Datasets:

pszemraj
/

scientific_lay_summarisation-plos-norm

article stringlengths 4.26k 146k	summary stringlengths 31 3.31k	section_headings stringlengths 9 553	keywords stringlengths 0 1.24k	year stringclasses 13 values	title stringlengths 20 281	article_length int64 1.05k 36.8k	summary_length int64 14 689
Kidney function depends on the nephron, which comprises a blood filter, a tubule that is subdivided into functionally distinct segments, and a collecting duct. How these regions arise during development is poorly understood. The zebrafish pronephros consists of two linear nephrons that develop from the intermediate mesoderm along the length of the trunk. Here we show that, contrary to current dogma, these nephrons possess multiple proximal and distal tubule domains that resemble the organization of the mammalian nephron. We examined whether pronephric segmentation is mediated by retinoic acid (RA) and the caudal (cdx) transcription factors, which are known regulators of segmental identity during development. Inhibition of RA signaling resulted in a loss of the proximal segments and an expansion of the distal segments, while exogenous RA treatment induced proximal segment fates at the expense of distal fates. Loss of cdx function caused abrogation of distal segments, a posterior shift in the position of the pronephros, and alterations in the expression boundaries of raldh2 and cyp26a1, which encode enzymes that synthesize and degrade RA, respectively. These results suggest that the cdx genes act to localize the activity of RA along the axis, thereby determining where the pronephros forms. Consistent with this, the pronephric-positioning defect and the loss of distal tubule fate were rescued in embryos doubly-deficient for cdx and RA. These findings reveal a novel link between the RA and cdx pathways and provide a model for how pronephric nephrons are segmented and positioned along the embryonic axis. The kidney eliminates metabolic waste in the body using highly specialized structures called nephrons. Individual nephrons are composed of a blood filter (renal corpuscle), a tubule that recovers or secretes solutes, and a collecting duct [1]. The renal corpuscle contains epithelial cells called podocytes that form the slit-diaphragm filtration barrier and allow collection of substances from the blood [2]. In a number of vertebrate species, including some mammals, the renal corpuscle is connected to the tubule by a short stretch of ciliated epithelium called the neck segment that guides filtrate entry into the tubule [3–5]. The mammalian nephron tubule is subdivided into a series of proximal and distal segments connected to a collecting duct [1,6]. The polarized epithelial cells in the tubule segments have a unique ultrastructure and express a select cohort of solute transporters [1]. Thus, each segment is functionally distinct and performs the transport of particular solutes that are required for proper renal function. In higher vertebrates, three kidneys of increasing complexity arise sequentially from the intermediate mesoderm (IM): the pronephros, the mesonephros, and the metanephros [7]. The pronephros and mesonephros degenerate in succession, with the metanephros serving as the adult kidney. Lower vertebrates, such as fish and amphibians, develop a pronephros during embryonic stages, and then form a mesonephros that will be used throughout their adult life [8–10]. Each of these kidneys contains the nephron as its basic functional unit [8]. To date, much of our knowledge of kidney development has come from gene-targeting studies in the mouse [7,11,12]. These experiments have identified a number of genes that play essential roles in the early stages of metanephros development, but there is a limited understanding of the molecular pathways governing the later stages of kidney ontogeny, when individual nephrons form and become segmented [7]. The zebrafish is an ideal genetic and developmental model system for dissecting the molecular mechanisms of nephron formation because of the anatomical simplicity of the pronephros, which contains two nephrons as opposed to the thousands of nephrons in a mammalian metanephros [9]. During zebrafish development, bilateral stripes of IM lying on either side of the trunk undergo a mesenchymal-to-epithelial transition to form the pair of pronephric nephrons. The anteriormost renal progenitors differentiate into podocytes, which migrate medially and fuse at the midline to form a single renal corpuscle. The nephrons also fuse posteriorly at the cloaca to form a shared exitway. From a functional standpoint, these pronephric nephrons have been thought to consist of three parts: (1) the blood-filtering renal corpuscle, (2) a very short tubule region that transports solutes, and (3) long pronephric ducts that convey the resulting waste to the cloaca [9]. Contrary to this model, recent studies have suggested that the ‘duct' region possesses regional segmentation, based on the restricted expression boundaries of solute transporter orthologues known to be expressed in the tubule segments of metanephric nephrons. For example, a rostral stretch of the pronephric duct expresses the endocytic receptor megalin (lrp2) [13] and the sodium bicarbonate transporter NBC1 (slc4a4) [14], which are expressed in the proximal tubule in mammals. These reports raise the possibility that portions of the pronephros considered to be duct might in fact be tubule, thus suggesting that the organization of the zebrafish pronephros is more complex than previously appreciated. However, a complete model of the molecular anatomy of the zebrafish pronephros and whether there is a functional correlation to the segments of the mammalian nephron remain unclear. Furthermore, the pathway (s) directing segmentation of the pronephros along the embryonic axis are unknown. Numerous factors are known to control segmental patterning along the anterior-posterior (A-P) axis during vertebrate development and thus provide candidate pathways that might act to establish pronephros segmentation. Retinoic acid (RA) signaling is vital for directing the A-P regionalization of tissues deriving from all three germ layers, such as the hindbrain, paraxial mesoderm, and gut [15–19]. Control of RA production via retinaldehyde dehydrogenase (RALDH) synthesizing enzymes [20] and the degradation of RA via the CYP26 catabolizing enzymes establishes both the location and timing of RA signaling [21,22]. In addition to RA, the caudal (cdx) transcription factors (Cdx1, Cdx2, and Cdx4 in mammals and cdx1a and cdx4 in zebrafish) are responsible for determining vertebral identity and directing posterior body formation [23–31]. cdx genes are known to act as master regulators of the homeobox (hox) transcription factors [25], and in turn, overlapping domains of hox gene expression along the A-P axis are thought to confer segmental identities [32]. In mice, loss of Cdx function causes posterior shifts in Hox gene expression that are associated with abnormal vertebral patterning, and posterior truncations due to defects in the extension of the embryo axis [23,25–27,33]. Similarly, studies in zebrafish have shown that the loss of cdx4 function or deficiency of both cdx1a and cdx4 causes shifts in hox gene expression domains, a shortened body axis, and altered patterning of the blood, vascular, and neural tissues [24,28–31]. These lines of evidence indicate that the cdx genes play essential roles in controlling cell fates along the embryonic axis; however, the molecular mechanisms underlying these effects have not been elucidated [34]. In this study, we undertook a functional genomics approach to identify new markers of the zebrafish pronephros. From this analysis, we found that the pronephros is composed of at least eight regions, including two proximal and two distal tubule segments. We explored how segmental identity is controlled during nephrogenesis by testing the roles of RA signaling and the cdx genes. We found that RA is required to induce proximal segment fates and prevent the expansion of distal segment fates, whereas the cdx genes are necessary for positioning the pronephros along the embryonic axis. Embryos deficient in cdx1a and cdx4 displayed a posterior shift in the location of the pronephros and formed proximal but not distal nephron segments. The cdx genes were found to control the expression boundaries of raldh2 (aldh1a2) and cyp26a1, suggesting a model in which the cdx pathway influences where the pronephros forms along the body axis by localizing the source of RA, while subsequent RA signaling acts to direct the segmentation of the pronephros. To gain insight into the molecular mechanisms that control vertebrate renal development, we undertook a functional genomics approach to identify genes expressed in the kidney. We mined two gene collections, one