Datasets:

ola13

/

small-the_pile

like 8

An Island man is reaching out to the public to help find his son. Bob Weir's son Joey Weir has been missing since May. Bob Weir says no one has heard from Joey in two months, and said that's not like him. Weir said Joey is 37 years old and has been working in Manitoba as a carpenter for years. He said he's about five foot seven inches tall, 160 pounds and that he has a tattoo on his chest of the Island. "We think he's alive, we think he's just out on the streets for some reason or other. And I just wanna get in contact with him, so that we can take care of him." Weir says he's filed a missing persons report with the Winnipeg police. (Brian Higgins/CBC) Weir has filed a missing persons report with the Winnipeg police and said the Charlottetown police are also aware of the situation. Police in Winnipeg confirm they are looking for Joey Weir. Bob Weir asks anyone with information to contact either the Winnipeg or Charlottetown police. More P.E.I. news:

High-resolution computed tomography to differentiate chronic diffuse infiltrative lung diseases with chronic multifocal consolidation patterns using logical analysis of data. Chronic lung consolidation has a limited number of differential diagnoses requiring distinct managements. The aim of the study was to investigate how logical analysis of data (LAD) can support their diagnosis at HRCT (high-resolution computed tomography). One hundred twenty-four patients were retrospectively included and classified into 8 diagnosis categories: sarcoidosis (n=35), connective tissue disease (n=21), adenocarcinoma (n=17), lymphoma (n=13), cryptogenic organizing pneumonia (n=11), drug-induced lung disease (n=9), chronic eosinophilic pneumonia (n =7) and miscellaneous (n=11). First, we investigated the patterns and models (association of patterns characterizing a disease) built-up by the LAD from combinations of HRCT attributes (n=51). Second, data were recomputed by adding simple clinical attributes (n=14) to the analysis. Third, cluster analysis was performed to explain LAD failures. HRCT models reached a sensitivity >80% and a specificity >90% for adenocarcinoma and chronic eosinophilic pneumonia. The same thresholds were obtained for sarcoidosis, connective tissue disease, and drug-induced lung diseases when clinical attributes were added to HRCT. LAD failed to provide a satisfactory model for lymphoma and cryptogenic organizing pneumonia, with overlap between both diseases shown on cluster analysis. LAD provides relevant models that can be used as a diagnosis support for the radiologist. It highlights the need to add clinical data in the analysis due to frequent overlap between diseases at HRCT.

Q: Use CSV file to change URL for web test In Visual Studio Web test my URL is https:example//api/{{test1}}/mode/{{test2}} Here I want to pass values of test1 and test2 from a CSV file. I tried https://exampl/api/{{DataSource1.Table5002#csv.objectId}}/mode/{{DataSource1.Table5002#csv.model}} where in table5002, columns objectId and model are added. Values from CSV work fine when I use them in string body. I tried these: Context parameters, here I can't bind context parameters with datasource. Tried giving https://exampl/api/{{DataSource1.Table5002#csv.objectId}}/mode/{{DataSource1.Table5002#csv.model}} in URl. This doesn't take values from data source. Please help me on how to use CSV values in URL. A: When i give my URL like this:https://exampl/api/{{DataSource1.Table5002#csv.objectId}}/mode/{{DataSource1.Table5002#csv.model}}, now it is working fine.

What about the questions I asked about whether the new entity would comply with Order No. 2000 (especially if the state has the vertically integrated utilities operate the system)? See attached word version of my orginal E-mail. 02/21/2001 11:03 AM Bernadette Hawkins@ENRON Bernadette Hawkins@ENRON Bernadette Hawkins@ENRON 02/21/2001 11:03 AM 02/21/2001 11:03 AM To: Steven J Kean/NA/Enron@Enron, Richard Shapiro/NA/Enron@Enron, Linda Robertson/NA/Enron@ENRON, James D Steffes/NA/Enron@Enron, Susan J Mara/NA/Enron@ENRON, Mary Hain/HOU/ECT@ECT, Jeff Dasovich/NA/Enron@Enron, Mark Palmer/Corp/Enron@ENRON cc: Subject: Scope of FERC Jurisdiction Over State-Owned Utility Attached is a memo that addreses the FERC's jurisdiction over the transfer/sales of utility assets to the state of California. At a minimum, FERC must approve the transfer. Call if you have questions. Joe ----- Forwarded by Bernadette Hawkins/Corp/Enron on 02/21/2001 01:55 PM ----- "Tracey Bradley" <[email protected]> 02/21/2001 01:10 PM To: <[email protected]> cc: <[email protected]>, "Andrea Settanni" <[email protected]>, "Ronald Carroll" <[email protected]> Subject: Scope of FERC Jurisdiction Over State-Owned Utility Please see attached memorandum. We have also attached FERC's orders addressing LIPA's acquisition of LILCO's transmission assets and LIPA's open access tariff. Please call if you have any questions. - 0138443.01 - EC97-45.TXT - NJ98-4.TXT

APB: Reloaded The Ranking Description In APB Reloaded you take on the role of a Criminal - hell-bent on causing havoc and making money, or an Enforcer - tapped by the city to keep order. The city never sleeps and the fight never ends in this fast paced Massively Multi-player, Action Shooter!

Offer HN: Friendship in the Valley? - juiceandjuice I kind of feel retarded for posting on here, but I'm starting to go out of my mind doing everything by myself, and looking for buddies on CL/okcupid seems weird to me. I'll try to keep this simple.<p>I just moved here to work at SLAC from SLC, Utah a month ago, and most of the people I know are physicists twice my age. In true nerd form, the idea of meeting a ton of new people by myself gives me some anxiety, a bit more than the thought of me trying to sell myself online to a bunch of strangers.<p>Anyways, I need new friends. I've got a ton to offer, but the most relevant thing, the reason this is <i>really</i> an offer, is probably the fact that I have a car and I'm not afraid to use it (i.e. driving to the city for whatever). Also, I'm 100% down for food adventures, beer (first round is on me), live music, movies. ====== bigiain Can I suggest Dorkbot? <http://dorkbot.org/dorkbotsf/> Their tagline is "People doing strange things with electricity" - in my experience you end up with a fascinating crowd of people hovering somewhere on the borderline of hardware geeks, software geeks, artists, and pranksters. They've got a meeting next Wednesdsay in SF - I've made some _great_ friends via Dorkbot in SF as well as Sydney (where I live) and Seattle. (If you go, find Karen and tell her Big says "Hi!", and there might be an Australian girl named Pia visiting, tell her I say Hi too!) ------ scrrr You will probably meet more interesting people here than on okCupid. I like this offer and would go for a beer with you if I was in that area. ------ util Lots going on at Noisebridge in SF: <https://www.noisebridge.net/wiki/Noisebridge> In particular, you might want to check out Five Minutes of Fame next week (8 p.m., Thursday). Could be a good opportunity to bump into some interesting people. ------ fbailey can't help you, but it's absolutely understandable and not at all retarded :) ------ rms Try posting an intro message on SF Redditors.. it's a very friendly group. <http://groups.google.com/group/SFredditors/> ~~~ juiceandjuice Thanks, I just joined... waiting to be approved.

by exercisebeforeknitting Here comes the Secret Pal 7 Questionnaire: 1. Are you a yarn snob (do you prefer higher quality and/or natural fibers)? Do you avoid Red Heart and Lion Brand?Only somewhat. I love Lion Brand Cotton-Ease and Wool-Ease isn’t bad either but I won’t use Red Heart. I don’t mind acrylic (especially if it makes the yarn washable) but I don’t knit with anything that is 100% acrylic. Also, even though I’m vegan, I use animal fibers. It’s less a political thing and more a dietary thing for me. 2. Do you spin? Crochet? Nope. 3. What do you use to store your needles/hooks in? In some pretty vases that never get used for flowers. 4. How long have you been knitting? Would you consider your skill level to be beginner, intermediate or advanced? I learned first as a little kid but I really got started six years ago. Intermediate to advanced. 5. Do you have an Amazon or other online wish list? Amazon list only has a couple things on it. I’m more of a glutton for my Knit Picks wish list. Email me if you want that. I warn you in advance: it’s long and frivolous. 7. Do you have a sweet tooth? Favorite candy? Sweet tooth, you bet. Unfortunately (well, fortunately for my health, I guess), I’m vegan and don’t eat anything with meat/dairy/eggs. That cuts out a lot of sweets. I’m a sucker for dark chocolate without milk or butter. 8. What other crafts or Do-It-Yourself things do you like to do? Knitting is really my only crafty habit. 9. What kind of music do you like? Can your computer/stereo play MP3s? (if your buddy wants to make you a CD) Anything but country and metal. I love classic jazz and world music. Yes, I can play mp3s. 10. What’s your favorite color? Or–do you have a color family/season/palette you prefer? Any colors you just can’t stand? I love blue. There aren’t any colors I dislike but I admit to being the only knitter in blogland that doesn’t like variegated, multi-colored, pooling and self-striping yarns. 11. What is your family situation? Do you have any pets? Married with two smelly dogs (see flickr account). 13. What is/are your favorite yarn/s to knit with? I’m currently going through a Knit Picks phase. I don’t buy expensive yarn- I’m really cheap. I like washable yarns like Dale of Norway Falk, KP Shine, Essential, Cascade 220 Superwash, Lion Brand Cotton-Ease, etc. In addition to being cheap, it appears that I’m also lazy. When it comes to socks and baby knits, I don’t intend to do any hand washing. I readily knit with feltable wool for scarves, mittens, hats, etc. 15. What is/are your current knitting obsession/s? I’d have to say either baby sweaters or mittens. Maybe socks. I’m just looking below at old blog posts and that seems to cover it. 16. What is/are your favorite item/s to knit? It depends on the season, my mood and how cold I am! 17. What are you knitting right now? A blue baby sweater (see picture below). 18. Do you like to receive handmade gifts? Yes! 19. Do you prefer straight or circular needles? Straight. I know it means sewing (which I dislike), but I like the feel of straight needles better than circs. 20. Bamboo, aluminum, plastic? Bamboo or any kind of wooden needles. 21. Do you own a yarn winder and/or swift? Nope. 22. How did you learn to knit? My mom taught me when I was 6 but my little brother taught me when I grew up. 23. How old is your oldest UFO? Oldest UFO that I haven’t abandoned entirely? Probably a year. 24. What is your favorite animated character or a favorite animal/bird? I love dogs and I wish I could adopt ten. I don’t watch TV so I couldn’t name any animated characters. 25. What is your favorite holiday? July 4th because there are lots and lots of fresh tomatoes around then. I could live a happy life with only fresh tomatoes to eat. 26. Is there anything that you collect? Bad habits? No, not much else. 27. What knitting magazine subscriptions do you have? None. I never buy mags. Occasionally a Phildar one but it’s pretty rare. When I started knitting, I went a little nuts on books and now I’m not really pattern-deficient! 28. Any books, yarns, needles or patterns out there you are dying to get your hands on? Not really (see above). I have a pretty decent collection of books and more size 8 needles than I’d care to admit. I’m always game for yarn. :-) 29. Are there any new techniques you’d like to learn? Steeking. I’m way too scared to actually try it without adult supervision. Maybe in another lifetime. Besides, my fair isle knitting is confined to small projects like mittens, hats and socks. 30. Are you a sock knitter? What are your foot measurements? I love socks. I’m sort of a slow sock knitter. I didn’t know what to measure so here are three different spots:Around lower part of calf: 11″Around ankle: 8.25″Length from heel to toe: 8.75″

Final Thoughts Regarding the New iPad I spent much of the day yesterday mulling over all of Apple’s announcements regarding the new iPad. What struck me most of all, was how closely the rumor mill pegged this announcement. So how good was the reporting surrounding the new iPad in the weeks leading up to it’s introduction? Let’s take a look. The Hardware Just as predicted, the new iPad sports a incredibly dense 2048×1536 pixel display. This works out to 264ppi, which according to Apple, at a viewing distance of 15 inches or less, makes pixels indiscernible to the human eye. Okay, the rumor mill got one right on the nose. What’s next? How about a new processor? The new “A6”, which was rumored to be quad-core never made an appearance. Instead, what we received was the rumored dual-core A5X. Seemingly splitting the difference between the two rumors, the A5X does not have quad-core processors, as had been reported with the mythical “A6” chip, but instead has “quad-core graphics”, to better power the new Retina display. So, it seems that the rumor mill, and I, were half right and half wrong regarding the new processor. In one sense, I was totally wrong. Let’s call it a draw. As for RAM, so far there is no word on how much Apple has packed in the new device, but as rumors suggested, I would wager that Apple bumped it from 512MB to 1GB to better assist the new graphics. The device’s cameras were the next item of speculation ahead of the introduction. Many rumors claimed that Apple would be building in improved cameras on both the front and the rear of the device. Little was mentioned at the announcement regarding the front-side camera– it appears to be the same as the iPad 2’s. Reports had predicted that Apple would be building in an 8 Megapixel camera on the rear of the device. The new iPad does have an improved camera, but 8MP it is not. No, we’ll have to settle with 5MP in this year’s model. Nonetheless, the camera can shoot 1080p HD video, and has built-in stabilization. Not bad. The last major bit of speculation regarding hardware, came in the form of next-generation 4G LTE networking. Only until just prior to the new iPad’s introduction was it all-but-confirmed that the device would have 4G LTE networking. In the months leading up to the announcement it was much less certain. Besides, Apple’s inclusion of the network technology raises an important question. Will the next iPhone have 4G LTE built in? I personally do not think the technology is small enough, or power-efficient enough for Apple to put it in an iPhone yet, but the company has already set up expectations to the contrary by building it into the new iPad*. Time will tell I suppose. The Design There was an abnormal amount of confusion regarding the design of the new iPad. Some claimed it would be thinner, others claimed it would be thicker, but ultimately no one knew what it would look like until days prior to the introduction. I vehemently, and incorrectly, argued that the new iPad would not be thicker– I was wrong. However, the device turned out to be less than a millimeter thicker, which would be unnoticeable by most. Also, to my surprise, the new iPad is ever so slightly heavier than the iPad 2. Again, only by a minuscule amount – .1LBS What we got, was an iPad that is ever-so-slightly thicker and heavier than the iPad 2, with more gradually tapered edges than the design it replaced. Other Odds and Ends Just as I had suggested, Apple echoed their iPhone marketing model, and moved the iPad 2 down to an entry-level position and lowered it’s price to $399. Apple claims they made this move to aggressively push the iPad in the education market. Fair enough. All other half-baked rumors surrounding the new iPad’s pricing and storage capacities fell through yesterday. Apple maintained the same 16/32/64GB storage capacities at the same $499/$599/$699 price points as the previous two generations of the device. Also, I predicted that Smart Covers were here to stay for awhile. Unsurprisingly, it seems that nothing has changed regarding Smart Covers. Last year’s covers will work just fine with this year’s iPad, and is in fact, what Apple is still selling today alongside the new iPad. This made perfect sense to me, especially considering how big a deal Apple made them at last year’s iPad event. Late-breaking reports about a clunky, Smart Cover-esque case coming from Apple look particularly foolish now. Of course, the flimsy reports of an 8 (or 7.85)-inch iPad fell apart yesterday as well. I do not think the time is right for Apple to roll out a new-sized iPad. The market is still gobbling up this current-sized iPad, and developers would have to retool** all of their iPad apps to work with the new, smaller screen in addition to the 9.7-inch screen we all know and love. Perhaps with time, but that time is not now. Siri did not make a large appearance at yesterday’s announcements as I had hoped. The new iPad will not have the voice-controlled assistant built in. Seemingly splitting the difference between rumors once again, Apple did build in speech-to-text instead*. The system-wide keyboard now sports a new “microphone” key, which, when pressed, invokes an iPhone 4S-like dictation feature. You speak, and it writes. That is, sadly, the extent of Siri-like features for this version of iOS on the new iPad. I still hold out hope that Apple will build Siri in at a later date. I love that lady. Conclusion It seems that the Apple community was largely prepared for yesterday’s announcements. Nothing ultra-surprising was announced, but all of it was welcomed nonetheless. The biggest selling point for this new iPad is the new Retina display- reporters with initial hands-on experience with the device are already raving about it. Naturally, with this nicer screen, came a requirement for more graphics horsepower. The new iPad has that as well, along with new, faster, 4G LTE networking and a better backside, “iSight” camera. Not too bad for the same $499 starting price. Now It’s Your Turn What do you think about yesterday’s iPad announcements? Surprised? Disappointed? Will you be buying one? We can’t wait to hear your thoughts. Leave a comment below! *I plan to write more on this subject in the coming days. **Arguably, developers will have to retool their apps for this new Retina display anyway. I still think it’s a matter of timing, as much as anything else, before we see the iPad in a variety of sizes. Featured I love it. I have held out waiting first for a front facing camera, then the retina screen. My other big desire is an SD slot but I can live without it. But the things that are frustrating on my iPhone the new iPad will do brilliantly. I love music apps but any iPad would be great for that.a And Im a photographer, so the retina screen and color balance will allow me to edit photos. I think most of my 40+ photo apps are Universal. So as soon as I can afford one, it is mine!

The Prophet's (s) Recommendation to Ibn `Umar, Allah Be Pleased With Both of Them Al-Tirmidhi narrated from Ibn `Umar - Allah be well-pleased with both of them! - that he said: "Allah's Messenger held my shoulders1 and said: 'Be in the world as if you were either a stranger or a traveller, and count yourself as one of those who lie in their graves.'"2 Al-Nasa'i's and Ahmad's narrations have the following addition at the beginning of the hadith: "Worship Allah as if you see Him." This recommendation contains the exposition of the stages of spiritual travel and wayfaring toward the station of the Supreme Sovereign King. These three stages include all the abodes of travelers and the stations of those who have arrived. We have made an extensive and valuable study of this narration, which we shall cite further down, if Allah wills. NOTES: 1 Al-Tirmidhi's wording has "held part of my body," but the shaykh used the wording of al-Bukhari. The latter narrated the hadith without the clause "and count yourself as one of those who lie in their graves." 2 Narrated by al-Bukhari as mentioned, al-Tirmidhi, Ibn Majah, Ahmad Allah's blessings and peace on the Prophet., his Family, and his Companions

Urinary retention in elderly women: diagnosis & management. The management of urinary retention in the elderly female can present a challenging conundrum for primary care physicians, geriatricians, and urologists. It is often difficult to diagnose due to concomitant comorbidities and potential cognitive impairments. Evaluation should include a comprehensive history and physical examination, post-void residual, and urinalysis with consideration given to urodynamic testing in select patients. Management varies from conservative to invasive and should be tailored to the individual patient. Primary goals of care include symptom reduction, prevention of urinary tract infection, and upper tract deterioration. This presents an up-to-date review of the presentation, diagnosis, and management options available for elderly women with urinary retention.

UNITED STATES DISTRICT COURT FOR THE DISTRICT OF COLUMBIA UNITED STATES v. Case No. 15-cr-00048 (CRC) DAVID BRONSTEIN, et al., Defendants. MEMORANDUM OPINION As James Madison observed long ago, “no language is so copious as to supply words and phrases for every complex idea, or so correct as not to include many equivocally denoting different ideas.” The Federalist No. 47, at 225 (James Madison) (C. Rossiter ed., 1963). Legislatures at all levels have powerfully confirmed Madison’s insight. Yet even if some imprecision must be tolerated in the vast web of statutes that govern our daily lives, the criminal law must be sufficiently definite to provide fair notice to those it would punish on society’s behalf and to cabin the discretion of its appointed peacekeepers and factfinders. The question before the Court is whether a law prohibiting three separate forms of speech in the Supreme Court of the United States fulfills these important constitutional requirements. The defendants are five individuals who stood up and spoke out at the beginning of a Supreme Court argument session last Term. They were charged with uttering “loud” language and making a “harangue” or “oration” in the Supreme Court building, all in violation of 18 U.S.C. § 6134. Defendants have moved to dismiss that count of the criminal information filed against them, challenging each of the above terms as unconstitutionally vague in all of their applications. With respect to “harangue” and “oration,” the Court agrees—a prosecution under this language would violate the Due Process Clause. The word “harangue” is not only anachronistic; its meanings are too imprecise and varied to clearly delineate the prohibited conduct. The word “oration,” while more common in modern parlance, suffers from similar definitional ambiguity. Read in isolation, the statute’s prohibition of “loud” utterances also poses vagueness concerns. But because the term “loud” can be fairly construed as banning only those utterances that disturb or tend to disturb the normal operations of the U.S. Supreme Court, the Court will permit Defendants’ prosecution based on that limiting construction. I. Background A. The April 1, 2015 Incident Defendants David Bronstein, Matthew Kresling, Yasmina Mrabet, Belinda Rodriguez, and Richard Saffle arrived at the Supreme Court on the morning of April 1, 2015 to attend an oral-argument session. 1 They passed through an initial security checkpoint, entered the Upper Great Hall, cleared security again, and took their places inside the courtroom. Supreme Court police officers stood at designated posts throughout the courtroom. After a buzzer indicated that proceedings would begin in five minutes, Officer Dunford recited the following message to all assembled: Welcome to the Supreme Court of the United States. During today’s oral arguments it is important that you remain seated and silent. When the first case breaks, please remain silent. If you are remaining for the second case, remain seated. If you are leaving, silently exit the Courtroom. . . . Please alert one of the police officers if you observe anything suspicious, and in the event of an emergency, please remain calm and follow the directions of a police officer. Thank you. Govt.’s Opp’n Defs.’ Mot. Dismiss 3 (“Opp’n”). The buzzer sounded again at 10:00 a.m. The Supreme Court Marshal struck a gavel to inaugurate the day’s proceedings, and three police 1 The following facts are drawn from the Government’s Opposition to Defendants’ Motion to Dismiss. The Court accepts them as true for purposes of the present motion. See United States v. Ballestas, 795 F.3d 138, 149 (D.C. Cir. 2015). 2 officers standing in front of the public seating area motioned upward to implore visitors to stand. As the Justices took the bench, the Supreme Court Marshal intoned a familiar greeting: The Honorable, the Chief Justice, and the Associate Justices of the Supreme Court of the United States. Oyez! Oyez! Oyez! All persons having business before the Honorable, the Supreme Court of the United States, are admonished to draw near and give their attention, for the Court is now sitting. God save the United States and this Honorable Court. Id. The Marshal then gaveled audience members to their seats, and the police officers motioned downward to indicate that visitors should sit for the remainder of the argument session. By 10:02 a.m., only one member of the audience—Defendant Belinda Rodriguez—remained standing. Rodriguez extended her arm in the air and stated, “We rise to demand democracy. One person, one vote!” Id. A Supreme Court police officer detained Rodriguez and escorted her out of the courtroom. Moments later, Defendant Kresling arose and stated, “We rise to . . . . Money is not speech. One person, one vote!” Id. Another police officer detained Kresling and escorted him away. Next up was Defendant Mrabet, who raised one arm and stated, “Justices, is it not your duty to protect our right to self-government? The first . . . overturn Citizens United. One person, one vote!” Id. She, too, was restrained and taken from the courtroom. Defendant Saffle then initiated a fourth interruption by stating, “Justices, is it not your job to ensure free, fair elections?” Id. at 5. Saffle’s outburst met the same response. At this point, Chief Justice Roberts spoke from the bench to warn audience members against further demonstrations: “Anyone else interested in talking will be admonished that it’s within the authority of this Court to punish such disturbances by criminal contempt.” Id. Immediately thereafter, Defendant Bronstein began singing, “We who believe in freedom shall not rest; we who believe in freedom shall not rest.” Id. Bronstein was detained and escorted out of the courtroom. 3  In all, these verbal interruptions lasted “approximately two to four minutes.” Id. Each defendant was arrested, and the arresting officers—with the aid of other Supreme Court employees—processed the defendants elsewhere in the building. All five defendants were transported to the U.S. Capitol Police station later that day to conclude the arrest process. Two days later, on April 3, 2015, the U.S. Attorney’s office filed a two-count criminal information against all five defendants. See Information, ECF No. 1. Count One alleged that each of the five, “with the intent of interfering with, obstructing, or impeding the administration of justice, or with the intent of influencing any judge, juror, witness, or court officer in the discharge of their duties, did demonstrate in or near a building housing a court of the United States,” in violation of 18 U.S.C. § 1507. Count Two charged all five defendants with “[1] unlawfully mak[ing] a harangue or oration, or [2] utter[ing] loud, threatening, or abusive language in the Supreme Court Building or grounds,” in violation of 18 U.S.C. § 6134. For the sake of simplicity, the parties have christened § 6134’s two relevant clauses the “Harangue Clause” and the “Uttering Clause.” The Court adopts this terminology. B. Defendants’ Motion to Dismiss On May 14, 2015, Defendants moved to dismiss Count Two as resting on a facially unconstitutional statute. They advanced two sets of arguments. First, noting that they had been charged with violating the Harangue and Uttering Clauses in their entirety, Defendants contended that select portions of those clauses were unconstitutionally overbroad in violation of the First Amendment. Because the phrase “Supreme Court . . . grounds” includes the surrounding sidewalks, which have been held to be a “public forum” for purposes of First Amendment doctrine—see United States v. Grace, 461 U.S. 171, 180 (1983)—Defendants claimed that the Harangue and Uttering Clauses restrict too much protected speech and are 4 therefore facially unconstitutional. And second, Defendants argued that both clauses were unconstitutionally vague on their face so as to violate the Fifth Amendment’s Due Process Clause. Specifically, they claimed that a prohibition of “loud” language gives visitors “no criteria . . . to determine whether their speech will be criminal” and “vests too much discretion in the police.” Defs.’ Mot. Dismiss (“Mot. Dismiss”) 13. The Harangue Clause, too, allegedly “places unfettered discretion in the police” in criminalizing “harangue[s]” and “oration[s]” in the Supreme Court building and grounds. Id. at 6. In its brief in opposition, the Government clarified that it did not intend to prove that Defendants uttered “threatening” or “abusive” language, or that they violated § 6134 anywhere in the Supreme Court “grounds” other than the building itself. See Opp’n 14, 17. But rather than obviate Defendants’ First Amendment challenge by superseding the Information with a more narrowly tailored charging document, the Government responded in kind. It argued that Defendants lacked standing to challenge parts of § 6134 that they were not actually accused of violating and that the Harangue and Uttering Clauses passed muster under conventional First Amendment forum analysis. At an oral hearing held on September 29, 2015, the Government agreed to file a Superseding Information, which it did on October 1, 2015. Count Two now contains no reference to “abusive” or “threatening” language or the Supreme Court grounds as a whole—it simply charges Defendants with “unlawfully mak[ing] a harangue or oration or utter[ing] loud language in the Supreme Court Building.” Superseding Information 2, ECF No. 38. Defendants subsequently informed the Court that they no longer intended to challenge Count Two on First Amendment grounds. But they “do continue to urge the Court to [d]ismiss Count Two on vagueness grounds” as requested in their motion to dismiss. Status Rep. of Oct. 13, 2015, ECF 5 No. 39, at 1. The Court must therefore decide whether the Due Process Clause permits a prosecution for making a “harangue” or an “oration,” or uttering “loud” language, in the Supreme Court building. II. Standard of Review A criminal defendant “may raise by pretrial motion any defense, objection, or request that the court can determine without a trial on the merits.” Fed. R. Crim. P. 12(b)(1). Pretrial motions may challenge “a defect in the indictment or information,” as long as “the basis for the motion is then reasonably available and the motion can be determined without a trial on the merits.” Fed. R. Crim. P. 12(b)(3)(B). See, e.g., United States v. Kim, 808 F. Supp. 2d 44, 55– 57 (D.D.C. 2011) (reviewing a criminal defendant’s motion to dismiss an indictment on First Amendment grounds). III. Analysis A. Principles of Constitutional Vagueness Doctrine Vagueness doctrine is an outgrowth of the Due Process Clause of the Fifth Amendment, not the First Amendment. United States v. Williams, 553 U.S. 285, 304 (2008). A criminal law is unconstitutionally vague if it is written so imprecisely “that it fails to give ordinary people fair notice of the conduct it prohibits,” or is “so standardless that it invites arbitrary enforcement” by police, prosecutors, and juries. Johnson v. United States, 135 S. Ct. 2551, 2556 (2015). Such provisions are vague to the extent that they call for “wholly subjective judgments without statutory definitions, narrowing context, or settled legal meanings.” Williams, 553 U.S. at 306; see also City of Chicago v. Morales, 527 U.S. 41, 62 (1999) (rejecting the idea of “inherently subjective” criminal provisions as inimical to due process). Statutes whose interpretation must be filtered through “individual sensitivities” are especially vulnerable to vagueness challenges, 6 because their meanings are “varying and unascertainable” rather than “principled and objective.” Big Mama Rag, Inc. v. United States, 631 F.2d 1030, 1037–38 (D.C. Cir. 1980). These notice and fairness concerns are heightened in the First Amendment context, where “a more stringent vagueness test should apply.” Holder v. Humanitarian Law Project, 561 U.S. 1, 19 (2010) (quoting Hoffman Estates v. Flipside, Hoffman Estates, Inc., 455 U.S. 489, 495 (1982)). Nonetheless, “perfect clarity and precise guidance have never been required even of regulations that restrict expressive activity.” Ward v. Rock Against Racism, 491 U.S. 781, 794 (1989); see also Grayned v. City of Rockford, 408 U.S. 104, 110 (1972) (“Condemned to the use of words, we can never expect mathematical certainty from our language.”). All law enforcement “requires the exercise of some degree of police judgment.” Grayned, 408 U.S. at 114. The reality that virtually all statutes will generate interpretive difficulties at the margins is addressed not by vagueness doctrine, but by the requirement of proof beyond a reasonable doubt. Williams, 553 U.S. at 306. Even an “imprecise” criminal law will satisfy due process, then, as long as it is fundamentally “comprehensible” ex ante. Coates v. City of Cincinnati, 402 U.S. 611, 614 (1971). But there must always be an “ascertainable standard for inclusion and exclusion.” Smith v. Goguen, 415 U.S. 566, 578 (1974). A criminal prohibition must have some objective core. Claimants may bring either as-applied or facial vagueness challenges. The former type “do not challenge . . . statutory terms in all their applications,” but instead allege invalidity only insofar as a law prohibits “engaging in certain specified activities.” Humanitarian Law Project, 561 U.S. at 14. With as-applied challenges, courts “consider whether a statute is vague as applied to the particular facts at issue, for ‘[a] plaintiff who engages in some conduct that is clearly proscribed cannot complain of the vagueness of the law as applied to the conduct of 7 others.’” Id. at 20 (quoting Hoffman Estates, 455 U.S. at 495) (alteration in original); accord Parker v. Levy, 417 U.S. 733, 756 (1974) (“One to whose conduct a statute clearly applies may not successfully challenge it for vagueness.”). This rule “makes no exception for conduct in the form of speech.” Humanitarian Law Project, 561 U.S. at 20. Concluding that certain activity “fall[s] comfortably within the scope of” an allegedly vague statute, id. at 22, does not usurp the jury’s role when courts can find as a matter of law that the conduct is “plainly prohibited,” id. at 23. If a court determines as a matter of statutory interpretation that a complainant’s own conduct was criminal, it may not “analyz[e] other hypothetical applications of the law”—that is, invoke the fair-notice rights of others—to strike down a statute as vague in all of its applications. Hoffman Estates, 455 U.S. at 495. But such a disposition is available only if “[a]pplying the statutory terms . . . does not require . . . untethered, subjective judgments.” Humanitarian Law Project, 561 U.S. at 21; see also id. (concluding that most of plaintiffs’ proposed activities fit the “narrowing [statutory] definitions” of the terms “training” and “expert advice or assistance”). When a complainant whose conduct was not “clearly” proscribed as a matter of law raises a facial vagueness challenge, the court may properly consider “the vagueness of the law as applied to the conduct of others.” Hoffman Estates, 455 U.S. at 495. When a court does “hold a statute to be vague [on its face]” because of its irreducible subjectivity, “it is vague in all its applications,” even if virtually everyone would agree that “some conduct . . . clearly falls within the provision’s grasp.” Johnson, 135 S. Ct. at 2561. Accordingly, a legislature may not, for example, prohibit people from behaving “‘in a manner annoying to persons walking by’—even though spitting in someone’s face would surely be annoying.” Id. (citing Coates, 402 U.S. at 611). And a merchant charging a thousand dollars for a pound of sugar can successfully 8 challenge a statute criminalizing “unjust or unreasonable rate[s]” as facially vague, even though virtually no one would characterize such a price as just or reasonable. Id. (citing United States v. L. Cohen Grocery Co., 255 U.S. 81, 89 (1921)). The fundamental subjectivity of these terms would preclude a court from holding that any conduct plainly falls within their reach. Lastly, courts must consider whether a provision is fairly “amenable to a limiting construction” before striking it down as vague. Skilling v. United States, 561 U.S. 358, 405 (2010); see also id. at 410 (paring potentially vague statutory language down to its “core applications”); Hoffman Estates, 455 U.S. at 494 n.5 (“In evaluating a facial challenge to a state law, a federal court must . . . consider any limiting construction that a state court or enforcement agency has proffered.”). For instance, a “contextual evaluation” of the statutory structure and the setting in which the relevant behavior occurred may help “determine[] the scope of the regulation.” United States v. Thomas, 864 F.2d 188, 197 (D.C. Cir. 1988). In some situations, the text of “a statute written specifically for [a certain] context” may be fairly limited to prohibit only those activities “impact[ing] . . . the normal activities” of the forum. Grayned, 408 U.S. at 112; see also United States v. Agront, 773 F.3d 192, 197 (9th Cir. 2014) (reasoning that “the requisite quantum of noise is found by looking to the context in which the regulation applies”). B. Defendants’ Facial Vagueness Challenges 1. “Loud” Defendants first claim that the Uttering Clause’s prohibition of “loud” language is unconstitutionally vague in all of its applications. What of the schoolteacher, Defendants ask, who realizes that she will need to raise her voice outside the Supreme Court building in order to instruct her charges amidst the hubbub of First Street? Or the patron of the Supreme Court cafeteria who wishes to be heard over the clangor of nearby construction? Defendants argue that 9 the word “loud” furnishes visitors “no criteria at all by which to determine whether their speech will be criminal.” Mot. Dismiss 13. Defendants further complain that the prohibition of “loud” language “vests too much discretion in the police.” Id. Depending on the sensibilities of the nearest officer, that provision would allegedly permit the arrest of someone who “briefly crie[d] out after accidentally dropping a heavy object on his foot,” or a passerby “speaking on the sidewalk just loudly enough to be heard over the traffic.” Id. at 14. Because Count Two now charges Defendants with violating the Uttering Clause only in the Supreme Court building, most of these examples are geographically beside the point. But Defendants have adequately registered their more general line-drawing concern with the word “loud.” Whether a criminal statute comports with due process must “be examined in the light of the conduct with which a defendant is charged.” United States v. Nat’l Dairy Prods. Corp., 372 U.S. 29, 33 (1963). So the question is whether the Uttering Clause’s prohibition of “loud” language gave Defendants insufficient notice of what the clause criminalized, or invited arbitrary and standardless law enforcement, in the context of interrupting an oral-argument session at the Supreme Court. Even with the clause’s parameters thus confined, this is not a case in which the provision “by [its] terms . . . appl[ies] without question to certain activities,” with marginal or doubtful cases possible to imagine. Goguen, 415 U.S. at 578. For a court cannot hold that an impermissibly subjective criminal statute clearly applies to any conduct. The statute does not define “loud,” nor (so far as the Court is aware) does that adjective have any “settled legal meaning[].” Williams, 553 U.S. at 306; cf. Humanitarian Law Project, 561 U.S. at 21 (“Congress also took care to add narrowing definitions to the material-support statute over time. These definitions increased the clarity of the statute’s terms.”). Well-regarded dictionaries 10 define “loud” simply as “[s]trongly audible; making a powerful impression on the sense of hearing,” 2 and “marked by intensity or volume of sound.” 3 The Court discerns no objective criteria for determining that a noise’s audibility is strong enough, that the sense of hearing has been subjected to a powerful enough impression, or that a sound generates sufficient intensity. These uncontroversial definitions of “loud” boil down to an irreducibly subjective formulation: producing enough volume to cause some set of human beings to describe it as strongly audible, powerful, or intense. The context at issue here—ongoing judicial proceedings in which Defendants had been warned to “remain silent,” Opp’n 3—only deepens this indeterminacy. One police officer might conclude that any verbal communication qualifies as “loud” in the relative solemnity of a Supreme Court session, whereas another might believe himself authorized to arrest visitors who shout at the top of their lungs, but not distinctly audible whisperers and chatterers. It is true that “we can never expect mathematical certainty from our language.” Grayned, 408 U.S. at 111. But we can expect that our criminal law not “condition[] . . . liability on confusing and ambiguous criteria.” Colautti v. Franklin, 439 U.S. 379, 394 (1979). To be sure, § 6134’s prohibition of “loud” language calls for a different sort of subjective judgment than has been condemned in most of the Supreme Court’s prior vagueness cases. Under these decisions, legislatures may not criminalize “annoying” behavior, Coates, 402 U.S. at 611, or prosecute as “vagrants” those deemed to be “[r]ogues and vagabonds,” “persons who use juggling,” “common night walkers,” or “habitual loafers,” Papachristou v. City of Jacksonville, 2 Oxford English Dictionary Online (Sept. 2015), http://www.oed.com/view/Entry/110467? isAdvanced=false&result=1&rskey=iMLDkO& (last visited Dec. 22, 2015). 3 Merriam-Webster Online Dictionary, http://www.merriam-webster.com/dictionary/loud (last visited Dec. 22, 2015). 11 405 U.S. 156, 156–57 n.1 (1972). Nor may they prohibit people from treating the U.S. flag “contemptuously,” Goguen, 415 U.S. at 568; require criminal suspects to provide “credible and reliable” identification to police officers, Kolender v. Lawson, 461 U.S. 352, 353 (1983); forbid the electronic transmission of “indecent” communications, Reno v. ACLU, 521 U.S. 844, 871 (1997); or define “loitering” as remaining in one place “with no apparent purpose,” Morales, 527 U.S. at 61. Such amorphous standards transfer policymaking to police and juries with no plainly proscribed activity from which to analogize. A prohibition of “loud” language at least requires some baseline level of noise, even if the proscribed decibel range is not marked “with consummate precision.” Thomas, 864 F.2d at 195. But a statute forbidding “unjust or unreasonable rate[s]” was struck down in L. Cohen, 255 U.S. at 89, even though some monetary charge was undoubtedly necessary for criminal liability and the real difficulty lay in determining exactly which rates were excessive. A prohibition of merely “loud” language—like one on charging “unjust or unreasonable rate[s]”—simply “has no core.” Goguen, 415 U.S. at 578. That is not the end of the matter, however. As the Supreme Court has observed, “[i]t has long been our practice, . . . before striking a federal statute as impermissibly vague, to consider whether the prescription is amenable to a limiting construction.” Skilling, 561 U.S. at 405. The Ninth Circuit very recently reviewed—and declined to strike down as vague—a regulation quite similar to the Uttering Clause. See United States v. Agront, 773 F.3d 192 (9th Cir. 2014). That regulation prohibited “[d]isorderly conduct which creates loud, boisterous, and unusual noise” on property under the control of the Department of Veterans Affairs. 38 C.F.R. § 1.218(b)(11). The regulation also defined “Disturbances” as, among other things, “[c]onduct on property which creates loud or unusual noise.” Id. § 1.218(a)(5). After concluding that both subsections were designed “to maintain a calm environment at VA facilities,” the Ninth Circuit held that the 12 regulation prohibited only such noise as “would tend to disturb the normal operation of a VA facility.” Agront, 773 F.3d at 197. Even though the regulation did “not identify a specific decibel level,” the court was satisfied that “the normal operation of VA facilities provides an adequate measure for determining what constitutes prohibited conduct.” Id. at 198. The Ninth Circuit patterned its opinion on the Supreme Court’s in Grayned v. City of Rockford. Grayned upheld an ordinance prohibiting “the making of any noise or diversion which disturbs or tends to disturb the peace and good order of [a] school session.” 408 U.S. at 108. Although the “prohibited quantum of disturbance [wa]s not specified in the ordinance,” the Supreme Court concluded that forbidden activities could be “easily measured by their impact on the normal activities of the school.” Id. at 112. The Court adopts the same approach here. The Government may prosecute Defendants for having “utter[ed] loud . . . language in the Supreme Court Building,” but only insofar as their utterances disturbed or tended to disturb the normal operations of the U.S. Supreme Court. Such a construction is “fairly possible,” Boos v. Barry, 485 U.S. 312, 331 (1988), and accords with Congress’s evident intent to preserve the order, decorum, and proper functioning of the nation’s highest Court.4 4 It is worth noting that this construction of the Uttering Clause overlaps considerably—perhaps entirely—with Regulation Five of the Supreme Court’s Building Regulations. 40 U.S.C. § 6102(a)(2) authorizes the Marshal of the Supreme Court, with the approval of the Chief Justice, to prescribe regulations “that are necessary for . . . the maintenance of suitable order and decorum within the Building and grounds.” These regulations carry the same penalties as violations of the Harangue and Uttering Clauses. 40 U.S.C. § 6137. Regulation Five forbids the creation of “noise disturbance[s]” within the Supreme Court Building and grounds, defined (in part) as “any sound that . . . tends to disturb the order and decorum of the Supreme Court.” Regulation Five, Supreme Court of the United States: Building Regulations, http://www .supremecourt.gov/publicinfo/buildingregulations.aspx (last visited Dec. 22, 2015). The existence of Regulation Five does not affect the Court’s holding. The Court would have adopted its present construction of § 6134 had Regulation Five never been promulgated; it will not 13  2. “Harangue” and “Oration” No principled limiting device exists to alleviate the vagueness of § 6134’s other contested terms, “harangue” and “oration.” Section 6134 fails to define either term, and neither one appears to have a “settled legal meaning[].” Williams, 553 U.S. at 306. The Government has not cited any case law that might crystallize the words’ ambiguous meanings in the context of a legal venue like the Supreme Court. From leading dictionaries’ entries on “harangue” and “oration,” the Court discerns not an objective and neatly isolable core, but a multiplicity of meanings—many inviting purely subjective reactions—that it cannot referee in any neutral fashion. Although § 6134 was passed in the mid-twentieth century, 5 the word “harangue” is something of an anachronism. It appears in no other federal statute or regulation, civil or criminal. The various definitions of “harangue” rest largely on subjective assessments of the nature of the speech involved. The Oxford English Dictionary defines “harangue” as “a speech addressed to an assembly; a loud or vehement address, a tirade; formerly, sometimes, a formal or pompous speech.” 6 According to Merriam-Webster, a “harangue” is “a forceful or angry invalidate an act of Congress merely because the Marshal and Chief Justice have implemented a broad grant of authority in a way that closely resembles the limiting construction this Court has placed on § 6134, which was adopted by a separate set of legal actors. 5 1949, to be precise. For a brief history of Congress’s enactment of the set of statutes regulating conduct in the Supreme Court building and grounds, see Hodge v. Talkin, 949 F. Supp. 2d 152, 162–63 (D.D.C. 2013), overruled on other grounds by Hodge v. Talkin, 799 F.3d 1145 (D.C. Cir. 2015). 6 Oxford English Dictionary Online (Sept. 2015), http://www.oed.com/view/Entry/84094?rskey =vY8eQx&result=1#eid (last visited Dec. 22, 2015). 14 speech,” “a speech addressed to a public assembly,” or “a ranting speech or writing.” 7 And Ballentine’s Law Dictionary defines “harangue” as “[a] noisy, bombastic, ranting speech.” 8 Citing other dictionaries would only compound the uncertainty by expanding the pool of possible meanings. The Government proposes that the Court exalt one element of one dictionary’s multi- part entry by deeming the word’s “ordinary definition” to be “a forceful or angry speech.” Opp’n 29. Even accepting this suggestion, whether certain utterances are “forceful” or “angry” cannot be determined without reference to subjective perceptions and individual sensitivities. The same is true of the alternative modifiers “vehement,” “formal,” “pompous,” “ranting,” “noisy,” and “bombastic.” Case law on the meaning of “harangue,” such as it is, hardly clarifies its subjective and multiple dictionary definitions. A state supreme court has reported that a trial judge verbally reprimanded a defendant who “interrupted the proceedings with verbal protests”—much as Defendants allegedly did here—for engaging in a “harangue.” Quintana v. Virginia, 295 S.E.2d 643, 651 (Va. 1982). Yet widely varied usages of that word abound. See, e.g., Edwards v. South Carolina, 372 U.S. 229, 233 (1963) (citing a city manager’s statement that a “religious harangue” was one element in what he described as a course of “boisterous, loud, and flamboyant conduct”) (internal quotations omitted); Ognibene v. Parkes, 671 F.3d 174, 199 (2d Cir. 2011) (contrasting “[p]assing criticisms” with “passionate harangues” by reference to “the intensity of a speaker’s expression”); White v. Dunlap, 175 F. Supp. 2d 1281, 1284 (D. Kansas 2001) (stating that someone who allegedly “yell[ed] and scream[ed]” and “ranted for hours” would have engaged in 7 Merriam-Webster Online Dictionary, http://www.merriam-webster.com/dictionary/harangue (last visited Dec. 22, 2015). 8 Ballentine’s Law Dictionary 548 (3d ed. 1969). 15 a “harangue”); Pennsylvania v. Brown, 164 A. 726, 728 (Pa. 1933) (quoting a jury instruction as having defined “harangue” as “a noisy, bombastic, ranting speech,” in accordance with Webster’s New International Dictionary). The word “harangue” simply has no “unambiguous scope,” Hoffman Estates, 455 U.S. at 494 n.6—no heartland of “paramount applications” to furnish a secure limiting principle, Skilling, 561 U.S. at 404. There is no indication that Congress “certainly intended the statute to cover” at least the most narrow definitional formulations of “harangue.” Id. For all the Court can tell, an additional requirement of pomposity, vehemence, or bombast was meant to differentiate “harangue” from its clausal neighbor, “oration.” And especially given that “a more stringent vagueness test” applies to criminal statutes that interfere with First Amendment rights, Humanitarian Law Project, 561 U.S. at 19 (quoting Hoffman Estates, 455 U.S. at 499), the Court will not strain to salvage an amorphous criminal provision in the absence of any principled guidance. The term “harangue” is therefore unconstitutionally vague on its face, and a prosecution for making one would violate the Due Process Clause. 9 9 The definitional imprecision of “harangue” is exacerbated by the rarity of its use in modern American English. Google’s Ngram Viewer—which plots the “frequency of usage of selected words in the aggregate corpus of published books in different historical periods,” Authors Guild v. Google, Inc., 804 F.3d 202, 217 (2d Cir. 2015)—confirms that “harangue” is somewhat of a linguistic artifact. According to this fascinating tool, the word’s relative usage peaked in this country amid the fervent speechifying of the Revolutionary War, and has declined steadily ever since, with blips in the first and last decades of the nineteenth century. Whereas “harangue” once vastly overshadowed its kindred nouns “tirade,” “diatribe,” “jeremiad,” and “philippic,” Ngram Viewer indicates that all five words now appear at a similarly infrequent rate, with “harangue” (including its verb form) running in second place as of 2008, slightly ahead of “diatribe.” (A visual representation of the Court’s Ngram search is attached as Appendix A to this opinion). While the Court does not rest its holding on the word’s dwindling use, these findings lend some support to the conclusion that § 6134’s ban on harangues does not put today’s ordinary American on notice of how not to behave in and around the Supreme Court. 16  Section 6134’s prohibition on making an “oration” suffers a similar fate. While the term is certainly more familiar to the average citizen than “harangue,” it appears (but is not defined) in only one other federal statute, where making an “oration” is deemed to be a form of “demonstration” forbidden on certain federal cemetery property. See 38 U.S.C. § 2413. An accompanying regulation similarly prohibits “[e]ngag[ing] in any orations” on Arlington National Cemetery grounds. 32 C.F.R. § 553.22(f)(3). The Court has found just one other use of the word “oration” in a federal regulation—38 C.F.R. § 1.218(a)(14)(ii)’s prohibition of “any . . . demonstration” on VA property, defined (in part) as “any oration or similar conduct to assembled groups of people.” The context of these statutes hardly sharpens the term’s meaning—these usages merely clarify that orations have been understood to qualify as one form of demonstration, and that orations can be made to assembled groups of people. The Oxford English Dictionary defines “oration” as “[a] formal discourse delivered in elevated and dignified language, esp. one given on a ceremonial occasion such as a public celebration, a funeral, etc.”10 Merriam-Webster’s entry is quite similar: “a formal speech,” or “an elaborate discourse delivered in a formal and dignified manner.” 11 As with “harangue,” the Government asserts that a fragment of one of these entries is the word’s “ordinary definition”— namely, “a formal speech.” The problem with this attempted narrowing is that understandings of formality are “varying and unascertainable,” because they are inevitably “colored by one’s attitude[s],” background, and life experiences. Big Mama Rag, 631 F.2d at 1037–38. What strikes one observer as gruff and unceremonious may seem to another perfectly decorous and 10 Oxford English Dictionary Online (Sept. 2015), http://www.oed.com/view/Entry/132195? isAdvanced=false&result=1&rskey=gojAyw& (last visited Dec. 22, 2015). 11 Merriam-Webster Online Dictionary, http://www.merriam-webster.com/dictionary/oration (last visited Dec. 22, 2015). 17 mannerly. There is simply “no value-free measurement” of what characteristics render a manner of speaking “formal,” id. at 1038, even in the special setting of ongoing judicial proceedings. The same is true of at least the adjectives “elevated,” “dignified,” and “elaborate.” The Court’s research has uncovered almost no case law elucidating the meaning of “oration.” One state supreme court has “supposed” that “‘an oration’ is ‘a public address.’” Massachusetts v. Gilfedder, 73 N.E.2d 241, 242 (Mass. 1947). And in determining whether a defendant had “recite[d] an oration,” the City Magistrates’ Court of New York resorted to consulting the works of Plutarch, Aristophanes, Shakespeare, Tennyson, and Milton in holding that reading one’s poetry aloud did not constitute “recit[ing] an oration.” People v. Morris, 201 N.Y.S.2d 739, 740–43 (1960); see also id. at 740 (“The Court has looked to the statute and regulations, as well as the decided cases, and finds no sufficient definition of the term ‘recite an oration’ to control the instant fact situation. Accordingly, the Court has delved into classical authorities for assistance in resolving this question.”). A college literature syllabus is not a penal code. An outspoken “person of ordinary intelligence,” Williams, 553 U.S. at 304, should not be forced to peruse Paradise Regained—or, for that matter, obscure and aging state-court decisions—to skirt the criminal law’s sting. Even if defining “oration” as “a public address” would avert a vagueness challenge (hardly a sure assumption), that choice would require discarding the Oxford English Dictionary and Merriam- Webster entries for “oration,” both of which entail something more than vocalization in the presence of others—namely, a degree of formality or solemnity. Glossing over a word’s central distinguishing feature would be an act of judicial will, not of principled construction. It is not as if the “vast majority” of existing authorities embody such a limitation. Skilling, 561 U.S. at 407 (quoting United States v. Runnels, 833 F.2d 1183, 1187 (6th Cir. 1987)). 18  * * * The Government may proceed under the theory that Defendants uttered “loud” language that disturbed or tended to disturb the normal operations of the U.S. Supreme Court. But the terms “harangue” and “oration” are unconstitutionally vague in all of their applications. Congress has not defined these words, nor has their meaning “evolved over the years from repeated adjudications.” U.S. Civil Serv. Comm’n v. Nat’l Ass’n of Letter Carriers, AFL-CIO, 413 U.S. 548, 572 (1973). Due process demands greater rigor in deploying the “awful machinery of the criminal law.” United States v. Kozminski, 487 U.S. 931, 950 (1988) (quoting United States v. Shackney, 333 F.2d 475, 487 (2d Cir. 1964)). And the Court will not impose a false consensus on the linguistic community for the sake of constitutional avoidance. IV. Conclusion For the forgoing reasons, the Court will grant in part and deny in part Defendants’ motion to dismiss. A separate order accompanies this Memorandum Opinion. CHRISTOPHER R. COOPER United States District Judge Date: December 22, 2015 19 Appendix A

