheobronchial foreign body found that these foreign bodies were located in the trachea in 75 cases ( 5.25% ) , right bronchial tree in 780 patients ( 54.62% ) , left bronchial tree in 567 cases ( 39.71% ) , and bilateral bronchial tree in six cases ( 0.42% ) . types of foreign body included peanuts ( 1244 cases , 87.12% ) , beans ( 93 cases , 6.51% ) , and others ( 91 cases , 6.37% ) . coughing , choking , acute dyspnea , sudden onset of symptoms , and wheezing are the main features of fba in tracheobronchial tree . sometimes , it can subside spontaneously and quickly even when a foreign body is in situ . of all these signs and symptoms , the most predictive one is witnessed aspiration associated with a choking episode ( penetration syndrome ) . had described that neither clinical signs and symptoms nor radiology hasve sufficient diagnostic sensitivity or specificity , on which one can rely for the diagnosis . only the presence of choking crisis , when elicited in history , has good sensitivity and specificity ( 96% and 76% , respectively ) in their series . fba may lead to airway compromise and death or serious sequels such as bronchiectasis , atelectasis , and recurrent pneumonia . to prevent these complications , prompt diagnosis and removal of foreign body are mandatory . whenever a choking crisis is present in the patient 's history , however , absence of early symptoms and radio - opaque objects should not exclude the possibility of foreign body inhalation . in this case , the reason behind not reaching the correct diagnosis preoperatively was neglecting the importance of detailing the remote history of fba and absence of symptoms as well during aspiration . another reason for incorrect diagnosis was confusing the sequel of fba with that of pulmonary tb . it is the under appreciation of symptoms of choking crisis which leads to retained foreign body . bronchiectasis and all other long - term complications which occur after pulmonary tb can also occur due to retained foreign body lung . hence , the importance of a proper history taking can not be overlooked , and possibility of fba should always be ruled out in such cases before making a diagnosis of pulmonary tb and thus subjecting the patient to long - term and cumbersome antituberculosis therapy unnecessarily .

tracheobronchial foreign body aspiration ( fba ) is a very common and lethal problem among children . it can easily be diagnosed with a typical history of choking crisis . clinical examination and radiology play a secondary role in diagnosis . acute choking episode may lead to death or else to serious sequels such as bronchiectasis , atelectasis , and recurrent pneumonia . here , we report an interesting case of bronchiectasis in a young female initially thought to be a consequence of pulmonary tuberculosis , who was subsequently found to have retained foreign body in the left lower lobe lung which was the actual cause of her symptoms .

a 22-year - old gravida two para one woman in her 23 week of pregnancy presented with a painful papular eruption on her face and neck of one week 's duration . she denied history of sick contacts , sun exposure , or sexually transmitted diseases . on examination , her temperature was 37.8c , heart rate 120 beats per minute , and blood pressure 127/72 mmhg . there were multiple hyperpigmented plaque - like lesions covering 80% of her body surface , and tender umbilicated vesiculo - papular lesions on her face , neck and upper torso in different stages of development . her fundal height was appropriate for stated length of pregnancy and gynecological examination was unremarkable . intravenous acyclovir 5 mg / kg per dose three times daily and intravenous cefazolin one gram every six hours were administered . , no new lesions were noted , and herpetic rash cleared by tenth day of therapy . subsequently , viral and bacterial cultures from lesions isolated hsv-1 and methicillin sensitive staphylococcus aureus , which was also present in her bloodstream . kaposi in 1887 , eh is a disseminated herpetic infection of inflamed skin that may complicate ad , darier - white disease , pemphigus foliaceus , mycosis fungoides , sezary syndrome , ichthyosis vulgaris , and burns . several theories have been proposed to explain pathogenesis of eh , including decreased skin integrity , impaired plasmacytoid dendritic cell recruitment and local interferon production . associated findings may include fever , malaise , lymphadenopathy , elevated serum ige levels , and relative lymphopenia . failure of early recognition and prompt treatment with intravenous acyclovir and concomitant antibiotics may carry risk of multiorgan failure and death . use of corticostroids has not been shown to cause eh , and treatment of the underlying ad is warranted . overall , ehg is rare but serious condition that may complicate pregnancy in patients with ad and requires prompt recognition .

eczema herpeticum ( eh ) , or kaposi 's varicelliform eruption , is a skin infection with herpes simplex type i virus ( hsv-1 ) that occurs in patients with compromised skin integrity , such as atopic dermatitis ( ad ) . unrecognized , it may be fatal and viremia in pregnancy may lead to fetal demise and miscarriage . we describe a rare case of eh in pregnancy , eczema herpeticum gravidarum ( ehg ) , which is the third published report in the literature to date .

this is a case of dnet ( dysembryoplastic neuroepithelial tumor ) that presented with atypical findings making a radiological diagnosis uncertain . dnet is a rare benign tumor generally seen in children and adolescents with intractable epilepsy . the typical radiological findings of dnet are supratentorial tumor generally affecting the temporal lobes and without any peritumoral edema or mass effect . given its excellent prognosis this should be considered in any case of supratentorial mass presenting with epilepsy , especially in pediatric and adolescent age groups . a 19-year - old male with a 6-month history of intractable seizures was referred for an mri examination by the neurologist . the sequences performed were t1weighted imaging ( t1w1 ) , t2 weighted imaging ( t2w1 ) , fluid attenuated inversion recovery ( flair ) , diffusion weighted imaging , and a gadolinium ( gd ) contrast enhanced scan . the scans showed a large irregular cystic mass lesion in the right temporal - parietal - occipital region with a low signal on t1wi [ figure 1 ] and a high signal on t2wi [ figure 2 ] and a hyperintense region around the tumor on flair sequence . additionally , peritumoral edema and mass effects were seen in the form of a midline shift . the posterior horn of the lateral ventricle and the third ventricle were compressed and deviated anteriorly . the gd contrast enhanced scan [ figure 3a and b ] showed enhancement of the lesion wall . ti weighted image of the 19-year - old male with dysembryoplastic neuroepithelial tumor involving the right temporo - oocipital lobe ( large arrow ) and mass effect at the anterior horn of right lateral ventricle ( small arrow ) . t2 weighted axial image at the level of head of caudate nucleus shows the peritumoral edema ( small arrow ) multinodular lesion in the temporooccipital lobe ( large arrow ) . ( a ) gd contrast enhanced t1 weighted axial image at the level of caudate nucleus shows the lesion wall enhancement ( arrow ) . ( b ) corresponding sagittal plane lesion involving temporo - occipital lobe reconfirms the axial plane features additionally , but unrelated to the presenting symptoms a maxillary sinus cyst was also seen . given the age , history , and mri findings of the lesion size and content we considered the diagnosis of a right temporal parietal occipital cystic mass -probably a glioma ( ependymoma or large astrocytoma ) and the patient was referred for surgery , following which a sample was sent for histopathology analysis . pathology combined with immunohistochemistry [ figure 4 ] findings was diagnostic of dysembryoplastic neuroepithelial tumor ( who grade 1 ) . glial fibrillary acidic protein ( gfap ) stained histopatholgy slide shows the specific glioneuronal elements ( arrow ) . immunohistochemistry for glial fibrillary acidic protein ( gfap ) , s-100 protein , establish the presence of astrocytic and neuronal components , while gfap reactivity is negative for an oligodendrocytic component the patient was successfully treated and follow - up examinations were done as required without any findings of consequence . dysembryoplastic neuroepithelial tumors are a relatively recent discovery having been identified barely 2 decades ago . the name given to this type of tumor is controversial as its dysembryogenetic origins are subject to debate . presently , dnets are classified by who as grade 1 neuronal and mixed glial tumors . this tumor generally affects children and young adults and presents with a history of intractable seizures . the hallmarks for diagnosis are an intracortical supratentorial tumor in the temporal lobe with multinodular structure and no peritumoral edema or signs of mass effect in young patients who present with intractable seizures . in our case the large size of tumor with occipital involvement and the absence of characteristic multinodular appearance and the presence of mass effect and edema made the diagnosis difficult . pathologically , dnet is a benign , predominantly intracortical lesion composed mainly of a population of heterogeneous cellular components , such as oligodendrocyte - like cells with admixtures of mature neurons and astrocytes . the principal differential diagnoses of dnets are oligodendrogliomas and gangliogliomas . in our case , the diagnosis was established based on the histopathological findings ( confirmed on review ) and clinical data . thus , the diagnosis of dnet can not rely just upon imaging features but needs a multidisciplinary contribution from the clinical and diagnostic department involving the clinician , radiologist as well as the pathologist to reach a definite and conclusive diagnosis . in this case the variations in morphological and pathological appearances of dnet are still being documented due to the low incidence of this disease . however , with increasing availability of modern histological and imaging facilities the incidence of diagnosed cases is increasing . considering the fact that this tumor is benign and slowly growing with excellent prognosis and surgical outcome without any lasting neurological deficit , the radiologist should consider this entity during differential diagnosis of a young adult or child with relevant clinical history of late onset of intractable epilepsy even in the absence of the typical radiological markers .

we present a rare case of dysembryoplastic neuroepithelial tumor , a rare benign glioneuronal tumor of the central nervous system . it generally occurs in the supratentorial region and the temporal cerebral cortex in children and young adults . the most common presentation is epilepsy . the supratentorial tumor without any signs of mass effect or peritumoral edema is the conventionally accepted diagnostic criteria . in this case of a 19-year - old male with intractable epilepsy , atypical features such as the location of the tumor and the presence of mass effect and peritumoral edema made imaging diagnosis difficult . diagnosis was confirmed through histopathology . due to its recent discovery and relatively rare occurrence it is important for radiologists to recognize this disease entity .

growing rubber is the major agricultural activity in kerala . rubber plantation workers collect the latex from the trees by tapping , and then coagulate it by mixing with formic acid , which is further processed before sales . as formic acid is easily available to the rubber growing population both suicidal and accidental ingestion is commonly seen . formic acid is also used in other industries such as paper , tanning electroplating , and manufacturing of disinfectants . this is a case study of one patient with accidental formic acid poisoning who was admitted in our hospital . a 39-year - old female patient presented to our a and e department with alleged history of accidental consumption of concentrated formic acid ( 85% ) . there was no history of breathlessness , chest pain , or hoarseness of voice . on examination , she was kept nil per orally , nasogastric tube was not inserted and stomach wash not given . she was started on infusion of proton pump inhibitor and oral sucralfate 15 ml thrice daily . intravenous ( iv ) fluids included 1000 ml of sodium chloride , 500 ml of 5% dextrose , and 500 ml of normal saline . she was also prescribed amoxicillin and clavulanic acid injection 1.2 g iv twice daily empirically . after 4 h , her urine bag showed dark colored urine suggesting of hemoglobinuria and intravascular hemolysis [ figure 1 ] . dark red urine from a patient of formic acid poisoning subsequently , patient had two episodes of vomiting which were bloodstained and her throat pain worsened . by 1 day , patient had complications such as hematemesis , hematuria , and hemoglobinuria . however , her bleeding time , clotting time , and prothrombin time was normal suggesting that hemolysis is related to the degree of acidity . her total white blood cell ( wbc ) counts were 18,900 on day one with predominant polymorph nuclear lymphocytosis . on the 2 day , patient did not have any hematemesis , her hematuria improved and her coagulation profile was normal . multiple whitish patches were noticed in her oral cavity , which was managed symptomatically with local hygiene . on day 4 , multiple ulcers were noted on the soft palate , buccal mucosa , base of tongue and right side of epiglottis [ figure 2 ] . mucosal ulcerations in the oral cavity with informed consent patient was taken for open gastrostomy on day 5 and enteral feeding started [ figure 3 ] . she was regularly followed - up for stricture formation and underwent regular esophagogastroduodenoscopy ( ogd ) at 4 , 8 , and 12 weeks . it is colorless liquid with the pungent odor and the majority of victims are males , with most cases of suicidal intent and minority cases , which are accidental . common complications are acute renal failure , metabolic acidosis , acute respiratory distress syndrome , oral cavity burns , esophageal strictures , gastrointestinal perforation , aspiration pneumonia , sepsis , shock and rarely tracheoesophageal fistula , pneumomediastinum , and chemical injury to the cornea . the patient should be immediately admitted , vomiting should not be induced and gastric lavage should not be attempted . if severe gastrointestinal hemorrhage is seen , no steroids should be given as it may precipitate impending perforation of the gut wall . high doses of folinic acid ( 1 mg / kg iv bolus followed by 6 doses of 1 mg / kg iv doses at 4 hourly intervals ) should be given in severe poisoning . folinic acid acts by enhancing formate degradation in the liver . hemodialysis should be considered if electrolyte imbalance is uncorrectable . daily urine output , serum creatinine , and serum potassium levels should be monitored to detect early onset of acute renal failure . patient has to be kept nil per orally and iv fluids should be administered to counter shock . pain relief should be done with viscous lignocaine and oral morphine along with light sedation if required . long - term complications include esophageal stricture , for which reparative surgery should be done if required . in a patient with formic acid poisoning , gastrointestinal perforation , hematemesis , respiratory distress , hematuria are associated with increased mortality . increasing age , ph < 7.3 , and hematemesis are risk factors for increased morbidity . metabolic acidosis can be corrected with administration of iv bicarbonate during initial few hours to reduce the associated morbidity and mortality . easy availability should be curtailed by enforcing remedial measures . spreading the knowledge of side - effects of formic acid , both acute , and

among the workers in a rubber plantation in south india , ingestion of formic acid either accidentally or with suicidal intention is a common problem . formic acid is diluted and used for coagulation of rubber latex . easy availability makes formic acid a common poison . the aim of this article is to study the case of formic acid poisoning , its complications and management . patient was managed symptomatically . antidote was not used and no nasogastric aspiration was done . patient had dysphagia ; nutrition was maintained with open gastrostomy done on day 5 and subsequent enteral feeding . measures to prevent anticipated complications were undertaken . stricture of the esophagus is a common complication leading to long - term morbidity . after initial management , all patients should be on follow - up for prevention and management of strictures . workers should be educated on complications of formic acid poisoning and easy availability should be curtailed by enforcing remedial measures .

in their review recently published in critical care , anantham and coworkers outline the ethical framework that forms the basis of the professional obligations of physicians who respond to health care emergencies , such as an influenza pandemic . bearing in mind the high mortality rates reported for the sporadic human cases of h5n1 avian influenza and experiences gained confronting the recent sars ( severe acute respiratory syndrome ) epidemic , many health care professionals will wonder whether we are well prepared to cope with the anticipated influenza pandemic . worldwide , health authorities and many individual institutions have undertaken substantial efforts to plan and prepare for such a catastrophic event . confronted with the predicted magnitude of a pandemic in reports presented by the mass or professional media , most physicians might feel at least some unease , if not outright fear , about the duties and associated risks they will have to face in the event of an influenza pandemic . after decades of low personal risk for contracting lethal diseases while providing care to patients , physicians -at least in developed countries are suddenly facing the possibility that occupational risk will increase substantially . if they are not confronted before the onset of an influenza pandemic , these feelings of unease and fear could profoundly hinder individual physicians in fulfilling their professional duties ; they could therefore undermine institutional and societal preparations [ 4 - 8 ] . hence , a reappraisal of the ethical basis of our professional duties as physicians and of justifiable or nonjustifiable limits to these duties should be an integral part of pandemic preparedness efforts , not only for professional organizations and health authorities , but also for individual physicians . in their review , anantham and coworkers provide explanations of the basic principles of ' the rule of rescue ' , the ' free choice of the profession ' and the implicit ' contract of the medical profession with society ' , which help us to understand the inevitability of accepting professional risk as a physician . more important than the discussion of these basic principles are the authors ' comments on nonlegitimate and legitimate limits to professional risk . sheer heroism will not solve the problems that will be encountered during a pandemic , because high - risk behaviours ( for example , failure to use universal precautions ) might further aggravate problems by rapidly diminishing the numbers of available physicians . although society has the right to demand service from physicians during a health care crisis , physicians have the reciprocal right to demand sufficient institutional support ( for example , protective equipment , chemoprophylaxis and , if available , vaccination ) . in addition to these logistical provisions , society and institutions will also have to address broader issues , including plans for child and elder care , transportation to work or lodging , and provision of adequate compensation to families of physicians succumbing to disease . addressing these and other related issues in advance will help institutions to ensure adequate turnout of the medical workforce in the event of a pandemic . although anantham and coworkers provide a good overview of the ethical issues that arise while preparing for an influenza pandemic , they do not give a detailed ' recipe ' for institutions or physicians planning to embark on or to intensify their efforts for pandemic preparedness . national guidelines and reviews are available for many of the logistical and organizational issues that health care systems and individual institutions must address [ 10 - 13 ] . however , the evidence suggests that we can not assume that health care workers will universally accept the increase in occupational risk associated with fulfilling their professional duties during an influenza pandemic . more research into and reports of successful interventions to improve the acceptance of increased professional risk among health care workers physicians in the fields of emergency medicine , pulmonology , intensive care and infectious diseases will be among the first to confront a pandemic , the article by anan - tham and coworkers should remind us of our professional obligations and enhance our willingness to fulfill those despite associated risks . otherwise , as the authors concluded , ' influenza will run it 's course ... leaving entire populations ravaged and the history will judge ( us ) harshly . '

after decades of low personal risk for contracting lethal diseases , physicians are suddenly facing the possibility of a substantial increase in occupational risk during an influenza pandemic . if they are not confronted before the onset of an influenza pandemic , feelings of unease and fear or ignorance about physicians ' professional obligations could profoundly hinder individual physicians in fulfilling their professional duties . such feelings could therefore undermine institutional and societal preparations . in their review published in critical care , anantham and coworkers outline the ethical framework that forms the basis of the professional obligations of physicians who respond to health care emergencies , such as an influenza pandemic .

haemorrhoidal disease is common . when the supporting submucosal fibres fragment due to prolonged straining during defaecation of hard stools , the anal cushions are no longer restrained from engorging excessively with blood and this results in bleeding and prolapse [ 1 , 2 ] . after other life - threatening diseases have been excluded , in the past , severe circumferential prolapse with massive engorgement of both external and internal haemorrhoidal plexuses required extensive ablation to ensure adequate treatment with subsequent mucocutaneous reconstitution . a 75-year - old man was admitted electively to the hospital for assessment and management of persistent prolapsed haemorrhoids ( fig . 1 ) , despite recurrent surgery , thrice in the past 3 years . he had no loss of appetite nor weight loss . on examination , he was pale and tired - looking . a rectal examination revealed massive , irreducible , prolapsed , circumferential haemorrhoids that were ulcerating , bleeding and occluding the anal orifice . the external components showed squamous hyperplasia with keratinization and a frond - like , friable appearance . proctoscopy revealed solid palpable internal haemorhoidal components with a similar pigmentation ( acanthosis ) as the external components at their classic anatomical positions the left lateral , right posterior and right anterior positions but no definite rectal mucosal lesion was seen . he was found to be anaemic with a haemoglobin level of 7 gm / dl . the differential diagnosis included an extensive locally advanced anal carcinoma , an extensive fungating perianal condylomata acuminata ( buschke - lowenstein 's disease ) , chronically prolapsed ( fourth degree ) haemorrhoids with external components or a chronic rectal prolapse . his iron - deficiency anaemia was corrected by blood transfusion prior to an examination under anaesthesia . prolapsed thrombosed fourth degree haemorrhoids ( with permission ) . in the lithotomy position , an extensive milligan morgan haemorrhoidectomy with mucocutaneus skin bridges and high ligation was performed ( fig . 2 ) . the external component of the haemorrhoidal tissue disintegrated into black clots on dissection ( fig . 3 ) . an intussucepting rectal prolapse with a sulcus between the prolapse and the edge of the anal canal became evident . a modified delorme 's procedure was done by excising the redundant mucosal sleeve , reducing the prolapse and plicating the prolapsed muscle wall to the proximal rectal mucosa cuff ( fig . 2 ) . however , as most of the anal canal skin at the level of the dentate line was incorporated in the extensive internal and external haemorrhoidal engorgement and thus been excised en - bloc , the distal component of the plication was sutured but to the fascia ( epimysium ) overlying the internal anal sphincter . pouting of the rectal mucosa at the anal orifice causing a mucoid leak was prevented by not stitching to the perianal skin . the wide perianal skin defects were approximated to facilitate healing and reduce pain ( fig . he was discharged on the eighth postoperative day on iron supplements and advised a high - fibre diet and regular follow - up . this case illustrates the importance of excluding an underlying rectal prolapse in a patient with recurrent haemorrhoids despite conventional haemorrhoidectomy . the introduction of less invasive surgical modalities , which offer good symptomatic control and less postoperative pain , has reduced the number of patients requiring conventional haemorrhoidectomy . conventional haemorrhoidectomy deals with the symptoms alone without due regard to restoration of the normal physiology by fixation of the congested anal cushions . on the other hand , stapled haemorhoidopexy tries to correct the primary pathology , by after reducing the prolapsed haemorrhoidal tissue , the redundant lower rectal mucosa is excised and the prolapse fixed back into its proper place on the wall of the anal canal [ 4 , 5 ] . there is less postoperative pain as the procedure avoids the sensitive anoderm below the dentate line , which is usually incorporated in conventional haemorrhoidectomy . in this case , the true nature of the rectal prolapse was not diagnosed till the milligan > 34 cm outside the anal verge , there is not enough space with the staple housing to contain it , and thus a circular pph ( proximate ethicon ) stapler may be found to be effective . in this patient with such a wide extension of the external component outside the anal verge , a more expensive alternative might be to use two staplers simultaneously . in areas with limited health resources , an alternative surgical method for the irreducible massive circumferential prolapsed ( fourth degree ) haemorrhoids is an excision followed by a modified delorme's correction approach , if there is associated rectal prolapse as in this case , so as to reduce rectal mobility and prevent recurrence [ 9 , 10 ] . this research received no specific grant from any funding agency in the public , commercial or not - for - profit sectors .

more recently some patients with rectal mucosal prolapse and obstructive defaecation have been treated with the procedure for prolapse and haemorrhoids . we report a case of symptomatic chronic circumferentially prolapsed haemorrhoids that had several failed attempts at surgical repair . this was finally managed by ablation and correction of the associated rectal mucosal prolapse by a modified delorme 's procedure akin to a stapled anopexy .

a 12-year - old male patient visited our polyclinic with complaints of pain and swelling in the left knee . his medical record showed the pain had started after an impact to the lateral side of the left knee while playing football 2 months ago . radiological and clinical examinations of the traumatic area were performed . while following the injury of the left knee suspected of ligamentous strain , swelling of the knee regressed . the pain was localized to a 2 cm area on the lateral side of the distal thigh . on the anteroposterior and lateral radiographs of the left femur , a 1-cm calcified mass was detected in the distal region of the vastus lateralis muscle , where the pain was localized . before anesthesia , the painful region was marked with a marker . a ring - shaped wire was placed laterally on the marked painful region . under fluoroscopic vision , the ring - shaped guide wire was placed on the calcified mass ( fig . a bright - surfaced and coin - shaped cartilage - like mass with a size of 210 mm was observed through the incision line . the result of intraoperative consultation ( frozen section ) was the neoplasm with fusiform cell . in macroscopic examination of the excised mass , a grey - white sectional view of an irregular - shaped solid tumoral mass of 1 cm in diameter was observed besides firm regions at certain locations . in microscopic examination of the tumor , short and irregular bundle structures , which involve wide dystrophic calcification regions and consist of large fusiform cells with narrow cytoplasm and oval nucleus , were observed . in the tumor , under 100 magnification ( high magnification field ) , there were 12 mitoses , nuclear pleomorphic structures at mild - medium level of severity . according to the classification of soft tissue tumors in the grading scale of fedaration nationale de lutte contre le cancer3 ) , tumor differentiation of the mass was 3 , mitosis was 2 ( 12/10 high magnification field ) , tumor necrosis was 0 , and total score was 5 . furthermore , in immune - histochemical analyses of our tissue samples , ki-67 proliferation index was found to be slightly high ( range , 5% to 6% ) . late recurrence and metastasis to a distant organism were not found during the long - term follow - up ( 3 years ) . during active and passive flexion and extension movements of the left knee , the majority of sss are located around the extremity45 ) , and they are less frequently seen in the neck , heart , and lung2 ) . in extremities , they are located around large joints such as the knee joint . they are in close relation with the joint capsule , tendon sheath , bursa and facial structures . it is commonly believed that ss does not originate from synovial cells but from mesenchymal cells1 ) . if it is calcified , it can be detected within the soft tissue in radiography2 ) . prognostic indicators of ss include inefficient excision of the mass , a mass larger than > 5 cm , male gender , > 20 years of age , high - degree tumor , presence of necrosis , neurovascular invasion , high mitosis rate , and syt - ssx1 variant6 ) . the metastatic spread of ss is to regional lymph nodes and lung in general7 ) . ss appears as a heterogeneous multi - lobular soft tissue mass having similar or higher signal density than muscle on t1-weighed magnetic resonance imaging ( mri ) . on t2-weighed mri the image obtained in mri evaluation of our case was in accord with that presented in the literature . even though the radiological characteristics of ss are not pathognomonic , it is seen as a calcified mass in soft tissues in up to 30% of cases8 ) . considering that formation of calcified mass also occurs in case of mo , it should also be added to the differential diagnosis . it generally occurs after a soft tissue trauma9 ) . in the x - ray assessment of our case , in addition , the patient had a history of trauma in the mass region , and the clinical picture indicated mo . ss has 3 subtypes from the histological aspect ; biphasic , monophasic , and poorly differentiated types10 ) . in the histological analysis of our case samples , there was no symptom in our patient with ss . during the evaluation of the injury caused by a trauma , a < 1 thus , the diagnosis of ss was made in the early - stage before the symptoms emerged and appropriate surgical treatment was performed . therefore , it is advised to consider a diagnosis of ss in patients with a history similar to our patient 's and radiographic evidence of < 1 cm lesions suspicious of mo .

a calcification mass was incidentally found in the soft tissue of a patient who had a history of trauma to the extremity during examination . the patient had no symptom . the pathological analysis of the mass revealed it was an early - phase synovial sarcoma ( ss ) . the diagnosis was made before the onset of symptoms and proper surgical intervention was performed . therefore , in case of a < 1 cm lesion clinically suspicious of myositis ossificans , ss should be taken into consideration as a possible diagnosis .

because of serious complications such as rupture and strangulation of the hernia content , incarceration of the umbilical hernia is a significant surgical condition ( 1 ) . the small bowel , the omentum and the large bowel are frequently seen in the hernia sac . , we present a patient with an incarcerated umbilical hernia caused by a giant ovarian tumor . a 61-yr - old woman was admitted to the emergency department with symptoms of sudden abdominal pain , nausea , vomiting and painful swelling in a previously diagnosed umbilical hernia . she had had severe abdominal pain and the sensation of a mass for the previous 2 hr . because of her low socioeconomic status , she had no history of routine healthcare , and she had a history of uncontrolled hypertension . on examination , she had a 1510 cm , irreducible , purple - colored umbilical hernia , and there was extreme tenderness and hyperemia on hernia . because of the incarcerated umbilical hernia and possible strangulation of the hernia content , the patient underwent an urgent operation without any diagnostic evaluation . during the operation , a partial omental infarct and an intraabdominal tumor 1 ) . a partial omentectomy was performed , and abdominal incision was extended from pubis to the epigastrium . a large , multilocular , left ovarian cyst , which extended from the transverse colon to rectovesical space , was observed ( fig . total abdominal hysterectomy and bilateral salphingo - oophorectomy were performed with no complications . during the operation , the resected tumor measured as 252316 cm and weighed 3,680 g. on microscopic examination , the tumor was uniform and composed of pale oval cells with prominent grooves ( coffee bean appearance ) . the diagnosis of a granulosa cell tumor was supported by the immunohistochemical expression of inhibin in the neoplastic cells ( fig . 3 ) . because she had high blood pressure , the patient was followed - up in the intensive care unit . about 2 weeks after discharge , she underwent second operation ( ie , a staging operation ) that used the same incision . an omentectomy , a paraaortic and pelvic lymphadenectomy , peritoneal washing , cytology analysis , and peritoneal biopsies were done at that time , and no metastases were found . after the second operation , combination chemotherapy with bleomycin ( 10 mg / m ) , cisplatin ( 100 mg / m ) and etoposide ( 100 mg / m ) was begun . a granulosa cell tumor of the ovary is an uncommon neoplasm derived from granulosa cells . although it can be seen at any age , it occurs most commonly during the perimenopausal and early postmenopausal years . the incidence of granulosa cell tumors has been reported to be 0.4 to 1.7 per 100,000 women ( 2 ) . postoperative chemotherapy is given for patients with granulosa cell tumors that are of stages ii , iii , and iv . however , some patients with large stage - i tumors ( ie , those > 10 - 15 cm ) , a high mitotic index , tumor rupture or all or any combination of these can be considered for adjuvant chemotherapy ( 2 ) . this is why we gave adjuvant chemotherapy to our patient : because of the high risk of recurrence . however the benefit of adjuvant chemotherapy for high - risk stage - i patients has not been supported by prospective randomized studies ( 2 ) . the umbilicus is a site at which intra - abdominal cancer metastases that are inoperable can be seen , beacuse the tumors appear as a characteristic sister mary joseph 's nodule . the small bowel , the omentum , and the large bowel are frequently seen within the hernia sac ( 3 ) . rare cases including gallstones after a laparoscopic cholecystectomy , perforated acute appendicitis , strangulated meckel 's diverticulum , myomatous uterus , and incarcerated pregnant uterus in the umbilicus have been reported ( 3 ) . millar and associates reported a patient similar to ours : theirs was the first report of a reducible umbilical hernia with an ovarian tumor ( 4 ) . but ours is the first report of an incarcerated umbilical hernia with a giant ovarian tumor . uluda and associates reported incarceration of an umbilical hernia during pregnancy because of a sessile fibroid ( 1 ) , and wong ( 5 ) reported a uterine fibroid presenting as an incarcerated umbilical hernia during pregnancy . in conclusion , intra - abdominal tumors presenting as incarcerated or strangulated hernias are extremely rare but do occasionally occur . if it is not suspected before surgery , a careful exploration is needed to identify the content . in such cases , diagnostic biopsies , mass resections , or both , with primary hernia repairs definitive surgery for the primary disease should be planned after doing a detailed evaluation of the patient and consulting with the related surgical branches in elective surgery services .

we report a rare case of a giant ovarian tumor presenting as an incarcerated umbilical hernia . a 61-yr - old woman was admitted to the hospital with severe abdominal pain , an umbilical mass , nausea and vomiting . on examination , a large , irreducible umbilical hernia was found . the woman underwent an urgent operation for a possible strangulated hernia . a large , multilocular tumor was found . the tumor was excised , and a total abdominal hysterectomy and bilateral salphingo - oophorectomy were performed . the woman was discharged 6 days after her admission . this is the first report of incarcerated umbilical hernia containing a giant ovarian tumor within the sac .

in june 2010 , a previously healthy 28-year - old male presented with 1 month history of darkening of skin . the patient was well until june 2010 , when his fiance noticed darkening of his face . because of progressive increase in his darkness , she left him . his previous medical history was unremarkable . on examination ; he was afebrile with pulse rate of 82 beats / min , respiratory rate of 16 breaths / min , and blood pressure of 126/78 mmhg without any postural drop . only abnormality in physical examination was generalized hyper pigmentation , which was most marked on face , dorsum of upper limbs , nape of neck , chest and suprascapular region posteriorly [ figure 1 ] . his full blood count , erythrocyte sedimentation rate ( esr ) , glucose , liver , and renal function including electrolytes were normal . an ultrasound abdomen revealed a well - defined hypoechoeic mass in right suprarenal region . computed tomography ( ct ) abdomen showed a well defined , hypo dense mass in right suprarenal gland measuring 23 mm 20 mm without any calcification or intra - abdominal lymphadenopathy . magnetic resonance imaging ( mri ) abdomen revealed a mass measuring 22 mm 24 mm in right suprarenal gland . his adrenal functions were as follow : baseline 8.00 am serum cortisol 160 nmol / l [ normal range 150 - 550 nmol / l ] , increasing to 170 nmol / l 60 minute after 250 g i.v cosyntropin ; [ normal response 550 nmol / l ] . baseline concomitant adrenocorticotropic hormone ( acth ) level was 1100 pg / ml [ normal 9 - 56 ] . on open laparotomy , a right adrenal mass measuring 25 mm 30 mm was detected with superior margin of mass attached to inferior vena cava . standard four drug anti - tubercular ( att ) regimen was started along with hydrocortisone 17.5 mg . fludrocortisone was not started as his blood pressure ( bp ) was normal and his electrolytes were also normal . at 4 week follow up , patient presented with extreme fatigue with loss of energy , severe weakness , tiredness , and postural dizziness . dose of hydrocortisone was increased to 25 mg , fludrocortisone 100 gm was added the patient improved markedly with regard to his constitutional symptoms and his bp was 140/90 mmhg without any postural fall at 2 month follow up . at 6 month , he was well and was on his routine baseline activities . att was discontinued and hydrocortisone dose was reduced to 15 mg and fludrocortisone was also reduced to 50 gm . at last follow up in february 2011 , when asked about his 6 month ordeal journey , he replied : feeling good because of vanishing tan , but the tan of unfaithfulness will be there forever . adrenal is involved in 6% of active disease , but it is difficult to establish the diagnosis . the combination of generalized hyper pigmentation with unilateral adrenal mass in the absence of constitutional symptoms was an interesting finding and it illustrates a diagnostic dilemma . tuberculosis was thought to be the cause of adrenal mass , considering the high prevalence of tb in this part of the world , but the unilateral nature of mass was most worrisome , particularly in the absence of active tb and negative tuberculin test . ct of adrenal gland ca nt reliably differentiate between tubercular mass and other benign and malignant mass ; ultimately tissue biopsy remains the mainstay of diagnosis . the initial deterioration in our patient probably resulted from inadequate dose of synthetic cortisol , as rifampicin results in its inactivation . a 2 - 3 fold increase in glucocorticoid dose is required in the presence of hepatic enzyme inducing drug . plasma acth can not be used as a criterion for glucocorticoid dose adjustment . in primary adrenal insufficiency , acth is invariably high before the morning dose and rapidly declines with increasing cortisol levels after glucocorticoid ingestion . aiming at acth levels within the normal range , therefore , would invariably result in over - replacement . in the absence of reliable biomarker of glucocorticoid activity , monitoring of glucocorticoid replacement is primarily based on clinical judgement , carefully taking into account signs and symptoms suggestive of over and/or under replacement .

adrenal tuberculosis is a rare manifestation of active tuberculosis and is a difficult diagnosis to make if its presentation is sole manifestation of tuberculosis . we present an interesting case of a young male who presented only with symptoms of hyper pigmentation and was diagnosed as adrenal tuberculosis . also , this report highlights the importance of drug interaction between antitubercular drug and steroid which lead to the deterioration in the early part of treatment and , later on was corrected by increasing the dose of steroids .

type 2 dm is the most common form of dm . the symptoms that commonly indicate hyperglycemia are polyuria , polydipsia , weight loss , fatigue , weakness , blurry vision , frequent skin infections , and slow healing of skin lesions after minor trauma . taste disorders like ageusia ( taste loss ) , hypogeusia ( decrease in taste ) , and dysgeusia ( abnormal taste ) form an important but neglected part of presentation of dm . we report a unique case of a housewife presenting with altered taste as the initial symptom of dm . a 50-year - old educated housewife , presented with complaints of altered taste of all kinds of food on and off for a period of 2 months . there was no history of rhinitis , sinusitis , head injury , denture use , or any gastrointestinal disorders . history excluded thyroid disorders , liver or kidney disorders , use of alcohol , tobacco , local radiation therapy , or drugs associated with altered taste . there was no personal or family history of hypertension or dm . on examination , she was afebrile with blood pressure of 124/80 mmhg and body mass index ( bmi ) of 26.6 kg / m given the complaints , a random blood sugar level test was performed , which revealed a level of 291 mg / dl . hence , the patient was advised dietary changes and routine investigations to look for any systemic disorder and confirm diagnosis of dm . fasting and postprandial blood sugar levels ( fbsl and ppbsl ) were found to be 146 and 188 mg / dl , respectively . fundus examination of the eye showed no signs of retinopathy . based on laboratory values , patient was diagnosed as a case of type 2 dm ( american diabetes association , 2007 ) . the laboratory values repeated after 2 months showed fbsl - 122 mg / dl , ppbsl - 175 mg / dl , and hba1c - 7.6% . over 2 months after 5 months of regular exercise and diet , the values of fbsl , ppbsl , and hba1c dropped down to 118 mg / dl , 151 mg / dl , and 6.6% , respectively . the patient has been advised to continue with diet / exercise and follow - up every 3 monthly with fbsl , ppbsl , and hba1c reports . studies that have shown an increase in prevalence of diabetes in india have also reported a very high prevalence of undiagnosed diabetes in the community . the individuals who are unaware of their disease status are left untreated only to present at a later stage with complications . patients with xerostomia , sjgren 's syndrome , and zinc deficiency also experience taste loss . other conditions in which taste loss may occur include liver and kidney disorders , dm , depression , and surgical procedures around the chorda tympani or glossopharyngeal nerve . numerous drugs ( methotrexate , dexamethasone , antihypertensives , and antimicrobial agents ) have been associated with taste loss . le floch et al . , in 1989 had mentioned about the decrease of the diabetic individual 's ability to detect and recognize the primary taste modalities . an indian study in 2012 evaluating 50 cases of dm with oral complications found taste impairment in 20% cases . another indian study found that taste alteration was more common in uncontrolled diabetics than in controlled diabetics . electrogustometric examination in 73 patients from czech republic showed that about 40% of type 2 dm have hypoguesia and 5% have aguesia . a 2009 spanish study concluded that hyperglycemia induces a concentration - dependent impairment of sweet taste perception in diabetic patients as the result of an adaptation of the sensory cell to elevated circulating concentrations of glucose . newly - diagnosed dm patients have a blunted taste response with a preference for sweet - tasting foods , which is partially reversed after correction of hyperglycemia , and is independent of somatic or autonomic nerve function . many mechanisms are being considered , but a specific cause for taste sense alteration is still not known . it is believed that in diabetic patients with complications ; neuropathy involving taste nerve tracts and microangiopathy involving taste buds may be responsible for the decreased taste sensation . but in newly diagnosed dm cases without complications , defects in the taste receptor may be responsible . disturbance of taste is mostly transient and does not often appear in daily practice . also patients do not associate taste disturbance with chronic diseases like diabetes or hypertension . in our case , a taste disturbance helped us to diagnose a case of dm before the complications could set in . it is very essential that we specifically ask patients for history of altered taste whenever other risk factors for diabetes are present . also it is important to give attention to complaints related to taste by any vigilant patient . the risk of indian patients getting diabetes is evaluated using the indian diabetes risk score based on factors such as age , obesity , physical inactivity , family history of diabetes , etc . changes in taste thresholds in type 2 dm if systematically analyzed and documented , may provide an additional diagnostic , screening , and monitoring tool for dm in the future . as seen in this case , rather than being an indicator of duration or complications of disease , it could be an indicator of fluctuations in blood sugar levels .

diabetes mellitus ( dm ) is a common disease which usually manifests in the form of polyuria , polydipsia , weight loss , fatigue , weakness , blurry vision , frequent skin infections , and slow healing of skin lesions . taste disturbances like ageusia , hypogeusia and dysgeusia have been associated with dm . the early diagnosis of dm based on these symptoms is very important to start treatment early and thereby prevent complications . we present an interesting case of a female presenting with altered taste as the first symptom of dm .