comprising developmentally expressed genes from embryonic zebrafish cDNA libraries [35] and another compiled from an adult zebrafish kidney library [36]. Gene expression patterns were analyzed by whole-mount in situ hybridization using wild-type zebrafish embryos between the 5 somite stage and 144 hours post fertilization (hpf). We identified a number of genes, including 15 solute transporters, that were expressed within specific subregions of the pronephros. In total, eight distinct regions could be visualized, with some genes expressed in more than one region (Figure 1A). Representative examples of region-specific genes include wt1b, slc20a1a, trpm7, slc12a1, stc1, slc12a3, and gata3, as compared to expression of cdh17, which is found in all tubule and duct progenitors [37] (Figure 1A). We investigated where the mouse or human orthologues of some of these genes are expressed in the mammalian metanephric kidney, and found that many corresponded to segment-specific domains within the nephron. For example, Slc9a3 is expressed in podocytes, the proximal convoluted segment (PCT) and proximal straight segment (PST) (Figure 1B) [38]. Slc20a1 is expressed throughout the entire nephron epithelium, although stronger expression was observed in proximal tubule segments (Figure 1B). Transcripts for Slc13a3 are found in the PST [39], while Slc12a1 is restricted to the thick ascending limb (TAL) and macula densa (MD) (Figure 1B) [40,41]. Slc12a3 is expressed in the distal convoluted tubule (DCT) (Figure 1B) [41]. Lastly, GATA-3 expression specifically marks the collecting ducts (CD) (Figure 1B) [42,43]. Based on this cross-species gene expression comparison, the following identities were assigned to the zebrafish pronephros segments we observed (going from proximal to distal): podocytes (pod), neck (N), PCT, PST, distal early (DE), corpuscle of Stannius (CS), distal late (DL), and the pronephric duct (PD) (Figure 1A and 1E). Our division of PCT and PST within the tubule is based on the observation that the slc20a1a-expressing PCT cells undergo morphogenesis from a linear tube into a coiled structure by 5 days post-fertilization (dpf), while the trpm7- and slc13a1-expressing PST segment maintains a linear structure (Figure 1C). Expression of trpm7 and slc13a1 is discontinuous within the PST, an observation that has been shown recently to reflect the presence of two cell types in this region: transporting epithelia and multiciliated cells [44,45]. The renal corpuscle connects to the PCT via a short segment of cells that express the transcription factor rfx2, and fails to express almost all of our PCT solute transporters (Figure 1D). As rfx2 marks ciliated cells and rfx genes are essential regulators of ciliogenesis [46,47], we hypothesize that this region corresponds to the ciliated neck segment found in other fish species as well as mammals [3–5]. However, a more detailed analysis is needed to confirm this hypothesis. In addition to the neck segment, rfx2 expression was also detected in presumptive ciliated cells along the length of the PST and DE segments, as described previously [44,45]. For the distal tubule, we adopted the DE/DL nomenclature used in Xenopus [48], although the zebrafish DE appears analogous to the TAL segment in mammals and the DL appears analogous to the mammalian DCT segment according to our gene expression comparison. We included the CS as a discrete segment, as it initially arises from the tubular progenitors within the pronephros, but by 48 hpf, it is located just dorsal to the DE/DL boundary [49,50] (unpublished data). The DL segment expresses slc12a3 and connects to the cloaca via a short segment that expresses gata3 and likely represents the PD. Our data are consistent with the notion that the zebrafish pronephric kidney resembles a ‘stretched-out”' mammalian nephron, and suggests that rather than being composed of mostly nephric duct (as currently believed), it is made up of extensive proximal and distal tubule epithelium (Figure 1E). Between 24 and 48 hpf (the start of blood filtration), the pronephros undergoes significant morphogenesis, including the midline migration of podocytes and the growth/extension of the tubules [9]. In order to better quantitate these morphological changes, as well as to precisely define the anatomical boundaries of each segment, we mapped the expression domains of segment-specific markers relative to the somites by performing double whole-mount in situ hybridization with myosin heavy chain (mhc) at 24 and 48 hpf (Figures 2 and S1–S4). At 24 hpf, podocyte and neck progenitors are arranged in a slight curve at the level of somite 3–4 with the anterior boundary of the PCT level with somite 5 (Figures 2 and S1). By 48 hpf, the podocyte progenitors have fused at the midline (level with somite 3) with the presumptive neck region forming a lateral extension that connects with the PCT also situated at the level of somite 3 (Figures 2 and S3). During this time, the length of the PCT, PST, and DE segments increased, possibly due to cell division within each segment (Figure 2 and S1–S4). This growth may provide the driving force that is responsible for the shift in the anterior boundary of the PCT from somite 5 to somite 3 between 24 and 48 hpf, and for the coiling morphogenesis of the PCT observed between 72 and 144 hpf (Figure 1C). However, the DL segment did not increase in length between 24 and 48 hpf, indicating that there is not a uniform expansion in all segments during development. During juvenile development (2–3 wk post-fertilization) the DL segment is proportionately larger than the other segments, suggesting that its expansion predominates at later stages of development (unpublished data). Interestingly, at 24 hpf, we observed an overlap of the DL and PD expression domains at the level of somite 17 (Figure 2 and Figure S2). This overlap may indicate the presence of an additional segment (such as a discrete CNT equivalent), though to date we have not discovered any genes expressed solely in this domain. In addition to mapping the morphological changes that occur between 24 and 48 hpf, we also noted segment specific changes in gene expression patterns during this time. For example, transcripts for the solute transporters slc13a1 (inorganic sulphate transporter), slc13a3 (sodium-dicarboxylate carrier), and slc22a6 (organic anion transporter) were all absent from the PST segment at 24 hpf but were found expressed at 48 hpf (Figures 2 and S3; and unpublished data). Similarly, transcripts for trpm7 (divalent cation-selective ion channel) and slc41a1 (Mg 2+ transporter) were not found in cells of the CS at 24 hpf but could be detected at 48 hpf (Figure 2 and unpublished data). The up-regulation of these genes likely reflects the maturation/differentiation of the segment epithelia before the onset of blood filtration, which begins around 40 hpf [51,52]. However, the glomerulus does not fully mature until 4 dpf, based on the size exclusion of different-sized fluorescent dextrans [53]. Further profiling of segment expression patterns at later stages is needed to investigate whether the maturation of the transporting epithelial is also an ongoing process. We next sought to characterize the developmental pathways that establish the segmentation pattern of the pronephros. Retinoic acid (RA) is essential for the development of numerous tissues during embryogenesis [25]. In vertebrates, a gradient of RA in the upper trunk is responsible for directing the A-P patterning of the hindbrain into segmental compartments [15,54], and gain or loss of RA also affects vertebral identity [25]. Interestingly, RA has been reported to regulate pronephros formation in Xenopus [55]. To explore whether RA was needed for pronephros segmentation, we injected wild-type zebrafish embryos with a morpholino to retinaldehyde dehydrogenase 2 (raldh2), which encodes an enzyme required to produce RA [20]. We then examined raldh2 morphants at 48 hpf with our panel of segment-specific markers, in combination with mhc expression to map segment length and location relative to the somites. Embryos deficient in raldh2 had fewer podocytes, as evidenced by punctate staining of the podocyte markers wt1b, wt1a, and mafb (Figure 3A and unpublished data). Both proximal tubule segments were slightly shortened, based on the reduced expression domains of slc20a1a (PCT) and trpm7 (PST) (Figure 3). Conversely, the distal tubule was expanded in length, with the clck transporter (marking both the DE and DL) expressed in a greater proportion of the cdh17-positive pronephric tubule (note that the overall length of raldh2 morphants is reduced compared to wild-type) (Figure 3). Each segment within the distal tubule was moderately expanded, with a lengthened DE shown by expanded slc12a1 expression, enlarged clusters of stc1-expressing