Detection of low dose effects of psychopharmaca: Application of a semi-Marcov model to rhesus monkey behaviour. Behavioural testing of psycho-active drugs at lower doses is needed for medical applications and for the study of pharmacological brain mechanisms. Sensitive methods to detect effects on the time structure of behaviour are lacking. We propose a procedure based on a description within the framework of continuous time Marcov chain models. This class of models is generalized to account for constraints on the organisation of a motor pattern including the speed at which it is terminated. This leads to semi-Marcov models with transition rates that quickly increase from zero to a constant level. We describe and compare several models. As an application we consider amphetamine effects on infant rhesus monkeys. One of the models is preferred since, besides giving a good fit, it demonstrates consistent amphetamine effects that can be interpreted as short-term effects on motor constraints. Amphitamine also induced more mother-directed behaviour. We give maximum likelihood procedures for behaviour analysis based on the preferred model.

The Peninsula (newspaper) The Peninsula is an English language daily published from Doha, Qatar. Its main competitors are the Gulf Times and the Qatar Tribune. History The Peninsula was launched in 1996 by Dar Al Sharq. The company also publishes the Arabic news daily Al Sharq and recently launched (February 2016) Arabic business daily Lusail. The company is headed by chairman Thani bin Abdullah Al Thani, a member of the ruling family. Management The Peninsula is headed by editor-in-chief Khalid Bin Mubarak Al-Shafi. Format The Peninsula is published in all-colour broadsheet format and number of pages vary from 24 to 40. On weekdays they have 36 pages in the main section, which is divided into 24 pages on local and international news, 8 pages business news and 8 pages sports news. On weekends (Friday and Saturday) the newspaper is only 24 pages and single section. It also have a 16-page community news tabloid called Doha Today published along with the newspaper from Sunday to Thursday. On Friday they have 16-page weekend tabloid named The Peninsula Plus.They also have a classified advertisement pullout called Penmag which is in tabloid format and published during the weekdays. References External links The Peninsula Newspaper Category:1996 establishments in Qatar Category:English-language newspapers published in Qatar Category:Media in Doha Category:Publications established in 1996

The development of semiconductor memory technology is essentially driven by the requirement for increasing the performance of the semiconductor memories in conjunction with miniaturization of the feature sizes. However, further miniaturization of the semiconductor memory concepts based on storage capacitors may be difficult due to the large quantity of charge that is required for writing to and reading from the storage capacitors, which leads to a high current demand. Therefore, thought is increasingly being given to new cell concepts that are distinguished by a significantly lower quantity of charge for the writing and reading operation. Semiconductor memories having a resistance memory element that exhibits a bipolar switching behavior are one such new promising circuit architecture. In order to provide maximum density of memory units, it is desirable to provide a cell field consisting of a plurality of memory cells, which are conventionally arranged in a matrix consisting of column and row supply lines, called also word and bit lines, respectively. The actual memory cell is usually positioned at the crosspoints of the supply lines that are made of electrically conductive material. The word and bit lines are each electrically connected with the memory cell via an upper or top electrode and a lower or bottom electrode. To perform a change of the information content in a particular memory cell at the addressed crosspoint, or to recall the content of the memory cell, the corresponding word and bit lines are selected either with a write current or with a read current. To this end, the word and bit lines are controlled by appropriate control means. There are several memory cells that are able to fit into such memory cell arrangement. For example, RAM (Random Access Memory) comprises a plurality of memory cells that are each equipped with a capacitor that is connected with a so-called selection transistor. By selectively applying a voltage at the corresponding selection transistor via the word and bit lines, it is possible to store electric charge as an information unit (bit) in the capacitor during a write process and to recall it again during a read process via the selection transistor. A RAM memory device is a memory with random access, i.e., data can be stored under any particular address and can be read out again under this address later. Another kind of semiconductor memory is DRAM (Dynamic Random Access Memory), which comprises in general only one single, correspondingly controlled capacitive element, e.g., a trench capacitor, with the capacitance of which one bit each can be stored as charge. This charge, however, remains for a relatively short time only in a DRAM memory cell, so that a so-called “refresh” must be performed regularly, wherein the information content is written in the memory cell again. Since it is intended to accommodate as many memory cells as possible in a RAM memory device, one has been trying to realize them as simple as possible and on the smallest possible space, i.e., to scale them. The previously employed memory concepts (floating gate memories such as flash and DRAM) will, due to their functioning that is based on the storing of charges, presumably meet with physical scaling limits within foreseeable time. Furthermore, in the case of the flash memory concept, the high switching voltages and the limited number of read and write cycles, and in the case of the DRAM memory concept the limited duration of the storage of the charge state, constitute additional problems. The CBRAM (conductive bridging RAM) memory cell, also known as a programmable metallization cell (“PMC”), may be switched between different electric resistance values by bipolar electric pulsing. In the simplest embodiment, such an element may be switched between a very high (off resistance) and a distinctly lower (on resistance) resistance value by applying short current or voltage pulses. The switching rates may be less than a microsecond. Very high ratios of the off resistance (R(off)) to the on resistance (R(on)) are achieved in the case of the CBRAM cells, due to the very high-resistance state of the solid electrolyte material in the non-programmed state. Typical values are R(off)/R(on)>106 given R(off)>1010′Ω and an active cell area <1 μm2. At the same time, this technology is usually characterized by low switching voltages of less than 100 mV for initiating the erase operation and less than 300 mV for the write operation. In structural terms, a CBRAM cell is a resistance memory element comprising an inert cathode electrode, a reactive anode electrode and a solid state electrolyte arranged between the cathode and anode. The term “solid state electrolyte,” as referred to herein, includes all solid state materials in which at least some ions can move under the influence of an electric field. The surfaces of the chalcogenide material, usually provided in a CBRAM cell are deposited by means of sputtering methods, have an amorphous structure and frequently contain superfluous chalcogenides that are poorly bound so that these weakly bound chalcogenide atoms are conglomerated like clusters and cannot be removed, which leads to the formation of Ag-chalcogenide conglomerates or protrusion defects in the Ag doping and electrode layer, which usually is made of Ag. In addition, the etch process of noble metals is difficult as no etch chemistry exists for etching silver, for example. It is, thus, difficult to obtain a homogeneous, planar anode for the CBRAM cells using silver. Current approach is to simultaneously deposit silver together with the other metallic material in a co-sputtering process. However, the planarization and the structuring of the anode has to be done using a physical process.

TV Reviews All of our TV reviews in one convenient place. Prev Next View All Battlestar Galactica Season 1 A- Miniseries, Part 1 Episode 1 Here we are, at the beginning. A miniseries is a weird way to start an hourlong show—it’s a deliberately irregular pace compared to what the rest of the show is going to do, and it requires an awful lot of investment from first-time viewers trying to get into the series. So it’s weirder still that it works for Battlestar Galactica. Partly that’s because the show has so much it needs to establish in the first few episodes. Partly, there’s something, too, in the tone three hours of cinema sets that an hourlong episode can’t quite provide, no matter how gripping it is. The miniseries is pure immersion, and as many fans of Battlestar came to it on Netflix or DVD, this is a show built for and on the wholehearted dedication of binge-watching. This miniseries has its issues. David Sims, dearly departed from The A.V. Club, pronounced it “meh” to me yesterday. He’s wrong, but it’s a fair assessment. The miniseries is long, at times very slow, and given how many characters are introduced, their sudden dramatic lines (or in Commander Adama’s case, speeches) are hard to swallow. (Helo’s line to Boomer as they’re debating bringing Gaius onto the ship is a great example of the melodrama: “Sharon. Look at these clouds and tell me this isn’t the end of everything.”) But the miniseries has an awful lot to do in its three hours, and this first half has to do the heavy lifting of introducing a whole world and then making the audience care about it. Given how difficult its job is, it succeeds admirably. Battlestar Galactica isn’t really comprehensible without the miniseries—and it’s fascinating that the show was so unafraid to establish a whole universe in a few scant minutes. It’s a type of world-building best-suited to endless franchises—the multi-book series, the film trilogy, the serialized television show. The detail is there for richness, not for third-act plot expediency. Battlestar Galactica has to sell this world hard right from the start, and from my point of view, it does a great job. The first half-hour to 45 minutes of the miniseries, I’d argue, are the strongest; once the actual war starts, the show shifts gears, moving into a mode that it adopts for the rest of the series—the slow process of enduring a war of attrition. And the way it builds that world is with a kind of atmospheric detail that is surprising, even now, 10 years later. Syfy might not have granted Battlestar the biggest special-effects budget out there, but the show makes up for it with other props, some tangible, some not: the intercom system, the uniforms, the lighting, the rank insignia on everyone’s sleeves. The language of the show, which is a coherent, lively prop within itself—offering clues on the world’s treatment of gender, the cylons, the life of the soldiers on the Galactica, and of course, that lovely workaround “frak,” which gives the show an ability to be powerful without ever saying that other f-word. (I’d love to build a glossary of terms from this show: Just in this episode, there’s “FTL drive,” “hyper-light,” “thank the lords of Kobol,” and “frak,” and that doesn’t include terms that have been updated to serve the show’s purposes, like “action stations,” “sir,” and “toaster.”) Every show creates some kind of dialect, but Battlestar Galactica developed it consciously and wholly; from the first minute there is a fullness to the narrative that seems endless. And the miniseries has to do that, in order to make the next part matter. Because once the world is established, and the major characters all introduced, Battlestar Galactica starts doing terrible things to them. And if the audience doesn’t care, then it’s just not that meaningful. It’s a pacing change that is almost abrupt: The episode starts with smooth tracking shots and bright walk-and-talk scenes that would make Aaron Sorkin proud, before moving to choppy, occluded shots of black space and distant, silent explosions. Light, quite literally, is extinguished from the world. And as it is, the scenes suddenly become protracted, so tension can pool in between shots. Essentially, the miniseries is training us to feel terrified for these characters on a regular basis. Without much warning, it inserts us, the audience, into the wrong side of a war—the losing side. And not just losing, but like, totally fucked losing. The humans have no chance of getting out of this. And that realization is a slowly dawning one, for all of the characters, and for the audience too. A lot of this process of revisiting Battlestar Galactica will be comparing what it first felt like with what it feels like now—answered questions, solved mysteries, dichotomies that are much grayer than they first appear. The word “subvert” gets thrown around a lot in criticism, but I think it’s valid here: Battlestar Galactica starts out telling an adventure story and then does almost the exact opposite of what you’d expect. By the end of the miniseries, especially, nothing feels like it should, and that is gripping, and addictive, too. If Battlestar Galactica is a big coloring book, much of what I’ve discussed above are the lines. It’s the execution that gives the pages color, and a lot of that comes down to the performances. A lot of this episode is dedicated just to showcasing the performances of these characters, who are so wholly embedded in their roles it’s hard to believe they haven’t been playing these characters for years. Katee Sackoff’s appearance as Starbuck is visually a ball of energy in the otherwise somber ship (her blonde hair helps set that off, contrasted against Galactica’s gloomy halls). Mary McDonnell’s line deliveries, somehow both warm and dry at the same time, elevate what could be casual posturing or stereotypical maternal bossiness into the sketches of a complex, strong character. Edward James Olmos makes material that really should be cheesy into stirring, grand speeches—he somehow always makes it sound like he’s speaking straight from the heart. (I have my reservations about how well his performance ages in the series, but it’s good in this first episode.) Even the fringe cast finds a niche and works with it. The attack on Caprica happens about 45 minutes in, and it amazed me, in this rewatch, how invested I was in the characters and their welfare already. It’s that kind of panic that keeps you watching. Several months ago I tossed off a crack about Tricia Helfer’s acting skills in a review of a new drama she was in, Killer Women. A lot of people reached out to me to tell me that I was wrong, which is fair. I underestimated her. I’ve had a lot of trouble caring about Six and Gaius’ love connection, and I’m not sure why. Rewatching, though, I found myself asking a lot of questions about who Six is, and why she does what she does. We see two different copies of her in this episode—and then the hallucination of her, in Gaius’ head, who will end up becoming quite the fixture. With all of them, Helfer has a delicate anxiety that weighs on her, even as it lends her grace. She’s actively tortured by what she’s doing, even though she’s also convinced that it’s God’s plan. Insofar that this show has a single villain, Six is the closest we come—she’s the first and most ubiquitous representative of the cylons, both beautiful and terrible. It brings me to the opening scene of Battlestar Galactica, which is one of the more indelible images of the series, I think—the one where Six walks into the space station, flanked by toasters, and says to the man waiting there: “Are you alive?” What does “alive” even mean to her, I wonder? She is genuinely fascinated with life’s fragility, its creation and destruction. She’s genuinely fascinated with human frailty, too—Gaius’ selfishness fascinates her, even as it pains her. And to her, life is a whole different thing than it is for humans. It’s a continuum that transcends a mere body; and yet, what a body. I’m not trying to be gratuitous with that—her body is so much of her character, in that, she is beautiful and carefully well-dressed and physically making love to Gaius and making out with an anonymous space station official. Gaius says: “You’re a cylon.” She responds: “I’m a woman.” There are many copies of Six. Each one has a body that is a weapon. That is striking. In many ways that moment with Six walking into the space station is the image of the series—a complex computer wearing a red dress entering a scene knowing that she is going to win, and choosing to engage with human life before discarding it. (With her tongue. But still.) Above all what the miniseries does is remind humanity of its own flaws. In this case, the flaws became sentient and came back and nuked their parents, and maybe we’re not there just yet. But so much of the fundamental guts of this series strikes at the basic question of what it means to be the most powerful species on a fragile planet, whether we like it or not. Sure, the people we see didn’t do anything themselves—instead they all inherited a shitty situation. But, now what? Do they deserve saving, as Adama asks? Do we? It’s a strikingly reasonable question—and one that Six is bringing to us in one hand, while wielding vengeance in the other. So say we all: Original airdate: 12/8/2003 12/8/2003 If I had to point to a specific way this first episode falls short, it’s that it introduces a few conflicts that are totally boring with a few that feel entirely vital, but it doesn’t seem to know which is which. (This is the problem the show has forever, so, yeah.) For example, Lee’s conflict with his father and Starbuck over Zak bores me to tears—it seems to exist purely so Adama can make that portentous speech where he says: “The day comes when you can’t hide from the things you’ve done anymore.” It’s a great line—and follows the quote I used above as the sub-headline of the review, to point to the idea of humanity’s reckoning with its works. But inter-Adama drama is a lot less interesting than the show thinks it is. I never thought this before, but the narrative of a warrior class being prepared for an ancient threat that everyone else has dismissed is really similar to Anne McCaffery’s The Dragonriders Of Pern series. “War… with the cylons?” “This better be for real.” Adama speech count: 2. One at the decommission ceremony; one over the intercom. 2. One at the decommission ceremony; one over the intercom. Everything Laura Rosslin says is perfect, but I particularly loved her response to the question, “Wait, who put you in charge?” “Well, that’s a good question. The answer is ‘no one.’” It has a faint uptick to it, like she’s asking a question, but she is totally not. That’s the schoolmarm with complete command of her classroom talking. Rosslin’s call sign: D-456-345-A This is the list of characters in this episode, by appearance. It interested me to see that cylons are two of the three first people we get to know: Six Starbuck Five Commander Adama Callie Gaeda Tighe The Chief (Lee, in a photograph) Boomer Helo Laura Roslin Billy Lee Gaius Apollo Dee I have always been fond of the useful explanation for why everything in the battlestars is so retro—corded phones and no Internet. “We were so frightened by our enemies that we literally looked backwards for protection.” Have you spent hours trying to rationalize why everything in the world of BSG has cut corners? I have! I am forever rooting for The Chief and Boomer together, which means I am forever unhappy. But this scene of theirs at the beginning is so cute: “The gimble is broken.” “Shut up, sir.” The shot of the bodies of the Chief’s men being expelled into hard vacuum hurts every time. It’s well done. Which leads to a real question: Why does Adama trust Tighe? He is a sloppy mess in this first episode. Office of the XO: Here’s how the logistics of this season’s coverage will play out. I’ll do each half of the miniseries in one review, and then take two episodes a week for the rest of the series. I think I’m going to try to do both halves of season one’s finale “Kobol’s Last Gleaming” in the same review, though, so there might be one review with three episodes jammed together, or one week with just one episode. If you have any suggestions or requests, let me know. Here’s how the logistics of this season’s coverage will play out. I’ll do each half of the miniseries in one review, and then take two episodes a week for the rest of the series. I think I’m going to try to do both halves of season one’s finale “Kobol’s Last Gleaming” in the same review, though, so there might be one review with three episodes jammed together, or one week with just one episode. If you have any suggestions or requests, let me know. Favorite character time: Yeah, why not? We’re going to be here a while. My choice is always Kara Thrace, though whenever I see either The Chief or Laura Rosslin on-screen, my love is sorely tested. Anyone out there for Gaius, who is my least favorite?

<?php namespace frontend\controllers\cabinet; use shop\readModels\Shop\ProductReadRepository; use shop\useCases\cabinet\WishlistService; use Yii; use yii\filters\AccessControl; use yii\filters\VerbFilter; use yii\web\Controller; class WishlistController extends Controller { public $layout = 'cabinet'; private $service; private $products; public function __construct($id, $module, WishlistService $service, ProductReadRepository $products, $config = []) { parent::__construct($id, $module, $config); $this->service = $service; $this->products = $products; } public function behaviors(): array { return [ 'access' => [ 'class' => AccessControl::className(), 'rules' => [ [ 'allow' => true, 'roles' => ['@'], ], ], ], 'verbs' => [ 'class' => VerbFilter::className(), 'actions' => [ 'add' => ['POST'], 'delete' => ['POST'], ], ], ]; } /** * @return mixed */ public function actionIndex() { $dataProvider = $this->products->getWishList(\Yii::$app->user->id); return $this->render('index', [ 'dataProvider' => $dataProvider, ]); } /** * @param $id * @return mixed */ public function actionAdd($id) { try { $this->service->add(Yii::$app->user->id, $id); Yii::$app->session->setFlash('success', 'Success!'); } catch (\DomainException $e) { Yii::$app->errorHandler->logException($e); Yii::$app->session->setFlash('error', $e->getMessage()); } return $this->redirect(Yii::$app->request->referrer ?: ['index']); } /** * @param $id * @return mixed */ public function actionDelete($id) { try { $this->service->remove(Yii::$app->user->id, $id); } catch (\DomainException $e) { Yii::$app->errorHandler->logException($e); Yii::$app->session->setFlash('error', $e->getMessage()); } return $this->redirect(['index']); } }

Q: Replacement for "too" in "too X to Y" In phrases of the form "too X to Y" (e.g. "too big to fail"), can "too" ever be replaced by a word such as "exceedingly", e.g. "exceedingly big to fail"? It sounds wrong to me, although "exceedingly big" on its own sounds certainly correct. If it isn't correct, how else can I express in formal writing that something is "too X to Y" by a large margin? "Much too X to Y" sounds informal. A: Too in the too Adj to VP construction is a negative word. If something is too big to fail, then it's so big that it can't/won't/shouldn't/must not fail. The negative is part of the meaning; the modal (can, will, should, etc.) is supplied by context. This is related to the so Adj that S and such NP that S construction, as in It was so spicy (that) I couldn't eat it. It was such spicy food (that) I couldn't eat it. The too construction uses an infinitive VP instead of a whole tensed clause like the so/such construction, but the sense is the same, except for the hidden negative and modal in the too construction. But they're all idiomatic constructions and don't follow other grammatical rules. Consequently *exceedingly big to fail doesn't work at all.

Inspiring Pleasure and Awe Inspiring Pleasure and Awe By Kelli Frost-Allred A roulette wheel, a hummingbird, a shooting star, and Around the World in 80 Days all share one common thread: Each inspires pleasure and awe, and each moves so quickly the human eye can scarcely track it. Entertainment in the twenty-first century moves at a fast pace, and this play is no exception. If you plan to visit the Utah Shakespeare Festival with children this summer, consider this stage adaptation of the Jules Verne novel, Around the World in 80 Days. All family members, adults and older children alike, will surely find the fun in this globetrotting adventure. (Remember, however, younger children, under age five, are not allowed in Festival theatres.) “Misadventure” better describes the trek of Philias Fogg, an English aristocrat bent on winning a gentlemen’s bet that he can set a new and unthinkable record by circumnavigating the globe in just eighty days. The wager is sizable, the outcome is doubtful, and the risks are great. What, then, would possess Philias Fogg to enter into such a wager? In short, he’s an arrogant know-it-all who insists that with the completion of the Great Indian Peninsula Railway, “one would only need eighty days.” A time machine might be needed to transport the audience back to 1873, the year in which Verne penned the story, when Victorian England was more a land of do’s and don’ts than of imagination and adventure. The visionary Verne created a vehicle (excuse the pun!) that showcased nineteenth century modes of transportation that revolutionized travel: train and steamboat. Around the World in 80 Days will be presented in Utah’s most prestigious and sophisticated indoor theatre, the Randall L. Jones Theatre. But don’t come to this play expecting extravagance and flourish, because playwright Bengt Ahlfors designed the play as a minimalist piece. Few elaborate elements will adorn the plot; few set pieces, scant costume changes, and suggestive props provide the side dishes to the play’s main course. The play moves Philias Fogg and his manservant from one location to the next, introducing new characters at each stop around the globe. These supporting characters are the seasonings that make this theatre piece a satisfying meal. As characters enter the play, they turn to the audience and introduce themselves, giving colorful descriptions of their own unique circumstances. When Fogg finds himself in India without transportation, he offers to buy an elephant. The elephant’s owner asks if Fogg needs “a riding elephant or a fighting elephant?” When Fogg says he needs a riding elephant, the owner responds: “So you want to buy a fighting elephant for riding? It is very important for you to reach Allahabad? And there are no other means of conveyance? Then the price is very high.” Fogg’s lesson in supply and demand continues, to the audience’s amusement. Philias rescues a woman from becoming a human sacrifice in the jungle, sealing his fate as her savior. And while Mrs. Aouda falls in love with Fogg, the audience follows suit, and the stuffy protagonist becomes, in fact, the hero of the play. The secondary plot involves a London detective (Fix) who is on the trail of Fogg. Detective Fix suspects the gentleman of having stolen a large sum of money that turned up missing on the very day Fogg embarked upon his odyssey. Half the fun of the play is seeing Fix fall victim to his own mean-spirited devices. The music of Chopin—a contemporary of Jules Verne—weaves throughout the story and serves to connect what might otherwise be disjointed scenes. “Fantasie impromptu,” a polonaise, a nocturne, a rhapsody, and more become the aural setting for each new horizon. The music lends depth, humor, emotion, and vibrancy to the play. The British once claimed that the “sun never sets on the Union Jack.” Audiences are invited to re-visit the world-according-to-Queen-Victoria. Representing an era characterized by repression, stodginess, and rules, the director and cast of Around the World in 80 Days invite you to join in the fun of uncovering the humor, warmth, creativity, daring, and adventure of the same era. (From Midsummer Magazine, the Official Magazine of the Utah Shakespeare Festival, 2001)

// // EmptyExecutorCommand.swift // OpenTerm // // Created by Louis D'hauwe on 09/04/2018. // Copyright © 2018 Silver Fox. All rights reserved. // import Foundation import ios_system /// No-op command to run. struct EmptyExecutorCommand: CommandExecutorCommand { func run(forExecutor executor: CommandExecutor) throws -> ReturnCode { return 0 } }

Arsenite inhibition of CYP1A1 induction by 2,3,7,8-tetrachlorodibenzo-p-dioxin is independent of cell cycle arrest. We show here that arsenite (As(3+)) elicits multiple effects on gene control, such as the interruption of cell cycle control by initiating G(2)/M arrest as well as inhibiting the aryl hydrocarbon (Ah) receptor-mediated 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD)-inducible expression of CYP1A1. This raises the question as to whether As(3+) is selectively inhibiting TCDD induction of CYP1A1 independent of cell cycle control. As(3+) stimulated a concentration-dependent increase in G(2)/M phase arrest that was detected at 12.5 microM As(3). However, cotreatment of HepG2 cells with TCDD and concentrations of As(3+) as low as 0.5 microM stimulated a pronounced decrease in the induction of CYP1A1-dependent ethoxyresorufin-O-deethylase activity and protein, indicating that the inhibition of CYP1A1 induction by As(3+) was considerably more sensitive than As(3+)-initiated cell cycle arrest. Low concentrations of As(3+) also initiate a dose-dependent reduction in TCDD-induced mouse Cyp1a1 as well as human CYP1A1 in primary hepatocytes cultured from transgenic CYP1A1N(+/-) mice. Because primary hepatocytes in culture are quiescent, these results indicate that the actions of As(3+) on TCDD-initiated induction of CYP1A1 are independent of cell cycle control. As(3+) does not impact on Ah receptor function as evaluated by nuclear transport and binding to xenobiotic responsive element sequences, but it does reduce TCDD-induced CYP1A1 mRNA, a property that is concordant with RNA polymerase II association to the gene and the reduction in transcriptional heteronuclear RNA. We conclude from these studies that interruption of CYP1A1-induced transcription by As(3+) is not dependent upon cell cycle arrest.

The developer of dinosaur survival hit Ark has folded free-to-play spin-off Survival of the Fittest back into the main game, Survival Evolved. This means that Survival of the Fittest will no longer be a separate free-to-play game. But it will be maintained as a playable game mode inside Survival Evolved. "If there are issues with the game, we will resolve them," developer Studio Wildcard promised in a post on Steam. "If we're able to make performance updates due to optimisation work done on the main game, SotF will also receive them. Major content upgrades to SotF will be pending further expansion of the team, and the development kit will continue be updated with content from ARK: Survival Evolved (which can be directly copied into SotF by modders)." Unfortunately, this all means the console (PlayStation 4 and Xbox One) versions of Survival of the Fittest are on hold "so we can take a step back and see how these changes pan out in the long term". "It is very important for us to see how SotF progresses and we want to make sure we're making the right choices," Studio Wildcard continued. "We understand that these changes are quite big and will impact the future of game, but hope you can understand our reasons to do so and will continue to support the game mode you love." Survival of the Fittest was designed as a competitive battle mode for Ark, and began life as an internal mod side-project, but was eventually released standalone earlier this year. Despite being folded back into Survival Evolved, Survival of the Fittest will still exist as its own application, and everyone who has thus-far played the game can continue to play it without having to own the main game. But going forward, Studio Wildcard stressed, Survival of the Fittest should be considered part of Survival Evolved. So, why has Studio Wildcard done this? A lot of it has to do with the release of the Survival of the Fittest development kit. But it's also in part to do with money. Survival of the Fittest was free-to-play in the truest sense. There were no microtransactions. It worked as an Ark demo of sorts, but still came at a cost to Studio Wildcard. "When a game like SotF is made free to play, there are still expenses," the developer explained. "This can range from development work, server costs, running of tournaments, prizes and of course the opportunity cost. "To ensure that SotF would remain a success and a sound choice, Wildcard would have had to put a lot of resources and time into learning how to become a 'free to play' developer. We would have had to learn how to monetise a free game, notoriously through the use of in-app purchases such as skins and other cosmetics. "Ultimately, it's clear this is not who we are, we like to make games, and to make the gameplay fun. We don't know much about monetisation, and quite frankly we aren't interested in hiring an economics team to take over that process, it is much more in our and your best interest for Wildcard to solely focus on the development of a game. "We just aren't cut out for free to play mechanics. With SotF being part of Ark: Survival Evolved, it'll be able to draw from Survival Evolved resource pool directly, and enable us to continue operating the title." Sounds fair enough, really.

17 Mich. App. 585 (1969) 170 N.W.2d 176 CAVANAGH v. CAVANAGH Docket No. 6,063. Michigan Court of Appeals. Decided May 29, 1969. *586 Piggins, Balmer, Grigsby, Skillman & Erickson for plaintiff. Buesser, Buesser, Snyder & Blank, for defendant. BEFORE: McGREGOR, P.J., and R.B. BURNS and DANHOF, JJ. McGREGOR, P.J. This appeal disputes a judgment of absolute divorce granted defendant by the circuit court on the ground of extreme cruelty. The court awarded custody of the four oldest boys, aged 14, 13, 12 and 8, to their father, the defendant, and the other four children to their mother, the plaintiff. The court found that defendant had presented the required proof for a judgment of divorce. Plaintiff contends, however, that statutory grounds for divorce were not established because the primary factors mentioned by the court, namely, the absence of hope for reconciliation and incompatibility, are not sufficient, according to Michigan divorce statutes. Clearly, incompatibility is not a statutory ground for divorce. Niskanen v. Niskanen (1963), 371 Mich 1. However, since review of divorce judgments is de novo, Buck v. Buck (1948), 320 Mich 624, the total quantum of evidence presented to the lower court may be reviewed. The record contains ample factual support for a finding of extreme cruelty on the part of plaintiff, as pleaded by defendant. Therefore, we are not convinced that we must have reached a different *587 conclusion had we occupied the position of the lower court under like circumstances. Reeves v. Reeves (1952), 335 Mich 193. Plaintiff controverts the lower court's custody disposition by arguing, first, that the judge should not have relied on the preferences of the three older boys. The trial judge did not rely solely on the wishes of the boys, but was guided by a comprehensive and well-reasoned opinion by the Friend of the Court Referee. The Referee heard six witnesses for the plaintiff and three witnesses for the defendant, as well as the parties themselves. In addition, he had the benefit of a separate report by an investigator for the Friend of the Court. This report, based on three days of testimony, interviews with the children, and independent investigation, recommended that custody of the four older boys be awarded to defendant and that custody of the other four children be awarded to plaintiff. The testimony taken at the Friend of the Court hearings was offered and admitted into evidence at the trial, in its entirety, pursuant to the stipulation of the parties. Thus, it is not apparent that the judge abused his discretion regarding the custody of the three older boys. Next, plaintiff asserts that the grant of custody of the 8-year-old boy to the father was erroneous, since there is a clear statutory preference for the custody of children under 12 to be awarded to the mother. MCLA § 722.541 (Stat Ann 1957 Rev § 25.311); Paton v. Paton (1961), 363 Mich 192. Defendant responds by arguing that the award of custody is discretionary, with the child's welfare the primary consideration. Arsenault v. Arsenault (1966), 5 Mich App 476. The record indicates that the court determined the custody of the 8-year-old child largely in reference to the Friend of the Court report and its own conclusions as to the best interests *588 of the child. Pursuant to the stipulation of the parties made at trial, the trial judge conferred privately, in chambers, with the five oldest children to assist the court in its determination. The custody determination was proper, as countenanced by Hornbeck v. Hornbeck (1946), 316 Mich 208. The final issue raised concerns the court's award of support and alimony payments and the disposition of marital property. The court was clearly within its discretion in its disposition of the litigants' property and its determination of payments to be made. Again, we cannot conclude that we would have reached a different conclusion or that the record discloses a manifest abuse of discretion. Billingsley v. Billingsley (1946), 315 Mich 417. Affirmed. Costs to defendant. All concurred.

“They came in and there were two guys” Honig said. “I asked one of them what size he needed and he showed me a badge and took me outside. They told me they were from Homeland Security and we were violating copyright laws.” They placed the underwear in an official Homeland Security bag and had Honig sign a statement saying she wouldn’t use the logo. – From the Kansas City Star article: Homeland Security Confiscates Royals Underwear in Kansas City It was just yesterday that I highlighted the dangers of granting government excessive powers under the guise of fighting terrorism in the piece: The BBC is Using Anti-Terror Surveillance to Find Tax Dodgers. Here’ an excerpt: Many commentators, including myself, have been sounding the alarm for many years that only a short-sighted society filled with fearful imbeciles would ever grant government tyrannical powers in the name of fighting an overhyped, outside enemy. As has happened countless times in world history, once these powers are granted they are always eventually used against the domestic population. Sometimes it is used to crackdown on dissent, but sometimes it’s used just to earn money and shake down the domestic plebs. It appears the British Broadcasting Corportation (BBC) in Great Britain is now using it simply to collect tax. The very next day, we American slaves wake up to learn that the Department of Homeland Security, a worthless bloated bureaucracy with a $39 billion budget, has been spending its time and money raiding a creator of unlicensed World Series panties. I wish this was a joke. The Kansas City Star reports that: Peregrine Honig says she just wanted to help celebrate the hometown team when she designed Lucky Royals boyshorts. The panties, with “Take the Crown” and “KC” across the bottom, were set to be sold in Honig’s Birdies Panties shop Tuesday. But Homeland Security agents visited the Crossroads store and confiscated the few dozen pairs of underwear, printed in Kansas City by Lindquist Press. “They came in and there were two guys” Honig said. “I asked one of them what size he needed and he showed me a badge and took me outside. They told me they were from Homeland Security and we were violating copyright laws.” She thought that since the underwear featured her hand-drawn design that she was safe. But the officers explained that by connecting the “K” and the “C,” she infringed on major league baseball copyright. (The officials involved could not be immediately reached for comment.) They placed the underwear in an official Homeland Security bag and had Honig sign a statement saying she wouldn’t use the logo. Oh and it’s not just this one-off panty raid either. This is actually the sort of stuff the U.S. gestapo DHS is prioritizing. The Kansas City Star also reported that:

/* dumpf.h: Copyright (C) 1991 Barry Vercoe, John ffitch This file is part of Csound. The Csound Library is free software; you can redistribute it and/or modify it under the terms of the GNU Lesser General Public License as published by the Free Software Foundation; either version 2.1 of the License, or (at your option) any later version. Csound is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU Lesser General Public License for more details. You should have received a copy of the GNU Lesser General Public License along with Csound; if not, write to the Free Software Foundation, Inc., 51 Franklin St, Fifth Floor, Boston, MA 02110-1301 USA */ /* DUMPF.H */ typedef struct { OPDS h; MYFLT *ksig, *ifilcod, *iformat, *iprd; int format; int32 countdown, timcount; FILE *f; FDCH fdch; } KDUMP; typedef struct { OPDS h; MYFLT *ksig1, *ksig2, *ifilcod, *iformat, *iprd; int format; int32 countdown, timcount; FILE *f; FDCH fdch; } KDUMP2; typedef struct { OPDS h; MYFLT *ksig1, *ksig2, *ksig3, *ifilcod, *iformat, *iprd; int format; int32 countdown, timcount; FILE *f; FDCH fdch; } KDUMP3; typedef struct { OPDS h; MYFLT *ksig1, *ksig2, *ksig3, *ksig4, *ifilcod, *iformat, *iprd; int format; int32 countdown, timcount; FILE *f; FDCH fdch; } KDUMP4; typedef struct { OPDS h; MYFLT *k1, *ifilcod, *iformat, *iprd; /* MYFLT *interp; */ int format; int32 countdown, timcount; MYFLT k[4]; FILE *f; FDCH fdch; } KREAD; typedef struct { OPDS h; MYFLT *k1, *k2, *ifilcod, *iformat, *iprd; /* MYFLT *interp; */ int format; int32 countdown, timcount; MYFLT k[4]; FILE *f; FDCH fdch; } KREAD2; typedef struct { OPDS h; MYFLT *k1, *k2, *k3, *ifilcod, *iformat, *iprd; /* MYFLT *interp; */ int format; int32 countdown, timcount; MYFLT k[4]; FILE *f; FDCH fdch; } KREAD3; typedef struct { OPDS h; MYFLT *k1, *k2, *k3, *k4, *ifilcod, *iformat, *iprd; /* MYFLT *interp; */ int format; int32 countdown, timcount; MYFLT k[4]; FILE *f; FDCH fdch; } KREAD4; typedef struct { OPDS h; STRINGDAT *str; MYFLT *ifilcod, *iprd; int32 countdown, timcount; char *lasts; FILE *f; FDCH fdch; } KREADS;

1. Field of the Invention The present invention relates to magnetic recording and assisted magnetic recording, and particularly to a magnetic recording medium capable of realizing an areal recording density of at least 150 gigabits per square centimeter and a method of manufacturing the same. 2. Background Art Hard disk drives (HDDs) are indispensable devices for usage requiring large-capacity information recording in computers and consumer-electronics products. In the future too, needs for large-capacity recording will be high. It is required to increase the areal recording densities of recording media in order to realize large capacity while serving the needs for savings in space and energy. Presently, approaches to high density by improvement in perpendicular magnetic recording have been attempted. However, according to conventional perpendicular magnetic recording, it is estimated that a feasible maximum areal recording density is 150 Gbit/cm2 (1 Tbit/inch2). The reason why the areal recording density has the limit is interpreted to be due to a fundamental principle of recording according to which a medium suitable for high density recording deteriorates in thermal stability. High density magnetic recording requires magnetic grains forming a magnetic recording medium to be finer to form highly accurate recording bit boundaries (magnetic transition region). However, in a case of making the magnetic grains fine, the magnetic energy KuV that stabilizes magnetization directions of respective grains cannot retain a magnitude sufficient against thermal energy kBT as a disturbance. Accordingly, a phenomenon occurs that recorded magnetization information deteriorates (thermal decay of magnetization) immediately after recording. Here, Ku, V, kB, and T are a uniaxial magnetic anisotropy energy, a magnetic grain volume, the Boltzmann constant, and the absolute temperature, respectively. Improvement in areal recording density while maintaining thermal stability requires use of a magnetic recording layer having a high magnetic anisotropy energy Ku. As described in IEEE Trans. Magn., vol. 36, p. 10 (2000) and the like, an L10 FePt ordered alloy is a material having perpendicular magnetic anisotropy energy Ku higher than that of existing CoCrPt alloys, and receives attention as a next-generation magnetic recording layer. Use of the L10 FePt ordered alloy as a magnetic recording layer absolutely necessitates reduction in exchange interaction between crystalline grains. Accordingly, in recent years, many attempts of adding a non-magnetic material, such as MgO, SiO2 or C, to an L10 FePt ordered alloy to form granular structure have been reported. Here, the granular structure represents a structure including magnetic crystalline grains made of an FePt alloy and grain boundaries made of surrounding non-magnetic material. However, recording cannot be made on the magnetic recording layer material having such a high Ku, using an existing magnetic head. This is because a soft magnetic material used for a magnetic writer pole has the maximum value of saturated magnetic flux density B of approximately 2.5 T, and thus the magnitude of the magnetic field generated by the magnetic writer pole is limited. Thus, assisted magnetic recording, or a new concept of magnetic recording, has been proposed. Presently, two assisting schemes, laser heating and microwave irradiation schemes have mainly been proposed, and referred to as thermally assisted magnetic recording (IEEE Trans. Magn., vol. 37, p. 1234 (2001)) and microwave assisted magnetic recording (IEEE Trans. Magn., vol. 44, p. 125 (2008)), respectively. These assisted magnetic recording schemes irradiate a magnetic recording layer with assist energy to facilitate magnetization reversal and then form a recording bit using a magnetic field generated by the magnetic writer pole. Since FePt has a disordered fcc structure as a metastable phase in addition to the L10 ordered structure, this requires to be subjected to an ordering process by heat treatment. It has been known that, the higher the degree of ordering (degree of ordering S), the higher the magnetic anisotropy energy is obtained. Improvement in degree of ordering requires heat treatment. The methods therefor are broadly divided into a method of heating after forming a film of an FePt alloy (post annealing method), and a method of forming a film of an FePt alloy on a preheated substrate (substrate heating method). In a case of granulation by adding a nonmetal element to an FePt alloy thin film, a fabrication method is required to be determined on the basis of any of heating methods as a premise. An example of a fabrication method using the post annealing method is disclosed in Appl. Phys. Lett., vol. 91, p. 072502 (2007). According to this document, a post annealing process is applied to a multilayer film structure in which a periodic structure including an Fe layer, Pt layer, and a SiO2 layer as a grain boundary material is repeatedly stacked n times, thereby obtaining L10 FePt alloy magnetic thin film having a granular structure. The diameters of the FePt magnetic grains at this time are approximately 6 nm. Accordingly, the grains can be applied to high density magnetic recording. On the other hand, an example of the fabrication method using the substrate heating method is disclosed in Appl. Phys. Lett., vol. 91, p. 132506 (2007) and J. Appl. Phys., vol. 103, p. 023910 (2008). These documents have reported that a granular structure can be obtained without using the periodically laminated structure such as in Appl. Phys. Lett., vol. 91, p. 072502 (2007), and the diameters of the grains can relatively easily be controlled according to a heating temperature of a substrate and an amount of addition of non-magnetic material. Various oxides and carbon have been discussed as a grain boundary material. It has been understood that C is a specific grain boundary material which can realize an excellent granular structure among these materials. J. Magn. Magn. Mater., vol. 322, p. 2658 (2010) discloses an example of fabricating an L10 FePt alloy magnetic thin film which realizes both a favorable granular structure with the diameters of magnetic grains of about 6 nm and a high coercivity Hc of at least 3 T (30 kOe).