3.3.1 ) using a phylogenetic clustering approach , which progressively examined reciprocal best scoring blast hits at decreasing phylogenetic nodes of a reference animal tree . we recovered 1,235 gene families with orthologous members in all genomes . to assess the effect of fast and slow evolving characters on the tree topology , several phylogenetic approaches were taken ( see supplementary note 5 ) . gene families were considered to be ancestral bilaterian gene families when an orthologous group had at least two protostome and two deuterostome representatives ( in - group ) or two sequences from either in - group and two from basal ( that is , non - bilaterian ) metazoans ( out - group ) . draft genome scaffolds were clustered into ancestral linkage groups ( algs ) based on the locations of orthologous genes in other metazoan genomes , as described previously we iteratively constructed a parsimonious scenario of chromosome evolution , and ancestral genes were assigned to ancestral algs when any other assignment would imply more hops between algs in the history of that gene family ( supplementary note 6 ) . if another set of orthologous genes is identified within a maximal distance of 10 genes of the previous set , both sets were merged together into a microsyntenic block . only syntenic blocks with at least three orthologues per species were considered . gene families with a maximum of 2 missing species ( out of 22 ) were included . intron and indel positions were detected using conserved flanking sites ( 3 out of 8 amino acids ) , no gaps were allowed to flank introns . for indels , phylogenetic inference based on presence or absence was computed with mrbayes as described in supplementary note 5.3 . 3.3.1 ) using a phylogenetic clustering approach , which progressively examined reciprocal best scoring blast hits at decreasing phylogenetic nodes of a reference animal tree . we recovered 1,235 gene families with orthologous members in all genomes . to assess the effect of fast and slow evolving characters on the tree topology , several phylogenetic approaches were taken ( see supplementary note 5 ) . gene families were considered to be ancestral bilaterian gene families when an orthologous group had at least two protostome and two deuterostome representatives ( in - group ) or two sequences from either in - group and two from basal ( that is , non - bilaterian ) metazoans ( out - group ) . draft genome scaffolds were clustered into ancestral linkage groups ( algs ) based on the locations of orthologous genes in other metazoan genomes , as described previously we iteratively constructed a parsimonious scenario of chromosome evolution , and ancestral genes were assigned to ancestral algs when any other assignment would imply more hops between algs in the history of that gene family ( supplementary note 6 ) . if another set of orthologous genes is identified within a maximal distance of 10 genes of the previous set , both sets were merged together into a microsyntenic block . only syntenic blocks with at least three orthologues per species were considered . gene families with a maximum of 2 missing species ( out of 22 ) were included . intron and indel positions were detected using conserved flanking sites ( 3 out of 8 amino acids ) , no gaps were allowed to flank introns . for indels , phylogenetic inference based on presence or absence was computed with mrbayes as described in supplementary note 5.3 .

current genomic perspectives on animal diversity neglect two prominent phyla , the molluscs and annelids , that together account for nearly one - third of known marine species and are important both ecologically and as experimental systems in classical embryology13 . here we describe the draft genomes of the owl limpet ( lottia gigantea ) , a marine polychaete ( capitella teleta ) and a freshwater leech ( helobdella robusta ) , and compare them with other animal genomes to investigate the origin and diversification of bilaterians from a genomic perspective . we find that the genome organization , gene structure and functional content of these species are more similar to those of some invertebrate deuterostome genomes ( for example , amphioxus and sea urchin ) than those of other protostomes that have been sequenced to date ( flies , nematodes and flatworms ) . the conservation of these genomic features enables us to expand the inventory of genes present in the last common bilaterian ancestor , establish the tripartite diversification of bilaterians using multiple genomic characteristics and identify ancient conserved long- and short - range genetic linkages across metazoans . superimposed on this broadly conserved pan - bilaterian background we find examples of lineage - specific genome evolution , including varying rates of rearrangement , intron gain and loss , expansions and contractions of gene families , and the evolution of clade - specific genes that produce the unique content of each genome .

the genus microbacterium was proposed by which having numerous species established within the family microbacteriaceae , , . the organisms of these genera are characterized by the presence of n - glycolyl residues in the cell walls , by having major isoprenoid quinones mk-11 , mk-12 and mk-13 or minor isoprenoid menaquinones mk-10 or mk-14 and by g + c contents of 6572 mol% . the genus microbacterium is known to infect human and animals most frequently , only one report on plant is found , , . microbacterium sp . strain subg005 was isolated from the infected leaves of mangifera indica l. the isolate was confirmed as a phytopathogen by pathogenicity test on healthy leaves of m. indica l. and fulfilled koch 's postulates . genomic dna was extracted from young culture grown in nutrient medium using protocol given by . genome sequencing of this strain was done with high throughput ion torrent personal genome machine with ion torrent server ( torrent suite v3.2 ) , and total data of 17 , 22,450 paired - end reads with 103.45x coverage were obtained . the annotation of the genome was performed using the ncbi prokaryotic genomes automatic annotation pipeline ( pgaap ) ( http://www.ncbi.nim.nih.gov/genome/annotation_prok/ ) utilizing genemark , glimmer , and trnascan - se tools and functional annotation was carried out using the rapid annotations using subsystems technology ( rast ) server with the seed database . the total length of the genome was found to be 70 , 21,676 bp , allocated into 485 contigs having > 500 bp and 5740 contigs 500 bp . organism also contains 1879 n50 contigs , 92 rrna ( 5s , 16s , 23s ) and 119 trna . according to rast annotation , it is interesting to note that this organism having ten genes for type i secretion systems for aggregation ( fig . subg005 have 967 genes for carbohydrate metabolism , sixty seven genes for nitrogen metabolism , four genes for arsenic resistance as well as five genes for resistance of other heavy metals like cobalt , zinc and cadmium . it also has one hundred fifty three genes related to virulence , disease and defense and 92 genes for abc transporter as well as 26 genes for cation transporter .

microbacterium sp . subg005 is a gram positive bacterium , isolated from infected leaf of mangifera indica l. in rajkot ( 22.30n , 70.78e ) , gujarat , india . the genome sequencing of microbacterium sp . subg005 is having type i secretion system genes of pathogenicity as well as heavy metal resistance unique genes . the genome size is 7.01 mb with g + c content of 64.80% and contains rrna sequences . genome sequencing analysis provides information about the microbe role in host pathogen interaction . the whole genome sequencing has been deposited in ddbj / embl / genbank under the accession number jnnt00000000 .

a 15-year - old girl was presented with lump in the right breast since 8 month . lump was rapidly increasing in size with no other significant history available . on examination 1312 cm mobile lump with visible vessels on the overlying skin in the upper and inner quadrant was present ( figure 1 ) . lump was firm to hard , and was free from overlying skin and underlying structure . there was no history of risk factors for malignancy of breast .general examination did not revealed any findings consistent with metastatic disease . excision biopsy showed well defined smooth mass with 131112 cm size and weight of 800 gm ( figure 2 ) . she had a normal breast development over a period of 8 month follow up . although simple fibroadenoma is a disorder of breast development , giant fibroadenoma is a disease . it is the most common tumor of the breast in a female younger than 30 years . jgf is characterized by rapid growth , large size , stretching of the overlying skin , and dilatation of superficial veins . it is usually single and > 5 cm in size /or > 500 gms in weight . the usual age of presentation of phyllodes tumor is more than 35 years ( rarely reported in puberty ) and increased stromal cellularity , pleomorphisim , and the presence of mitotic figures points towards phyllodes tumor rather than fibroadenoma . juvenile gigantomastia is characterized by its positive estrogen receptor status and its hypersensitivity to estrogen . other differential diagnosis includes : giant lipoma , juvenile breast hypertrophy , and great hamartoma . multiple giant fibroadenomas ( mgf ) are rare and reported to occurs usually in adolescent black females . the high sensitivity of mri for cancer detection raised the possibility that it could replace biopsy in future . differentiation of giant juvenile fibroadenomas from phyllodes tumor on basis of trucut biopsy is difficult . wide excision or mastectomy should be performed , if required , on the basis of final histopathological diagnosis . high index of suspicion is required for the diagnosis . surgical excision remains the cornerstone of the treatment . the approach should be determined by the surgeon s preference , skills , and experience . depending on the size of the tumor , age of the patient , and stage of sexual maturity , reshaping of the breast after the removal of the tumor may be necessary . the challenge to the physician is to differentiate it from phyllodes which may require aggressive treatment .

fibroadenomas are benign solid tumor associated with aberration of normal lobular development . juvenile giant fibroadenoma is usually single and > 5 cm in size /or > 500 gms in weight . important differential diagnoses are : phyllodes tumor and juvenile gigantomastia . simple excision is the treatment of choice .

in 1952 , wildervanck , described a cervico - oculo - acoustic syndrome consisting of klippel feil deformity , abducens palsy with globe retraction ( duane 's retraction ) , and congenital hearing loss . this report describes a case with hypoplastic frontal sinus along with triad of wildervanck syndrome . the patient is a 9-year - old female child admitted to avbr hospital for deformity of an ear , short and deviated neck since birth . anthropometric parameters were suggestive of short stature ( height - 119 cm ; <3 percentile ) . on examination , her vitals were stable . her right eye was smaller than the left eye with an intermittent involuntary decrease in size . it was suggestive of right eyeball retraction . left abducens nerve palsy with short neck and malformed right ear klippel audiometry revealed profound hearing loss on right side and moderate sensorineural hearing loss on the left side . brainstem evoked response audiometry was also suggestive of sensorineural hearing loss on the left side . computed tomography ( ct ) spine was showing of fusion of the thoracic vertebrae , suggestive of klippel feil deformity . hence , patient 's relatives refused to opt for surgery ; hence , child was referred to higher center with better expertise management for surgery . wildervanck syndrome comprises of the triad of klippel feil deformity ( fusion of 1 cervical vertebra ) , duane retraction syndrome , and hearing loss . other spinal deformities ( spina bifida occulta , sprengel deformity , and hemivertebrae , fusion of the ribs , absent ribs , kyphosis , scoliosis , and basilar impression ) may coexist . hearing loss in patients with the wildervanck syndrome may be sensorineural , conductive , or mixed and may be accompanied by malformations of the external ear , external acoustic meatus , ossicles , and bony labyrinth . there is a consensus about the mode of inheritance of wildervanck syndrome , but all agree that genetic factors are involved . further , the gene would be partly sex limited acting on a polygenic background , which is modified by sex , rendering females more susceptible than males to action of the gene . an environmental etiology , due to a vascular disruption sequence during embryonic development has been noted in klippel feil anomalies as in moebius and poland sequences . a combination of defects ( kiippel feil and moebius ) could induce the more complex phenotype observed in wildervanck syndrome . wildervanck stated that deafness should be sensorineural in type ; cases with conductive or mixed losses have also been reported . only one - third of the patients with wildervanck have been described as having hearing loss ; although , audiometry in our patient revealed a moderate degree of sensorineural deafness . wildervanck syndrome with frontal sinus hypoplasia and cholesteatoma is very rare association , which has not yet been described in literature . an expert team work is required for the surgery as intubation may be difficult because of klippel feil deformity . the possibility of wildervanck should be kept in mind , while evaluating a case of klippel feil deformity .

we report a case of wildervanck syndrome exhibiting klippel feil anomaly , duane 's retraction syndrome and congenital deafness . since the first case was reported in 1952 , there have been more reports describing this triad either complete or incomplete . our case has a complete triad of the syndrome along with frontal sinus hypoplasia . our case is unique as the triad was associated with frontal sinus hypoplasia , which is very rare association .

bioethical issues are pervasive throughout society , and with the scientific progress and technical advances that scientists continue to develop , new bioethical issues are continually arising . the goal of most courses is for students to be able to amass and assimilate information for use , either later in the course or during future activities . this course , topics in bioethics , is designed to allow students to discuss and learn about different bioethical issues and to develop educated personal positions on these topics . sometimes the students go into a topic believing they are on one side , only to find out that it is not a two - sided , black - and - white issue , but a series of intertwined issues separated by large gray areas . for example , many students have heard about the medical testing atrocities of the nazi camps in germany during world war ii . but they are shocked to learn that human experimentation has occurred in the united states and other countries over the past hundred years . through a series of hollywood films and popular and scientific readings , students are exposed to additional topics of gene testing , designer babies , cloning , and other topics . students gather knowledge about the topic , including pros and cons of the different biotechnological issues and uses . during classroom discussions , students discuss the topic , and gain insight into different perspectives through the eyes of fellow students and through introductory readings . before presenting students with any course materials or content , they are given a basic introductory survey ( appendix 1 ) . this 1 ) provides insight into their prior knowledge and 2 ) serves as a first introduction to some of the topics that will be covered in the class . the course has been set up in five parts , the fifth part being student - chosen topics and student - led discussions . the primary topics that have been covered are listed in table 1 , including movies that have been shown during one class period and some suggested readings . additional topics that have been suggested or covered by students are listed in appendix 2 . the course is offered in a single three - hour time slot , allowing the instructor to introduce the topic to be viewed and complete the movie in one class period . students are asked to read relevant literature , including popular literature and historical reports ( appendix 3 ) , before the subsequent class period . students are provided with some guiding questions to facilitate the topic discussion ( appendix 5 ) . see appendix 4 for links to short films about these topics . during the class period following the introduction and movie , students are expected to openly discuss the topic and work through the questions provided ( fig . 1 and appendix 5 ) and any additional questions that arise . the role of the instructor is solely that of facilitator , to assure that the science is sufficiently understood during the discussion and the group stays focused on the topic(s ) being discussed . the students discuss the pros and cons of the topic(s ) and develop their own perspectives and opinions . examples of questions for the human experimentation class discussion ( following the viewing of the film miss evers boys ) . for questions associated with other topics , keeping topics broad is important to allow the students to see the breadth of topics and to explore aspects of interest to them . as an example of the breadth of the topic of cloning having broader topics allows for classes to discuss different subtopics that might be of more individual interest and allows for a more far - reaching introduction to the technology of cloning . the list of discussion questions for each individual topic has been designed to lead the discussion to include the breadth of the topics . student assessment is based on three aspects participation in discussions , effective written communication , and presentation of a well - prepared topic . class size is critical in having effective student participation , with 8 to 12 students being an optimum number for discussions . students are assessed following each discussion and provided with feedback designed to improve their participation in future topics through a course website . it is also important to provide feedback to students who dominate the discussion to encourage them to allow others to participate . with each topic , students were required to turn in an electronic version of a six- to eight - page ( double - spaced ) essay . essays were graded on the quality of writing and the accuracy of information ( science or historical fact ) . one of the goals of the student - chosen presentations is to create an effective learning environment . students are paired up by the instructor to mix majors to allow for differences in philosophies and understanding . the student presenters are required to provide two articles for the class to read prior to the discussion , with these articles being popular reading ( e.g. , news articles or short review articles ) rather than scientific literature . to facilitate productive discussions , the topics are approved ( sometimes focused , sometimes broadened ) several weeks prior to the presentation , papers are made available one week prior to the presentation , and students prepare discussion questions . the topic presentation , discussion leadership , preparation , article choice and questions provided for the discussion account for 20% of the overall course grade . the students who deliver the presentations also write their fifth position paper on their chosen topic . the informal feedback suggests that the students enjoy the non - lecture style course , which facilitates their ability to develop opinions and to express those opinions through discussion and writing . students have indicated that they gain alternative insight into topics through their classmates during the discussion period . appendix 1 : pre - course survey to be completed at the start of class appendix 2 : student topics and additional topics that could be covered appendix 3 : topics with readings and/or movies appendix 4 : online movie resources appendix 5 : discussion questions for other class topics appendix 6 : results from cloning survey ( spring 2014 )

exposing students to current biotechnological and medical issues is eye - opening for many students in a way that is not always achieved through lecture - based learning . lecture or investigative teaching styles provide a tremendous knowledge base for the students , but sometimes these teaching styles do not allow the student to fully develop , especially personal attitudes to issues in bioethics . through online videos , hollywood movies , guided readings and classroom discussions , students in this course are informed of some bioethical topics , encouraged to learn about other topics , and use this gained knowledge to develop personal positions regarding the value and/or risk of the issues . this course has been well - received by previous students as a favorite in terms of both topics covered and style .

gorlin - goltz syndrome ( ggs ) , or nevoid basal cell carcinoma syndrome , is an autosomal dominant genetic disease with an estimated prevalence of 1:57,0001:256,000 and a high level of penetrance and variable expressiveness [ 1 , 2 , 3 ] . calcification of the falx cerebri is one of the major diagnostic criteria of ggs that can be detected in 79% of patients with ggs . a 53-year - old woman was referred to a radiologist for performance of a routine computed tomography scan of the head to exclude intracranial hemorrhage after accidental head trauma . the computed tomography imaging detected lamellar calcification of the falx cerebri , which is a pathognomonic feature of ggs ( fig . 1 ) . meeting the criteria for ggs and considering the pathognomonic feature of the lamellar calcification ( major criterion for ggs ) , the patient was referred to the department of dermatology . an examination of the patient 's skin showed multiple small lesions clinically resembling basal cell carcinomas ( bccs ) on the back , for which shave excisions were carried out . pathologic examination of the lesions revealed 9 superficial bccs on the back and 1 nodular bcc on the nose . the patient reported that the first bcc had occurred at the age of 27 years , and subsequently 4 other superficial bccs had been removed by shave excision until the diagnosis of ggs was established . furthermore , the patient presented with multiple palmar pits and marked syndactyly of the toes . therefore , in our case , 2 major criteria [ ( i ) lamellar calcification of falx cerebri , and ( ii ) more than 2 bccs ] and 1 minor criterion ( marked syndactyly of digits ) were detected . additionally , the diagnosis of ggs was confirmed by positive testing for mutations in the tumor suppressor gene ptch . taking into account that ggs is an autosomal dominant genetic disease with nearly full penetrance and variable expressivity , the daughters of our patient were screened for ptch gene mutations as well . although they both had no bccs upon clinical inspection and none recorded in their medical history , one of the daughters tested positive for a ptch gene mutation . as a consequence , our patient and her daughter are now being screened for bccs on a regular basis as well as having been made aware of the necessity for adequate primary prophylaxis of skin cancer , such as the avoidance of excessive exposure to ultraviolet radiation . as ggs is a genetic syndrome affecting different organs , early recognition of the specific criteria for ggs is crucial [ 8 , 9 ] . in our case , the incidental finding of lamellar calcification of the falx cerebri of the head finally led to the diagnosis of ggs . this work was partly funded by a research grant from the german research foundation ( gu1271/2 - 1 ) to e.g.

here , we report the case of an incidental finding of lamellar calcification of the falx cerebri in a routine computed tomography scan of the head after an accidental trauma . this lamellar calcification led to the diagnosis of gorlin - goltz syndrome ( ggs ) in the patient and her daughter . lamellar calcification of the falx cerebri is a pathognomonic feature of ggs . our case report highlights the importance of a multidisciplinary diagnostic approach to ggs .

it is important to identify the relevant investigations for timely repair and prevention of serious morbidity . we report a case of a 23-year - old female who had sustained a penetrating trauma following a fall on sharp metal spike , but presented without any positive clinical finding . between the options of conservative management or explorative laparoscopy , a 23-year - old female tourist from the isle of man admitted as an emergency case 2 h after having a fall from 12-feet height onto a sharp metal spike of a lamp . she was haemodynamically stable with a total noble 's early warning score of 0 . on examination , there was 2 1 cm triangular penetrating wound on the left iliac fossa , some rebound tenderness and silent bowel . there are bruises but no evidence of head , neck , chest or limb injury . her blood tests ( i.e. haemoglobin , haematocrit , c - reactive protein and white cell counts ) were normal ; chest and abdominal radiography did not show any evidence of perforation . a computed tomographic ( ct ) scan of the abdomen and pelvis was arranged , which showed soft tissue injury on the left abdominal wall but no sign of penetration to the peritoneal cavity nor free fluid nor free gas in the abdominal cavity . explorative laparoscopy was consented for and there were 30 cc free blood in the douglas pouch ( fig . 1 ) and a contusive lesion of the descending colon ( fig . 2 ) . the lesion appeared ischaemic and involved in the serosa and muscle layer of the colon ( fig . 2 ) . she recovered well and discharged as soon as bowel function recovered , which was on the fourth day postoperatively . the incidence of penetrating abdominal trauma differs from hospital to hospital and management depends on patient 's haemodynamic stability . it is clearly stated in many literatures that the gold standard management of patient who presented with haemodynamic instability is an urgent laparotomy . however , the grey area still persists when it comes to which investigation is most useful to evaluate the patient who presents haemodynamically stable or with no clinical findings such as peritonitis or viscous perforation . an effective and efficient algorithm has yet been formed . when assessing a patient with penetrating injury , the main aim of the assessment is to identify injuries that might require urgent repair to avoid deterioration of the damage , thus avoiding an unnecessary laparotomy . routine investigation such as blood test and plain radiographs could give a prognostic picture of a patient . in this case , her plain abdominal and chest radiographs clearly indicated that no perforation of the bowel had occurred . given that her vital signs were stable and normal haematocrit , this indicated that no major haemorrhage has occured . it gives a good picture of any peritoneal injuries including the best view of the retroperitoneal structures . this imaging has sensitivity and specificity of 94.9 and 95% , respectively . despite being statistically effective , the ct scan could give a pitfall in evaluating a patient , whereas in this case it fails to detect minor injury such as bowel contusion . although requiring general anaesthesia and experienced laparoscopist , it could achieve 90100% sensitivity in evaluating abdominal trauma , shorter hospital stay and cost - effective [ 4 , 5 ] . in this case , therapeutic laparoscopy was also carried out and this had saved the patient from the possibility of delayed perforation of the bowel and late formation of stricture . in conclusion , a penetrating bowel trauma requires a systematic approach . the main objective in the algorithm is to evaluate if urgent laparotomy is required . in a ct scan is highly sensitive and specific , however , poor at detecting a bowel contusion . exploratory laparoscopy is a necessary adjunct in the diagnosis and management of penetrating bowel trauma .

a young lady presented to the hospital following a penetrating abdominal trauma . she was haemodynamically stable during the initial assessment . despite fruitless finding from blood test , plain radiograph and computed tomographic scanning , a bowel contusion was found during an explorative laparoscopy . here , we highlight the need for laparoscopy as a diagnostic and therapeutic tool in haemodynamically stable patient with a penetrating abdominal trauma .

basal cell carcinoma ( bcc ) is one of the common malignant cutaneous neoplasms seen in the elderly . nodular basal carcinoma is a more frequently seen variant , whereas fibroepithelioma of pinkus is rare . clinical examination revealed a single nodule of size 3 cm 4 cm on the lateral part of abdomen . it was dome - shaped in appearance and had surface telangiectasia [ figure 1 ] . nodule with pigmented beaded border and central dome - shaped , pinkish area on the lateral part of abdomen a biopsy from the nodule showed two different histological patterns , nodular at one half and anastomosing pattern at the other half [ figure 2 ] . both the tumor patterns were connected with the surface epidermis and also with one another . nodular masses were made up of basaloid cells with peripheral palisade , and cleft was noted between the tumor islands and the stroma [ figure 3 ] . , cords and columns of basaloid cells were seen forming reticulated network . at places peripheral palisading , melanin pigment , and follicular germ - like structures protruding were seen [ figure 4 ] . thus the histopathological and clinical features were suggestive of nodular bcc in continuity with fibroepithelioma of pinkus . masses of basaloid cells ( left half ) and cords and columns of basaloid cells forming reticulated pattern ( right half ) , ( h and e , 100 ) aggregations of basaloid cells with palisading at the periphery , cleft formation , and melanin pigment deposition is also seen ( h and e , 200 ) cords and columns of basaloid cells with peripheral palisading . nodular bcc is the commonest variant of bcc that presents as pearly or pigmented papule or nodule with rolled out border with or without ulceration on the sun - exposed parts . nodular bcc histologically shows tumor masses made up of basaloid cells having peripheral palisading and cleft between the surrounding stroma and the tumor islands . it is considered as a rare variant of bcc with distinct clinical and histopathological features . it presents as skin - colored to pink sessile or pedunculated papule or nodule on the trunk often resembling a fibroma . it is commonly reported to occur in adult males aged 4060 years . however , a few cases in pediatric population have been reported . it consists of basaloid cells arranged in cords and columns , which anastomose with each other . many of the cords and columns show connections with the surface epidermis . apart from cases of nodular bcc with fibroepithelioma of pinkus , other histological variants of bcc - like adenoid - cystic bcc and keratotic bcc has been described with fibroepithelioma of pinkus . fibroepithelioma of pinkus is considered as an unusual variant of bcc by some authors , whereas others consider it to be a benign analogue of bcc . presence of fibroepithelioma of pinkus in continuity with nodular bcc in this case supports its malignant nature .

fibroepithelioma of pinkus and nodular basal cell carcinoma ( bcc ) are different morphological variants of bcc . it is very rare to see both the variants together in a single lesion . here we report a case of a 56-year - old female who presented with a nodule on the trunk , which on biopsy showed features of both nodular bcc and fibroepithelioma of pinkus .

this is particularly true for subgroups of patients with symptomatic epilepsy , frequent generalized tonic fortunately , the injuries are most often trivial , with abrasions , contusions , and wounds being the most frequent . however , more severe injuries may also occur , like burns , head or dental injuries , and fractures . studies have shown an increased risk of fractures among people with epilepsy , but the extent of the increase is debatable . most fractures are caused by falls , but nontraumatic fractures caused by the seizures themselves have also been reported . although seizure - related compression fractures of the vertebral corpora in the thoracic spine are fairly well known , these complications are easily overlooked as some may be subclinical . generalized tonic clonic seizures comprise are the seizure type that is most often associated with such fractures , and the seizures may not always be due to epilepsy . here , i present a patient with symptomatic focal epilepsy who sustained a femoral neck fracture following a long - lasting focal motor seizure . the patient is a 47-year - old man living in a nursing home for people with epilepsy and disabling comorbidities of neurological , cognitive , and/or psychiatric nature . he has a long history of drug abuse ; for many years , he was addicted to amphetamine . at the age of 37 , he had a subarachnoidal hemorrhage ( sah ) which caused a left - sided hemiparesis and mild cognitive deficiency . eventually , he was able to walk with some assistance , but he spends most of his time in a wheelchair . in the first two years following the sah , he had two epileptic seizures . the first was a short - lasting focal motor seizure with left - sided convulsions and preserved consciousness . clonic seizure starting with left - sided jerks . following the last seizure , he was given lamotrigine , and on this medication while sitting in a wheelchair and possibly precipitated by an upper respiratory infection , he had a focal motor seizure with left - sided convulsions . during the seizure even though 25-mg ( 10 + 15-mg ) diazepam was given rectally , the seizure lasted more than 2 h. thus , he was transported to the local hospital . here , the seizure activity stopped spontaneously . on the following days , he complained of pain in the left hip area , and on the third postictal day , an x - ray of the hip disclosed a medial fracture of the left femoral neck ( fig . three months after this event , he had an assessment of bone mineral density in the right femur and lumbar spine ( dxa ) . the values were 2.0 and 1.7 sd below mean , respectively ( t - score : 2.3 and 2.0 ) . this case illustrates that forceful contractions sufficient to cause fractures may not only be associated with generalized tonic clonic seizures . this case illustrates that focal motor convulsions may give rise to such severe seizure - related complications . predisposing factors in this case were the long duration of the convulsions , i.e. , the seizure developed into epilepsia partialis continua , and his low bone mineral density . whether his sitting position ( he was sitting in a wheelchair during the first half hour of the seizure before he was lifted into a bed ) may have also played a role is uncertain . if and to what extent antiepileptic drugs are responsible for the decreased bone mineral density and increased fracture rate seen in people with epilepsy have been a matter of much debate for the last few years . while the enzyme - inducing drugs are assumed to exert a negative effect on bone health , drugs like lamotrigine , which was used in this case , however , bone strength is influenced by several factors other than drugs , e.g. , inheritance , smoking and exercise habits , bmi , nutrition , sun exposure , and some diseases . in this case , physical inactivity and heavy smoking is assumed to have contributed to the low bone mineral density and thus an increased susceptibility to fractures . in all patients who , in the postictal phase of an epileptic seizure , focal or generalized , present with severe pain in the hip area and inability to walk , a fracture of the femoral neck should be suspected . to avoid avascular necrosis of the femoral head ,

people with epilepsy are more accident prone than the non - epilepsy population . bone fractures are most often due to seizure - related falls . however , seizures themselves , in particular generalized tonic - clonic seizures , may also cause fractures , e.g. of the thoracic spine . here , i present a man who developed focal epilepsy following a subarachnoidal hemorrhage . during a focal motor seizure with left - sided convulsions and preserved consciousness that lasted 2 hrs , he sustained a femoral neck fracture . in persons with low mineral density , as in this case , contractions associated with simple focal motor seizures may be sufficient to give rise to such a severe complication .

herein , we describe a case of colon cancer and synchronous liver metastasis in which both tumours were treated laparoscopically . a 70-year - old woman was admitted to our hospital with a diagnosis of cancer of the sigmoid colon . barium enema showed an encircling mass in the sigmoid colon [ figure 1 ] . computed tomography ( ct ) revealed a low - density area in the left lateral segment of the liver [ figure 2 ] . liver function was normal , and the pre - operative carcinoembryonic antigen level was 6.2 ng / ml ( normal range , < 5 ng / ml ) . we planned two - stage procedure for the patient because it was considered to be a highly invasive treatment for this elder patient when both sigmoid colectomy and hepatectomy were performed simultaneously . in addition , interval hepatic resection for synchronous metastases of colorectal cancer , with a routine waiting period of 46 months , was recommended to improve the patient selection . therefore , laparoscopic sigmoid colectomy was performed first . with the patient in the supine position , pneumoperitoneum of 8 mmhg was established , and trocars were placed in the right upper and lower abdomen [ figure 1 ] . after the sigmoid colon was mobilised from the surrounding tissues , a skin incision ( 6 cm ) was made in the left lower abdomen . the sigmoid colon was exteriorised and resected through the skin incision after appropriate barrier protection of the wound edges was ensured . the post - operative course was uneventful , first flatus was recognised on day 2 , solid diet was started on day 3 , the patient was discharged and directly went home on post - operative day 11 . ( a ) barium enema shows an encircling tumuor in the sigmoid colon ( arrows ) ( b ) port sites for laparoscopy assisted sigmoid colectomy ( a ) computed tomographic scan shows a metastatic liver tumour ( arrow ) ( b ) port sites for laparoscopic partial hepatectomy five months after the first operation , ct scan revealed that the slight enlargement of the liver tumour ( 2537 mm in diameter ) , but new lesions were not observed [ figure 2 ] . after co2 insufflation with a pressure of 8 mmhg , inspection of the peritoneal cavity revealed no remarkable adhesion . the falciform , left triangular and coronary ligaments were dissected , and the left hepatic lobe was mobilised . hepatic resection was performed with an endoscopic autosuture stapler ( endogiaii , us surgical , norwalk , ct , usa ) under lower pneumoperitoneum pressure to prevent gas embolism . the resected specimen was removed from the port site , which was enlarged to 3 cm in the supraumbilical area with an endocatchii device ( us surgical ) . the post - operative course was uneventful and the patient was discharged and directly went home on day 14 . she is currently doing well , with no evidence of disease recurrence during the 8 months since the procedure . further development of instruments and techniques has made it possible to apply laparoscopic surgery to malignant diseases . to our knowledge , this is the first report of laparoscopic resection of both primary tumour and metastatic liver tumour . in comparison to conventional surgery , laparoscopic surgery is beneficial with respect to short - term outcome , including earlier recovery and less pain . our research in a murine model has shown that laparoscopic surgery is advantageous for gastrointestinal malignancies due to reduced impairment of systemic and intraperitoneal cell - mediated immune responses . although a comparison of long - term outcomes between laparoscopic and conventional surgeries for advanced colon cancer has been recently published , there have been no reports of randomised trials of laparoscopic hepatectomy in patients with metastatic liver tumours .

we report herein the case of 70-year - old woman in whom colon cancer and a synchronous metastatic liver tumour were successfully resected laparoscopically . the tumours were treated in two stages . both post - operative courses were uneventful , and there has been no recurrence during the 8 months since the second procedure .