cells that comprise the CS, and lengthened DL shown by slc12a3 expression (Figure 3). The expression domain of gata3 (PD) was also expanded (Figure 3). In contrast, the cloaca marker aqp3 was unchanged (Figure 3A). These data suggest that RA signaling is necessary for podocyte formation and/or survival, as well as for establishing the normal pattern of nephron segmentation. Multiple enzymes are capable of synthesizing RA and a recent analysis of the neckless (nls) (now called aldh1a2) mutant, which is defective in raldh2, demonstrated that there are additional sources of raldh-like enzyme activity in the zebrafish embryo [56–58]. Based on this, we hypothesized that the nephron phenotype in raldh2 morphants represented the effect of reducing RA production, rather than a complete inhibition. To more fully block RA signaling, we utilized a competitive, reversible inhibitor of raldh enzymes, 4-diethylaminobenzaldehyde (DEAB) [59], which has been used to effectively prevent de novo RA synthesis in zebrafish embryos [58,60]. Wild-type embryos were treated with DEAB starting at 60% epiboly (early gastrula) until the 15 somite stage, and nephron segmentation was assayed at 48 hpf by double whole-mount in situ hybridization using mhc expression to mark the somites. Expression of the podocyte markers wt1b, wt1a, and mafb was absent in DEAB-treated embryos, suggesting that podocyte development was completely blocked (Figure 3 and unpublished data). Expression of the PCT and PST markers slc20a1a and trpm7 was also absent, suggesting that these segments had failed to be specified (Figure 3). In contrast, clck expression (marking the DE and DL segments) was dramatically expanded, such that it was present throughout the entire tubule territory (Figure 3). These findings suggest that the pronephric tubule adopts a distal tubule identity when RA synthesis is inhibited. Within this ‘distal-only' pronephros, the DE marker slc12a1 was expressed from the anterior limit of the tubule to almost the middle of its length, the DL marker slc12a3 was expressed from the middle of the tubule to near its posterior limit, and the PD marker gata3 was expanded by an additional four somite lengths (Figure 3). A marked expansion of stc1-expressing cells was also detected, with multiple clusters of cells arranged in bilateral stripes, as opposed to the small groups of stc1-expressing cells seen in wild-type embryos (Figure 3). Expression of aqp3 was not altered, suggesting that progenitors of the cloaca are unaffected by the inhibition of RA production over this developmental interval (Figure 3). It is not known if the observed DEAB phenotype represents a full loss of RA signaling, as trace amounts of maternal RA have been detected in the yolk [61] and as zygotic raldh2 transcripts are expressed prior to 60% epiboly [56,57]. Nevertheless, our results demonstrate that RA, produced by raldh2 and possibly one or more unknown raldh enzymes, plays an essential role in the formation of proximal nephron fates (podocytes, PCT, PST) and in suppressing the expansion of distal fates (DE, CS, DL, PD). To determine more precisely when RA signaling was needed for the development of proximal segment fates, we performed a DEAB timecourse experiment (Figure 3). Blocking RA signaling from 90% epiboly (late gastrula) to the 5 somite stage caused a milder phenotype than the longer 60%- 15-somite exposure that was characterized by a loss of podocytes, reduced lengths of the PCT and PST segments, and small increases in the lengths of the distal segments (Figure 3). A slightly longer DEAB treatment, from 90% epiboly to the 10 somite stage, expanded distal segments further than the raldh2 morphants or DEAB 90% epiboly-5 somite treated embryos (Figure 3). In addition, examination of the slc20a1a and trpm7 expression patterns showed that the PST segment was ablated, while the PCT was only slightly shortened (Figure 3). Loss of PST identity was also confirmed by the absence of slc13a1 and slc22a6 transcripts, which are additional PST markers (Figure 2 and unpublished data). These findings suggest that, at least for this DEAB time window, the expansion of distal fates occurs at the expense of the PST segment. Finally, we tested whether DEAB treatment during somitogenesis would affect pronephros segmentation. DEAB treatment from 5–15 somites or 10–15 somites had no effect on the segmentation pattern of the pronephros (unpublished data), thus suggesting that an inhibition of RA signaling must be initiated prior to the 5 somite stage in order to affect nephron patterning. Taken together, our DEAB timecourse data indicate that RA signaling is required to induce proximal nephron fates and to prevent an expansion of distal fates, thereby establishing the normal pronephric segmentation pattern. Interestingly, our data suggest that different segments have different temporal requirements for RA signaling. RA is essential between 90% epiboly and the 5 somite stage to induce podocytes, between 90% epiboly and 10 somites to induce PST formation, and between 60% epiboly and 15 somites to form the PCT. The PCT segment is the most refractory to RA inhibition and is only lost following the longest DEAB treatment window (60% epiboly to 15 somites). Given these findings, we tested whether increasing the concentration of RA by exogenous treatment would promote proximal nephron fates at the expense of distal fates. We exposed wild-type zebrafish embryos to RA during similar developmental intervals used for our DEAB experiments, and then assayed segment marker expression at 24 hpf by double in situ hybridization with mhc to mark the somites. Wild-type embryos treated with 1 × 10−7 M RA between 90% epiboly and 5 somites developed a normal number of podocytes, as evidenced by wt1b expression, but displayed expanded proximal tubule domains, shown by expression of slc9a3 (marking both the PCT and PST), slc20a1a (PCT), and trpm7 (PST) (Figure 4). Conversely, the clck-expressing distal tubule domain was reduced, due to reductions in the length of the DL (marked by slc12a3) and PD (marked by gata3) (Figure 4). However, the DE segment (marked by slc12a1) was unaffected (Figure 4). The position of the stc1-expressing CS segment cells was shifted posteriorly, and the level of expression was slightly reduced (Figure 4). A longer treatment window, from 60% epiboly–15 somites resulted in a more severe ‘proximalized' phenotype with a longer expanse of proximal tubule and a greater reduction in each distal tubule domain (Figure 4). In these embryos, the position of the stc1-expressing CS population was shifted even more posteriorly, and was located at the distal edge of the yolk sac extension (Figure 4A). We next treated wild-type embryos with higher dose of RA (1 × 10−6 M) over this same 60% epiboly–15 somites time window, as well as two shorter time periods: 60% epiboly–5 somites, and 90% epiboly–5 somites. Embryos treated for any of these time windows displayed a completely ‘proximalized' phenotype with the tubule domain being comprised entirely of proximal segment identities (Figure 4 and unpublished data). In these embryos, the proximal marker slc9a3 was expressed throughout the cdh17-expressing tubule population (Figure 4 and unpublished data). Within this ‘proximal-only' pronephros, the PCT marker slc20a1a was expressed from the anterior limit of the tubule to somite 13, and the PST marker trpm7 was expressed from somite 14 to the posterior limit of the tubule, where the trpm7-expressing tubules fused at the prospective site of the cloaca (Figure 4 and unpublished data). Expression of all distal segment markers was absent, suggesting that the DE, CS, DL, and PD had failed to be specified (Figure 4 and unpublished data). These results show that exogenous RA treatment from gastrulation stages until the 5 somite stage is sufficient to ‘proximalize' the pronephros, suggesting that this time period is the critical window when RA signaling is required for proximo-distal patterning of pronephric progenitors. To further explore the notion that RA alters the patterning of renal progenitors prior to the 5 somite stage, we examined the expression patterns of the Notch ligands deltaC (dlc) and jagged2a (jag2a), and the renal transcription factors wt1a, pax2a, pax8, and evi1, as these genes are detected in the IM during early somitogenesis and have been implicated in early nephron patterning [44,62–64]. Wild-type embryos were treated with DMSO, DEAB, or 1 × 10−6 M RA from 60% epiboly until the 6 somite stage, and then IM gene expression was assayed by whole-mount double in situ hybridization together with myoD to mark the somites. Transcripts for pax2a and pax8, which label all pronephric progenitors, were found throughout the IM domain in a similar pattern in wild-type, DEAB-treated, and RA-treated embryos (Figure