Afiniti Afiniti International Holdings Ltd., also called Afiniti, is a multinational data and software company based in Washington, D.C. Founded in 2005, Afiniti is focused on developing artificial intelligence for use in customer call centers. With a 2017 valuation of $1.6 billion, the company is considered a unicorn. History 2005–2016 Afiniti was founded in 2005 in Washington, D.C. by Zia Chishti, a former Morgan Stanley investment banker who had previously co-founded Align Technology. In 2008 the company submitted several patents related to matching caller data with computer models, which were granted in 2014. The company confidentially filed for a potential future initial public offering (IPO) in late 2016. Around that time Afiniti also introduced software to run phone numbers "through a variety of databases prior to when a call center agent picks up the phone." The system referred to around 100 databases to gather information on callers, including from public profiles such as Twitter. According to Fortune, the system operated on "the idea that it's possible, using thousands of call records, to determine which agents perform best with certain type of customers." 2017–2018 According to the Wall Street Journal, by January 2017 the company had installed its artificial intelligence software in around 150 call centers for several dozen companies, among them Caesars Entertainment Corporation and Sprint. By April 2017 the company was valued at $1.6 billion and had board members such as John W. Snow and José Maria Aznar. That month the company closed a fourth round of venture funding, bringing in $80 million from investors such as GAM, McKinsey & Co, Elisabeth Murdoch, and John Browne. The round brought the company's total funding raised since its inception to $100 million. Afiniti signed a deal with Huawei in September 2017 and Avaya in April 2018. In January 2018, Fortune included Afiniti on its list of the 100 companies "leading the way in A.I." By June 2018, Afiniti was active in 18 countries and had 1,000 employees. Afiniti moved its headquarters to a larger building in Washington, D.C. in July 2018. It was featured on a Forbes list of exits to watch in 2018. According to Chishti, the company saw 100 percent revenue growth each year between 2013 and 2017. Services and technology According to the company, its software uses AI to help companies increase efficiency by "predicting interpersonal behavior" between the callers and agents. VentureBeat explains that "when a customer calls into a call center, Afiniti matches their phone number — either landline or cellphone — with any information tied to it from up to 100 databases. These databases carry purchase history, income, and other demographic information." Data on customers is collected from the customers and from data brokers. Afiniti does not charge for the software or service itself, but instead takes a percentage of any proven revenue increases resulting from use of the software. Key people Afiniti's structure includes a board of directors, advisory board, management team and "local leadership" team. Zia Chishti serves as CEO, while other executives and staff include former politician Wyatt Roy. Chishti also serves as chairman of the board, and the six other board members consist of Mohammed Khaishgi, Larry Babbio, John Sununu, Jose Maria Aznar, Hasnain Aslam, and John W. Snow. Among the members of Afiniti's advisory board are Tom Glocer, Michael Mullen, Peter Bonfield, Lord Browne, Ivan Seidenberg, Simon Lee, Andrew Knight, Andrea Wong, Elisabeth Murdoch, Nobuyuki Idei, Richard Gephardt, Laura Tyson, Will Greenwood, Rod Phillips, Robert Kimmitt, Federico Ghizzoni, Fred Singer, Fabio Corsico, Simon Murray, Brad Brown, Francois Fillon and David Cameron. See also List of unicorn startup companies References External links afiniti.com Category:Software companies based in Washington, D.C. Category:Software companies of the United States

Battle of San Carlos (1817) The Battle of San Carlos was a battle between the Portuguese forces under Francisco das Chagas Santos and the Misionero forces led by Andrés Guazurary, popularly known as Andresito, in San Carlos, modern-day Argentina. After having been defeated by Andresito on the previous year, Portuguese commander Francisco das Chagas Santos prepared for a new military campaign against the Misioneros, with a force of 800 men and 2 artillery pieces. After taking the chapel of San Alonso, Chagas headed for the Mission of San Carlos, where the independentist forces led by Andresito and Serapio Rodriguez awaited the Portuguese. After days of very intense fighting, the Portuguese managed to control most of the town and push Andresito's men to San Carlos' church and college, in which heavy fighting continued to occur, while they expected for reinforcements to come. However, the column of Captain Arand that had the objective of helping the rebels was attacked by the Portuguese and crushed, having its commander been killed. On the third day of battle, the buildings in which the rebels were caught fire, making their situation even more desperate and forcing them into submission, even though some men, including Andresito himself, managed to escape. The battle resulted not only in a major victory for the Portuguese, but also to the de facto elimination of Andresito's threat to them. References San Carlos 1817 San Carlos 1817 San Carlos 1817 Category:1817 in Portugal Category:1817 in Brazil Category:1817 in Uruguay

T cell-mediated cytotoxicity induced by Listeria monocytogenes. II. Specificity of cytolytic effector cells. Listeria monocytogenes- (LM) antigen-dependent cytotoxic lymphocytes, identified in a companion manuscript as T cells (CTL), can kill a wide variety of target cells, including syngeneic fibroblasts of both fetal and adult origin, and certain allogeneic and xenogeneic tumor cells. Cold target cell inhibition assays revealed that cells susceptible to lysis can block the cytolytic process in a dose-dependent manner, whereas lysis-resistant cells cannot. Several lines of evidence indicate that to realize their cytolytic potential, LM-dependent CTL must bind to their targets. Aggressor cells that adhere to susceptible target cell monolayers have enhanced cytolytic activity when compared with unfractionated cells or cells that do not adhere. LM-dependent CTL fail to kill when they are separated from susceptible targets by an agar barrier. Arguments against the complicity of a soluble mediator in the killing process derive from the rapid (within 3 hr) expression of cytotoxicity in circumstances where cell contact can occur, and the finding that spent medium in which LM-dependent CTL are either activated or assayed is devoid of cytolytic activity. The specificity of LM-dependent CTL suggests that these effector T cells recognize an as yet unidentified array of antigens that are expressed on a variety of rodent cells. Their cytolytic repertoire cannot be ascribed solely to the polyclonal activation of alloreactive T cells, because responder cells that have been negatively selected for a particular RT-1 haplotype can kill target cells bearing these alloantigens.

1. Technical Field The present invention relates generally to Digital-to-Analog circuitry and, more specifically, to a method and apparatus for a coarse Digital-to-Analog Converter architecture for voltage interpolation. 2. Introduction A coarse Digital-to-Analog Converter (DAC) architecture is commonly used in mixed-mode systems requiring monotonicity, wherein the DAC acts as an interface to convert a digital code to an analog signal. For high resolution resistor string DACs, the resistor string is typically placed in several rows whereby the resistors of one row align with resistors of another row to form columns. In this design, each resistor is connected to a switch network through a resistor tap, and a binary-to-unary decoder is used to select switches to be closed such that the sub-DAC voltage comes from the resistor taps connected to the selected switches. The output voltage from each row is then fed into a multiplexer, wherein the multiplexer produces the coarse DAC output voltages. Conventional coarse DAC designs attempt to extend the resolution of differential resistor string DACs by feeding the multiplexer output voltages into a voltage interpolation amplifier. One such resistor string DAC design includes an M-bit coarse DAC combined with an N-bit interpolation amplifier to achieve M+N bit total resolution, wherein the coarse DAC is used to generate two DAC voltages with a voltage difference of 2N*VLSB, the voltage difference across one resistor in a string of resistors in the coarse DAC circuit. This design includes a resistor string comprising 2M resistors, with two sets of switches connected to each resistor tap. Accordingly, the number of switches is equal to twice the number of resistors. For input data K, the Kth tap is connected to low output voltage VOL and the K+1th tap is connected to high output voltage VOH. Due to the large number of switches, this design requires a significant amount of circuit real estate and generates a significant glitch when changing data.

Q: how to kill a command executed within xterm I'd like to control the execution of shell commands within an xterm window. This is an example code (Ruby): pid = Process.fork if pid.nil? exec "xterm -e 'while true; do echo -n .; sleep 1; done'" else puts "pid is: #{pid}" Process.detach(pid) end However, the xterm window doesn't get killed: $ ./tst2.rb pid is: 26939 $ ps aux | grep xterm | grep -v grep user 26939 0.0 0.0 4508 800 pts/3 S 13:11 0:00 sh -c xterm -e 'while true; do echo -n .; sleep 1; done' user 26943 0.6 0.0 72568 6280 pts/3 S 13:11 0:00 xterm -e while true; do echo -n .; sleep 1; done $ kill 26939 $ ps aux | grep xterm | grep -v grep user 26943 0.1 0.0 72568 6280 pts/3 S 13:11 0:00 xterm -e while true; do echo -n .; sleep 1; done How can the xterm window be killed? A: You need to find the PID of the xterm process in order to kill it. In your case, the easiest way would be to bypass the sh process, as you don't need it. To do this, you have to pass the arguments to exec in an array, not as a command line: exec('xterm', '-e', 'while true; do echo -n .; sleep 1; done')

It will still be a while before you are able to order drone-delivered packages, however. The news: The Federal Aviation Administration has granted UPS’s drone business a Part 135 certification, meaning it is treated as a full-fledged airline, able to operate as many drones in as many locations as it wishes (although there are a lot of obstacles and caveats before that can happen in reality). UPS has dubbed its new drone airline “UPS Flight Forward,” and it’s the first in the US to gain official recognition. Currently: UPS has been providing a drone delivery service at the WakeMed hospital and campus in Raleigh, North Carolina, since March, moving medical samples around the site about 10 times a day. This new certification means UPS can expand beyond this site. It plans to bring a similar service to hospital campuses across the country in the coming weeks. In practice: The certification sounds grand, but it’s just a first step. Although UPS can say it runs a drone airline, in reality it still needs to get approval from the FAA whenever it wants to run a flight beyond an operator’s visual line of sight (it tested this last week at the Raleigh site). And although it’s free to launch its service elsewhere, each one must be individually approved by both the FAA and local regulators. UPS also needs to build up its own capabilities: it’s setting up a center where operators can oversee fleets of drones. It’s a significant step, but we remain a long way away from a world where you can pull out your smartphone and order a package to be delivered by drone. Sign up here for our daily newsletter The Download to get your dose of the latest must-read news from the world of emerging tech.

REVIEW: Moomins and the Winter Wonderland (2017) As winter approaches, and the Moomins prepare to hibernate until the spring, Moomintroll (Bill Skarsgård) grows concerned about what happens while he sleeps. When he wakes early he, his father Moominpappa (Stellan Skarsgård), and Little My (Alicia Vikander), and drawn into a strange new world of invisible creatures and the coming of “Christmas” – whoever that may be. Tove Jansson’s Moomin books are household names in Scandinavia, and much of Europe, but to a certain extent have never quite managed to break fully into Australian pop culture. That makes the Children’s International Film Festival (CHIFF) screenings of the 2017 animated feature Moomins and the Winter Wonderland in Melbourne and Sydney something of a treat, since it is a rare occasion indeed for Australian audiences to be exposed to their idiosyncratic charms. This is an appropriately idiosyncratic feature film as well, and seems well matched to the characters. The Moomins – white troll-like creatures with vaguely hippopotamus-like heads – first appeared in illustrator Tove Jansson’s 1945 novel The Moomins and the Great Flood. She refined and expanded the characters in their second adventure, Comet in Moominland, and ultimately wrote and illustrated nine novels, five picture books, and a newspaper comic strip. Their popularity was such that they were soon adapted many times for film and television, including this animated feature screening in Australia. The multitude of previous animated adaptation is of key relevance here, because the animation in Moomins and the Winter Wonderland predates the film by several decades. A Polish television adaptation that ran from 1977 to 1982 has been compiled together, remastered for 4K resolution, and entirely re-dubbed with fresh dialogue. It makes it difficult to determine just how new this 2017 production really is. It is new, but at the same time it is more than 35 years old. This is not even the first time this compilation film has been assembled. Another story arc of the Polish series was compiled in a similar fashion in 2008’s Moomin and Midsummer Madness. The act of taking short episodes and chaining them together into an 83-minute feature understandably has a strong effect on the film’s structure. It means the film seems to jump from one story thread to another in a very regimented and formal fashion. To its credit there is an overall arc that runs through the film, but it certainly comes and goes in a stop-start fashion. The animation, comprising felt creatures with paper cut-out backgrounds, is simply delightful. The footage has been cleaned up and assembled so well as to feel as if it was deliberately produced in the present day with an eye towards a “retro” look. The new English language dub is, on the whole, tremendous. Stellan Skarsgård is pitch-perfect, as is Alicia Vikander. Bill Skarsgård is effective, but his performance suffers a little from sounding a bit too much like his horror role Pennywise in the recent It movies. It will not be a problem for young viewers – at least I hope none of them have been watching It – but for the adults in the audience it does feel just a tiny bit off-kilter and unintentionally amusing. This is a wonderful animated feature, particularly for the young end of the children’s audience, but even for anybody else it is a sweet and amusing introduction to one of Europe’s most beloved set of children’s characters. It comes packed with charm for viewers of any age.

Kotho and aging. Three fibroblast growth factor(FGF) members, FGF19, FGF21, and FGF23, function as endocrine factors that regulate various metabolic processes. The unique feature of these endo- crine FGFs is the fact that they require Klotho proteins to bind to their cognate FGF recep- tors. Defects in Klotho or FGF23 result in disturbed mineral metabolism and accelerated aging. The aging phenotypes can be alleviated by correcting phosphate imbalance, leading us to hypothesize that phosphate accelerates aging. In contrast, overexpression of FGF21 extends life span in mice. Thus, the FGF-Klotho endocrine axes have emerged as key regula- tors of the aging process and are regarded as potential therapeutic targets for the treatment of age-related disorders.

Conventionally, hemodialysis apparatuses for performing treatments requiring extracorporeal circulation of the blood of patients have been used, for example, for patients with renal failure, drug-addicted people, etc. This hemodialysis apparatus includes a blood processing machine for bringing blood into contact with dialysate via a semipermeable membrane to purify the blood, a blood circuit connected to a blood flow path of the blood processing machine, and a dialysate circuit connected to a dialysate flow path of the blood processing machine. The blood circuit includes an arterial line through which blood is led from a patient to the blood flow path of the blood processing machine, a venous line through which blood is led from the blood flow path of the blood processing machine back to the patient, and drip chambers attached to the arterial line and the venous line. The blood circuit further includes a line for medication infusion, etc. On the other hand, the dialysate circuit includes a dialysate supply line for supplying dialysate to the dialysate flow path of the blood processing machine, and a dialysate drain line for draining dialysate from the dialysate flow path of the blood processing machine. Furthermore, the hemodialysis apparatus is connected also with pressure monitor lines for monitoring the internal pressures of the circuits, and other components. As described above, the hemodialysis apparatus is composed of many components. Extreme care should be taken to connect these components and examine the hemodialysis apparatus. Specifically, since, in particular, the blood circuit is connected to a blood vessel of a patient, abnormal conditions, such as disconnection, may cause the following accidents: air may be drawn into the blood circuit so as to be mixed into the body of the patient; and blood in the blood circuit may leak out so that the patient may experience blood loss. These accidents must be prevented before they occur. Therefore, when treatment is performed, health care workers have examined a blood circuit for abnormal conditions with the greatest care. This examination has placed great physical and mental stress on the health care workers. To address the above-mentioned problem, hemodialysis apparatuses described in PATENT DOCUMENTS 1 and 2 can automatically detect abnormal conditions in a blood circuit in order to perform safe treatment while reducing stress on health care workers. A blood circuit of the hemodialysis apparatus of PATENT DOCUMENT 1 is connected with a priming fluid reservoir for use in priming. The priming fluid reservoir is disposed above pressure detectors attached to pressure monitor lines. While an arterial line and lines of a dialysate circuit are interrupted, the pressure difference between the priming fluid reservoir and the pressure detector is detected, thereby detecting abnormal conditions in the blood circuit based on the pressure difference. In the hemodialysis apparatus of PATENT DOCUMENT 2, a pressure monitor line of a blood circuit is connected with an air pump. While the blood circuit is closed, air is pumped to the blood circuit by the air pump to detect the pressure of the blood circuit, thereby detecting abnormal conditions in the blood circuit based on the detected value. PATENT DOCUMENT 1: Japanese Patent Publication No. 2005-218709 PATENT DOCUMENT 2: Japanese Patent Publication No. 2002-95741

SINGAPORE - The overall crime rate in Singapore has risen this year, largely fuelled by a significant increase in the number of commercial crime cases. According to the mid-year crime statistics released by the police on Monday (Aug 24), a total of 16,575 cases were recorded between January and June this year, 6.7 per cent more than that of the same period last year. In particular, the number of commercial crimes increased by 55.3 per cent - 3,893 such cases were recorded in the first half of this year, up from 2,506 in the same period last year. Among commercial crimes, cheating involving e-commerce and scams such as "credit-for-sex" and "Internet love" were the main categories which saw a spike. For example, 627 cases were related to "credit-for-sex", a new scam that emerged in the second half of last year. Culprits would use mobile messaging platforms to ask their victims to purchase gift cards or virtual credit in exchange for escort or sexual services. Police commercial affairs department director David Chew said that the growing trend of online crime is a cause for concern and the police will continue to expand their outreach efforts to educate people about online scams. "While the police will do all it can to investigate, deter and disrupt the activities of these criminals, the public has an important role to play," he said. "Online transactions may be convenient, but the public should always be alert and exercise due diligence when engaging in online transactions to avoid falling victim to scammers." But it was not all bad news. Fewer crimes of other categories, such as housebreaking and theft, were committed in the first half of this year, compared to the same period last year. The number of cases related to unlicensed moneylending and harassment fell by about 25 per cent, while that of cyber-extortion cases plunged by about 73 per cent. Outrage of modesty cases also dipped by about 5 per cent. The youth crime situation has also improved, with fewer young people being arrested for crime. Senior Assistant Commissioner of Police Tan Hung Hooi said: "Singapore remains a safe place to live and work in. The police will work hand in hand with the community and key stakeholders to ensure that Singapore continues to be a safe home for everyone."

A Teenager With A Pulse. Theresa stalks Daniel, hoping to get to know him better, Eric asks Hope advice on Nicole having feelings for him, and Cameron calls Chad with bad news about his CT scan. NBC Universal Inc. In the rectory, Eric tells Nicole the bishop's not happy about Sami's legal issues but he's not transferring him to a new parish. She's glad and apologizes for judging Sami when she was arrested. He'd like to forget it ever happened but she can tell this isn't settled. He agrees. She brings up Brady reuniting with Kristen. They need to break them up! Eric offers to pray instead of interfering. "The heart wants what it wants," he tells her. She should know that. Cameron gets a third opinion on Chad's CT scan at the hospital. The doctor suggests to get the patient to a specialist right away. Cameron hyperventilates. Abe passes the doctor on his way out and suggests Cameron sneak out of work to join Chad and Theo at the park. Cam's too busy. Abby watches Chad showing Theo magic tricks at the lake. She joins them. The guys go hunting for frogs and later rejoin Abby when Abe shows up to bring Theo to speech therapy. Once they're gone, Abby and Chad chit chat and she brings up Stefano. Chad doesn't want to talk about his father. They make plans to drop by the coffee shop to check on renovations when Cameron calls Chad in for a follow-up. At home, JJ talks to Uncle Lucas about his mom not trusting him. They commiserate over their dislike of Daniel and Lucas offers to help JJ visit Will. JJ runs upstairs and Jenn arrives. Lucas tells her she's got problems with JJ. She wonders what her son has done now and assumes Lucas is accusing her of being a rotten mother. Lucas knows she's doing the best she can. Jenn relaxes and says JJ needs to change his behavior. Lucas calls him a teenager with a pulse. He suggests she let him see Will. He leaves and JJ returns. Jenn gives him the okay to see his cousin and he picks her up and hugs her. She's the best! Jenn laughs and gives him his cell phone. She leaves and he calls Rory to ask if he's got 'the stuff'. At the hospital, Maxine isn't happy Daniel has been surfing with Parker. Theresa sighs when she sees photos of the doctor, shirtless. Anne drags her to Jenn's office and says she's the bottom of the food chain and needs to get her "skinny ass" down to HR to complete her paperwork or she won't be paid. She leaves and Theresa pops a cigarette in her mouth. Hope catches her. There's no smoking in the building. Hope knows Theresa had a bumpy road before she arrived in Salem and she cares. She'd like to help. Theresa gets sarcastic. Maxine stares at Daniel by the hub. He tells her to let it go. She argues that he and Jenn were great together. Jenn walks by and they clam up. Jenn arrives at her office and Theresa steps out to HR. Jenn thinks Theresa has turned a corner. Hope brings up Daniel but Jenn's tired of defending herself. JJ has to come first. Hope thinks she sounds like Jack. She didn't put up with her walking away from him so why should Daniel? Elsewhere, Theresa finds a nurse to gossip about Daniel with until he walks by heading for lunch. She follows. Meanwhile, Anne barges into Jenn's office searching for Theresa. JJ meets Rory at school. He thanks him for the calculator. It got him through Chemistry class. JJ's baffled. Rory whispers to check out the battery compartment. Rory comments that the seller was super sketchy and hands over his cell so JJ can call his teacher to get out of class. Hope arrives at the rectory to drop off papers. Eric needs advice about Nicole. "Do you think it's possible she's developed inappropriate feelings for me?" Hope has seen the way Nicole looks at him. Maybe she's struggling with her feelings. JJ plays with the vial of cocaine in the park while calling Theresa to come pick it up. She brushes him off saying she's on a date. She hangs up and JJ spins around and bumps into Nicole. He drops the coke. Theresa misses a call from Jennifer while she heads into the pub to greet Daniel. Chad arrives at the hospital and accuses Cameron of tearing him away from Abigail on purpose. Cameron tells him to stop it. This is serious. They need to discuss his CT scan results. Related Articles USER COMMENTS Om my gosh I just figured out I'm as clueless as Eric. Or as clueless as I thought Eric was since today his asking Hope her unbiased and observant eye on how Niki is around him. HE Freaking KNEW!!!!! I'm hoping two things. Niki see's the drug and decides she has to investigate thus leaving the rectory -she needs to get away from him quick it is so obvious how she feels That it is better she leave for a job and not over broken heart. And if she goes to the Pub and see's the tart,Teresa going after Danny she either pretends she's Danny's woman at the moment or she just tells the girl to back off he's taken Posted by Spring is near at Thursday, August 01 2013 11:26 AM Hello fellow posters! This has got to be THE dumbest episode yet. It was just getting good too. Jenn should get an Oscar for being the biggest most naive idiot in soapland and I really like her. But between JJ and Theresa, it's sickening how she just falls for everything. Hope Nicole busts JJ for his "coke". And what does using Roy's phone have to do with anything, JJ calling his teacher, etc. Nicole has feelings for Eric and Eric goes to Hope for "counseling". Stupid and a waste of air time. Although I did not like Kristen, I will miss her character. Theresa makes me sick and smoking at that! Are you kidding me? Between JJ and Theresa, this is the best show yet to coach kids on how to commit crimes and self destruct, too depressing to watch, I ff through these scenes, read the recaps. Hoping Sami gets off and Stefano gets caught, but probably not. He never does. More later! Posted by allmylovingdays at Thursday, August 01 2013 11:35 AM I guess the JJ using Rorys phone is so Jenn doesn't see he called Teresa who JJ thinks his mom hates so it was to keep him and her out of trouble. He is/was hoping that once she got her coke it would be party time for them. Since the coke seems to be bought from someone sketchy you have to wonder. AND THIS HAS ME ROLLING now that I thought of it-what if little Teresa gets sick and Dr Danny has to save her -ya know he has that fetish for his patients lol Hi Spring Posted by Spring is near at Thursday, August 01 2013 11:55 AM AMLD - I kind of thought something similar; what if Theresa becomes Dan's patient, that would be a great way to "get to know him". LOL!! Posted by ldiablo at Thursday, August 01 2013 12:03 PM Wow I don't believe it but I actually think that I found someone I hate more then Anne welcome to Salem Theresa! Right now not to happy about Theresa mom dumping her and all her problems on the poor people of Salem. It makes sense that T(Theresa) would move back to Salem! The Governor of Illinois has passed the legal marijuna law so smoke em if you got em! What ever happened to the tough smart investigative report I loved because this Jenn is not her. This Jenn is very stupid and so boring that I dooze off when she comes on? Dr. Hormone should be in bed with T by the end of the week unless horndog number 2 Brady see's her first! Hooray no stupid Kristen scenes to ruin my day but way too much teen angst. Went thru stupid high school days once before don't want to revisit it all over again . Did I say end of the week I think Dr. Dan will get busy with T in Brady's pub washroom right now. Poor JJ go cry on mommy's shoulder that mean old Dan has wronged you again booo hoo. Posted by DragonSoap at Thursday, August 01 2013 02:14 PM allmylovingdays ... thank you...I somehow missed the Tony part but I remember her falling for John. I guess it still seems a little weird...but you're right...it's Stephano. WilSon...my goodness...y'all are right IF they really want to go "hiking" they could leave the baby with Mom (Gabi) or any other dozen sitters... But alas...if you bring a baby into the world and intend to raise it...that baby takes first priority over everything else. Will had plenty of opportunity to give up responsiblity but chose not to...even fought for his rights... I sure wish Brady would get past Kristen. Posted by momduke at Thursday, August 01 2013 03:20 PM Why is it that Sami's in jail and still has that stupid red ribbon in her hair??? What is that all about???Why, why??? Posted by littleguysmom at Thursday, August 01 2013 04:01 PM Hi everyone just got done watching the show kinda boring to day. The only scene I liked was Theo frog hunting. Glad Chad is at least spending time with him. I hope Nicole steps back and crush that little vial of coke, would deserve JJ right for pushing the harder stuff. Good to see Lucas today. Well got to go finish my dishes. @holdingon I hope you are alright, please check in, I'm worried about you. Back later, hope there are more posters on the board, zuzu sorry about your cable service, they always want more money for channels we use to receive free. Posted by ladybelle at Thursday, August 01 2013 04:42 PM Yeah,the show was rather boring today. Why did Eric ask Hope's advice on Nicole's feelings? Let's get this investigation under way on Bernardi. I wonder what they will find at his house. I hope Nicole gets that vial of coke. JJ needs to be busted. Bye Bye Kristin, hope it's sooner than later.

1. Field of the Invention The present invention relates to a method for driving an electrophoretic display that displays images through position changes of electrophoretic particles. 2. Description of the Related Art The electrophoretic display includes a thin film transistor array panel having pixel electrodes each connected to a thin film transistor, a common electrode panel including a common electrode, and positive or negatively charged electrophoretic particles that move between the pixel electrodes and the common electrode. A common reference voltage is applied to the common electrode and data voltages that are larger or smaller than the common voltage are applied to the pixel electrodes according to gray information. Differences between the common voltage and the data voltages are applied to the electrophoretic particles as image display voltages of positive or negative polarity causing the electrophoretic particles to move to the pixel electrodes or the common electrode. The distance that the electrophoretic particles move is determined by the application time of the image display voltages which is based on the gray information for each pixel resulting in disposition of the electrophoretic particles at various positions between the pixel electrodes and the common electrode. However, if the image display voltages are repeatedly applied to the electrophoretic particles, arbitrary charges are stimulated in each pixel such that afterimages may be generated. Accordingly, each pixel must be refreshed through the application of a compensation voltage to remove the stimulated charges for the prevention of the afterimage. After the desired image is displayed for a predetermined time the compensation voltage of the same value but of opposite polarity to the image display voltage is applied for the predetermined time to display a compensation image which is the reverse of the desired image. The display of the compensation image between displays of the desired images degrades the performance of the electrophoretic display delays the image display because of the finite speed of the electrophoretic particles.

The present invention relates to digital telephone switching systems and more particularly to an improved integrated telephone transmission and switching system. Digital telephone switching systems have been utilized in automatic message accounting systems such as described in the cross-referenced application entitled "Integrated Message Accounting System." That system, which may be termed a base switch, utilizes pulse code modulated (PCM) techniques for switching telephone signals in PCM format from one time slot on a multitime slot digital data bus commonly known as a T-1 line to any other time slot on any T-1 line in the system. A T-1 line generally has 24 time slots each having eight bits together with a framing bit for a total of 193 bits per frame operating in a multiframe format of 12 frames. The base switch handles in one embodiment up to 64 T-1 lines or 1536 time slots and additionally provides for detecting, sending and receiving of dial pulses, detecting on-hook and off-hook conditions indicated in the signaling frames of a multiframe format, generating and sending necessary service tones in PCM format and sending and receiving multifrequency tones. It would be desirable to utilize the existing digital switching capabilities of the above described system at a local subscriber line level so that a plurality of local subscribers can be connected to the base switch thereby enabling connections to any other subscriber line in the telephone system. In view of the above background, it is an objective of the present invention to provide an improved integrated transmission and switching system.

import Foundation /// The details of a specific condition struct ASTCondition: Codable, Equatable { enum Kind: String, Codable { case BooleanCondition /// TODO: What other kinds are there? } /// The kind of condition let kind: ASTCondition.Kind /// The name of the variable determining this condition let variableName: String /// If the condition is inverted let inverted: Bool }

A double-blind study comparing the effectiveness of cromolyn sodium and sustained-release theophylline in childhood asthma. The effectiveness of cromolyn sodium and theophylline on asthma in children was compared during a 3-month trial. Forty-six children (aged 5 to 15 years) with asthma were assigned at random to cromolyn or theophylline (Theo-Dur) treatment groups. Each subject received theophylline placebo or cromolyn placebo in addition to the active drugs. A methacholine challenge test was done at the start of the study to document asthma and was repeated during the third month. The theophylline dosage was regulated to obtain serum levels of 10 to 15 micrograms/mL by a physician not involved directly with patient care. Forty patients completed the study. Both theophylline and cromolyn treatment groups showed improvement from base-line status in terms of symptom scores, pulmonary function, and decreased use of inhaled albuterol. Patients treated with theophylline had more side effects and required more frequent office visits than those treated with cromolyn. Both groups had decreased sensitivity to methacholine, and for one statistical test patients treated with cromolyn improved significantly. These results indicate that cromolyn is as effective as theophylline in treating mild to moderate asthma in children; additional benefits were fewer side effects and a possible decrease in bronchial hyperactivity.

Q: Clarification On MySQL Join Query I am having some issues creating this JOIN query. The table setup is as follows | tags || tag_links || articles | |________________||________________||________________| | | | | | | | id | | article_id | | id | | tag_name | | tag_id | | | There are 3 tables, and this is a many-to-many relationship. The objective is to find all the tags associated with a given article id. The tags table contains all of the tags The tag_links table contains the link between the articles and the tags, where the tag_id is equal to the id in the tags table, and the article_id is equal to the id in the article table The articles table contains the id ( amongst other columns, but the other columns are not important ) I am having a hard time because the article id is already provided. I don't think that this is even needed in the query, but I am at a loss right now. I am trying to grab all of the tag_id's that are associated with the article_id that I pass in, and then grab all of the tag_names from all of the tag_id's i just queried for. Any help is greatly appreciated. Thanks! A: This is a simple join you can use to get tag names for a given article id select distinct t.* from tags t join tag_links tl on(t.id = tl.tag_id) where tl.article_id=@id <---- article id

<?xml version="1.0" encoding="UTF-8" ?> <Form version="1.2" maxVersion="1.2" type="org.netbeans.modules.form.forminfo.JPanelFormInfo"> <AuxValues> <AuxValue name="FormSettings_autoResourcing" type="java.lang.Integer" value="0"/> <AuxValue name="FormSettings_generateMnemonicsCode" type="java.lang.Boolean" value="true"/> <AuxValue name="FormSettings_i18nAutoMode" type="java.lang.Boolean" value="false"/> <AuxValue name="FormSettings_layoutCodeTarget" type="java.lang.Integer" value="2"/> <AuxValue name="FormSettings_listenerGenerationStyle" type="java.lang.Integer" value="0"/> <AuxValue name="FormSettings_variablesLocal" type="java.lang.Boolean" value="false"/> <AuxValue name="FormSettings_variablesModifier" type="java.lang.Integer" value="2"/> <AuxValue name="designerSize" type="java.awt.Dimension" value="-84,-19,0,5,115,114,0,18,106,97,118,97,46,97,119,116,46,68,105,109,101,110,115,105,111,110,65,-114,-39,-41,-84,95,68,20,2,0,2,73,0,6,104,101,105,103,104,116,73,0,5,119,105,100,116,104,120,112,0,0,1,44,0,0,1,-112"/> </AuxValues> <Layout class="org.netbeans.modules.form.compat2.layouts.DesignBorderLayout"/> <SubComponents> <Container class="javax.swing.JPanel" name="jPanel2"> <Constraints> <Constraint layoutClass="org.netbeans.modules.form.compat2.layouts.DesignBorderLayout" value="org.netbeans.modules.form.compat2.layouts.DesignBorderLayout$BorderConstraintsDescription"> <BorderConstraints direction="Center"/> </Constraint> </Constraints> <Layout class="org.netbeans.modules.form.compat2.layouts.DesignBorderLayout"/> <SubComponents> <Container class="javax.swing.JScrollPane" name="jScrollPane1"> <AuxValues> <AuxValue name="JavaCodeGenerator_CreateCodeCustom" type="java.lang.String" value="new BeanTreeView();"/> </AuxValues> <Constraints> <Constraint layoutClass="org.netbeans.modules.form.compat2.layouts.DesignBorderLayout" value="org.netbeans.modules.form.compat2.layouts.DesignBorderLayout$BorderConstraintsDescription"> <BorderConstraints direction="Center"/> </Constraint> </Constraints> <Layout class="org.netbeans.modules.form.compat2.layouts.support.JScrollPaneSupportLayout"/> </Container> </SubComponents> </Container> </SubComponents> </Form>

Living-donor liver transplantation in the United States: identifying donors at risk for perioperative complications. Donor safety has been scrutinized by both the medical community and the media. Variability exists in reported donor complications and associated risk factors are ill defined. Use of administrative data can overcome the bias of single-center studies and explore variables associated with untoward events. A retrospective cohort study identifying living liver donors in two large healthcare registries yielded 433 right and left lobe donors from 13 centers between 2001 and 2005. Perioperative complications were identified using International Classification of Diseases, 9th Revision (ICD-9) coding data and classified according to the Clavien system. Logistic regression models identified factors associated with complications. There was one perioperative death (0.23%). The overall complication rate was 29.1% and major complication rate defined by a Clavien grade >or=3 was 3.5%. Center living-donor volume (OR = 0.97, 95% CI = 0.95-0.99) and the ratio of living-donors to all donors (living and deceased) (OR = 0.94, 95% CI = 0.92-0.96) were associated with a lower risk of all complications. Donor age >50 years (OR = 4.25, 95% CI = 1.22-14.87) was associated with a higher risk of major complications. Living liver donation is currently performed with a low risk of major morbidity. Use of administrative data represents an important tool to facilitate a better understanding of donor risk factors.

MEXICO CITY (Reuters) - Fourteen suspected criminals were killed after a confrontation with police and marines in Mexico’s Gulf state of Veracruz, Mexican police said on Monday. A spokesman for the municipal police in the city of Jesus Carranza, about 255 miles (410 km) south of the state capital, Xalapa, confirmed to Reuters that 14 gunmen were killed by authorities after attacking a patrol. Reports by local news outlets that an undetermined number of attackers escaped to a nearby mountain could not be confirmed immediately. Veracruz is home to a variety of turf battles among rival cartels, including the extremely violent Zetas.

Mormons don’t have the hottest of reputations. Probably because Mormons are traditionally conservative, believe in ‘modest’ dress and value virginity before marriage. So it’s not exactly regarded as a sexy faith (to be fair, are there any sexy religions?) But this couple, Danielle and Clayton, are demonstrating quite the opposite. The Mormon couple are what’s known as ‘monogamish’ – when a couple don’t have formalised external relationships (polyamory) but do sometimes indulge in sexual activities outside of their marriage. Clayton and Danielle Watson (38 and 34 respectively) from Salt Lake City, Utah, USA, grew up in conservative Mormon families and met at university when they were 22 and 18. The couple fell in love and dated for a year before they were married and the pair have only ever had sex with each other but were not virgins on their wedding day which was, apparently, a disappointment for their families. After they were married, Danielle and Clayton realised that traditional monogamous relationship came with a standards, rules and expectations that they were not comfortable conforming to. With this, they decided to explore being monogamish which allowed them to set rules and boundaries to suit them. Their ‘monogamish’ relationship involves naturism, being sex positive, putting on shows in sex clubs, having sex in the same room as others, flirting with other couples and sharing sexy pictures. You can find Danielle and Clayton on Instagram here. MORE: Asda is holding a massive Yankee Candle sale with items costing as little as 10p MORE: Women are sharing their #SoProud birth stories Advertisement Advertisement

848 F.2d 1239 U.S.v.DeLeon* NO. 87-1257 United States Court of Appeals,Fifth Circuit. MAY 23, 1988 1 Appeal From: N.D.Tex. 2 AFFIRMED. * Fed.R.App.P. 34(a); 5th Cir.R. 34.2

A. Field of the Invention This invention relates to remote-controlled tubing safety valves and more particularly to a tubing safety valve having a check valve and remote-control means for maintaining the check valve in open position. B. The Prior Art Remote-controlled tubing safety valves utilized in well installations are well known. Such valves are normally biased towards a closed position and are held open hydraulically. Although the valve is positioned in the tubing string, the hydraulic conduit controls are often at the surface. Having the controls at the surface permits the valve to be opened or closed regardless of the conditions at the valve. Such remote-controlled valves have the disadvantage that if it is desired to operate the valve in response to conditions at the valve, means must be provided for sensing these conditions at the surface and then means must be provided to operate in response to the sensed conditions. The remote sensing of conditions followed by the remote operation of the valve takes time. During this time period equipment and personnel at the surface may be damaged and/or injured. The remote sensing and controlled operation of the valve is simply not fast enough in all circumstances. Sometimes remote-controlled tubing safety valves are opened without the use of the hyrdraulic control means. To open the valve, fluid is pumped downward into the tubing string until a sufficient pressure differential exists across the valve for the valve member to move to slightly open position. (See Composite Catalogue of Oil Field Equipment and Services 1974-75 pages 3997 and 3998 and U.S. Pat. No. 3,870,101 to Helmus). To partially open the valve by pumping through it, the force exerted by the main biasing means which urges the valve member closed and which is normally overcome by the hydraulic means, must be overcome by the pressure differential across the valve. When the valve member is opened in this manner it is only partially opened and a high velocity flow results. This high velocity flow can erode the valve member and the valve seat. If the valve becomes eroded it will leak and must be replaced. U.S. Re. Pat. No. 26,149 discloses a remote control subsurface tubing safety valve. One form of the valve has a flapper valve member. However, even this flapper valve can not be pumped through without overcoming the force of the main spring biasing the valve member to a closed position and thus cannot operate as a check valve responsive to conditions at the valve. U.S. Pat. No. 3,860,066 to Pearce et al discloses a remote-controlled tubing safety valve having two springs. The springs acts against an operating sleeve to bias it to a first position where the valve member is in a valve closing position while hydraulic means move the operating sleeve to a second position so that the valve member is in a valve opening position. One spring is disposed above the valve member while the second spring is disposed below the valve member. In the first form of the valve the valve member is a rotating ball valve confined between two valve seats. To close the safety valve, the springs overcome the hydrostatic head of fluid in the hydraulic control conduit. Generally one heavy spring is provided to do this; however, as illustrated in the aforementioned patent to Pearce, two springs may be provided. The upper spring may be stronger than the lower so that it alone can move the valve member operator to valve closing position. The second spring operates in conjunction with the first spring to assist in moving the operator and to maintain the valve member tightly confined between its seats. The lower and upper springs may be of equal stength but is preferable to have the lower spring be weaker than the upper spring. This is because if the valve member is forced upward by the lower spring, the pivot of the valve member can become worn causing the valve to malfunction. Again if the valve disclosed in the aforementioned patent to Pearce was attempted to be opened by pumping through the valve rather than by utilizing the hydraulic control means, a high pressure differential would have to be created across the valve, high velocity flow through the valve would result thereby causing erosion of the valve member and valve seat surfaces. There are valves having valve members that respond quickly to conditions at the location of the valve for movement between valve opening and closing positions. Such valves may be ambient-type (e.g. the valve closes when the ambient pressure around the valve drops below a predetermined level), a pressure-differential type (e.g. the valve automatically closes when there is an abnormal increase of pressure through the valve) or injection safety valves. (See Composite Catalogue of Oil Field Equipment & Services 1974-75 pages 3995, 4008 to 4011, and 4014). However, such valves only close in response to the predetermined condition and cannot be controlled to open or close from the surface. Injection safety valves do respond quickly to close the tubing string whenever a backkick occurs. However, present injection safety valves have no means to maintain the valve in an open position if it is desired to have a high back flow rate through the valve because they are urged towards a close position by such back flow. In addition they may have biasing means to constantly urge the valve member to a closed position. It is sometimes desirable to inject fluids in a well equiped with a subsurface safety valve. In doing so, it is desirable that a check valve be present down in the tubing to protect personnel and equipment at the well. Equipment has not been available for this purpose without running additional equipment in to the well.