cap polyposis is a rare but distinct disorder with characteristic endoscopic and histological features.1,2 it is characterized by multiple distinctive erythematous , inflammatory colonic polyps located from the rectum to the distal colon . and the polyps are covered with fibrinopurulent mucus which appears like a ' cap . ' the etiology of this disease is still unknown , and no specific treatment has been established . there have been a few reports about the cases of cap polyposis responsive to infliximab.3 herein we report a cap polyposis that was remarkably improved after a single infliximab infusion and had no recurrence for 3 years . a 58-year - old woman was admitted to our hospital because of mucous bloody stools , frequent defecation and tenesmus for 2 weeks . one month ago , the patient had been managed in other hospital with 2nd generation cephalosporin antibiotics because of community acquired pneumonia . on physical examination hemoglobin was 14.5 g / dl , white blood cell count was 6,380/mm , platelet count was 319,000/mm and data of c - reactive protein or erythrocyte sedimentation rate were not increased . stool occult blood test was positive , but , clostridium difficile antigen assay of stool was negative . colonoscopy showed about 20 reddish sessile polyps covered with white purulent exudates , and scattered hyperemia on rectum and sigmoid colon . we first diagnosed pseudomembranous colitis based on patient 's history of antibiotics administration and colonoscopic finding . however , there was no clinical symptom improvement after oral administration of 250 mg metronidazol qid for 3 weeks . the colonoscopic finding for follow up showed no improvement , and additional biopsy was performed . histological finding showed that the polyps were consisted of elongated , tortuous , and hyperplastic crypts that attenuated toward the surface ( fig . heavy infiltration of inflammatory cells , ulcerated mucosal surface and fibrinopurulent exudates are characteristic of the so - called " cap polyp . " on the basis of these characteristic colonoscopic and histologic findings , therefore , the patient was diagnosed with cap polyposis . after 12 months of these managements , there was no improvement of clinical symptom and colonoscopic finding . then , we considered surgical management or infliximab infusion . therefore , we first administered 5 mg / kg dose of infliximab . at 7th days , following the infliximab infusion , clinical improvement occurred . after 4 weeks of infliximab infusion , colonoscopy revealed that the multiple sessile polyps decreased in size and numbers ( fig . therefore , we decided to follow up the patient with no additional administration of infliximab . for 3 years , the patient experienced no clinical symptom recurrence , and the last colonoscopy revealed almost complete mucosal recovery except for tiny scant scars ( fig . common clinical manifestation of cap polyposis is mucous bloody diarrhea lasting for weeks to months , and women are mostly afflicted . tenesmus , rectal bleeding , abdominal pain , constipation , weight loss , and hypoproteinemia have also been reported.3,4 epidemiology and etiology of cap polyposis have not been well known . several suggestions have been made on its pathogenesis , including a form of inflammatory bowel disease , an infectious origin such as helicobacter pylori or escherica coli 018 , improvement after antibiotics treatment,5,6 whereas other suggested on association with mucosal prolapse syndrome or abnormal colonic motility resulting in local ischemia and recurrent mucosal trauma.5,6 diagnosis of this disease in the present case was established through colonoscopic finding , clinical manifestation and histological finding . the endoscopic finding showed erythematous polyps with adherent fibrinopurulent exudates like a cap , and this finding resembled inflammatory polyp or pseudomembranous colitis . the microscopic finding revealed elongated hyperplastic glands with inflammatory infiltrate in the lamina propria and fibromuscular obliteration of lamina propria . the cap of polyp is formed by mucus , fibrin , and inflammatory cells.1,3 several case reports have suggested a few treatment modalities , based on etiological hypothesis ; anti - inflammatory agent , antibiotics , immunomodulators , and endoscopic and surgical therapy ( table 1 ) . however optimal treatment has not yet been established . the effectiveness and administration schedule of infliximab for cap polyposis also have not yet been established . one report described complete remission after four infusions of infliximab at 0 , 8 , 12 , and 24 weeks , however another reports showed no benefit after a similar treatment.3,9 in our present case , the patient fortunately achieved remarkable clinical , endoscopic and histological responses after single infusion of infliximab . the short term response of our patient was published in korean.20 our present case is the long term follow up result after 3 years . furthermore , resolution of the disease maintained for 36 months . consequently , our present case might support the hypothesis that inflammation has some role in the pathogenesis of cap polyposis.3 of course , additional studies about cap polyposis treated with infliximab infusion , including its optimal dosage and administration schedule , are needed . nevertheless we suggest that infliximab might be a good treatment modality for cap polyposis patients who are refractory to conservative management .

cap polyposis is a rare disorder with characteristic endoscopic and histological features ; its etiology is still unknown , and no specific treatment has been established . we report a case of cap polyposis that improved remarkably after infliximab infusion and had no recurrence for 3 years .

a 31-year - old indian woman , with a history of hypothyroidism ( on levothyroxine tablets 100 g / day ) presented with a history of fever of 104f of 5-day duration to the department of internal medicine ; investigations done at a laboratory of paras hospital , gurgaon , showed low platelet counts ( 45,000/cumm ) with positive dengue serology both immunoglobulin g and m ) . one day after admission in the hospital , she had sudden loss of vision in both eyes with headache and vomiting . on neurosurgery consultation , she was conscious , oriented with bilateral complete loss of vision ( no perception of light ) and no direct or consensual light reflex with a pupil size of 4 mm in diameter . rest of the neurological exam was normal ; magnetic resonance imaging ( mri ) of the brain revealed pituitary macro adenoma of 16 22 mm size with evidence of acute hemorrhage ( iso- to hyperintense on t1 and hypointense on t2 ) with enhancement of the tumor on contrast [ fig . 1 ] . serum prolactin was 11.68 ng / ml ( normal 4 - 30 ng / ml ) and serum thyroid stimulating hormone ( tsh ) was 4.649 iu / ml ( normal 0.33.0 iu / ml ) on thyroxin replacement therapy . urgent transnasal trans sphenoidal decompression of the macroadenoma was done , after replacing platelets ( > 100,000/cumm ) . vision was 20/60 and 20/40 in the right and left eye , respectively , with residual bilateral temporal field defects after 3-month follow - up . dengue hemorrhagic fever is one of the causes of low platelet count leading to petechial rash and spontaneous bleeding from mucosal surfaces . our case was a patient diagnosed with dengue hemorrhagic fever with a low platelet count without any rash or systemic bleeding . this catastrophe had arisen due to bleeding into the pituitary adenoma , probably predisposed by the low platelet count due to dengue hemorrhagic fever . in medical literature , this association has never been reported . by pointing out this rare association , authors want to emphasize that a low platelet count due to dengue hemorrhagic fever may cause pituitary adenoma apoplexy . under this condition , mri of the brain should be done and pituitary hormones levels should be checked to rule out pituitary apoplexy . other causes of visual deterioration in patients with dengue fever are optic neuropathy , maculopathy , retinal capillary occlusion , foveolitis , and retinal hemorrhage . if the diagnosis is made in time , urgent treatment in the form of decompression of optic nerves through transnasal trans sphenoid route may help to save vision as in the presented case .

dengue hemorrhagic fever leading to hemorrhage in pituitary adenoma is not reported till date : we herein report the first case of bilateral visual loss secondary to pituitary adenoma hemorrhage associated with dengue hemorrhagic fever . urgent transnasal trans sphenoidal decompression of the macroadenoma prevented permanent visual loss in this patient . pituitary apoplexy should be considered as differential diagnosis of visual deterioration apart from retinal hemorrhage , maculopathy , and optic neuropathy in cases of dengue hemorrhagic fever . early decompression of optic nerves helped in the restoration of vision .

hydrocephalus is a well - known complication of brain lesions , but it can also be a rare complication of a spinal lesion . it has been described in association with spinal tumors , spinal infections , and congenital anomalies of the cervicomedullary junction4,5,7,9 ) . however , acute obstructive hydrocephalus caused by cervical fracture and dislocation has been reported extremely rarely . here , we present a rare case of acute obstructive hydrocephalus following a cervical fracture and dislocation . a 60-year - old female patient was referred to our emergency room(er ) with quadriplegia and respiratory difficulty . prompt intubation and mechanical ventilation support were required in the er . on neurological examination , her mental state was alert and cranial nerve functioning was normal , showing no evidence of head injury . however , she showed quadriplegia and anesthesia below the c3 dermatome and her respiration was faint . we also detected decreased anal tone and loss of urinary sense . computed tomography ( ct ) of brain revealed no evidence of abnormalities such as hemorrhage or hydrocephalus ( fig . 1 ) . plain cervical radiography and ct scan of cervical spine revealed a fracture and dislocation at the c3 - 4 level ( fig . 2 ) . cervical spine magnetic resonance imaging ( mri ) with ventilator support demonstrated severe cord compression with evident signal change at the c3 - 4 level ( fig . because of her inability to breathe independently , she was treated conservatively with high - dose methylprednisolone and intravenous fluid . however , 24 hours after the admission , her mental status had deteriorated to stupor , and both her pupils had dilated to 5 mm . 4 ) . to alleviate the symptoms , we performed lumbar cerebrospinal fluid ( csf ) drainage . after the evd , her mental status improved to drowsiness . however , 4 days after evd when the drainage catheter was removed , she fell into a deep stupor and the pupillary reflex disappeared . her family refused further treatment , and she became comatose and expired 2 months after injury because of respiratory failure , in spite of mechanical ventilator support . hydrocephalus is a well - known complication of head injury but an uncommon complication of a spinal lesion . acute hydrocephalus is thought to result from the blockage of csf flow in the brain . specifically , blockage of the ventricular system at the outlet foramen or structural blockage of the arachnoid villi generates a pressure gradient that ultimately leads to the enlargement of the ventricles2 ) . on the contrary , hydrocephalus caused by spine pathologies , such as spinal tumors , spinal infections , postcervical myelography , and congenital abnormalities of the cervicomedullary junction , has been reported . in these cases , the pathology was thought to be caused by the disruption of csf flow , impaired absorption at arachnoid villi due to elevated csf protein or fibrinogen , tumor infiltration into the cistern , direct compression of the ventricular outlet , or compression of the spinal venous plexus by the tumor itself . however , hydrocephalus after spinal trauma is extremely rare . the non - communicating type is usually the result of the obstruction of csf flow due to congenital anomalies such as aqueduct stenosis or tumors . the communicating hydrocephalus is usually post - inflammatory in origin and complicated by acute or chronic meningitis . hydrocephalus that results from head injury is usually communicating8 ) . in our patient , however , we believe that the pathogenesis may be related to non - communicating hydrocephalus . the first possible mechanism is the direct compression of the csf outlet pathways . menendez et al.6 ) reported a case of hydrocephalus with an occipital condylar fracture fragment pushing into the medulla oblongata . this bone fragment may have caused direct compression and obstruction of csf outlets , such as the fourth ventricle , foramen of magendie , or foramen of luschka . the second plausible mechanism of hydrocephalus is a spinal cord edema secondary to complete cord injury . yablon et al.10 ) suggested that the swelling of the spinal cord , observed after spinal trauma , may extend up to two vertebral segments above and below the injured vertebrae . challagundla et al.1 ) reported a case of hydrocephalus following fracture dislocation of c5 - 6 in a patient with ankylosing spondylitis . he postulated that hydrocephalus resulted from the obstruction of csf flow at the fourth ventricular outlets due to the ascending edema of the medulla oblongata from the cervical spine . we conjecture that an edema , ascending the spinal cord to brain stem , may have obstructed the csf flow pathways at the fourth ventricular outlets and raised intracranial pressure in our patient . acute hydrocephalus resulting from complete spinal cord injury following cervical fracture and dislocation is an unusual complication . although rare , it should be considered if the patient 's level of consciousness deteriorates after spinal cord injury .

hydrocephalus is a well - known complication of head injury , but an uncommon complication of a spinal lesion . here , we present a rare case of acute obstructive hydrocephalus secondary to a cervical fracture and dislocation . a 60-year - old female patient was transferred to the emergency department with quadriplegia and respiratory difficulty . imaging studies showed a cervical fracture and dislocation at the c3 - 4 level . she required intubation and mechanical ventilation . twenty - four hours after admission , her mental status had deteriorated and both pupils were dilated . computed tomography of the brain showed acute hydrocephalus ; therefore , extraventricular drainage ( evd ) was performed . after the evd , her mental status recovered and she became alert , but she remained quadriplegic and dependent on the ventilator . two months after injury , she died because of respiratory failure caused by pneumonia .

sirenomelia is a rare and fatal congenital anomaly characterized by single fused lower limbs with multiple urogenital and anorectal malformations with an incidence of 0.8 - 1 case /100000 births , with male to female ratio being 3:1 . the sequence was originally described by rocheus in 1542 and palfyn in 1953 and named after the mythical greek sirens . duhamal in 1961 defined the anomalies of mermaid syndrome and described it as the most severe form of caudal regression syndrome . this syndrome has a strong association with maternal diabetes where the relative risk is 1:200 to 1:250 and 22% of fetuses with this anomaly will have diabetic mothers . most of the cases of sirenomelia results in still birth or die within in a day or two due to congenital complications . a 34-week , 1400-g preterm infant of unidentified sex was born to a 23-year - old primigravida mother with no significant past medical history . the infant was delivered by assisted breech vaginal delivery with an apgar 's score of 3 and 5 at 1 and 5 minutes , respectively . on physical examination of the infant showed single umbilical artery with multiple external deformities including a single lower tapering web like lower extremity with no feet and absence of external genitalia and anus . additionally , potter 's facies i.e. , prominent infraorbital folds , small slit like mouth , receding chin , downward curved nose , and low set soft dysplastic ears were seen [ figures 1 and 2 ] . an autopsy was performed which showed severe bilateral lung hypoplasia , absence of the bladder , ureters , and bilateral kidneys . uterus and vagina were atretic but ovaries and fallopian tubes were normal , rectum and anus were atretic . death was attributed to pulmonary hypoplasia along with renal anomalies , and a diagnosis of sirenomelia was given . potter 's facies i.e. , prominent infraorbital folds , small slit - like mouth , receding chin , downward curved nose , and low set soft dysplastic ears including a single lower tapering web like lower extremity with no feet potter 's facies i.e. , prominent infraorbital folds , small slit - like mouth , receding chin , downward curved nose , and low set soft dysplastic ears including a single lower tapering web like lower extremity with no feet antero - posterior view showing single femur and tibia lateral view showing single femur and tibia sirenomelia as a part of caudal regression syndrome has its own pathogenesis which is maternal metabolic derangement in diabetes , but evidences have shown that sirenomelia and caudal regression are two different entities . the etiology of sirenomelia is unclear though it is well known that the embryological injury occurs between 28 and 32 days of life and the site is at the caudal mesoderm . stevenson et al . explains diversion of blood away from the caudal region of the embryo through the abdominal umbilical artery although altered oxidative metabolism from maternal diabetes may cause free oxygen radicals in the developing embryo which may be teratogenic . recent studies have shown that vascular disruption precedes caudal dysgenesis in the mouse . in our case report the clinical and anatomical features consistent with sirenomelia apus type as there is only one tibia and one femur . this type of vascular anomaly is considered a remnant of the vitelline artery complex and is almost always associated with sirenomelia . so if diagnosed early the alternative of termination of pregnancy can be safely advised to the mother . similarly proper control of blood glucose level in a diabetic mother may prevent the occurrence of sirenomelia .

sirenomelia also known as the mermaid syndrome , is a rare congenital malformation of uncertain etiology . it is characterized by fusion of the lower limbs and commonly associated with severe urogenital and gastrointestinal malformations . there are approximately 300 cases reported in the literature , 15% of which are associated with twinning , most often monozygotic . the syndrome of caudal regression is thought to be the result of injury to the caudal mesoderm early in gestation .

hemiballism - hemichorea ( hb - hc ) is characterized by the continuous and involuntary movements of both the distal and proximal part of the extremities . most of cases are associated with diabetes mellitus with poor control and presented in the elderly women . typical brain magnetic resonance imaging ( mri ) presentation shows unilateral hyper - intensity signal over the striatum region , contra - lateral to the symptom side . nonetheless , bilateral hb - hc is seldom reported . here a 85-year - old taiwanese woman with poor controlled non - insulin dependent diabetes mellitus ( niddm ) noted four limbs involuntary movements one week prior to medical attention . a neurological consultation was made and it revealed she had bilateral hb - hc ( first with left sided extremities , which was then ensued with right sided extremities ) . after admission , contrasted cerebral mri was performed ; it showed the evidence of t1 weighted imaging with hyperintensity signal in bilateral putamen regions ( figure 1 ) . the routine laboratory work - up showed that her fasting blood sugar was up to 500 mg / dl and hemoglobin a was 16.2% . during the two - week hospitalization , her bilateral hb - hc was greatly subsided . after she discharged from the ward , her bilateral hb - hc remained silent . the second mri was taken four months after her initial involuntary episode and showed complete resolution of the previously - reported brain lesions . we report the case of a patient with initial hbhc over the left side extremities . the symmetrical focal abnormalities over bilateral striatum of her brain mri taken during the hospitalization correspond to her clinical manifestations . the clinical symptom could be alleviated with intensive correction of hyperglycemia state and administration of low doses of haloperidol . the follow - up brain mri , which showed intact cerebral parenchyma , also echoes the satisfactory treatment . on literature review , most of reported cases are associated with poor controlled type 2 diabetes mellitus in either hypoglycemic or hyperglycemic state as the initial manifestation . the other etiologies are ischemic change contra - lateral to the lesion side , infection , or tumor metastasis . it is speculated by some scholars inflammation process plays a pivotal role in this malady owing to increased level of igg in cerebrospinal fluid examination . however , the definite cause of hb - hc is still uncertain and required advanced studies . in addition few cases have been documented with bilateral hb - hc , and whose efficacy of treatment and neuro - imaging studies are compatible with one another .

hemiballism - hemichorea ( hb - hc ) is a hyperkinetic disorder characterized by continuous involuntary movements of the extremities . it could be associated with non - insulin dependent diabetes mellitus . a very few cases of bilateral hb - hc have been reported until today . we describe here the case of a taiwanese woman ( 85 years old ) presenting with bilateral hb - hc and diabetes mellitus .

both hodgkin and non - hodgkin lymphoma ( nhl ) can involve the bones . the involvement may be solitary or multi - focal . combined treatment with chemotherapy and radiation has good response with the majority of the low - risk patients surviving until 10 years . we present the role of 18 fluoride - fluorodeoxyglucose ( 18f - fdg ) positron emission tomography - computed tomography ( 18f - fdg pet - ct ) in an interesting case of primary diffuse large b cell lymphoma ( dlbcl ) of the tibia . a 53-year - old - male patient who presented with pain and swelling of the right lower limb was evaluated . a biopsy from the swelling revealed dlbcl . he was referred to our center for a whole body 18f - fdg pet - ct for initial staging . pretreatment 18f - fdg pet - ct of the thigh and leg showed intense metabolic activity in a large soft tissue mass arising from the proximal part of right tibia [ figure 1 ] . pretreatment 18 fluoride - fluorodeoxyglucose positron emission tomography - computed tomography ( pet - ct ) showing intense metabolically active soft tissue lesion noted involving the proximal part of right tibia ( coronal pet ( a ) , fused coronal pet ct ( b ) , sagittal pet ( d ) , sagittal fused pet ct ( e ) and maximum intensity projection ( mip ) lower limbs ( f ) ) . mip of the whole body fdg pet ( c ) showing no abnormal lymph nodes elsewhere in the body the patient underwent chemotherapy and local radiation to the involved site and was referred for an 18f - fdg pet - ct 3 months after the completion of treatment . posttreatment 18f - fdg pet - ct was normal with complete regression of previously noted abnormality [ figure 2 ] . posttreatment 18 fluoride - fluorodeoxyglucose positron emission tomography - computed tomography ( pet - ct ) showing complete resolution of metabolic activity in the proximal part of right tibia ( coronal pet ( a ) , fused coronal pet ct ( b ) , sagittal pet ( d ) , sagittal fused pet ct ( e ) and maximum intensity projection ( mip ) lower limbs ( f ) ) . mip of the whole body fdg pet ( c ) showing no abnormal lymph nodes elsewhere in the body . primary bone lymphomas represent approximately 5% of the extranodal lymphomas , majority of which are dlbcl . they can arise from any bone , but long bones ( femurs and tibiae ) are the common sites . 18f - fdg pet ct helps in identification of lymph nodal involvement and also differentiation of monostotic from polyostotic involvement by lymphoma . 18f - fdg pet - ct is beneficial in the response assessment and effectiveness of treatment . viable tumor lesions are difficult to be differentiate from bone fibrosis and remodeling using conventional modalities . 18f - fdg pet is also more sensitive than magnetic resonance imaging in identifying response . patients treated with combined modality versus single modality therapy were found to have a superior outcome , with a significantly better survival . the 5-year overall survival for patients treated with combined modality was 95% in one of the largest studies . reports on the utility of 18f - fdg pet - ct in primary bone lymphomas have also been published . role of 18f - fdg pet - ct in initial staging and response assessment in lymphomas has been well - established . this case reports adds to the existing knowledge that 18f - fdg pet - ct is a useful modality in assessment of primary bone lymphoma .

primary lymphoma of the bone is a rare clinical presentation constituting to < 1% of all lymphomas . the long bones are usually involved . combined treatment with chemotherapy and radiation offers long - term survival . the authors present the role of 18 fluoride - fluorodeoxyglucose positron emission tomography - computerized tomography in initial staging and response assessment in a case of primary diffuse large b cell lymphoma of the tibia .

gastrointestinal leiomyomas are rare benign tumors incidentally detected during endoscopy in asymptomatic population . clinical presentation may vary from non - specific abdominal pain to life - threatening complications like massive bleeding and perforation requiring emergent surgical interventions . our case is first of its kind in cecum which is managed by endoscopic mucosal resection resulting in complete excision and resolution of symptoms . a 51-year - old woman was referred to gastroenterology clinic for screening colonoscopy . at the initial visit , the patient reported intermittent episodes of rectal bleeding for the last few months prior to the visit . her past medical history was significant for hypertension , diabetes mellitus , dyslipidemia and vitamin d deficiency . on initial evaluation , she was afebrile with heart rate of 86 beats per minute and blood pressure of 160/100 mm hg . laboratory workup revealed a normal hemoglobin of 14.7 g / dl , hematocrit 44% , white cell count of 12.6 10/l and platelets of 255 10/l . she was noted to have two sessile , smooth polypoid lesions measuring 20 mm ( fig . 1 ) and 6 mm in the cecum . 2 ) with interlacing fascicles of spindle shaped cells and cigar shaped nuclei ( fig . 4 ) . section of leiomyoma of cecum showing a downward proliferation of muscularis mucosae which elevated the mucosa . cecal leiomyoma on high magnification showing interlacing fascicles of spindle shaped cells with cigar shaped nuclei . gastrointestinal leiomyomas are smooth muscle tumors arising from the muscularis mucosae , muscularis propriae and possibly from smooth muscle of the vessel wall in the bowel . they are also known to be slow growing tumors predominantly seen in men and mean age of detection is 62 years . though they are known to occur in the entire gastrointestinal tract , esophagus is reported as the most common site . colonic leiomyomas are uncommon with a reported incidence of 3% of all the gastrointestinal leiomyomas . in the large intestine , recto - sigmoid and descending colon are the most common sites of origin . to the best of our knowledge there were a total of 16 cases of leiomyoma in the cecum and ascending colon out of the total 87 cases in the whole colon , making this tumor in the right colon a very rare one . malignant tumors in turn are primary and metastatic . benign tumors involving the cecum may be hyperplastic polyps , adenomatous polyps and lipomas . leiomyomas can be asymptomatic and can be detected during routine colonoscopy . when symptomatic , the symptoms range from abdominal pain , altered bowel habit and bleeding . bleeding from leiomyoma can vary from being detected on occult blood testing [ 8 , 9 ] to more overt bleeding . massive blood loss needing transfusion , perforation , obstruction , intussusception and hemoperitoneum are among the few complications described which generally require surgical intervention . endoscopic snare cauterization with or without saline lift has been described in literature especially for tumors involving the left colon [ 9 , 12 ] . endoscopic submucosal dissection has also been done for leiomyomas of the esophagus and stomach . however , to the best of our knowledge , there have not been reports of such therapy being attempted in the right colon with none reported so far in the cecum . our case proves that such treatment in cecum can be safely attempted with proper technique and expertise . alternatively , the use of endoscopic ultrasound to assess precisely the location and origin of tumor for feasibility of endoscopic resection has also been suggested in literature . however , it should be borne in mind the fact that most of these tumors mimic epithelial polyps in their gross appearance during colonoscopy . . massive bleeding and giant tumors causing compression are some of the clinical scenarios necessitating bowel resection which were also described in literature [ 7 , 16 , 17 ] . we are not aware of any specific recommendations for follow - up after resection , although this is probably based on the clinical scenario and type of treatment and completeness of resection .

gastrointestinal leiomyomas are smooth muscle tumors arising from the muscularis mucosae , muscularis propriae and possibly from smooth muscle of the vessel wall . management depends on the size , location and the clinical scenario . endoscopic snare cauterization with or without saline lift has been described in literature for tumors involving the left colon . to the best of our knowledge , endoscopic resection of right colon leiomyoma was never attempted in the past . we present a case of cecal leiomyoma which was resected endoscopically .

in ano - rectum different types of neoplastic as well non - neoplastic lesions can occur . among the latter , hemorrhoids , anal fissure or polyps are common . this is a report of an anal growth , which was clinically diagnosed as thrombosed pile but histopathology and immunohistochemistry revealed its real nature . a 60-year - old male presented to surgical out - patients department complaints of bleeding from rectum and pain during defecation . he reported a history of weight loss and anorexia , and at examination he was pale and cachectic . on rectal examination a growth about 321 cm was found in the rectum , 4.3 cm from the anal verge . the clinical diagnosis was of a thrombosed pile , therefore it was excised and sent for histopathological examination . the examination at the microscopy revealed a tumor replacing the entire wall thickness with ulceration of overlying epithelium . the tumor cells were disposed in fascicles and sheets ( figure 1a ) and were spindle - shaped . few of them showed prominent inclusion like nucleoli and atypical mitotic figures , while many contained blackish pigment ( figure 1b ) . the tumour cells were strongly positive for s-100 and hmb-45 ( figure 1d ) . based on these findings a diagnosis of sarcomatous variant of malignant melanoma figure 1microphotograph of the tumor in the ano - rectum showing ( a ) the tumor cells arranged in long parallel running fascicles ( b ) the high - power view of individual cells with prominent spindling and abundant blackish pigment in many of them ( c ) schmorl 's stain demonstrating the pigment to be melanin stained as blue green granules and ( d ) strong positivity for hmb-45 in the tumor tissue . microphotograph of the tumor in the ano - rectum showing ( a ) the tumor cells arranged in long parallel running fascicles ( b ) the high - power view of individual cells with prominent spindling and abundant blackish pigment in many of them ( c ) schmorl 's stain demonstrating the pigment to be melanin stained as blue green granules and ( d ) strong positivity for hmb-45 in the tumor tissue . thereafter , an abdomino - perineal resection with removal of bilateral inguinal , pelvic and mesorectal lymph nodes was carried out . on histological examination no residual tumor was identified at the primary site , however one of the inguinal lymph nodes was found to harbor the metastatic tumor deposits . the patient received radiation and chemotherapy and was then discharged and advised for a regular follow - up . the patient however came back after 13 months and on computerized tomography ( ct ) scan of abdomen showed multiple secondaries in liver . the patient was discharged on his own request and thereafter no follow up could be obtained . malignant melanoma is a rare neoplasm in the ano - rectum accounting for only 13% of all tumors . most of the malignant melanomas are of classical type and the sarcomatous variant , although it is well known in skin has been rarely reported at this site . by reporting this case we intended to alert clinicians and pathologist about its occurrence and importance of its recognition . a dermal sarcomatoid melanoma has even worse prognosis than classical malignant melanoma with a 5-year survival rate accounting to only 15% , despite an aggressive , multimodality approach . it has been reported that 38% of patients have already metastatic disease at the time of diagnosis . however , its prognosis in ano - rectum is not yet clear due to its rarity at this site . the present case also showed a dismal prognosis , as patient developed disseminated malignancy despite aggressive therapy . further data on the various prognostic factors is needed , which is possible only if more cases are reported . its diagnosis also may be difficult even on histology and it may be confused with other more common spindle cell tumors i.e. leiomyoma , haemangioma , haemangiopericytoma , neurilemmoma , neurofibroma , granular cell tumor , spindle cell lipoma , gastrointestinal stromal tumor , malignant fibrous histiocytoma , leiomyosarcoma , rhabdomyosarcoma , fibrosarcoma and spindle cell carcinoma . the key diagnostic feature is the melanin production , which may be absent in approximately 20% of the cases . in such difficult cases only immunostaining can help in achieving the correct diagnosis . a sarcomatous melanoma in ano - rectum is seldom reported in the literature and the present case highlights several key points . most importantly , when faced with a spindle cell lesion of anal canal , especially in an elderly , the diagnosis of sarcomatous melanoma must be included in the differential . as occurred in our case , the clinical impression is often misleading , therefore it is important that the pathologist maintain a high index of suspicion . the histologic appearance of sarcomatous melanoma mimics other spindle cell tumors , therefore immunohistochemical stains play an important role in diagnosis . since present therapeutic strategies may not necessarily alter the prognosis , an early recognition of this unusual variant of malignant melanoma is a key to prolong the survival .

we report a case of extremely rare variant of ano - rectum malignant tumor . the tumor is often misdiagnosed as either hemorrhoids or rectal polyp , which are benign diseases . on histology also this variant may be confused with other more commonly occurring spindle cell lesions in this area ; its recognition is therefore important as it normally has a poor prognosis .

lemierre 's syndrome is rare and to our best knowledge never before described after gynecological surgery ; however , it should be considered in case of rapidly developing respiratory problems after even simple surgical procedures . these bacteria are common in the oropharyngeal tract , and the syndrome often originates here . the patient usually presents with sore throat and fever , later complicated by pulmonary infarcts , respiratory dysfunction , and often also arthritic manifestations . without proper antibiotic treatment , the syndrome is rare , with 3,6 annual cases per million inhabitants in denmark , the incidence being highest between the ages of 14 and 24 years . in this article , we present a case of lemierre 's syndrome after evacuation of the uterus in an otherwise healthy young woman . a 26-year - old otherwise healthy woman was referred to the department due to rising levels of human chorionic gonadotropin and intermittent vaginal bleeding 6 weeks after a legal medical abortion . a new vaginal ultrasound revealed placental remnants in the uterus , and a surgical evacuation of the uterus was carried out . the operation went without complications , and the patient was discharged later on the day of the surgery . the following day , the patient was readmitted due to a temperature of 39.5c and abdominal pain and , suspecting severe endometritis , metronidazole , benzylpenicillin , and gentamicin were administered intravenously . within 24 h , the patient deteriorated , saturation fell to 90% and respiratory rate rose to around 40 breaths per minute even though oxygen was given by mask . temperature peaked at 40.7c even though antibiotics was administered intravenously , c - reactive protein rose to around 300 mg / l and leukocytes to around 15 10/l . the patient was moved to the intensive care unit and intubated . due to the rapid deterioration of respiratory function , a ct scan was performed showing thrombophlebitis of the internal jugular vein and hepatomegaly , and the patient was diagnosed with lemierre 's syndrome . benzylpenicillin and gentamicin were discontinued , and instead tazocin and clindamycin were administered in combination with metronidazole . after 2 weeks of respiratory support and antibiotics at the intensive care unit and another week in a standard hospital ward , the patient had recovered and was discharged . at no point had the patient presented with symptoms from the oropharyngeal tract . blood cultures showed infection with f. necrophorum , which were also cultivated from the patient 's cervix , and it was concluded that the infection originated from the cervix . infection following surgical evacuation of the uterus is common , occurring after 57% of all evacuations . common infective agents include neisseria gonorrhoea , chlamydia thracomatis , gardnerella vaginalis , and a wide variety of anaerobic bacteria . fusobacterium necrophorum is a common finding in the urogenital tract , however , normally not a pathogenic one and we have found only one previous report of lemierre 's syndrome caused by f. necrophorum originating from the urogenital tract . it is not known how infection with f. necrophorum causes septic thrombophlebitis of the internal jugular vein . for lemierre 's syndrome originating in the oropharyngeal tract , both hematogenous spread ; local spread through the oropharyngeal lymphatic system and spread through abscesses in the loose connecting tissue close to the internal jugular vein has been suggested . our case supports the theory of hematogenous spread , as the patient never had symptoms from the oropharyngeal tract , and as f. necrophorum was cultivated from the patient 's cervix and not from her oropharyngeal tract . once infection reached the internal jugular vein , it will spread hematogenously throughout the body , causing a variety of complications , that is , pulmonary embolisms , arthritis , or abscesses . early diagnosis and correct treatment is crucial to complete recovery . the syndrome is best diagnosed through a ct of the neck and lungs , which will show thrombophlebitis of the internal jugular vein . antibiotic treatment should be given upon suspicion , and should include metronidazole and beta - lactamase inhibitor . to prevent thromboembolic complications , anticoagulation should be considered . other efforts , that is , respiratory support or surgical drainage of abscesses are often necessary .

key clinical messageeven minor surgical interventions can have serious complications . lemierre 's syndrome is rare and to our best knowledge never before described after gynecological surgery ; however , it should be considered in case of rapidly developing respiratory problems after even simple surgical procedures .

psychiatry from a study comparing olanzapine with haloperidol in first - episode patients and comparing any brain changes to control changes over time . they claim that , over a 2-year period , whole gray matter volume decreases significantly more in patients administered haloperidol than in controls or patients on olanzapine . however , the time of the follow - up mri scans was short ; there were many dropout subjects in this study and disproportionately among the groups ; and some time periods were missing in one group entirely , thus hampering interpretation of these results . there have now been several other studies attempting to examine the question of neuroleptic effects on brain structure . while it , appears consistently in most , but , not all , studies that the caudate enlarges with typical neuroleptics , the changes seen with respect , to other cortical regions and ventricular enlargement have yet to be shown to be due to medication ( table iv ) . there are two large and interesting independent , studies of people with a prodromal syndrome that , is high likely to lead to schizophrenia - one in scotland- and another in melbourne , australia ( table iii ) . initially during the prodrome , a change in brain structure seems to be present in the temporal lobe volume and cingulated . on follow - up in those who have gone onto a psychotic episode , further changes can be seen in the cingulate , temporal lobe , and parahippocampal gyrus . these two independent studies have results that are not entirely consistent with each other , but it is interesting that neither show ventricular enlargement , or its progression at this stage . in general , while both research groups see initial changes in temporal and frontal lobes in people who later develop schizophrenia and progressive change in the time interval from prodrome to onset , of clinical illness , the specific changes that are clearly predictive of illness need to be further delineated . the underlying basis for the changes detected by imaging could be related to abnormalities in axonal integrity and organization that begin to take place during the normal adolescent neuronal pruning and reorganizational process , and continue through out , the lifetime of the individual during aging and brain response to normal stresses . in some individuals , it , may even begin prenatally , but last , a lifetime . perhaps examining white matter integrity we now have the techniques in mri , ie , diffusion tensor imaging ( dti ) and magnetization transfer ( mt ) . two measurements based on dti images are the apparent , diffusion coefficient ( adc ) , which measures the water content and reflects the amount of cerebrospinal fluid ( csf ) , and fractional anisotropy ( fa ) , which measures the direction of flow or , indirectly , the lining up of fibers . the fa is high when fibers are orientated in one direction and low when there is diffusion and the fibers are more disorganized . the adc is high when the water content , is high and low when the water content , is low . magnetization transfer ( mt ) is a proton - weighted mri image that can give information about the integrity of myelin , in particular with the quantification of the magnetization transfer ratio ( mtr ) . the most , recent , focus of our research group has been to extend the previous longitudinal studies back in time from the first , episode to the study of individuals at high genetic risk for schizophrenia who arc in the age range for peak incidence of developing the disorder . current preliminary data are illustrated on 15 such adolescents , 15 controls , and 15 of their siblings with chronic schizophrenia ( figures 2 to 6 ) . figure 2 shows a dti comparison of fa in high - risk subjects with controls illustrating evidence of reduced fa ( or directional axonal organization ) already taking place in the left , posterior superior temporal gyrus . figure 3 shows evidence of higher adc ( or water content , ic , csf ) already evident in the left parahippocampal gyrus and right , superior temporal gyrus in the high - risk patients . this is more widespread in those with schizophrenia , suggesting that atrophic changes occur early and could be progressing into later stages of illness . figure 4andfigure 5 show that mt changes are also present , ie , changes in fiber membranes in the superior frontal gyrus and posterior cingulate . in additionne have been performing functional mri ( fmri ) lexical decision task , as previously developed , which has the ability to show lateralized activation in the superior temporal gyrus in normal individuals . in our preliminary analyses , less lateralized activation is seen in the individuals at , high - risk for schizophrenia than controls , similar but to a lesser extent , than what , is seen in the patients with chronic schizophrenia ( figure 6 ) . these studies taken together indicate that changes are occurring early in the brains of people who are likely to later develop schizophrenia , and that these changes are relevant to those regions of the brain that are involved in language processing . it appears that brain structural change is detectable in both gray and white matter prior to illness onset , that , active progression of the changes may also begin prior to the onset of clinical symptoms , that progressive brain changes may account , for the brain structural anomalies seen in chronic schizophrenia , and that the structures involved in language processing are affected . white - matter anomalies in the anatomical connections relevant to language and/or myelination of these connections could be involved . the ability to have specific mri predictors of who will develop schizophrenia among those at high risk appears hopeful for the near future . having the ability to predict , the development , of illness will then lead to studies to determine whether early pharmacological treatment , will prevent , the cortical progressive brain cortical change and , in doing so , have a significant effect , on clinical outcome .

schizophrenia is a chronic progressive disorder that has at its origin structural brain changes in both white and gray matter . it is likely that these changes begin prior to the onset of clinical symptoms in cortical regions , particularly those concerned with language processing . later , they can be detected by progressive ventricular enlargement . current magnetic resonance imaging ( mri ) technology can provide a valuable tool for detecting early changes in cortical atrophy and anomalous language processing , which may be predictive of who will develop schizophrenia .