S5). Consistent with our previous results, wt1a expression was absent in DEAB-treated embryos, and wt1a was strongly up-regulated in RA-treated embryos (Figure S5). The expression domains of deltaC and jag2a, normally restricted to a proximal region of the IM adjacent to somites 2–5, were absent in DEAB-treated embryos, and expanded posteriorly in RA-treated embryos (Figure S5). Expression of evi1, found in the distal portion of the IM starting around somite 6, was shifted anteriorly to somite 3 following DEAB treatment and reduced to the most posterior group of IM cells following RA treatment (Figure S5). These findings demonstrate that changes in RA dosage during gastrulation to early somitogenesis are associated with gene expression changes in IM progenitors, far in advance of their mesenchymal-to-epithelial transition that creates the pronephric tubules. In addition to RA, multiple tissues along the embryonic axis are segmentally patterned by the cdx genes [25,34]. Loss of cdx gene function leads to an expansion of anterior trunk fates and axial elongation defects that result in a loss/truncation of the posterior trunk and tail [23–30,34]. In zebrafish, cdx4–/– mutant embryos display expanded wt1a expression at the 15-somite stage, suggesting that the podocyte lineage might be expanded and thus implicating cdx genes in pronephros patterning [24]. We therefore examined the formation of the pronephros in cdx4–/– and cdx1a/4-deficient (herein referred to as cdx-deficient) to assess development of the renal corpuscle, tubule, and pronephric duct. In addition, we used differential interference contrast (DIC) optics to visualize the somite boundaries and determine the size and position of each segment relative to the somites. It is important to note that the size of posterior somites in cdx4–/– embryos, and both the size and number of the somites in cdx-deficient embryos, is greatly reduced toward the posterior, due to the axial elongation defect [24,29–30]. A similar defect has also been observed in mouse Cdx mutants [34]. At 24 hpf, wild-type embryos expressed wt1a in presumptive podocytes (located adjacent to somite 3, marked by an arrow in Figure 5A) as well as a population of presumptive mesenchymal cells located next to somites 1–3 in a broad lateral domain (indicated by a bracket and ‘M' in Figure 5A). cdx4–/– embryos had expanded wt1a expression at 24 hpf that ranged from a position anterior to somite 1 to approximately somite 7, and cdx-deficient embryos showed an even more dramatic posterior expansion that reached somite 12 (Figure 5A). As the expansion of wt1a in cdx mutant embryos could indicate increased numbers of podocytes and/or the mesenchymal population, we examined wt1b expression, which specifically marks podocytes [65]. Equivalent numbers of wt1b-expressing podocytes were formed in cdx4–/– mutant and wild-type embryos, but podocytes in cdx4–/– embryos were located more posteriorly, at the level of somite 5 (Figure 5A). cdx-deficient embryos developed a normal number of wt1b-expressing podocytes, though they were arranged in a pair of somewhat irregular linear groupings (rather than forming bilateral spherical clusters), and they were also located more posteriorly, adjacent to somite 7 (Figure 5A). We conclude from these observations that the loss of cdx4 and cdx1a/4 function progressively expands wt1a expression without increasing the number of podocytes and leads to podocyte formation at more posterior locations along the embryonic axis. To assess tubule formation in cdx mutants, we examined the expression of cdh17 at 24 hpf. While cdx4–/– embryos formed complete tubules that fused at the cloaca, cdx-deficient embryos displayed cdh17 expression that was reduced and discontinuous, with the tubules failing to fuse (Figure 5A). Consistent with the posterior shifts in podocyte position, the A-P position of the tubule, marked by cdh17 transcripts, was shifted caudally in both cdx4–/– and cdx-deficient embryos. In wild-type embryos, the tubule spans the length of somites 4–18, but was located from somites 6–20 in cdx4–/– embryos, and from somites 8–13 in cdx-deficient embryos (Figure 5A). We next characterized the tubule segmentation pattern in cdx mutant embryos by examining the expression patterns of slc20a1a (PCT), trpm7 (PST), slc12a1 (DE), stc1 (CS), slc12a3 (DL), gata3 (PD), and aqp3 (cloaca). cdx4–/– embryos showed a slight expansion of the PCT, which spanned an additional two somites compared to wild-types (Figure 5A and unpublished data). The PST, DE, CS, and PD were all shorter than normal in cdx4–/– embryos, with the PD displaying the most severe reduction in length (Figure 5A and unpublished data). Transcripts for aqp3 were not detected in cdx4–/– embryos, suggesting a defect in cloaca development (Figure 5A). These results indicate that loss of cdx4 leads to a slight expansion in PCT fate with corresponding reductions in more distal fates. In contrast to cdx4–/– embryos, cdx-deficient embryos showed discontinuous slc20a1a expression and failed to express trpm7, slc12a1, stc1, slc12a3, gata3, or aqp3 (Figure 5A). These results suggest that the tubule territory in cdx-deficient embryos acquires a PCT identity, while the remaining nephron segments fail to develop. These defects were not the result of delayed development, as at later developmental stages, cdx-deficient embryos continued to possess tubules that only expressed PCT-markers, and the tubules never fused caudally (unpublished data). In addition, expression analysis of the podocyte marker mafB in cdx-deficient embryos at 48 hpf revealed that podocytes fail to fuse into a single renal corpuscle. Instead, the podocytes formed bilateral corpuscles that were dilated compared to wild-type and cdx4–/– embryos, presumably due to fluid accumulation (Figure 5B). Consistent with this, cdx-deficient embryos had developed glomerular cysts by 72 hpf, as well as severe pericardial edema, indicative of renal failure (Figure 5C). In contrast, cdx4–/– embryos never exhibited glomerular cyst formation or edema, suggesting that although various segment lengths were shortened, these embryos were able to maintain adequate kidney function (Figure 5C). In summary, our expression analyses show that cdx deficiency causes a posterior shift in the location of the pronephros along the embryonic axis (Figure 5D). While the podocytes and PCT populations formed relatively normally, the PST and distal tubule segments were reduced or absent in cdx4–/– and cdx-deficient embryos, respectively (Figure 5D). Thus the cdx genes, acting either directly or indirectly, are required for the formation of the distal nephron segments and establishing the normal segmentation pattern of the pronephros. Given the largely opposite effects of cdx-deficiency and loss of RA signaling on nephron patterning, as well as the recent report that cdx genes control how the hindbrain responds to RA during its patterning [30,31], we wondered if an interplay between these pathways was operative during pronephros segmentation. The location and level of RA within tissues is dependent on the expression of raldh-synthesizing enzymes and cyp26-degrading enzymes [15,54]. We therefore investigated the expression of these genes in cdx-deficient embryos during early somitogenesis, as our previous experiments suggested that the IM is being influenced by RA signaling at this time. At the 5 somite stage, expression of raldh2 in the paraxial mesoderm was expanded posteriorly in cdx4–/– embryos compared to wild-types (Figure 6A). An even greater posterior expansion was seen in cdx-deficient embryos, with raldh2 transcripts being detected throughout the entire unsegmented paraxial mesoderm and tailbud region (Figure 6A). Expression of the RA-catabolizing enzyme cyp26a1 in the upper trunk region was also expanded posteriorly in cdx4–/– embryos at the 5 somite stage, and more extensively expanded in cdx-deficient embryos (Figure 6A). To visualize how the combined changes in raldh2 and cyp26a1 expression altered the source of RA along the trunk, we generated digital overlays of these expression patterns. This analysis suggested that the anterior boundary of RA production (i. e. , the junction of the cyp26a1 and raldh2 expression domains) was located more posteriorly in cdx4–/– mutants compared to wild-types, and that this posterior shift was more pronounced in cdx-deficient embryos (arrows in Figure 6A). To better quantitate these posterior shifts, we examined expression of raldh2 and cyp26a1 at the 10 somite stage when the somites could be visualized by staining for myoD transcripts. We found that the raldh2 expression boundary in cdx4–/– and cdx-deficient embryos was shifted posteriorly by 1 and 2 somites, respectively, compared to wild-type embryos (Figure 6B). The cyp26a1 domain in wild-type embryos occupied