"Safe" has been described as a horror movie of the soul, a description that director Todd Haynes relishes. California housewife Carol White seems to have it all in life: a wealthy husband, a beautiful house, servants, beauty, and a lot of friends. The only thing she lacks is a strong personality: Carol seems timid and empty during all of her interactions with the world around her. At the beginning of the film, one would consider her to be more safe in life than just about anyone. That doesn't turn out to be the case. Starting with headaches and leading to a grandmal seizure, Carol becomes more and more sick, claiming that she's become sensitive to the common toxins in today's world: exhaust, fumes, aerosol spray, etc. She pulls back from the sexual advances of her husband and spends her nights alone by the TV or wandering around the outside of her well-protected home like an animal in a cage. Her physician examines her and can find nothing wrong. An allergist finds that she has an ... Written by David Eschatfische <[email protected]>

Laura Brander-Wallin Laura Irene Brander-Wallin (née Brander; 5 April 1909 - 1 January 1994) was a Finnish seamstress and politician, born in Pori. She was a member of the Parliament of Finland from 1948 to 1958 and again for a short time in 1962. She was at first a member of the Social Democratic Party of Finland (SDP) and later of the Social Democratic Union of Workers and Smallholders (TPSL). References Category:1909 births Category:1994 deaths Category:People from Pori Category:People from Turku and Pori Province (Grand Duchy of Finland) Category:Social Democratic Party of Finland politicians Category:Social Democratic Union of Workers and Smallholders politicians Category:Members of the Parliament of Finland (1948–51) Category:Members of the Parliament of Finland (1951–54) Category:Members of the Parliament of Finland (1954–58) Category:Members of the Parliament of Finland (1958–62) Category:20th-century Finnish women politicians Category:Women members of the Parliament of Finland

People have the power protest inside Ferguson City Hall protest October 13, 2014 The United States is going in the wrong direction on a wide range of social, economic and foreign policy issues and people are justifiably upset and angry. One question we are regularly asked is: “What should I do?” In our last two newsletters, we examined the stages of successful social movements to show how movements can progress toward victories. This week, we attempt to answer the question by describing the fifth class of the Popular Resistance School, “The Roles of Individuals and Movements” and how to be effective at them. There are many necessary roles in the popular movement at this time, which means there is something for everyone to do. We are at a critical moment when the fifteen core issues of the movement for economic, racial and environmental justice as well as peace are in crisis and people are organizing to solve them. As we wrote in 2011, during the preparations to occupy Freedom Plaza in Washington, DC, on a broad range of issues from taxing the rich to getting money out of politics to strengthening the social safety net and more, there is already majority support. In 2014, Josh Sager demonstrated that while in electoral politics the US appears to be center-right (and shifting ever rightward), the people’s positions are center-left. National consensus for solutions to the crises is growing despite the lack of commercial media coverage. The necessary ingredients for winning major social changes – national consensus on issues and a mobilized ‘movement of movements’ – are developing, but these ingredients merely create the conditions for change. To realize those changes, we need to understand what the various roles are that people need to take on and how to be effective in those roles by avoiding the pitfalls that could undermine our work toward the society we desire to create. There are four basic roles in a movement and each one is needed. Some people can play more than one role or can move from one to another and some will be most comfortable focusing on one role. The prominence of each role changes throughout the development of a successful social movement, as the tasks of each stage, differ. People often gravitate toward one role and that can be seen early in life in the way they respond to challenges. Review this list and consider which roles resonate with you. The Advocate or Reformer: The advocate is most drawn to working with those in authority to create change, perhaps through educating legislators, writing policy or using the courts. The movement role played by the advocate is to translate the demands of the people’s movement for the power structure and to act as a watchdog for the movement. The Organizer or Change Agent: The organizer works to bring people together to solve problems, especially in a way that is empowering such as using horizontal, democratic processes for making decisions. The movement role played by the organizer is to grow the movement and to facilitate coordinated strategic activities. The Helper or Citizen: The helper is typically a more mainstream person who is drawn to providing direct aid to solve problems. If a neighbor can’t shovel the snow off their sidewalk, the helper will do it. The role that the helper plays in the movement is to show that there is widespread support for the aims of the movement and to bring greater legitimacy to the movement. The Rebel: The rebel is one who is most likely to make a lot of noise about an injustice. When something bad happens, the rebel wants everyone to know and will confront the power holders about it. The role that the rebel plays is to highlight injustice and to take direct action in order to create the tension required for changes to occur. To be effective, the roles need to be handled in ways that achieve the grand strategy of the movement; i.e. (1) To grow the movement by pulling people toward it, especially people in the power structure; (2) To create unity in the movement so solidarity is strengthened and people work together for common objectives; and, (3) To deepen our understanding of the issues and the solutions to injustices and crisis situations that are needed. Each of these roles can be played in ways that achieve these strategies or, if done poorly, can undermine the movement. For example, an effective advocate will be accountable to the people in the movement and will represent their views, while an ineffective advocate may start to ally more with the power holders than with the people and might try to convince the movement to compromise in ways that violate their fundamental goals. An organizer will ideally provide the tools and support that empower people to be creative and to make decisions and take actions that are strategic, while an ineffective organizer will behave in a way that is hierarchical, ordering people to take action and excluding diverse views instead of building consensus for the action. The heads of some non-governmental organizations may come to believe they are the movement, rather than recognizing their power comes from the movement. The rebel can create conflicts with police or others that repel people and push them away from the movement. Using overly strident tactics can actually empower the police or those in power to crack down on the movement. Done well, the rebel shows courage that becomes contagious. We discussed this and more with George Lakey, an activist who has been involved in many social movements and has trained many activists, on the Clearing the FOG podcast, available here on Mondays. In particular, Lakey admonishes people to avoid being drawn into conflict by right-wing white supremacists because this will legitimize state suppression of the movement and repel people who are unpersuaded from the movement. There will be a white supremacist rally in front of the White House in Washington, DC on August 12. In response, a coalition of organizations from DC and surrounding states are organizing a celebration of diversity in Freedom Plaza from noon to 5:00 pm. It is our hope that this effort will show support for the movement’s goals without being confrontational in a counterproductive way. We Must Work Together and Use Conflict To Become Stronger Successful movements are diverse in many ways, including the roles that different people and organizations play. Sometimes people will fail to recognize the value of people who play roles different from theirs in the movement and may, as a result, weaken the movement by attacking allies. A rebel may view an advocate as too supportive of the power structure. An advocate may view a rebel as too radical. If the people and organizations that play different roles within the movement develop trust and a collaborative relationship, then there will be space to discuss whether the advocate is getting too close to the power holders or the rebel’s actions might be isolating rather than drawing people into the movement. Without that collaboration, the movement may weaken itself through discord. That said, even the best collaborations will encounter internal conflict. Lakey describes how conflict can be constructive for a movement rather than destructive. Conflict may take a movement that is stagnating and bring it to a deeper level of collaboration. It can bring new energy to the movement when simmering concerns are aired and resolved. Lakey writes: People who face strategic hard choices are more likely to come up with creative and wise next moves when the four roles fight it out — fighting fairly while acknowledging differences. The research is clear: Over time, diversity actually does produce the best outcomes. Or at least diversity works when everyone agrees on the bottom line: The role the group plays in the larger movement. The most successful tactic of those in power is to divide a movement. So it is essential for a movement to find ways to confront conflict in a constructive way that builds unity rather than sowing division. A current example of this is the coalition of peace and justice movements that are organizing to oppose President Trump’s military parade in Washington, DC in November, which happens to be the 100th anniversary of Armistice Day (changed to Veteran’s Day in 1954). A number of different groups were organizing responses to the parade. In February, those groups came together to organize in a collaborative way that has space for a variety of actions under a common theme of divesting from war and investing in peace. The website is NoTrumpMilitaryParade.us. You can sign on as an organization or an individual there. The coalition has written a statement and is asking other organizations to sign on in support. The statement acknowledges the many ways that militarism causes harm at home and abroad. At home, militarism normalizes violence, which results in violence in our communities. Spending on the Pentagon is consuming an increasing proportion of our federal discretionary budget, now almost two-thirds, when those dollars are needed for housing, education, health care, jobs and more. The military is the biggest polluter and user of fossil fuels in the world, contributing to environmental destruction and climate change. All organizations who agree with the statement are invited to sign on. This will be published on August 8, but sign-ons will continue after that. Read the statement and sign-on here. When we create a movement of movements, which is essential for ultimate victory, we are bringing diverse people and organizations into a coalition together. A coalition adds strength to the movement as people united by a common goal emphasize communication and coordination while respecting each other. Coalitions allow organizations and individuals to participate in ways that are consistent with their unique strengths. Understanding the roles of individuals and different organizations in a movement is a key to building a successful social movement. One organization or network of individuals cannot do everything. One individual cannot play every role. Organizations and individuals supporting each other, developing strategy and tactics together after listening to different views, create unity. Solidarity of vision and purpose is what creates a powerful movement. To answer the question, “What do I do?”: Find your role and find your issue, then get involved either locally or at the state, national or international level. If you are already involved, then understanding how the roles contribute to the goals of the movement may make your work more effective. And whatever you do, know that you are part of a growing movement of movements that has the power to create transformational change.

Anesthesiologist staffing considerations consequent to the temporal distribution of hypoxemic episodes in the postanesthesia care unit. Hypoxemia, as measured by pulse oximetry (SpO2), is common in postanesthesia care unit (PACU) patients. The temporal distribution of desaturation has managerial implications because treatment may necessitate the presence of an anesthesiologist. We retrieved SpO2 values recorded electronically every 30 to 60 seconds from 137,757 PACU patients over n = 80 four-week periods at an academic medical center. Batch mean methods of analysis were used. Onset times of hypoxemic episodes (defined, on the basis of previous studies, as SpO2 <90% lasting at least 2 minutes) were determined and resolution at 3, 5, and 10 minutes was assessed. Episodes beginning <30 minutes and ≥30 minutes after PACU admission were compared. Patients undergoing intubation in the PACU were identified by doing a free text search of electronically recorded nursing notes for phrases suggesting intubation, followed by a confirmatory manual chart review. Intervals from PACU admission to intubation were determined. Fewer than half (31.2% ± 0.05%) of episodes of PACU hypoxemia lasting ≥2 minutes occurred <30 minutes after PACU admission. Most (i.e., >50%) occurred ≥30 minutes after admission (P < 0.0001). Few (<1%) anesthesia providers transporting patients to the PACU were still present in the PACU 30 minutes after arrival in the PACU. Fewer than half (37%; 95% confidence interval, 27.4% to 48.8%) of PACU intubations occurred <30 minutes after PACU admission. Most (i.e., >50%) occurred ≥30 minutes after admission (P = 0.029). Hypoxemic episodes in the PACU resolved more slowly than episodes in operating rooms (P < 0.0001). After 3 minutes, 40.9% ± 0.6% were unresolved in the PACU versus 23% (99% upper confidence limit) in operating rooms, and 32.6% ± 0.5% vs 9% (99% upper confidence limit) after 5 minutes. Because most (68.8%) hypoxemic episodes in the PACU occur ≥30 minutes after admission, a time by which the anesthesia provider who transported the patient usually would no longer be present (>99% of cases), the PACU needs to be considered when anesthesiologist operating room staffing and assignment decisions are made.

Does previous salpingectomy improve implantation and pregnancy rates in patients with severe tubal factor infertility who are undergoing in vitro fertilization? A pilot prospective randomized study. To evaluate the implantation rate and pregnancy rate (PR) in patients with severe tubal factor infertility who were undergoing IVF. Patients who had undergone salpingectomy were compared with those who had not. A prospective randomized study. A department of obstetrics and gynecology at a university hospital. Thirty patients who previously had undergone salpingectomy and 30 patients who had not undergone salpingectomy before IVF treatment. Laparoscopy with or without salpingectomy followed by IVF with the use of combined GnRH agonist and hMG therapy in a long stimulation protocol. Embryo implantation rate and ongoing PR per transfer. The cumulative PRs were compared for the two groups of patients. After the first IVF attempt, the implantation rate was 10.4% in the group with salpingectomy and 4.6% in the group without salpingectomy. For all IVF attempts, the respective embryo implantation rates in the two groups were 13.4% and 8.6%. The ongoing PR per transfer was 34.2% in the group with salpingectomy compared with 18.7% in the group without salpingectomy. After four IVF attempts, the probability of becoming pregnant was greater in the group of patients with salpingectomy (75%) than in the group without salpingectomy (63%). Previous salpingectomy in patients with severe tubal factor infertility who are undergoing IVF seems to increase the embryo implantation rate and the PR per cycle of IVF. This monocentric study must be followed by other similar studies to allow for a metaanalysis and confirm this clear trend with definitive evidence.

Covering Military and community news, events and stories from South Carolina, parts of North Carolina and Georgia. Monday, August 18, 2014 Meet Future Soldier Jonathan Callahan Soon to be an Army Infantryman Future Soldier Jonathan Callahan Jonathan Callahan, 18, joined the Army to be an Infantryman. He said he got the right job. “I want to do something to get my adrenaline going while at the same time do something for my country,” Callahan said. He also said he likes the idea of experiencing other cultures. He will start his training this Sept. at Ft. Benning, Ga. Overview of Job The infantry is the main land combat force and backbone of the Army. It’s also the starting point for many advanced schools such as: Special Forces, Airborne School, Ranger School, Sniper School, and Pathfinder School. Job Duties ·Defend the country against any threat by land ·Capture, destroy and repel enemy ground forces during combat Training Enlistees attend Infantry One Station Unit Training for 14 weeks, which primarily takes place in the field, as well as the classroom. During training, they will list their specific infantry job preferences, although assignments are determined by the needs of the Army. Upon graduation from One Station Unit Training, they are assigned to one of the following infantry specialties: ·Infantryman (11B) ·Indirect Fire Infantryman (11C) Helpful Skills ·Possess tremendous discipline and high morale ·Readiness to accept a challenge and face danger ·Interest in light weapons and ground tactics ·Ability to remain calm under stressful situations If you are interested in pursuing this job or another U.S. Army job, call the Sgt. 1st Class Michael Tyo at 828-449-9458. Or stop by the Army Recruiting Center at 2001 East Dixon Boulevard in the Cleveland Mall in Shelby, N.C.

LARGE parts of the Victorian public service could be outsourced to the private sector as the state government scrambles to free up cash to boost infrastructure and services. In what could be the biggest shake-up of the public sector since the Kennett era, a government taskforce headed by Department of Premier and Cabinet secretary Helen Silver is believed to be closely scrutinising a range of administrative and support roles, including information technology, human resources, finance, corporate services, legal services and the government reporting service. The government is applying to the Australian Taxation Office to offer a restricted class of redundancies targeting between 10 per cent and 20 per cent of some agencies, while avoiding workers involved in delivery of ‘‘front-line’’ services. Department of Human Services secretary Gill Callister has confirmed the department will shed about 500 positions. The Department of Sustainability and Environment is likely to lose about 200, while the Department of Business Innovation is likely to lose 15 per cent of its staff — about 110 positions. It is believed the Department of Primary Industry will lose about 400 positions and Justice around 690. In addition to the proposed cuts from the so-called Better Services Taskforce, an unreleased review of state finances, headed by Kennett-era Treasury secretary Mike Vertigan, has also recommended deep public sector cuts, outsourcing, privatisation and spending cuts. The government has asked the Vertigan review to examine ‘‘private sector involvement in service delivery’’. The moves have been initiated as the government tries to deliver a minimum $100 million budget surplus as part of a strategy to pay for future infrastructure without taking on debt. With the budget deeply in deficit during the second half of last year and revenue weak, it is struggling to find the money. Community and Public Sector Union Victorian secretary Karen Batt was unsympathetic, accusing it of ‘‘taking the public out of public service... There is clearly a privatisation agenda’’. Labor frontbencher Martin Pakula said: ‘‘If the Premier is getting ready to bring in the toecutters, he must come clean now and tell Victorians what it means for jobs.’’ The government is also facing hostility on another front, with business and unions attacking its decision to raid the Victorian WorkCover Authority to keep the budget in the black. Laws passed last night will result in $471 million being taken out of the WorkCover Authority over four years. Australian Industry Group Victorian director Tim Piper said no other workplace insurance system in Australian paid a dividend to government. Victorian Employers’ Chamber of Commerce and Industry chief Mark Stone said the move ‘‘must not endanger the government’s capacity or willingness’’ to cut WorkSafe premiums. More than 500 unionists rallied against the changes. Ralph Edwards of the Construction, Forestry, Mining and Energy Union said Premier Ted Baillieu ‘‘has finally done something... Unfortunately, he’s done the wrong thing.’’ Cesar Melhem of the Australian Workers’ Union said: ‘‘No government should help itself to workers’ money’’.

MOSCOW (Reuters) - Russia’s foreign ministry on Thursday accused Lithuania of an unfriendly and provocative act, a day after a Lithuanian court found a former Soviet defense minister guilty of war crimes for his role in a 1991 crackdown in Lithuania. A Vilnius court sentenced Dmitry Yazov, 94, in absentia to 10 years in prison. He was the highest-ranking person on a list of 67 former military officials and army officers being sentenced after the three-year trial. “We characterise the given actions as extremely unfriendly and essentially provocative, demonstrating the bias and political motivation of this disgraceful judgement,” Russia’s foreign ministry said in a statement. It accused the court of ignoring witness testimony and not allowing Russian diplomats to attend the trial. “The attempts by the authorities to rig obvious facts using legal manipulations simply reflect the deconstructive course of the current Lithuanian leadership with regard to Russia,” the foreign ministry said. Lithuania became the first Soviet republic in March 1990 to declare independence from Moscow. The Soviet Union was formally dissolved in December 1991. Fourteen civilians were killed by the Soviet army in January 1991, prosecutors say, all but one of them during the storming of the state television headquarters and TV tower by Soviet paratroopers. More than 700 others were wounded. Russia refused to cooperate with the trial, calling it illegal and in violation of the fundamental principles of justice, and former Soviet President Mikhail Gorbachev, 88, declined to testify.

Police searching for male in connection with knifepoint robbery STATEN ISLAND, N.Y. -- The NYPD is asking the public's assistance identifying an individual in connection with an armed robbery in the 122nd Precinct. According to police, the unidentified male entered New Targee Cleaners, located at 1132 Targee St., at approximately 5:30 p.m.on August 11 and engaged a female worker in conversation. Police said he askedabout same day dry cleaning services before leaving establishment. The man then re-entered and demanded everybody on the floor and brandished a knife, police said. An NYPD spokesman said the woman who spoke with the male resisted and refused to get down on the floor. She struggled with the man and received a small laceration on her stomach, the spokesman said. The woman refused medical attention at the scene. The suspect removed $500 and fled the location in an unknown direction, according to police. A level-one mobilization was called to search for the suspect. People with information are urged to call the precinct's detectives at 718-876-8196 or NYPD's Crime Stoppers Hotline at 1-800-577-8477 (TIPS), or for Spanish, 1-888-577-4782 (PISTA). The public can also submit tips by logging onto the Crime Stoppers website or by texting tips to 274637 (CRIMES) then entering TIP577. All calls are kept strictly confidential.

575 N.E.2d 926 (1991) 216 Ill. App.3d 647 159 Ill.Dec. 119 The PEOPLE of the State of Illinois, Plaintiff-Appellee, v. Edward G. McNEELEY, Jr., Defendant-Appellant. No. 3-90-0581. Appellate Court of Illinois, Third District. June 20, 1991. Peter A. Carusona, Office of the State Appellate Defender, Spencer Daniels, Trial Counsel, Ottawa, for Edward Gerald McNeeley, Jr. Terry A. Mertel, States' Attys. Appellate Prosecutor, Ottawa, Kevin W. Lyons, State's Atty., Peoria, for the People. Presiding Justice STOUDER. The defendant, Edward G. McNeeley, Jr., was charged by indictment with unlawful possession of more than 900 grams of cocaine and unlawful possession with intent to deliver more than 900 grams of cocaine (Ill.Rev.Stat.1989, ch. 56½, pars. 1402(a)(11), 1401(a)(11)). Following a jury trial, the defendant was acquitted of those charges but convicted of the lesser included offenses of possession of more than 15 but less than 100 grams of cocaine and possession with intent to deliver more than 15 but *927 less than 100 grams of cocaine (Ill.Rev. Stat.1989, ch. 56½, pars. 1402(a)(2), 1401(a)(2)). The trial court subsequently sentenced him to a term of seven years' imprisonment. On appeal, we found that Judge Bumgarner had erred in denying the defendant's motion to have a different judge hear his motion for a new trial. Our decision was based on the fact that the motion for a new trial directly attacked Judge Bumgarner's conduct during the reading of the jury verdicts. We therefore remanded the cause with instructions that a different judge would consider the merits of the defendant's motion for a new trial and would conduct a new sentencing hearing if he denied that motion. People v. McNeeley (No. 3-89-0395, Rule 23 Order, filed May 4, 1990). Following a hearing on remand, Judge McCuskey denied the defendant's motion for a new trial. Judge McCuskey thereafter resentenced him to seven years' imprisonment. The defendant appeals. The record shows in relevant part that at the defendant's trial the State presented considerable circumstantial evidence showing that the defendant possessed over 900 grams of a substance containing cocaine, along with paraphernalia used in selling cocaine. At the conclusion of the evidence, the jury received instructions on the charged offenses and also on the lesser offenses of possession of more than 15 but less than 100 grams of cocaine and possession with intent to deliver more than 15 but less than 100 grams of cocaine. Following deliberations, the jury returned with four verdicts. The trial judge read the first two verdicts, which found the defendant not guilty of possession of more than 900 grams of cocaine and not guilty of possession with intent to deliver 900 grams of cocaine. After reading the second not guilty verdict, the judge stated: "And now you know why we can't do much with narcotics, and you're excused. Thank you very much." He then dismissed the jury, left the bench, and went to his chambers. After learning that he had not read all of the verdicts, the judge returned to the bench and instructed the jury to return to the jury box. The last two verdicts found the defendant guilty of possession of more than 15 but less than 100 grams of cocaine and guilty of possession with intent to deliver more than 15 but less than 100 grams of cocaine. The judge subsequently ordered the jury polled and all of the jurors affirmatively stated that those were the verdicts they had reached. He then apologized to the jury for going off "half-cocked" and discharged them. At the hearing on remand, bailiff Harry Rohleder testified that he was the bailiff in the courtroom when the events in question occurred. He stated that when the judge made the above-quoted statement, he sounded a little angry. The judge then got up and walked out of the courtroom. Rohleder told the jurors to go into the jury room, which they did. As they were getting ready to leave, the judge asked them to be reseated in the jury box. A minute or two had passed between the time the judge left the bench and when he returned. Rohleder noted that no one went into the jury room with the jurors, and no one talked with them at any time in his presence. He further noted that when the judge initially made his comments and left, the jurors just looked at each other and shrugged or smiled. Courthouse security officer Kenny Mack testified that after the trial judge read the first two verdicts, he threw down the verdict forms, jumped up, and quickly went into his chambers. The jurors looked upset and started talking among themselves. They then went into the jury room. After one to two minutes, the judge returned. Mack noted that at one point before the judge returned, one or two of the jurors went out the gate that divides the audience from the rest of the courtroom, but were told to come back by the bailiff. On cross-examination, Mack stated that the jurors were unable to hear anything the assistant state's attorney said to the judge in his chambers. He also noted that although he handcuffed the defendant, it *928 was done outside the sight of anyone in the courtroom. Mack acknowledged that while the events in question were transpiring, he was busy escorting the defendant out of the courtroom and was paying attention to him. Marcia Straub, the defendant's trial attorney, testified that the judge made the statement in question in a loud angry voice, swung his hands in the air, got up, and literally ran off the bench. She noted that it was possible the jurors heard the defendant expressing his relief to his girlfriend after the first two verdicts were read. Straub also noted that the jurors appeared upset and angry. She and the defendant then walked out of the courtroom. At the time, the jurors were talking to each other in the jury room and the bailiff was with them. When the judge returned after about three minutes, the jurors were still in the jury room or coming back into the jury box. She did not see any of them anywhere else. Deputy circuit clerk Linda Smiddy testified that she was clerking for the trial judge at the time. After the judge read two of the verdicts, he handed all four forms to her and left the courtroom. She immediately went after him and handed him the four verdict forms, telling him he had failed to read two of them. No more than two minutes passed between the time he left and when he returned. When she and the judge returned to the courtroom, the jurors were scattered, but were all in the room. The motion judge found that there was no evidence the trial judge's comments had prejudiced the defendant, coming as they were after the jury had returned unanimous verdicts. The judge noted that the jury's deliberations were uneventful and that the defendant had presented no direct evidence that the polling process was tainted in any way. On appeal, the defendant argues that he was denied his right to properly poll the jury on the guilty verdicts because the trial judge's statements and conduct insured that no juror would voice any dissent with respect to the verdicts. The purpose of polling a jury is to determine that the verdict accurately reflects each juror's vote as reached during deliberations and that the jurors' votes were not the result of force or coercion. (People v. Williams (1983), 97 Ill.2d 252, 73 Ill.Dec. 360, 454 N.E.2d 220.) For the comments of a judge to constitute reversible error, the defendant must show that the remarks were prejudicial and that he was harmed by them. (People v. Garcia (1988), 169 Ill.App.3d 618, 120 Ill.Dec. 81, 523 N.E.2d 992.) The mere possibility of harm to the defendant is not sufficient grounds for holding that a jury poll was improper. People v. Chandler (1980), 88 Ill.App.3d 644, 44 Ill.Dec. 314, 411 N.E.2d 283. Here, the defendant's appeal argument is necessarily speculative, since there was no direct evidence that any juror was precluded from voicing his dissent due to the trial judge's behavior. While it is certainly possible to envision situations where a judge's behavior would mandate a presumption that he had improperly influenced the jury polling, this is not such a case. The instant judge's actions, while improper, left a question of fact as to whether the jury polling had been tainted. The judge hearing the motion for a new trial determined from the evidence presented that the defendant had failed to meet his burden of showing that the polling was tainted. While that evidence included some testimony that the jurors were upset and scared by the judge's outburst, it also included testimony indicating that the jurors were unfazed by the outburst. Under these circumstances, we find that the motion judge did not abuse his discretion in finding that the defendant was not entitled to a new trial. The defendant further argues that it was reversible error to receive the jury's guilty verdict after the jury was discharged and the court had lost control of it. He relies upon People v. DeStefano (1965), 64 Ill.App.2d 389, 212 N.E.2d 357, where the trial court improperly accepted a guilty verdict after declaring a mistrial. In DeStefano, the jury foreman told the court the jury could not reach a verdict. The court declared *929 a mistrial and released the jurors, who left the box, returned to the jury room, and engaged in conversation with the bailiff and an assistant state's attorney. The court then learned that the jury had in fact found the defendant guilty with respect to one charge and was hung only as to a second charge. After the bailiff retrieved the signed guilty verdict form from the jury room, where it had been left, the trial court accepted the verdict. The appellate court reversed, holding that the trial court had lost control of the jury and that the integrity of the verdict was called into question. In cases of this type, the pivotal question is whether the trial court lost control of the jury, i.e., whether the protective shield which must surround a jury was removed, allowing the jurors to be influenced by improper outside factors. (People v. Gale (1971), 132 Ill.App.2d 986, 271 N.E.2d 94.) Here, unlike DeStefano, we note that either the judge or the deputy circuit clerk retained control over all the signed verdict forms throughout the events in question. Further, the judge hearing the motion for a new trial could have properly concluded from the evidence that the court never lost control of the jurors. One witness indicated the jurors might have heard the defendant talk with his girlfriend. Another witness, who admitted that he was paying more attention to the defendant than to the jurors, indicated that one or two jurors might have gone through the gate. The bulk of the evidence showed, however, that the jurors simply went back to the jury room by themselves, then returned to the jury box when the judge returned. Under these circumstances, the motion judge could have properly concluded that the jurors were subjected to no improper outside influences. Accordingly, the judgment of the circuit court of Peoria County is affirmed. Affirmed. BARRY and GORMAN, JJ., concur.