endometriosis affects approximately 1 in 10 women during their reproductive years with an average diagnostic delay of 9 years and an estimated cost to the american healthcare system of approximately $ 22 billion a year . endometriosis is the most common indication for operative laparoscopy and is frequently encountered as a secondary finding during laparoscopy , . the ovaries , the posterior leaf of the broad ligament , and the posterior cul - de - sac are the most common locations of endometriosis . less commonly , the anterior cul - de - sac ( the area between the bladder and the anterior uterus ) is involved . surgical intervention to release a scarred obliterated anterior cul - de - sac is associated with a significant risk of intraoperative bladder injury , , . other reasons for vesicouterine adhesions may be previous cesarean deliveries or anterior uterine wall myomectomy , , , . a 42 year - old , gravida 1 , para 1 , 110 lb , patient has been complaining of a right - sided pelvic pain for one month . on ultrasound she was found to have a septated right ovarian cyst and fluid in the posterior cul - de - sac . the patient was counseled about her options and decided with the surgeon to proceed with total laparoscopic hysterectomy and salpingo - oophorectomy with possible conversion to laparotomy if indicated by findings . upon entry , the patient was found to have an obliterated anterior cul - de - sac with the uterus adherent to the bladder reflection ( figure 1 ( fig . 1 ) ) , fibrotic parametrium bilaterally from endometriosis , right endometrioma stuck to the back of the uterus and pelvic sidewall , left ovary stuck to the pelvic sidewall and ureter , and adhesions of the sigmoid colon to the left pelvic sidewall . the procedure was begun by lysing the adhesions of the sigmoid to the pelvic sidewall freeing it so that the ureter can be seen on the left . therefore , further dissection was done with the ureter freeing it into the cardinal ligament and locating the uterine artery lateral to the ureter where it was clipped with surgiclips and transected . dissection was then continued on the left side anteriorly with the harmonic scalpel freeing the fibrotic parametrium and left ovary to be taken with the uterus and cervix and taking the vessels and cardinal ligament . this allowed entry to the space behind the scarred endometriosis of the bladder to the uterine fundus and dissection was performed using the harmonic scalpel . this stripped the bladder away from the uterus without injury to the bladder using the harmonic ace with the active blade toward the uterus . the ureter was exposed at the pelvic brim and dissected down past the ovary s attachment to it using harmonic and sharp dissection to the point where the ip ligament could be taken as a pedicle . the anterior broad ligament peritoneum , the posterior broad ligament peritoneum and the round ligament were taken down with the dissection line designed to remove the fibrotic endometriosis areas with the uterus and attached ovaries . therefore , we followed the ureter to the cardinal ligament and identified the uterine artery lateral to the ureter and it was surgiclipped . dissection continued with the ureter exposed allowing the parametrium to be taken down with the harmonic scalpel . the operation continued then as planned without complications or breaks in the technique ( figure 2 ( fig . our technique is to use traction - countertraction and fully excise either sharply or with harmonic ace dissection all diffusely involved peritoneal surfaces , all deep endometriotic implants wherever they may be , and treatment of endometioma by either excision or oophorectomy . if deep infiltrating bowel endometriosis exists and results in minor entry , interrupted silk closure is done with intracorporeal knot tying . if more extensive bowel resection is needed , general surgery is consulted . if a patient gets a bowel preparation before abdominal x - ray studies it makes sense then to bowel - prepare patients before putting energy sources and sharp instruments into their abdomen . we recommend the technique above that we used many times to deal with scarred vesicouterine reflection . a peritoneal incision is made from round ligament to round ligament using the harmonic ace energy source . then lateral dissection is done with identification of the uterine vessels ( if needed they can be taken at this point ) ; the active blade of the instrument is then inserted laterally under the most lateral scar bands pointing cephalad and rotated in toward the uterus at about a 45 degree angle ( which is going to be removed so damage to it is irrelevant and superficial anyway if it were to be left ) . the active blade is then pulled quickly cephalad cutting quickly through very small increments of the scar band to prevent thermal injury to the bladder . this technique allows very rapid reopening of the densly scarred anterior cul - de - sac from any reason . from our experience , bladder entry with this technique is extremely uncommon and when it does occur has uniformly been well above the trigone and easily repaired laparoscopically .

endometriosis may in severe cases lead to obliteration of the anterior and/or posterior cul - de - sacs in the female pelvis . the anterior cul - de - sac is generally less commonly affected . this type of cases usually presents a challenge for the operating surgeon , whether via open route or through laparoscopy . in this paper , we present an illustrative case and explain our technique for dealing with a scarred and totally obliterated anterior cul - de - sac because of endometriosis during total laparoscopic hysterectomy .

a 71-year - old man presented with a four - year history of a right infra - auricular mass . head and neck computed tomography revealed a mass with heterogenous density and a fatty component ( fig . partial parotidectomy was performed , revealing a solitary well - defined mass measuring 4.23.52.5 cm with a thin capsule . the tumor comprised oncocytic cells and fat cells with mature adipose tissue occupying about 50% to 60% of the tumor . immunohistochemically , the oncocytic cells were strongly positive for ae1/ae3 ( 1:1,000 , dako , glostrup , denmark ) and cytokeratin 7 ( 1:1,000 , dako ) . peripheral cells were stained by p63 ( 1:1,000 , dako ) and cytokeratin 5/6 ( 1:200 , dako ) . epithelial membrane antigen ( 1:200 , dako ) stained the luminal surface and sebaceous glands . the oncocytic cells were negative for smooth muscle actin ( 1:1,000 , dako ) and calponin ( 1:1,000 , dako ) . cytokeratin 14 ( 1:400 , biogenex , the hague , the netherlands ) expression was restricted to sites of sebaceous differentiation . an apical - luminal pattern of dog1 ( 1:200 , leica , newcastle upon tyne , uk ) staining was observed in the normal serous acini , while the tumor cells were negative ( fig . 2c , d ) . based on the microscopic findings , we rendered a diagnosis of oncocytic lipoadenoma with sebaceous differentiation . this rare tumor was not mentioned as an entity in the 2005 world health organization ( who ) histologic classification of tumors of salivary glands . in the english literature , there is no gender predilection , and the patient ages range from 7 to 89 years ( median of 55.5 years ) . the universal microscopic finding in the literature was an encapsulated tumor comprising a mixture of oncocytic cells and fat cells . uncommon findings as sclerotic and polycystic changes ascribed to chronic involution , squamous metaplasia , lymphoid stroma , and metaplastic bone formation have been reported . the presence of mitochondria in those oncocytic cells was confirmed by both immunohistochemical and ultrastructural studies . phosphotungstic acid hematoxylin staining and antimitochondrial antibody were utilized to demonstrate the presence of mitochondria [ 3,6 - 8 ] . ultrastructural studies also provided evidence that oncocytic lipoadenoma may be derived from striated ductal cells based on similar histological features . dog1 expression was found in both normal and neoplastic counterparts of intercalated ducts and acinar cells , whereas striated duct cells were negative . the oncocytic cells in our case were negative for dog1 , which supports the contention that striated ductal cells were the origin of this tumor . differential diagnoses include sialolipoma , oncocytoma , oncocytosis , sclerosing polycystic adenosis , and oncocytic metaplasia . oncocytomas are also encapsulated tumors with immunohistochemical findings identical to those of oncocytic lipoadenomas , but they lack adipose tissue as their component cells . in addition , 20% of patients with oncocytomas have a history of radiation exposure . the presence of sclerotic and polycystic change can be reminiscent of sclerosing polycystic adenosis , but oncocytic lipoadenomas lack xanthomatous and apocrine change , which is commonly seen in sclerosing polycystic adenosis . in addition , the presence of acini in sclerosing polycystic adenosis can be aided by dog1 antibody . sebaceous differentiation is not an uncommon finding in salivary glands and can be found in sebaceous lymphadenoma , sebaceous adenoma , pleomorphic adenoma , oncocytoma , sialoblastoma , and warthin tumor . the majority of the reported oncocytic lipoadenomas including our case exhibit sebaceous differentiation . lipoadenomas are similar to adenolipomas of the breast , thyroid , and skin in that they all demonstrate a histological mixture of epithelial components and adipose tissue . in contrast to adenolipoma , which is considered to be a hamartoma , oncocytic lipoadenoma is believed to be a true neoplasm . an altered hmga2 gene rearrangement is more commonly seen in lipoma , pleomorphic adenoma , and leiomyoma .

oncocytic lipoadenoma is a rare tumor , with only 18 cases having been reported since the first in 1998 . we encountered a case of oncocytic lipoadenoma presenting as a slowly growing parotid mass in a 71-year - old man . this tumor is characteristically comprised of a mixture of oncocytes and adipocytes . the present case is one of five reported cases of oncocytic lipoadenoma showing sebaceous differentiation . the results of immunohistochemical study with dog1 antibody supported the origination of this tumor in the striated duct .

the closure of the mesenteric defect following bowel resection has traditionally been undertaken , especially in open surgery , in an attempt to prevent bowel herniation and subsequent strangulation . with the advent of laparoscopic surgery however , the value of this practice has been challenged and many surgeons do not routinely close the resultant mesenteric defect following laparoscopic bowel resection . proponents of the former approach point to the risk of small bowel herniation through an open mesenteric defect , potentially leading to bowel obstruction and rarely to catastrophic mesenteric ischemia . in support of this argument , several case studies have reported complications attributed to the nonclosure of the mesenteric defect ; interestingly , these studies often relate to laparoscopy - assisted colostomies.[25 ] conversely , opponents of the mesenteric defect closure advocate that such practice may result in the constriction of the bowel mesentery , inadvertent ligation of blood vessels and/or mesenteric hematoma formation and could , therefore , compromise the blood supply to the bowel anastomosis and lead to anastomotic dehiscence . here we propose a simple technique , applicable to both open and laparoscopy - assisted colectomies , that enables a quick closure of the mesenteric defect while minimizing the risk of blood vessel injury . following bowel resection , the ligatures used for mesenteric vessel ligation are left long [ figure 1 ] . once the bowel anastomosis is completed , the long ligatures on either side of the mesenteric defect are tied together closing the defect [ figure 2 ] . following bowel resection , mesenteric vessels are ligated and the ligatures are left long long ligatures on either side of the mesenteric defect are tied together closing the defect unfortunately , there is paucity of high - quality data to inform surgical practice on this topic with much of the available evidence based on case reports and nonrandomized , observational studies . this report describes a simple technique that enables the closure of the mesenteric defect while minimizing the risk of inadvertent damage to the blood vessels supplying the bowel anastomosis . our mesenteric defect closure technique represents an alternative to those previously reported in the literature , such as stapled closure or closure using a continuous running suture , and is currently being evaluated in a prospective study undertaken in our unit .

the closure of the mesenteric defect following bowel resection remains controversial . proponents of the intervention cite the risk of bowel herniation through an open mesenteric defect and subsequent bowel obstruction whereas supporters of the opposing view advocate that such practice may lead to inadvertent compromise of the bowel blood supply . we describe a novel technique that enables efficient mesenteric defect closure while minimizing the risk of blood vessel injury .

removal of tracheobronchial secretions to maintain airway patency is a standard of care in mechanically ventilated patients . since the endotracheal tube ( ett ) cuff abruptly stops the mucociliary escalator , endotracheal suctioning is essential to physically remove the secretions this can be achieved by the conventional open system or closed circuit suction system ( ccss ) . the advantages of ccss include limiting environmental , personnel and patient contamination and preventing the loss of lung volume as well as the alveolar de - recruitment associated with standard suctioning in the severely hypoxemic patients . we report an unusual case of an airway foreign body blocking the ccss , the like of which has never been reported before . a 57-year - old farmer presented with a history of fall from a tractor while working in the fields . he sustained head injury , multiple rib fractures on the right side and fracture of the right leg . at the time of presentation he was agitated and tachypnoeic . computed tomography ( ct ) head showed small right sided subdural hematoma contrast enhanced ct chest showed multiple rib fractures , hemo - pneumothorax , basal consolidative changes and surgical emphysema on the right side . the patient 's clinical condition remained stable for 3 days while he was treated with analgesics , antibiotics and 5 l / min oxygen ( o2 ) inhalation by face mask . glasgow coma score remained 15 , arterial blood gas ( abg ) and chest x - rays showed no deterioration . on the 4 day he became drowsy and tachypnoeic . his heart rate ( hr ) increased from 76 to 104 bpm , blood pressure ( bp ) increased from 130/80 to 150/100 mmhg , respiratory rate ( rr ) increased from 18 to 35/min and spo2 dropped to 89% despite increasing inspired o2 concentration . he was intubated and put on ventilator on bi - level mode , following which his condition stabilized within 5 min . hr settled to 88 bpm , rr to 20/min , bp 140/84 mmhg and spo2 97% . as a protocol , ccss ( 14 french ) was attached and suctioning done every 2 h and as and when required . 6 h after putting on ventilator , he again developed tachypnoea ( rr increased from 20/min to 45/min ) , tachycardia ( 110 bpm ) , hypertension ( 150/110 mm hg ) , and de - saturation ( spo2 dropped from 97% to 90% ) . anticipating secretions ccss catheter was passed through the ett but nothing could be sucked out . auscultatory findings ( conducted sounds all over the chest ) and spirometry findings ( decreased inspiratory and expiratory peak flows , low tidal volume ) suggested retained secretions . the ccss was disconnected and on close inspection a tiny stone blocking its tip could be seen [ figure 1 : blocked tip of ccss ] ; [ figure 2 : on close observation tiny stone foreign body blocking the tip of catheter ] which the patient probably inhaled / aspirated at the time of accident . later a large volume of secretions was sucked out using a different suction catheter ; following that the patient 's condition stabilized . a bronchoscopy was performed immediately to rule out the presence of any other foreign body . the patient was managed on the ventilator and tracheostomy done on the 5 day of intubation . he was weaned off the ventilator on the 11 day , operated upon for fracture tibia on the 16 day and discharged on the 23 day following admission in satisfactory condition . ccss has become popular in the recent past because of certain advantages over the traditional open system . it prevents problems associated with ventilator disconnection like hypoxemia , hemodynamic instability , alveolar derecruitment , loss of lung volume and ventilator malfunction . it has also been reported to have some role in protecting against ventilator associated pneumonia and in decreasing environmental contamination with patient 's secretions . it has been found to be more cost effective in patients requiring prolonged ventilation . despite all these benefits it has been postulated to have lower efficacy in removing endotracheal secretions . in our case , it got totally blocked by an airway foreign body ; leading to its failure to remove secretions . since there are chances of the catheter tip , which is not visible in the ccss , getting blocked by inspissated secretions , blood clot or in rare cases like authors by an aspirated small foreign body , the authors suggest that one should be watchful for other signs of retained secretions ; particularly if a closed - suction system is being used . to conclude , closed - suction system has many proven benefits , but the invisibility of its tip can pose serious problems . hence while using ccss , it is advisable to be extra cautious about the signs - symptoms of retention of tracheal secretions .

closed circuit suction system ( ccss ) has become a standard of care for the tracheal suctioning of mechanically ventilated patients . the advantages of ccss over the open suction system include decreased environmental , personnel and patient contamination , preservation of lung volumes and oxygenation especially in the severely hypoxemic patients . on the other hand , ccss has lower efficacy in removal of secretions and it may have certain other disadvantages due to the invisibility of its tip . we report an unusual case of an airway foreign body causing blockage of the ccss leading to retained secretions and deterioration of patient . timely changing over to open suction system helped in its detection and improvement of patient .

serious lesions in the back of the head and lack of pupil reaction and muscular response make it seem pointless for the receiving doctor to commence treatment . the point is not to restore her to a normal life but to keep her body alive long enough to figure out whether she qualifies as an organ donor . early identification of potential donors provides better transplant results , the doctor knows , and yet some element of doubt makes intubations of the dying girl difficult . the problem relates to a crucial transition characteristic of modern transplantation medicine as a person shifts positions from a patient - in - need - of - treatment to a donor - in - need - of - conservation . the story above was narrated on 9 november 2010 , when the danish center for organ donation ( dco ) brought together nurses , scientists , surgeons , and anesthesiologists to discuss the ethical quandaries in transplantation medicine . in particular , intubations and resuscitation of brain dead or near - brain dead patients gave rise to concern , and throughout the day , various cases were discussed in the search for moral guidance . the conference participants took this opportunity for reflection to try to identify key moments of moral decision making and possible principles on which to base such decisions . in fact , the conference participants seemed to proceed as if they were making an evidence - based medical decision : they searched for a decision tree with clear priorities , best evidence ( moral principles and specification of the information needed ) , and steps to follow . but what , really , is the type of decision making at stake in these instances of moral quandary ? according to classic decision - making theory , a decision is rational when based on full appreciation of available evidence and aimed at defined aims . in as early as 1959 , however , charles lindale suggested , in what is now regarded a classic article in organization theory , that good decision making is a ' science of muddling through ' . it is never clear what constitutes the full range of evidence , and not least because of the time limits imposed on every critical choice , it is very rare that anyone ever attempts to gather that range of evidence ( by whatever standards ) . furthermore , decision trees laying out ' the ideal rational decision ' tend to neglect unexpected and , in principle , unrelated events . such unrelated events , however , were often of vital importance in the cases discussed on 9 november and will be familiar to many doctors . whether or not to resuscitate or incubate a potential donor typically needs to be decided within minutes . if intubated , donors must be kept in intensive care units , where doctors often struggle to find available beds . as a possible consequence , other patients are perhaps moved out of intensive care or scheduled operations are cancelled because the only temporary space for a potential donor is the operation theater . these complex decisions must be made at a point in time when it is unclear whether the relatives will consent to the donation or whether the donor medically qualifies . when discussing a case in the conference room , surgeons want to know whether the patient is registered in the national donor registry , but in the emergency room , there is not always time to check this information before a decision must be made . the practicalities of everyday clinical decision making involve a lot of muddling through beyond what decision trees take into consideration . but the moral problems in clinical decision making in organ donation seem to be more akin to those of organizational decision making in general , and when clinicians deal with them , it is probably useful to turn to a more pragmatic form of bioethics . instead of assuming a moral ' evidence base ' , we might be of more help to health professionals by acknowledging the lack of universal norms and standard situations . a productive dialogue about the problems people actually handle must appreciate the basic ambiguities surrounding the situations doctors and nurses face as patients become donors . health professionals dealing with new technologies in critical care units act in many instances as what anthropologist rayna rapp calls ' moral pioneers ' : they need to create norms beyond the guidance of existing ones . when discussing decal decisions , clinicians must reflect on real - life situations such as those presented at the conference , rather than rest on presumptions about a point of total clarity at which the ' real ' ethical decision was made . we contend that the kind of dialogue that health professionals need is better facilitated by an ethics of muddling through - which does not presume clarity where there is none - than by a set of principles that they rarely get the chance to apply . consequently , we suggest rethinking more generally what we want ethics to do for us in relation to the issues raised through organ donation , in which norms are constantly negotiated and challenged in the messy and complex context of everyday clinical decision making . the authors thank the speakers and participants at the meeting in middleware , denmark , on 9 november 2010 and the danish center for organ donation ( dco ) for supporting this commentary .

organ donation offers opportunities for people in critical care units to help save the lives of other patients . it is not always easy , however , to handle the transition from treating a patient to preserving a potential donor , and organ donation consistently provokes ethical questions in critical care units . what do we expect ethics to deliver ? in light of a recent ethics conference in denmark , we suggest that by acknowledging that decisions made in the clinic rarely abide to rational decision trees with clear ethical priorities , we can better learn from each other 's experiences . we suggest embracing an ' ethics of muddling through ' to enhance relevant reflections and stimulate a productive dialogue among health professionals .

the most frequently involved regions are the head and neck , hands , penis and arms . alhe typically manifests with single or multiple , red / brown dome - shaped papule or subcutaneous nodules . in some cases , histologically , it appears as reactive proliferation of a small blood vessel that surrounds a muscle artery together with inflammatory infiltrates . a 30-year - old male patient presented to the department of maxillofacial surgery with swelling in the right facial region . his anamnesis revealed that the patient had his right first molar tooth extracted owing to infection a year ago and that painless swelling in that region had been present ever since . clinical examination of the swelling demonstrated a painless , hard , mobile , localized elastic lesion on palpation in the subcutaneous tissues extending in line with mandibular border . the lesion was located approximately between the angle of the mandible and the anterior aspect of the sternocleidomastoid muscle ( 23 cm below the inferior border of the mandible ) [ figure 1a ] . ( d ) 12 month postoperative extraoral view there was no lymphadenopathy in the region . the lesion was explored at the level of the subplatismal plane via extraoral approach under local anesthesia through an incision made parallel to the mandibular border . the lesion , which appeared of vascular origin because of red - brown color , was capsulated and associated with a small artery on both the anterior and posterior borders [ figure 1b ] . after total enucleation , subcutaneous tissues were sutured with 3/0 polyglycolic acid and the skin was sutured with 4/0 polyprolene . the excised specimen measuring 1.5 cm was sent to the laboratory for histopathological examination [ figure 1c ] . there was a large blood vessel with patent lumen and thick wall in the middle of the lesion [ figure 2a ] . ( a ) histopathological image of the large blood vessel ( h&e stain , x40 ) . ( b ) photomicrograph showing lymphocyte and eosinophilic leukocyte infiltration along with blood capillaries ( h&e stain , x200 ) vascular configurations were lined by epithelioid endothelial cells . edematous connective tissue with lymphocyte and eosinophilic leukocyte infiltration were detected among vascular configurations [ figure 2b ] . under the light of these findings , the patient was diagnosed with epithelioid hemangioma . no esthetic problem or complaint or recurrence was encountered over the course of the 3-year follow - up period [ figure 1d ] . here , we report a case of alhe in the angle region of the mandible in a 30-year - old male patient . the etiology of alhe remains unknown , because it is not clear if it is primarily a vascular neoplasm , a lymphoproliferative process or a heterogeneous group of entities . trauma , infections and renin or hyperestrogenic conditions ( pregnancy or oral contraceptive agents ) are considered to be the likely causes . infection was considered as the etiological factor in the present case report , because it was learned from his anamnesis that swelling caused by an infected first molar tooth a year ago induced the pathology in that region . alhe usually appears in head and neck region , frequently in the auricular area and usually measures about 23 cm in size . however , other authors have reported that lips , oral mucosa and tongue may also be involved . in the present case , epithelioid the present case report might contribute to the literature of other cases of epithelioid hemangioma that might be presented in the future . in the literature , it is usually mentioned that alhe is an asymptomatic lesion , more prevalent among females and that lymphadenopathy is present in about 520% of patients . particularly , considering that alhe is a reactive lesion , frequent palpation of the lesion by the patients may be triggering the inflammatory process . alhe must be histologically and clinically differentiated from kimura disease , which is a chronic inflammatory condition characterized by large subcutaneous nodules in the head and neck region . it should be kept in mind that kimura disease is more prevalent among young males ; it is associated with increased immunoglobulin e levels and skeletal involvement may be encountered . the most significant distinctive criterion is the fact that whilst alhe is pathology of vascular origin , kimura disease is a chronic inflammatory process . in addition to kimura disease , differential diagnosis of alhe includes cutaneous lymphoma , cavernous hemangioma , pyogenic granuloma , kaposi sarcoma and bacillary angiomatosis . vascular proliferation in subcutaneous tissue , the presence of cobblestone - like endothelial cells lining the vessels , lymphocyte infiltration together with eosinophilia are important histopathological criteria for diagnosis . eosinophilic chemotactic factor released from mast cells is suggested as an extra agent contributing to eosinophilia , which adds to the inflammatory characteristics of such cases . alternative therapies include electrodessication , curettage , radiotherapy , cryotherapy , chemotherapy , corticosteroids , laser surgery and various agents , for example , interferon alpha 2b . spontaneous remission in such cases is possible within months , even years , but recurrences are frequent . treatment is necessary in symptomatic cases and in situations that alter the patient 's appearance . in the present case we believe that complete surgical resection is a successful therapeutic option for such cases , because of its feasibility and practicality .

angiolymphoid hyperplasia with eosinophilia ( alhe ) , also called epithelioid hemangioma , is a rare benign vascular lesion usually affecting the muscular arteries of the head and neck in female patients . here , we report a 30-year - old male patient who presented with painless swelling in the angle region of the mandible . the diagnosis of the specimen , which was surgically removed under local anesthesia , was made as alhe . the patient has remained uneventful for 3 years .

a 24-year - old man was diagnosed at birth with coarctation of the aorta and a patent ductus arteriosus and subsequently diagnosed with a bicuspid aortic valve ( bav ) and a sub - aortic membrane . at the age of one month he had repair of the coarctation and closure of the ductus . in 1993 the bav was noted on echocardiogram with a small sub - aortic membrane and a peak velocity of 1.6 m / s . repeat echocardiogram showed a bav and sub - aortic membrane with no significant aortic regurgitation or aortic stenosis . surprisingly , the cmr demonstrated a sinus of valsalva aneurysm ( sva ) , which had not been apparent on the echo images because it was outside standard imaging planes ( figure 1a , 1b ; supplementary files 1 and 2 ) . there was aneurysmal dilatation of the right coronary sinus with a maximum dimension across the aortic sinus of 5.7 cm . on cmr flow was directed eccentrically by the domed posterior leaflet of the bav into the right coronary sinus ( figure 1d ; supplementary file 3 ) . the jet impacts on the supero - lateral wall of the right coronary sinus ( figure 1c ) . the jet eccentricity was also demonstrated on echo ( figure 2 ; supplementary file 4 ) . the sub - aortic membrane may also contribute to the eccentricity of the jet ( figure 2 ) by directing flow towards the belly of the posterior leaflet rather than more centrally . figure 1a ) cmr short axis view using true - fisp demonstrating bicuspid aortic valve with a large postero - medial leaflet and smaller anterior leaflet ( arrow ) . b ) cmr short axis view ( true - fisp ) obtained just above the aortic valve plane demonstrating sinus of valsalva aneurysm with aneurysmal dilatation of the right coronary sinus ( arrow ) . c , d ) an eccentric jet of flow directed eccentrically by the domed aortic valve leaflet ( black arrow ) into the right coronary sinus ( white arrow ) . a ) cmr short axis view using true - fisp demonstrating bicuspid aortic valve with a large postero - medial leaflet and smaller anterior leaflet ( arrow ) . b ) cmr short axis view ( true - fisp ) obtained just above the aortic valve plane demonstrating sinus of valsalva aneurysm with aneurysmal dilatation of the right coronary sinus ( arrow ) . c , d ) an eccentric jet of flow directed eccentrically by the domed aortic valve leaflet ( black arrow ) into the right coronary sinus ( white arrow ) . figure 22-dimensional ( a ) and colour doppler ( b)echocardiography in an apical 5-chamber view demonstrating an eccentric jet of flow directed through the aortic valve towards the right coronary sinus . the sub - aortic membrane ( arrow ) appears to contribute to the eccentric direction of lv outflow . 2-dimensional ( a ) and colour doppler ( b)echocardiography in an apical 5-chamber view demonstrating an eccentric jet of flow directed through the aortic valve towards the right coronary sinus . the sub - aortic membrane ( arrow ) appears to contribute to the eccentric direction of lv outflow . he underwent successful repair of the sva and resection of the sub - aortic membrane and remained well when followed up in clinic . congenital aneurysms are often caused by weakness at the junction of the aortic media and the annulus fibrosus . acquired aneurysms are caused by conditions affecting the aortic wall , such as infections , degenerative diseases ( atherosclerosis , connective tissue disorders or cystic medial necrosis ) or trauma . the presence of bav is associated with ascending aortic dilatation due to associated cystic medial necrosis . recently provided new insights into the pathophysiology underlying aortic dilatation in bav patients using cmr . the authors found a significant correlation between the systolic lv outflow jet angle with the aortic root channel and dilatation at the levels of the sva , sinotubular ( st ) junction , and the ascending aorta which could be important in the formation of aortic dilatation in bav . our case describes the formation of sva associated with an lv outflow jet which is eccentrically directed by a sub - aortic membrane through the bav and into the right coronary sinus . it is probable that the asymmetric sinus dilatation is the result of many years of lv outflow impacting on the congenitally abnormal wall of the right coronary sinus . because it is out of the normal echocardiogram planes , the sva may have been developing over many years but it has not been noted previously . cmr proves to be a valuable imaging modality in demonstrating the sva and the likely mechanism of its development . cmr is useful in defining the three - dimensional anatomy of the aneurysm more precisely , including variations of flow direction during cardiac cycle . in addition , cmr may also provide better evaluation of aneurysm wall thickness or presence of thrombus , and better detection of small perforations .

cardiac magnetic resonance imaging ( cmr ) demonstrated a sinus of valsalva aneurysm ( sva ) with severe dilatation of the right coronary sinus in association with a congenital bicuspid aortic valve ( bav ) and sub - aortic membrane . the sva had not been apparent on echocardiography as the dilatation was outside standard echo image planes . on both cmr and echo , blood flow was eccentrically directed into the right coronary sinus by the domed posterior leaflet of the bav . the impact of the aortic jet on the wall of the right coronary sinus is probably important in the aetiology of the sinus dilatation . cmr proved valuable in demonstrating the sva and understanding its aetiology .

ketamine is a noncompetitive antagonist of the n - methyl - d - aspartate ( nmda ) receptor , a major subtype of glutamate receptors . recent studies have shown that ketamine has antidepressant activity.1,2 induction of mania and psychotic symptoms has been reported in a patient receiving intravenous ( iv ) ketamine therapy for reflex sympathetic dystrophy.3 recently , ketamine abuse or recreational use has been gaining increasing attention.4 more recently , ketamine has become popular in many countries including usa as a club drug , often used by teens and young adults . however , whether ketamine abuse via other routes of administration such as inhalation can also induce mania remains unclear . we here report a patient who developed manic symptoms following ketamine abuse by inhalation . ethical approval from a review board was not required for this case report , as the patient was under regular therapy and his case was not intended to be used for research . a 26-year - old han taiwanese man had suffered from tourette syndrome and obsessive compulsive disorder since he was 12 years old and started to abuse ketamine by inhalation from 22 years old . he denied any mood disorder before using ketamine or other substance abuse / dependence until he started to abuse ketamine by inhalation . initially , he took ketamine 5 g / wk for several weeks and then 1015 g / wk for months ( with a total duration of 12 months ) . since his first time of ketamine use , he had experienced marked euphoria , labile mood , dissociation , and auditory hallucinations , and these symptoms vanished after hours . even during the following 5 months after he stopped use of ketamine , he still had persistent elated mood , increased goal - directed activity with more energy , decreased sleep need , and fewer obsessive compulsive behaviors . after the manic - like period , his mood gradually shifted to a depressive state . approximately 7 months after stopping ketamine use , a major depressive episode occurred , with worsening of obsessive compulsive symptoms . however , due to poor drug adherence and poor treatment response , he was then hospitalized to our psychiatric ward , where he achieved full remission from the major depressive episode and partial remission from obsessive compulsive disorder with sertraline 200 mg / d and aripiprazole 10 mg / d for 3 weeks . he continued this treatment to keep a stable mood with minimal obsessive compulsive symptoms for at least 21 months during outpatient follow - up . the antidepressant effects of ketamine are believed to be related to the change in cortical excitability likely caused by cortical disinhibition5,6 and reduction in the activity of inhibitory interneurons.7 acute changes in cortical excitability and glutamate release are proposed to initiate a sequence of biochemical and structural changes within cortical networks.8,9 the abnormality may occur in people with bipolar tendency , whose glutamate receptors are hypersensitive or glutamate is overreleasing . this case suggests a possible relationship between manic symptoms under recreational dosage and administration route of ketamine . according to the previous studies,2,10,11 subanesthetic dose via intravenous - administered ketamine transient manic - like symptoms were noted in a few bipolar and unipolar depressed patients , but this transient mood elevation seems inconsistent with a persistent substance - induced syndrome.12,13 that is , in these studies , the transient elevated mood did not meet the criteria for mania , in terms of the disease duration or the number of symptoms . only one case report3 shows the possibility of the induction of mania in a patient receiving intravenous ketamine therapy . first , bipolar tendency could not be entirely excluded in this patient although manic or hypomanic symptoms were not noted under antidepressant treatment . second , we did not conduct screen tests for multi - substances ; therefore , we could not prove the validity of his self - report . to the best of our knowledge further research is warranted to replicate this finding and to elucidate the possible mechanism of ketamine - related mania symptoms . if the finding can be confirmed in the future , physicians should pay attention to manic symptoms in patients abusing ketamine .

ketamine , a noncompetitive antagonist of the n - methyl - d - aspartate ( nmda ) receptor , has multiple clinical uses . on the other hand , ketamine abuse or recreational use has been gaining increasing attention . induction of mania and psychotic symptoms has been reported in a patient receiving iv ketamine therapy for reflex sympathetic dystrophy . we here report a 26 year - old man who abused ketamine by inhalation for 12 months and developed manic - like symptoms after ketamine use . this case suggests a possible relationship between manic symptoms and ketamine abuse . to the best of our knowledge , this may be the first report regarding mania after recreational use of ketamine .

first described in 1975 , antley - bixler syndrome ( abs ) is an autosomal recessive , exceptionally rare craniosynostosis syndrome characterized by radiohumeral synostosis present from the perinatal period ( omim number # 207410 ) . there is a wide spectrum of anomalies seen in abs ; other features include midface hypoplasia , choanal stenosis or atresia , and multiple joint contractures . mortality has been reported to be as high as 80% in the neonatal period , primarily due to airway compromise , and prognosis improves with increasing age . a full - term appropriate for gestational age ( aga ) female baby was born of non - consanguineous marriage of a primiparous mother by caesarean section . there was no history of obvious congenital anomalies or fetal loss in the family . on examination , vitals were stable . craniofacial abnormalities found were brachycephaly ( cephalic index=95.45 ) , frontal bossing , large anterior fontanel , open metopic suture , synostosis in sagittal and lambdoid sutures , deficient skull bones over both temporal fosse , proptosis of right eye with opacity of cornea , left eye prominent with redness of conjunctiva , low set ears , high arched palate , choanal stenosis , bilateral stenotic external auditory canal , short neck , hemangioma over nose and philtrum , and depressed nasal bridge . limb defects were radioulnar synostosis leading to fixed flexion deformity of elbow joints , fixed flexion deformity of both thumbs in proximal and distal interphalangeal joints , arachnodactyly , rocker - bottom feet , hallux varus , knee and hip joint contracture . other abnormalities were prominent chest , female genitalia with hypoplastic labia majora [ figure 1 ] . the picture of the baby with antley - bixler syndrome sepsis screen was positive on day four and blood culture revealed late onset sepsis by staphylococcus aureus . radiological investigations showed radioulnar synostosis and arachnodactyly.[figure 2 ] ultrasonography ( usg ) of brain revealed ventricular dilatation . the baby received gentamicin and ciprofloxacin ( as per culture sensitivity ) for late - onset sepsis for 14 days . above features however , there were no enlarged interphalangeal joints or increased femoral bowing or fractures . at present trapezoidocephaly , midface hypoplasia , humeroradial synostosis , bowing of femora , fractures , and other abnormalities . ( 1997 ) stated that since the first report by antley and bixler ( 1975 ) at least 23 cases had been reported . they reported an affected infant who died a few days after birth of respiratory failure . unlike previously described cases , the elbow joint contractures in our patient were due to radioulnar synostosis rather than radiohumeral synostosis . the infant did not have long bone fractures , and the femurs were not markedly bowed . ( 1998 ) reported a patient with clinical manifestations that they considered consistent with abs who carried an ser351-to - cys mutation on one allele of the fibroblast growth factor receptor 2 ( fgfr2 ) gene . ( 1998 ) suggested that the abs is an autosomal dominant condition with possible gonadal mosaicism , or that alternatively , an autosomal dominant form and an autosomal recessive form of abs may exist . mutations in the genes for fgfr have been reported to be involved in some craniosynostosis syndromes such as pfeiffer , apert , cruzon , and jackson - weiss syndromes . mutations in the cytochrome p450 oxidoreductase gene ( por ) located on chromosome 7q11.23 result in autosomal recessive inheritance and an abs phenotype that includes genital ambiguity and characteristic urinary steroid profile . in utero exposure to fluconazole may be a reason . digenic inheritance where fgfr2 mutations account for the skeletal abnormalities and different mutations causing altered steroidogenesis contribute to the genital anomalies . ( 1995 ) reported two affected sibs , in the first case , renal agenesis was recognized prenatally when oligohydramnios led to the sonographic diagnosis of absent kidneys during the seventh month . clinical features were recognized by ultrasonography at 21 weeks in the second case . however , no such findings were present in our patient . undetectable unconjugated estriol implying abnormal fetal steroid or sterol metabolism has been demonstrated at mid - gestational maternal serum screening and may provide a prenatal marker for this disorder in some cases . 2010 ) noted that craniosynostosis and radiohumeral synostosis present from the perinatal period are generally considered to be the minimum criteria for a diagnosis of abs , thus helping us to diagnose the case . respiratory compromise secondary to upper airway obstruction varies from severe nasal congestion to multiple apneic episodes leading to death in the first few months of life . our patient already had three episodes of apnea and receives saline nasal drops for nasal congestion . in future , she may need tracheostomy or placement of gastrostomy tube . . there has been no propensity to fracture postnatally . in our patient , we have planned enucleation of the right eye . left , we may attempt resection of the radiohumeral joint . we shall follow - up the patient frequently for early diagnosis and treatment of the complications and monitor neurodevelopmental outcome .