the region of somites 2–3, just rostral and slightly overlapping with raldh2, as shown by double in situ hybridization (Figure 6B). In cdx4–/– embryos, cyp26a1 transcripts were detected in the region of somites 3–5, whereas in cdx-deficient embryos they extended from somites 3–7 (Figure 6B). These analyses reveal a striking correlation between the presumptive source of RA at the 10 somite stage and the axial position of the pronephros at 24 hpf in each genotype (i. e. , the source of RA and the position of the pronephros both start at somites 3,5, and 7 in wild-type, cdx4–/–, and cdx-deficient embryos, respectively). The combination of these data, together with the results from our DEAB experiments, suggest a model in which the cdx genes act upstream of raldh2 and cyp26a1 to localize the source of RA along the A-P axis, and that RA, in turn, acts on the IM to induce the proximal segments and prevent an expansion of the distal segment fates. If our model is correct, then inhibiting RA synthesis in cdx-deficient embryos should rescue pronephric positioning and the formation of the distal tubule segments. To test this, we treated cdx4–/– and cdx-deficient embryos with DEAB from 90% epiboly to the 5-somite stage and examined pronephros segmentation. In support of our model, we found that cdx4–/– and cdx-deficient embryos exhibited a one-somite anterior shift in the position of the pronephros, as shown by expression of cdh17 (Figure 7). In addition, the development of podocytes was abrogated, and the length of the PCT was reduced in DEAB-treated cdx4–/– and cdx-deficient embryos (Figure 7), consistent with our findings in wild-type embryos (Figure 3). We observed that the DE segment was increased in DEAB-treated cdx4–/– embryos, as shown by an expansion of the slc12a1 expression domain (Figure 7). DEAB treatment also increased the number of CS cells in cdx4–/– mutants, shown by the expression of stc1, and increased the DL segment length, evidenced by expansion of the slc12a3, romk2, and clck expression domains (Figure 7 and unpublished data). In cdx-deficient embryos treated with DEAB, formation of the DE, CS, and DL segments was rescued, shown by expression of slc12a1, stc1, and slc12a3, respectively (Figure 7). A similar rescue of the expression of the DE and DL markers romk2 and clck was also observed (unpublished data). These findings demonstrate that cdx gene function is not necessary to specify distal segment identity directly, but instead suggests that the abrogation of distal segment formation in cdx-deficient mutants is related to the level of RA that the renal progenitors are exposed to. Taken together with the above results, these finding provide good evidence that the pronephric positioning defect and failure to form the distal tubule identities in cdx-deficient embryos is caused by mis-localization of the RA source along the A-P axis. Retinoid signaling plays essential roles in the A-P patterning of a number of diverse tissues in the embryo. During early development, a source of RA in the upper trunk (cervical) region is produced by the action of the RA synthetic enzyme, Raldh2, which is expressed in the anterior paraxial mesoderm [54]. The coordinate expression of RA-catabolizing Cyp26 enzymes in surrounding tissues creates a so-called ‘sink' for this RA source [54]. Collectively, these enzymes are thought to create a gradient of RA activity that diffuses into surrounding tissues [34,54]. The functions of this RA source have been extensively studied in the developing hindbrain, where the effects of graded RA signaling are thought to create nested expression domains of RA-responsive genes that drive A-P segmentation of the hindbrain into a series of rhombomeres [15,54]. In addition to regionalizing the overlying neurectoderm, RA produced in the upper trunk paraxial mesoderm has been implicated in the regionalization of the underlying endoderm. Studies in zebrafish have shown that RA acts directly on the endoderm to specify hepatopancreatic progenitors that give rise to the liver and pancreas [17,18]. RA also influences mesodermal cell fate decisions during zebrafish development, including the formation of the pectoral fin field—which arises from the lateral plate mesoderm adjacent to the upper trunk somites [56,57,66]—and the heart [67]. In the latter case, inhibition of RA synthesis leads to an expansion of precardiac mesoderm, resulting in an excessive number of myocardial progenitors [67]. These findings indicate that, in addition to acting as an inducer of cell fates such as in the hindbrain and endoderm, RA also plays an important role in restricting certain cell fates. Our study now adds the IM as another mesodermal derivative that is patterned by RA. Our results show that RA production is essential during gastrulation and early somitogenesis for the induction of proximal nephron fates as well as to restrict the expansion of distal nephron fates. Over this period of development, RA is produced by the anterior paraxial mesoderm (PM). The IM, which gives rise to the pronephros, is located lateral to the PM (Figure 8). Given the role of RA as a diffusible morphogen in other tissues, we hypothesize that RA diffuses from the PM and establishes a gradient along the IM, with high levels of RA inducing proximal fates and low RA levels being permissive for distal fates (Figure 8). Our time-course experiments with DEAB support this view, with the most severe reduction in proximal fates (and concomitant expansion in distal segments) corresponding to the longest treatment window. However, further work is needed to determine the nature of the RA gradient, as well as how dynamic fluctuations in retinoid availability [54] affect the dose and length of time that the renal progenitors are exposed to RA. A gradient-free model has recently been proposed for RA-dependent hindbrain patterning, based on the finding that sequential expression domains of the cyp26a1, cyp26b1, and cyp26c1 genes are essential for rhombomere boundary establishment [68,69]. It is unclear if a similar mechanism might operate during pronephros segmentation, as cyp26b1 and cyp26c1 do not show a nested pattern of expression in the IM. Overall, the effects of RA on the patterning of the IM can be regarded as ‘anteriorizing.' Our finding that exogenous RA treatment induces proximal tubule fates to form throughout the pronephros supports this conclusion. Classically, RA is known as a ‘posteriorizing' factor due to its effects on the central nervous system, where an inhibition of RA signaling causes an expansion of anterior neural fates in the hindbrain [15,54]. Thus we conclude that RA can actually have both anteriorizing and posteriorizing activities, depending on the tissue in question. A unified way to characterize these effects would be to consider the upper trunk RA source as an organizing center, akin to the dorsal organizer in the gastrula, that locally patterns cell types in all three germ layers. Previous studies have implicated RA as a regulator of renal development. Animal cap experiments in Xenopus showed that RA, together with Activin, is sufficient to induce the formation of pronephric tubules [70]. A more recent study in Xenopus reported that overexpressing various RA antagonists results in a complete loss of the pronephros (glomus, tubules, and duct) [55]. This phenotype is more severe than what we observed and may reflect differences in the efficacy of DEAB to completely block RA production compared with other RA antagonists. The pronephric tubules in Xenopus are segmented into proximal and distal segments [48], similar to the zebrafish pronephros, however a role for RA in Xenopus nephron segmentation has not been reported. In mammals, it has long been known that vitamin A deficiency causes severe renal malformations [71]. Targeted mutagenesis of the RAR genes in mouse, followed by elegant rescue experiments, established an important role for RA as a dose-dependent inducer of the GDNF receptor Ret [72,73]. GDNF is an essential regulator of ureteric bud branching morphogenesis, and loss of GDNF signaling results most frequently in renal agenesis [74]. Because ureteric bud branching is an essential prerequisite for nephrogenesis, RA serves a key role in stimulating nephron formation. At present it is not known whether RA is also involved in the proximodistal patterning of metanephric nephrons. Interestingly, Raldh2 transcripts are found in podocyte progenitors, whereas Cyp26a1 is expressed by the tubule anlagen during metanephros development, suggestive of a role for RA in mammalian nephron patterning [75]. Transplantation studies in frogs suggest that RA may act directly on pronephric precursors [55]. However, the downstream targets of RA in the IM are not known. In the hindbrain, the presumptive RA gradient is thought to regulate