--- author: - 'V. D’Elia$^{1,2}$, E. Pian$^{3,4}$, A. Melandri$^{5}$, P. D’Avanzo$^{5}$, M. Della Valle$^{6,7}$, P.A. Mazzali$^{8,9,10}$, S. Piranomonte$^{1}$, G. Tagliaferri$^{5}$, L.A. Antonelli$^{1,2}$, F. Bufano$^{11,12}$, S. Covino$^{5}$, D. Fugazza$^{5}$, D. Malesani$^{13}$, P. Møller$^{14}$, E. Palazzi$^{3}$' title: 'SN 2013dx associated with GRB130702A: a detailed photometric and spectroscopic monitoring and a study of the environment [^1]' --- [Long-duration gamma-ray bursts (GRBs) and broad-line, type Ic supernovae (SNe) are strongly connected. We aim at characterizing SN 2013dx, which is associated with GRB130702A, through sensitive and extensive ground-based observational campaigns in the optical-IR band.]{} [We monitored the field of the Swift GRB 130702A (redshift z = 0.145) using the 8.2 m VLT, the 3.6 m TNG and the 0.6 m REM telescopes during the time interval between 4 and 40 days after the burst. Photometric and spectroscopic observations revealed the associated type Ic SN 2013dx. Our multiband photometry allowed constructing a bolometric light curve.]{} The bolometric light curve of SN 2013dx resembles that of 2003dh (associated with GRB030329), but is $\sim$10% faster and $\sim$25% dimmer. From this we infer a synthesized $^{56}$Ni mass of $\sim$0.2 M${_\odot}$. The multi-epoch optical spectroscopy shows that the SN 2013dx behavior is best matched by SN 1998bw, among the other well-known low-redshift SNe associated with GRBs and XRFs, and by SN 2010ah, an energetic type Ic SN not associated with any GRB. The photospheric velocity of the ejected material declines from $\sim 2.7\times 10^{4}$ km s$^{-1}$ at $8$ rest frame days from the explosion, to $\sim 3.5\times 10^{3}$ km s$^{-1}$ at $40$ days. These values are extremely close to those of SN1998bw and 2010ah. We deduce for SN 2013dx a kinetic energy of $\sim 35 \times 10^{51}$ erg and an ejected mass of $\sim 7$ M${_\odot}$. This suggests that the progenitor of SN2013dx had a mass of $\sim$25-30 M$_\odot$, which is 15-20% less massive than that of SN 1998bw. Finally, we studied the SN 2013dx environment through spectroscopy of the closeby galaxies: $9$ out of the $14$ inspected galaxies lie within $0.03$ in redshift from $z=0.145$, indicating that the host of GRB130702A/SN 2013dx belongs to a group of galaxies, an unprecedented finding for a GRB-associated SN and, to our knowledge, for long GRBs in general. Introduction ============ The connection between gamma-ray bursts and supernovae has been firmly established on the basis of a handful of nearby events ($z < 0.3$) for which a decent spectroscopic monitoring was possible (Galama et al. 1998; Patat et al. 2001; Hjorth et al. 2003; Stanek et al. 2003; Malesani et al. 2004; Pian et al. 2006; Bufano et al. 2012), which enabled deriving the physical properties of the SNe (Mazzali et al. 2006a,b; Woosley & Bloom 2006; Hjorth & Bloom 2012). In these few cases, observations have revealed that SNe accompanying GRBs are explosions of bare stellar cores, that is, their progenitors (whose estimated mass is higher than $\sim$20 M$_\odot$) have lost all their hydrogen and helium envelopes before collapse (a.k.a. supernovae of type Ic). A stripped star of Wolf-Rayet type (Crowther 2007) appears indeed more suited to favor the propagation of a relativistic jet. However, many unknowns still surround the GRB-SN connection: the properties of their progenitors (e.g., their multiplicity and metallicity, Podsiadlowski et al. 2010; Levesque et al. 2014), the nature of their remnants (e.g., Woosley & Heger 2012; Mazzali et al. 2014), and the formation and propagation of the jets through the stellar envelope (Zhang et al. 2003; Uzdensky & MacFadyen 2006; Fryer et al. 2009; Lyutikov 2011; Bromberg et al. 2014). The detailed analysis of the physics of the supernovae can elucidate these problems, and accurate optical spectroscopy is a fundamental tool to this aim. It is well known, in fact, that light curve models alone do not have the ability to uniquely determine all supernova parameters. In particular, while the mass of $^{56}$Ni can be reasonably well established from the light-curve peak if the time of explosion is known to within a good accuracy, or from the late, exponential decline phase of the light curve if this is observed, the two parameters that determine the shape of the light curve, the ejecta mass $M_{ej}$ and the kinetic energy $E_K$, are degenerate (Eq. 2; Arnett 1982). Only the simultaneous use of light curve and spectra can break this degeneracy (Mazzali et al. 2013, and references therein). Time-resolved optical spectra of GRB-SNe can be acquired only at $z \ls 0.3, $ however. At higher redshift, the subtraction of the host galaxy and afterglow components from the spectrum of the GRB optical counterpart lowers the signal-to-noise ratio dramatically, so that the resulting spectral residuals are noisy (e.g., Melandri et al. 2012; 2014). In fact, in the redshift range $0.3 \ls z \ls 1$ the current generation of telescopes can test the SN-GRB connection only on the basis of a single spectrum acquired at the epoch of maximum light (Della Valle et al. 2003; Soderberg et al. 2005; Berger et al. 2011; Sparre et al. 2011; Jin et al. 2013, Cano et al. 2014) or through the detection of rebrightenings in the GRB afterglow light-curves, due to emerging SNe (e.g. Bloom et al. 1999; Lazzati et al. 2001; Greiner et al. 2003; Garnavich et al. 2003; Masetti et al. 2003; Zeh et al. 2004; Gorosabel et al. 2005; Bersier et al. 2006; Della Valle et al. 2006; Soderberg et al. 2006, 2007; Cobb et al. 2010; Tanvir et al. 2010; Cano et al. 2011a,b; 2014). Finally, at redshift higher than one, even the detection of a rebrightening is in general not possible. SN 2013dx, associated with GRB130702A at $z=0.145$, represents a remarkable new entry into the group of the most consistently investigated SN-GRB events. Here, we present the results of our extensive photometric and spectroscopic campaign, carried out with the VLT, TNG, and REM telescopes, covering an interval of about $40$ days after GRB detection. In particular, we obtained 16 spectra spaced apart by 2-3 days. The paper is organized as follows: Section 2 summarizes the properties of GRB130702A and its associated SN 2013dx as reported in the literature; Sect. 3 introduces our dataset and illustrates the data reduction process; Sect. 4 presents our results; in Sect. 5 we draw our conclusions. We assume a cosmology with $H_0=70$ km s$^{-1}$ Mpc$^{-1}$, $\Omega_{\rm m} = 0.3$, $\Omega_\Lambda = 0.7$. GRB130702A/SN 2013 dx ===================== GRB130702A was detected by [*Fermi*]{}-LAT and -GBM instruments on July 02, 2013 at 00:05 UT (Fermi trigger 394416326, Cheung et al. 2013; Collazzi et al. 2013). In the following, this time represents our $t0$. The intermediate Palomar Transient Factory reported a possible counterpart after following up the burst in the optical band at the position RA(J2000) = $14h 29m 14.78s$ DEC(J2000) = +$15d 46' 26.4"$. The transient was $0.6"$ away from an SDSS faint source ($r = 23.01$) classified as a star, which was later identified as its host galaxy (Singer et al. 2013; Kelly et al. 2013). A [*Swift*]{} target-of-opportunity observation was then activated, and analysis of the XRT and UVOT data revealed a coincident, new X-ray source in the sky (D’Avanzo et al. 2013a). The fading behavior was confirmed both in the X-ray by subsequent XRT observations (D’Avanzo et al. 2013c) and in the optical bands by several ground-based telescopes (see, e.g., Guidorzi et al. 2013; Xu et al. 2013; D’Avanzo et al. 2013b). GRB130702A was also observed by Konus-Wind in the $20-1200$ keV band (Golenetskii et al. 2013) and by INTEGRAL (Hurley et al. 2013) in the mm (Perley and Kasliwal 2013) and in the radio band (van der Horst 2013). The redshift of the transient was reported to be $z=0.145$ (Mulchaey et al. 2013a; D’Avanzo et al. 2013d; Mulchaey et al. 2013b). The emerging of a new supernova associated with GRB130702A was detected by several spectroscopic measurements (Schulze et al. 2013; Cenko et al. 2013; D’Elia et al. 2013), and was named SN 2013dx (Schulze et al. 2013b, D’Elia et al. 2013b). Observations and data reduction =============================== We observed the field of SN 2013dx in imaging and spectroscopic modes using VLT, TNG, and REM. Details on the data acquisition and reduction process are given below. Figure 1 shows the SN 2013dx field, with two nearby galaxies clearly visible. Details on the analysis of this field can be found in Sect. 4.6. {width="9cm"} Photometry ---------- ### TNG photometry TNG photometry was conducted using the DOLORES camera in imaging mode, with the SDSS g,r,i,z and the Johnson U filters. Image reduction was carried out by following the standard procedures: subtraction of an averaged bias frame, division by a normalized flat frame. Astrometry was performed using the USNOB1.0[^2] catalogs. Aperture photometry was made with the Starlink[^3] PHOTOM package. The aperture was set to $10$ pixels, which is equivalent to $2.5"$. The calibration was made against the SDSS catalog and Landolt standard field stars (for the U filter). To minimize any systematic effect, we performed differential photometry with respect to local isolated and non-saturated standard stars selected from these two catalogs. The log of the TNG photometric observations can be found in Table 1. Date$^a$ t-t0 (d)$^b$ texp(s)$^c$ filt.$^d$ mag$^e$ flux ($\mu$Jy)$^f$ ---------- -------------- ---------------- ----------- ---------------- -------------------- 0705 $ 3.89692$ $ 2\times300$ U $19.95\pm0.04$ $23.4\pm0.9$ 0720 $ 18.90617$ $ 5\times120$ U $21.27\pm0.26$ $7.0\pm1.9$ 0723 $ 21.90367$ $ 10\times120$ U $21.94\pm0.27$ $3.7\pm1.0$ 0804 $ 33.89719$ $ 5\times240$ U $22.66\pm0.28$ $1.9\pm0.6$ 0703 $ 1.96469$ $ 2\times300$ g $19.29\pm0.06$ $80.4\pm4.3$ 0705 $ 3.88074$ $ 1\times300$ g $20.12\pm0.08$ $37.4\pm2.8$ 0714 $ 12.93708$ $ 1\times300$ g $20.33\pm0.12$ $30.9\pm3.5$ 0716 $ 14.92913$ $ 1\times300$ g $20.40\pm0.10$ $28.9\pm2.9$ 0717 $ 15.90906$ $ 1\times300$ g $20.38\pm0.04$ $29.6\pm1.0$ 0720 $ 18.89108$ $ 1\times300$ g $20.76\pm0.07$ $20.7\pm1.4$ 0723 $ 21.88002$ $ 1\times300$ g $21.05\pm0.10$ $16.0\pm1.6$ 0703 $ 1.95541$ $ 2\times300$ r $19.10\pm0.01$ $91.9\pm1.2$ 0705 $ 3.89015$ $ 1\times300$ r $19.84\pm0.02$ $46.6\pm0.8$ 0709 $ 7.91513$ $ 1\times300$ r $19.91\pm0.05$ $43.5\pm2.1$ 0714 $ 12.94571$ $ 1\times300$ r $19.77\pm0.03$ $49.8\pm1.2$ 0716 $ 14.92508$ $ 1\times300$ r $19.76\pm0.03$ $50.2\pm1.2$ 0717 $ 15.92203$ $ 1\times300$ r $19.71\pm0.06$ $52.6\pm2.7$ 0720 $ 18.89967$ $ 1\times300$ r $19.85\pm0.04$ $46.1\pm1.6$ 0723 $ 21.89224$ $ 1\times300$ r $20.06\pm0.04$ $38.1\pm1.4$ 0804 $ 33.88716$ $ 1\times300$ r $20.92\pm0.06$ $17.3\pm1.0$ 0703 $ 1.97366$ $ 2\times300$ i $18.97\pm0.05$ $101\pm4.5$ 0705 $ 3.88548$ $ 1\times300$ i $19.89\pm0.04$ $43.5\pm1.7$ 0714 $ 12.94145$ $ 1\times300$ i $19.95\pm0.05$ $41.2\pm2.0$ 0716 $ 14.92082$ $ 1\times300$ i $19.95\pm0.06$ $41.2\pm2.4$ 0717 $ 15.92766$ $ 1\times300$ i $19.89\pm0.07$ $43.3\pm2.7$ 0720 $ 18.89542$ $ 1\times300$ i $19.82\pm0.06$ $46.5\pm2.8$ 0723 $ 21.88747$ $ 1\times300$ i $20.15\pm0.06$ $34.1\pm1.9$ 0705 $ 3.90667$ $ 5\times120$ z $19.71\pm0.03$ $50.1\pm1.3$ : **Log of the TNG photometric observations** $^a$: Observation date (month-day) $^b$: Time after the GRB (observer frame) $^c$: Exposure time $^d$: Adopted filter $^e$: Magnitudes in AB system, except U-band magnitudes, which are Vega (not corrected for the Galactic extinction) $^f$: Fluxes (corrected for the Galactic extinction). ### VLT photometry VLT photometry was carried out using the FORS2 camera in imaging mode with the Johnson U,B,R,I filters. Image reduction was performed using the same standard techniques as were adopted for the TNG data. Images were calibrated against Landolt standard field stars. Again, differential photometry was performed to minimize any systematic effects. The aperture was set to $10$ pixels, which is equivalent to $1.3"$. The log of the VLT photometric observations can be found in Table 2. Date$^a$ t-t0 (d)$^b$ texp(s)$^c$ filt.$^d$ mag$^e$ flux ($\mu$Jy)$^f$ ---------- -------------- ------------- ----------- ------------------ -------------------- 0710 8.032 $2\times60$ u $ 21.36\pm0.04$ $12.7\pm0.5$ 0711 9.974 $2\times60$ u $ 21.42\pm0.04$ $12.0\pm0.5$ 0713 11.966 $2\times60$ u $ 21.51\pm0.07$ $11.1\pm0.7$ 0716 14.974 $2\times60$ u $ 21.70\pm0.14$ $9.3 \pm1.3$ 0720 18.971 $2\times60$ u $ 22.53\pm0.60$ $4.3 \pm3.2$ 0722 20.972 $2\times60$ u $ 22.54\pm0.51$ $4.3 \pm2.6$ 0727 25.975 $6\times60$ u $ 23.06\pm0.12$ $2.7 \pm0.3$ 0730 28.980 $8\times60$ u $ 23.21\pm0.11$ $2.3 \pm0.2$ 0804 33.002 $8\times60$ u $ 23.20\pm0.16$ $2.3 \pm0.4$ 0806 35.966 $8\times60$ u $ 23.24\pm0.15$ $2.2 \pm0.3$ 0810 39.984 $8\times60$ u $ 23.46\pm0.21$ $1.8 \pm0.4$ 0710 8.034 $1\times60$ g $ 20.20\pm0.01$ $37.2\pm0.3$ 0711 9.976 $1\times60$ g $ 20.12\pm0.01$ $39.8\pm0.4$ 0713 11.968 $1\times60$ g $ 20.30\pm0.01$ $33.9\pm0.4$ 0716 14.976 $1\times60$ g $ 20.40\pm0.03$ $30.8\pm0.8$ 0720 18.973 $1\times60$ g $ 20.85\pm0.07$ $20.3\pm1.4$ 0722 20.974 $1\times60$ g $ 20.87\pm0.09$ $20.0\pm1.8$ 0727 25.979 $2\times60$ g $ 21.21\pm0.03$ $14.6\pm0.4$ 0730 28.987 $2\times60$ g $ 21.67\pm0.03$ $9.5 \pm0.2$ 0804 33.009 $2\times60$ g $ 21.85\pm0.04$ $8.1 \pm0.3$ 0806 35.973 $2\times60$ g $ 22.12\pm0.04$ $6.3 \pm0.2$ 0810 39.991 $2\times60$ g $ 22.17\pm0.06$ $6.0 \pm0.3$ 0710 8.035 $1\times60$ r $ 19.99\pm0.01$ $44.9\pm0.3$ 0710 8.040 $1\times60$ r $ 19.97\pm0.01$ $45.7\pm0.3$ 0711 9.977 $1\times60$ r $ 19.91\pm0.01$ $48.4\pm0.3$ 0711 9.982 $1\times60$ r $ 19.90\pm0.01$ $48.9\pm0.3$ 0713 11.969 $1\times60$ r $ 19.84\pm0.01$ $51.6\pm0.3$ 0716 14.977 $1\times60$ r $ 19.82\pm0.01$ $52.7\pm0.5$ 0720 18.974 $1\times60$ r $ 19.93\pm0.01$ $47.4\pm0.6$ 0722 20.968 $1\times60$ r $ 19.94\pm0.02$ $47.1\pm0.9$ 0727 25.981 $1\times60$ r $ 20.25\pm0.01$ $35.4\pm0.3$ 0730 28.989 $1\times60$ r $ 20.35\pm0.01$ $32.2\pm0.3$ 0804 33.011 $1\times60$ r $ 20.68\pm0.02$ $23.7\pm0.3$ 0806 35.975 $1\times60$ r $ 20.95\pm0.02$ $18.6\pm0.3$ 0810 39.994 $1\times60$ r $ 21.20\pm0.03$ $14.8\pm0.4$ 0710 8.037 $1\times60$ i $ 20.22\pm0.02$ $36.3\pm0.5$ 0711 9.979 $1\times60$ i $ 20.14\pm0.01$ $39.3\pm0.4$ 0713 11.971 $1\times60$ i $ 20.07\pm0.01$ $41.8\pm0.5$ 0716 14.978 $1\times60$ i $ 19.93\pm0.02$ $47.3\pm0.7$ 0720 18.976 $1\times60$ i $ 19.76\pm0.08$ $55.3\pm4.0$ 0722 20.977 $1\times60$ i $ 19.99\pm0.02$ $44.8\pm1.0$ 0727 25.982 $1\times60$ i $ 20.23\pm0.02$ $35.9\pm0.6$ 0730 28.990 $1\times60$ i $ 20.28\pm0.02$ $34.3\pm0.6$ 0804 33.013 $1\times60$ i $ 20.49\pm0.05$ $28.4\pm1.3$ 0806 35.977 $1\times60$ i $ 20.60\pm0.03$ $25.5\pm0.6$ 0810 39.995 $1\times60$ i $ 21.02\pm0.06$ $17.4\pm0.9$ : **Log of the VLT photometric observations** $^a$: Observation date (month-day) $^b$: Time after the GRB (observer frame) $^c$: Exposure time $^d$: Adopted filter $^e$: Magnitudes in AB system (not corrected for the Galactic extinction) $^f$: Fluxes (corrected for the Galactic extinction). ### REM photometry Optical and NIR observations were performed with the REM telescope (Zerbi et al. 2001; Chincarini et al. 2003; Covino et al. 2004) equipped with the ROSS2 optical imager and the REMIR NIR camera. The ROSS2 instrument is able to observe simultaneously in the g, r, i, and z SDSS filters. Observations of GRB130702A/SN2013dx were carried out over fifteen epochs between 2013 July 10 and Aug 13. Image reduction was carried out by following the same standard procedures as for the TNG and VLT photometry, including differential photometry. The aperture was set to $10$ pixels, which is equivalent to $5"$. Astrometry was performed using the USNOB1.0 and the 2MASS[^4] catalogs for the optical and NIR frames, respectively. The calibration was made against the SDSS catalog for the optical filters and the 2MASS catalog for NIR filters. The log of the REM photometric observations can be found in Table 3, where we only report the g and r photometry. In the i band the S/N was too low, and the SN 2013dx too much contaminated by the host galaxy to obtain firm detections. In the z and H bands we did not detect the SN down to typical upper limits of $z\sim 19.7$ (AB, $3\sigma$) and $H\sim 18$ (Vega, $3\sigma)$. The columns are organized in the same way as in Table 1. Date$^a$ t-t0 (d)$^b$ texp(s)$^c$ filt.$^d$ mag$^e$ flux ($\mu$Jy)$^f$ ---------- -------------- -------------- ----------- ---------------- -------------------- 0711 $9.04484 $ $9\times300$ g $20.54\pm0.19$ $25.4\pm9.2$ 0713 $11.05959$ $9\times300$ g $20.56\pm0.08$ $25.1\pm3.6$ 0715 $13.10455$ $9\times300$ g $20.40\pm0.11$ $28.9\pm5.9$ 0716 $14.10692$ $9\times300$ g $20.45\pm0.13$ $27.6\pm6.9$ 0718 $16.06110$ $9\times300$ g $20.32\pm0.22$ $31.3\pm13$ 0719 $17.09980$ $9\times300$ g $21.56\pm0.41$ $10.0\pm8.7$ 0725 $22.99765$ $9\times300$ g $21.36\pm0.13$ $12.0\pm3.0$ 0711 $ 9.04484$ $9\times300$ r $19.96\pm0.09$ $43.5\pm4.9$ 0713 $11.05959$ $9\times300$ r $19.91\pm0.07$ $45.3\pm4.1$ 0715 $13.10455$ $9\times300$ r $19.75\pm0.10$ $52.6\pm6.7$ 0716 $14.10692$ $9\times300$ r $19.62\pm0.14$ $59.5\pm10$ 0718 $16.06110$ $9\times300$ r $19.81\pm0.16$ $49.8\pm10$ 0719 $17.09980$ $9\times300$ r $19.88\pm0.16$ $46.6\pm9.5$ 0725 $22.99765$ $9\times300$ r $20.01\pm0.15$ $41.6\pm7.4$ : **Log of the REM photometric observations** $^a$: Observation date (month-day) $^b$: Time from the GRB (observed frame) $^c$: Exposure time $^d$: Adopted filter $^e$: Magnitudes in AB system (not corrected for the Galactic extinction) $^f$: Fluxes (corrected for the Galactic extinction). {width="9cm"} Spectroscopy ------------ ### TNG spectroscopy TNG spectroscopy was carried out using the DOLORES camera in slit mode, with the LR-B grism. This configuration covers the spectral range $3000-8430$Å with a resolution of $\lambda/\Delta\lambda = 585$ for a slit width of $1$” at the central wavelength $5850$Å. Spectra were acquired at five epochs. A slit width of $1$” was used in all but the first observation, for which a $1.5$” slit was adopted, owing to a seeing angle higher than $1$”. The slit position angle was set to the parallactic angle in all our observations. Table 4 contains a summary of the TNG spectroscopic observations. The spectra were extracted using standard procedures (bias and background subtraction, flat fielding, wavelength and flux calibration) under the packages ESO-MIDAS[^5] and IRAF[^6]. Ne-Hg or helium lamps and spectrophotometric stellar spectra acquired in the same nights as the target were used for wavelength and flux calibration. To account for slit losses, we matched the flux-calibrated spectra with our multiband TNG photometry acquired in the same nights. ### VLT spectroscopy VLT spectroscopy was carried out using the FORS2 camera in slit mode, with the 300V grism. This configuration covers the spectral range $3300-9500$ Å with a resolution of $\lambda/\Delta\lambda = 440$ for a slit width of $1$” at the central wavelength $5900$ Å. Eleven spectroscopic epochs were acquired. A slit width of $1$” was used in all observations. The slit position angle was set to different values in each observation to place different field galaxies in the slit to study the SN 2013dx surroundings (see Sect. 4.2 for details). Table 5 gives a summary of the VLT spectroscopic observations. As for the TNG data, the spectra were extracted using the packages ESO-MIDAS and IRAF. A He+Ag/Cd+Ar lamp and spectrophotometric stars acquired the same night of the target were used for wavelength and flux calibration. For a few epochs, some spectrophotometric stars were not observed in the same night as the target. In these cases, the flux calibration was performed using archival data. In none of these epochs, however, was the difference beween the observation time of the scientific files and the adopted standard longer than three days. To account for slit losses, we checked the flux-calibrated spectra against our simultaneous VLT multiband photometry. Results ======= Optical light curves -------------------- Our optical photometric data, only corrected for Galactic extinction, are shown in Fig. 2. The SN component starts to emerge and dominate its host galaxy and GRB optical afterglow at about $\text{five}$ days after the GRB explosion. We fit empirical curves to the data past day five to determine the peak times of SN2013dx in the different bands. The results in the rest frame are $T_{peak,i} = 16 \pm 2$ days, $T_{peak,r} = 15 \pm 1$ days, $T_{peak,g} = 10 \pm 2$ days, and $T_{peak,U} = 8 \pm 1$ days. SN 2013dx is one of the few cases in which a SN is observed in the U band. The U peak is observed very early, at about one week in the rest-frame. As commonly observed in other SNe, the peak occurs at later times while moving to redder bands. As an example, the I-band peak is observed about a week later than that in the U-band. {width="18cm"} Optical spectra --------------- First, all the VLT and TNG optical spectra of SN 2013dx were dereddened using the Galactic value $E(B-V)=0.04$ mag toward its line of sight (Schlegel, Finkbeiner, & Davis 1998). The intrinsic extinction appears to be negligible both from X-ray data and from analysis of the X-ray-to-optical spectral energy distribution. Then, we estimated the host galaxy contribution. Since SN 2013dx was still bright at the time of our last observation (10 Aug.) and later on its field became not observable anymore because of solar constraints, we could not acquire a reliable spectrum to subtract the host galaxy contribution from our data. Therefore, we considered the SDSS magnitudes of the host galaxy, $u=24.42\pm 0.96$, $g= 23.81\pm0.85$, $r = 23.01\pm0.24$ $i=23.22\pm0.39,$ and $z=23.04\pm0.59$, and noted that after they were reduced to rest-frame, they were consistent with the normalized template of a star-forming galaxy with moderate intrinsic absorption ($E(B-V) <0.10$, Kinney et al. 1996). Then we subtracted this rescaled template from our dereddened fluxes. The host galaxy contributes about 15% of the total flux, and possibly less, because not all its light is captured in the slit when acquiring the SN spectra. Finally, we subtracted the afterglow contribution. The afterglow light curve can be modeled with a broken power law, as shown in Singer et al. (2013). We thus adopted their first decay index ($\alpha_1=0.57$) and their temporal break $t_{b}=1.17$ days. However, the second decay index $\alpha_2$ does not take into account the emerging SN contribution. $\alpha_2=1.85$ is the lowest index for which the afterglow is not oversubtracted in our early time photometry, while $\alpha_2=2.5$ is the highest index allowed by the closure relations linking spectral and temporal indices (Zhang & Mészáros 2004). Thus, we chose an average $\alpha_2 = 2.2$. The adopted spectral index is $\beta_{\nu}=0.7$ (Singer et al. 2013). Even assuming the two extreme decay indices, the difference in the afterglow contribution can only be appreciated in the first three spectra, and it is lower than 20% in the worst case. Figure 3 shows our sixteen dereddened, host- and afterglow-subtracted TNG and VLT spectra. The spectra are shown starting from $4000$Å in the rest-frame, because the flux calibration becomes unreliable at shorter wavelengths. In Fig. 4 we compare in the rest-frame 11 of our spectra with those of SN 1998bw at comparable phases after explosion (Patat et al. 2001). Each SN 1998bw spectrum is scaled in flux by an arbitrary constant to find the best match with our spectral dataset. In most pairs of spectra the same continuum shape and broad absorption features can be seen, even if some diversities are present (at t$<20$ d the $4400$Å pseudo-emission peak is completely absent in 1998bw; the pseudo-peak around $6300$Å in 1998bw is absent in 2013dx; the strong absorption around $7000$Å in 1998bw is much less pronounced in 2013dx at t$<15$ d). This fact leads us to classify SN 2013dx as a broad-line type Ic SN, that is, one with a highly stripped progenitor (no hydrogen or helium left before explosion), similar to those of previously studied GRB- and XRF-SNe (Mazzali et al. 2006a,b). Other GRB-associated SNe, such as 2003dh, 2006aj, and 2010bh, do not compare spectrally as convincingly with SN 2013dx. {width="9cm"} Of the broad-lined SNe that are not accompanied by GRBs/XRFs, the type Ic SN 2010ah shows a remarkable spectral similarity. In Fig. 5 we show the comparison of the models that best describe the two available spectra of SN2010ah (Mazzali et al. 2013) with the spectra of SN2013dx (corrected as detailed above) taken at comparable phases. The agreement between the two SNe is quite good at $4500 \ls \lambda \ls 6000$ Å, where the most relevant absorption features are located. At wavelengths shorter than $4500$ Å some residual contamination from the afterglow or a shock breakout component (e.g., Campana et al. 2006; Ferrero et al. 2006) might still be present in the SN2013dx spectrum, while at wavelengths higher than $6000$ Å the model shown for SN2010ah clearly does not match SN 2013dx accurately. We note that both SNe show a SiII absorption line ($\sim6000$ Å) and O I absorption line ($\sim7300$ Å), but they are weaker in SN2013dx than in SN2010ah. This may suggest a reduced abundance of silicon and oxygen in the former SN. {width="9cm"} Bolometric light curve ---------------------- We computed a bolometric light curve in the range $3000--10000$ Åfrom our multicolor light curves. After correcting the photometric data in an analogous way as done for the spectra (Galactic extinction, host galaxy, and afterglow contribution, see Sect. 4.2) and after applying k-corrections using our VLT spectra (that cover a wider wavelength range than the TNG spectra), we splined the residual monochromatic light curves, which should represent the supernova component, and the broad-band flux at each photometric observation epoch was integrated. The flux was linearly extrapolated blueward of the U-band flux down to 3000 Å and redward of the I-band flux to $10000$ Å. The result is reported in Fig. 6. The errors associated with the photometry, host galaxy template, and afterglow were propagated and summed in quadrature. The figure also shows the bolometric light curves of SN 1998bw (Patat et al. 2001), SN 2006aj (Pian et al. 2006), SN 2010bh (Bufano et al. 2012), SN 2003dh (Hjorth et al. 2003), SN 2003lw (Mazzali et al. 2006a), SN 1994I (Richmond et al. 1996) and SN 2012bz (Melandri et al. 2012). {width="9.2cm"} Photospheric velocities ----------------------- To estimate the velocity of the SN ejected material, we started out from the general similarity between our spectra and those of SN1998bw. Following Patat et al. (2001, see their Fig. 5), we identified the [$\lambda$6355]{} feature and followed its redward shift along our spectra. In the spectra acquired between 17 and 22 July, the cosmological redshift and the blueshift due to the photospheric expansion combine to cause this absorption doublet to overlap with the telluric feature at 6870 Å. For these spectra, the position of the [$\lambda$6355]{} cannot be measured. ![Temporal evolution of the photosphere expansion velocity of SN 2013dx (large circles) measured directly on the spectra from the position of the minimum of the [$\lambda$6355]{} absorption line. For comparison we report the photospheric velocities of other core-collapse Ic SNe (1994I, small circles; 2002ap, stars; 2003dh, triangles; 2006aj, small filled squares), as derived from spectral models (Sauer et al. 2006; Mazzali et al. 2002; 2003; 2006b). For SN1998bw we report both the velocities derived from direct measurements (crosses, Patat et al. 2001) and those derived from models (large open squares, Nakamura et al. 2001).](Photo4.pdf){width="9cm"} The time evolution of the photosphere expansion velocity as deduced from the minimum of the absorption trough of the $\lambda$6355 line is shown in Fig. 7 (large circles). The velocity decline extends from $\sim 2.7\times 10^{4}$ km s$^{-1}$ at $8$ rest frame days from the explosion to $\sim 3.5\times 10^{3}$ km s$^{-1}$ at $40$ days. Figure 7 also displays the photospheric velocities of other SNe, in particular that of SN 1998bw, computed by Patat et al. (2001) using the same procedure as that adopted by us. The photospheric velocities of SN 2013dx and SN 1998bw agree very well, although at very late time the latter retains a slightly higher velocity expansion (see also Fig. 4 of Patat et al. 2001). Comparing the expansion velocity of SN 2013dx with that of other SNe, we find that the former is higher than that of SN 1994D (Patat et al. 1996), SN 1994I (Millard et al. 1999), SN 1997ef (Patat et al. 2001) and SN 2006aj (Mazzali et al. 2006), but not as extreme as that of SN 2003dh (Hjorth et al. 2003). Physical parameters of SN 2013dx -------------------------------- The bolometric light curve of SN 2013dx shows that the peak luminosity of this SN is intermediate between those of the nearby GRB-SNe 1998bw and 2003dh on one hand and those of the two XRF-SNe 2006aj and 2010bh (Fig. 6) on the other. The spectrum of SN 2013dx is much more similar to that of the most energetic Ic SNe, and especially to SN 2010ah, which, among the broad-lined Ic SNe not accompanied by a GRB/XRF, is the most spectroscopically similar to SN 1998bw (Mazzali et al. 2013), although because of its lower ejecta mass, it has a significantly lower kinetic energy ($1.2 \times 10^{52}$ erg vs $5 \times 10^{52}$ erg inferred by Nakamura et al. 2001 for SN 1998bw). The similarity of the light-curve shape of SN 2013dx to the shapes of those of SN 1998bw and SN 2003dh and the spectral resemblance to SN 1998bw and SN 2010ah led us to adopt these three previously known and well-studied SNe as “templates” for estimating the physical parameters of SN 2013dx through the relationships that link the SN ejecta mass $M_{ej}$ and kinetic energy $E_K$ to the observables, that is, to the width of the bolometric light curve and the photospheric velocities (Arnett 1982, see Sect. 4.1 in Mazzali et al. 2013). This method, described in detail by Mazzali et al. (2013; see also Valenti et al. 2008; Walker et al. 2014), should be applied with caution when only few SNe are available that provide a good match and the data coverage of both target and templates is not excellent. However, when the observational information is adequate, the outcome satisfactorily agrees with the results of modeling based on radiative transport: for SN 2010ah, which has a well-sampled light curve, but only two spectra taken around maximum light, the physical parameters obtained with the two approaches differ by no more than 25% (Mazzali et al. 2013). The dataset presented here for SN 2013dx is detailed and rich, and we can compare it with as many as three template SNe with good data for which models were developed (Nakamura et al. 2001; Deng et al. 2005; Corsi et al. 2011; Mazzali et al. 2003; 2006a; 2013). This allows us to use the rescaling method to describe the physics of SN 2013dx with good accuracy. Developing a dedicated model is beyond the scope of this paper, but will be presented in the future. Based on the similarity of the light-curve shape of SN2013dx and SN2003dh, we adapted the model curve of 2003dh (Mazzali et al. 2003; Deng et al. 2005) by compressing it by 10% in time and dimming it by 25% in flux. We thus obtained the synthetic curve reported in Fig. 6 (solid line). Since SN 2003dh produced an estimated $^{56}Ni$ mass of $\sim$ 0.35 M$_\odot$ (Mazzali et al. 2006a), the 25% flux dimming corresponds to a $^{56}Ni$ mass of 0.26 M$_\odot$. However, this is further reduced by the effect of the 10% faster temporal evolution of SN 2013dx with respect to SN 2013dx. By taking this into account and assuming $^{56}Ni$ decay dominates at early times (i.e., neglecting the contribution of $^{56}Co$ decay), we obtain a further reduction of 20%, meaning that the final estimated $^{56}Ni$ mass synthesized by SN 2013dx should be $\sim$0.2 M$_\odot$. From a spectroscopic point of view, SN2013dx is a close analog of the GRB-SN prototype SN1998bw and a very close analog of the broad-lined type Ic SN2010ah, although in the latter case the comparison is limited to only two spectra. This suggests that the photospheric velocities are similar and that the kinetic energy of SN2013dx may then just simply scale like the ejecta mass. Using the observed light curve width $\tau$ and measured photospheric velocities of SNe 1998bw, 2003dh, 2013dx (Figs. 6 and 7) and SN 2010ah (Mazzali et al. 2013), we applied the scaling relationships to SN2013dx and to each of the adopted template SN. Then we averaged the results and found for SN2013dx $M_{ej} = 7 \pm 2$ M$_\odot$ and $E_K = (35 \pm 10) \times 10^{51}$ erg. Our errors on these physical quantities reflect conservatively the empirical nature of the method and its uncertainties (for instance, the fact that the phases at which the measured photospheric velocities are compared are never identical for the target and the template SN). The progenitor of SN 2013dx is thus probably $25-30 M_{\odot}$, which is $15- 20\%$ less massive than that estimated for SN 1998bw ($30-35 M_{\odot}$, Maeda et al. 2006) Field of SN2013dx ----------------- The field of SN 2013dx shows a bright galaxy southward of the transient, at $\sim 8"$ from the SN position (see Fig. 8). This could have been the SN host, since the faint source ($R=23.01$) at $0.6"$ from SN 2013dx was initially misclassified as a star in the SDSS (Singer et al. 2013). For this reason, Leloudas et al. (2013) obtained a spectrum of this galaxy, reporting a $z=0.145$, which is the same as that of the transient (Mulchaey et al. 2013a,b; D’Avanzo et al. 2013d). Kelly et al. (2013) performed an extensive study of this galaxy and its outskirt, concluding that the SN 2013dx host galaxy is a dwarf satellite of the bright one. Many more galaxies are present in the SN 2013dx field. Kelly et al. 2013 noted that many of them have an SDSS photometric redshift compatible with that of the host and the bright galaxy. In addition, they also pointed out that the SDSS spctroscopic galaxy survey targeted five galaxies brighter than $17.7$ within 15’ from SN 2013dx, their redshift being close to $z=0.145$. We decided to use different slit position angles during our VLT spectroscopic campaign. This allowed us to study both the spectroscopic evolution of the SN and to determine the redshift of more nearby galaxies. The different position angles adopted are described in Table 5, and the corresponding slit orientations are displayed in Fig. 8. This figure also marks with numbers the $14$ galaxies that we placed in the slit in our observations (“S” marks a star). We determine the redshift of all these galaxies, although for three of them the determination is not completely certain because it relies on faint absorption or emission features. Table 6 illustrates the redshift of the galaxies, which are numbered as in Fig. 8. The uncertain redshifts are marked with “?”, while the last two columns of the table list the emission and absorption features on which the redshift determination is based. The spectra of our $14$ field galaxies are shown in appendix A1. It is interesting to note that $9$ out of $14$ galaxies lie within $0.03$ from $z=0.145$, that is, the redshift of SN 2013dx, and one more is within $0.2$. These $\text{ten}$ galaxies are marked in red in Fig. 8, while the remaining $\text{\\ four}$ are marked in blue. In particular, we confirm the photometric redshifts reported for two of the field galaxies in Fig. 2 of Kelly et al (2013), their sources S3 and S5. This is clear evidence that SN 2013dx occurred in a group or a small cluster of galaxies. This conclusion is strengthened by the fact that many more galaxies in the SDSS, falling just outside the field of view of our images, have a spectroscopic or photometric redshift consistent with $z=0.145$. In detail, since the angular separation among the two farthest galaxies with the same redshift in the field is $\sim 3'$, the physical extent of the group at $z=0.145$ is $\sim 600$ kpc. This is the first SN associated with a long GRB detected in such an environment (and, to our knowledge, the first long GRB in general). For the SN 1998bw environment, a candidate cluster was first claimed (Duus & Newell 1977), but then not confirmed by spectroscopic analysis (Foley et al. 2006). For SN 2012bz, associated with GRB120422A, two objects have been reported at the redshift of the GRB (Schulze et al 2014). However, this looks like an interacting system consisting of two or possibly three galaxies, and not like a group. Intuitively, one may argue that the probability of hosting a GRB should be higher in the largest galaxy of the cluster, where the maximum star-formation occurs. However, the dwarf galaxies have comparatively high or higher specific star-formation rates, which might bias the probability of hosting a GRB in their favor. Indeed, studies on complete samples of GRBs (see, e.g., Perley et al. 2014; Vergani et al. 2014) show that at $z<1$ long GRBs strongly prefer low-mass galaxies (confirming previous studies on incomplete samples). This is probably because GRB progenitors are more easily developed in low-metallicity environments, which possess a high specific SFR. {width="9cm"} Conclusions =========== We have presented an extensive and sensitive ground-based observational campaign on the SN associated with GRB130702A at $z =0.145$, one of the nearest GRB-SNe detected so far. Its relative proximity guaranteed the construction of a nice dataset with a good S/N. The properties of SN 2013dx are similar to those of previous GRB- and XRF-SNe: the peak luminosity is intermediate between those of GRB-SNe and XRF-SNe, and the photospheric velocities are more similar to those of GRB-SNe. Accordingly, the physical parameters of SN 2013dx, derived with the empirical method based on the rescaling of the quantities known for other SNe, are similar to those determined for the previous GRB-SNe, but somewhat lower than those of SN 1998bw: we estimate a synthesized $^{56}Ni$ mass of $\sim$ 0.2 M$_\odot$, an ejecta mass of $M_{ej} \sim 7$ M$_\odot$, and a kinetic energy of $E_K \sim 35 \times 10^{51}$ erg. Furthermore, we performed a study of the SN 2013dx environment through spectroscopy of the field galaxies close to the host of GRB130702A. We find that $65\%$ of the observed targets have the same redshift as SN 2013dx, indicating that this is a group of galaxies. This represents the first report of a GRB-SN association taking place in a galaxy group or cluster. We thank an anonymous referee for several helpful comments. We are grateful to the ESO Director for awarding Discretionary Time to this project. We thank S. Valenti for several helpful discussions and F. Patat for providing the photospheric velocities for SN 1998bw. We thank the TNG staff, in particular G. Andreuzzi, L. Di Fabrizio, and M. Pedani, for their valuable support with TNG observations, and the Paranal Science Operations Team, in particular H. Boffin, S. Brillant, C. Cid, O. Gonzales, V. D. Ivanov, D. Jones, J. Pritchard, M. Rodrigues, L. Schmidtobreick, F. J. Selman, J. Smoker and S. Vega. The Dark Cosmology Centre is funded by the Danish National Research Foundation. VDE acknowledges partial support from PRIN MIUR 2009. This research was partially supported by INAF PRIN 2011, PRIN MIUR 2010/2011, and ASI-INAF grants I/088/06/0 and I/004/11/1. FB acknowledges support from FONDECYT through Postdoctoral grant 3120227 and from Project IC120009 “Millennium Institute of Astrophysics (MAS)” of the Iniciativa Cientifica Milenio del Ministerio de Economia, Fomento y Turismo de Chile. D.M. acknowledges the Instrument Center for Danish Astrophysics for support. The spectra are publicly available on WISeREP - http://wiserep.weizmann.ac.il. [DUM]{} Arnett, W.D. 1982, ApJ, 253, 785 Berger, E., Chornock, R., Holmes, T.R., et al. 2011, ApJ, 743, 204 Bersier, D., Fruchter, A.S., Strolger, L.-G., et al. 2006, ApJ, 643, 284 Bloom, J.S., Kulkarni, S.R., Djorgovski, S.G., et al. 1999, Nature, 401, 453 Bloom, J.S., van Dokkum, P.G., Bailyn, C.D., Buxton, M.M., Kulkarni, S.R. & Schmidt, B.P. 2004, AJ, 127, 252 Bromberg, O., Granot, J. Lyubarsky, Y. Piran, T. 2014, MNRAS, 443, 1532 Bufano, F., Pian, E., Sollerman, J., et al. 2012, ApJ, 753, 67 Campana, S., Mangano, V., Blustin, A. J., et al. 2006, Nature, 442, 1008 Cano, Z., Bersier, D., Guidorzi, C., et al. 2011a, ApJ, 740, 41 Cano, Z., Bersier, D., Guidorzi, C., et al. 2011b, MNRAS, 413, 669 Cano, Z., de Ugarte Postigo, A., Pozanenko, A., et al. 2014, A&A, 568, 19 Cenko, S.B. et al. 2013, GCN Circ 14998 Cheung, T. et al. 2013, GCN Circ 14971 Chincarini, G., Zerbi, F. M., Antonelli, A. et al. 2003, The Messenger 113, 40 Cobb, B.E., Bloom, J.S., Perley, D.A., et al. 2010, ApJ, 718, 150 Clocchiati, A., Suntzeff, N. B., Covarrubias, R., & Candia, P., 2011, AJ, 141, 163 Collazzi, A.C. et al. 2013, GCN Circ 14972 Corsi, A., Ofek, E.O., Frail, D.A., et al. 2011, ApJ, 741, 76 Covino, S., Stefanon, M. Fernandez-Soto, A. et al. 2004, SPIE 5492, 1613 Crowther,P.A. 2007, ARAA, 45, 177 D’Avanzo, P. et al. 2013a, GCN Circ 14973 D’Avanzo, P. et al. 2013b, GCN Circ 14982 D’Avanzo, P. et al. 2013c, GCN Circ 14977 D’Avanzo, P. et al. 2013d, GCN Circ 14984 D’Elia, V. et al. 2013, GCN Circ 15000 Della Valle, M., Malesani, D., Benetti, S., et al. 2003, A&A, 406, L33 Della Valle, M., Chincarini, G., Panagia, N., et al. 2006a, Nature, 444, 1050 Della Valle, M., Malesani, D., Bloom, J.S., et al. 2006b, ApJ, 642, L103 Della Valle, M., et al. 2008, CBET, 1602, 1 Deng, J., Tominaga, N., Mazzali, P.A., et al. 2005, ApJ, 624, 898 Duus, A., & Newell, B. 1977, ApJS, 35, 209 Ferrero, P., Kann, D.A., Zeh, A., et al. 2006, A&A, 457, 857 Filippenko, A.V. 1997, ARAA, 35, 309 Foley, R.J., et al. 2003, PASP, 115, 1220 Foley, S., Watson, D., Gorosabel, J., Fynbo, J.P.U., Sollerman, J., McGlynn, S., McBreen, B., Hjorth, J. 2006, A&A, 447, 891 Fryer, C.L., Brown, P.J., Bufano, F., et al. 2009, ApJ, 707, 193 Fynbo, J.P.U., Watson, D., Thöne, C.C., et al. 2006, Nature, 444, 1047 Galama, T.J., Vreeswijk, P.M., van Paradijs, J., et al. 1998, Nature, 395, 670 Galama, T.J., Tanvir, N., Vreeswijk, P.M., et al. 2000, ApJ, 536, 185 Gal-Yam, A., Moon, D.-S., Fox, D.B., et al. 2004, ApJ, 609, L59 Gal-Yam, A., Fox, D.B., Price, P.A., et al. 2006, Nature, 444, 1053 Garnavich, P., Stanek, K.Z., Wyrzykowski, L., et al. 2003, ApJ, 582, 924 Golenetskii, S. et al. 2013, GCN Circ 14986 Gorosabel, J., Fynbo, J.P.U., Fruchter, A., et al. 2005, A&A, 437, 411 Greiner, J., Klose, S., Salvato, M. et al. 2003, ApJ, 599, 1223 Guidorzi, C. et al. 2013, GCN Circ 14968 Hjorth, J., & Bloom, J. S. 2012, in “Gamma-Ray Bursts”, ed. C. Kouveliotou, R. A. M. J. Wijers, & S. E. Woosley (Cambridge: Cambridge Univ. Press) (arXiv:1104.2274) Hurley, K. et al. 2013, GCN Circ 14974 Hjorth, J., Sollerman, J., Møller, P., et al. 2003, Nature, 423, 847 Kelly, P.L., Filippenko, A.v., Fox, O.D., Zheng, W. & Clubb, K.I. 2013, ApJL, 775, 5 Jin, Z.-P., Covino, S., Della Valle, M. et al. 2013, ApJ, 774, 114 Kinney, A, Calzetti, D., Bohlin, R.C., McQuade, K., Storchi-Bergmann, T. & Schmitt, H.R. 1996, ApJ, 467, 38 Iwamoto, K., Mazzali, P.A., Nomoto, K., et al. 1998, Nature, 395, 672 Lazzati, D., Covino, S., Ghisellini, G., et al. 2001, A&A, 378, 996 Leloudas, G. et al. 2013, GCN Circ 14983 Levan, A.J., Tanvir, N.R., Fruchter, A.S. et al. 2014, ApJ, 792, 115; Levesque, E.M. 2014, PASP, 126, 1 Lyutikov, M. 2011, MNRAS, 411, 2054 Maeda, K., Nomoto, K., Mazzali, P.A. & Deng, J. 2006, ApJ, 640, 854 Malesani, D., Tagliaferri, G., Chincarini, G., et al. 2004, ApJ, 609, L5 Maselli, A., Melandri, A., Nava, L., et al. 2013, Sci, 343, 48 Masetti, N., Palazzi, E., Pian, E., et al. 2003, A&A, 404, 465 Matheson, T., Garnavich, P.M., Stanek, K.Z., et al. 2003, ApJ, 599, 394 Mazzali, P.A., Deng, J., Maeda, K., et al. 2002, ApJ, 572, L61 Mazzali, P.A., Deng, J., Tominaga, N., et al. 2003, ApJ, 599, 95 Mazzali, P.A., Deng, J., Pian, E., et al. 2006a, ApJ, 645, 1323 Mazzali, P.A., Deng, J., Nomoto, K., et al. 2006b, Nature, 442, 1018 Mazzali, P. A., Kawabata, K. S., Maeda, K., et al. 2007, ApJ, 670, 592 Mazzali, P.A., Valenti, S., Della Valle, M., et al. 2008, Science, 321, 1185 Mazzali, P.A., Walker, E.S., Pian, E. et al. 2013, MNRAS, 432, 2463. Mazzali, P.A., McFadyen, A.I., Woosley, S.E., Pian, E. & Tanaka, M. 2014, MNRAS, 443, 67 Melandri, A., Pian, E., Ferrero, P. et al. 2012, A&A 547, 82 Melandri, A., Pian, E., D’Elia, V. et al. 2014, A&A 565, 72 Millard, J. Branch, D., Baron, E. et al. 1999, ApJ, 527, 746 Mirabal, N., Halpern, J.P., An, D., Thorstensen, J.R., & Terndrup, D.M. 2006, ApJ, 643, L99 Modjaz, M., Stanek, K.Z., Garnavich, P.M., et al. 2006, ApJ, 645, L21 Mulchaey, J. et al. 2013a, ATel 5191 Mulchaey, J. et al. 2013b, GCN Circ 14985 Nakamura, T., Mazzali, P.A., Nomoto, K., et al. 2001, ApJ, 550, 991 Olivares, E.F., Greiner, J., Schady, P., Rau, A., Klose, S. & Krühler, T. 2012, IAUS, 279, 375 Paczynski, B. 1998, ApJ, 494, L45 Patat, F., Benetti, S., Cappellaro, E., Danziger, I.J., Della Valle, M., Mazzali, P.A., & Turatto, M. 1996, MNRAS, 278, 111 Patat, F., Cappellaro, E., Danziger, J., et al. 2001, ApJ, 555, 900 Perley, D. and Kasliwal, M. 2013, GCN Circ 14979 Perley, D., Perley, R.A., Hjorth, J. et al. 2015, ApJ submitted, 2014arXiv1407.4456P Pian, E., Mazzali, P. A., Masetti, N., et al. 2006, Nature, 442, 1011 Pignata, G., Stritzinger, M., Soderberg, A.M., et al. 2011, ApJ, 728, 14 Podsiadlowski, P., Ivanova, N., Justham, S. & Rappaport, S. 2010, MNRAS, 406, 840 Richmond, M. W., van Dyk, S. D., Ho, W., et al. 1996, AJ, 111, 327 Sauer, D., Mazzali, P.A., Deng, J., et al. 2006, MNRAS, 369, 1939 Schlegel, D. J., Finkbeiner, D. P., & Davis, M. 1998, ApJ, 500, 525 Schulze, S. et al. 2013, GCN Circ 14994 Schulze, S. et al. 2013b; D’Elia et al. 2013b, CBET 3587 Schulze, S., Malesani, D., Cucchiara, A. et al. 2014, A&A, 566, 102 Singer, L.P. et al. 2013a, GCN Circ 14967 Singer, L.P., Cenko, S.B., Kasliwal, M.M. et al. 2013b, ApJL, 776, 34 Soderberg, A.M., Kulkarni, S.R., Fox, D.B., et al. 2005, ApJ, 627, 877 Soderberg, A.M., Kulkarni, S.R., Price, P.A., et al. 2006, ApJ, 636, 391 Soderberg, A.M., Nakar, E., Cenko, S.B., et al. 2007, ApJ, 661, 982 Sollerman, J., Jaunsen, A.O., Fynbo, J.P.U. et al. 2006 A&A 454, 503 Sparre, M., Sollerman, J., Fynbo, J. P. U., et al. 2011, ApJ, 735, 24 Stanek, K.Z., Matheson, T., Garnavich, P.M., et al. 2003, ApJ, 591, L17 Starling, R.L.C., Wiersema, K., Levan, A.J., et al. 2011, MNRAS, 411, 2792 Tanvir, N.R., Rol, E., Levan, A.J. et al. 2010, ApJ, 725, 625; Taubenberger, S., Pastorello, A., Mazzali, P.A., et al. 2006, MNRAS, 371, 1459 Thomsen, B., Hjorth, J., Watson, D., et al. 2004, A&A, 419, L21 Uzdensky, D.A., & MacFadyen, A.I. 2006, ApJ, 647, 1192 Valenti, S., Benetti, S., Cappellaro, E., et al. 2008, MNRAS, 383, 1485 van der Horst, A.J. 2013, GCN Circ 14987 Vergani, S.D., Salvaterra, R., Japelj, J. et al. 2015, A&A submitted, 2014arXiv1409.7064 Walker, E.S., Mazzali, P.A., Pian, E. et al. 2013, MNRAS, 442, 2768 Woosley, S.E. & Bloom, J.S. 2006, ARAA, 44, 507 Woosley, S.E. & Heger, A. 2012, ApJ, 753, 32 Xu, D. et al. 2013, GCN Circ 14975 Xu, D., de Ugarte Postigo, A, Leloudas, G et al. 2013, ApJ, 776, 98 Zeh, A., Klose, S. & Hartmann, D.H. 2004, ApJ, 609, 952; Zerbi, F. M., Chincarini, G., Ghisellini, G. et al. 2001, AN 322, 275 Zhang, B. & Mészáros, P. 2004, IJMPA, 19, 2385 Zhang, W., Woosley, S.E., & MacFadyen, A. I. 2003, ApJ, 586, 356 SN 2013dx field galaxy spectra ============================== In this appendix we report the $14$ spectra of the galaxies in the field of SN 2013dx (see also Sect. 4.6). {width="19cm"} {width="19cm"} {width="19cm"} {width="19cm"} [^1]: Based on observations collected at the Italian 3.6-m Telescopio Nazionale Galileo (TNG), operated on the island of La Palma by the Fundacion Galileo Galilei of the INAF (Instituto Nazionale di Astrofisica) at the Spanish Observatorio del Roque de los Muchachos of the Instituto de Astrofisica de Canarias under program A27TAC 5, and at the European Southern Observatory, ESO, the VLT/Antu telescope, Paranal, Chile, proposal code: 291.D-5032(A). [^2]: http://www.nofs.navy.mil/data/fchpix/ [^3]: http://starlink.jach.hawaii.edu/starlink [^4]: http://www.ipac.caltech.edu/2mass/ [^5]: http://www.eso.org/projects/esomidas/ [^6]: http://iraf.noao.edu/

Q: JQuery executing onLoad So I'm trying to execute a function on a component when the page loads. This is what I have so far. $(document).ready(function() { var $foo = $('#data_lost').hide(); $f = function () { doSomething... }; $foo.change($f); }); So this all works fine and dandy. Here's the problem. I also need $f executed on $foo when the page loads. I tried setting $foo.ready($f), but that doesn't work. I tried setting it inside and outside of document.ready(). Neither options work. I'm assuming that doing it outside doesn't work because the tag doesn't exist until document is ready, and doing it inside doesn't work because when the document is ready, the tag has already become ready, so it won't ever be ready again, so $f isn't called. Ideas?? TIA! A: Well, goes to show...you ask...fate has it that you find your own answer soon after... added: $foo.change(); after $foo.change($f).

// Package mydnsjp implements a DNS provider for solving the DNS-01 challenge using MyDNS.jp. package mydnsjp import ( "errors" "fmt" "net/http" "time" "github.com/go-acme/lego/v4/challenge/dns01" "github.com/go-acme/lego/v4/platform/config/env" ) const defaultBaseURL = "https://www.mydns.jp/directedit.html" // Environment variables names. const ( envNamespace = "MYDNSJP_" EnvMasterID = envNamespace + "MASTER_ID" EnvPassword = envNamespace + "PASSWORD" EnvPropagationTimeout = envNamespace + "PROPAGATION_TIMEOUT" EnvPollingInterval = envNamespace + "POLLING_INTERVAL" EnvHTTPTimeout = envNamespace + "HTTP_TIMEOUT" ) // Config is used to configure the creation of the DNSProvider. type Config struct { MasterID string Password string PropagationTimeout time.Duration PollingInterval time.Duration HTTPClient *http.Client } // NewDefaultConfig returns a default configuration for the DNSProvider. func NewDefaultConfig() *Config { return &Config{ PropagationTimeout: env.GetOrDefaultSecond(EnvPropagationTimeout, 2*time.Minute), PollingInterval: env.GetOrDefaultSecond(EnvPollingInterval, 2*time.Second), HTTPClient: &http.Client{ Timeout: env.GetOrDefaultSecond(EnvHTTPTimeout, 30*time.Second), }, } } // DNSProvider implements the challenge.Provider interface. type DNSProvider struct { config *Config } // NewDNSProvider returns a DNSProvider instance configured for MyDNS.jp. // Credentials must be passed in the environment variables: MYDNSJP_MASTER_ID and MYDNSJP_PASSWORD. func NewDNSProvider() (*DNSProvider, error) { values, err := env.Get(EnvMasterID, EnvPassword) if err != nil { return nil, fmt.Errorf("mydnsjp: %w", err) } config := NewDefaultConfig() config.MasterID = values[EnvMasterID] config.Password = values[EnvPassword] return NewDNSProviderConfig(config) } // NewDNSProviderConfig return a DNSProvider instance configured for MyDNS.jp. func NewDNSProviderConfig(config *Config) (*DNSProvider, error) { if config == nil { return nil, errors.New("mydnsjp: the configuration of the DNS provider is nil") } if config.MasterID == "" || config.Password == "" { return nil, errors.New("mydnsjp: some credentials information are missing") } return &DNSProvider{config: config}, nil } // Timeout returns the timeout and interval to use when checking for DNS propagation. // Adjusting here to cope with spikes in propagation times. func (d *DNSProvider) Timeout() (timeout, interval time.Duration) { return d.config.PropagationTimeout, d.config.PollingInterval } // Present creates a TXT record to fulfill the dns-01 challenge. func (d *DNSProvider) Present(domain, token, keyAuth string) error { _, value := dns01.GetRecord(domain, keyAuth) err := d.doRequest(domain, value, "REGIST") if err != nil { return fmt.Errorf("mydnsjp: %w", err) } return nil } // CleanUp removes the TXT record matching the specified parameters. func (d *DNSProvider) CleanUp(domain, token, keyAuth string) error { _, value := dns01.GetRecord(domain, keyAuth) err := d.doRequest(domain, value, "DELETE") if err != nil { return fmt.Errorf("mydnsjp: %w", err) } return nil }

Local effects of retrovirally transduced endostatin-expressing human umbilical cord blood CD34+ cells on transplanted malignancy in a mouse model of hepatic cancer. Antiangiogenesis has been exploited as an effective approach to inhibit the growth of solid tumors. This technique has been evaluated using various vectors in several xenograft animal models to demonstrate the efficacy of endostatin gene therapy against cancer growth. However, previous studies have not examined the use of cord blood CD34+ cells as endostatin-producing cells for gene therapy against hepatoma. This exploratory study was done to investigate the local effects of CD34+ cells transduced with the endostatin gene on a mouse xenograft tumor model. The human endostatin gene was transferred into CD34+ cells using the recombinant retrovirus plasmid, pLncx/endo. Expression was verified by RT-PCR and Western blot analyses, confirming the stable expression and secretion of endostatin from the transferred CD34+ cells. The proliferation of vascular endothelial cells was evaluated by MTT assay and found to decrease by about 59.9% when treated with the supernatant of cultured transfected CD34+ cells in vitro. These genetically modified cord blood CD34+ cells were implanted intratumorally and tumor regression was evaluated after 2 weeks. The average size of a xenograft tumor in the CD34+/endo group was reduced 31.39% compared to that in the untreated mice or those transplanted with CD34+ cells transduced with a control vector. The microvascular density of the tumor decreased 62.45% in the treated group. The expression of proliferation cell nuclear antigen (PCNA) also decreased significantly in the treated group. Moreover, the apoptotic index (AI) of tumors, as evaluated by TUNEL staining, was significantly enhanced in the treatment group. Our findings indicate that angiogenesis of the xenograft tumor in mice may be inhibited by local administration of genetically modified CD34+ cells expressing the endostatin gene. This novel approach may lead to a new direction of cell-based gene therapy for malignancy.