antley - bixler syndrome ( abs ) is rare form of craniosynostosis of both autosomal dominant and autosomal recessive inheritance . we are reporting a female term appropriate for gestational age newborn with clinical features of frontal bossing , brachycephaly , proptosis , synostosis of radioulnar joints , hemangioma over nose and philtrum , hydrocephalus suggestive of abs .

west syndrome ( ws ) is the most common early - onset epileptic encephalopathy and is characterized by infantile spasms , hypsarrhythmia on electroencephalography ( eeg ) , and developmental arrest or regression . the etiology of ws is heterogeneous , including infections , perinatal events , and congenital genetic disorders . although adrenocorticotropic hormone ( acth ) is probably the most effective treatment for ws , serious adverse effects can occur . hemophilia a is the most common type of hemophilia and is an x - linked recessive disorder induced by factor viii deficiency , but reports of ws with hemophilia a are rare . here the patient was a 1-year - old boy who was the second child of healthy unrelated parents . his uncle on his mother 's side suffered from severe hemophilia a and received factor viii infusions at fixed intervals . the patient was born by uncomplicated , normal vaginal delivery at full term with a birth weight of 2405 g. at ages 4 and 7 months , he achieved head control and rollover , respectively . although social smile appeared at 4 months , it vanished at 6 months . motor skills and cognitive development were arrested at 67 months . from 6 months , he had recurrent episodes of seizure with sudden flexions of the upper and lower limbs 34 times a week . he was referred to our hospital at age 1 year with a chief complaint of daily seizures that occurred in clusters from 11 months . g / l , red blood cell ( rbc ) count was 426 10/l , and coagulation studies revealed normal prothrombin time ( pt ) and prolonged activated partial thromboplastin time ( aptt ) of 67.3 s ( reference range : 25.043.0 ) . coagulation factor assay revealed severe factor viii deficiency ( < 1 iu / ml ) . he was diagnosed with severe hemophilia a. interictal eeg showed very high - amplitude slow waves mixed with spikes , suggesting hypsarrhythmia . brain magnetic resonance imaging ( mri ) and computed tomography ( ct ) results were normal . based on neuropsychomotor delay , eeg findings of hypsarrhythmia , and spasms , which occurred in clusters , a diagnosis of ws was formed . finally , synthetic acth ( 0.0125 mg / kg / day ) was administered intramuscularly daily for 2 weeks . before acth therapy , factor viii levels were routinely measured , and an infusion of factor viii was performed at fixed intervals to keep the trough level > 2 iu / dl to prevent lethal hemorrhage . inhibitor levels were also checked . while receiving acth , the previous medications of antiepileptic drugs were continued . this patient had ws with severe hemophilia a. adrenocorticotropic hormone therapy was effective , and infusion of factor viii at fixed intervals was useful for safe administration of acth therapy . our patient had ws with severe hemophilia a. the etiology of ws is heterogeneous , including genetic and acquired causes such as hypoxic ischemic encephalopathy , tuberous sclerosis complex , chromosomal disorders , cerebral malformations , infections , metabolic disorders , intracranial hemorrhage ( ich ) , and stroke . intracranial hemorrhage is a significant complication for children with hemophilia and occurs in approximately 5% of all untreated and severe cases . single remote symptomatic seizures often occur in perinatal and childhood ich , and 13% of children with perinatal or childhood ich developed epilepsy by 2 years of age . although ganesan and kirkham suspected that a small ich not detected by intracranial images might trigger seizures in a patient with hemophilia a complicated with ws , the underlying etiology of our case is unknown . significant side effects of acth therapy include infection , hypertension , and cerebral atrophy with subsequent subdural hematoma . cerebral atrophy was observed in all japanese patients who were treated with acth , varying from minimal to massive . although it is generally accepted that the adverse effects of acth are dose - dependent , subdural hematoma may occur even during administration of low - dose acth therapy . therefore , prophylactic infusions of factor viii were performed every other day to prevent subdural hematoma and other bleeding episodes . then , infusion with the coagulation factor at fixed intervals might be required for the safe administration of acth therapy for patients with ws with coagulopathy . the diagnosis of hemophilia in our case was based on the existence of family history . the reliability of clinical history might be low , and family history might not be helpful for patients with inherited coagulopathy resulting from spontaneous mutation or the variable expression of a coagulopathy . indeed , marked bruising and hematoma at the intramuscular injection site of acth may lead to the diagnosis of hemophilia a without family history . thus , coagulation screening prior to acth therapy should be routinely performed to prevent potentially fatal bleeding . in conclusion , we report that an infusion of factor viii at fixed intervals should be used for the safe administration of acth therapy for patients with ws with severe hemophilia a. because the identification of pediatric patients at risk of hemorrhage before acth therapy might result in a change in management of treatment , coagulation screening tests should be performed prior to acth therapy .

hemophilia a is an x - linked recessive disorder caused by factor viii deficiency , which is an important factor in the coagulation system . here , we describe a 1-year - old boy with hemophilia a who developed west syndrome ( ws ) . recombinant factor viii was administered during adrenocorticotropic hormone ( acth ) therapy to prevent intracranial hemorrhage . infusion of factor viii at fixed intervals is useful for the safe administration of acth therapy for patients with ws with severe hemophilia a. a coagulation screening test should be performed before acth therapy .

scabies , a contagious infestation caused by the human mite , sarcoptes scabiei , affects all races and social classes worldwide . the most common presentations of scabies include classic burrows , pruritic papules , and inflammatory nodules , although in the crusted variant , thick hyperkeratoses with numerous mites predominate . sometimes , secondary lesions like impetigo or folliculitis , eczematous changes or pseudolymphoma , and some atypical presentations such as urticaria , darier 's disease , dermatitis herpetiformis , and bullous pemphigoid may be seen . in communities where scabies is not endemic , the index of suspicion is low , bullous scabies can be confused with vesiculobullous diseases like bullous pemphigoid . moreover , missing the diagnosis of diseases like scabies can lead to an outbreak among health - care workers . bullous lesions over scabies - prone sites , nocturnal itching , genital involvement , detection of mite on histopathology , and response to antiscabies treatment finally confirmed the diagnosis of bullous scabies in our case . a 26-year - old unmarried male presented with a four - day history of multiple blisters over both hands preceded by a two - week history of generalized pruritus . examination revealed multiple , erythematous excoriated papules on the wrist , trunk , lower limbs , and web spaces of fingers . multiple tense vesicles and bullae , 0.5 - 1.5 cm sized , containing clear fluid were also present on the dorsum of both hands and web spaces of fingers [ figure 1 ] . ( a ) multiple tense blisters over hands with erythematous papules over wrist , ( b ) papulovesicular lesions over dorsum of right hand , ( c ) papulovesicle , on the first web space of the left hand , and ( d ) papulonodular lesions over the the scrotum and glans penis biopsy and histopathology of one of the vesicles revealed epidermal spongiosis , multilocular intraepidermal blisters , subepidermal edema with dense lymphohistiocytic infiltrate , and a few eosinophils . the presence of mites within the blister cavity was also noted [ figure 2 ] . skin biopsy from lesion showing intraepidermal cleft containing a scabies mite ( encircled ) and mixed inflammatory infiltrate ( h and e , 100 ) immunofluroscence study could not be done due to economic constraints . the patient was treated with whole - body applications of 5% permethrin lotion and a single 12 mg dose of oral ivermectin along with oral antihistamines to control pruritus . superinfection of mite lesions with staphylococcus aureus could cause blisters , as occurs in bullous impetigo . autoantibody - mediated bulla formation could occur secondary to ( a ) exposure of basement membrane zone ( bmz ) antigens following physical injury by the mite or lytic enzymatic digestion , or ( b ) cross reactivity of mite antigens with the bmz antigens ( antigenic mimicry ) . bullae may occur as an i d reaction to scabietic mites , a process that has been termed scabid . the presence of mites within the intraepidermal blister cavity gives credence to the theory of lytic enzymes of the mite as a cause of blisters . regardless of the pathogenesis , lesions consist of pruritic , tense or flaccid large bullae , sometimes hemorrhagic or crusted , in a disseminated distribution in scabies - prone sites with or without classic lesions of scabies . in our review of the literature , there were totally 30 cases of bullous scabies presenting with blister formation with or without classic burrows and itchy papules and nodules of scabies [ table 1 ] . bullous scabies is typically reported with subepidermal blisters . however , in our case , the blisters were intra epidermal . cases of bullous scabies reported in world literature because of the clinical and histopathologic similarity of the two conditions , bullous pemphigoid may be difficult to differentiate from bullous scabies . the diagnosis of bullous scabies should be considered for any bullous eruption accompanied by papules and itching that are resistant to steroid treatment . some of the differentiating features between bullous scabies and bullous pemphigoid are summarized in table 2 . bullous scabies versus bullous pemphigoid treatment of bullous scabies is essentially similar to that of classical scabies .

scabies is an infestation caused by sarcoptes scabiei , characterized by polymorphous lesions that may include burrows , papules , nodules , excoriation , and crusts . vesicular and bullous lesions are rather rare . bullous scabies is regarded as a distinct subtype of scabies , closely resembling bullous pemphigoid . here , we report a case of bullous scabies in an adult male and review the literature .

high - resolution manometry ( hrm ) has profoundly changed the exploration of esophageal motility by allowing the measurement of many levels of the esophagus . the chicago classification was developed to facilitate the interpretation of hrm and to promote widespread use of hrm in clinical practice even if some disorders have not yet been addressed [ 1 , 2 ] . a 37-year - old woman was referred to the hospital in november 2012 for dysphagia . the patient had been experiencing thoracic pain and dysphagia for solids for 6 months and lost 20 kg . she had no prior medical history , was not taking any medication and did not smoke . echoendoscopy and thoracic ct scan were also normal , with no muscular thickening and no mediastinal tumor . the catheter was placed transnasally and positioned to obtain recordings from the hypopharynx to the stomach with 36 circumferentially sensitive sensors . the hrm protocol included at least one 30 s assessment of basal sphincter pressure and ten 5 ml water swallows in a supine position . esogastric junction pressure was 32 mm hg ( normal < 43 ) and integrated relaxation pressure ( irp ) 20 mm hg ( normal < 15 ) , showing impaired relaxation after swallowing . the mean distal contractile integral ( dci ) was 8,063 mm hg cm s and the contractile front velocity was 74.3 cm / s ( normal < 6.3 ) . intrabolus pressure was high at 10 mm hg ( normal < 8.4 ) , suggesting esophageal stasis . based on these results , pneumatic dilatation was performed with a rigiflex balloon ( boston scientific ) positioned at the esogastric junction . the balloon was inflated to 30 mm 5 psi for 1 min and 8 psi for 1 min . three months after endoscopy , the patient described clinical improvement with only two episodes of dysphagia , no chest pain , no regurgitation and weigh gain . hrm showed an esogastric junction pressure of 25 mm hg ( normal < 43 ) , irp 12 mm hg ( normal < 15 ) , mean dci 2,514 mm hg cm s and normal peristalsis . this case report shows a patient with abnormal basal esogastric junction pressure , high irp and a hypercontractile peristaltic disorder of the esophagus . these results suggest a jackhammer esophagus due to the dci above 8,000 mm hg cm s , a result which is never found in control subjects . three clinically relevant subtypes of achalasia are described with panesophageal pressurization in type 2 but without the high dci and no normal peristalsis . jackhammer esophagus is rare ( 4.1% in a tertiary center ) and mainly revealed by dysphagia . roman et al . described three patterns of hypercontractility : multipeaked and synchronized with breathing , multipeaked not synchronized with breathing and not multipeaked . the mean irp was significantly higher in the group of patients without multipeaked contractions ( n = 8) . a study comparing pneumatic dilatation and laparoscopic myotomy for achalasia after 2-year follow - up showed no difference between the two groups . injection of botulinum toxin is effective in relieving symptoms in 85% of patients , but symptoms recur in 50% at 6 months . this is an alternative treatment option which is mainly used for older or high - risk patients [ 7 , 8 , 9 ] . there is no definitive treatment and the existing options palliate dysphagia by lowering esogastric junction pressure . there is no validated treatment for jackhammer disorder : pneumatic dilatation , myotomy and botulinum toxin injections should be considered for these patients . one explanation is that the patient consulted soon after the first symptoms , while most patients wait years before undergoing hrm . roman et al . described partial recovery of peristalsis in some achalasia patients after myotomy . this suggests that esogastric junction obstruction may play a role in peristalsis failure in some achalasia patients . in conclusion the hypothesis of early - stage achalasia is possible and could provide information on the physiopathology of this disease . one session of dilatation had relieved the symptoms and the motility disorder at 6-month follow - up .

we describe a patient with dysphagia . the results of endoscopy , ct scan and echoendoscopy were normal . high - resolution manometry ( hrm ) showed esogastric junction dysfunction and hypercontractile peristaltic disorder . these hrm abnormalities completely disappeared after pneumatic esophageal dilatation . we discuss the treatment options and recovery of peristalsis after balloon dilatation .

imatinib came in vogue since 2000 , as being convenient , effective and a drug with tolerable side - effects . in our patients population , treated over a period of 7 years , we concluded that around 10% of patient population had hematological toxicity , while 15 - 20% had non - hematological toxicity . the overall survival oas was 85% , which is comparable to any published literature , indicating the imatinib is effective drug and can be easily tolerated without much side effects . it was retrospective analysis of newly diagnosed chronic myeloid leukemia patients registered at our institute from year 2002 to 2009 . the total number of evaluable patients in this period is 516 and there were 343 males and 172 females ; male : female ratio : 2:1 . most of them ( 77.9% ) had received prior hydroxyl urea though mostly for less than 1 month . the median hemoglobin was 10 g / dl , the white cell count was 1.86 lakhs / cumm and the platelet count was 3.47 lakhs / cumm . the sokal risk score distribution of the cases was as follows : low-25% , intermediate 47% , high-28% . 470 ( 91.1% ) achieved complete hematological response ( chr ) . among those who achieved chr ( n = 470 ) , 347 ( 73% ) achieved it within 3 months while 123 ( 27% ) took more than 3 months to achieve chr . among those in which cytogenetic assessment was done at some point , 79% achieved major cytogenetic response and 40% achieved complete cytogenetic response . during the follow - up , 66 patients out of the 470 who achieved chr , lost chr ( 14% ) . the median follow - up for the entire cohort was 38.9 22 months ( range : 1 - 96 months ) . the median event free survival ( efs ) was 79.3 months ( 5 year efs 65% ) . dose escalation was carried out in 148 patients ; of these 36% had response , which was suboptimal , 25% had an optimal response , 35% there was no effect / progression and 2.3% could nt tolerate the higher dose . event free survival of chronic myeloid leukemia patients the most common non - hematological toxicity was related to skin depigmentation , which was seen in 92 patients ( 15.6% ) . the other common toxicities were edema ( 8% ) , transaminitis ( 0.7% ) , skin rashes in 2% , cramps and myalgias in 16% . most of the non - hematological toxicities were grade . grade hematological toxicity was seen in 11% patients ( anemia 2% , thrombocytopenia 5.5% and neutropenia 11% ) . the total number of evaluable patients in this period is 516 and there were 343 males and 172 females ; male : female ratio : 2:1 . most of them ( 77.9% ) had received prior hydroxyl urea though mostly for less than 1 month . the median hemoglobin was 10 g / dl , the white cell count was 1.86 lakhs / cumm and the platelet count was 3.47 lakhs / cumm . the sokal risk score distribution of the cases was as follows : low-25% , intermediate 47% , high-28% . achieved complete hematological response ( chr ) . among those who achieved chr ( n = 470 ) , 347 ( 73% ) achieved it within 3 months while 123 ( 27% ) took more than 3 months to achieve chr . among those in which cytogenetic assessment was done at some point , 79% achieved major cytogenetic response and 40% achieved complete cytogenetic response . during the follow - up , 66 patients out of the 470 who achieved chr , lost chr ( 14% ) . the median follow - up for the entire cohort was 38.9 22 months ( range : 1 - 96 months ) . the median event free survival ( efs ) was 79.3 months ( 5 year efs 65% ) . dose escalation was carried out in 148 patients ; of these 36% had response , which was suboptimal , 25% had an optimal response , 35% there was no effect / progression and 2.3% could nt tolerate the higher dose . the most common non - hematological toxicity was related to skin depigmentation , which was seen in 92 patients ( 15.6% ) . the other common toxicities were edema ( 8% ) , transaminitis ( 0.7% ) , skin rashes in 2% , cramps and myalgias in 16% . most of the non - hematological toxicities were grade . grade hematological toxicity was seen in 11% patients ( anemia 2% , thrombocytopenia 5.5% and neutropenia 11% ) . in our cohort of patients , 91% patients achieved chr , out of which 73% were able to achieve it in within 3 months . dose escalation was required in 28% of patients , out of which 36% responded while 35% progressed or had no response . this data of ours is comparable to already published literature and emphasize that cml patients needs to be followed up regularly to improve the overall outcome .

cancer institute chennai is the first institute of oncological sciences to be established in the country . in icon meeting , they presented the data of 516 patients , of which 91% patients achieved complete hematological response . the overall survival was 88% and event free survival was 65% at 5 years .

the victims normally present with acute cholinergic crisis due to the inhibition of the enzyme acetylcholinesterase . a presentation of late onset neuropathy , due to long - term occupational exposure to op , has also been described . an intermediate syndrome that occurs between the early cholinergic crisis and late onset neuropathy is rare and often missed . this syndrome usually occurs 24 to 96 hours following ingestion of op and presents with clinical symptoms like weakness in the neck flexor muscles , proximal limb muscles , respiratory muscles , and depressed tendon reflexes . extrapyramidal symptoms ( eps ) , such as , tremor , rigidity or dystonia , as part of the intermediate syndrome , are very rare . the authors report a case of intermediate syndrome with extrapyramidal symptoms due to organophosphorus poisoning in a 12-year - old adolescent girl , who survived a near lethal suicidal attempt . a 12-year - old adolescent girl , in a suicide attempt , consumed an organophosphorus pesticide , fenthion , and developed profuse frothing , lacrimation , and vomiting soon after . she was taken to a nearby rural hospital and treated with gastric lavage , atropine , antibiotics , and intravenous fluid . there was no history of fever , seizures , jaundice , bleeding manifestation , head trauma , delayed developmental milestones or any neurocognitive decline . following admission , treatment was continued with atropine and other supportive measures with close monitoring . four days after admission , she developed loss of speech , tremor and intermittent jerky movements , in all four limbs with extension of neck . on day 7 she became unconscious and examination revealed a glasgow coma scale ( gcs ) score e2v2m2 . her vital signs included : a blood pressure of 100/60 mmhg ; heart rate of 94/minute ; respiratory rate of 45/minute ; and temperature of 38.5c . in addition she developed rigidity , mask - like face , and intermittent hypertonia [ figure 1 ] . magnetic resonance imaging ( mri ) of the brain , done on day 15 , revealed no abnormality . her speech returned partially on day 16 and it was slow , with slurring and a monotonous tone . she was discharged on day 18 and referred to the department of psychiatry for evaluation . at follow - up after three months , all her signs and symptoms had completely reversed . organophosphorus is a commonly used suicidal agent , as it is an easily found pesticide in the rural agricultural - based communities . however , reports on acute and long - term complications in adolescent suicide - attempt survivors following op ingestion are scarce in literature . these are : ( 1 ) cholinergic crisis / type 1 syndrome ; ( 2 ) intermediate syndrome / type 2 syndrome ; ( 3 ) organophosphate - induced delayed polyneuropathy ( opidn ) ; and ( 4 ) chronic organophosphate - induced neuropsychiatric disorder ( copind ) . among them , cholinergic crisis is the most common following exposure to larger doses of op compounds . ingestion of a few specific op compounds like diazinon , methylparathion , methamidaphos , fenthion , and ethylparathion , among others , might result in such a distinctive neurological complication , in a dose - dependent manner . the clinician should be alert and anticipate such neurological sequelae if the victim consumes these specific op compounds . our patient initially presented with a cholinergic crisis , but later on she developed features of extrapyramidal involvement such as temporary loss of speech , muscle tone abnormalities , tremor and rigidity . the reversibility of the symptoms with supportive management establishes a transient phase of the syndrome . the extrapyramidal symptoms , which occur rarely as a part of the intermediate syndrome , are thought to be due to the inhibition of acetylcholinesterase in the human extrapyramidal areas . increased susceptibility of the basal ganglia nuclei to the toxic products , in the absence of efficient detoxification pathways , may also be responsible . although abnormal signal intensities in the region of basal ganglia have been demonstrated in brain mris for some patients , most cases are reported to have normal neuroimaging . the reason for presenting this case is that the intermediate syndrome following op poisoning is an uncommon neurological complication and it might go unnoticed if the clinician has not included this in the differential diagnosis . moreover , the intermediate syndrome presenting with extrapyramidal symptoms is extremely uncommon in children . although it is reversible in most cases , a few children might develop features of respiratory muscle weakness progressing into respiratory failure . as it is a very common mode of suicide in rural areas , identification of the syndrome and timely referral for appropriate supportive care

the victims of organophosphorus ( op ) pesticide poisoning usually present with acute cholinergic crisis , due to the inhibition of the enzyme acetylcholinesterase . any neurological complication in the form of intermediate syndrome is rare and its presentation with extrapyramidal symptoms is even rarer . the authors report such a case in a 12-year - old adolescent girl , who survived a near lethal suicidal attempt .

crossed renal ectopia is a rare anomaly and ninety percent of crossed ectopic kidneys are fused to their ipsilateral mate . based on autopsy findings , the incidence has been estimated to be one in 2000 individuals . we hereby report on a 53-year - old woman with two episodes of painless gross hematuria . imaging revealed left side fused crossed renal ectopia and filling defect within the pyelocaliceal of crossed kidney . the patient underwent surgery applying a midline incision . the left kidney showed a lump pattern embedded in lower pole of the right kidney . left sided nephrectomy histopathological evaluation revealed clear cell carcinoma with severe nuclear atypia ( fuhrman grade 4/4 ) . crossed renal ectopia is a rare anomaly and ninety percent of crossed ectopic kidneys are fused to their ipsilateral mate . based on autopsy findings , the incidence has been estimated to be one in 2000 individuals . unilaterally fused kidney with inferior ectopia is the most common variety , whereas fusion with superior ectopia is the least common ( 1 ) . the association of a malignant tumor with this anomaly is extremely rare ( 2 , 3 ) . only four tumors in crossed kidneys have been reported and histopathological evaluations have confirmed renal cell carcinoma in all aforesaid tumors ( 1 ) . a 53-year - old woman was admitted to our department with two episodes of painless gross hematuria during the last three months . she had no history of systemic diseases , constitutional symptoms and familial history of urological disorders . physical exam revealed a palpable ill - defined mass in the right upper quadrant with extension to the umbilical region . serum creatinine was 1.4 mg / dl , and urine analysis revealed microscopic hematuria ( 20 - 25 rbc / hpf ) . intravenous urography ( ivu ) revealed left side fused crossed renal ectopia and filling defect within the pelvis of the crossed kidney ( figure 1 a ) . a filling defect was evident in the left crossed fused kidney in retrograde pyelography ( figure 1 a ) . computerized - tomography ( ct ) scan confirmed the presence of left crossed renal ectopia associated with an enhancing mass , arising from the pelvis and pyelocaliceal system of the crossed kidney ( figure 1 c , 1d ) . the patient underwent surgery applying a midline incision . left kidney showed a lump pattern , embedded in the lower pole of the right kidney . both pelvises of kidneys were located anteriorly . left renal pelvis and parapelvis tissue were firm . interestingly , when the left main renal artery was clamped temporarily , both kidneys became partially ischemic , whereas clamping the right renal artery was associated with right renal ischemia with no effect on the crossed left sided kidney . during the right renal artery all bleeding sites were ligated with absorbable sutures . left ureter was resected near the bladder . macroscopic evaluation of the specimen revealed a 9 7 5.5 cm kidney with a well - defined mass , which had variegated cut surfaces measuring 8 5 4 cm with extension into the proximal ureter . microscopic evaluation showed a malignant renal tumor with solid and alveolar patterns , clear cell morphology and severe nuclear atypia ( fuhrman grade 4/4 ) . immunohistochemistry evaluation showed negative reaction for ck7 , ck20 , ck5 and ck6 , and high nuclear weight cytokeratin in favor of clear cell type renal cell carcinoma . renal sinus and pyelocaliceal system were invaded by tumors . however , the perirenal fat was tumor free . magnetic resonance imaging ( mri ) and ultrasonography was applied on a regular basis to detect any evidence of local recurrence . nevertheless , local recurrence was not detected during the 18-month follow up after surgery ( figure 2 ) . crossed renal ectopia is an uncommon congenital anomaly and in most cases usually presents fusion of both kidneys . the incidence has been estimated to be one in 2000 live births ( 1 ) . there is a mild male predominance and left to right cross over occurs more frequently ( 1 ) . the association of malignant tumor with such anomalies is extremely rare ( 2 , 3 ) . computerize tomography scan is the modality of choice in detecting tumor in fusion anomaly . the surgical approach for ectopic and although a vascular study ( i.e. angiography ) was not performed for the present case , preoperative vascular studies are of utmost importance and ensure proper interruption of the blood supply prior to resection . a good vascular map we recommend trans - peritoneal nephrectomy for patients with crossed fused ectopia , which is associated with optimal access to main vessels . nephrectomy is necessary in such cases and vascular mapping prior to surgery may help avoid significant hemorrhage during surgery and decreases ischemia of the remaining kidney . nephrectomy is necessary in such cases and vascular mapping prior to surgery may help avoid significant hemorrhage during surgery and decreases ischemia of the remaining kidney .

introduction : crossed renal ectopia is a rare anomaly and ninety percent of crossed ectopic kidneys are fused to their ipsilateral mate . based on autopsy findings , the incidence has been estimated to be one in 2000 individuals.case presentation : we hereby report on a 53-year - old woman with two episodes of painless gross hematuria . imaging revealed left side fused crossed renal ectopia and filling defect within the pyelocaliceal of crossed kidney.conclusions:the patient underwent surgery applying a midline incision . the left kidney showed a lump pattern embedded in lower pole of the right kidney . left sided nephrectomy was performed while temporary right renal artery was clamped temporarily . histopathological evaluation revealed clear cell carcinoma with severe nuclear atypia ( fuhrman grade 4/4 ) . however , local recurrence was not detected during the 18-month follow up after surgery .

the diagnosis and management of a child with ambiguous genitalia should be considered as an emergency . we describe complete genito - urinary reconstruction in a four year old female child with ambiguous genitalia . the child had right solitary kidney with ectopic ureter opening in high vesico - vaginal confluence with hypo - plastic urinary bladder and continuous incontinence of urine . a 4-year old child presented with continuous incontinence of urine since birth and ambiguous external genitalia , hence was reared like a male child . since child was from remote village , antenatal ultrasonography was not done . on general examination , apparently child was healthy looking . external genitalia examination showed prominent and fused labio - scrotal folds with posteriorly placed clitoris with clitoromegaly and an orifice of the urogenital sinus [ figure 1 ] . ultrasonography of abdomen and excretory urography revealed mild hydroureteronephrosis of right pelvicalyceal system and ureter and non - visualization of left kidney and urinary bladder . genitogram showed severe variety urogenital sinus with high vesico - vaginal confluence with anterior hypo - plastic urinary bladder and posterior vagina . external genitalia showing prominent and fused labio - scrotal folds with posteriorly placed clitoris with clitoromegaly genitoscopy showed common urogenital sinus opening , anterior orifice showed hypo - plastic urinary bladder with severely incompetent bladder outlet and ectopic ureteric orifice opening at junction of bladder and vagina , resulting in total urinary incontinence , although renal function was well - preserved . since urinary bladder was hypo - plastic with lack of capacity and continence mechanism , continent urinary diversion was planned . the urinary tract reconstruction was done with continent ileocecal pouch , the penn pouch , using appendix on mitrofanoff principle , the stoma was placed at the umbilicus . two lateral plates from dorsal split phallic and preputial skin were used to construct labia minora and labio - scrotal folds were used to construct labia majora [ figure 2 ] . labia minora and labia majora after re - construction and clitoroplasty post - operatively , child was asymptomatic ; pouchogram was done at 3 weeks which showed good capacity neo - bladder , with no evidence of reflux or urinary leak [ figure 3 ] . child was kept on clean intermittent catheterization ( cic ) through umbilical stoma and dilation of reconstructed vestibule . child is on cic with normal renal functions with asymptomatic bacteriuria over four years of follow up . pouchogram showing good capacity neo - bladder , with no evidence of reflux or urinary leak the urogenital sinus is an embryological anomaly which consists of a common channel of urethra and vagina . it can be associated with an imperforate anus , and then the malformation is called a cloacal defect . in the high narrow urogenital sinus malformation , the vagina appears to insert into rather masculinized urethra , occasionally vaginal insertion occurs at a very high level , even as high as the bladder triagone , as in our child . potential indications include following cystectomy for genitourinary malignancy , and occasionally in cases of bladder exstrophy , cloacal anomalies , or neurogenic bladder . the possibility of functional reconstruction as an alternative to urinary diversion in a case of a severe urogenital sinus with a high confluence between bladder and vagina and with urinary incontinence is presented by scott g et al . , sheldon et al . , have cited a case of a tiny hypo - plastic bladder with a severely incompetent bladder outlet , in which orthotopic gastric neobladder and orthotopic neourethra was constructed in a mitrofanoff fashion . sheldon have also cited a case of solitary kidney which drained through ectopic ureter , resulting in total urinary incontinence . in this case also , the bladder was not deemed suitable for reconstruction ; a neobladder was constructed . our child also had high vesico - vaginal confluence with urinary incontinence ; hence , continent urinary diversion with penn pouch with reversed appendix on mitrofanoff principle was constructed with cutaneous stoma at umbilicus . simultaneously , ambiguous genitalia were corrected by clitoral fixation to pubis preserving neurovascular bundles and reconstruction of labia minora and labia majora . patient has complete continence for 4 - 5 hours and she evacuates urine by performing cic through a completely camouflaged stoma at umbilicus . although patient requires clean intermittent catheterization , this seems to be an acceptable trade off for continence and freedom from an external appliance . sheldon et al . , have performed orthotopic continent catheterizable neourethra using an extension of mitrofanoff principle . we prefer catheterizable stoma at umbilicus for its ease of intermittent catheterization and reduced incidence of infection , especially in female patients . complete functional and cosmetic reconstruction of ambiguous genitalia patient with urinary tract abnormality is possible in single stage .

the diagnosis and management of a child with ambiguous genitalia and severe variety of urogenital sinus with a high vesico - vaginal confluence is challenging . this 4-year - old female child had solitary right kidney with ectopic ureter opening in high variety of urogenital sinus with hypo - plastic urinary bladder and incontinence . we describe genitourinary reconstruction with complete functional rehabilitation in this child . this complex problem was managed with continent urinary diversion with penn pouch and refashioning of external genitalia , rendering continence and near normal female external genitalia . the child and parents are happy with continence and aesthetically normal external genitalia .

it is becoming increasingly apparent that excess fluid is detrimental to patient outcome , and that there is a limit to volume responsiveness of the heart . it would therefore be potentially useful to be able to predict when volume infusions will be futile for the management of critically ill patients . perel and colleagues , followed by other workers , introduced the use of respiratory variations in systolic pressure for the prediction of fluid responsiveness ; methods of detecting these variations have even been automated with monitoring devices . based on the presumed physiological mechanism , however , the prediction was that that these techniques probably would not work in subjects with spontaneous efforts ; and this was indeed supported in an earlier study by rooke and colleagues . in the previous issue of critical care , heenen and colleagues confirmed that pulse pressure variations are a poor predictor of cardiac output responsiveness in spontaneously breathing subjects . similar to other studies , they also found that approximately one - half of the subjects did not respond to fluids . importantly , heenen and colleagues also found that a test we previously described based on respiratory variations in right atrial pressure ( pra ) also failed to predict fluid responsiveness . the authors presented a number of possible reasons for the difference from our previous studies . first , their study included patients who did not have adequate inspiratory efforts , whereas we only included patients with adequate efforts . i can understand how one would include these patients when examining overall usefulness of a test for the whole population , but this test is based on the response of pra when pleural pressure falls , and if it does not fall then the test can not be used . in their discussion heenen and colleagues argued that a difference in the findings may also be because we had disconnected patients from the ventilator . we only did this on a few occasions , however , to ensure that we did not miss an inspiratory effort and thus this should also have had a minimal effect on our results . the most significant difference was that almost 30% of our subjects had no inspiratory fall in pra , whereas only three patients or 14% had no inspiratory fall in pra in heenen and colleagues ' study . heenen and colleagues indicate that they took the difference between end - inspiration and end - expiration , but we are not told what happened when there was a forced expiration . this can raise pra at end - expiration and make it appear that there is an inspiratory fall when in fact there is only a fall in the expiratory pra back to baseline . we excluded such measurements from our studies because that change should not predict fluid responsiveness . my actual practice at the bedside is to try to identify a cycle with no forced expiration at any phase during the respiratory cycle ; if i can not identify such a cycle , then i do not use the test . another potential problem is the interpretation of an increased ' x ' or ' y ' descent as an inspiratory fall in pra , rather than using the base of the ' a ' wave . i am not surprised that respiratory variations in pra were not sensitive for predicting fluid responsiveness . we previously argued that patients who are close to the plateau of the cardiac function curve would have a significant fall in pra but a minimal response to volume . i argue that the real question should not be the potential to predict an increase in cardiac output , but rather the potential for there not to be a response to volume . the clinician therefore needs to know when not to give fluid rather than when to give it . based on this reasoning , the low specificity for our test observed by heenen and colleagues is of greater concern . their estimate was based on only three patients , however ; hardly a large enough sample size to give much confidence to this estimate . another point of note is that the use of colloids also confounds the assessment of volume responsiveness , because there is a suggestion that colloids sometimes give a hemodynamic benefit that is not related to a starling mechanism and would thus not be predicted by dynamic measures . what is often seen is a rise in cardiac output without a rise in pra , a change in heart rate or a change in afterload , which means that there had to be a change in cardiac contractility . possible mechanisms could be a reduction of edema in the heart or electrolyte shifts that effect cardiac function . although not stated , heenen and colleagues probably used the mid - axillary line , which gives values ~3 mmhg higher than our values referenced to 5 cm below the sternal angle . in summary , heenen and colleagues have shown that respiratory variations in pulse pressure do not predict the volume responsiveness of cardiac output in spontaneously breathing subjects . their data also raise potential concerns regarding the predictive value of respiratory variations in pra . before this approach is rejected , however , it is important to be certain that the technical details are correct , and that the population size is adequate .

the prediction of which patients respond to fluid infusion and which patients do not is an important issue in the intensive care setting . assessment of this response by monitoring changes in some hemodynamic characteristics in relation to spontaneous breathing efforts would be very helpful for the management of the critically ill . this unfortunately remains a difficult clinical problem , as discussed in the previous issue of the journal . technical factors and physiological factors limit the usefulness of current techniques .

in response to the outbreak of pandemic ( h1n1 ) 2009 in mexico , we conducted an observational study of critically ill patients with this infection in winnipeg , canada . we examined blood samples from 20 patients with laboratory - confirmed pandemic ( h1n1 ) 2009 . ethnicity was nonwhite for 10 patients , white for 9 , and unknown for 1 . peripheral blood mononuclear cells were stored , and a subset of samples were thawed and resuspended in 200 ul phosphate - buffered saline . genomic dna was extracted by using the qiaamp dna mini kit ( qiagen , valencia , ca , usa ) according to the manufacturer s instructions . dna was amplified by using previously reported primers surrounding the 32-bp deletion in the ccr5 gene : 5 primer , tcattacacctgcagctctc ; 3 primer , tggtgaagataagcctcac . wild - type ccr5 dna results in a 197-bp product , but the 32 allele results in a 165-bp product . the genotype was determined by visual examination of the pcr product and of a known heterozygote used as a control . the ccr532 allele was not found in the nonwhite patients , but it was found in 5 of the 9 white patients ( figure ) ; overall allele frequency for white patients was 27.8% . among the 5 who were heterozygous for the ccr532 allele , 1 died , 1 remained in the intensive care unit for > 1 month , and 3 were discharged . lane 1 , heterozygous positive control ; lanes 25 and 711 , patient samples ; lane 6 , 100-bp ladder ; lane 12 , negative control . ccr532 heterozygosity is observed in samples 2 , 3 , 4 , 5 , and 11 . the outbreak of pandemic ( h1n1 ) 2009 infection in canada affected primarily young women ; a preponderance were nonwhite and they had no major concurrent conditions . risk factors identified included a history of lung disease or smoking , obesity , hypertension , and diabetes . the frequency of ccr532 heterozygosity among white populations has been reported to range from 10% to 15% ( 12,13 ) ; we found ccr532 heterozygosity at a higher than expected frequency ( 55.5% ) among white patients with critical illness caused by pandemic ( h1n1 ) 2009 . although deficiency of the receptor protects against acquisition of hiv , evidence is accumulating to suggest it plays a role in severity of illness caused by flavivirus infections ( 7,8 ) . in animal models of influenza , ccr5 plays a role in directing cd8 + t cells to the site of infection , and its absence is associated with increased mortality rates ( 9,10 ) ; however , to our knowledge a similar association in humans has not yet been reported . our observation suggests that ccr532 is 1 of the factors associated with increased severity of illness among white patients with pandemic ( h1n1 ) 2009 . identifying genetic factors associated with greater risk for illness severity will help explain the unique pathogenesis displayed in the pandemic ( h1n1 ) 2009 outbreak and may have public health implications . further studies are required to illuminate the role of ccr5 in delivery of immune cells to the site of influenza infection .