rhombomere segmentation by activating the expression of the anterior, 3' Hox genes, i. e. , those comprising the 1st through 5th paralog groups [15,54,76]. In zebrafish, transcripts for hoxb1a, hoxb1b, and hoxb5a are found in proximal portions of the IM, thus making them potential candidates for mediating the effects of RA during pronephros segmentation [34]. Future studies using single, double, and triple morpholino injections can test the importance of these hox genes for renal development. The effects of RA on pronephric segmentation may also be coordinated by the action of non-Hox pathways. Our results suggest the intriguing possibility that RA signaling targets may include renal transcription factors as well as members of the Notch signaling pathway. The gene evi1 encodes a zinc-finger transcription factor that has been implicated in patterning distal regions of the pronephros in Xenopus, and overexpression of evi1 was found to inhibit proximal segment formation [63]. These data are consistent with our results showing that expression of evi1 in the IM was expanded following DEAB treatment, and reduced following exposure to exogenous RA. Another renal transcription factor candidate is the odd-skipped related transcription factor 1 (osr1) encoding a zinc-finger repressor. Recent studies in Xenopus and zebrafish have shown that osr1 is expressed in the ventral mesoderm during gastrulation and later in an anterior domain of the IM [77]. Morpholino-mediated knock-down of osr1 leads to defects in the formation of podocytes and proximal tubule progenitors [77], consistent with Osr1 participating in a common pathway with RA. The Notch pathway may also interact with RA during nephron segmentation. Conditional knockout of Notch2 in the mouse metanephros results in a loss of podocytes and proximal tubule fates, whereas distal markers are relatively unaffected [78]. In zebrafish, Notch signaling has been shown to regulate the differentiation of multiciliated cells and principle cells in the pronephric tubules [44,45]. However, a role for Notch signaling in the formation of proximal nephron fates is also suggested by the expression pattern of the Notch ligands deltaC, jag1b, and jag2a, which are restricted to proximal portions of the intermediate mesoderm [62,64]. Simultaneous knockdown of jag1b/2a results in an abnormally small renal corpuscle and dysmorphic proximal tubules, consistent with a conserved role for Notch signaling in proximal nephron development [79]. Our finding that DEAB treatment abrogates deltaC and jag2a expression in the proximal IM, while exogenous RA expands their expression, supports a role for RA acting upstream of the Notch pathway. Our study provides evidence that cdx genes control the expression domains of raldh2 and cyp26a1 along the embryonic axis. The boundaries of both raldh2 and cyp26a1 are progressively shifted toward the posterior in cdx4 and cdx1a/4-deficient embryos, suggesting that the upper trunk source of RA is posteriorly shifted. We hypothesize that this posterior shift in RA production results in a posterior shift in the position of the pronephros (Figure 8). We propose that this effect, combined with the axial elongation defects, leads to reduced or absent distal segment fates. The ability to rescue distal segments by treating cdx mutants with a pulse of DEAB is consistent with this model, and also demonstrates that cdx function is not requisite for the induction of distal fates from the intermediate mesoderm. Thus additional, as yet unidentified pathways, are responsible for directing distal fates. While our data supports the notion that Cdx factors exert their effects by the regulation of RA signaling, it does not rule out the possibility that Cdx factors may also function to repress proximal fates independent of RA signaling. Given the mounting evidence that the upper trunk RA source is an important organizing center, we would predict that both the patterning and positioning of numerous organs would be affected in cdx mutants. Consistent with this, defects in several mesodermal fates that arise in the anterior trunk region have been observed in cdx-deficient embryos. Vascular precursors are progressively expanded when cdx activity is abrogated, and blood precursors are both reduced and shifted posteriorly in cdx mutants [24,29]. In addition to mesodermal defects, cdx mutants also display patterning defects in the neurectoderm that gives rise to the anterior spinal cord [30,31]. We hypothesize that many, if not all, of these defects in cdx mutants are caused by the abnormal localization of RA along the A-P axis. The loss of cdx gene function in both zebrafish and murine models has been shown to cause global shifts in hox gene expression in the mesoderm and neurectoderm [24,25,29–30,34]. Given the rostral shifts and expansions of both raldh2 and cyp26a1 expression observed in cdx4 and cdx1a/4-deficient embryos, Hox transcription factors are attractive molecules for regulating raldh2 and cyp26a1 expression. Defects in blood formation in cdx4-null zebrafish can be rescued by the overexpression of several hox genes [24], and the overexpression of hoxa9a also results in a partial rescue of the axis elongation defect in cdx4–/– embryos [29]. Future studies are needed to examine whether hox gene overexpression (s) can rescue pronephros positioning and formation of distal segments in cdx mutant embryos. In conclusion, our studies have revealed an important link between the cdx genes and localization of RA, and provide evidence that RA signaling is a central determinant of pronephros A-P segmentation. Our results establish the zebrafish embryo as a simplified model of vertebrate nephron segmentation that will further our understanding of mammalian nephron segmentation, and provide insights into the causes of kidney birth defects and renal disease in humans. Zebrafish were maintained and staged as described [80,81]. Tübingen strain wild-type embryos were used for all experiments. DEAB and all-trans retinoic acid (Sigma-Aldrich) were dissolved in 100% dimethyl sulfoxide (DMSO) to make a 1 M stock and aliquots were stored at −80°C. For DEAB and RA treatments: embryos were incubated in 1. 6 × 10−5 M DEAB/DMSO in E3 embryo media, 1 × 10−6 M or 1 × 10−7 M RA/DMSO in E3 embryo media, or 1. 6 × 10−5 M DMSO (control) in E3 in the dark over particular developmental intervals, then washed five times with E3 and then fixed at 24 or 48 hpf. These experimental treatments were fully penetrant and produced consistent results at the doses and treatment windows that were examined. raldh2 morpholino (CAACTTCACTGGAGGTCATCGCGTC) was injected into 1-cell wild-type embryos. Incrosses of kggtv205 heterozygous adults (maintained on the Tübingen strain) were used to obtain cdx4–/– embryos and were injected at the 1-cell stage with cdx1a morpholino (CAGCAGATAGCTCACGGACATTTTC) as described [29] to obtain cdx-deficient embryos. Both raldh2 and cdx1a morpholinos produced fully penetrant effects. Embryos were raised to appropriate stages and fixed in 4% paraformaldehyde (PFA) /1×PBST for gene expression analysis. For all reported gene expressions, at least 20 embryos were examined. Whole-mount in situ hybridization of zebrafish embryos was performed as previously described [24]. The expression patterns of cdh17, clck, cyp26a1, evi1, gata3, mhc, myoD, nbc1, pax2a, pdzk1, raldh2, ret1, sall1, sglt1, slc4a2, slc20a1a, wt1a, and wt1b were previously reported [14,24,29,37,55,56,61,82–86]. For antisense probe production, we used the following IMAGE clone template plasmids, restriction enzymes for DNA linearization, and RNA enzymes: mafb: 7995399, pExpress-1, EcoR1, T7; rfx2, pBK-CMV, template was PCR amplified using primers GTGAATTGTAATACGACTCACTATAGGG and TTAACCCTCACTAAAGGGAACAAA, T7; slc9a3: 6996791, pExpress-1, EcoRI, T7; slc26a2: 4760214, pBK-CMV, EcoRI, T7; slc13a1: 6793065, EcoRV, t7; slc13a3: 4744276, pCMV-sport6. 1ccdb, EcoRI, T7; slc22a6: 4744276, pBK-CMV, SalI, T7; slc12a1: pBK-CMV, EcoRI, T7; slc12a3: 7037010, pExpress-1, EcoRI, T7; stc1 was amplified from 24 hpf embryo cDNA using primers ATGCTCCTGAAAAGCGGATTT and TTAAGGACTTCCCACGATGGA and cloned into pGemTEasy, NcoI, Sp6. Gene-specific primers spanning 700–1,000 bp of the coding sequence were used to amplify DNA fragments from E15. 5/P0 kidney cDNA pools, and the PCR products of the right size were cloned into the pCRII-Topo vector (primer sequences available upon request). DNA templates for riboprobe production were generated by PCR with T7 and Sp6 Ready Made primers (Integrated DNA Technologies) from PCRII-TOPO clones or T7 and T3 Ready Made primers from Bmap library clones. Digoxigenin-labeled anti-sense riboprobes were synthesized from the PCR product and purified with Micro Bio-spin columns P-30 Tris RNase-free (Bio-Rad). Probes were diluted with prehybridization buffer (50% formamide, 5×SSC, pH4. 