Q: Javascript analysis fail for .js files containing ES7 Decorators I'm currently using Babel (the Javascript transpiler) which allows me to use the future syntax now. I'm using the decorator functionality (https://github.com/wycats/javascript-decorators). However when I run analysis on that code, SonarQube throws the following error: [09:19:43] 09:19:43.693 ERROR - Unable to parse file: /...../my-form.js 09:19:43.693 ERROR - Parse error at line 10 column 1: 1: import {View, Component, Inject, NgScope} from 'app/app'; ... 9: 10: @Component({ ^ 11: selector: 'my-form' 12: }) 13: @View({ 14: template: myTemplate 15: }) Will this be covered soon by the Javascript plugin (or at least skipped by the parser but allowing it to continue processing of the file)?. Is there a way to file a JIRA issue for this? A: From the SonarQube user group: Regarding the support of the decorator construction, it will not be supported by the JavaScript plugin as long as it will not be part of the ECMAScript Standard. Moreover when the JavaScript plugin is not able to parse a file the analysis should not fail, it should succeed but no issue will be reported on the unparsed file. However there is already a JIRA ticket where you can vote up to show them the need for this feature. JIRA - Support experimental JavaScript features

[Lymphadenitis toxoplasmotica--a zoonosis]. Between 1975 and 1985, 49 in-patients suffering from Toxoplasmosis of head and neck lymph nodes, have been treated chirurgically at the ENT clinics of the universities of Cologne and Homburg/Saar. In the collective there are as much men as women. The patients have an average age of 30 years, the anamnesis is about 3 months. The patients were complaining of swellings of lymph nodes of the angle of mandible or of the submandibular region, but without fever or other signs of infection. Typically, the lymph nodes were not fixed but mobile, hard and indolent. Blood parameters and electrolytic levels are not pathologically changed. The patients do not feel sick in general. The diagnosis is to be confirmed by serological investigations, supported by lymph node histology (Lymphadenitis Piringer-Kuchinka). In the present study, three acute cases of Toxoplasmosis with high serological titers could be diagnosed. The differential diagnosis of the lymphadenitis toxoplasmotica will be discussed.

MH370 – The Engine Fire Theory To follow up on previous postings about my sighting of a glowing orange plane on the night MH370 disappeared, hardly anything is known about what happened to that flight after it disappeared from radar – and it seems that even that data is under review. That is a good thing in my opinion, since the independent scientists who are looking into my sighting seem to be having issues fitting it with what they already believe happened. Now, I’m not a scientist, but I know what I saw. And contrary to what some critics might be saying out there on the world wide web, I have not been changing “what I saw” to fit what the experts believe. On the contrary, I have refused to change my testimony, even though it doesn’t fit (yet). I have been clarifying it to make it more intelligible, though; first with the help of Cruisers Forum members, who asked question after question to tease out the details (and that was much appreciated, since there are things I wouldn’t have thought of mentioning otherwise), and now with the help of the scientists on Duncan Steel’s independent team. Various independent investigators have approached me, and worked hard to present theories which fit with my sightings. I hope to publish the work of those investigators who give me permission to do so, since each theory is deserving of thanks. The scientific analysis, of course, gets done over at Duncan’s place! Stewart Stoddart, a flight test engineer kindly contacted me a while ago, with the intention of taking what I had seen, working off the assumption that it was MH370, and putting it into a viable flight plan. He has done so, and very patiently, given the apparent confusion over timings and positions of the craft. He has questioned me over and over about timings. He has teased out further thoughts and common sense applications of those thoughts, and despite great difficulty to make my timings fit with the published timings that are known from earlier in the flight, he has worked with them to create a flight plan that seems to work for both sets of timings, even though mine seemed to go against almost everything the investigators previously believed. The first image he is sharing reflects the timing of when the aircraft passed me. I believe I have been able to narrow down the time of the sighting to the time at which I preformed an accidental gybe. The image reflects the elevation angles I witnessed the craft at, and the Azimuths (position relative to boat) I witnessed. From that he has been able to calculate things such as altitude, and airspeed. I owe an enormous debt of gratitude to Stewart for his patient work, and look forward to seeing his full work published. An interactive version of our track can be downloaded here: Kate’s GPS Track in .kml format, which automatically opens in Google Earth. It’s quite a big file, so don’t do this on your mobile phone’s data connection unless you have a mega package! If you are interested in how I established the timings, I have posted the process of elimination over at Duncan’s Blog. Duncan Steel, I believe is listed amongst the top four scientists in this world (see his info page!) and it is an honour to have been in communication with him. He’s a fantastic teacher, who very patiently puts things into perspective for me in words I can understand. I can’t thank his dedicated team enough. They have all shown a professional interest. I’d particularly like to thank Dr Bobby Ulich and Henrik Rydberg; but everyone has shown admirable dedication to the cause. A potential Northern route which MH370 could have flown, which fits the published data plus my sighting: Stewart Stoddart This second image is an overview of what he currently believes the Northern part of MH370s course could have been. I can’t say too much about it, since I don’t understand it fully, but I do know that it is one possible scenario which so far fits with both my data and the technical data which has been made available to the public. Potential flight route for MH370s Southern leg, which fits the lower speed and altitude I witnessed, as well as the Inmarsat data: Stewart Stoddart Finally, the last image shows a potential Southern route for MH370. This is based on the assumption that MH370 was flying at a low altitude and at a reduced speed; in other words, as I saw it. It demonstrates that it is possible for MH370 to have met those Inmarsat timings even if it were flying disabled. I am very grateful to Stewart for sending me these graphics with permission to share, since I understand that he is not yet ready to publish his full report. Many investigators, including Stewart and his team, are dedicating a huge amount of time and expertise to trying to unravel this mystery, and so sharing what we can is what it’s all about. I realise I haven’t expressed (here on my own blog anyway) my heartfelt sympathy for the families and friends of MH370. Rest assured, there truly are people who are working their fingers to the bone to find out what happened to your loved ones. Like this: Related Hi Kate, I think you have done as much as you can over this. And you were 100% correct to do so. But I’m a little concerned now for YOU. Let the experts deal with the information and perhaps move on. It can easily become an obsession. Thanks Ted, it’s very kind of you to show such concern. That said, I think you should consider whether you would answer the questions if you were asked, or if you’d just set it aside and move in. Have you even read Duncan’s blog? If not, I suggest you do, and carefully, so that you can more fully understand the situation before offering advice to strangers on matters on which you are ignorant. Ted, I apologise. I wrote that terse answer before I’d had my morning cup of tea. I should know better. A word of explanation… At Duncan’s blog I am answering questions as I am asked. It’s the least I can do, and I assure you that when the questions stop, so will I 🙂 Meantime, I owe it to the families and friends to offer what help I am able. Also, this blog is my own little diary, intended for me to read when I am older. This is quite a life event for me, so I think recording the key points in a few posts is quite natural. Rest assured, it’s only a part-time hobby now, I am busy during the day time on the boat now, preparing to sail off again in a few months, hopefully. I have emailed Stewart Stoddart the same thing I am about to ask you here. Whilst I commend you for investing a lot of time, energy and resilience in standing by your eye witness accounts of MH370, may I please ask you a simple question which no one yet seems to know. Why is it that you, Steele and others have failed to also collaborate and work with eye witness Mike McKay (the oil rig worker) that also saw a plane “in flames” on the same night as you? Mr McKay has lost his job over this, has gone into recluse and has basically been lambasted for coming out with his observations, which by now he has most likely regretted having ever seen that plane in the distance. Do you know how I can contact him? IF he were to contribute at Duncan’s place, as I have, I am sure the team would be more than happy to investigate all scientific angles of his observation. The simple answer to your question is that (as far as I know) he has not come forward to discuss the issue there. Thank you Kate. Yes that is a shame the poor man has been pushed out entirely and yet he could hold crucial insights onto what happened that night. Lets’ hope somehow, someone reads this and tries to contact him directly. I just hope he will still be willing to help us. All the best. Patrick: Thank you for the link to this information. I wonder how Katherine’s and Mike McKay’s reports would fit in with a right side cockpit, hull piercing, blast fire in the co-pilot’s oxygen mask assembly, as with Egyptair flight 667 in July, 2011? This sort of blast fire would likely take out various communication systems and, once the hull was opened up, cause all of the oxygen to be rapidly removed from the plane. The lack of air pressure, and therefore available oxygen, would likely have extinguished the fire once the co-pilot’s 30 minute oxygen tank was exhausted. At higher elevations, of 37,000 feet, however, the sub-zero (-44 C) cold temperatures would make life unsustainable. Perhaps the pilot of MH 370 dove the plane down to a lower altitude for more oxygen and warmth. Unfortunately, at a lower elevation, of 10,000 to 5,000 feet, the blast fire would likely have more oxygen and be able to burn longer. Under this co-pilot’s oxygen mask electrical arc ignited blast fire theory, the communications systems might have been taken out without the loss of the number one, left, engine. I wonder how a hole in the plane’s (777-200) hull would affect its flight path and would the autopilot correct for the added drag? Would this cause the right engine to run out of fuel first?

Q: What does the negative balance number mean? My credit card has a negative number but my credit limit has not been exceeded. Do I owe that negative sum to the bank? I have only spent 26$ since I made my last payment to the card. Does this actually mean I owe them that negative balance? A: A negative balance on a credit card account means they owe you money. This typically happens when you are issued a refund on a purchase around the same time as your payment goes through. Your transaction history should show each purchase as a positive amount, and any payments/refunds as negative amounts. A negative balance can be paid out by the bank if it remains for a length of time (~6 months, or sooner if you request a refund), but usually they just show a negative balance and it gets resolved as you make additional purchases with the card.

A US web expert has called for web users to abandon Internet Explorer 6 for the greater good of the internet. Developed in 2001 and packaged with Windows XP, IE6 was the most widely used web browser of its tenure, reaching usage of up to 80 per cent during its peak in 2002 and 2003. Despite being superseded by IE7 and IE8, as well as the rise of competitors such as Firefox, Safari, Opera and Chrome, market share was still at 25 per cent in September 2008, according to a Net Applications Market Share survey. In a post on social media blog Mashable, associate editor Ben Parr says internet users and web developers are at a crossroads and for the web to move on, IE6 must be abandoned. "We've sputtered on with the dead weight of IE6 since 2001, but we're just now reaching a breaking point and companies are starting to feel it," he said. "YouTube and Digg clearly believe that it's not in their best interests to continue supporting the outdated browser and thus have put the word out about their plans to phase out support. "More and more companies will take their lead as it becomes harder and harder to justify the cost of keeping a site running correctly in Microsoft's old browser." Twitter and Facebook have also been urging users to upgrade their browsers. Mr Parr says that the web has done all right, despite IE6, but the coming release of HTML 5 means innovation will be stifled if websites continue to cater to IE6. He says HTML 5 offers a range of benefits, including being able to embed video and audio directly into html, a time tag to help browsers recognise time in html pages, the ability to drag and drop files directly onto the browser, the ability to create web apps that can determine your location and provide more relevant information, and the ability to save files locally when using web-based applications. Mr Parr says people have stuck with IE6 because it is the standard browser of Windows XP. A recent survey by Digg found people primarily use IE6 at work, because they have no other option. "Without a significant event like Google not loading in IE6, people have stayed content with their current browser," Mr Parr said. Microsoft has been contacted for comment. ABC News Online has no plans to drop support for IE6 in the near future.

.. BACpypes bsll module .. module:: bsllservice BACnet Streaming Link Layer Service =================================== BACnet streaming link layer... Streaming Packets ----------------- .. function:: _Packetize(data) :param data: octet stream to slice into packets This is a long line of text. .. class:: _StreamToPacket(StreamToPacket) This is a long line of text. User Information ---------------- This is a long line of text. .. class:: UserInformation() .. method:: __init__(**kwargs) :param string username: the user name :param string password: the user password :param boolean allServices: :param boolean deviceToDeviceService: :param boolean routerToRouterService: :param boolean proxyService: :param boolean laneService: :param boolean proxyNetwork: This is a long line of text. Connection State ---------------- Every thing is connected and every connection has a state. * NOT_AUTHENTICATED - no authentication attempted * REQUESTED - access request sent to the server (client only) * CHALLENGED - access challenge sent to the client (server only) * AUTHENTICATED - authentication successful This is a long line of text. .. class:: ConnectionState This is a long line of text. .. attribute:: address This is a long line of text. .. attribute:: service This is a long line of text. .. attribute:: connected This is a long line of text. .. attribute:: accessState This is a long line of text. .. attribute:: challenge This is a long line of text. .. attribute:: userinfo This is a long line of text. .. attribute:: proxyAdapter This is a long line of text. Service Adapter --------------- This is a long line of text. .. class:: ServiceAdapter() This is a long line of text. .. method:: __init__(mux) This is a long line of text. .. method:: authentication_required(addr) This is a long line of text. .. method:: get_default_user_info(addr) This is a long line of text. .. method:: get_user_info(username) This is a long line of text. .. method:: add_connection(conn) This is a long line of text. .. method:: remove_connection(conn) This is a long line of text. .. method:: service_request(pdu) This is a long line of text. .. method:: service_confirmation(conn, pdu) This is a long line of text. .. class:: NetworkServiceAdapter(ServiceAdapter, NetworkAdapter) This is a long line of text. TCP Multiplexing ---------------- This is a long line of text. .. class:: TCPServerMultiplexer(Client) This is a long line of text. .. method:: __init__(addr=None) :param addr: address to bind This is a long line of text. .. method:: request(pdu) :param pdu: message to process This is a long line of text. .. method:: indication(server, pdu) :param server: multiplexer reference :param pdu: message to process This is a long line of text. .. method:: confirmation(pdu) :param pdu: message to process This is a long line of text. .. method:: do_AccessRequest(conn, bslpdu) :param conn: message to process :param bslpdu: message to process This is a long line of text. .. method:: do_AccessResponse(conn, bslpdu) :param conn: message to process :param bslpdu: message to process This is a long line of text. .. class:: TCPClientMultiplexer(Client) This is a long line of text. .. method:: __init__() This is a long line of text. .. method:: request(pdu) :param pdu: message to process This is a long line of text. .. method:: indication(server, pdu) :param server: multiplexer reference :param pdu: message to process This is a long line of text. .. method:: confirmation(pdu) :param pdu: message to process This is a long line of text. .. method:: do_AccessChallenge(conn, bslpdu) :param conn: message to process :param bslpdu: message to process This is a long line of text. .. class:: TCPMultiplexerASE(ApplicationServiceElement) This is a long line of text. .. method:: __init__(self, mux) This is a long line of text. .. method:: indication(*args, **kwargs) :param addPeer: peer address to add :param delPeer: peer address to delete This is a long line of text. Device-to-Device Service ------------------------ This is a long line of text. .. class:: DeviceToDeviceServerService(NetworkServiceAdapter) This is a long line of text. .. method:: process_npdu(npdu) This is a long line of text. .. method:: service_confirmation(conn, pdu) This is a long line of text. .. class:: DeviceToDeviceClientService(NetworkServiceAdapter) This is a long line of text. .. method:: process_npdu(npdu) This is a long line of text. .. method:: connect(addr) This is a long line of text. .. method:: connect_ack(conn, pdu) This is a long line of text. .. method:: service_confirmation(conn, pdu) This is a long line of text. Router-to-Router Service ------------------------ This is a long line of text. .. class:: RouterToRouterService(NetworkServiceAdapter) This is a long line of text. .. method:: process_npdu(npdu) This is a long line of text. .. method:: connect(addr) This is a long line of text. .. method:: connect_ack(conn, pdu) This is a long line of text. .. method:: add_connection(conn) This is a long line of text. .. method:: remove_connection(conn) This is a long line of text. .. method:: service_confirmation(conn, pdu) This is a long line of text. Proxy Service ------------- This is a long line of text. .. class:: ProxyServiceNetworkAdapter(NetworkAdapter) This is a long line of text. .. method:: process_npdu(npdu) This is a long line of text. .. method:: service_confirmation(conn, pdu) This is a long line of text. .. class:: ProxyServerService(ServiceAdapter) This is a long line of text. .. method:: add_connection(conn) This is a long line of text. .. method:: remove_connection(conn) This is a long line of text. .. method:: service_confirmation(conn, bslpdu) This is a long line of text. .. class:: ProxyClientService(ServiceAdapter) This is a long line of text. .. method:: __init__(self, mux, addr=None, userinfo=None) :param mux: :param addr: :param userinfo: This is a long line of text. .. method:: get_default_user_info(addr) This is a long line of text. .. method:: connect(addr=None, userinfo=None) This is a long line of text. .. method:: connect_ack(conn, bslpdu) This is a long line of text. .. method:: service_confirmation(conn, bslpdu) This is a long line of text. .. method:: confirmation(pdu) This is a long line of text. LAN Emulation Service --------------------- To be developed.

91 F.3d 155 NOTICE: Ninth Circuit Rule 36-3 provides that dispositions other than opinions or orders designated for publication are not precedential and should not be cited except when relevant under the doctrines of law of the case, res judicata, or collateral estoppel.UNITED STATES of America, Plaintiff-Appellee,v.Jose Carlos CASTRO-BARRAZA, Defendant-Appellant. No. 95-10302. United States Court of Appeals, Ninth Circuit. Submitted June 10, 1996.Decided July 29, 1996. 1 Before: REINHARDT and HALL, Circuit Judges, and MERHIGE, Senior District Judge.* 2 MEMORANDUM** 3 Jose Carlos Castro-Barraza was convicted of possession of marijuana with intent to distribute in violation of 21 U.S.C. § 841(a)(1) and (b)(1)(B)(vii). He appeals the district court's denial of his motion, made prior to trial, for disclosure of information relevant to calculation of his sentence under the Guidelines; the district court's denial of his motion for acquittal based on the insufficiency of the evidence; the district court's determination that he did not qualify for the U.S.S.G. § 5C1.2 "safety valve" exception to the minimum sentence; and the district court's determination that he was not entitled to a downward adjustment in his sentence based on acceptance of responsibility. 4 A. Motion for Disclosure of Guideline Information 5 Castro Barraza appeals the district court's denial of his motion, styled "Motion for Disclosure of Guideline Sentencing Information," filed pursuant to Rule 16 of the Federal Rules of Criminal Procedure. 6 Castro-Barraza asserts that Rule 16 entitled him to discovery prior to trial of any and all information in the possession of, or available to, the Government concerning his status under the Sentencing Guidelines. 7 Federal Rule of Criminal Procedure 16(a)(1)(B) provides: 8 Upon request of the defendant the government shall furnish to the defendant such copy of the defendant's prior record, if any, as is in possession, custody, or control of the government, the existence of which is known, or by the exercise of due diligence may become known, to the attorney for the government. 9 In this case, the Government did not come into possession of information concerning Castro-Barraza's 1994 concealed weapon conviction until the pre-sentence report was prepared subsequent to Castro-Barraza's conviction. This Court has stated that a prosecutor fulfills his duty of discovery and disclosure under Rule 16(a)(1)(B) by revealing the defendant's record of prior convictions and any F.B.I. rap sheet. U.S. v. Trejo-Zambrano, 582 F.2d 460, 465 (9th Cir.1978); see also United States v. Audelo-Sanchez, 923 F.2d 129, 130 (9th Cir.1991) (holding that government was not required to reveal speeding ticket because minor offenses do not appear on defendant's criminal record). The absence of the September 1994 state gun violation from the settlement conference report did not violate Rule 16 because the conviction, due to its recent nature, was not yet on Castro-Barraza's record, as made available to the probation officer in the ordinary performance of his duties. In light of the practical realities involved in gathering information needed to sentence a defendant under the guidelines, the Court declines to construe Rule 16 to create an obligation on the part of the Government to provide greater information than is available to the Probation Department in the course of the regular performance of its duties. 10 B. Sufficiency of Evidence to Prove Violation of 21 U.S.C. § 841(a)(1) and (b)(1)(B)(vii) 11 To sustain a conviction for possession of marijuana with intent to distribute it, "the government must prove that the defendant (1) knowingly (2) possessed the marijuana (3) with intent to distribute it." See United States v. Quintero-Barraza, 78 F.3d 1344, ---- (9th Cir.1995). 12 In this case Castro-Barraza testified at trial that he was the passenger and knew that there was a large amount of marijuana in the Dodge Caravan. He also admitted that he had told Agent Fresquez that he was the driver at the time of the arrest. The testimony of Agent Fresquez, Mary Vanover and Mary Archibald concerning the clothing of the driver and passenger of the Caravan, as well as the direction of their flight, was not inconsistent with a conclusion that Castro-Barraza was the driver. Thus, when reviewing the evidence in the light most favorable to the prosecution, the jury could have found that Castro-Barraza was driving a vehicle containing 430 pounds of marijuana which he was to deliver to another individual, fled when followed by a law enforcement officer, and gave contradictory stories to explain his actions. These facts support a conviction of possession of marijuana with intent to distribute it. See Id. See also United States v. Haro-Portillo, 531 F.2d 962, 963 (9th Cir.1976) ("when one drives a car laden with contraband, there is a substantial basis from which the trier of fact may infer that the driver has knowing possession of the contraband"). 13 C. Qualification for the U.S.S.G. § 5C1.2 "Safety Valve" Exception 14 U.S.S.G. § 5C1.2 provides that the district court "shall impose a sentence in accordance with the applicable guidelines without regard to any statutory minimum, if the court finds that the defendant meets" five statutory criteria. One such criteria is that the defendant "not have more than 1 criminal history point, as determined under the sentencing guidelines." 18 U.S.C. § 3553(f)(1). Castro-Barraza challenges the district court's inclusion of his 1994 state weapons possession charge in the calculation of his criminal history points. If the weapons charge is included, Castro-Barraza is ineligible for the U.S.S.G. § 5C1.2 "safety valve." 15 U.S.S.G. § 4A1.2(a)(1) provides that "[t]he term 'prior sentence' means any sentence previously imposed upon adjudication of guilt, whether by guilty plea, trial, or plea of nolo contendere for conduct not part of the instant offense." Castro-Barraza urges, as he did below, that the 1994 weapons charge should not have counted because the conviction was invalid under Arizona law because it resulted in a suspended sentence and forfeiture of the weapon--a combination that Castro-Barraza asserts does not accord with Arizona law. 16 The district court rejected Castro-Barraza's arguments. The Court concludes that the district court did not err in counting Castro-Barraza's 1994 state conviction for carrying a concealed weapon towards his criminal history where Castro-Barraza's record indicated a valid conviction and where the district court heard testimony from the Arizona magistrate that the magistrate had found Castro-Barraza guilty of carrying a concealed weapon. Furthermore, Guideline § 4A1.2 does not provide a basis to challenge the validity of a prior conviction. U.S. v. Price, 51 F.3d 175, 177-178 (9th Cir.1995). 17 D. Adjustment Based on Acceptance of Responsibility 18 U.S.S.G. § 3E1.1 authorizes a two-point reduction in the base offense level "[i]f the defendant clearly demonstrates acceptance of responsibility for his offense. The burden is on the defendant to "clearly" show that he is deserving of the reduction. United States v. Alexander, 48 F.3d 1477, 1493 (9th Cir.1995). 19 In this case Castro-Barraza put the government to its proof at trial. While a defendant's decision to exercise his right to trial does not automatically render him ineligible for a reduction for acceptance of responsibility, such a situation is rare. Id. at 1494. Here, Castro-Barraza has gone beyond asserting a defense of duress and has challenged the sufficiency of the evidence establishing his possession of the drugs at trial and on appeal. Cf. U.S. v. Ing, 70 F.3d 553, 555-556 (9th Cir.1995) (trial court erred in denying defendant a reduction for acceptance of responsibility where there was nothing to identify such a failure other than the assertion of an entrapment defense at trial). Furthermore, Castro-Barraza either lied at the time of his arrest or during his trial testimony. Finally, Castro-Barraza's presentence report indicates the probation officer's conclusion that "[t]he defendant ... attempts to minimize his participation [in the offense]." In light of the foregoing, the Court concludes that the district court's determination that Castro-Barraza was not entitled to the two-point reduction for acceptance of responsibility was not clearly erroneous. 20 The Court AFFIRMS Castro-Barraza's conviction for possession of marijuana with intent to distribute in violation of 21 U.S.C. § 841(a)(1) and (b)(1)(B)(vii) and the sentence imposed. * The Honorable Robert R. Merhige, Jr., Senior United States District Judge for the Eastern District of Virginia, sitting by designation ** This disposition is not suitable for publication and may not be cited to or by the courts of this circuit except as provided by 9th Cir.R. 36-3

Q: Disable Resharper Extensions I have installed some resharper plugins and since resharper is not loading anymore into VS2013. (Unable to load package). Does anyone know how to disable/uninstall resharper packages from outside VS? Running latest (2016.2) version of R# A: This may be a bit like cracking a nut with a hammer but you could try removing all traces of Resharper from %LOCALAPPDATA%\JetBrains and %APPDATA%\JetBrains and re-install it and then re-add the extensions to see which caused you the problem (would be good to know which one it is so that others don't have the same problem.) It seems that the Resharper installation is following the Microsoft standard of spreading numerous cached versions of the same files all over your hard drive to fill it up, not like back in the old days when it was all in just one location.

Sebastian Gregory Sebastian Gregory (born 3 March 1990) is an Australian actor and musician. He is a self-taught guitarist, drummer and songwriter, who formed a band called Menace when he was thirteen. After being spotted in his own music video, Gregory was signed to an acting management agency. He has appeared in a number of short films, commercials and theatre productions. He made his first television appearance in a 2004 episode of Blue Heelers. Two years later he landed a recurring role in the soap opera Neighbours. Gregory made his feature film debut in Acolytes. This was followed by a role in 2009 film Beautiful and a regular role in children's television series The Elephant Princess. Gregory's next film roles were in comedy films Accidents Happen and A Heartbeat Away. In April 2012, Gregory joined the cast of Neighbours for a second time. Early life Gregory was born in Melbourne, Australia in the early 1990s. He was given a drum kit when he was ten years old and he made the first of his guest appearances at hotels and clubs when he was eleven. Gregory is a self-taught guitarist, drummer and songwriter. He formed a band called Menace when he was thirteen. The band was later taken to London by Xenomania and they were offered a recording contract. Gregory's acting talent was discovered after he was spotted in his own music video. He was then signed to an acting management agency. Career Gregory has appeared in a number of short films, commercials, theatre, television productions and films. In 2004, he appeared as Rohan Shanley in an episode of Blue Heelers. Two years later Gregory landed a recurring role in the long-running soap opera Neighbours. He played Garrett Burns, a love interest for Rachel Kinski (Caitlin Stasey). Gregory made his feature film debut in Jon Hewitt's Acolytes. He played Mark, a teenager who becomes involved in murder and violence. Principal photography on the film began in April 2007 in Queensland. Gregory's band, Menace, had two songs featured on the soundtrack. Shortly after, Gregory was cast in Beautiful a film by writer-director Dean O'Flaherty. Of his role as Danny in the film, Gregory told Sacha Molitorisz of The Sydney Morning Herald "I always seem to be playing a weird, freaky kid. But there's something really beautiful about Danny." Molitorisz said Gregory "delivers a powerfully understated performance in the film." For his portrayal of Danny, Gregory earned a nomination for Best Young Actor at the 2009 Australian Film Institute Awards. Gregory was cast in the regular role of JB Deekes in the children's television series The Elephant Princess in 2008. His Menace bandmates made a cameo appearance in episode seven of The Elephant Princess and one of their tracks was also featured. In June 2008, a writer for Variety reported Gregory had joined the cast of Accidents Happen, a dark comedy film based on a semi-autobiographical screenplay by Brian Carbee. Gregory auditioned for the role of Billy, but the filmmakers thought he would be perfect for the role of Doug Post instead. Accidents Happen was shot in Sydney and released in 2009. Gregory's next film role came about in 2011 when he starred in A Heartbeat Away, an Australian musical comedy. On 10 April 2012, it was announced Gregory had joined the cast of Neighbours again as "mathematics genius" Ed Lee. He had a four-month guest contract with the soap and began appearing from 8 June 2012. Gregory filmed a role in Return to Nim's Island in the Gold Coast during August 2012. Filmography Film Television References External links Category:1990 births Category:Living people Category:Australian male television actors Category:Male actors from Melbourne Category:21st-century Australian male actors

Azabat talking crosswords Description azabat talking crosswords are a series of collections of crosswords, 70 per cd that can be ordered from the Uk based company for £20 each. Crosswords are a very popular and traditional passtime, often contained in news papers, in which a number of words of varying length are arranged in a grid horizontally and vertically. Some or all of The letters of these words are obscured, so the players objective is to fill in all the missing letters and thus guess individually what each word means, from a number of sometimes extremely cryptic clues, for instance "person who pumps Iron" might be a clue for the word weightlifter. Sinse the words are arranged in grid pattern, one crossing another, filling in letters in one word will fill in letters in the words it crosses, and so make it easier to guess subsequent words, however this also means that if a player makes a mistake on a clue, a player might find themselves with incompatible letters in later words, and need to go back and retrace their steps. Thus solving crosswords requires patience, logic, and a very good vocabulary. As one of their primary goals is creating games playable by computer novices, Azabat's crosswords work in a similar fashion to the games in their second games volume, with everything in the interface intended to be as simple and easy as possible. There are thus far three volumes in the collection, each available for 20 uk Pounds or 30 dollars, and though the games are retail only, a demo cd is available free of charge from Azabat to let you try before you buy. All the azabat games run directly from the cd with no installation needed, feature sound effects in the games and are self voicing with recorded speech. As one of the primary intentions of Azabat is to create games playable by computer novices, the games use only the function keys,number row, space bar and cursers to make things easier, with all in game keys explained in the documentation, which also contains detailed instructions on solving crosswords and the ability to get hints if your stuck. The games also have bright, high contrast graphics, making them perfect to play for people with any level of site, indeed in the word games the magnification can be turned up as far as 64 times normal and all the letters and clues are on bright, well contrasting backgrounds.

Q: Java: Make one item of a jcombobox unselectable(like for a sub-caption) and edit font of that item How to make one item in a combobox unselectable because I need to separate items in a combobox with a sub-topic. And is it possible to modify the font of that particular item individually? jComboBox_btech_course.setFont(new java.awt.Font("Tahoma", 0, 14)); jComboBox_btech_course.setModel(new javax.swing.DefaultComboBoxModel(new String[] { "Select Course" })); jComboBox_btech_course.setName(""); private class theHandler implements ActionListener { public void actionPerformed(ActionEvent evt) { //BTech courses if(jComboBox_mtech_dept.getSelectedItem().equals("Civil Engineering")) { jComboBox_btech_course.removeAllItems(); jComboBox_btech_course.addItem("Building Construction"); jComboBox_btech_course.addItem("Principle And Practice"); jComboBox_btech_course.addItem("Surveying"); jComboBox_btech_course.addItem("Engineering Geology"); jComboBox_btech_course.addItem("Structural Analysis"); jComboBox_btech_course.addItem("Hydraulic Engineering"); jComboBox_btech_course.addItem("Environmental Engineering"); jComboBox_btech_course.addItem("Structural Design"); jComboBox_btech_course.addItem("Geotechnical Engineering"); /*This item has to be unselectable*/ jComboBox_btech_course.addItem("***Sub-topic***"); jComboBox_btech_course.addItem("Transportation Engineering"); jComboBox_btech_course.addItem("Foundation Engineering"); jComboBox_btech_course.addItem("Estimation & Valuation"); jComboBox_btech_course.addItem("Hydrology & Flood Control"); jComboBox_btech_course.addItem("System Analysis, Project Planning And Construction Management"); jComboBox_btech_course.addItem("Irrigation Engineering"); jComboBox_btech_course.addItem("Computer Application in Civil Engineering"); jComboBox_btech_course.addItem("Planning, Design & Detailing"); } } } A: Foreword: In the proposed solution I assume that you want to disable items that start with "**". You can change this logic to whatever you want to. In an improved version the MyComboModel class (see below) may even store which items are disabled allowing arbitrary items to be marked disabled. Solution to your question involves 2 things: 1. Disallow selecting items which you want to be disabled For this you can use a custom ComboBoxModel, and override its setSelectedItem() method to do nothing if the item to be selected is a disabled one: class MyComboModel extends DefaultComboBoxModel<String> { public MyComboModel() {} public MyComboModel(Vector<String> items) { super(items); } @Override public void setSelectedItem(Object item) { if (item.toString().startsWith("**")) return; super.setSelectedItem(item); }; } And you can set this new model by passing an instance of it to the JComboBox constructor: JComboBox<String> cb = new JComboBox<>(new MyComboModel()); 2. Display disabled items with different font For this you have to use a custom ListCellRenderer and in getListCellRendererComponent() method you can configure different visual appearance for disabled and enabled items: Font f1 = cb.getFont(); Font f2 = new Font("Tahoma", 0, 14); cb.setRenderer(new DefaultListCellRenderer() { @Override public Component getListCellRendererComponent(JList<?> list, Object value, int index, boolean isSelected, boolean cellHasFocus) { if (value instanceof JComponent) return (JComponent) value; boolean itemEnabled = !value.toString().startsWith("**"); super.getListCellRendererComponent(list, value, index, isSelected && itemEnabled, cellHasFocus); // Render item as disabled and with different font: setEnabled(itemEnabled); setFont(itemEnabled ? f1 : f2); return this; } });

No Results Found Quick Search Tips: Instead of using the search box, find your gear by clicking the product category tabs and other navigation links. Try varying the spelling to see if the word is spelled correctly. Check out the items below that are suggested based on your search terms. We'd love to help you find what you're looking for-call us anytime at 888-566-6123. Suggested Items: big hot deals!! About our Amplifiers & Effects Music123 offers you the absolute lowest price on an outstanding selection of guitar, bass, and keyboard amplifiers and effects. From the ideal beginner's guitar or a bass guitar package that includes an amplifier, M123 has you covered. Whether you're a rocking lead guitarist, a bass phenom, or a keyboard wizard, you'll find the right amplifiers and effects from all your favorite brands—right here at Music123. Read our helpful hands-on reviews and buying guides to help you choose your amp or effect. Shop risk-free with our Lowest Price and Complete Satisfaction guarantees to back every purchase. Publisher does not accept liability for incorrect spelling, printing errors (including prices), incorrect manufacturer's specifications or changes, or grammatical inaccuracies in any product included in the Music123 catalog or website. Prices subject to change without notice.

Find the right company for you What qualities are you looking for in a great employer? Use our tool to find the companies on our list that suit you best.

.generic-datasource-query-row .query-keyword { width: 75px; }

The new face of Marc Jacobs SHARE THIS ARTICLE Well, you got it right! The fresh new face of Marc Jacobs has finally been revealed and it is none other than our lovely Cher. The trend that they are following for their new campaign is to cast iconic elder women and these ad promotions will be continuing for some time now. In the past few years, if you have noticed, there has been no dearth of celebrity women in popular fashion campaigns. From Saint Laurent that cast Joni Mitchell to Joan Didion’s Céline ads, they are at the moment all over the place, and we simply love it! Many of us did wonder whether casting elder women for ad campaigns, who rein their 60s and 70s, would end up being a flash for their pan trend or not? But we are now extremely glad to say that this is not the case. Katie Grand, who is the editor of Love magazine and also every season for Marc Jacobs, helps to creative direct the ad campaigns, on the morning on Wednesday, and uncovered the fresh new ads for Marc Jacobs. We have to say Cher looked wonderful and simply refined and iconic for the New York-based brand ads. The 69-year-old singer and actress, Cher, who was there at the Met Gala event this year and accompanied Jacobs, was seen wearing a black gown. The gown, which was floor-length, belonged to Jacobs’s dark, moody fall 2015 collection. The collection has been inspired by the famous Diana Vreeland’s apartment during the later part of her life. Since the ’60s, Cher has stuck to the fashion industry and is known to be a fashion industry staple. This is why in the current shots that has been taken by David Sims, she looks a bit fierce, which is not at all a surprise to us.

Plasmid cloning vectors that can be nicked at a unique site. We describe ColEl-type plasmids, with relaxed DNA replication, based on pMB9, and carrying the CmR determinant of R1, in addition to the TcR determinant of pMB9. One of the plasmids, pPH207, has unique sites for EcoRI, HindIII, BamI, SalI and HpaI. Insertion of foreign DNA into all but the last of these inactivates either the CmR or the TcR determinant. The original CmR TcR plasmid (pCM2) contains a copy of IS1 which produces deletions to left and to right. Most of these inactivate either the CmR or the TcR determinant. An internal 280 bp deletion of IS1 DNA in pPH207 greatly reduces the frequency at which deletions are observed. The main feature of these plasmids is a site that is cleaved by some preparations of EcoRI in only one strand of the DNA duplex (the EcoRIn site). This site facilitates strand separation of sequences inserted at the HindIII, BamI and SalI sites of the TcR gene, and also of any inserted at the true EcoRI site by a method that destroys that site. Since the orientation of the EcoRIn site is known, the orientation of sequences inserted at the neighbouring sites can be easily determined. Plasmid pPH207 is not mobilised by a Hfr, but its mobilisation is promoted by ColEl. It is therefore Mob- bom+. Experiments with minicells show that it directs the copious synthesis of chloramphenicol transacetylase.

Beyond single pathway inhibition: MEK inhibitors as a platform for the development of pharmacological combinations with synergistic anti-leukemic effects. The MEK/MAPK signaling module is a key integration point along signal transduction cascades that regulate cell growth, survival, and differentiation, and is aberrantly activated in many human tumors. In tumor cells, constitutive MAPK activation affords increased proliferation and resistance to apoptotic stimuli, including classical cytotoxic drugs. In most instances, however, MAPK inhibition has cytostatic rather than cytotoxic effects, which may explain the lack of objective responses observed in early clinical trials of MEK inhibitors. Nevertheless, amenability of the MAPK pathway to pharmacodynamic evaluation and negligible clinical toxicity make MEK inhibitors an ideal platform to build pharmacological combinations with synergistic antitumor activity. In AML, the MEK/MAPK pathway is constitutively activated in the majority of cases (75%), conferring a uniformly poor prognosis; in preclinical models of AML, MEK blockade profoundly inhibits cell growth and proliferation and downregulates the expression of several anti-apoptotic players, thereby lowering the apoptotic threshold. Apoptosis induction, however, requires concentrations of MEK inhibitors much higher than those required to inhibit proliferation. Nevertheless, MEK blockade efficiently and selectively sensitizes leukemic cells to sub-optimal doses of other apoptotic stimuli, including classical cytotoxics (nucleoside analogs, microtubule-targeted drugs, gamma-irradiation), biologicals (retinoids, interferons, arsenic trioxide), and, most interestingly, other signal transduction/apoptosis modulators (UCN-01, STI571, Bcl-2 antagonists). In most instances, these MEK inhibition-based combinations result in a striking pro-apoptotic synergism in preclinical models. Here we briefly discuss evidence suggesting that MAPK pathway inhibition could play a prominent role in the development of integrated therapeutic strategies aimed at synergistic anti-leukemic effects.