because chemokine receptor 5 ( ccr5 ) may have a role in pulmonary immune response , we explored whether patients with severe pandemic ( h1n1 ) 2009 were more likely to carry the ccr532 allele than were members of the general population . we found a large proportion of heterozygosity for the ccr532 allele among white patients with severe disease .

chronic kidney disease is associated with increased risks during pregnancy . from the maternal side , gestational hypertension , pre - eclampsia , eclampsia and death have been described . from the fetal side , intrauterine growth restriction , polyhydramnios , premature birth and small for gestational age a 32-year - old woman presented with twin pregnancy after in vitro fertilisation at a gestational age of 24 weeks + 3 days because of imminent preterm labour . she had stage-4 chronic kidney disease due to lupus nephritis that had been diagnosed 15 years earlier . before pregnancy , her blood pressure was 110/80 mmhg and heart rate 88 beats per min and regular . mol / l ( normal values < 80 mol / l ) and blood urea nitrogen was elevated to 20 mmol / l ( normal values < 7.8 haemoglobin was reduced to 6.3 mmol / l ( normal values , 7.010.0 mmol / l ) , whereas alanine aminotransferase ( 7 u / l ) , lactate dehydrogenase ( 169 u / l ) and platelet counts ( 191 10/l ) were in the normal range . continuous infusions of the tocolytic substance , atosiban , and an oxytocin receptor antagonist were administered to halt premature labour . ultrasound examinations were performed using a voluson ultrasound machine ( general electric healthcare , amersham , uk ) with the woman in a semi - recumbent position . amniotic fluid volume was measured according to the standardized techniques using the single deepest pocket measurement giving the vertical dimension of the largest pocket of amniotic fluid measured at a right angle to the uterine contour [ 2 , 3 ] . the single deepest pocket measurement is interpreted as normal amniotic fluid volume ( 2.18.0 cm ) and polyhydramnios ( > 8.0 cm ) . ultrasound showed diamniotic and dichoriotic twins with estimated weights of 609 and 693 g , respectively . repeated ultrasound evaluations confirmed intrauterine growth restriction in twin 1 by 24.7 % and twin 2 by 14.3% , respectively , and polyhydramnios as the cause of imminent preterm labour ( figure 1a ) . because of the well - known association between polyhydramnios and elevated uraemic toxins , intrauterine growth restriction and threatening preterm labour of premature children , haemodialysis treatments were started to reduce uraemic toxins , including blood urea nitrogen ( figure 1b ) dialysis was administered 6 days per week for 3 h each using a biocompatible haemodialysis membrane . after initiation of haemodialysis treatment , ultrasound evaluation showed a significant decrease in amniotic fluids and reduction in the clinical complaints . at a gestational age of 28 weeks + 4 days , pre - eclampsia developed showing an elevated maternal blood pressure , elevated liver enzymes as well as an elevated pulsatility index in the arteria umbilicalis . birth weights of the twins were 941 and 1164 g , respectively ( figure 1c ) . six weeks after delivery and cessation of haemodialysis , the mother 's plasma blood urea nitrogen was 18 when the twins were seen last at the age of 12 months , the psychomotor development was uneventful . 1.example for the determination of amniotic fluid volume using the single deepest pocket measurement ( dotted line in a ) and change of blood urea nitrogen ( b ) in a woman with known chronic kidney disease , presenting with twin pregnancy and imminent preterm labour , before and after starting haemodialysis treatment . ( c ) twins after delivery at a gestational age of 28 weeks + 4 days . example for the determination of amniotic fluid volume using the single deepest pocket measurement ( dotted line in a ) and change of blood urea nitrogen ( b ) in a woman with known chronic kidney disease , presenting with twin pregnancy and imminent preterm labour , before and after starting haemodialysis treatment . ( c ) twins after delivery at a gestational age of 28 weeks + 4 days . there have been previous reports of pregnancy in prevalent haemodialysis patients . however , the present case is unique because haemodialysis had to be started in a woman with moderate - chronic kidney disease due to life - threatening fetal complications during pregnancy . this case suggests that reducing polyhydramnios by haemodialysis in a woman presenting with twin pregnancy and preterm labour , with known chronic kidney disease and elevated uraemic toxins , can prolong pregnancy considerably , even up to several weeks . effective treatment of elevated uraemic toxins thereby significantly reduced the morbidity risks of the twins . the results presented in this paper have not been published previously in whole or part , except in abstract format .

a 32-year - old woman with known stage-4 chronic kidney disease due to lupus nephritis presented with twin pregnancy after in vitro fertilization at a gestational age of 24 weeks + 3 days because of imminent preterm labour . repeated ultrasound evaluations confirmed intrauterine growth restriction in both twins and polyhydramnios as the cause of imminent preterm labour . after initiation of haemodialysis treatment , ultrasound evaluation showed a significant decrease in amniotic fluids , and also reduction in blood urea nitrogen and in clinical complaints could be observed . at a gestational age of 28 weeks + 4 days , delivery was performed by caesarean section . this case study shows that effective treatment of elevated uraemic toxins significantly reduced the morbidity risks of the twins .

primary localized fibromatosis of breast is defined as locally invasive , noncapsulated and well - differentiated fibroblastic growth which arises within the mammary gland . we report here a case of 60-year - old female presenting with fibromatosis breast mimicking sarcoid lesions . a 60-year - old female presented with the chief complaint of 6 month 's history of painless , raised , and gradually increasing lesion on the left breast . there was no history of any trauma , radiation therapy , or previous surgery of the breast . there was no history of breast cancer in the patient or her family . on local examination , a well - defined plaque , skin - colored with slight erythema , firm to hard in consistency , with dimpling and tethering of the skin was present [ figure 1 ] . the chest x - ray was normal with little increase in hilar shadow on the left side , which was not significant . fine needle aspiration cytology ( fnac ) from the lump was negative for any cancer cells . a small 4-mm punch biopsy was taken from the edge of the plaque and histopathology revealed spindle cell formation in the lower dermis along with fibroblast proliferation and deposition of homogenous eosinophilic material and collagen deposition . follow up examination a year later did not show any recurrence . a well - defined plaque , skin colored , with dimpling and tethering of the skin histopathology under 10 showing spindle cell formation in the lower dermis along with fibroblast proliferation and deposition of homogenous eosinophilic material and collagen deposition primary fibromatosis of the breast is a rare neoplasm which accounts for less than 0.2% of all the breast neoplasms . a history of trauma to the breast is common , but it may arise de novo as in our patient . the etiology of the disease is unknown , but it has been reported to occur in patients with gardner syndrome and familial multicenteric fibromatosis . clinical presentation is a hard painless lump associated with dimpling and tethering of the skin and retraction of the nipple . since patient complained of breathlessness , we initially thought it to be a sarcoid lesion on the breast . reported that in sarcodosis breast , the most common clinical finding is a nontender , firm , mobile breast mass without evidence of skin or nipple changes . thus , fibromatosis of breast can clinically mimic sarcoidosis . however , biopsy findings in our case were consistent with fibromatosis which is benign mesenchymal tumor of the breast and includes spindle cell formation in the lower dermis . mammography findings as in our case can most frequently mimic a breast carcinoma and has been reported in past , so , performing an fnac is must which was negative in our case . this case is being reported so that for its unique clinical presentation in which fibromatosis almost mimicked sarcoidosis breast and to emphasize the role of histopathological findings in such cases .

primary mammary fibromatosis is a rare skin condition which can arise after trauma or previous surgery . the exact etiology is unknown . very few cases have been reported in literature and the main emphasis is to differentiate this condition from breast carcinoma . we report here an unusual case of a 60 year old female who presented with skin lesion which clinically looked sarcoid with history suggestive of sarcoidosis , but on histopathology fibromatosis of breast was revealed . complete work up ruled out any carcinomatous changes . surgical excision of the lesion was done with no recurrence seen in one year follow up period .

oral lichen planus ( olp ) is a chronic , autoimmune mucocutaneous disease , occurring most commonly in the middle aged women . lichen planus may also occur concurrently or independently in the skin and the genital , anal , esophageal , nasal and laryngeal mucosae . andreasen reported that the average age of occurrence in males and females is 40 - 49 years and 50 - 59 years , respectively . clinically the oral lesions have been grouped into reticular , papular , plaque like , atrophic , erosive and bullous forms . olp usually occurs in a bilaterally symmetrical pattern , commonly involving buccal mucosa , gingivae and dorsum of the tongue . the lesions are usually painless , though pain and burning sensation are associated with erosive and atrophic lesions . earlier studies have implicated stress , anxiety , depression as the causes for olp . however , whether stress is the cause or the consequence , was left undetermined . concluded that human leukocyte antigen ( hla ) associated genetic factors play a certain role in the pathogenesis of olp . hedberg and associates reported that epithelium involved by olp was consistently positive for hla - dr . lodi g et al . reported that lichen planus is sometimes associated with infections or auto immune diseases and / or neoplasia , but the association had not been established . certain systemic diseases like diabetes mellitus , hypertension , ulcerative colitis , myasthenia gravis , lupus erythematosus , etc were considered to be associated with olp . a more consistent association was found between chronic liver disease and erosive form of olp . recent studies indicate an association between hepatitis c virus ( hcv ) and olp.[1521 ] hcv is a hepatotrophic ribonucleic acid ( rna ) virus , which possibly alters the antigenecity of the epidermis , causing an interaction with activated t- cells , or acts through a modulation of the quality of host immune response . oral lichenoid reactions caused by drugs and dental restorative materials have been considered as variants of olp . drugs implicated are non steroidal anti inflammatory agents , sulfonyl ureas , beta blockers , oral hypoglycemic agents , dapsone , pencillamine . dental restorative materials like amalgam , composite , acrylic , gold have been reported to cause lichenoid reactions . lichenoid lesions have also been reported in tobacco chewers ; however , the causative role of tobacco in the pathogenesis of olp has not been identified . current literature suggests that olp is caused by cluster of differentiation 8 ( cd-8 ) cell mediated damage to the basal keratinocytes leading to apoptosis . the antigen inciting the cytotoxic t cells could be any of the above mentioned factors including stress , chronic liver disease , hcv virus , dental restorative materials and/or drugs . the main event in the pathogenesis appears to be increased production of cytokines leading to the recruitment of langerhans cells and clonal expansion of cytotoxic cells . langerhans cells produce increased amounts of interferon -alpha ( ifn - ) , which further activates cytotoxic cell mediated apoptosis , via the keratinocyte caspase cascade . interferon - production increases the apoptosis through the up regulation of p53 and matrix metallo proteinase -1 ( mmp-1 ) . non specific mechanisms like mast cell degranulation and mmp -1 activation further aggravate the t cell accumulation , basement membrane disruption by mast cell proteases and keratinocyte apoptosis ( triggered by basement membrane disruption ) . the chronicity of the olp lesions might be partly explained by the fact that the basement membrane disruption triggers keratinocyte apoptosis and apoptotic keratinocytes are unable to repair the breach in basement membrane . therefore , interaction of various factors is probably responsible for the initiation , aggravation and persistence of olp . the current treatment modalities are not only inadequate in treating all patients and preventing recurrences , but also have significant side effects . further clarity on the pathogenesis will aid in modifying therapeutic interventions , thus significantly reducing the morbidity of olp patients .

oral lichen planus ( olp ) is a chronic mucocutaneous disease of uncertain etiopathogenesis . several factors including stress , genetics , systemic diseases , viruses , dental restorative materials and drugs have been implicated as causative agents . the disease seems to be mediated by an antigen specific mechanism , activating cytotoxic t cells , and non specific mechanisms like mast cell degranulation and matrix metalloproteinase activation . further clarity on the pathogenesis will aid in modifying therapeutic interventions , thus significantly reducing the morbidity of olp patients .

six and half year old boy had complaints of genitourinary problem in the form of hypospadias , small phallus and hydrocele . this case illustrates that klinefelter syndrome was presented in the infancy with hypospadias and hydrocele which are very uncommon presentation of the disease however , hypospadias and hydrocele are rare presenting features of this commonest chromosomal disorder . in this case report , we describe a boy who had hypospadias and right sided hydrocele along with 47 , xxy chromosomal disorder . a 6-year - old boy attended to our endocrine out - patient department with the complaints of misdirection of urine and small phallus since birth . his weight and height was 16.2 kg ( > 50 to < 75 percentile ) and 121 cm ( > 50 to < 75 percentile ) respectively . upper segment and lower segment ratio was 1.01 and arm span and blood pressure were 119 cm and 96/60 mmhg respectively . examination of the external genitalia revealed , small phallus ( phallic length 2.5 cm ) , labioscrotal folds were separated . routine laboratory investigations including complete hemogram , serum electrolyte , urea , creatinine , plasma glucose were within the normal limits . ultrasonography of the abdomen revealed no abnormality , but ultrasography of testes showed right sided hydrocele and the left testes size was 1.75 cm 1.2 cm . lh and fsh were high ( 11.8 iu / l and 15.0 iu / l ) and he had undetectable serum testosterone level . right sided hydrocele , small phallus karyotyping showing an extra x chromosome ( 47 , xxy ) klinefelter syndrome is the most common chromosomal disorder with prevalence of 1 in 500 - 640 men . it is estimated that more than 50% of men are not diagnosed and that 90% of those identified are diagnosed only post - pubertally . prenatal detection of the klinefelter syndrome karyotype is the first of three peaks in the diagnosis . second , in childhood , small testes and phallus and a tall , thin body habitus are clues to the diagnosis of klinefelter syndrome ; although , these findings overlap with findings in the normal boys . the boys may also manifest clinodactyly , hypertelorism , gynecomastia , elbow dysplasia , high arched palate , hypotonia , language delay or learning and reading disabilities requiring therapy . finally , the diagnosis in adulthood results from presentation with similar complaints , but increasingly made during the evaluation for infertility . at puberty , the testes fail to increase in size and become firm due to a progressive loss of germ cells and seminiferous tubule hyalinization and fibrosis genitourinary problems like hypospadias as a presenting feature is very rare . serum fsh and lh are increased uniformly in men with klinefelter syndrome , thus indicating leydig cell and seminiferous tubule dysfunction . mean serum testosterone levels are reduced , but as many as one - third of patients have total testosterone levels within the low - normal range . in this case , the klinefelter syndrome has been presented unusually in infancy and the presenting features are hypospadias and hydrocele . although , the genitourinary problems are rare in klinefelter syndrome , it should be considered and thoroughly investigated so that they can be managed appropriately .

introduction : klinefelter syndrome usually presents in the puberty and adulthood with its characteristic features . we report a boy who had klinefelter syndrome with hypospadias and hydrocele.case note : six and half year old boy had complaints of genitourinary problem in the form of hypospadias , small phallus and hydrocele . karyotyping showed 47,xxy.conclusion : this case illustrates that klinefelter syndrome was presented in the infancy with hypospadias and hydrocele which are very uncommon presentation of the disease

acute appendicitis is a common disease in all age groups , and typically presents with right lower abdominal pain . however , atypical presentations are well known and may be associated with unusual manifestations , leading to diagnostic delays with an increase in morbidity and mortality . if abscess formation is seen on imaging studies , ct- or ultrasound - guided drainage is often performed as the initial treatment . various types of fistulae associated with the appendix have been reported , but there are no previous reports of a non - malignant connection between an abscess and the duodenum . we herein present a patient with a duodenal fistula that developed during the treatment of perforated appendicitis presenting with a retroperitoneal abscess . a 53-year - old japanese man presented with a 10-day history of lower abdominal pain . he had a past medical history of hypertension and iron deficiency anemia , and his only medication was for iron deficiency anemia . the remainder of the physical examination revealed a fever of 38.3 c and right lower abdominal tenderness on palpation . laboratory data revealed a mild leukocytosis ( white blood cell count of 10,400/mm ) and iron deficiency anemia . computed tomography of the abdomen showed a 7 cm 5 cm 8 cm retroperitoneal abscess with high - density lesions and compression of adjacent organs including the duodenum and ascending colon ( fig . this was felt to be consistent with perforated appendicitis , and treatment was begun with intravenous piperacillin and tazobactam . , his condition generally improved , and workup regarding the iron deficiency anemia was then undertaken . colonoscopy showed no abnormalities , but esophagogastroduodenoscopy showed an elevated lesion with granulomatous tissue in the duodenum without ulcer formation . ten days after drainage was performed , duodenography showed granulomatous tissue with flow of contrast demonstrating a connection between the abscess and the duodenum ( fig . pathological examination showed granulomatous tissue inside the appendix with an inflammatory background and fecaliths surrounded by macrophages . repeat egd showed no abnormality at 90 days after drainage and the iron deficiency anemia resolved spontaneously . perforated appendicitis has many presentations , including an abdominal mass , abscess , peritonitis or , rarely , fistulae . many unusual fistulae have been reported including cutaneous , umbilical , colon , kidney , bladder and aorta but a fistula between a peri - appendiceal abscess and the duodenum has not yet been reported . management of fistulae , especially to the duodenum , are challenging because approximately 10 l of fluid from the stomach , bile duct , and pancreas pass through the duodenum each day . a retroperitoneal abscess around the duodenum and appendix should be checked to differentiate it from valentino 's syndrome ( a perforated duodenal ulcer presenting as appendicitis ) . in the present case , in addition , the specimen showed the appendix with inflammatory background and granulomatous tissues , compatible with perforated appendicitis . we usually manage the fistula by administering total parenteral nutrition , and withholding oral intake . however , in this patient an influx from the duodenum into fistula was not seen on the fistulogram and oral intake was continued . fortunately , this patient had no complaints of abdominal pain , gradually improved and the amount of drainage did not change with oral intake . the role of interval appendectomy in this situation is not fully defined . in consideration of his age and the specimen showed granulomatous tissue inside the appendix with an inflammatory background , compatible with appendicitis . in summary , we present here the first case of perforated appendicitis associated with a duodenal fistula . written informed consent was obtained from the patient for publication of this case report and accompanying images . a copy of the written consent is available for review by the editor - in - chief of this journal on request . kenji okumura undertook the gathering of information for this case and was a major contributor in writing the manuscript . tadao kubota and alan t. lefor conceived the manuscript and were a major contributor to the manuscript .

introductionretroperitoneal abscess is an unusual presentation of perforated appendicitis . a fistula between the duodenum and an abscess resulting from appendicitis has not been previously reported.presentation of casea 53-year - old japanese man with a past medical history of hypertension and iron deficiency anemia presented with a 10-day history of fever and right lower abdominal pain , and was diagnosed with a retroperitoneal abscess secondary to perforated appendicitis . he was then treated with piperacillin and tazobactam after undergoing ultrasound - guided drainage , after which his overall condition improved . due to iron deficiency anemia , we performed further evaluation for gastrointestinal bleeding and esophagogastroduodenoscopy showed an elevated lesion with granulomatous tissue in the duodenum , without an associated ulcer . at 10 days after abscess drainage , duodenography with contrast showed continuity between the abscess cavity and the duodenum . at 74 days after drainage , we performed laparoscopic appendectomy . pathological examination showed granulomatous tissue inside the appendix with an inflammatory background and fecaliths infiltrated by macrophages.discussionperforated appendicitis has various presentations and many unusual fistulae have been reported , however , a fistula between a peri - appendiceal abscess and the duodenum has not yet been reported . a retroperitoneal abscess around the duodenum and appendix should be checked to differentiate it from valentino 's syndrome.conclusionwe present the rare complication of a duodenal fistula during the treatment of perforated appendicitis . the possibility of fistula formation should be considered in patients with complicated appendicitis .

langerhans cell histiocytosis ( lch ) is a rare histiocytic disorder characterized by abnormal proliferation of functionally immature langerhans cells . the prevalence of lch is estimated to be 1 - 2 cases per 1 million people . when it occurs in the bone , it has a predilection for the skull , spine , rib and humerus . we present a case of solitary lch occurring in an adult clavicle , a rare presentation with limited cases reported in published studies . a 25-year - old female presented with a left shoulder pain that had persisted for 2 months . due to deteriorating pain , she visited a nearby hospital and was diagnosed with bone tumor of the clavicle on radiography . she then was referred to our institute for further treatment . on initial physical examination , the range of motion of the left shoulder was limited due to pain . on the plain radiograph , there was a 2-cm osteolytic lesion in the middle third of clavicle with slight periosteal reaction ( fig . the lesion was depicted as low intensity on t1-wi and high on t2-wi , with the extra - skeletal mass extending to the coracoid process ( fig . 2 ) . on positron emission tomography ( pet)-ct , the lesion was solitary with a maximum standardized uptake value ( suvmax ) of 14.23 ( fig . differential diagnosis included malignant lesions such as ewing sarcoma and plasmacytoma ; therefore , open biopsy was performed . on histopathologic examination , the lesion was composed of histiocytic appearing cells with prominent eosinophils . on immunohistochemistry , the lesion was positive for cd1a and s-100 , confirming the diagnosis of lch ( fig . one year after biopsy , the lesion is well healed with no local recurrence or distant metastasis . lch is an abnormal proliferation of tissue macrophage called langerhans cells which was previously known as histiocytosis x that grouped eosinophilic granuloma , hand - schller - christian disease and letterer - siwe disease . the etiology of this entity is still unknown , with conflicting reports between its neoplastic origin and the possibility of a reactive immune condition . recent findings of a mutation in braf and map2k1 have led to the assumption of its neoplastic origin , at least in some subgroups . lch occurring in an adult is uncommon , since lch predominantly occurs in children , with approximately 80 % of the disease happening under the age of 15 . although the majority of lch occurs as a solitary lesion , it could also present as multiple lesions involving the skin , lymph node , lung , liver and spleen . wester et al . reported 61 cases of lch occurring in adults , with only 6 % involving the clavicle . a solitary lesion in the clavicle is extremely rare , and only 12 cases have been reported to date . diagnosis of lch is sometimes difficult and it is reported to be underdiagnosed especially in the adult population . the most frequent lesion occurring in an adult clavicle is a metastasis of carcinoma , but the radiographic differentiation between metastasis , osteomyelitis and lch is often difficult . although most of the malignant tumors occur in the end of the bone , localization is not particularly helpful for a definitive diagnosis . utilization of pet - ct for lch has been reported in a number of studies , and efficacy has been shown for overall disease extension and posttreatment assessment . it is superior to bone scintigraphy , where only 35% of the cases are detected , but it does not lead to a definitive diagnosis . cortical destruction and soft tissue extension that was observed in our case are rare , and biopsy is mandatory to make a diagnosis . although uncommon , lch should be considered in the differential diagnosis of an osteolytic lesion occurring in an adult clavicle . treatment consists of surgery , radiation therapy , chemotherapy and combination therapy depending on the localization and spread of the lesion . surgery is usually sufficient for solitary lesions , where only 2 local recurrences among the 61 cases have been reported for adult lch . several options for surgery have been reported from biopsy alone to curettage with bone grafting . because some lch undergo spontaneous regression , it is prudent to limit the invasiveness of the treatment for small lesions . in our case , there has been only one report of a malignant lch of the clavicle , and although the lesion is extremely heterogeneous in presentation , local aggressiveness such as pathological fracture warrants cautious follow - up . open biopsy for definitive diagnosis of the lesion subsequently led to remission of the lesion . although uncommon , lch should be considered in the differential diagnosis of an osteolytic lesion in the clavicle . the rarity of this tumor occurring in an adult clavicle has not enabled prediction of the outcome , therefore additional follow - up is warranted . informed consent was obtained from the patient for this case report and any accompanying images .

langerhans cell histiocytosis ( lch ) usually occurs in children under the age of 10 years with a predilection for the skull , spine , rib and humerus . solitary lch occurring in an adult clavicle is uncommon with limited reports to date . the lesion in our patient was curetted with the intent to make a diagnosis , which subsequently lead to the remission of the symptom and the disease . at the final follow - up after 1 year , no local recurrence or metastasis is observed .

the safety of contrast agent in echocardiography was reported and there is a study showing that these agents have a good safety profile in both cardiac and abdominal ultrasound applications.1 ) here we introduced a simple diagnostic approach to coronary artery fistula with contrast agent during echocardiography and it helped us to access the diagnosis because of the typical diastolic flow in pulmonary artery . she had been suffering from dyspnea on exertion for 5 years but could not be diagnosed . no abnormal findings were observed on an initial chest posterioaneterior view and electrocardiogram . however cardiac echocardiography revealed abnormal small turbulent flow in the main pulmonary artery ( fig . because there was no evidence of a right - to - left shunt , pulmonary parenchymal disease , or hypersensitivity to perflutren , which are contrast agent contraindications , we administered the definity contrast agent ( bristol - myers squibb medical imaging , north billerica , ma , usa ) in real echocardiographic mode ( infusion rate of 3.0 ml / min mixed with normal saline , 50 ml ) using a vivid 7 ( ge ultrasound , horten , norway ) ultrasound system and found unusual whitish flow in the main pulmonary artery during the diastolic phase ( fig . 1c and d ) . under the impression that this was a coronary artery fistula , we performed aortic computed tomography ( ct ) and revealed two huge right coronary artery fistulas in the main pulmonary artery ( fig . coronary artery fistulas account for only 0.4% of congenital heart defects2 ) and approximately 50% of pediatric coronary vasculature anomalies . the incidence of coronary artery fistula in the overall population is estimated to be about 0.002% , and 20% of patients with a congenital coronary artery fistula have other concomitant car - diac anomalies , most frequently aortic and pulmonary atresia and patent ductus arteriosus . tetralogy of fallot has also been reported.3 - 5 ) congenital fistulas often arise from the right coronary artery system and the majority enter the right ventricle , right atrium , superior vena cava , coronary sinus , or pulmonary arteries.6 ) many patients are asymptomatic ; however , an awareness of these fistulas is important because they have been associated with various clinical features including chest pain or heart failure in young patients.7 ) coronary artery fistulas have been diagnosed with aortography,8 ) coronary angiography,9 ) and coronary ct.7 ) although there is a case of colour doppler assessment of a coronary fistula,10 ) we can not easily confirm these fistulas with echocardiography . in this study , we used a simple diagnostic approach for a coronary artery fistula using a contrast agent , which aided with the diagnosis , because of the typical diastolic whitish flow in the pulmonary artery . the safety of the contrast agent ( including definity ) has been reported , and wei et al.1 ) showed that these agents have a good safety profile in both cardiac and abdominal ultrasound applications . the incidence of severe adverse reactions to ultrasound contrast agents is no greater and may be lower than that reported for contrast agents commonly used in other cardiac imaging tests.1 ) the flow of a coronary artery fistula can be noted easily during the diastolic phase by contrast infusion , so the coronary artery fistula can be approached in a more direct way .

coronary artery fistulas have been diagnosed with aortography , coronary angiography , and coronary computed tomography ( ct ) . a large fistula can be occasionally found as a mass lesion on echocardiography but can not be easily confirmed . here , we report a new diagnostic approach to coronary artery fistulas using a contrast agent and transthoracic echocardiography . transthoracic echocardiography of a 46-year - old female suffering from dyspnea revealed suspicious small turbulent flow in the main pulmonary artery . following infusion of a contrast agent , we found whitish flow in the main pulmonary artery during the diastolic phase , and aortic ct revealed two huge right coronary artery fistulas in the main pulmonary artery . a simple diagnostic approach to a coronary artery fistula using contrast agent helped us confirm the diagnosis because of the typical diastolic whitish flow in the pulmonary artery .

she experienced recurring syncope due to bradycardia , and electrocardiography ( ecg ) indicated a 4.5secondlong pause . , the left subclavian vein was punctured under ultrasonographic guidance and a sheath was inserted . then , a right ventricular ( rv ) lead ( tendril mri lpa1200m52 , st . jude medical ) was inserted and placed on the ventricular septum ; we checked the lead position in the left anterior oblique ( lao ) projection . moreover , we ensured that rwave sensing , capture threshold , and impedance were appropriate ( no data recorded ) . after 2 min , we observed that the st segments were elevated in the v1v4 leads ( fig . however , she did not have any chest pain or discomfort , and her blood pressure was stable . moreover the stsegment elevation diminished during transthoracic cardiac echocardiography . after 5 min , we found that the st segments were elevated again , which was sustained for approximately 60 sec . then , we placed the rv lead in the apex and screwed it in again . at this point , after replacing the rv lead , we did not observe any changes in the st segments . moreover , transthoracic cardiac echocardiography did not indicate any wall motion asynergy or pericardial effusion after implantation , and her plasma troponin level was not elevated . ( b ) twelvelead electrocardiogram during permanent pacemaker implantation , showing marked stsegment elevation in segments v1v4 . some complications related to rv lead insertion and stabilization are well known , including right heart perforation , lead displacement , and migration in the coronary sinus , but stsegment elevation during rv lead implantation is rare . in the present case , the st segments ( v1v4 ) were found to be significantly elevated immediately after screw extension ; removal of the lead diminished the stsegment change . even though the underlying cause was unclear , we speculated on the following possibilities . the most likely explanation is that the rv lead perforated the rv wall and that the extended screw stimulated the epicardium or accidentally the rv lead contacted precordial ecg leads . a previous case report 1 described focal stsegment elevation in a patient with epicardiac pacing after cardiac surgery . thus , they concluded that the pacing wire caused the current of injury and stsegment elevation seen on surface ecg . during pericardiocentesis , the needle for centesis is connected to the precordial lead of the electrocardiogram 2 . therefore , when the needle touches the myocardium , the st segment of the electrocardiogram will be elevated due to the current of injury . in the previous case report , we speculated that the pacemaker lead perforated the rv wall and might have contacted the pericardium . therefore , according to the focal surface leads , the st segment was elevated without reciprocal changes . although transmural ischemia is unlikely based on the presence of intact ventricular wall motion , it can not be excluded completely due to the lack of reciprocal ecg changes . on the other hand , pericarditis can be excluded based on the clinical time course of stsegment elevation and the lack of pericardial effusion . a less likely explanation is that we extended the screw to the anterior wall , which is located between the septum and rv free wall ; this could have compressed or caused a spasm in the left anterior descending ( lad ) artery , which could have induced myocardial ischemia . the lad artery runs along the epicardial surface of the heart within the interventricular groove , superficial to the interventricular septum . hence , there is a risk that the pacemaker lead may be implanted close to the lad artery , which could cause spasm or compression of the artery 3 . therefore , physicians should carefully ensure that the lead does not fix against the anterior wall . use of the lao view is recommended to differentiate the rv free , anterior , and septal walls during assessment of the lead tip position 4 , 5 . in the present case the 90 left lateral view also is recommended for this purpose 6 . in the present case , we could immediately detect an ecg change via monitoring of the precordial leads . thus , we believe there might be some cases in which ecg abnormalities are detectable only in the precordial or limb leads during pacemaker implantation . therefore , 12lead ecg monitoring during pacemaker implantation may be useful for physicians to avoid such complications as rv perforation and myocardial ischemia .

key clinical messagesome acute complications are known during permanent pacemaker implantation such as pneumothorax , lead perforation , lead dislodgement , and hemorrhage . stsegment elevation in electrocardiogram during implantation is rare , but it might indicate critical complication like myocardial ischemia or ventricular perforation . physicians should pay attention about stsegment change during pacemaker implantation .

the rectus abdominis muscle ( ram ) flap is traditionally harvested by a longitudinal abdominal and rectus sheath incision with significant morbidity including hernia formation , pain , infection , unpleasing scar and morbidity with future laparotomies . several minimally invasive ( mis ) techniques have been proposed to minimise this morbidity which includes four reports of laparoscopic and robotic techniques . the pfannenstiel incision has been previously described once but required an incision through the entire length of the anterior rectus sheath . we report the first case of a ram flap harvest using an mis technique through a small pfannenstiel incision without longitudinal division of the anterior or posterior rectus sheaths . a previously healthy 52-year - old female was diagnosed with a partially obstructing rectal cancer 8 cm from the anal verge . the patient underwent neoadjuvant chemoradiation followed by a robotic ultra - low anterior resection with a stapled anastomosis and proximal diversion . at 2-month post - operatively , a 5 cm pfannenstiel incision was made and extended down to the anterior rectus sheath which was divided transversely . flaps were created superiorly and inferiorly separating the rectus muscle from the anterior fascia followed by division of the peritoneum in the midline to enter the abdomen . three 5-mm trocars were placed at the umbilicus , the right and left lower quadrants . after laparoscopic resection of the previous anastomosis and take down / repair of the fistula , a redo ultra - low anterior resection was performed with a transanal inter - sphincteric resection , coloanal pull - through and a hand - sewn anastomosis . the left rectus muscle was then harvested in a laparoscopic - assisted fashion through the pfannenstiel incision without longitudinal division of either anterior or posterior rectus sheaths [ figure 1 ] . the rectus muscle was divided superiorly at the level of the costal margin and inferiorly at the pubis while preserving the deep inferior epigastric vessels . the flap was then rotated and transposed between the rectum and the vagina and held by interrupted sutures . the total operative time was 4 h while the rectus harvest time was less than 45 min . the patient 's post - operative course was uneventful with minimal pain , and the patient was discharged home after 6 days . the patient continued to do well at 4-month follow - up without any evidence of fistula recurrence or hernia formation . depiction of port and incision sites with magnified view of the minimally invasive dissection planes for the flap harvest from the pfannenstiel incision previously described transabdominal mis approach for ram harvest have several benefits over the open method which include less post - operative pain , shorter hospital stay , faster recovery and improved cosmesis due to avoidance of a vertical skin incision . however , this approach still leads to vertical division of the posterior rectus sheath which continues to pose a risk of hernia formation and increased post - operative pain . our method is different from all previous reports of laparoscopic , robotic and pfannenstiel approaches as no longitudinal violation of either anterior or posterior rectus sheath was necessary which reduces or eliminates the risk of hernia formation . our harvest time was much shorter ( 45 min ) than previously reported mis harvest time ( 78125 min ) . longer operative time and a steep learning curve which have been cited as reasons for slow adaptation of these techniques can be overcome with our technique with a potential for widespread adaptation . other potential benefits include prevention of intra - abdominal adhesions and bypassing the need to address adhesions from previous surgeries as we remain extra - peritoneal . based on our early experience , this approach is feasible with optimal results and likely leads to less post - operative pain , shorter hospital stay and rapid recovery while maintaining the cosmetic benefit afforded by other mis techniques . moreover , it likely leads to potentially lower hernia rates with preservation of both anterior and posterior rectus sheaths . further prospective studies and long - term follow - up will be needed to better elucidate the advantages of this novel technique .

the rectus abdominis muscle ( ram ) is a workhorse flap to fill or repair abdominal defects . a drawback of an open ram harvest is donor site morbidity , and minimally invasive techniques for flap harvesting have been previously proposed but involve vertical division of the rectus fascia . we present a case of a 52-year - old woman with a recurrent rectovaginal fistula in a radiated field treated with a laparoscopic low anterior resection with simultaneous ram flap harvest utilising a single pfannenstiel incision . our novel modified laparoscopic - assisted ram harvest technique prevents longitudinal violation of the anterior and posterior rectus sheaths , thereby promoting a quick recovery , improved cosmesis and decreased post - operative morbidity .