5,50 μg/ml yeast tRNA, 1% SDS, 50 μg/ml heparin) to 10 μg/ml and stored at −80 °C. Neonatal kidneys were dissected free of surrounding tissues except the ureter and fixed with 4% PFA at 4 °C for 24 h. After PBS washes, they were incubated with 30% sucrose at 4 °C overnight. Kidneys were swirled in five dishes of OCT to remove sucrose and mounted in OCT in a dry ice/ethanol bath. The OCT blocks were stored at −80 °C. Sections were cut at 20 μm and air dried. Sections were post-fixed with 4% PFA for 10 min, treated with 10 μg/ml proteinase K for 10 min and post-fixed for 5 min. Slides were acetylated (1. 33% Triethanolamine, 0. 065% HCl, 0. 375% acetic anhydride) for 10 min and dehydrated with 70% ethanol and 95% ethanol for 5 min each. Slides were air dried then incubated with 500 ng/ml digoxigenin-labeled riboprobes at 68 °C overnight. Hybridized sections were washed with 50% formamide, 1×SSC, pH4. 5 for 30 min at 65 °C, treated with 2 μg/ml RNase for 15 min at 37 °C, and washed with 2×SSC, pH4. 5 for 30 min, and twice with 0. 2×SSC, pH4. 5 for 30 min at 65 °C. Slides were washed three times at room temperature with 1×MBST (0. 1 M maleic acid, 0. 15 M NaCl, 0. 1% Tween-20, pH7. 5) for 5 min each, and incubated with blocking solution (2% Boehringer Mannheim (BM) blocking reagent) in 1×MBST, 20% heat-inactivated sheep serum) for 1 h. After incubation with anti-digoxigenin antibody-AP (Roche, 1: 4000) at 4 °C overnight, sections were washed with 1×MBST at room temperature, 5 min for three times, then with NTMT (0. 1 M NaCl, 0. 1 M Tris-HCl, pH9. 5,50 mM Mg2Cl, 0. 1% Tween-20,2 mM Levimasole) for 10 min, and developed with BM purple (Roche). Color reactions were stopped with fixatives (4% PFA, 0. 2% glutaraldehyde) and sections mounted with glycergel mounting media (DAKO). Images were captured with a Nikon DXM1200 digital camera attached to a Leitz DMRB microscope.	In the kidney, structures known as nephrons are responsible for collecting metabolic waste. Nephrons are composed of a blood filter (glomerulus) followed by a series of specialized tubule regions, or segments, which recover solutes such as salts, and finally terminate with a collecting duct. The genetic mechanisms that establish nephron segmentation in mammals have been a challenge to study because of the kidney' s complex organogenesis. The zebrafish embryonic kidney (pronephros) contains two nephrons, previously thought to consist of a glomerulus, short tubule, and long stretch of duct. In this study, we have redefined the anatomy of the zebrafish pronephros and shown that the duct is actually subdivided into distinct tubule segments that are analogous to the proximal and distal segments found in mammalian nephrons. Next, we used the zebrafish pronephros to investigate how nephron segmentation occurs. We found that retinoic acid (RA) induces proximal pronephros segments and represses distal segment fates. Further, we found that the caudal (cdx) transcription factors direct the anteroposterior location of pronephric progenitors by regulating the site of RA production. Taken together, these results reveal that a cdx-RA pathway plays a key role in both establishing where the pronephros forms along the embryonic axis as well as its segmentation pattern.	Abstract Introduction Results Discussion Materials and Methods	developmental biology danio (zebrafish) vertebrates teleost fishes nephrology	2007	The cdx Genes and Retinoic Acid Control the Positioning and Segmentation of the Zebrafish Pronephros	15,617	370
White-nose syndrome is one of the most lethal wildlife diseases, killing over 5 million North American bats since it was first reported in 2006. The causal agent of the disease is a psychrophilic filamentous fungus, Pseudogymnoascus destructans. The fungus is widely distributed in North America and Europe and has recently been found in some parts of Asia, but interestingly, no mass mortality is observed in European or Asian bats. Here we report a novel double-stranded RNA virus found in North American isolates of the fungus and show that the virus can be used as a tool to study the epidemiology of White-nose syndrome. The virus, termed Pseudogymnoascus destructans partitivirus-pa, contains 2 genomic segments, dsRNA 1 and dsRNA 2 of 1. 76 kbp and 1. 59 kbp respectively, each possessing a single open reading frame, and forms isometric particles approximately 30 nm in diameter, characteristic of the genus Gammapartitivirus in the family Partitiviridae. Phylogenetic analysis revealed that the virus is closely related to Penicillium stoloniferum virus S. We were able to cure P. destructans of the virus by treating fungal cultures with polyethylene glycol. Examination of 62 isolates of P. destructans including 35 from United States, 10 from Canada and 17 from Europe showed virus infection only in North American isolates of the fungus. Bayesian phylogenetic analysis using nucleotide sequences of the viral coat protein geographically clustered North American isolates indicating fungal spread followed by local adaptation of P. destructans in different regions of the United States and Canada. This is the first demonstration that a mycovirus potentially can be used to study fungal disease epidemiology. Pseudogymnoascus destructans (Pd; previously named Geomyces destructans) is an emerging fungal pathogen responsible for a fatal disease, white-nose syndrome (WNS) in hibernating bats in North America [1–3]. Experts estimate over 5 millions bats died from WNS in North America since the disease was first noted in New York in 2006 [4–6]. Currently WNS has spread to at least 29 states in the United States (plus three additional states where Pd presence has been confirmed, but not WNS) and five provinces in Canada [4]. The fungus is widely distributed in Europe [6,7] and recently has been reported from the northeast of China and Siberia [8,9], but no mass mortality has been reported in European or Asian bats [6,8]. Pd’s lethal effect on North American bats coupled with its clonal genotype in North American isolates [10,11], its single mating type [12] and the absence of close relatives [13] led many researchers to hypothesize a recent introduction to North America [1,6, 14,15]. Pd is confirmed in seven North American [1,4] and 13 European species of bats [4,9]. The natural history of the genus Pseudogymnoascus and its allies indicate that they are commonly isolated from soils in colder regions of the world [16]. Unlike Pd many of its close relatives are cellulolytic saprobes and non-pathogenic [16,17]. Mycoviruses associated with fungi have drawn interest because of their potential roles in fungal biology and pathogenicity [18]. Mycoviruses are very frequent in fungi and generally maintain a persistent lifestyle [19]. Horizontal transmission is very rare, and is likely restricted to closely related strains, although phylogenetic studies indicate transmission among species has occurred [20]. Transmission has only been documented in a few cases outside the laboratory [21]. Most mycoviruses are cryptic with no known biological effects on their fungal hosts, although there is a lack of research in this area. However, there are significant examples where mycoviruses play important roles in fungal biology and ecology [22]. Here we used mycoviruses of Pd as a tool to study the epidemiology of WNS. We investigated mycoviruses in Pd and show that population variation of a Pd-mycovirus can be useful in tracing the spread of WNS. We examined 62 isolates of Pd from North American and European bats for mycoviruses (Table 1). The isolates were cultured from four North American and one European species of bats and were collected from 2008 to 2015. North American isolates included 14 from Pennsylvania, seven from New York, six from West Virginia, three from North Carolina, three from Vermont, one from Ohio, one from Indiana and 10 from New Brunswick, Canada. We screened 16 isolates of Pd from the Czech Republic and one isolate from Slovakia in Europe. Double-stranded RNA (dsRNA) extracted from all North American isolates showed two bands—a larger band close to 1. 8 kb (RNA 1) and a smaller band close to 1. 