INTRODUCTION {#s1} ============ The ocular surface has two main functions; refracting light, and protecting the intraocular environment by forming an effective barrier against fluid loss and pathogen penetration. It is comprised of the corneal epithelium, limbal epithelium and conjunctival epithelium \[[@R1]\]. Due to the exposure of the cornea to the external environment the cells of the corneal epithelium need to be constantly replaced. The limbal epithelium is thought to contain limbal epithelial stem cells (LESCs) which upon differentiation into transient amplifying cells will move centripetal to the cornea to replenish the old cells \[[@R2]\]. The LESCs can be distinguished from terminally differentiated corneal epithelial cells by the expression of integrin α9, ΔNp63α and ABCG2. Corneal epithelial cells express high levels of cytokeratin 3, cytokeratin 12, involucrin and connexin 43 \[[@R3]\]. In certain corneal diseases, like limbal stem cell deficiency, or in cases of damages from external sources the pool of LESCs is depleted, which leads to an impairment in corneal epithelial maintenance and consequent conjunctivalization. In most cases limbal stem cell transplantation is the first choice of treatment. Hereby either autologous or allogeneic limbal epithelial stem cells \[[@R4]\], or expanded *ex vivo* limbal epithelial stem cells are transplanted \[[@R5]\], however, the risk of graft rejection is high. In addition, LSC transplantation has other downsides including risks to the contralateral healthy eye, and limited cell expansion *ex vivo*. It is also not applicable if patients have damage to both eyes, if patient\'s LSC deficiency has a genetic background, or in Stevens-Johnsons syndrome \[[@R6]\]. Furthermore, chronic inflammation negatively affects the long-term survival of transplants \[[@R7]\]. The discovery that adult somatic cells can be reprogrammed to an undifferentiated, pluripotent state similar to embryonic stem (ES) cells has revolutionized the concept of cell fate. Those so called iPS cells can be generated by introducing the four transcription factors *Oct4, Sox2, Klf4* and *c-myc* into adult somatic cells. Those resulting cells have the ability to differentiate into all three germ layers \[[@R8], [@R9]\]. With this method ethical concerns associated with ES-cell harvesting from embryos could be avoided, as no oocytes or embryos are used. Furthermore, patient-specific cells can be used, which makes it ideal for drug screening, disease modeling and regenerative medicine. However, pluripotent cells may form teratomas, which limits the use of iPS cells in the clinics \[[@R10]--[@R12]\]. Especially dangerous in this context is the use of the proto-oncogenes *c-myc* and *Klf4* in reprogramming events, hence these transcription factors should be replaced. As shown by Yu and colleagues replacing *c-myc* and *Klf4* by *Nanog* and *Lin28* also lead to sufficient reprogramming of human somatic cells \[[@R13]\]. Still, generating iPS cells and consequently differentiating them is time-consuming, and the efficiency of reprogramming is rather low. Converting cells from one cell lineage to another without prior dedifferentiation into pluripotent cells would eliminate the risk of teratoma formation. This concept of lineage conversion is not new, already in 1987 Davies and colleagues have shown that introduction of just cDNA alone may convert fibroblasts into myoblasts \[[@R14]\]. In recent years, this field has gained new interest and it has been shown that mouse fibroblasts can be transdifferentiated into neurons \[[@R15]\] or cardiomyocytes \[[@R16]\]. Furthermore, it is a rather fast process, taking between 2-4 days to complete transdifferentiation, and it occurs with high efficiency \[[@R15], [@R16]\]. So far no protocol exists for converting fibroblasts into the limbal epithelial/corneal epithelial lineage. In the present study, we show that it is possible to generate corneal limbal cells directly form fibroblasts. For comparison (Figure [1](#F1){ref-type="fig"}), we also differentiated iPS cells (reprogrammed from human dermal fibroblasts) and consequently differentiated them into cells of the corneal epithelial lineage. The expression profile for corneal epithelial-specific markers was investigated in both types of cells, and compared with human corneal epithelial cells (HCEC), that served at our experiments as a control/reference. {#F1} RESULTS {#s2} ======= Generation of iPS cells from human dermal fibroblasts {#s2_1} ----------------------------------------------------- For the generation of iPS cells human dermal fibroblasts were infected with the 4 Yamanaka factors: Oct4, Sox2, Klf4 and c-myc. After 2 weeks ES-like colonies appeared and those colonies were picked up and cultured in iPS cell culture conditions. iPS cell colonies stably maintained their iPS cell-like morphology during the whole culture period and subsequent passages (Figure [2A](#F2){ref-type="fig"}). To assess whether the generation of iPS cells was successful we analyzed the expression of Oct4, Sox2, Klf4, c-myc as well as the pluripotent stem cell marker Nanog by immunostaining. All iPS cell colonies analyzed expressed the pluripotency markers (Figure [2B](#F2){ref-type="fig"}). The ES-like morphology of the generated iPS cells, the possibility to expand iPS cell colonies and the positive immunostaining for the pluripotency markers indicate the successful reprogramming of human dermal fibroblasts to iPS cells. {#F2} iPS cells could be differentiated to corneal epithelial cells {#s2_2} ------------------------------------------------------------- Next, we determined if our generated iPS cells could be differentiated to corneal epithelial cells by mimicking the natural environmental niche. Thereby the surface of the well was coated with gelatin and the differentiation medium was conditioned with human limbal stromal cells. The differentiation process was evaluated over a 21 days period. Already at first days of differentiation the iPS cells started to flatten and changed from a round sphere-like morphology to the cobblestone appearance typical for HCEC. This appearance did not change during the whole culture period (Figure [3A](#F3){ref-type="fig"}). To further examine whether our iPS cells differentiated to the corneal epithelial lineage we performed immunocytochemistry for corneal epithelial markers. The immunostaining was positive for all tested corneal epithelial markers: ΔNp63, CK3, CK12, C/EBPδ, ITF2, ABCG2 and Pax6, but to different extend. Pax6, ABCG2 and ITF2 proteins were expressed at low levels in all examined cells, whereas the expression of CK3, CK12 and ΔNp63 was stable and relatively high over the 21 days culture period (Figure [3B](#F3){ref-type="fig"}). To determine if the differentiation was specific to the corneal epithelial lineage, differentiated cells were also stained for CK10, a skin epithelial marker. The differentiated cells did express to some extend CK10, but the expression level was similar in HCEC stained for the same marker ([Supplementary Figure S1](#SD1){ref-type="supplementary-material"}). The expression levels for all stained proteins are summarized in Table [1](#T1){ref-type="table"}. ###### Summary of immunocytochemistry analysis Day 7 Day 14 Day 21 IPS cells HCEC ------------ -------- -------- -------- ----------- ------ **ΔNp63** +++^a^ ++ ++ \- +++ **CK3** ++ +++ +++ \- ++ **CK12** ++ +++ +++ \- ++ **Pax6** \+ \+ \+ \- \+ **C/EBPδ** +++ +++ +++ ++ +++ **ITF2** ++ \+ \+ \+ \- **ABCG2** \+ \+ \+ \- \+ **CK10** \+ \+ ++ \- \+ **Oct4** ++ ++ +++ +++ \+ **Sox2** ++ ++ +++ +++ \+ **Klf4** ++ \+ ++ +++ ++ **c-myc** ++ +++ +++ +++ +++ **Nanog** +++ +++ +++ +++ \+ {#F3} Immunocytochemistry reveals expression of pluripotency markers in differentiated cells {#s2_3} -------------------------------------------------------------------------------------- One hallmark of iPS cells is their differentiation capability to give rise to cells of all three germ layers. This feature makes those cells as valuable for regenerative medicine as virtually all body organs can be grown *in vitro*, but in the same time it limits their use, as undifferentiated cells can give rise to teratomas upon transplantation. Therefore, it must be ensured that all iPS cells are differentiated and do not express any pluripotency markers anymore. Hence, we assessed the loss of iPS cell pluripotency during the differentiation process by immunostaining for Oct4, Sox2, Klf4, and Nanog. The expression levels decreased significantly only for Klf4 and partially for Oct4, whereas other markers remained at high level (Figure [4](#F4){ref-type="fig"}), suggesting an incomplete differentiation, which can lead upon transplantation to uncontrolled cell growth and teratomagenesis. {#F4} RT-qPCR confirms successful differentiation of iPS cells {#s2_4} -------------------------------------------------------- To confirm the results from immunocytochemistry a reverse transcriptase qPCR was done to detect the expression level of the stemness markers, and limbal cell markers. Interestingly, contrary to the immunostaining results, the gene expression for ΔNp63 was continuously increasing over the 21 day culture period and Pax6, which could almost not be detected by immunocytochemistry, had a very strong positive fold change of over 250 at all the three time points compared to iPS cells. The expression levels of CK3 and CK12 were increasing over the time of differentiation and reached similar levels of gene expression as HCEC cells. The expression levels for CK10 were increasing over time, but were still below the expression level of HCEC (Figure [5A](#F5){ref-type="fig"}). No change was observed in the expressions of TCF4, ABCG2 and connexin 43 genes (data not shown). {#F5} The immunostaining showed a strong protein expression for all pluripotency markers, RT-qPCR showed a decrease for Oct4, Sox2, Klf4 and Nanog at the mRNA level, though the level of the positive control HCEC, was far lower. This may suggest that the loss of stemness was not achieved completely (Figure [5B](#F5){ref-type="fig"}). Taking together, we conclude that our differentiation method resulted in the generation of corneal epithelial like cells similar to HCEC cell line but with some "traces" of pluripotency, or contamination with iPS. Successful transduction of primary fibroblasts with limbal epithelial regulators {#s2_5} -------------------------------------------------------------------------------- A pool of lentiviruses containing three genes (transcription factors) important in limbal epithelial development (ΔNp63α, TCF4 and C/EBPδ) plus either Oct4 or Klf4 or both (hereafter referred to as PCT, PCTO, PCTK and PCTOK, respectively) was prepared to infect human dermal fibroblasts. To enhance the direct transdifferentiation towards the limbal epithelial lineage the cell medium was changed two days post transduction to a corneal epithelial medium and another two days later cells were seeded on gelatin. Cell morphology stayed the same over the first 4 days, but just upon re-seeding the infected cells on gelatin-coated wells induced morphological changes (Figure [6A](#F6){ref-type="fig"} & [Supplementary Figure S2](#SD1){ref-type="supplementary-material"}). The cells developed a more triangular, cobblestone appearance typical for corneal epithelial cells, although the culture stayed heterogeneous with cells displaying also a more fibroblast-like phenotype. Surprisingly, from the seven different conditions tested (summarized in Table [2](#T2){ref-type="table"}), cells infected with only the three corneal developmental transcription factors (PCT) showed the highest degree of morphological changes and proliferated much faster than cells subjected to other conditions (images have been quantified using Image J software and the confluency of cells after 14 days has been scored: PCT- 95%, PCTK- 17%, PCTO- 61% PCTOK- 6%). When either Oct4 or Klf4 was added to the three corneal developmental transcription factors, cells also started to change morphology but more cells kept their original fibroblast-like appearance. ###### Summary of direct transdifferentiation results PCTOK PCTK PCTO PCT PC PT CT --------------------------- ------- ------ ------ ----- ---- ---- ---- **Morphological changes** \+ \+ ++ ++ \- \- \- **CK3** ++ \+ ++ ++ \- \- \- **CK12** ++ \+ ++ ++ \- \- \- {#F6} Cells transduced with all five factors (PCTOK) showed a high degree of cellular stress with lots of apoptosis and even after 14 days in culture ([Supplementary Figure S3](#SD1){ref-type="supplementary-material"}) those cells still displayed a slower cell proliferation and less morphological changes. Cells transduced with only two factors (PC, PT and CT) did not show any change in the morphology (Table [2](#T2){ref-type="table"}). To further assess the degree of transdifferentiation, the infected cells were stained 7 days post infection, for CK3 and CK12 (Figure [6B, 6D](#F6){ref-type="fig"}). Additionally reverse transcriptase PCR clearly showed that all 5 transcription factors that were introduced into the host\'s genome, have been expressed at day 3 post infection (Figure [6C](#F6){ref-type="fig"}). The staining for CK3 and CK12 was positive for four conditions (no staining for cells treated with only two factors was observed), though infection with PCTK showed a little bit weaker expression compared to the other three conditions (Figure [6B, 6D](#F6){ref-type="fig"}). Pax6 protein was not detected in either of the conditions (data not shown). These results suggest that transduction of fibroblasts with transcription factors important for corneal epithelial development induced changes to a more corneal epithelial-like cell type. To check if the proposed transdifferentiation protocol also results in the elevation of the expression of genes specific for limbal epithelial cells, we performed qPCR analysis (Figure [7](#F7){ref-type="fig"}). We investigated the gene expression only under the condition where fibroblasts were transduced with only three transcription factors (TCP) because such condition achieved the highest degree of transdifferentiation. The expression levels of CK3 and CK12 genes were increasing over the time and reached \~16 and 2.1 fold increase respectively when compared with untreated fibroblasts. Very high expressions were observed for ΔNp63α, C/EBPδ and TCF4, however it has to be remembered that these genes had been introduced with the help of lentiviral vectors. No change in the expression of Pax6 transcript was observed. {#F7} DISCUSSION {#s3} ========== In this study we performed the transdifferentiation of human dermal fibroblasts into limbal cells, and compared the efficiency of the process to differentiation of limbal cells from iPS (reprogrammed from human dermal fibroblasts). Since transdifferentiation of human epithelial cells into human limbal cells has not been done before, we had to test several different conditions and various combinations of transcription factors, to achieve the conversion. The pioneering work by Yamanaka and colleagues to induce pluripotent cells from somatic cells by retroviral infection of defined transcription factors in 2006 \[[@R8]\], paved the way for others to improve the protocols, using different approaches for generating iPS cells, amongst others lentiviral- \[[@R13]\] and adenoviral-delivery systems \[[@R17]\] as well as non-viral systems using expression plasmids \[[@R18]--[@R20]\] and transposons \[[@R21]\]. Another strategy is the use of small molecule compounds like the DNA methyltransferase inhibitor 5′-azacytidine and the histone deacetylase inhibitor valproic acid \[[@R22]\]. We used a retroviral-delivery system for introducing the four transcription factors into dermal fibroblasts as well as valproic acid and hypoxia conditions to increase reprogramming efficiency. In addition, we added the ROCK inhibitor Y-27632 that had been shown to enhance the survival and growth of ES cells under unfavorable conditions such as dissociation \[[@R23]\]. This reprogramming approach yielded a good efficiency with colonies showing morphology similar to ES-cells and expression of pluripotency markers. Furthermore, our iPS cells have been expanded over more than 15 passages without any loss of ES-cells typical morphology, thus further indicating the successful reprogramming of fibroblasts into iPS cells. The cell cycle of our iPS cells has also been previously characterized \[[@R24]\]. The analysis has confirmed short G1 phase and high number of cells in G2 phase, which is in accordance with other reports describing iPS cells. Adult stem cells reside within specialized microenvironments in which they are kept undifferentiated due to secreted signals from surrounding cells, cell-cell interactions and adhesion to extracellular matrix components \[[@R25], [@R26]\]. As stem cells divide into more differentiated cells they migrate out of this niche and have access to new cues from the environment, which leads to further differentiation steps \[[@R27]\]. The properties of the microenvironment, including the composition of available on the surface chemical groups, its elasticity, even movement, may affect cell differentiation \[[@R28]\]. Hence, changed environment (i.e. changed culture conditions) will prompt to differentiate iPS cells into certain lineages. Using collagen type IV as coating material and a cell culture medium specific for the growth of keratinocytes in 2011 Sakurai and colleagues succeeded for the first time in differentiating mouse iPS cells into stratified epithelial progenitor cells \[[@R29]\]. One year later Hayashi et al. succeeded in inducing corneal epithelial cells from human iPS cells via the SDIA method. This method utilizes a feeder layer and a differentiation medium \[[@R30]\]. Consequently, several groups followed similar protocols, most of them used Collagen type IV as coating material as this is the most abundant basement membrane component of the cornea \[[@R31]--[@R33]\]. Collagen type IV promotes the proliferation of p63-positive cells, a marker for corneal epithelial cells \[[@R34]\], though it is quite expensive. We have recently shown that LESCs could be derived from human pluripotent stem cells under serum-free conditions by growing them on commercially-available bioengineered collagen matrices (LinkCell™) mainly comprised of medical grade collagen type I \[[@R35]\]. These results show that LESCs derived from iPS and from embryonic stem cells proliferate 2-4 folds better on the bioengineered type I collagen matrices than on the collagen IV-coated control petri dishes. Recently, the importance of autophagy in epidermal development has been described, which may suggest possible future solutions for enhancing epithelial cell differentiation and transdifferentiation, for instance, by targeting autophagy related pathways \[[@R36]\]. As autophagy profoundly affects the metabolism of not only epithelial cells but also other cell types \[[@R37]--[@R39]\], hence autophagy modulators should be tested also as modulators of transdifferentiation. Here we show that iPS cells could be rapidly differentiated into corneal epithelial cells by seeding them on gelatin-coated culture dishes instead of collagen type IV-coated dishes, and by using conditioned corneal epithelial medium. Gelatin consists of denatured collagen polypeptide chains, which were isolated from bovine or porcine skin or bone by acid or base extraction. Due to this isolation procedure lot-to-lot variance is an issue \[[@R40]\]. We used gelatin from porcine skin and were able to successfully induce the differentiation, though no comparison was made with collagen type IV coating. To reduce the lot-to-lot variance and other issues related with using products from animal origin, recombinant gelatin could be used. Our differentiation protocol led to changes in morphology as well as expression of cornea epithelial specific markers. CK3 and CK12 are key markers for terminally differentiated corneal epithelial cells, whereas ΔNp63α is a proposed marker for limbal stem cells \[[@R3]\]. Our differentiated cells express all three markers and their protein expression seemed to stable over the 21-day culture period. Another marker for ocular and neural tissue is Pax6 which is expressed in the developing eye and continues to be expressed in the mature corneal epithelium \[[@R41]\]. Surprisingly, we could detect only weak protein expression of Pax6 in the differentiated cells for all the time points tested; similarly, the human corneal epithelial cells (positive control) did not show high levels of protein expression for Pax6 despite the fact that RT-qPCR results suggested the opposite, e.g., the increase in gene expression for Pax6 was at least 200--fold more than undifferentiated iPS cells, similar to those for HCEC. The observed discrepancy may be due to the low affinity of the antibody used for Pax6 detection. Also, gene expression levels for ΔNp63α increased towards the end of the 3-week culture period. The differences in the results obtained by the two methods may be attributed to the post-transcriptional regulatory processes (i.e. miRNAs) regulating the translatory potential of mRNA. Hence, mRNA may be degraded before it is translated into proteins, therefore, the correlation between protein levels and abundance of corresponding mRNA is not very strong \[[@R42]\]. The formation of teratomas upon transplantation of iPS cells into immunosuppressed mice is one of the hallmarks of pluripotent cells. This feature limits the use of iPS cells in the clinic, as it must be ensured that differentiated cells do not possess pluripotency prior to transplantation. Therefore, we tested the differentiated cells for Oct4, Klf4, Sox2, and Nanog expression. Immunostaining revealed that the differentiated cells did not completely lose their pluripotency, as most of these markers were still expressed. RT-qPCR results show the opposite, all genes were down-regulated in the differentiated cells, however, the expressions of Oct4 and Klf4 increased after 21 days of differentiation process. Klf4 is important for postmitotic epithelial cells, especially skin, gut \[[@R43]\] and corneal epithelial cells \[[@R44]\]. This phenomenon explains why differentiated cells show quite similar mRNA of KLF4 levels as iPS cells. One possible reason of such increase in expression could be the reactivation of the transgene. Normally, the transgenes are expressed in the beginning of the reprogramming event and once stable iPS cells are generated, the transgenes are silenced and only the endogenous genes are solely expressed \[[@R9]\]. But it was shown for c-myc that the transgene could get reactivated and consequently drive tumor formation \[[@R45]\]. As Klf4 is a proto-oncogene, reactivation of the transgene could lead to the formation of teratomas and possibly other types of tumors, when transplanted. Therefore, further tests are necessary to reveal if the transgene was reactivated. As for the generation of iPS cells with defined factors, cells can be directly reprogrammed into another cell type without dedifferentiation to a pluripotent state by introducing tissue specific transcription factors \[[@R46]\]. This was successfully shown for transdifferentiating fibroblasts into the neural lineage \[[@R15]\] and cardiomyocytes \[[@R16]\]. For transdifferentiating fibroblasts into the corneal epithelial lineage no protocol exists so far. Thus, we set out to determine if the introduction of key developmental limbal epithelial transcription factors could transdifferentiate human fibroblasts into the corneal epithelial lineage. ΔNp63α, C/EBPδ and TCF4 are important developmental limbal epithelial regulators, where ΔNp63α seems to play a role in the proliferative potential of limbal epithelial cells as it is solely expressed by stem-like cells and not terminally differentiated cells \[[@R47]\]. C/EBPδ is responsible for the self-renewal of limbal epithelial stem cells by forcing the cells into the G~0~/G~1~ phase of the cell cycle and keeping them quiescent \[[@R48]\]. TCF4 maintains the functional properties of corneal epithelial stem cells, is exclusively found in the limbal epithelium and co-localizes with ΔNp63α \[[@R49]\]. To enhance the transdifferentiation potential the cells were also infected with Oct4 or Klf4. Those two pluripotency markers were chosen due to their expression in either limbal stem cells (Oct4) \[[@R50]\] or corneal epithelial cells (Klf4) \[[@R44]\]. The infection of fibroblasts with the cocktail of transcription factors plus changing the medium to a corneal epithelial medium seemed to be sufficient to induce limbal epithelial/corneal epithelial cells, since just upon seeding them on gelatin-coated wells virus transduced cells started to change morphology. Interestingly, cells that were infected with PCT showed the same strong expression of CK3 and CK12 as cells infected with PCTO, PCTK or PCTOK, however PCT cells proliferated and differentiated much faster than cells transduced with four or five factors. Since CK3 and CK12 are associated with terminally differentiated cells, a strong staining indicates successful change towards corneal epithelial cell state. As we did not observe any changes in cells treated with combinations of only two factors, it suggests that at least three of them are required for successful transdifferentiation. Nevertheless, all culture conditions showed a heterogeneous cell population, with many cells similar to corneal epithelial cells and some cells displaying a more fibroblast-like state. Taken together, these results indicate a direct conversion of fibroblasts to the corneal epithelial lineage is possible, but to various degree, and thus the protocol has to be further refined to produce pure corneal epithelial-like cells. Conclusion {#s3_1} ---------- The present study shows that corneal epithelial cells could be generated by differentiating human iPS cells with the help of gelatin-coated surfaces and corneal epithelial conditioned medium. Our differentiation strategy results in a rapid change of morphology to induce complete differentiation in 14-21 days. Furthermore, corneal epithelial-like cells could be generated by introducing defined factors into human fibroblasts. This is a first step towards generating corneal epithelial cells by transdifferentiation (direct conversion), however several improvements to the protocol still need to be done to assure a full, uniform differentiation, as well as further tests to assess the functional properties of the generated cells. MATERIALS AND METHODS {#s4} ===================== Cell culture {#s4_1} ------------ HEK293, human normal dermal fibroblasts (obtained as waste-product from cosmetic surgery and provided by Dr. Gunnar Kratz \[[@R51]\]), and limbal stromal cells (provided by Dr. May Griffith) were cultured in DMEM medium (PAA, Pasching, Austria) with 10% FBS (PAA) and 1% penicillin-streptomycin (GIBCO, Carlsbad, CA) antibiotics. Human corneal epithelial cell line (HCEC) (provided by Dr. May Griffith) was cultured in EpiLife medium (GIBCO) with 1% human corneal growth supplement (HCGS; GIBCO). Human iPS cells were maintained on mitomycin-C treated MEF feeder cells in primate ES cell medium (ReproCell, Yokohama, Japan). Cultures were kept at 37°C, 5% CO~2~ and 21% O~2~. All cell lines were maintained at a confluence of \~70%. IPS cell generation {#s4_2} ------------------- IPS cells were generated by infecting human dermal fibroblasts with Oct4, Klf4, c-myc and Sox2 \[[@R24]\]. Retroviruses containing the 4 reprogramming factors were independently produced by transfecting HEK293 cells using polyethylenimine (PEI, Polysciences Inc., Warrington, PA) based method, with vectors containing human Oct4, c-myc, Sox2 and Klf4, gag-pol plasmid pUMVC and pCMV-VSV-G envelope plasmid in DMEM containing 10% FBS. 48, 72 and 96 h after transfection viral supernatants were collected, filtered through 0.45 μm low protein binding PVDF filters (Millipore, Billerica, MA) and concentrated by centrifugation at 4000g for 1 h at 4°C using Amicon^®^ Ultra Centrifugal Filter Devices (Millipore). For reprogramming 50,000 fibroblasts/well were seeded in 6-well plates and infected on the next day with the mixture of viral concentrates in presence of 8 μg/ml polybrene (Sigma-Aldrich, St. Louise, MO). Transduced fibroblasts were kept in DMEM medium containing 1 mM valproic acid (Sigma-Aldrich) and 10 μM ROCK inhibitor (Y-27632; Wako reagent, Osaka, Japan) for 6 days. Then, cells were treated with trypsin/EDTA (PAA) and seeded on mitomycin-C treated MEF cells (5.5 × 10^4^ cells/cm^2^) in Primate ES Cell Medium supplemented with 1 mM valproic acid and 10 μM ROCK inhibitor. Cells were kept under hypoxic conditions (5% O~2~) with daily medium change. After 2 weeks first round ES-cell like colonies with sharp edges could be detected. To establish iPS cell lines, iPS colonies were picked up enzymatically using 1 mg/ml Collagenase/Dispase (Roche, Basel, Switzerland), dissociated mechanically into smaller clumps and seeded in Primate ES Cell Medium onto fresh mitomycin-C treated MEF cells and cultured under standard cell culture conditions. Conditioning of corneal epithelial medium by limbal stromal cells {#s4_3} ----------------------------------------------------------------- Corneal epithelial medium was conditioned as previously described \[[@R34]\]. In brief, confluent limbal stromal cells were mitotically inactivated by incubation with 10 μg/ml mitomycin-C (Abcam) in DMEM medium for 3 h at 37°C. Cells were washed 2 times with PBS and EpiLife basal medium containing 1% human corneal growth supplement was added. The limbal stromal-conditioned medium was collected daily and replaced with fresh corneal epithelial medium for 10 days. The conditioned medium was sterile filtered using a 0.22 μm -filter and stored at −20°C until use for IPS cell differentiation. Corneal epithelial differentiation of human IPS cells {#s4_4} ----------------------------------------------------- iPS cells were harvested using 1 mg/ml Collagenase/Dispase, washed with PBS, mechanically dissociated into smaller clumps and seeded on 0.1% gelatin-coated 6-well plates. Cells were grown in limbal stromal-conditioned medium with medium changes every 2-3 days. Cells were dissociated using Trypsin/EDTA and reseeded on gelatin-coated 6-well plates. Differentiation was observed over a 2-day period. For immunocytochemistry assays cells were trypsinized and seeded on 24-well plates coated with 0.1 % gelatin on day 7, 14 and 21. At the same time points RNA was extracted. Transdifferentiation of human dermal fibroblasts into limbal epithelial lineage {#s4_5} ------------------------------------------------------------------------------- Lentiviruses containing the transdifferentiation factors were independently produced by transfecting HEK293 cells (PEI) with vectors containing human ΔNp63α (kindly provided by Dr. Wendy Weinberg), TCF4, C/EBPδ (abmGood), Oct4 and Klf4, gag-pol plasmid pCMVΔR8.91 and VSV-G envelope plasmid pMDG in DMEM medium. 48, 72 and 96 h after transfection viral supernatants were collected, filtered through 0.45 μm low protein binding PVDF filters and concentrated by centrifugation at 4000 g for 1 h at 4°C using Amicon^®^ Ultra Centrifugal Filter Devices. For transdifferentiation 50,000 human dermal fibroblasts/well were seeded in 6-well plates in FibroGRO™ complete medium (Millipore) and infected on the next day with a mixture of viral concentrates (either without Klf4 or Oct4, with Klf4 or Oct4, or both) in the presence of 8 μg/ml polybrene. Two days post infection the medium was changed to EpiLife basal medium containing 1% human corneal growth supplements. 4 days post infection cells were seeded onto 0.1% gelatin-coated wells and morphological changes were observed. For the immunocytochemical analysis, cells were seeded in 24-well plates and analyzed on day 7 post infection. Immunocytochemistry {#s4_6} ------------------- The Immunocytochemistry has been performed similarly as described previously \[[@R52]\]. The medium in the tissue culture well was removed and cells were fixed with 4% PFA (Santa Cruz Biotechnology, Dallas, TX) for 20 min, permeabilized with 0.2% Triton X-100 (Sigma-Aldrich) for 20 min, blocked in 1% BSA (Sigma-Aldrich) for 1 h and incubated with primary antibody diluted in blocking solution (dilution 1:100 except anti-hSox2 dilution 1:20) overnight at 4°C. Cells were stained with their respective secondary antibody with conjugated fluorophore diluted in blocking solution for 1 h, counterstained with DAPI and treated with mounting medium. All incubation steps were done at room temperature except otherwise stated and in-between washing steps were conducted using PBS. To control for unspecific binding a negative control with just secondary antibody was done. Stained cells were observed using fluorescent microscopy (AxioVert.A1, Carl Zeiss Jena GmBH, Jena, Germany) and edited using ZEN imaging software. The fluorescence intensities were quantified using ImageJ software (available at <http://rsb.info.nih.gov/ij>; developed by Wayne Rasband, NIH). Primary antibodies used in this study {#s4_7} ------------------------------------- Rabbit anti-Oct4, mouse anti-Klf4, rabbit anti-Nanog (all Stemgent, Cambridge, MA), goat anti-hSox2 (R&D Systems, Minneapolis, MN), goat anti-ΔNp63 (N-16), rabbit anti-C/EBPδ (M-17), mouse anti-ITF-2 (C-1), goat anti-K12 (N-16), goat anti-K3 (Q-14) (all Santa Cruz Biotechnology), rabbit anti-c-myc, mouse anti-Pax6 (both Abcam, Cambridge, UK), mouse anti-ABCG2 (Abcam, Cambridge, UK). Secondary antibodies used were: Alexa-Fluor^®^ 488 goat anti-rabbit IgG (Molecular Probes, Eugene, OR), Alexa-Fluor^®^ 488 donkey anti-goat IgG (Abcam), FITC goat anti-mouse IgG (Sigma-Aldrich). RNA isolation, cDNA synthesis, RT-PCR & quantitative RT-PCR {#s4_8} ----------------------------------------------------------- The procedure was performed similarly as described previously \[[@R53]\]. Total RNA was obtained using the High Pure RNA Isolation Kit (Roche). Reverse transcription was performed using the Maxima^®^ First Strand cDNA Synthesis Kit for RT-qPCR (Fermentas, Burlington, Canada) according to the manufacturer\'s suggested protocol, and cDNA was used as a template for PCR or stored at −20°C. To check the successful infection of transgenes RT-PCR was performed using DreamTaq Green PCR Master Mix (Fermentas) and then subjected to 1.5% agarose gel electrophoresis. Quantitative RT-PCR was performed in the CFX96™ Real-time PCR system (BioRad, Hercules, CA) with the iQ™ SYBR^®^ Green Supermix (Bio-Rad) using specific primers (final concentration 0.5 μM; Invitrogen, Carlsbad, CA) listed in Table [3](#T3){ref-type="table"}. As an internal reference glucose-6-phosphate dehydrogenase (GAPDH) was used and undifferentiated iPS cells as calibrator to determine the relative quantities of gene expression in each sample. The thermocycling program was performed as follows: 1 cycle at 95°C for 3 min and 40 cycles at 95°C for 15 s and 45 s at primer-specific annealing/extension temperature, followed by a melt curve analysis to control the quality of all PCR products (no nonspecific amplification or primer-dimer was observed in any of the reactions.). Cycle threshold (C~T~) values were obtained from the logarithmic amplification phase and the relative quantification of each gene was calculated applying the 2^−ΔΔCt^ method \[[@R54]\]. All assays were run in triplicates of 3-5 biological samples for each time point of differentiation. ###### Specification of primers used for RT-qPCR Gene Primer sequence Annealing/Extension temperature (°C) ------------- -------------------------- -------------------------- -------------------------------------- Oct4 forward TCTCGCCCCCTCCAGGT 60 reverse GCCCCACTCCAACCTGG Klf4 forward CCGCTCCATTACCAAGAGCT 59 reverse ATCGTCTTCCCCTCTTTGGC Sox2 forward CGAGTGGAAACTTTTGTCGGA 59 reverse TGTGCAGCGCTCGCAG Nanog forward AGAAGGCCTCAGCACCTAC 57 reverse GGCCTGATTGTTCCAGGATT ΔNp63 forward CTGGAAAACAATGCCCAGAC 59 reverse GGGTGATGGAGAGAGAGCAT CK3 forward TTAAGGACCCTCTACGACGC 59 reverse AATGATGCTGTCCAGGTCCA CK12 forward TGGAGATTGAGACCTACCGC 59 reverse ACCATTCACCATCTCCTGCA Pax6 forward ATAACCTGCCTATGCAACCC 60 reverse GGAACTTGAACTGGAACTGAC C/EBPδ forward CCATGTACGACGACGAGA 60 reverse GCCTTGTGATTGCTGTTGAAGA TCF4 forward GTAGTGCCATGGAGGTACAGAC 60 reverse TGTCTGCTGAGGAGTGTGATG CK10 forward GGCTGACCTGGAGATGCAAAT 60 reverse GGGGCAGCATTCATTTCCACA ABCG2 forward GTGCACATGCTTGGTGGTCTTGTT 60 reverse AGCTCGGTCTTAACCAAAGGCTCA Connexin 43 forward GCGTGAGGAAAGTACCAAAC 60 reverse GGGCAACCTTGAGTTCTTCC GAPDH forward GTCAGTGGTGGACCTGACCT 57-60 reverse CACCACCCTGTTGCTGTAGC Statistical analysis {#s4_9} -------------------- Analysis of RT-qPCR was done in Microsoft Office Excel. All values are represented as mean ± SD. SUPPLEMENTARY FIGURES {#s5} ===================== We would like to thank Dr. Gunnar Kratz for providing human dermal fibroblasts, Dr. Wendy Weinberg for ΔNp63α plasmid and Dr. May Griffith for human corneal epithelial cells (HCEC) and human limbal stromal cells. We kindly acknowledge the support from GeCONiI (POIG.02.03.01-24-099/13) and from VR NanoVision (K2012-99X -22325-01-5). **CONFLICTS OF INTEREST** The authors declare no potential conflicts of interest. ABCG2 : ATP-binding cassette sub-family G member 2 C/EBPδ : gene for CCAAT/enhancer binding protein (C/EBP), delta CEBPD : CCAAT/enhancer binding protein (C/EBP), delta CK3 : cytokeratin 3 CK10 : cytokeratin 10 CK12 : cytokeratin 12 *c-myc* : a gene for c-Myc oncogenic transcription factor C~T~ : cycle threshold DAPI : 4′6-diamidino-2-phenylindol EDTA : ethylenediaminetetraacetic acid ES : embryonic stem cells FBS : fetal bovine serum GAPDH : glucose-6-phosphate dehydrogenase HCEC : human corneal epithelial cells HCGS : human corneal growth supplement HEK293 : human normal dermal fibroblasts iPS : induced pluripotent stem cells iPS diff. : differentiated iPS cells ITF2 : immunoglobulin transcription factor 2; basic helix-loop-helix protein *Klf4* : Kruppel-like factor 4 (gut); transcription factor LESCs : limbal epithelial stem cells Lin28 : lin-28 homolog A; gene encodes LIN-28 family RNA-binding protein LSC : limbal stem cell MEFs : mouse embryonic fibroblasts miRNAs : micro RNA, a small non-coding RNA molecule mitomycin C : {11-Amino-7-methoxy-12-methyl-10,13-dioxo-2,5-diazatetracyclo\[7.4.0.0^2,7^.0^4,6^\]trideca-1(9),11-dien-8-yl}methyl carbamate; an anticancer drug Nanog : nanog homeobox, a DNA binding homeobox transcription factor involved in embryonic stem cells (ES) proliferation, reneval and pluripotency *Oct4* : octamer-binding transcription factor 4 Pax6 : paired box gene 6 PBS : phosphate-buffered saline PCT : lentiviral cocktail containing ΔNp63, C/EBPδ and TCF4 lentiviruses PCTK : lentiviral cocktail containing PCT plus Klf4 PCTO : lentiviral cocktail containing PCT plus Oct4 PCTOK : lentiviral cocktail containing PCT plus Oct4 and Klf4 PEI : polyethylenimine PFA : paraformaldehyde PVDF filters : polyvinylidene fluoride filters quantitative RT-PCR : real time quantitative reverse transcription polymerase chain reaction RT-PCR : reverse transcription polymerase chain reaction *Sox2* : transcription factor, also known as SRY --box2 (sex determining region Y)-box 2 TCF4 : transcription factor 4 (immunoglobulin transcription factor 2; ITF-2) ΔNp63α : unique C-termini α isoform of tumor protein p63.

hey there i tried not to draw a couple on this time around sorry for all the couples when i think holidays i think love. so i think ships. anyways i hope you enjoy this 5th day. check out the speed drawing youtu.be/NDrLXfMcqBc

{{- if .Values.rbac.enabled }} apiVersion: rbac.authorization.k8s.io/v1 kind: RoleBinding metadata: name: {{ include "enmasse.fullname" . }}-address-space-controller labels: {{ include "enmasse.labels" . | indent 4 }} roleRef: apiGroup: rbac.authorization.k8s.io kind: Role name: {{ include "enmasse.fullname" . }}-address-space-controller subjects: - kind: ServiceAccount name: {{ include "enmasse.fullname" . }}-address-space-controller namespace: {{.Release.Namespace}} {{- end }}

Introduction ============ Pain is one of the major complaints of patients suffering from rheumatoid arthritis \[[@B1]\]. It is almost always present and it is the main reason for medical consultation \[[@B2]\]. Moreover, in the early stages of the disease, pain reflects the nociceptive effects of local inflammation and is often a prominent and persistent feature. However, pain is a personal subjective experience that varies quite dramatically among individuals in response to an apparently similar stimulus. In patients with chronic rheumatic diseases, such as RA, several methods for a quantitative assessment of pain can be used \[[@B3]-[@B7]\]; the most simple and reliable is the evaluation of subjective pain by visual analog scale (0--100 mm) \[[@B3]\]. This parameter is also included in the set of parameters to evaluate the American College of Rheumatology (ACR) improvement criteria of the disease \[[@B8]\]. Analyses of correlation between subjective pain score and the radiographic scores, clinical, psychological and functional parameters may differ according to the severity and the disease duration. Moreover, most of the studies are referred to RA patients with a disease duration of at least several years \[[@B9]-[@B16]\]. The aim of this cross sectional study was to evaluate the correlation between subjective pain score and the other clinical, radiographic and functional parameters or scores commonly used in early severe RA patients; in particular, to examine whether other variables might provide greater explanation of the variation in subjective pain score in these patients. Patients and Methods ==================== A total of 105 patients with a diagnosis of Rheumatoid Arthritis (RA) (according to the American College of Rheumatology criteria of 1987) \[[@B17]\] who were to be enrolled in a prospective trial comparing the effectiveness of several treatment strategies, were included in this study. All patients has a disease duration of less than 3 years, were older than 16 years, and were free from any other serious disease process. Demographic and clinical characteristic and treatment of the study patients are reported in table [1](#T1){ref-type="table"}. ###### Demographic and clinical characteristics and treatment of the study patients **N° of patients** 105 -------------------------------------------------------- --------------- **Age, years** 50.93 ± 10.72 **Female / Males** 76 / 29 **Disease duration, months** 15.86 ± 8.14 **RA test + / -** 71 / 34 **Severity of pain (VAS mm)** 61.65 ± 19.10 **Duration of morning stiffness (min)** 82.14 ± 49.45 **Swollen joints (no.)** 11.00 ± 5.83 **Tender joints (no.)** 14.24 ± 6.75 **HAQ (0--3)** 1.39 ± 0.59 **Assessment of patients\' disease activity (VAS mm)** 50.84 ± 21.03 **ESR (mm/1h)** 48.78 ± 20.00 **CRP (mg/dl)** 3.06 ± 1.97 **Larsen-Dale score (0--200)** 15.90 ± 13.97 **Concomitant use of:** • **NSAIDS, % of patients** 70.9% • **Systemic corticosteroids, % of patients** 50.5 % VAS: Visual Analogue Scale; ESR: Erythrocyte Sedimentation Rate; CRP: C Reactive Protein. HAQ: Health Assessment Questionnaire None of these patients had been previously treated with disease modifying antirheumatic drugs (DMARDs). A total of 50.5% patients were already treated with prednisone (median dosage 5 mg/day). Pain was assessed according to a 100-mm horizontal visual analog scale (VAS) (0 = no pain and 100 = most severe pain). The patients\' functional disability index was assessed according to Stanford Health Assessment Questionnaire (HAQ); the overall index reported here varies from 0 to 3, 0 being the best (no problem) and 3 being the worst score \[[@B18]\]. Other clinical variables included: number of tender and swollen joints (66/68 joints), duration of morning stiffness, patients\' general health assessed according to a 100-mm VAS; laboratory evaluation included erythrocyte sedimentation rate (ESR), C-reactive protein (CRP) and the titre of rheumatoid factor. Radiographic damage of the small joints was assessed according to Larsen-Dale score, ranging from 0--200 points \[[@B19]\]. Bivariate relations between pain score and disease activity, functional status and demographic variables were analyzed by calculating Spearman\'s correlation coefficient. Regression analysis was performed with pain score (VAS) as the dependent variable; independent variables included age, sex, serologic status (positive/negative), duration of disease, patients global assessment of disease, number of tender and swollen joints, morning stiffness, Larsen-Dale radiographic score, ESR and CRP. All statistical analyses were done with the SPSS/PC+ statistical package. P values less than 0.05 were considered statistically significant. Results ======= Patients\' characteristics -------------------------- The 105 patients had a mean duration of disease of 15.8 months (SD 8.14); the mean age of patients was 50.9 (SD 10.7). Table [1](#T1){ref-type="table"} further shows that 76 (67%) were female, and 71 (60 %) of the study population was positive for rheumatoid factor. Disease activity measure show this patient group to have rather active disease. Disability score (HAQ) indicate that functional capacity was significantly affected in this group of patients. Bivariate correlations ---------------------- Subjective pain score was correlated statistically significantly with ESR (r = 0.375, p \< 0.001). CRP (r = 0.296, p \< 0.001), HAQ (r = 0.421, p \< 0.001), global assessment of disease activity by patients (r = 0.573, p \< 0.001), morning stiffness (r = 0.427, p \< 0.001). No significant statistical correlation was observed between subjective pain scores and rheumatoid factor values (r = 0.068, p = 0.255), neither between pain scores and number of swollen (r = 0.050, p = 0.314) and tender joints (r = 0.037, p = 0.359), Larsen radiographic score (r = 0.055, p = 0.284), age (r = 0.040, p = 0.320), and disease duration (r = 0.074, p = 0.210). Multiple linear regression analysis ----------------------------------- In the multiple regression analysis (forward selection), the global assessment of disease by patients was the primary explanatory variable for the pain subjective score, accounting for 32.8% of the variation. Morning stiffness contributed only 10.7% to explaining the variation of the subjective pain score, CRP, HAQ and Larsen-Dale score contributed 4.0%, 3.8% and 2.1% respectively (Table [2](#T2){ref-type="table"}). ###### Explanatory variables for findings on subjective pain score, by multiple linear regression analysis (n = 105) **Explanation** ------------------------------------------ ----------------- ------- ------ ------- Global assessment of disease by patients 0.330 0.074 32.8 0.000 Morning stiffness 0.119 0.29 10.7 0.000 CRP 2.225 0.71 4.0 0.009 HAQ 6.472 2.506 3.8 0.010 Larsen-Dale score 0.203 0.101 2.1 0.048 Total 53.3 B: coefficient; SE: standard error. Discussion ========== In this present study, the primary observation is that subjective pain intensity (VAS) in early severe RA patients is significantly correlated with patients\' global health assessment, HAQ and laboratory parameters (ESR, CRP). Moreover, we observed a very strong correlation between pain and the duration of morning stiffness but no significant correlation with other common clinical variables used for RA patients evaluation such as number of swollen and tender joints, rheumatoid factor, or demographic variables such as age, sex or disease duration. The HAQ has been shown to be valid and reliable for the assessment of functional status in patients with RA, and it is the best variable for predicting work disability and mortality \[[@B20],[@B21]\]. Health global assessment by physician and patients are important clinical variables included in the ACR set criteria for evaluating disease improvement \[[@B9]\]. In the regression model, 53.3% of the variation of the subjective pain scores was explained by Health global assessment by patients, HAQ score, morning stiffness, CRP and Larsen-Dale radiographic score, while sex, age, and duration of disease, ESR and rheumatoid factor did not contribute statistically significantly to the model. It is likely that the lack of significance of certain variables in this model may be correlated with the duration and severity of the disease; on the other hand, patients global assessment of the disease and HAQ score are definitely influenced by motivational and psychological factors \[[@B22],[@B23]\]. In this study, however, psychological factors have not been assessed but they may explain part of the variance in subjective pain \[[@B24]-[@B26]\]. It has been suggested that anatomical damage of joints leads to functional declines in long-standing RA; this could be the reason why Larsen-Dale score poorly correlates with pain in early RA \[[@B27]-[@B30]\]. It is possible that dissociation between pain and clinical scores may reflect a relative preservation of joints and correlation may be higher with more extensive and permanent anatomical damage \[[@B31]-[@B33]\]. In conclusion our results confirm that subjective pain score is strongly associated with disability and health assessment indexes. These findings suggest that pain, at least in the early stage of the disease, reflects more the functional disability of the patients than the clinical extent or the early radiographic damage of the disease. Pre-publication history ======================= The pre-publication history for this paper can be accessed here: <http://www.biomedcentral.com/1471-2474/3/18/prepub>

In vivo and in vitro inhibition of pancreatic cancer growth by targeted alpha therapy using 213Bi-CHX.A"-C595. The aim of this study was to investigate the effect of targeted alpha therapy for the control of in vitro pancreatic cancer cell clusters and micrometastatic cancer lesions in vivo. The expression of tumor-associated antigen MUC-1 on three pancreatic cancer cell clusters and animal xenografts was detected by indirect immmunostaining. Monoclonal antibodies C595 (test) and A2 (non-specific control) were labeled with 213Bi using the chelator CHX.A" to form the alpha-immunoconjugate (AIC). Cell clusters were incubated with AIC and examined at 48 h. Apoptosis was documented using the TUNEL assay. In vivo, an antiproliferative effect for tumors was tested at two days post-subcutaneous cell inoculation. Mice were injected with different concentrations of AIC by regional or systemic administration. Changes in tumor progression were assessed by tumor size. MUC-1 is strongly expressed on CFPAC-1, PANC-1 and moderate expression was found CAPAN-1 cell clusters and tumor xenografts. The AICs can target and kill cancer cell clusters (100 mm) in vitro. Some 73-81 % of cells were TUNEL positive cells in the clusters after incubation with AIC. At two days post- cell inoculation in mice, a single local injection of 74 and 148 MBq/kg of AIC causes complete inhibition of tumor growth. Systemic injections of 111, 222 and 333 MBq/kg of AIC cause significant tumor growth delay after 16 weeks, compared with the nonspecific control providing 333 MBq/kg after 16 weeks. CFPAC-1, PANC-1 and CAPAN-1 pancreatic cancer cell clusters and pancreatic tumor xenografts show high expression of the MUC-1 target antigen. 213Bi-C595 can specifically target and regress pancreatic cancer cell clusters in vitro, and delay and inhibit tumor growth in vivo. 213Bi-C595 may be a useful agent for the treatment of micrometastatic pancreatic cancer with overexpression of MUC 1 antigen in post-surgical patients with minimal residual disease.

Q: Is it possible to find the current (x,y,z) of an element as it moves using translate3d(x,y,z)? Using CSS3s -webkit-transform: translate3d(x,y,z); is it possible to trace the (x,y,z) movement as it moves with javascript? Example: An object begins at (0,0,0) and we translate it to (4,4,0) over a 4sec duration. Theoretically, at the first sec the element should be placed at (1,1,0), while at the second sec the element should be at (2,2,0), etc.. Is there a way for Javascript to track the object? Retrieving the css property of translate3d(x,y,z) will just return the final translation coordinates. Which is to be expected as that what it is set to. A: If you are moving the element through CSS transitions then no, there is no way to tack the element. There are eventlisteners for transitionstart and transitionend only. If you are animating through javascript then yes, you can trace x,y,z through: node = document.getElementById("yourid"); //your animation loop console.log(window.getComputedStyle(node).webkitTransform); //this will return a string var curTransform = new WebKitCSSMatrix(window.getComputedStyle(node).webkitTransform); console.log(curTransfrom); //this will return an object //end animation loop

Mou Signing Ceremony ABG Interlinks Ltd. (Bangladesh) & J. S. Ventilation a.s. (Denmark) has recently signed MOU to set up a joint venture Ventilation & Cooling industry in Bangladesh. This was successfully done by the active coordination of the Embassy of Denmark.A show room is being set up in Dhaka for installation of a Demo unit of this special cooling system i.e “Cool Ceiling” which could be an appropriate solution for Bangladesh weather conditions.