even in current times of standardized operating procedures and evidence - based medicine , every icu has its little secrets and recipes . these recipes include the method of starting enteral nutrition and how to achieve appropriate bowel movements , as well as the prevention and treatment of fever . all these factors are considered important and eventually affect final patient outcome , but there are no good data on different methods of achievement . the paper by schiefecker and colleagues deals with one such topic : the treatment of fever after aneurysmal sub - arachnoid hemorrhage ( sah ) . current guidelines suggest aggressive treatment and active temperature management , with a low - to - moderate grade of evidence but high recommendation by expert opinion . whether lowering the fever burden is warranted in all instances or unrecognized side effects may counteract its benefit is so far unknown . perhaps only fever prevention , but not its treatment , is warranted . a similar situation would be anemia after aneurysmal sah , where both its occurrence and subsequent transfusion are independently linked to worse outcome and require further investigation . one way of lowering the fever burden in the neurological icu is using a continuous infusion of diclofenac , repeatedly proposed by an italian group and supported by a small randomized trial . schiefecker and colleagues used the very same drug , but applied it as a short - time infusion lasting 30 minutes . they observed good fever control , but also a decrease in blood pressure in most patients . this decrease in blood pressure led to a decline in brain tissue oxygenation ( pbto2 ) , in the majority of events below the hypoxemia threshold of 20 mmhg . the statistician rand wilcox once noted ' how many discoveries have been lost by ignoring modern statistical methods ? ' . although he dealt with robust regression on this occasion , the same could be said for the rare application of contemporary multivariate techniques in the medical community . schiefecker and colleagues use generalized estimating equations , a statistical modeling technique for time series data , to reveal the relationship between fever treatment , blood pressure , pbto2 and final outcome of the patients . time series data are messy and difficult to analyze , due to high rates of artifacts , various confounders and myriads of possible interactions . most of our knowledge on outcome after sah is based on single indicators , which are either present or absent . the list includes premorbid risk factors such as hypertension or smoking habits , the severity of the initial hemorrhage , the occurrence of delayed cerebral ischemia or medical complications . data on modifiable treatment options , with the exception of the clipping versus coiling issue , are rare . the results of the current analysis are very intriguing , presenting one of the few instances of analysis of real - world physiologic data , amenable for targeted change . we learn that treatment of fever after aneurysmal sah does not invariantly lead to low blood pressure , and if the latter is preserved the decline in pbto2 may be prevented . it is beyond the current analysis , however , to answer the question of whether - careful - treatment of fever is better than doing nothing : for this , the number of patients is too small and controls without intervention are lacking . the authors of the paper are conservative in their conclusions and recommend tight monitoring and awareness when treating fever with parenteral diclofenac in poor - grade sah patients . i would like to add that a careful look at other treatment modalities and their side effects on blood pressure and pbto2 may not hurt . studies like that of schiefecker and colleagues are a plea for the use of multimodal neuromonitoring and electronic data recording : to learn more about what is actually happening in the patients we are taking care of . without contemporary medical , statistical and data analysis technology , the insights schiefecker and colleagues provide would not have been possible . further use could be to validate or disprove other treatment concepts or monitoring tools - by the way , transcranial doppler , how are you doing ... today , after more than three decades of research and use ? the neurosurgical icu is a technology - savvy environment with a multitude of advanced tools , providing lots of yet - to - be revealed information . having a pbto2 monitor sitting at the bedside is one thing , but a further , necessary , step is online data acquisition of all relevant signals , including pbto2 , blood pressure , intracranial pressure , and so forth , together , on one screen , for online care and offline review . there are several options for doing this , from freeware to dedicated , specialized systems for recording and analysis . however , even high - priced software is a one - time expense ; a low cost compared with the reimbursement for a single case of severe sah , as well as the burden on society for one patient with a less than optimal treatment outcome . this is the base for future intelligent , event - driven and monitoring - driven studies trying to improve the final outcome of our patients .

fever is prevalent in the majority of patients after aneurysmal subarachnoid hemorrhage and is associated with worse outcome . treatment of fever is highly recommended , but with low - grade evidence in current guidelines . the analysis by schiefecker and colleagues reveals that the situation may be more complicated than at first glance and careless treatment may introduce further harm . the importance of this study lies in analyzing real - world multimodal neuromonitoring data , showing a pitfall in incautiously applied treatment paradigms .

the exaggerated valsalva induced by cough is classically described in patients suffering from chronic obstructive pulmonary disease . constrictive pericarditis ( called as the heart of stone in the bible ) and pericardial effusion can present with cough . however , it is extremely rare to have cough syncope in a case of pericardial effusion . we describe a case of tussive syncope in an elderly gentleman with pericardial effusion elucidating the basic pathophysiology of this interesting syncopal syndrome . 64-years - old male , chronic alcoholic since last 30 years and ex - smoker ( 9 pack years ) , hypertensive on tab amlodipine 2.5 mg od , presented with a 15 days history of cough associated with mucopurulent expectoration and 3 - 4 episodes per day of unconsciousness associated with cough since the last 2 days the syncopal episodes lasted for 30 seconds to 1 minute with complete recovery after syncope . during one of the syncopal event , he had a fall , which was associated with scalp injury and epistaxis . on admission to hospital , he was normotensive , with a pulse rate of 80/min , with a blood pressure of 110/70 mm of hg . on physical examination , he was found to have palpable right supraclavicular lymph node , which was firm to hard , mobile , and non - tender , and jvp was not raised . breath sounds were decreased in the lower right hemithorax . the hemoglobin level was 13.4 g / dl , leukocyte count of 11000/cmm . a high - resolution contrast - enhanced ct scan of the chest was performed , which showed a concentric thickening of tracheobronchial tree , which was more pronounced in the lower lobe of the right lung with distal consolidation and ground - glass opacities . fine needle aspiration of right supraclavicular lymph node showed metastatic non - small cell carcinoma . transthoracic echocardiography revealed moderate pericardial effusion with 2 cm of fluid behind the posterior wall of the left ventricle [ figure 1 ] , no diastolic collapse of the ventricles . the heart valves and left ventricular systolic function were normal , with an ejection fraction of 60% . echocardiographic picture of pericardial effusion an episode of cough syncope was witnessed in the icu , during which the systolic blood pressure showed a 60 mm drop , along with tachycardia . after recovery from this episode , an echocardiogram was repeated , which showed evidence of tamponade in the form of early diastolic collapse of right ventricle , late diastolic right atrial inversion with abnormal movement of the septum when the patient coughed , which disappeared when he stopped coughing . pericardiocentesis was performed , 500 ml of hemorrhagic fluid was drained , and a pigtail catheter was placed for further drainage of fluid . after drainage of the pericardial fluid , the patient did not experience any further episodes of cough syncope . the pericardial fluid too showed numerous mesothelial cells and clusters of atypical cells , which were identified as metastatic non - small cell carcinoma . cough syncope is well recognized but uncommon phenomenon where increased intra - thoracic pressure leads to decreased cardiac output , increased intracranial pressure , cardiac arrhythmias , stimulation of a hypersensitive carotid sinus , neural reflex - mediated hypotension - bradycardia , laryngospasm , and left ventricular outflow obstruction leading to decreased cerebral blood flow . these patients generally have tachycardia , distended neck veins , muffled heart sounds , and pulsus paradoxus . the characteristic feature seen on echocardiography is the invagination of the right ventricular free wall in early diastole with further invagination of the right atrial wall at end diastole as pericardial pressure prevents adequate diastolic filling of the cardiac chambers . our patient did not exhibit any of these signs , except during bouts of coughing . pre - tamponade state where the amount of pericardial fluid was just below the limit of pericardial reserve , beyond which cardiac output gets compromised . the true filling pressure of the heart is the transmural pressure , which is the difference between the intracardiac pressure and the external pressure , which is the sum of the pericardial pressure and the intrathoracic pressure . in most patients with syncope , occurrence of cough syncope in our patient is probably due to cardiac tamponade , which manifested only during bouts of cough where raised intrathoracic pressure resulted in cardiac tamponade . a review of literature revealed a few cases of cough syncope with pericardial diseases like constrictive pericarditis[59 ] and cardiac tamponade . in patients with large pericardial effusions , who do not have signs of cardiac tamponade , it should be appreciated that cardiac output may drop drastically during bouts of cough , sometimes leading to syncope , which responds readily to drainage of the pericardial fluid . our case is the second one and the first one from india of the rare case of cough - induced syncope in a case of pericardial effusion with complete cessation of symptoms post- pericardiocentesis . thus , we believe that any case of cough - induced syncope needs a low threshold for investigations and a strong consideration to pericardial effusion , which may require drainage though the patient does not show tell - tale signs of cardiac tamponade .

cough syncope is classically described in patients with chronic obstructive pulmonary disease , and it is quite rare to find a treatable condition for the same . however , it is extremely rare to have cough syncope due to pericardial effusion . we present a case of pericardial effusion who presented to the intensive care with cough syncope .

a previously healthy 6-year - old boy visited samsung medical center with complaints of dyspnea and a barking cough lasting for 3 days . chest computed tomography demonstrated a well - defined posterior mediastinal mass measuring 4 cm , which was suspected to be a neural foraminal extension to the thoracic spine ( t3t4 ) . magnetic resonance imaging was conducted for further evaluation ; it showed a right upper paravertebral enhancing mass with an adjacent neural foraminal extension to the t2t5 spine ( fig . the mass was in the right posterior mediastinum , was located at the t2t5 level of the spine , and did not extend to the neural foramen . it was resected by electrocautery . the sympathetic chain at the t2 level was inevitably resected as part of the complete resection of the mediastinal tumor during the operation , because the tumor originated from this sympathetic chain . the intraoperative course was uneventful , with a stable hemodynamic status throughout the surgery . after the patient was sent to the post - anesthesia recovery unit , a sharp midline facial demarcation was observed , and the left face , neck , and chest ( contralateral to the operation site ) became flushed and warm ( fig . 2 ) . these findings were noted to increase in intensity when the patient cried . in contrast , the right face , neck , and chest ( ipsilateral to the operation site ) were pale and cool and did not change in color when the patient cried . a neurologic examination including that of the cranial nerves was normal , and miosis and ptosis were absent . the symptoms , including the color and the warmness of the face , started to show minimal improvement within an hour and completely resolved without any treatment 3 hours after surgery . the permanent pathologic findings revealed that the resected tumor was a ganglioneuroma . during follow - up on postoperative day 30 , there was no sign of color change on his face , neck , or chest . it is a rare disorder of the autonomic nervous system characterized by asymmetric facial flushing and sweating . the site of sympathetic nerve injury is known to be associated with normal face color . excessive flushing and sweating on the unaffected side of the face are recognized as a compensatory overreaction of vasodilatation for thermoregulation . the first neuron ( central ) originates from the hypothalamus and synapses onto the second neuron ( preganglionic ) in the lateral horn of the spinal cord . the second neuron synapses onto the third neuron ( postganglionic ) in the superior cervical ganglion . most of the vasomotor and sudomotor neural chain that innervates the face originates in t2 and t3 and connects to the superior cervical ganglion . the postganglionic vasomotor and sudomotor neural chains innervating the medial forehead and the nose travel with the internal carotid artery ; the other facial areas are regulated by the postganglionic neural fiber traveling with the external carotid artery . in the present case , histology of the resected mass revealed a ganglioneuroma , which is a tumor of the sympathetic nervous system , arising from neural crest cells . the sympathetic chain at the t2 level was inevitably resected to completely remove the mediastinal tumor during the operation , as the tumor originated from this sympathetic chain . the patient suffered asymmetric flushing of the left face ; his symptoms disappeared after 3 hours without complications . approximately one - fourth of the patients with harlequin syndrome have secondary harlequin syndrome or iatrogenic causes . secondary harlequin syndrome is caused by structural lesions and may be treated by surgical resection . according to a literature review the most common organic lesions are neurogenic tumors that compress the sympathetic trunk , such as mediastinal neurinoma and cervical syrinx . three patients underwent resection of thoracic neurogenic tumors . among them , 2 patients recovered from their symptoms , but the third patient s symptoms did not disappear postoperatively . an increasing number of cases of iatrogenic harlequin syndrome have been reported . thus far , 10 cases have been reported in the literature : following a paravertebral thoracic block ( 5 patients ) , resection of a neck mass ( 3 patients ) , jugular vein catheterization ( 1 patient ) , thoracic sympathectomy ( 1 patient ) , and lung resection ( 1 patient ) . however , 2 cases , which followed thoracoscopic sympathectomy and thoracoscopic wedge resection of the lung , had long - term sequelae according to the literature . the patient s concerns are often relieved by explaining the pathophysiology and the benign nature of the condition . if the symptoms are not tolerable , a contralateral sympathectomy or a stellate ganglion block could be considered for symptom relief . this is an extremely rare case report of iatrogenic harlequin syndrome that developed following thoracic surgery . we hope that this report will make thoracic surgeons aware of this rare syndrome as a possible complication after thoracic mediastinal mass excision .

harlequin syndrome is a rare disorder of the sympathetic nervous system characterized by unilateral facial flushing and sweating . although its etiology is unknown , this syndrome appears to be a dysfunction of the autonomic nervous system . to the best of our knowledge , thus far , very few reports on perioperative harlequin syndrome after thoracic surgery have been published in the thoracic surgical literature . here , we present the case of a 6-year - old patient who developed this unusual syndrome following the resection of a posterior mediastinal mass .

treacher collins syndrome ( tcs ) otherwise known as mandibulofacial dysostosis is a congenital disorder of craniofacial development that occurs with an incidence of 1 in 50,000 live births . early descriptions were attributed to berry ( 1889 ) , treacher collins ( 1900 ) and franceschetti and klein ( 1949 ) and hence the names berry 's syndrome and franceschetti zwahlen klein syndrome . from the structures affected and from studies in mice exposed to teratogenic cis or trans - retinoic acid , it has been deducted that the disease results from interference in the development of the first and second branchial arches ( gorlin et al . antimongoloid palpebral fissures , malar hypoplasia , mandibular hypoplasia , malformation of auricular pinna , coloboma of the lower eyelids , conductive deafness , and cleft palate are among the most frequent clinical presentations . a 10-year - old girl reported to the department of pediatric dentistry with the chief complaint of decayed teeth . examination revealed downward slanting of eyes , depressed zygomatic arches , sunken cheekbones , deformed external ears , coloboma of lower eyelid and retruded chin giving a bird - like appearance . clinical features of treacher collins syndrome mouth opening was limited to 18 mm and the path of closure was deviated to the right side . intraoral examination revealed class iii molar relationship with anterior open bite , crowding of maxillary and mandibular anterior teeth , high arched palate with submucosal cleft and deep dentinal caries in relation to teeth 75 and 36 [ figure 1 ] . low birth weight , frequent episodes of fever during childhood and delayed speech were elicited from a detailed case history . orthopantamogram showed underdeveloped condylar and coronoid processes , hypoplastic zygomatic arches and short rami [ figure 2 ] . short rami and anterior crowding functional abnormalities included difficulties in swallowing and hearing and impaired vision . a subsequent ent consultation revealed absence of middle ear on the right side and conductive hearing loss . the child 's father also had similar phenotypic features like antimongoloid palpebral fissures ; deficient malar prominence and anterior open bite [ figures 3 and 4 ] . father with treacher collins syndrome , but in milder form based on phenotypic and radiographic findings the diagnosis of tcs was made . the cephalometric analysis showed reduced anterior cranial base length , decreased the ramal height and mandibular length . extraction of 75 , apexification of 36 and distraction osteogenesis followed by comprehensive orthodontic therapy were planned . it is caused by mutation of the tcof1 gene , which exhibit linkage to human chromosome 5q32 locus . treacle that may serve as a link between rrna gene transcription and pre - rrna processing . detected mutations in genes encoding subunits of rna polymerases i and iii in treacher collins patients . more than 60% of tcs cases have no family history and arise , as a result of de novo mutation . in 40% the present case has shown the positive family history suggesting familial mutation transfer in tcof1 gene , which is seen in 40% of cases . diagnostic features of tcs include abnormalities in eyes , ears , nose / mouth , and facial bone . vast majority [ table 1 ] of these features were present in this case . based on these clinical features five clinical forms of tcs have been identified by franceshetti and klein . they are the complete form ( having all known features ) , an incomplete form ( presenting with less severe ear , eye , zygoma , and mandibular abnormalities ) , the abortive form ( only the lower lid pseudo coloboma and zygoma hypoplasia are present ) , the unilateral form ( anomalies limited to only one side of the face ) and the atypical form ( combined with other abnormalities not usually part of this syndrome ) . in our case , kasat and baldawa in their article on tcs describes the obligatory features of tcs given by axelsson et al . in 1963 which include antimongoloid palpebral fissures , anomaly of the lower eyelid , hypoplasia of malar bones and hypoplasia of mandible . differential diagnosis of tcs includes acrofacial dysostosis ( nager and miller syndrome ) and oculoauriculovertebral spectrum ( hemifacial microsomia and goldenhar syndrome ) . in addition , thumbs may be hypoplastic , aplastic or duplicated , and the radius and ulna may be fused . miller syndrome also has features in common with tcs , with the additional diagnostic feature of ectropion or out turning of the lower lids . the cleft lip , with or without cleft palate is more common than in tcs . goldenhar syndrome shows vertebral abnormalities , epibulbar dermoids and facial deformities . since this case had all the features of tcs and no additional features like hypoplastic thumb , fusion of radius and ulna , ectropion of lower lids , cleft lip , vertebral anomalies , etc . many children require a multidisciplinary approach involving a craniofacial team , comprising of a pediatric otolaryngologist , audiologist , plastic surgeon , geneticist , psychologist , dental surgeons , and other healthcare professionals . a well - planned treatment can produce excellent results for complete restoration of the form and function of the patient . when confirmed with tcs this would in turn help to build self - esteem in a child , thereby enabling him to lead a normal life .

treacher collins syndrome ( tcs ) or franceschetti syndrome is an autosomal dominant disorder of craniofacial development with variable phenotypic expression . it presents with characteristic facial appearance enabling it to be easily recognizable . a case of a 10-year - old girl having tcs is briefly described in this article . a review of the etiology , clinical features , differential diagnosis , and treatment options are also discussed .

spontaneous cervical hemorrhage may occur after trauma to the cervical vertebrae , infection , injury of the great vessels , violent head movement , cardiac catheterization or catheterization for intracranial angiography , foreign body ingestion , a parathyroid adenoma and etc . cervical hematoma presents as acute painful swelling and bruising of neck , and this is associated with dyspnea , hoarseness and dysphagia caused by compression on the surrounding organs such as the trachea , esophagus and recurrent laryngeal nerve ( 2 , 4 , 5 ) . parathyroid adenomas usually manifest symptoms related to hypercalcemia such as urinary stone , bone fracture , dehydration and so on ( 1 , 2 , 6 ) . it may be encountered as asymptomatic hypercalcemia , but as a very rare situation , it may present as a massive cervical hematoma . we report an unusual case of spontaneous cervical hematoma arising from the parathyroid adenoma with normal parathyroid hormone ( pth ) level . . she also suffered from hoarseness , headache on the right occipital area and pain radiating to her right shoulder and forearm . the patient denied any symptoms of upper respiratory infection or pharyngitis , and she had no previous history of drug use , medical procedure , trauma or foreign body ingestion . on physical examination , vital signs were stable and there was diffuse , ecchymotic swelling and tenderness , but no sensation of heat or erythema in the neck . , there was no evidence of acute infection ( white blood cells : 7,230/l , c - reactive protein : 0.23 mg / dl ) and coagulopathy ( prothrombin time : 10.5 sec , active partial thromboplastin time : 25.8 sec , bleeding time : 3 min ) . ct scanning of the neck showed an ill defined nonenhancing soft tissue density between the right carotid space and thyroid gland ( fig . under the impression of hematoma , sonography - guided aspiration was performed and 10 cc of old blood was aspirated . after that , a 2 cm sized heterogenous , echogenic mass was revealed in the right infrathyroid region ( fig . 1b ) . to rule out parathyroid abnormality , we performed further blood chemical assessment of the parathyroid function , but it proved to be within the normal limits ( calcium : 8.2 mg / dl , phosphate : 2.8 mg / dl , pth : 41.4 pg / ml ) . the specific cause of hematoma was not identified and conservative management with intermittent sono - guided aspiration was performed without specific events . after 3 weeks , her neck swelling and bruise were resolved and a follow - up ct scan revealed a peripheral rim - enhancing cystic lesion in the right tracheoesophageal groove ( fig . an organized hematoma and 3 cm sized , dark brown colored cystic mass was found in the right tracheoesophageal groove and posteroinferior aspect of the right thyroid gland , compressing the right recurrent laryngeal nerve ( fig . the histologic examination showed that the mass was mainly composed of fairly uniform , polygonal chief cells with small , centrally placed nuclei ; this was all compatible with parathyroid adenoma ( fig . postoperative course was uneventful and vocal cord paresis was resolved during one month after the surgery . spontaneous hemorrhage of the parathyroid gland may occur due to parathyroid adenoma , parathyroid hyperplasia or parathyroid cyst . the hemorrhage may be localized within the parathyroid gland , but it is often presented as extracapsular hemorrhage . the clinical symptoms depend on the amount and the location of hematoma , and various clinical presentations associated with the change in the pth level may also be shown ( 7 ) . asymptomatic hyperparathyroidism does not require surgical treatment , however , careful follow - up is necessary for symptoms that require emergency treatment . cervical hematoma from parathyroid adenoma requires surgical excision and evacuation of the hematoma if it results in airway compromise or hypercalcemic crisis ( 3 ) . despite typical pathologic findings of parathyroid adenoma , the pth was within normal limits ( 1 , 2 , 6 , 8) second , the path of pth secretion may be transformed into the lumen of the cyst instead of the blood stream . third , the pressure caused by the hematoma may interfere with the blood flow around the adenoma ( 7 , 9 , 10 ) . however , we did not verify if there was necrotic change of the parathyroid adenoma or an increased pth level in the cyst in this case . in conclusion , spontaneous cervical hemorrhage of a parathyroid adenoma may result in airway obstruction itself and may need the differential diagnosis of extracapsular hemorrhage of a cervical lesion ( 3 , 11 ) . assessment of the calcium , phosphorus and intact pth blood levels must be included in the diagnostic work up for spontaneous cervical hemorrhage from an unknown origin ( 2 ) .

parathyroid adenoma usually manifests with symptoms related to hypercalcemia , such as urinary stone and bone fracture . it may also present with asymptomatic hypercalcemia . however , spontaneous cervical hematoma may occur very rarely as a result of extracapsular hemorrhage of a cervical parathyroid adenoma causing acute painful cervical swelling , bruising , dyspnea , hoarseness and dysphagia . we report a 44-year - old woman who manifested as a spontaneous cervical hematoma without any clinical evidence of hyperparathyroidism .

enterocutaneous fistula formation following bowel resection is not uncommon ; however , fistula formation between the bowel and remaining rectal stump is rarely reported . in addition , the occurrence of a fistula between a false aneurysm and a rectal stump is similarly a rare phenomenon . an 84-year - old female was admitted to the hospital from the clinic complaining of dysuria and increased urinary frequency following an emergency laparotomy and hartmann 's procedure for a perforated diverticulum 3 months previously . her initial postoperative recovery was complicated by a pelvic collection and the development of hydronephrosis of the left kidney . unfortunately , 2 days prior to her clinic appointment , she was found to have a bilateral femoral deep vein thrombosis for which she was commenced on warfarin . after 2 days of treatment for a urinary tract infection and continuation of her warfarin , the patient complained of large fresh rectal bleed and haematuria . her inr was found to be high ; thus , warfarin was withheld and reversed with vitamin k , and instead an inferior vena cava filter was inserted . a ct angiogram was arranged which identified a large false aneurysm of the left internal iliac artery ( fig . the patient was transferred to the local vascular centre for endovascular coiling , which was successful . figure 1:a ct scan of small bowel fistula to the anal pouch . a ct scan of small bowel fistula to the anal pouch . following discharge , the patient re - presented to the clinic 2 years later complaining of increasing discharge from her rectal stump with a simultaneous decrease in colostomy output . a sigmoidoscopy demonstrated two fistulae within the rectal stump , and a ct confirmed a communication between the stump and proximal small bowel ( fig . 2 ) . the formation of a ureteric - arterio - enteric fistula is extremely rare and when reported has a poor prognosis . a similar case to the above was treated with open surgery and ligation of the iliac artery requiring a bypass graft , which despite a prolonged recovery period resulted in discharge from the hospital with no vascular sequelae . enterocutaneous fistulae are associated with considerable morbidity and mortality with some papers suggesting a mortality of 633% from complications such as sepsis ; however , enterocolonic fistulae are less well known . less commonly cases have been reported following radiotherapy , lymphoma and localized trauma ; however , few follow surgical intervention [ 4 , 5 ] . without intervention , there have been very few reported cases of fistula formation between small bowel and a rectal stump following a hartmann 's procedure . one case reported in japan following resection of adenocarcinoma of the bowel was treated surgically and found to be a recurrence . one paper reported a 30% spontaneous closure rate of small bowel fistula 's following a 4-week period of total parenteral nutrition and bowel rest advocating surgical management if unsuccessful ; however , this included few enterocolonic fistulae . in the present case , it seems that pelvic sepsis and inflammation led to both the formation of a false aneurysm and anenterocolonic fistulae . this patient 's residual symptoms are occasionally faecal incontinence and decreased stoma output , both of which she can manage . while the overall prognosis remains poor in such circumstances , successful conservative management is possible .

we present a case of an 87-year - old female who presented 3 months following an emergency hartmann 's procedure for perforated diverticulum with per rectum bleed . she was found to have a false aneurysm in the iliac artery communicating with her rectal stump . this was treated successfully with intravascular coiling ; however , she re - presented 2 years later complaining of passing stool per rectum and decreased colostomy output . she was found to have communication between two enterorectal fistulae with the distal segment of the remaining bowel .

ovarian vein syndrome is defined as ureteric obstruction caused by dilated ovarian vein with or without thrombosis and is a controversial and rare diagnosis . all cases reported so far are in adults where an abnormal gonadal vein compressed the ureter and caused obstructive uropathy mostly on the right side and lower ureter . here we report the ovarian vein syndrome caused by an arteriovenous malformation affecting the left upper ureter in an 8-year - old child . an 8-year - old girl presented with recurrent attacks of left flank pain of 6 months duration . intravenous pyelography ( ivp ) showed hydronephrosis with dilated left upper ureter with sudden tapering and normal lower ureter below the area of tapering [ figure 1 ] . she was diagnosed to have left upper ureteric obstruction and was taken up for laparoscopic exploration . intravenous urography showing a ureter - sudden narrowing and tapering of the upper ureter with normal distal ureter during surgery , we found that the upper ureter near the site of obstruction was surrounded by a sheet of vessels [ figure 2 ] . the gonadal vein instead of crossing from the lateral to medial side of the ureter , made a u shaped loop laterally , attached to the ureter at the apex of u and was seen draining into an abnormally placed lumbar vein with tributaries coming from above and below the confluence . the part of gonadal vein attached to the ureter was thrombosed with turbulent flow seen near the junction of gonadal vein with the lumbar vein . a small artery was seen entering the vein above the site of clot and causing turbulent flow in the vein . all the vessels were ligated proximally and distally laparoscopically and the parts of vessels attached to ureter were removed . the dilated gonadal vein attached to the left ureter , ureteroureterostomy was not done a line diagram is produced here for understanding the anomaly [ figure 3 ] . intraoperative pictures showing vascular anomaly surrounding the upper ureter and its ligation ( a ) ureter . ( h ) arterial communication ligated line diagram showing the abnormal course of the gonadal vein and its communication with the lumbar vein ( a ) inferior vena cava . ( k ) ureter postoperatively , doppler study was done to uncover major vascular anomalies and was found to be normal . subsequently the patient continued to have abdominal pain again and a repeat ivp at 2 months showed similar obstruction as in the past . the patient was operated again and the obstructing segment was excised and ureteroureterostomy was performed . ultrasound done after 3 months showed complete resolution of hydronephrosis and the patient remained asymptomatic . clarke described ovarian vein syndrome for the first time in 1964 . following initial controversy , all patients are multipara , leading to the hypothesis that the dilatation of the ovarian vein is due to recurrent obstruction by the gravid uterus . however , as this condition is rare , it is always a diagnosis of exclusion . the patients usually present with recurrent abdominal , flank or pelvic pain , which increases in the lying down posture , mainly in the pre - menstrual period . the diagnosis is confirmed by imaging studies - ultrasound , doppler , computed tomography and magnetic resonance imaging . the second one is due to puerperal ovarian vein thrombophlebitis , which causes perivenous phlegmon formation and resultant periureteritis . the patients present with nonspecific abdominal pain and fever 2 - 3 days after delivery . the majority of patients respond to conservative measures with antibiotics , although some patients may require temporary dj stenting or surgical ureterolysis with ligation of the ovarian vein . this is the first case in a child , and is a true vascular anomaly . the abnormally placed gonadal vein was thrombosed and the resultant collaterals communicated with a branch of gonadal artery and caused this anomaly . the case also highlights the need for excising the obstructed segment of ureter along with ureterolysis in cases of complex vascular obstruction of upper ureter .

ovarian vein syndrome is defined as obstructive uropathy caused by dilated ovarian vein with or without thrombosis . this is seen in the puerperal period as an acute condition with abdominal pain and fever and in multipara women with chronic recurrent abdominal pain . we report an ovarian vein syndrome caused by a true vascular anomaly in an 8-year - old child . laparoscopic ureterolysis was performed with ligation of the arteriovenous malformation during the first operation . as ureterolysis was not effective , the patient was reoperated and ureteroureterostomy was performed after 3 months , which emphasizes the importance of removing the diseased segment even if it looks normal .

the question of whether thyroid hormone supplementation should be provided to critically ill patients without a known history of thyroid disease is not a new debate . analysis of such patients led to the recognition of the euthyroid sick syndrome , which is characterized by low normal thyroxine ( t4 ) levels , low normal 3,5,3'-tri - iodothyronine ( t3 ) levels , variable thyroid - stimulating hormone ( tsh ) levels and elevated 3,3',5'-tri - iodothyronine ( reverse t3 ; rt3 ) levels . the physiologic changes that lead to these alterations are the body 's attempt to conserve metabolism during illness . t4 is normally metabolized through sequential deiodination to t3 then to 3,3'-di - iodothyronine ( t2 ) , which is then rapidly degraded to monoiodothyronines and thyronine . normally , about 40% of secreted t4 is monodeiodinated in the 5 ' position to yield t3 , and a similar fraction is monodeiodinated in the 5 position to yield rt3 . the body responds to illness by shunting t4 disproportionately towards rt3 , which can not be converted to the biologically active form of t3 but only deiodinated to t2 . although this process makes sense teleologically as a form of conservation of energy , these authors raise the question of whether this could actually impair the body 's response to the acute illness , namely the myocardial ischemia . unfortunately , they initially try to create an argument that the acute episode was associated with relative hypotension to the hypothalamic pituitary axis leading to a ' low t3 syndrome ' , although they are not able to offer any proof that such ischemia occurs in their cohort . they do mention the more likely etiology , which is cytokine - mediated suppression of t3 production . cytokines , including il-6 , il-1 , and tumor necrosis factor- , contribute to the suppression of the 5 ' deiodinase , thus shunting t4 into rt3 . this raises an interesting question of whether the level of tsh , either in itself or in how it changes over the illness , has any prognostic information . critically ill patients with the euthyroid sick syndrome can have a very low tsh level or it can be as high as 20 iu / ml . it is very possible that the higher tsh level represents recovery manifested as an asynchronous return of the hypothalamic pituitary and thyroid axes to normal . thus , as they recover from the acute illness they seem , transiently , to have a form of primary hypothyroidism . because one does not know what phase of recovery a patient has reached , we have focused on maintaining the t4 , which is the ' storage form ' of the hormone , in the normal range . this study of patients with acute cardiac illness is of interest because the authors are proposing that as we are able to resuscitate many of these acutely ill patients they will then have increased t4 requirements , and the ' low t3 syndrome ' might actually hinder our efforts . if this is a true ' low t3 syndrome ' due to hypothalamic pituitary ischemia , combination t4/t3 therapy might be of value during the period of decreased production . if it were truly a simple deficit in t3 production , reverse t3 should also be low . if reverse t3 is high , then what these authors are describing is truly the euthyroid sick syndrome . although the traditional approach is to not treat the euthyroid sick syndrome with levothyroxine because it will all be shunted into rt3 , the authors ask whether we should consider treating cardiac patients who have the euthyroid sick syndrome with t3 ( and not t4 ) to facilitate cardiac recovery . there is now evidence that the provision of t3 improves hemodynamic parameters after open - heart surgery [ 6 - 8 ] . studies in animals have shown that t3 administration after an acute myocardial infarction is associated with a better left ventricular ejection fraction , which is very thought - provoking because left ventricular function is an important indicator of outcome after an acute myocardial infarction . although there will be resistance from the endocrinology community to trials of t3 therapy in acutely ill patients , one must carefully consider whether it might have utility in a specific subset of patients as these authors propose who have an acute myocardial event . for that reason , this issue might need to be considered seriously in a prospective randomized trial . il = interleukin ; rt3 = 3,3',5'-tri - iodothyronine ( reverse t3 ) ; t3 = 3,3',5-tri - iodothyronine ; t4 = thyroxine ; tsh = thyroid - stimulating hormone .

the presence of a ' low t3 syndrome ' in the setting of nonthyroidal illness has long been recognized as the ' euthyroid sick syndrome ' , with the recommendation to observe and not treat with thyroid hormone replacement therapy . that approach has recently been challenged in the setting of critical cardiac illness . research demonstrating that thyroid hormone therapy may improve hemodynamic parameters has rekindled interest in the use of thyroid hormone therapy in critical illness . continued improvements in survival after critical cardiac illness provokes the question of whether thyroid hormone therapy would provide further incremental benefit .

a 36-year - old woman presented with a 12 6 cm ulcer on her right leg ( fig . 1 ) . she stated that it had been present for 8 years and denied any history of malignancy , ulcerative colitis or rheumatic disease . biopsy was diagnostic of pyoderma gangrenosum ( pg ) and prednisone 40 mg daily was initiated . due to incomplete response , she required several steroid - sparing agents , including dapsone , methotrexate , cyclosporine , mycophenolate , infliximab , adalimumab and azathioprine . despite this , the ulcers persisted and the prednisone could not be tapered below 20 mg daily . intravenous immunoglobulin ( ivig ) at 2 g / kg monthly was initiated with nearly complete improvement ( fig . the prednisone was tapered to 5 mg daily and ivig was tapered to 2 g / kg every 12 weeks . she has since done well on azathioprine and low - dose prednisone and has had no recurrent lesions . pg has an annual incidence of 310 per million persons , most commonly presents between 20 and 50 years of age and is more common in women . it is characterized by a neutrophilic infiltrate that is believed to be due to dysregulation of neutrophil function and altered innate immune responses . it frequently presents as painful ulcers that often follow surgery or trauma and is commonly misdiagnosed as infectious or ischemic lesions . initial therapy consists of corticosteroids , although steroid - sparing agents have been used , including dapsone , minocycline , methotrexate , cyclosporine , mycophenolate and tnf inhibitors . we reviewed 20 cases of ivig therapy in pg that are described in table 1 and table 2 . table 1 describes 13 cases that were treated with ivig 2 g / kg ( except for two in whom the dose was 1.5 and 2.5 g / kg , respectively ) . 12 of these achieved complete or nearly complete remission ; 2 had disease recurrence that required repeated courses of ivig . table 2 describes 7 patients treated with lower - dose ivig ( 0.5 g / kg ) . all had major or complete response , though all required continued corticosteroids , with 4 requiring additional immunosuppressive therapy . based on this case and our review of the literature , we believe that ivig is a useful therapeutic option in refractory pg and can be considered in cases of resistance to or intolerance of standard immunomodulatory therapy .

pyoderma gangrenosum is a neutrophilic dermatosis that occurs both as a primary disorder as well as secondary to an underlying disease . due to its low prevalence there are limited data on therapeutics , particularly in refractory cases . here , we discuss a case successfully managed with intravenous immunoglobulin and review the supporting literature .