// keygenerator.h : main header file for the KEYGENERATOR application // #if !defined(AFX_KEYGENERATOR_H__22CD5805_2CF6_11D9_A6F0_0060087D3389__INCLUDED_) #define AFX_KEYGENERATOR_H__22CD5805_2CF6_11D9_A6F0_0060087D3389__INCLUDED_ #if _MSC_VER > 1000 #pragma once #endif // _MSC_VER > 1000 #ifndef __AFXWIN_H__ #error include 'stdafx.h' before including this file for PCH #endif #include "resource.h" // main symbols ///////////////////////////////////////////////////////////////////////////// // CKeygeneratorApp: // See keygenerator.cpp for the implementation of this class // class CKeygeneratorApp : public CWinApp { public: CKeygeneratorApp(); // Overrides // ClassWizard generated virtual function overrides //{{AFX_VIRTUAL(CKeygeneratorApp) public: virtual BOOL InitInstance(); //}}AFX_VIRTUAL // Implementation //{{AFX_MSG(CKeygeneratorApp) // NOTE - the ClassWizard will add and remove member functions here. // DO NOT EDIT what you see in these blocks of generated code ! //}}AFX_MSG DECLARE_MESSAGE_MAP() }; ///////////////////////////////////////////////////////////////////////////// //{{AFX_INSERT_LOCATION}} // Microsoft Visual C++ will insert additional declarations immediately before the previous line. #endif // !defined(AFX_KEYGENERATOR_H__22CD5805_2CF6_11D9_A6F0_0060087D3389__INCLUDED_)

Egomaniacs Egomaniacs (also called narcissists) are individuals who suffer from narcissistic personality disorder. They have a delusional sence of self-worth and are NOT the same as an Arrogant Villain, though many people do confuse them - in simple terms an Egomaniac is obsessed with themselves and believes they should be the centre of attention, an object of worship/reverence and so forth. Many megalomaniacs are egomaniacal as they are certain attention-seekers.

<?xml version="1.0" encoding="ISO-8859-1" ?> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <meta http-equiv="Content-Type" content="text/html; charset=ISO-8859-1" /> <title>Eclipse Public License - Version 1.0</title> <style type="text/css"> body { size: 8.5in 11.0in; margin: 0.25in 0.5in 0.25in 0.5in; tab-interval: 0.5in; } p { margin-left: auto; margin-top: 0.5em; margin-bottom: 0.5em; } p.list { margin-left: 0.5in; margin-top: 0.05em; margin-bottom: 0.05em; } </style> </head> <body lang="EN-US"> <h2>Eclipse Public License - v 1.0</h2> <p>THE ACCOMPANYING PROGRAM IS PROVIDED UNDER THE TERMS OF THIS ECLIPSE PUBLIC LICENSE (&quot;AGREEMENT&quot;). ANY USE, REPRODUCTION OR DISTRIBUTION OF THE PROGRAM CONSTITUTES RECIPIENT'S ACCEPTANCE OF THIS AGREEMENT.</p> <p><b>1. DEFINITIONS</b></p> <p>&quot;Contribution&quot; means:</p> <p class="list">a) in the case of the initial Contributor, the initial code and documentation distributed under this Agreement, and</p> <p class="list">b) in the case of each subsequent Contributor:</p> <p class="list">i) changes to the Program, and</p> <p class="list">ii) additions to the Program;</p> <p class="list">where such changes and/or additions to the Program originate from and are distributed by that particular Contributor. A Contribution 'originates' from a Contributor if it was added to the Program by such Contributor itself or anyone acting on such Contributor's behalf. Contributions do not include additions to the Program which: (i) are separate modules of software distributed in conjunction with the Program under their own license agreement, and (ii) are not derivative works of the Program.</p> <p>&quot;Contributor&quot; means any person or entity that distributes the Program.</p> <p>&quot;Licensed Patents&quot; mean patent claims licensable by a Contributor which are necessarily infringed by the use or sale of its Contribution alone or when combined with the Program.</p> <p>&quot;Program&quot; means the Contributions distributed in accordance with this Agreement.</p> <p>&quot;Recipient&quot; means anyone who receives the Program under this Agreement, including all Contributors.</p> <p><b>2. GRANT OF RIGHTS</b></p> <p class="list">a) Subject to the terms of this Agreement, each Contributor hereby grants Recipient a non-exclusive, worldwide, royalty-free copyright license to reproduce, prepare derivative works of, publicly display, publicly perform, distribute and sublicense the Contribution of such Contributor, if any, and such derivative works, in source code and object code form.</p> <p class="list">b) Subject to the terms of this Agreement, each Contributor hereby grants Recipient a non-exclusive, worldwide, royalty-free patent license under Licensed Patents to make, use, sell, offer to sell, import and otherwise transfer the Contribution of such Contributor, if any, in source code and object code form. This patent license shall apply to the combination of the Contribution and the Program if, at the time the Contribution is added by the Contributor, such addition of the Contribution causes such combination to be covered by the Licensed Patents. The patent license shall not apply to any other combinations which include the Contribution. No hardware per se is licensed hereunder.</p> <p class="list">c) Recipient understands that although each Contributor grants the licenses to its Contributions set forth herein, no assurances are provided by any Contributor that the Program does not infringe the patent or other intellectual property rights of any other entity. Each Contributor disclaims any liability to Recipient for claims brought by any other entity based on infringement of intellectual property rights or otherwise. As a condition to exercising the rights and licenses granted hereunder, each Recipient hereby assumes sole responsibility to secure any other intellectual property rights needed, if any. For example, if a third party patent license is required to allow Recipient to distribute the Program, it is Recipient's responsibility to acquire that license before distributing the Program.</p> <p class="list">d) Each Contributor represents that to its knowledge it has sufficient copyright rights in its Contribution, if any, to grant the copyright license set forth in this Agreement.</p> <p><b>3. REQUIREMENTS</b></p> <p>A Contributor may choose to distribute the Program in object code form under its own license agreement, provided that:</p> <p class="list">a) it complies with the terms and conditions of this Agreement; and</p> <p class="list">b) its license agreement:</p> <p class="list">i) effectively disclaims on behalf of all Contributors all warranties and conditions, express and implied, including warranties or conditions of title and non-infringement, and implied warranties or conditions of merchantability and fitness for a particular purpose;</p> <p class="list">ii) effectively excludes on behalf of all Contributors all liability for damages, including direct, indirect, special, incidental and consequential damages, such as lost profits;</p> <p class="list">iii) states that any provisions which differ from this Agreement are offered by that Contributor alone and not by any other party; and</p> <p class="list">iv) states that source code for the Program is available from such Contributor, and informs licensees how to obtain it in a reasonable manner on or through a medium customarily used for software exchange.</p> <p>When the Program is made available in source code form:</p> <p class="list">a) it must be made available under this Agreement; and</p> <p class="list">b) a copy of this Agreement must be included with each copy of the Program.</p> <p>Contributors may not remove or alter any copyright notices contained within the Program.</p> <p>Each Contributor must identify itself as the originator of its Contribution, if any, in a manner that reasonably allows subsequent Recipients to identify the originator of the Contribution.</p> <p><b>4. COMMERCIAL DISTRIBUTION</b></p> <p>Commercial distributors of software may accept certain responsibilities with respect to end users, business partners and the like. While this license is intended to facilitate the commercial use of the Program, the Contributor who includes the Program in a commercial product offering should do so in a manner which does not create potential liability for other Contributors. Therefore, if a Contributor includes the Program in a commercial product offering, such Contributor (&quot;Commercial Contributor&quot;) hereby agrees to defend and indemnify every other Contributor (&quot;Indemnified Contributor&quot;) against any losses, damages and costs (collectively &quot;Losses&quot;) arising from claims, lawsuits and other legal actions brought by a third party against the Indemnified Contributor to the extent caused by the acts or omissions of such Commercial Contributor in connection with its distribution of the Program in a commercial product offering. The obligations in this section do not apply to any claims or Losses relating to any actual or alleged intellectual property infringement. In order to qualify, an Indemnified Contributor must: a) promptly notify the Commercial Contributor in writing of such claim, and b) allow the Commercial Contributor to control, and cooperate with the Commercial Contributor in, the defense and any related settlement negotiations. The Indemnified Contributor may participate in any such claim at its own expense.</p> <p>For example, a Contributor might include the Program in a commercial product offering, Product X. That Contributor is then a Commercial Contributor. If that Commercial Contributor then makes performance claims, or offers warranties related to Product X, those performance claims and warranties are such Commercial Contributor's responsibility alone. Under this section, the Commercial Contributor would have to defend claims against the other Contributors related to those performance claims and warranties, and if a court requires any other Contributor to pay any damages as a result, the Commercial Contributor must pay those damages.</p> <p><b>5. NO WARRANTY</b></p> <p>EXCEPT AS EXPRESSLY SET FORTH IN THIS AGREEMENT, THE PROGRAM IS PROVIDED ON AN &quot;AS IS&quot; BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, EITHER EXPRESS OR IMPLIED INCLUDING, WITHOUT LIMITATION, ANY WARRANTIES OR CONDITIONS OF TITLE, NON-INFRINGEMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Each Recipient is solely responsible for determining the appropriateness of using and distributing the Program and assumes all risks associated with its exercise of rights under this Agreement , including but not limited to the risks and costs of program errors, compliance with applicable laws, damage to or loss of data, programs or equipment, and unavailability or interruption of operations.</p> <p><b>6. DISCLAIMER OF LIABILITY</b></p> <p>EXCEPT AS EXPRESSLY SET FORTH IN THIS AGREEMENT, NEITHER RECIPIENT NOR ANY CONTRIBUTORS SHALL HAVE ANY LIABILITY FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING WITHOUT LIMITATION LOST PROFITS), HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OR DISTRIBUTION OF THE PROGRAM OR THE EXERCISE OF ANY RIGHTS GRANTED HEREUNDER, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGES.</p> <p><b>7. GENERAL</b></p> <p>If any provision of this Agreement is invalid or unenforceable under applicable law, it shall not affect the validity or enforceability of the remainder of the terms of this Agreement, and without further action by the parties hereto, such provision shall be reformed to the minimum extent necessary to make such provision valid and enforceable.</p> <p>If Recipient institutes patent litigation against any entity (including a cross-claim or counterclaim in a lawsuit) alleging that the Program itself (excluding combinations of the Program with other software or hardware) infringes such Recipient's patent(s), then such Recipient's rights granted under Section 2(b) shall terminate as of the date such litigation is filed.</p> <p>All Recipient's rights under this Agreement shall terminate if it fails to comply with any of the material terms or conditions of this Agreement and does not cure such failure in a reasonable period of time after becoming aware of such noncompliance. If all Recipient's rights under this Agreement terminate, Recipient agrees to cease use and distribution of the Program as soon as reasonably practicable. However, Recipient's obligations under this Agreement and any licenses granted by Recipient relating to the Program shall continue and survive.</p> <p>Everyone is permitted to copy and distribute copies of this Agreement, but in order to avoid inconsistency the Agreement is copyrighted and may only be modified in the following manner. The Agreement Steward reserves the right to publish new versions (including revisions) of this Agreement from time to time. No one other than the Agreement Steward has the right to modify this Agreement. The Eclipse Foundation is the initial Agreement Steward. The Eclipse Foundation may assign the responsibility to serve as the Agreement Steward to a suitable separate entity. Each new version of the Agreement will be given a distinguishing version number. The Program (including Contributions) may always be distributed subject to the version of the Agreement under which it was received. In addition, after a new version of the Agreement is published, Contributor may elect to distribute the Program (including its Contributions) under the new version. Except as expressly stated in Sections 2(a) and 2(b) above, Recipient receives no rights or licenses to the intellectual property of any Contributor under this Agreement, whether expressly, by implication, estoppel or otherwise. All rights in the Program not expressly granted under this Agreement are reserved.</p> <p>This Agreement is governed by the laws of the State of New York and the intellectual property laws of the United States of America. No party to this Agreement will bring a legal action under this Agreement more than one year after the cause of action arose. Each party waives its rights to a jury trial in any resulting litigation.</p> </body> </html>

AL HUDAYDAH, Yemen — Fighting raged Saturday around the international airport outside the Yemeni port of Al Hudaydah as fighters with a Saudi-led Arab coalition pressed their four-day-old offensive to seize the rebel-held city that is the gateway for food supplies to the famine-stricken country. Officials loyal to Yemen’s exiled government claimed their forces backed by the coalition had seized the airport, which lies just south of the city, and deployed engineers to clear explosives. But Iran-backed Houthi rebels launched a counteroffensive amid reports of heavy fighting at the airport gates and inside the sprawling compound, which has been closed since 2014. By Saturday afternoon, warplanes had struck Houthi targets on the edge of the city and fighting spread to a major road leading to the Houthi-held capital, Sana, blocking a key exit from the city. Hundreds of thousands of residents trapped in the city huddled in their homes, many wondering nervously if the fight will reach them. The battle for Al Hudaydah is shaping up to be the biggest and possibly most consequential of a war that started in 2015 when the Saudi-led coalition attacked the Houthis, who had seized the Yemeni capital a year earlier.

<?php namespace Victoire\Bundle\ViewReferenceBundle\ViewReference; class BusinessPageReference extends ViewReference { protected $entityId; protected $entityNamespace; protected $templateId; /** * @return mixed */ public function getEntityId() { return $this->entityId; } /** * @param mixed $entityId */ public function setEntityId($entityId) { $this->entityId = $entityId; } /** * @return mixed */ public function getEntityNamespace() { return $this->entityNamespace; } /** * @param mixed $entityNamespace */ public function setEntityNamespace($entityNamespace) { $this->entityNamespace = $entityNamespace; } /** * @return mixed */ public function getTemplateId() { return $this->templateId; } /** * @param mixed $templateId */ public function setTemplateId($templateId) { $this->templateId = $templateId; } }

The Last Podcast on the Left The Last Podcast on the Left is a weekly podcast on the Last Podcast Network featuring comedian and podcast host Ben Kissel, podcast producer and researcher Marcus Parks, and comedian and actor Henry Zebrowski (who joined in the third episode), all of whom are longtime friends. With a main episode released each Friday and a Side Stories episode released once a week, the episodes are generally one to two hours in length, with the hosts exploring the horrors of the world both imagined and real. Previous episodes have explored the topics of serial killers, conspiracy theories, UFO sightings, ghosts, and readings of fan-submitted creepypastas. Kissel, Parks, and Zebrowski tour with live performances of the podcast and produce The Last Stream on the Left, a live-streaming spin-off show on the Adult Swim website. Several repeat characters are present on the podcast, primarily voiced by Zebrowski, such as "Detective Popcorn" (the semi-erotic food-focused incompetent police detective), Charles Ng (a notorious serial killer), "Terry the Gnome,” and Minnie and Nannie Williams (victims of serial killer H. H. Holmes). The opening theme of the podcast features snippets from serial killers, such as Jeffrey Dahmer who utters the line, "That's when the cannibalism started." It also includes the line and subsequent advertisement transition "Rise from your grave!" uttered by Zeus from the Sega action game Altered Beast. The closing theme is Al Bowlly's "Midnight, the Stars and You,” a reference to The Shining. On November 19, 2019, it was announced that the show was moving exclusively to Spotify for ad sponsored episodes. In 2017, The Last Podcast on the Left received the People's Voice Webby in the Podcasts & Digital Audio (Comedy) category. In 2020, Houghton Mifflin Harcourt will release The Last Book on the Left, written by Kissel, Parks, and Zebrowski. Last Stream on the Left The Last Stream on the Left is a spin-off show hosted on the Adult Swim website. There are 6 seasons and a total of 106 episodes available on the Adult Swim website. Episodes List of Last Podcast on the Left episodes including Side Stories. References External links Category:Comedy and humor podcasts Category:Talk podcasts Category:Audio podcasts Category:Non-fiction works about serial killers Category:Crime podcasts Category:2011 podcast debuts Category:Horror podcasts

File Picture: U.S. President Donald Trump and Russia's President Vladimir Putin talk during the family photo session at the APEC Summit in Danang, Vietnam November 11, 2017. REUTERS/Jorge Silva WASHINGTON (Reuters) - U.S. President Donald Trump spoke on Tuesday with Russian President Vladimir Putin and the two leaders stressed the importance of the U.N.-led peace process in resolving the Syrian civil war, the White House said in a statement. In the more than hour-long phone call, Trump and Putin also agreed to explore ways to cooperate in the fight against militant groups such as Islamic State, the statement said. In addition, the two leaders discussed how to achieve peace in Ukraine and the need to keep pressure on North Korea to end its nuclear program, it said.

Le 11 octobre dernier sortait “Metal Galaxy”, nouvel albums du désormais duo japonais BABYMETAL. Résolument expérimental et éclectique, ce nouveau disque marque un tournant dans l’évolution sonore de BABYMETAL et délaisse quelque peu le kawaii metal. Pour son troisième passage dans l’Hexagone, le groupe s’offre un Élysée Montmartre plein à craquer ! True crime La soirée débute avec SKYND, le duo composé de la chanteuse du même nom et du producteur Father. Le concept est décrit comme une volonté de s’introduire dans les abysses de l’âme de tueurs en série afin d’atteindre les limites de l’humanité. Le tout sur un mélange d’électro et d’indus. La voix de la chanteuse Skynd est majoritairement modifiée à travers divers effets servant à instaurer ce climat angoissant et oppressant qui accompagne les histoires glaçantes évoquées dans les paroles. Il n’y a pas d’interaction avec le public, le groupe quitte la scène après une petite demi heure soit à peine le temps de se plonger dans son univers complexe. Da Da Dance 20h30 tapante, la salle est à nouveau plongée dans l’obscurité. Le premier titre “FUTURE METAL” extrait de l’album “Metal Galaxy” (2019) résonne sous les acclamations de la foule. Une cinématique est diffusée sur l’écran tandis que le Kami Band s’installe sur scène. On peut y voir Su-Metal et Moa-Metal se matérialiser telles des robots tandis que la voix de la chanteuse nous souhaite la bienvenue dans l’univers de BABYMETAL. Le groupe apparaît sur scène avec “DA DA DANCE”, Su et Moa étant accompagnées de Riho, ex-Morning Musume et Hello! Project. Cette dernière fait partie des “three avengers” remplaçant Yui-Metal qui a quitté le groupe en 2018. Su-Metal nous livre comme à son habitude une performance vocale sans accroc malgré les nombreuses notes hautes et une chorégraphie demandeuse. On enchaîne avec l’emblématique “Gimme Chocolate!!” qui a largement contribué à faire connaître le groupe sur la scène internationale. Le morceau est repris à tue-tête par l’auditoire qui n’hésite pas à reprendre certains pas de dance emblématiques. Lors du solo du Kami Band, la formation se rapproche de l’assemblée et Su-Metal échange même en français avec un parterre de fans conquis. C’est ensuite “Shanti Shanti Shanti” qui fait son retour sur la setlist, le titre étant une véritable fusion entre metal et musique traditionnelle indienne. Open the pit! L’intro de “BxMxC” résonne et la salle s’enflamme. Le morceau étant présent uniquement sur la version japonaise de “Metal Galaxy”, il est très surprenant de le voir jouer ce soir. Cependant, loin de nous l’idée de s’en plaindre ! Su-Metal délivre les paroles avec un flow d’une aisance déconcertante pour une artiste initialement formée au chant. L’instru tabasse, le pit s’en donne à cœur joie reprenant en choeur “B! M! C!”. S’en suit “Kagerou”, puis “Oh! MAJINAI” sur lequel figure Joakim Brodén (Sabaton) représenté en train de chanter ses parties sur l’écran en fond de scène. Le fameux masque de renard apparaît et c’est l’heure de “Megitsune”, autre titre essentiel de la discographie de BABYMETAL. L’Élysée Montmartre saute en rythme et reprend chaque “Sore!” de Moa-Metal qui est tout sourire face à une telle réaction. Il n’y a pas à dire, ce titre est réellement efficace en concert à tel point qu’il parvient même à réveiller les plus stoïques en fond de salle lorsque Su-Metal demande de sauter sur le dernier pré-refrain. Put your Kitsune up! On continue de sauter sur “PA PA YA!!” en featuring avec le rappeur Thaïlandais F.HERO et encore une fois l’auditoire donne du sien. C’est ensuite au tour de “Distortion” qui avait été présentée bien en amont de la sortie de “Metal Galaxy”, un autre morceau furieusement efficace dont seul BABYMETAL a le secret ! Une courte pause pour reprendre nos esprits et les premières notes de “KARATE” retentissent. L’audience est une nouvelle fois au rendez-vous pour soutenir les parties de Moa-Metal et les sing alongs du refrain. Retour nostalgique au premier album éponyme avec “Headbangeeeeerrrrr!!!!!” au plus grand plaisir des fans de la première heure. Le groupe quitte la scène afin de se préparer pour son rappel. Le trio reprend possession des lieux armé de ses drapeaux sur lesquels figurent le logo de la formation. Su-Metal réclame l’habituel wall of death et le pit ne tarde pas à s’exécuter. Autour de nous ça s’étonne “un wall of death ? Sur du BABYMETAL ?” et oui monsieur ! La demande prend en effet tout son sens lorsque les premiers riffs éclatent. Quel plaisir de pouvoir également entendre Moa-Metal chanter sans les effets studio ! Le groupe salue une ultime fois son public puis s’éclipse après une petite heure des plus intenses. See you! Une setlist sans faux pas, un groupe à l’énergie débordante et une Su-Metal au top de ses capacités vocales, de quoi faire de ce retour dans la capitale une date mémorable ! Riho s’est parfaitement intégrée au sein de la formation, à tel point qu’on aimerait bien la voir rejoindre celle-ci. Nous regrettons cependant un show assez court, bien que coutume habituelle de la formation, cela a surpris plusieurs personnes dans l’assemblée. Nous n’aurions pas refusé un petit “Ijime Dame Zettai”, ou même “Starlight” présente sur d’autres dates du “METAL GALAXY WORLD TOUR”. BABYMETAL sera sur la MainStage 1 lors de la 15ème édition du Hellfest le dimanche 21 juin prochain.

Q: Core Data: Strange faulting behavior when using lazy instantiation I have added a category to my NSManagedObject IBCompany, which should retrieve a specific time period, which is one of the IBCompany's relationships, based on a simple date comparison. When I run the following code, the NSArray sortedFinPeriodsDesc contains the faulted periods in the correct sorted order. However, when accessing them in the for each loop, each of the periods returns nil for its attributes, and in particular, nil for its EndDate. For this reason my method lastReportedPeriodforDate always returns nil, which is an error. #import "IBCompany+FinstatAccessors.h" @implementation IBCompany (FinstatAccessors) NSArray *sortedFinPeriodsDesc; - (IBFinPeriod*)lastReportedPeriodforDate:(NSDate*)date; { if ( !sortedFinPeriodsDesc ) { NSSortDescriptor *sortDescriptor = [NSSortDescriptor sortDescriptorWithKey:@"EndDate" ascending:NO]; sortedFinPeriodsDesc = [self.finperiod sortedArrayUsingDescriptors:[NSArray arrayWithObject:sortDescriptor]]; } IBFinPeriod *lastPeriod; for (IBFinPeriod *finPeriod in sortedFinPeriodsDesc) { if ( [finPeriod.EndDate compare:date] == NSOrderedAscending ){ // finPeriod.EndDate < date lastPeriod = finPeriod; break; } } return lastPeriod; } However, when replacing the first lines (lazy instantiation) in the method by removing the if clause and always instantiating and sorting NSArray sortedFinPeriodsDesc, the code works fine. Hence, I have a couple of questions: What is the error in my code? How does affect lazy instantiation faulting? Would you recommend defining the NSArray sortedFinPeriodsDesc as transient attribute and sorting it in awakeFromFetch instead? What would be the best option in your view? Thank you very much for your help! A: The "lazy loading" smacks of a premature optimisation. Particularly the way you've implemented it, you aren't actually using an instance variable, but a global variable (see here for details), meaning that each object isn't holding its own version of the array. I would suggest having the array local and generating it each time it is required. If this impacts performance, you can look at other methods, but even with the ivar problem above resolved, you are going to hit problems if the periods set is updated - your array is now out of date. You haven't said how many times your objects are being asked for this period, or how many objects, or how many periods, so it is difficult to give more specific advice. A fetched property might be a more efficient way of getting the period, but I don't have enough experience with them to help in your specific case.

Small-scale farmers throughout the tropics have long faced serious challenges. Many have struggled to secure access to nutritious food and good incomes. Climate change and ever dwindling natural resources make life even more difficult. However, with challenge comes opportunity. Dr. Ruben Echeverría, Director General of the International Center for Tropical Agriculture (CIAT), informs Food Tank that there is good reason to be hopeful about the problems facing tropical agriculture—and agricultural research has a large role to play. CIAT is based in Cali, Columbia, but they have projects in more than 50 countries. The institute works with small-scale farmers in low-income countries to improve food security, incomes, resilience, and natural resource management. To achieve their goals, CIAT develops new crop varieties, farming techniques, and technologies and disseminates them to farmers. CIAT also uses research, outreach, and policy engagement to help improve small-scale farmers livelihoods and integrate them into markets. In recent years, climate change resilience and sustainability have become top priorities for the organization. “Climate change is having a huge effect on tropical agriculture, and vice-versa,” Dr. Echeverría tells Food Tank. He elaborates, “we expect a significant reduction in the growth periods of most crops plus a dramatic increase in weather variability and extreme events like floods and drought.” Increased temperatures and unpredictable and extreme weather can lead to significant harvest losses. For this reason, CIAT and other agricultural research programs around the world have made a significant break from the past and refocused much of their efforts on building climate resilience. Climate resilience is the ability for farmers to endure and recover after shocks like hurricanes and droughts. Fortunately, Dr. Echeverría observes farmers are adapting much faster than he expected by changing agronomic techniques and demanding new technologies. While CIAT has long focused primarily on increasing the productivity and incomes of farmers throughout the tropics, they also have come to recognize the importance of sustainability. Indeed, the organization sees sustainability as vital for continued food production. As such, they research and promote sustainable intensification, an approach to agriculture that increases food production while minimizing impacts on the environment. For example, there are techniques that can address the devastating effects that growing meat demand is having on the environment. “A lot of research on this issue shows that there are sustainable tree-crop-livestock production systems that can reduce deforestation and land degradation,” Dr. Echeverría informs Food Tank. “Improved pastures, better rotations, more efficient livestock management techniques, and much more can help.” Another exciting trend in agricultural research is the use of big data. Scientists are now using extremely large sets of data collected on climate conditions, crop genetics, and other factors, such as soil type. They use this data to develop new farming technologies and develop forecasts to make planting recommendations. In 2017, CIAT launched the Big Data Platform to provide global leaders with open data, build collaborations, and demonstrate the power of big data analytics to enhance the impact of international agricultural research. “CIAT researchers continue to lead award-winning work demonstrating that big data and artificial intelligence have a key role to play in informing farmers’ decisions, helping them getting ahead of climate variability to produce more food, and make more income,” says Dr. Echeverría to Food Tank, referring to the recent awards that CIAT researchers won from the United Nations and Syngenta. Though the future of tropical agriculture holds promise, Dr. Echeverría underscores the need for more support for small-scale farmers and more research funding in important areas. International companies could do more to incorporate small-scale farmers in their value chains, and national research programs need to do more to support small-scale farmers. Similarly, Dr. Echeverría explained there is potential to expand the narrower focus of past agricultural research. Some researchers and activists have critiqued agricultural development programs for promoting cheap calories at the expense of a more diverse, nutritious food supply. However, Dr. Echeverría does not see it that way. He asserts to Food Tank that, “public international crop research has focused on the main cereals—rice, wheat, maize—because of their global importance in food security.” Still, he recognizes public agricultural research and donors to international agricultural could follow the lead of the private sector and extend funding to crops such as legumes, roots, tubers, and vegetables. Furthermore, Dr. Echeverría tells Food Tank that, “urbanization and globalization require a fresh look at what sustainable food systems would look like in the next three or four decades.” To make sustainable intensification a reality, Echeverría believes future investments in research will need to take these trends into account. So, what can those not involved in agricultural research do to support small-scale farmers and build sustainability in the food system? Dr. Echeverría thinks that there is a role for consumer choice and improved labeling of agricultural products. For example, large industrial plantations in the tropics use techniques that contribute to climate change and destroy the environment. With more comprehensive labeling, consumers could demand products that either come from small-scale farmers or plantations using more environmental practices. Join the Conversation:

Stretching over the River Thames since 1894, the famous Tower Bridge of London, England is one of the most recognizable landmarks in the world. Now you can add this timeless classic to your LEGO world buildings collection! Designed with advanced building techniques and rare colors and elements, the Tower Bridge is complete with its iconic paired towers and a drawbridge that really opens. Fun to build and display, it locks together solidly but can be taken apart in sections for easy transport. Includes 4 miniature vehicles; a black London taxi, a traditional red double-decker bus, a yellow truck and a green automobile. Completed model measures 40" (102 cm) long, 17" (45 cm) high and 10" (26 cm) wide.Includes 4 miniature vehicles: a black London taxi, a yellow truck, green automobile and even a traditional red double-decker bus! Features the iconic paired towers and a drawbridge that really opens and closes! Includes unique printed shield!Features hundreds of 1x1 slopes in tan! Many useful arches, angular bricks in tan! Includes 4 blue base plates and over 80 windows! Tower Bridge is ideal for building and display - it can be taken apart in sections for easy transport!

I was wondering if any of you musicians have dogs in your homes and if any problem arise when your playing I'm in the process of adopting a Border Collie or Brittany pup and am wondering how they will react to my kit I have a cat and she scurries upstairs as soon as i approach the kit i wonder if the dog will do the same? B-squared 06-02-2012 04:36 AM Re: Dogs & Drums I have 3 dogs and 2 cats. The cats just go in the other room when I okay. They are very curious about them. My dogs don't like to be near them when I play, but they don't mind my playing all that much. It's nothing like fireworks. In the summer when fireworks go off, even the ones launched 3 miles away, they whine and growl. They hate those. bermuda 06-02-2012 04:39 AM Re: Dogs & Drums We've had 4 dogs, and for some reason, they seem to come towards me when I play! One of them used to sing along (I'll guess that the harmonics of the ride & crash hurt her ears...) But, I'm pretty sure the volume isn't good for animals, I wouldn't make it a habit of locking them in the room while you practice. You can acclimate the new pet by playing quietly, and gauging the reaction. Then just act accordingly during future practices. Bermuda DrumEatDrum 06-02-2012 04:52 AM Re: Dogs & Drums My drums are in a studio room, separate from the rest of the house, and the dogs rarely, if ever, even want to go into the studio itself. Anon La Ply 06-02-2012 01:15 PM Re: Dogs & Drums The dog is not a fan. She just sits at the other end of the room and gives me reproachful stares. She's better than with the didgeridoo. The second I start playing she goes nuts, barking and attacking the end. I can't even imagine what her issue with it is because she was like that from day one. Skulmoski 06-02-2012 01:23 PM Re: Dogs & Drums My cat likes to come in the room when I play. It also has a bad habit of chewing my Slapklatz (similar to Moongel). GJS Liebe zeit 06-02-2012 03:59 PM Re: Dogs & Drums My dog (a border terrier) joins in, singing along to the drums. I hear him from the cellar sometimes. Usually he does it at the beginning of my practice then seems to get bored and wanders off. The funniest times have been when we've had band practice at my house and he's spontaneously started singing along to the full band. He also sings along to some tunes on CD/in the car etc. He's a big reggae fan http://www.youtube.com/watch?v=UUM0o...4&feature=plcp THC 06-02-2012 04:45 PM Re: Dogs & Drums When I play, my dog will almost always lay down and go to sleep with her head directly under the snare or the floor tom. I don't see how she can stand all the noise down there. When I'm playing at full volume, I wear headphones and feel weird about her being so close. I usually make her move across the room. Can't be good for her ears, but she doesn't seem to mind one bit. Richards1008 06-02-2012 08:34 PM Re: Dogs & Drums My cats are fascinated by my "drum room" (back of the house bedroom) Although I think its mostly due to the fact they are not usually allowed in there... (closed door, MUST mean something interesting) When they are in there, my one cat enjoys climbing through the port in the front bass drum head and lounging inside for a bit, which becomes problematic if I ever forget to check for him and start playing :-x Otherwise they stay outside and tolerate it, I think me not being in the same room but being in the house and them not being able to be with me bothers them more than anything, spoiled little buggers... larryace 06-02-2012 09:05 PM Re: Dogs & Drums Quote: Originally Posted by Liebe zeit (Post 1007310) My dog (a border terrier) joins in, singing along to the drums. I hear him from the cellar sometimes. Usually he does it at the beginning of my practice then seems to get bored and wanders off. The funniest times have been when we've had band practice at my house and he's spontaneously started singing along to the full band. He also sings along to some tunes on CD/in the car etc. He's a big reggae fan http://www.youtube.com/watch?v=UUM0o...4&feature=plcp Liebe, that was hilarious. But you are wrong that he's a big reggae fan. See I speak dog and what he's really saying is that Ringo would have been the better drummer for this song, hence the cries. How can you not hear that? lol - LZ, for the sake of posterity your terrier should be sampled - perhaps in a Chinese restaurant with sweet and sour sauce ... Ian Williams 06-03-2012 03:51 AM Re: Dogs & Drums My dogs prefer the actual drum sound. They hate cymbals! SticksEasy 06-03-2012 04:48 PM Re: Dogs & Drums We used to have a dog. She would come right up to me and try to get in my lap when I played. The rest of the time she would bark and run around the house. I'm sure it's something to do with the cymbal sounds. konaboy 06-03-2012 08:53 PM Re: Dogs & Drums My dog doesn't like the drums. when we first got her she would run down with me run between the stands sniff the bass drum beater then take off. Now she won't even go into the basement. She doesn't bark or anything when I play but I know she doesn't really like them. audiotech 06-04-2012 07:08 AM Re: Dogs & Drums As long as I'm downstairs in the studio and our Lhasa Apsos is upstairs, there is no problem. If for some reason she's downstairs before I start, she hurries upstairs to seclusion. She also has panic attacks when it thunders, so she doesn't care for loud sounds or vibrations. We had both a Shitzu and a Lhasa at the same time about ten years ago and they were pretty much the same way when it came to the drums. Dennis inneedofgrace 06-04-2012 05:40 PM Re: Dogs & Drums My dog does not like my mancave, where I have my drums. UNLESS I have food out there. Then she'll be there in a nanosecond, from any location in the house. JimmyTheMonkey 06-04-2012 06:07 PM Re: Dogs & Drums We have two dogs. Our Corgi doesn't even seem to notice when I play. Our Lab is simultaneously interested and afraid of the acoustic drums. He alternates between running in to checking out what the noise is and then running out in fright. He does this for the entire time I play. However, the Lab LOVES when I play e-drums. He will come up and rest his head on my bass drum leg and just sit there while I play. I am always afraid I will hit him with a stick but I try my best not to. NerfLad 06-04-2012 09:36 PM Re: Dogs & Drums 1 Attachment(s) I used to have a cat that loved drumsticks. Anytime he saw them he would do everything he could to get to them and switched between rolling them around on the floor and chewing on the tips. He was always mesmerized by the way they moved when I played. That was on an e-kit but when I brought acoustics into the house he didn't like the noise so he didn't watch me anymore. I want to say he got himself into that shirt on his own; don't really remember. He was a real character. Had to give him away because my sister was allergic :( topgun2021 06-05-2012 12:05 AM Re: Dogs & Drums My dog will grab my arm with his mouth and pull me away from the set as hard as he can. larryz 06-05-2012 03:42 PM Re: Dogs & Drums My cats aren't allowed in my drum room. But who knows, maybe they've tip-toed in there when I'm at work all day. Hmm..maybe my old white marine pearl snare wrap has "yellowed" for another reason.. NerfLad 06-05-2012 04:35 PM Re: Dogs & Drums Came home yesterday to a nice plop of cat poop right in the middle of my practice room. Doh! My rottie used to follow me downstairs to the basement when I would go down, but the minute I sat behind my kit, she would run upstairs and hide in the bathtub...she does the same thing with thunderstorms. I dont know what it was, but the low booms and stuff scared her, and made her hide in the bathtub.

Little Used Rule Gives Just 17 Republican Representatives the Power to Halt the Government Shutdown Because of a little used but perfectly valid procedural rule of the House of Representatives, just 17 GOP members of the House could end the federal government shutdown at any time. But because of the dire consequences for their political careers most observers agree it is unlikely to happen. The rule in question—No. XV of the House Rules—applies in situations where the Speaker of the House refuses to have an up-or-down vote on the House floor, as Speaker John Boehner (R-Ohio) is now doing with the Senate-passed continuing resolution that funds the government without delaying health reform. Boehner is applying the so-called “Hastert Rule,” a political principle (not a House rule) named after former Speaker Dennis Hastert (R-Illinois), that a Republican Speaker will not allow a bill to the floor if it is not supported by a majority of the Republicans in the House. Under Rule XV, however, if a majority of House members sign a “discharge petition,” Boehner would have to allow a vote. The House normally has 435 members, but deaths and resignations have dropped that number to 433, meaning that 217 members would need to sign the petition. Given that all 200 Democratic members would sign, only 17 Republican signatures would be needed to force a vote and end the shutdown. Although Capitol Hill insiders claim that as many as 175 GOP House members do not favor the shutdown, getting even 17 of them to sign a discharge petition may prove impossible, at least for a while. Historically speaking, party unity and discipline have meant that few members are willing to buck their party’s leadership on important issues. In fact, discharge petitions have been successful at getting legislation passed and signed only three times in U.S. history.

An air monitoring and met station at the site for the Piñon Ridge Mill. Site as viewed from the northwest. The Department of Energy already lists Piñon Ridge "under development" on its chart of U.S.uranium mills. The other four are: The Canon City Mill in Colorado, on standby. Cotter is owned by General Atomics in San Diego. Cotter President Amory Quinn says the company is looking at the possibility of someday re-opening the mill. "We're taking baby steps. But with uranium at $46/pound, it isn't economically feasible." Sweetwater Uranium Project in Wyoming, on standby. This mill was relatively new when it closed in 1983 and could re-open. Owner Rio Tinto of Australia failed to respond to a request for comment. Shootaring Canyon Mill, in Utah, is in the process of changing its license to operational. Uranium One Utah, Inc., owns Shootaring, also closed since the early 1980s, and the company vice president, Chris Sattler, says the company presently doesn't have enough resources in the region to keep its mill running profitably. Uranium One is instead concentrating on projects in Wyoming and Kazakhstan, which -- along with Russia, Australia, and Canada -- provide most of the world's uranium. Denison Mines' White Mesa Mill in Utah, 80 miles west of Piñon Ridge, has a monopoly but is not operating at full capacity, says CEO Ron Hochstein. Transportation costs from outlying mines are prohibitive, and uranium prices are too low, so processing uranium waste products from Canada and the U.S. -- also known as "alternate feed" -- helps keep the mill alive. More from Fortune Will Mmmhops be a hit? NBA confirms L.A. Clippers sale to ex-Microsoft CEO Steve Ballmer FBI and SEC probe into Carl Icahn and golfer Phil Mickelson NEW YORK (Fortune) -- With just one more permit from the State of Colorado, Energy Fuels Resources Corporation founder and CEO George Glasier can break ground for the first new U.S. uranium mill since the Cold War. Glasier's Piñon Ridge Mill, in Colorado's Paradox Valley, has been long in the making. EFR has spent nearly $9 million on development of the mill, with construction expected to cost another $130 million, possibly beginning in 2011. CH2M Hill has designed the computerized mill to process up to 1,000 tons of uranium daily, five pounds of uranium to the ton. The mill's design is so environmentally friendly and technologically advanced, there's nothing like it in the world, Glasier says. He's already talking to overseas customers: "The Chinese are acquiring uranium assets everywhere they can," he says. And here at home, he estimates that, in the country's clean energy future, electric utilities will generate enough need to boost uranium from its present $46 to a more robust $70 per pound. The Nuclear Regulatory Commission already has 22 applications for new nuclear plants nationwide; globally there are 53 new plants under construction and 436 operational. Though this is exactly the kind of project that might normally lead neighbors to say, "Not in my back yard," there's local precedent in Paradox Valley and throughout Montrose County. Union Carbide once ran a uranium mill nearby, which the Environmental Protection Agency later made one of its Superfund sites, spending $120 million to clean up hazardous materials there. Montrose County also supplied uranium for Madame Curie, the Manhattan Project, and Little Boy and Fat Man, the two bombs dropped on Hiroshima and Nagasaki, says local geologist Mike Thompson. It's definitely an area with a past. What's more, though Glasier is now a gentleman rancher, in his former life -- which included a series of uranium industry corporate counsel gigs in Denver -- he helped acquire properties for the White Mesa Mill in Utah, the last U.S. uranium mill constructed and the only mill currently operating. Then, 17 years ago, he left it all to build a herd of 1,000 Black Angus alongside western Colorado's San Miguel River, an area of flat valleys and red sandstone cliffs 60 miles northwest of Telluride and two hours from the nearest Wal-Mart. Which means, today, he's actually building this mill in his own community. With the door already open, Glasier has courted his community by speaking to business groups, holding a barbecue with live music in a local park, and giving tours of the blank building site. When the county awarded Glasier a land use permit in September, it was viewed as a vote of local confidence. "I'm considered a local," he says. He has served on the irrigation ditch company board, as town attorney (pro bono) for the 1,400-population Naturita (which has returned the favor by granting him back-up water rights for the proposed mill), and "helped put together a pretty good application for a job corps center." But jobs are elusive. With a 7.3% unemployment rate, nearly 1,000 county residents are out of work. "In a small town, you know them all," says Terri Tooker, Naturita Chamber of Commerce president. "The area certainly needs an economic boost." State economist Alexandra Hall agrees. But she also marvels at recent developments: "Our country has been through periods when it's been completely taboo to talk about adding nuclear power plants." The mill is expected to provide 85 jobs, and 200 more are likely to come from its mines. Calculating ripple effect, the Western Small Miners Association hopes for 1,392 new jobs total, from housing construction to schools. Many of Glasier's neighbors will likely be his employees, and nearly everyone has past ties to uranium. In 2008, Montrose County mineworkers averaged $55,927 annual pay, but local bloggers -- some the children of deceased uranium miners -- have alluded to the tradeoff of adequate income versus shortened lives. (Uranium workers here have had a cancer rate that's estimated to be five times higher than average.) There have been high-profile opposition efforts: Actress Daryl Hannah showed up at a hearing to denounce the proposed mill. And one anti-mill website lists 21 opposed organizations, including Sierra Club, Earth Justice, and Uranium Watch. But Colorado Governor Bill Ritter (D) says he believes a new mill can be safe, U.S. Senator Mark Udall (D-Co.) promises hawk-like vigilance, and Colorado's Department of Public Health and Environment anticipates taking 14 careful months to review EFR's mill application. The White House defers comment to the Department of Energy, which says, through spokesperson Jennifer Lee, "Unlike the first half of the 20th century, several federal and state agencies are actively involved in protecting uranium mill and mine workers and the public from potential harm: the EPA, NRC, NRC Agreement States, the Department of Labor Mines Safety and Health Administration, and the DOE." Many local residents, like Tomcat Mine owner John Reams, hope the permitting process moves quickly. Reams laid off 20 uranium miners from his Montrose County mine last month because Utah's White Mesa Mill stopped buying ore. So he welcomes the new mill. But he initially questioned if others would: "At first, we were wondering. We know the people doing it, but it was quite an obstacle to mount, to get the local people and get through the county." Glasier acknowledges a debt to his neighbors for trusting him this far, and he says they won't be sorry. "There's a 95% chance we'll get the license and build the mill," he says. "Credit's available; we have mines ready to go into production." Noting that the U.S. is the world's largest uranium consumer, while Russia is the main supplier, Glasier adds, "We've got to start producing uranium again."

import { BlockHandler } from "./block-handler"; export class InvalidGeneratorHandler extends BlockHandler {}