a. xylosoxidans inhabits aquatic environments ubiquitously and it has been implicated in outbreaks related to contaminated fluids in the hospital . it has also been recovered from various human body fluids , including respiratory tract secretions and peritoneal fluid . although a broad range of infectious etiologies due to a. xylosoxidans have been described in the literature primarily in immunocompromised hosts , it has rarely been reported as a cause of osteomyelitis . a 39-year - old male with a longstanding history of diabetes mellitus was in his usual status until 7 days prior to presentation when he developed severe pain in his left great toe . the pain was described as throbbing , progressive in nature , and associated with subjective fevers and malaise . he had noticed ulceration with an open wound on the left great toe 3 months before . the temperature was 102.1 f , blood pressure 91/58 mm hg , pulse 134 beats per minute , respirations 19 breaths per minute and oxygen saturation 98% on room air . there was deep ulceration with an open wound on his great toe with surrounding erythema and edema . laboratory studies revealed a white blood cell count of 19,100 cells / mm with 68% polymorphonuclear leukocytes , hemoglobin of 12.3 g / dl , and platelets of 281,000 per cubic millimeter . mmol / l , potassium 4.3 mmol / l , bicarbonate 22 meq / l , urea nitrogen 20 mg / dl , creatinine 1.2 mg / dl , and lactic acid 5.1 mg / dl . a magnetic resonance imaging ( mri ) study disclosed extensive bony destruction of his left great toe with surrounding soft tissue edema , findings compatible with osteomyelitis . the pathological examination of the infected bone revealed multiple fragments of dead bone with infiltrating plasma cells consistent with chronic osteomyelitis . the initial empiric antimicrobial therapy with vancomycin was changed to piperacillin / tazobactam based on the antimicrobial susceptibility results . there were no signs of recurrence on a follow - up mri study 6 weeks later . a. xylosoxidans was first isolated from ear discharge of patients with chronic otitis media . the organism has been further characterized thereafter . a. xylosoxidans is an aerobic , nonfermenting gram - negative rod with distinctive biochemical characteristics . a. xylosoxidans has the ability to survive in aqueous environments and as such , it can be a cause of nosocomial outbreaks especially when there is a breakdown of infectious control techniques . in fact , since it was first described in 1971 , it has been associated with numerous outbreaks due to contaminated fluids as well as other invasive nosocomial infections , such as catheter - related bacteremia , . except in nosocomial outbreaks , immunocompromised individuals are particularly at increased risk for developing severe infection due to a. xylosoxidans . in a review of 77 cases of bacteremia due to a. xylosoxidans by duggan et al . although bacteremia is the most frequently reported infection associated with a. xylosoxidans , a wide variety of other clinical manifestations have also been reported , including peritonitis , pneumonia , and prosthetic joint infection . in 1991 , osteomyelitis due to a. xylosoxidans was descried in a child who developed a plantar puncture wound . since then , only a small number of case reports of a. xylosoxidans osteomyelitis have been described in the literature , . our patient developed osteomyelitis potentially in direct contact with a. xylosoxidans in the presence of impaired defense system due to his longstanding uncontrolled diabetes mellitus . a. xylosoxidans is resistant to multiple antibiotics , including cefoxitin , ceftriaxone , cefotaxime , aztreonam , and aminoglycosides . it is usually susceptible to trimethoprim - sulfamethoxazole , antipseudomonal penicillins , ceftazidime , cefoperazone , and carbapenems , . we reported a case of osteomyelitis caused by a. xylosoxidans in a patient with diabetes mellitus . a. xylosoxidans is ubiquitous in aquatic environments , thus it has caused numerous nosocomial outbreaks due to contaminated fluids . it has also been associated with a wide array of infectious etiologies primarily in immunocompromised individuals . additionally , multi - drug resistance is not rare for this bacterium . heightened awareness of its pathogenic potential is paramount , though osteomyelitis caused by a. xylosoxidans is not a common clinical entity among the broad disease spectrum of a. xylosoxidans . written informed consent was obtained from the patient for publication of this case report and accompanying images . a copy of the written consent is available for review by the editor - in - chief of this journal on request .

achromobacter xylosoxidans is an aerobic , nonfermenting gram - negative rod and described as a waterborne bacterium since it habits aquatic environments ubiquitously . it has frequently been isolated from aquatic surroundings in the hospital and from various human body sites . although occasionally considered a non - pathogen , a. xylosoxidans has been associated with outbreaks of nosocomial infection due to contaminated fluids . moreover , a wide variety of infectious etiologies due to a. xylosoxidans has been reported primarily in immunocompromised individuals . heightened awareness of this bacterium and associated clinical importance is warranted for clinicians since its broad disease spectrum in humans and frequent multi - drug resistance may result in an increased mortality rate . in this report , we describe a case of osteomyelitis caused by a. xylosoxidans in a patient with a history of diabetes mellitus .

the thionamide group of drug such as propylthiouracil is generally first - line drug in the therapy of hyperthyroidism . the most common mild side effects are transient granulocytopenia , pruritus , urticaria , generalized maculopapular and papularpurpuric rashes , arthralgia , myalgia , and drug - induced fever . the most common severe side effects are agranulocytosis , thrombocytopenia , aplastic anemia , hepatitis , cholestatic jaundice , splenomegaly , lupus - like syndrome , polyarteritisnodosa , vasculitis , pancreatitis , nephrotic syndrome and disseminated intravascular coagulation . 48 years old female patient was admitted to our endocrinology clinic with the complaints of palpitations , sweating , heat intolerance andskin lesions . we learned that hyperthyroidism was detected eightyears ago , she used antithyroid drug ( patient can not remember the name of drug ) for twoyears , thyroidectomy was recommended and the patient did not continue her follow - ups because of fear of the surgery , she did not receive any antithyroid treatment for sixyears . finally she referred to the internal medicine clinic andpropylthiouracil 50 mg ( 3 1 ) therapy started . large numbers of necrotic - looking vasculitic skin lesions were revealed on her right ear , chest , bilateral lower extremity and abdomen [ figure 1 ] . wbc : 3.7 k / ul , neu : 1.3 k / ul , hgb : 12.1 g / dl , plt : 251 k / ul , tsh : 0.0059 miu / ml , t4 : 13.97 pmol / l , t3 : 5.79 pmol / l , sedimentation : 45 mm / h , crp : 109.5 mg / l was detected on his blood analysis . ana ( - ) , p - anca ( + ) , c - anca ( - ) were detected . thyroid gland size and its blood supply were increased and no nodule formation was observed in the doppler ultrasound . in the light of clinical and laboratory findings she was diagnosed leukocytoclasticvasculitis caused by ptu , with positive p - anca . we report a case of leukocytoclasticvasculitis caused by ptu , with positive p - anca . ptu is well known to cause vasculitisassociated with positive anca titres , and this typically occurs late in the treatment . ptu induced vasculitis has been associated with p - anca and laboratory findings of our case was also compatible with this diagnosis . the cause of ptu - induced vasculitis is unknown origin , although immune complex deposition is considered to be the pathogenetic mechanism of hypersensitive vasculitis . however , ptu has been shown to accumulate p - anca , which subsequently promotes antibody formation by polyclonal activation of b lymphocytes in susceptible individuals . the most common skin findings during the administration of antithyroid drugs are generalized maculopapular and papularpurpuric rashes , with an incidence of 4 - 6% . 748 people reported to have side effects when taking propylthiouracil . among them , 10 people ( 1.34% ) have leukocytoclasticvasculitis . in our case , we assumed that the vasculitis was due to ptu because the lesions rapidly regressed when the drug was discontinued . when biopsies are obtained in the acute phase of active disease , the typical pattern of neutrophil infiltration is readily observed . in our patient , although most patients recover completely simply by withdrawal of ptu , some patients who have severe renal involvement or impairment of multiple organ systems may require high dosages of prednisone for several months . in our case hepatic and renal functions were normal . in conclusion , we report a patient who presented with cutaneous manifestations of leukocytoclasticvasculitis with simultaneous development of p - ancas during ptu therapy for graves disease . the importance of this study is to call attention to the occurrence of serious cutaneous manifestationassociated with a systemic drug frequently used in internal medicine .

propylthiouracil ( ptu ) is a common drug used in patients with hyperthyroidism . it may cause perinuclearantineutrophil cytoplasmic antibodies ( p - anca ) in few patients with graves disease . this antibody has been associated with different forms of vasculitis . we report a patient who presented with cutaneous manifestations of leukocytoclasticvasculitis with simultaneous development of p - ancas during ptu therapy for graves disease .

vulvar epidermoid cysts have been reported to be frequently localized on the clitoral region and labia majora [ 410 ] .vulvar epidermal cysts are frequently multicystic and the diameter of the largest loculus is less than 1 cm . they generally grow slowly and their growth process stops when their diameters reach 5 cm . histopathological diagnosis differentiates vulvar cysts from other vulvar lesions . for the treatment of a large vulvar cyst , total excision of the mass we have reported this case because of its rare site of presentation ; and it should be kept in mind that vulvar epidermal cyst should be considered in the differential diagnosis of vulvar mass fig . 1 . a 47-year - old , multiparous woman presented with a history of a palpable mass in the vulva , causing difficulties in walking . the mass had been gradually increasing in size for a period of approximately 12 months . the patient s medical history revealed that she had mild complaints because of a vulvar mass but she had not sought medical care . her medical history was normal ; she had no history of gynaecologic surgical procedures and no history of vulvar trauma . physical examination at admission demonstrated a large ( 6 4 3.5 cm ) , regular contoured , mobile soft mass in the left labium minus . the uterus , cervix , vagina , and the patient s abdominal examination were normal . histopathological examination revealed the cyst was lined with stratified squamous epithelium and filled with keratin materials . the patient was discharged from hospital without any complications two days postoperatively and her follow - ups continue in our outpatient clinic fig . epidermoid cysts can occur in a variety of locations , including the face , trunk , neck , extremities and scalp . the rare vulvar cysts develop mostly as a result of implantation of superficial epidermal tissue into dermis or subcutaneous tissue following acquired aetiologies as exposure to trauma or following episiotomy . in addition , in some women with a certain ethnic origin and culture , vulvar epidermal cysts develop more frequently as a secondary effect of female circumcision . most of the vulvar epidermal cysts described so far have been localized on the clitoris ; and circumcision procedures and trauma have been demonstrated as underlying causes . a few anecdotal cases of epidermal cysts localized on the clitoris and labia in patients without any history of trauma or surgery have been reported in the literature . our patient , who had a vulvar epidermal cyst , had not been previously exposed to trauma or undergone any surgical intervention . the patients frequently present with an asymptomatic , slowly growing vulvar mass . as is the case with our patient , the patients may experience difficulty in walking because of the large cystic mass or a complicated and painful mass . the diameter of the largest epidermal cyst so far reported in the literature has been 12 cm . in the differential diagnosis of vulvar benign tumors which can develop on this location various cystic lesions must be considered . these include mucous cyst , cyst of the canal of nuck , bartholin s cyst , skene s duct cyst , epidermal inclusion cyst , lipogenic tumors such as adenolipoma and lipomas ; and also endometrioma , post - traumatic hematoma , inguinal hernia and vulvar syringoma , among rarely seen vulvar lesions . malignant tumors of the vulva though rare , such as liposarcoma , should also be considered in the differential diagnosis [ 1214 ] . for preoperative diagnosis , although detailed anamnesis and meticulous physical examination convey critical importance , mri is very important in the localization of the mass and its relationship with other tissues regarding the planning for treatment of larger vulvar masses . some authors have asserted that asymptomatic cases could be followed up using clinical and radiological methods . however , surgical excision of large and disturbing vulvar masses has been performed for the treatment of many exemplary cases reported in the literature , and is a more appropriate alternative . irrespective of the size of the mass , total surgical excision of the mass is more appropriate for definitive histopathological diagnosis and for the prevention of future development of complications including rupture of the cyst , hematoma , infection and ( rarely ) carcinoma . a urologist was included in the operative team because of the close vicinity of the mass to the urethra . a foley catheter was inserted through the urethra and the mass was then totally excised . the mass was easily dissected from neighboring tissues . since the mass was localized within subcutaneous tissue away from any vascular structures , minimal bleeding occurred . however , if the mass extends into the vicinity of the clitoris and anus , the inferior haemorrhoidal and clitoral branches of the pudendal vessels may be traumatized leading to bleeding episodes . haemostatic sutures should be used in cases of diffuse bleeding . as was the case with our patient , definitive diagnosis of epidermal cyst may be confirmed by the histopathological demonstration of typical cyst circumscribed with keratinized stratified squamous epithelium . epidermoid cysts can occur in a variety of locations including the face , trunk , neck , extremities and scalp . up to now , those vulvar epidermal cysts reported in the literature were localized on the labia majora and the clitoris . written informed consent was obtained from the patient for publication of this case report and case series and accompanying images . mustafa pehlivan contributed to study design , and pelin ozun ozbay contributed to data collection ; muzaffer temur and ozgur yilmaz contributed to writing and data analysis .

highlightsepidermal cysts can be located in any part of the body , though mainly on the face , torso , extremities and scalp , but they are rarely localized on the vulva.most of the vulvar epidermal cysts described so far have been localized on the clitoris ; and circumcision procedures and trauma have been demonstrated as underlying causes.our patient , had not been previously exposed to trauma or undergone any surgical intervention.vulvar epidermal cyst should be considered in the differential diagnosis of vulvar mass .

place patient in the right lateral decubitus position with left side up operating surgeon will stand facing abdomen with the assistant camera driver standing to the surgeons right and caudad measure 5 cm incision over umbilicus on stretch create incision at umbilicus and enter the abdominal cavity . place the alexis wound retractor place appropriate laparoscopic ports in gel point seal ( 2 5 mm ports and 1 15 mm port ) as disrected and shown in video place gel point seal on alexis retractor and insuffolate the abdomen mobilize the descending colon off of the retroperitoneum mobilize the spleen from lateral to medial to create plane between the spleen and the upper pole of the kidney dissect the ureter and gonadal vein from the level of the iliac vessels up to the lower pole of the kidney follow the gonadal vein to the renal vein in the area of the hilum . the gonadal vein can be ligated and divided near the renal vein if needed identify and divide any lumbar veins identify and divide the adrenal vein between clips dissect the renal vein circumferentially identify the renal artery and dissect it circumferentially mobilze the entire kidney off of the retroperitoneum pace a 5 - 12 mm port where the lower 5 mm port had been placed in the gel point seal ligate and divide the ureter and gonadal vein at the iliac vesselswith an endo - gia stapler ligate the renal artery with an endo - ta vascular stapler and then divide with endoshears ligate and divide the renal vein with an endo - gia stapler place the kidney in and large endocatch bag remove the gel point seal and the alexis retractor remove the kidney from the abdominal cavity replace the gel point seal survey for hemostasis and replace the descending colon in the appropriate location along with the spleen close the abdominal wall fascia and then the skin incision place patient in the right lateral decubitus position with left side up operating surgeon will stand facing abdomen with the assistant camera driver standing to the surgeons right and caudad measure 5 cm incision over umbilicus on stretch create incision at umbilicus and enter the abdominal cavity . place the alexis wound retractor place appropriate laparoscopic ports in gel point seal ( 2 5 mm ports and 1 15 mm port ) as disrected and shown in video place gel point seal on alexis retractor and insuffolate the abdomen mobilize the descending colon off of the retroperitoneum mobilize the spleen from lateral to medial to create plane between the spleen and the upper pole of the kidney dissect the ureter and gonadal vein from the level of the iliac vessels up to the lower pole of the kidney follow the gonadal vein to the renal vein in the area of the hilum . the gonadal vein can be ligated and divided near the renal vein if needed identify and divide any lumbar veins identify and divide the adrenal vein between clips dissect the renal vein circumferentially identify the renal artery and dissect it circumferentially mobilze the entire kidney off of the retroperitoneum pace a 5 - 12 mm port where the lower 5 mm port had been placed in the gel point seal ligate and divide the ureter and gonadal vein at the iliac vesselswith an endo - gia stapler ligate the renal artery with an endo - ta vascular stapler and then divide with endoshears ligate and divide the renal vein with an endo - gia stapler place the kidney in and large endocatch bag remove the gel point seal and the alexis retractor remove the kidney from the abdominal cavity replace the gel point seal survey for hemostasis and replace the descending colon in the appropriate location along with the spleen close the abdominal wall fascia and then the skin incision the single port donor nephrectomy is a viable next step in the evolution of donor nephrectomy . at times , steps in the procedure have to be accomplished out of order due to the challenges inherent in the single port which limits side to side retraction and mobility as discussed in the video . the cosmesis is excellent and patients return to activities very quickly . as the procedure evolves new instruments will be developed that will aide in the accomplishment of more of more and more complex tasks through the single port entry . dr david leeser and dr joseph del pizzo both teach single port techniques at courses sponsored by applied medical .

in 2007 , rane presented the first single port nephrectomy for a small non - functioning kidney at the world congress of endourology . since that time , the use of single port surgery for nephrectomy has expanded to include donor nephrectomy . over the next two years the technique was adopted for many others types of nephrectomies to include donor nephrectomy . we present our technique for single port donor nephrectomy using the gelpoint device . we have successfully performed this surgery in over 100 patients and add this experience to our experience of over 1000 laparoscopic nephrectomies . with the proper equipment and technique , single port donor nephrectomy can be performed safely and effectively in the majority of live donors . we have found that our operative times and most importantly our transplant outcomes have not changed significantly with the adoption of the single port donor nephrectomy . we believe that single port donor nephrectomy represents a step forward in the care of living donors .

a 31-year - old female had been suffering from irritation of the right eye since august 2009 . she was diagnosed with ectopic cilia in the right superior conjunctiva , and the cilia were excised at the initial clinic . since the cilia recurred , she was referred to our university hospital on april 13 , 2011 . slit - lamp examination demonstrated three black hairs located in the palpebral conjunctiva of the upper lid ( fig . 1a ) , and mild superficial punctuate keratopathy in the right eye . there was no family history of any similar disorder . it was excised as square - shaped tissue , including black hairs and a tarsal plate tissue . histopathological analysis revealed three hairs on the conjunctival surface , where conjunctival epithelium that contains goblet cells had grown into the stroma ( fig . however , neither dermal papillae nor hair matrixes nor hair follicle tumors were observed in the tissue , even in the deeper - cut sections ( fig . 1c ) . the ectopic cilia had not recurred as of october 2011 . a 46-year - old healthy male had been suffering from mild ocular pain in the left eye since october 2011 . slit - lamp examination demonstrated a hair located in the palpebral conjunctiva of the upper lid with hyperemia in the left eye ( fig . he was diagnosed as having ectopic cilia in the left superior conjunctiva , and the cilium was plucked out at a private clinic . slit - lamp examination showed a tiny conjunctival pit stained by fluorescein dye ( fig . the histopathology of the excised hair showed a hair follicle with neither dermal papilla nor hair matrix ( fig . a 31-year - old female had been suffering from irritation of the right eye since august 2009 . she was diagnosed with ectopic cilia in the right superior conjunctiva , and the cilia were excised at the initial clinic . since the cilia recurred , she was referred to our university hospital on april 13 , 2011 . slit - lamp examination demonstrated three black hairs located in the palpebral conjunctiva of the upper lid ( fig . 1a ) , and mild superficial punctuate keratopathy in the right eye . there was no family history of any similar disorder . it was excised as square - shaped tissue , including black hairs and a tarsal plate tissue . histopathological analysis revealed three hairs on the conjunctival surface , where conjunctival epithelium that contains goblet cells had grown into the stroma ( fig . however , neither dermal papillae nor hair matrixes nor hair follicle tumors were observed in the tissue , even in the deeper - cut sections ( fig . 1c ) . a 46-year - old healthy male had been suffering from mild ocular pain in the left eye since october 2011 . slit - lamp examination demonstrated a hair located in the palpebral conjunctiva of the upper lid with hyperemia in the left eye ( fig . he was diagnosed as having ectopic cilia in the left superior conjunctiva , and the cilium was plucked out at a private clinic . slit - lamp examination showed a tiny conjunctival pit stained by fluorescein dye ( fig . the histopathology of the excised hair showed a hair follicle with neither dermal papilla nor hair matrix ( fig . ectopic cilia are very a rare condition , presenting as a disturbance of the position of the eyelashes ; only 18 cases have been reported in humans . previous publications have reported two distinct types of this disorder : an anterior type , in which the cilia protrude from the anterior surface of the tarsal plate , and a posterior type , in which they protrude from the posterior surface . although the present cases are considered to be of the posterior type , histological analysis of posterior - type ectopic cilia has yet to be conducted . they are responsible for secreting mucin , a proteinous substance that makes up the inner layer of tears . in case 1 , histopathological analysis showed that the cilia were surrounded by granulation tissue consisting of inflammatory cells and blood vessels . the cilia - related lesion was located in the epithelial pit that contains goblet cells , which is consistent with the crypts of henle . in contrast , dermal papillae and hair matrixes , which are known to produce hair follicles , were not found in the excised tissue in either case , indicating that the cilia did not arise from the conjunctiva in situ . these results suggest that the cilia in the palpebral conjunctiva might have originated as normal cilia that spontaneously migrated from the eyelid , eventually becoming aberrant cilia in the crypts of henle . in conclusion , according to the histopathological analysis , ectopic cilia in the palpebral conjunctiva may be associated with the anatomical features of the crypts of henle as well as chronic inflammation . we can confirm that ectopic cilia in the palpebral conjunctiva are acquired aberrant cilia , in contrast to anterior ectopic cilia , which are congenital .

cilia are normally found at the eyelid margin , while ectopic cilia are one or more lash follicles appearing in an abnormal position within the eyelid . we herein report two cases of cilia located in the palpebral conjunctiva . a 31-year - old female and a 46-year - old male presented with ectopic cilia in the superior palpebral conjunctiva . histopathological study of the excised ectopic cilia and related lesions showed the cilia - related lesion to be located in the epithelial pit that contains goblet cells , which is consistent with the crypts of henle . the hair follicle was surrounded by granulation tissue , while a dermal papilla and a hair matrix , which are known to produce hair follicles , did not exist in the excised tissue . while anterior ectopic cilia are congenital , ectopic cilia in the palpebral conjunctiva may be acquired , and these aberrant cilia are associated with crypts of henle and chronic inflammation .

the anomalous origin of the left coronary artery from the pulmonary artery ( alcapa ) was first described in 1866 . the first clinical description , in conjunction with autopsy findings , was described by bland and colleagues in 1933 , so the anomaly is also called the bland - white - garland syndrome.1 in 1962 , fontana and edwards reported a series of 58 postmortem specimens and demonstrated that most patients had died at a young age.2 an embryological defect during fetal cardiac development leads to the left coronary artery arising from the pulmonary artery instead of the aorta . at birth , the infant is asymptomatic but as the pulmonary artery pressure decreases during the neonatal period , desaturated blood flows under low pressure from the pulmonary artery via the left coronary artery to the left ventricle.3 this predisposes one to myocardial ischemia . collateral vessels develop between the right and left coronary arteries and may provide adequate perfusion of the left ventricular myocardium . subsequently , as the pulmonary resistance decreases , a retrograde flow from the high - pressure coronary arteries to the pulmonary trunk results in myocardial steal and contributes to myocardial ischemia.3 , 4 over time , there is anterolateral myocardial infarction , mitral valve dysfunction , and congestive cardiac failure . the presenting features are paroxysms of irritability , which correlate with episodes of angina pectoris and symptoms of heart failure . dilated cardiomyopathy is an important differential diagnosis and may also arise as a result of alcapa . although alcapa presents predominantly in infancy , there are several case reports in adolescents and adults,5 , 6 with the oldest reported patient being 72 years at diagnosis.7 a 60-year - old man referred to our center due to dyspnea on exertion from one year previously , which was in new york heart association ( nyha ) functional class ii , without any history of chest pain . he had almost been normal during his life , carrying out his ordinary activities without limitation . he was a past smoker for several years and also was a current opium user . there was no history of systemic hypertension , diabetes , or dyslipidemia . at presentation , blood pressure was normal and a holosystolic murmur of grade iii / vi at the apex and another diastolic murmur at the left sternal border were detected . a twelve - lead electrocardiogram showed normal sinus rhythm with left - axis deviation and no q wave or st - t changes . chest x - ray showed marked cardiomegaly ( cardiothoracic ratio = 60% ) and pulmonary venous congestion . transthoracic echocardiography demonstrated severe left ventricular enlargement with moderate dysfunction [ left ventricular end - diastolic dimension ( lvedd ) = 7 cm , left ventricular end - systolic dimension ( lvesd ) = 4.5 cm , left ventricular ejection fraction ( lvef ) = 40% ] and mild mitral and tricuspid insufficiency along with mildly ) 35 mmhg ( increased systolic pulmonary artery pressure . there was regional wall motion abnormality in the inferior wall and multiple dilated coronary branches through the inferior wall extending toward the apex ( figures 1 & 2 ) . the origin of the right coronary artery from the right sinus of valsalva was seen ; however , in spite of dilated left coronary branches , its connection to the aorta could not be visualized ( figure 3 ) . electrocardiographically - gated multi - detector computed tomographic ( ct ) angiography revealed alcapa , with a retrograde flow from the left coronary artery to the pulmonary artery and extensive collateral vessels at the left ventricle apex ( figure 4 ) . presently , the prognosis for patients with alcapa is dramatically improved as a result of both early diagnosis using echocardiography with color flow mapping and improvements in surgical techniques , including myocardial preservation . alcapa anomaly may result from abnormal septation of the conotruncus into the aorta and pulmonary artery,1 or from persistence of the pulmonary buds together with involution of the aortic buds that eventually form the coronary arteries.2 there are two types : the infant type and the adult type , each of which has different clinical manifestations and carries a different prognosis . nowadays , the prognosis for patients with alcapa is dramatically improved as a result of both early diagnosis using echocardiography with color flow mapping and electrocardiographically - gated multi - detector ct angiography and improvements in surgical techniques . in asymptomatic adults , the recent literature suggests that if only moderate chronic ischemia and limited necrosis are present , survival without surgical correction is possible .

the anomalous origin of the left coronary artery from the pulmonary artery ( alcapa ) is a rare congenital cardiac malformation . it presents predominantly in infancy and its main presenting feature is myocardial ischemia or heart failure . survival to adulthood is quite uncommon . if untreated , mortality from alcapa approaches 90% in infancy ; early recognition and surgical correction are , therefore , essential . with early surgical correction , the prognosis is good . there are two types of alcapa syndrome : the infant type and the adult type , each of which has different manifestations and outcomes . infants experience myocardial infarction and congestive heart failure , and approximately 90% die within the first year of life . a literature review regarding this anomaly in teenagers and adults show that only 25 cases have been diagnosed during life and 18 additional cases of alcapa in these age groups have been diagnosed post mortem . we present a rare case of a 60-year - old man , who referred to our center due to dyspnea on exertion from the previous year without any history of chest pain and diagnosed as alcapa . given the absence of ischemia and the patient s age , only medical therapy was recommended .

it has rarely been described to cause megaoesophagus , the exact pathophysiology of which is not known for certain . in cases of megaoesophagus , the enlarged oesophagus causes tracheal compression and respiratory distress . it has also previously been described in one case to cause thoracic inlet compression with engorged neck veins and bilateral neck swelling . the key to management is recognition and urgent decompression of the oesophagus with nasogastric tube . an 81-year - old woman with a background of asthma , ischaemic heart disease and achalasia presented to hospital with a 2-h history of worsening shortness of breath . on examination , she was in visible respiratory distress and was tachypnoeic at 24 breaths per minute , with oxygen saturations of 93% on room air . examination of the chest revealed diffuse bilateral wheeze . furthermore , she had bilateral neck swelling which moved with expiration , and her neck veins were visibly distended . high - flow oxygen was administered , and an arterial blood gas revealed a respiratory acidosis with ph 7.19 , p02 15.7 ( on 15 l of oxygen ) , pc02 8.6 and a lactate of 2.9 . a provisional differential diagnosis of infective exacerbation of asthma was made with stridor of unknown cause . a plain chest radiograph was taken demonstrating a massively dilated air and fluid - filled oesophagus , with no visible intraparenchymal lung abnormality . a 16-french gauge nasogastric tube was immediately placed into the oesophagus with aspiration of air , fluid and food debris . this resulted in almost immediate relief of the patient 's respiratory distress , and she clinically improved . after decompression of the oesophagus , a computed tomography ( ct ) scan of the chest confirmed the diagnosis of megaoesophagus causing tracheal compression . the patient , now stabilized , was referred for oesophago - gastro - duodenoscopy ( ogd ) with a view to botulinum toxin treatment for underlying achalasia ( figures 13 ) . figure 3:axial slice of ct chest after nasogastric decompression showing persistent megaoesophagus and airway narrowing . over 50 years ago , the first instance of achalasia presenting in such fashion was first described , and since then , it has been sporadically reported in the literature . these cases have often had similar presentations , typically an elderly woman presenting with sudden onset of respiratory distress , stridor after a meal ; with quick relief of symptoms after oesophageal decompression by a nasogastric tube [ 210 ] . firstly , it is proposed that the dilated oesophagus is cephalically displaced against the cricopharyngeus muscle resulting in a pinch - cock , one - way valve system allowing air to enter the thoracic oesophagus but not to escape . secondly , results of pharyngeal and upper oesophageal sphincter ( uos ) manometry have shown repetitive uos contractions , increased residual uos pressure and failure of relaxation of the uos . it is postulated that acute fierce uos contraction could lead to a one - way valve system resulting in air trapped in a dilated oesophagus as above . in both instances , the normal belch reflex is lost and the enlarged oesophagus compresses the trachea retrosternally causing airway compromise . a case described in 1976 by mclean et al . reports similar engorged neck veins , facial swelling and bilateral neck swelling indicative of thoracic inlet obstruction . this high intrathoracic pressure results in reduced venous return to the heart and , by starling 's law , reduced cardiac output and hence a haemodynamically unstable patient . regardless of the pathophysiology , we advocate that the emergency management should remain the same achievement of urgent oesophageal decompression . the most effective way to achieve this is insertion of a large - bore nasogastric tube , coupled with suctioning of the upper respiratory tract . other methods including needle aspiration of the oesophagus , bougienage and oesophagoscopy with catheter insertion have also been described . in conclusion , doctors must be aware of this rare but potentially fatal acute complication of achalasia as , if managed correctly , a severely ill patient can be quickly and effectively stabilized before referral for definitive management .

achalasia is an idiopathic motility disorder of the oesophagus of increasing incidence . it is characterized by aperistalsis of the lower oesophagus and failure of relaxation of the lower oesophageal sphincter . patients classically present with chronic symptoms of dysphagia , chest pain , weight loss and regurgitation , and they commonly suffer pulmonary complications such as recurrent microaspiration of static , retained food contents of the upper oesophagus . however , it has also been described , uncommonly , to present with megaoesophagus and secondary tracheal compression . we present a case of megaoesophagus secondary to achalasia which presented with stridor and signs of acute superior vena caval obstruction .

mechanisms underlying membrane deformation are highlighted in numerous recent reviews [ 1 - 16 ] . in addition , the organization of the cytoskeleton can cause membrane deformation . in general , sculpting of membranes is assumed to be achieved by membrane scaffolding proteins , such as vesicular coats ( coatomer for coat protein [ cop]i vesicles and sec 23/24 and sec 13/31 for copii vesicles ) or clathrin and adaptor complexes for clathrin - coated vesicles ( ccvs ) , or by amphipathic helices of proteins that insert into and increase the area of one leaflet of the bilayer ( or by both ) . the molecular mechanisms underlying budding of carrier vesicles in endocytosis or biosynthetic transport pathways are the focus of molecular cell biological research at present . the gtpase dynamin serves the generation of endocytic vesicles in combination with the adapter protein complex ap2 and clathrin . in contrast , biosynthetic transport vesicles employ small gtpases - sar1p and the coat complexes sec23/24 and sec13/31 for copii vesicles and arf for copi vesicles and various ccvs - in combination with coatomer ( for copi ) or adapter complexes ap1 , 3 , and 4 ( for ccv ) . dynamin - mediated fission was thought to require a power stroke generated by a concerted conformational change in assembled dynamin and triggered by rapid gtp hydrolysis . however , more recent studies demonstrated that dynamin assemblies stabilize highly curved templates and that fission requires cycles of gtp hydrolysis . during these cycles , the underlying membrane undergoes squeezing and relaxation , resulting in the stochastic generation of a hemifission intermediate assumed to cause fission . thus , cycles of membrane binding and gtp hydrolysis - dependent dissociation were shown to be necessary for dynamin - catalyzed membrane fission ( reviewed in ) . another recent study showed that dynamin nucleation , and hence membrane deformation , occurs preferably at sites of high local curvature . in analogy to dynamin , sar1 was found to induce membrane curvature on liposomal membranes , and in more recent work , such a role has been reported for arf1 [ 25 - 27 ] . a minimal machinery consisting of liposomes , arf1 , and coatomer has been described to be sufficient for copi reconstitution in vitro in the presence of non - hydrolyzable gtp analogs . while additional factors , such as arf - gtpase - activating protein 1 , were reported to be required for the release of vesicles , this finding was recently challenged . which mechanism as vesicle separation is observed in minimal reconstituted liposomal systems , it is basically the coat protein or the small gtpase or both that catalyze the scission reaction . indeed , lee et al . have observed that , although a truncated form of sar1p supports bud formation in the copii system , the gtpase , when lacking its amphiphatic helix , lost the ability to deform the membrane . as a consequence , separation of the nascent vesicle this opens a possibility that in the early secretory pathway , the small gtpases , in addition to recruiting coat proteins , have a role in membrane fission . along these lines , free arf1-gtp has been recently reported to preferentially localize to areas of low membrane curvature when gtp - hydrolysis is stimulated by the curvature - sensitive arfgap1 enzyme . thus , arf1 is likely to reside at sites where fission finally occurs , at the neck of the nascent bud . models for the molecular mechanism of membrane separation have been forwarded on the basis of the assumption that the protein involved in a scission reaction would stabilize a transition state . conceptually , it may be useful to consider models in which an unstable , energetically unfavorable transition state that can be relaxed by membrane separation is generated . for the small gtpases , this would imply that they must have affinity to membranes strong enough to remain in a membrane at sites of increasing negative curvature , as represented by the growing neck of a maturing bud . to avoid escape from energetically unfavorable sites , the gtpase would need to be stably anchored to the bud s coat . in the case of copi vesicles , arf1 is tightly bound by multiple specific interaction sites with its covering sheet of polymerized coatomer , and thus firmly kept in place even at a location of negative curvature , which forms in the bud neck and is energetically unfavorable to accommodate the small gtpase . scission of a bud would then occur in case the energy barrier for spontaneous fusion of adjacent membranes in the neck was lower than that for an escape of arf1 from high - energy sites . arf1 was recently described to dimerize upon activation with gtp , and an arf1 mutant unable to dimerize did not support copi vesicle formation . thus , it seems attractive to speculate that the avidity to bind to membranes gained by dimerization of small gtpases adds to the mechanisms of membrane separation

biological membranes are highly dynamic ( e.g. , during cell division , organelle biosynthesis , vesicular transport , and neurotransmitter release ) . they can be shaped into protein - coated transport vesicles or tubules and undergo regulated fusion . the life of transport vesicles depends on highly specific and tightly regulated protein machineries , which not only shape the donor membrane into nascent budding structures but also help to overcome the energy barrier to break the bilayers apart in order to pinch off nascent vesicles . ultimately , vesicular membranes have to fuse with a target lipid bilayer , a process that again requires remodeling . here , we highlight recent insights into mechanisms that lead to membrane deformation in the process of vesicular budding .

visible 12 fs pulses covering the range of 470595 nm ( gray in figure 1 d , top ) at an 8 mhz repetition rate were provided by a home - built white light laser detailed in the supporting information . spectral phase and amplitude of the excitation pulses were controlled with a spatial light modulator ( jenoptik slm-320d ) in a grating - based 4f setup , which was used in double - pass geometry to avoid spatiotemporal coupling artifacts . the single - molecule samples were prepared according to the spin - coating procedure described in ref ( 28 ) . single aligned terrylene molecules were excited by focusing the s - polarized excitation beam with a reflective objective ( newport , 0.52 na ) via a pick - off mirror at 75 degree incidence angle onto the sample . the illumination was kept at a power density below 30100 w / cm in all experiments . a 1.42 na objective ( olympus plapon 60 ) collected the fluorescence , which was then focused onto an em - ccd camera ( andor ixon3 ) to produce wide field images of the sample with 300 magnification . a combination of a 3 mm wide beam block and spectral filters ( thorlabs felh0600/fel0600 , semrock ff02 - 617/73 - 25 ) suppressed excitation light background . delay traces report the total fluorescence intensity of an isolated emitter , averaged over 40 to 100 scans with 100 ms exposure per delay time . typically , a maximum of 2000 photons / s were collected per molecule , which corresponds at an estimated 5% detection efficiency and close to unit quantum efficiency to on average 0.005 excitations per laser shot and a poissonian probability for double excitation of only 10 per pulse . all intensities are presented relative to the emission with compressed pulses . as a result , in amplitude - shaping experiments , a small offset occurs due to limited shaping contrast . for the measurement in figure 2d , pulses were chirped by passing them through 2.5 cm of sf1 glass ( thorlabs ) . the closed - loop coherent control experiments used a genetic algorithm based on a selection - round system detailed in the supporting information . the spectral phase was parametrized into 3.2 nm spaced values , which were then connected with cubic spline interpolation . the fitness of an individual was defined as the fluorescence intensity relative to a reference measurement with a flat spectral phase . the optimum fitness intrinsically deviates from unity even with no control effect , because the algorithm selects the outer values of a normal distribution and divides through the statistical average .

coherent control uses tailored femtosecond pulse shapes to influence quantum pathways and drive a light - induced process toward a specific outcome . there has been a long - standing debate whether the absorption properties or the probability for population to remain in an excited state of a molecule can be influenced by the pulse shape , even if only a single photon is absorbed . most such experiments are performed on many molecules simultaneously , so that ensemble averaging reduces the access to quantum effects . here , we demonstrate systematic coherent control experiments on the fluorescence intensity of a single molecule in the weak - field limit . we demonstrate that a delay scan of interfering pulses reproduces the excitation spectrum of the molecule upon fourier transformation , but that the spectral phase of a pulse sequence does not affect the transition probability . we generalize this result to arbitrary pulse shapes by performing the first closed - loop coherent control experiments on a single molecule .