6 kb (RNA 2) in electrophoretic analysis (Fig 1A). None of the European isolates contained these dsRNAs, although two, CCF-4127 and CCF-4128, had dsRNAs profiles different from that of the North American isolates (Fig 1B). We found no dsRNAs of viral origin in five isolates of Geomyces sp. from Antarctic soil or in six isolates of Pseudogymnoascus sp. from cave soils in Pennsylvania (S1 Table). The dsRNA enrichment method is based on the premise that uninfected plants or fungi normally do not contain detectable amounts of high molecular weight dsRNA, and, when present, dsRNA is an indicator of a viral genome [23]. Sanger sequencing of cDNA clones from RNAs 1 and 2 of the North American isolates of Pd obtained from random primed RT-PCR provided nearly complete genomic sequences; ends were determined by 5' - primer ligated RNA ligase mediated-rapid amplification of cDNA ends (RLM-RACE) [24] providing consensus genomic sequences for RNAs 1 and 2 of 1761 bp and 1590 bp. Northern-blots using cDNA clones from RNA 1 or RNA 2 as probes confirmed the identity of the dsRNA bands (Fig 1C). We named this new virus Pseudogymnoascus destructans partitivirus-pa (PdPV-pa; the pa indicates the sequenced isolate is from Pennsylvania). A BLASTx search of GenBank showed closest similarity of RNA 1 of PdPV-pa with RNA 1 of Penicillium stoloniferum virus S (PsV-S), with 76% amino acid (aa) identity. Similarly, RNA 2 of Pd showed closest similarity with the RNA 2 of PsV-S with 67% aa identity. PsV-S is the type species of the genus Gammapartitivirus in the family Partitiviridae [25]. Sequence analysis of RNA 1 of PdPV-pa predicted a single open reading frame (ORF) of 540 aa (60 kDa) that codes for a putative RNA-dependent RNA polymerase (RdRp) (Fig 2A). RNA 2 also contained a single ORF of 470 aa (52 kDa) that codes for a putative coat protein (CP) (Fig 2B). Amino acid level sequence identity of PdPV-pa RdRp and CP with the approved members of genus Gammapartitivirus in the family Partitiviridae ranges from 58% - 76% and 36% - 67% respectively, which are within the species demarcation criteria (RdRp ≤ 90%; CP ≤ 80%) of the genus [42]. Further, the 5' termini of PdPV-pa RNAs 1 and 2 coding strand share a conserved CGCAAAA… sequence, where G is followed by A, U, or C but not G in the next 5 to 6 nucleotide positions, characteristic of the genus Gammmapartitivirus [25] (Fig 2C). Similarly, the 3' terminal 50 nucleotides of RNAs 1 and 2 were adenosine (A) rich in the range (7–24 nt) typical of members of the Gammapartitivirus genus [25] (Fig 2D). PdPV-pa particles were purified from mycelia of Pd and negative-stain transmission electron microscopy showed isometric particles of approximately 30 nm diameter, characteristic of members of the Partitiviridae (Fig 3A). PdPV-pa dsRNAs were also extracted from the purified virus particles to reconfirm their presence as genomic RNAs (Fig 3B). Bayesian trees constructed using aa sequences from the RdRp and CP of PdPV-pa clustered PdPV-pa with other members of genus Gammapartitivirus in the Partitiviridae family (Fig 4A & 4B). In both RdRp and CP trees, PdPV-pa appeared as a sister branch to PsV-S with strong posterior probability support of 92% and 100% respectively suggesting PdPV-pa is evolutionary close to PsV-S. The genome structure of PdPV-pa, conserved features in its RNAs explained above, its particle morphology, its RdRp and CP amino acid sequence identity within species demarcation criteria, and phylogenetic analyses all confirmed that PdPV-pa is a novel partitivirus belonging to genus Gammapartitivirus in the family Partitiviridae. We attempted several methods including single spore isolation, hyphal tip culture, protoplast culture, heat therapy and nutritional and chemical stress that involved application of the antiviral drugs cycloheximide or ribavirin, to cure Pd of the PdPV-pa infection. However, only partial success was achieved with high concentrations of cycloheximide (25 μg/ml) and ribavirin (300 μM) treatments after three passages. PdPV-pa remained suppressed in the fungus treated with cycloheximide or ribavirin when grown in media with the drug but once the fungus was transferred to drug-free media the virus reappeared. Finally, our attempt to cure the fungus using polyethylene glycol (PEG) -induced matric potential in minimal nutrition media made PdPV-pa undetectable. PdPV-pa infection in Pd was checked under matric potential gradients starting from -2MPa, -3MPa to -4MPa. We did not observe visible germination of Pd conidia or mycelia growth at -5MPa and -6MPa. PdPV-pa was undetected in PEG treated Pd isolates when evaluated by dsRNA extraction and RT-PCR with RdRp specific primers for PdPV-pa (Fig 5A & 5B). The detection limit of PdPV-pa in Pd was determined to be approximately 380 copies per cell (S1 Appendix). We enriched the viral dsRNA from total nucleic acid extracted from a defined number of Pd conidia followed by measurement of dsRNA concentration, and serial dilutions to determine the end-point of detection. Pd isolates where PdPV-pa was undetected after PEG treatment lost the characteristic gray pigmentation of wild type Pd and appeared white (Fig 6A). The virus-free isolate also produced significantly less conidia in comparison to wild type isolate (Fig 6B). Although PEG treatments were successful in obtaining a PdPV-pa free isolate of Pd, PdPV-pa tolerance to many other stresses mentioned above indicate that PdPV-pa is tightly associated with the Pd isolates from North America. Genetic variability of the RdRp and CP regions was analyzed in 45 North American isolates of PdPV-pa by amplification using specific primers followed by sequence analysis (Fig 7A & 7B). Using a 930 bp region of RdRp amplicons after trimming and alignment, we found the average percentage identity ranged from 99. 7 to 99. 9 among the 45 isolates. The high level of conservation in the RdRp is also reflected by a total of only 15 segregating sites, including seven singletons among the isolates examined. For the CP, nucleotide variability was higher: in a 1088 bp of amplicon of the CP, the average percent identity ranged from 96. 8 to 98. 4 and included 127 segregating sites out of which 69 were singletons. The Bayesian tree based on the RdRp nucleotide sequences of 45 North American isolates of PdPV-pa produced a largely unresolved tree with no clusters with significant support. However, the Bayesian tree constructed from the nucleotide sequences of the CP clustered the 45 PdPV-pa isolates into two major clades based on their geographical distribution (Fig 8). One clade was comprised of Canadian isolates; the other clade included isolates from the USA, although the posterior probability of this separation was lower than for other branching in the tree. The USA clade further included well supported clusters of isolates from New York, Pennsylvania, West Virginia, North Carolina, Vermont, Indiana and Ohio. Indiana and Ohio had one isolate each and separated as sister branches. The separate topologies of USA and Canadian clusters indicate independent diversification of Pd isolates subsequent to movement to particular regions. Within each major clade there were examples of sub-branching topologies representing isolates based on their local distribution although the pattern was not consistent throughout. The phylogeny of the PdPV-pa isolates showed no structure based on the taxonomy of the bats indicating that Pd is a generalist pathogen that is transmitted readily across bat species. In this study, we isolated and characterized a novel virus, PdPV-pa, from the pathogenic filamentous fungus causing WNS in North American bats. Based on the nucleotide sequence, sequence properties at the 5' and 3' termini, genome organization, morphology of the virus particle and phylogenetic analysis, PdPV-pa was confirmed as a new member of the genus Gammapartitivirus, family Partitiviridae. PdPV-pa shows closest similarity with PsV-S within Gammapartitivirus. The branch supports of over 90% in posterior probability in the RdRp and 100% in the CP Bayesian trees separating PdPV-pa from PsV-S (Fig 4A & 4B) and Gammapartitivirus species delimitation criteria (≤ 90% aa-sequence identity in RdRp and/or ≤ 80% aa-sequence identity in CP [26]) confirmed PdPV' s taxonomic placement into a distinct species [25]. The occurrence of PdPV-pa infection in Pd isolates from diverse geographical locations and time suggests PdPV-pa is widely spread in North America. We could not rule out the possibility of PdPV-pa incidence in Europe considering the sample size of 17 isolates that we examined in this study. Previously, Warneke et al. [14] reported a Pd isolate from Germany (MmyotGER2) showing similar mortality effects to North American isolates when inoculated onto North American little brown bat (M. lucifugus) under experimental conditions. Unfortunately, we were not able to obtain the German isolate to evaluate the presence of PdPV-pa. However the close association of PdPV-pa in a diverse subset of the North American population of Pd sampled (35 isolates from 7 states) may provide some indications of the roles of PdPV-pa in WNS. Many mycoviruses have been reported to elicit phenotypic changes, including both hypovirulence and hypervirulence in their fungal hosts [18]. For example, the presence of Helminthosporium victoriae 145S virus (chrysovirus) in the plant pathogenic fungus, Helminthosporium victoria increased virulence in oat plants. The viral dsRNAs up-regulated Hv-p68, an alcohol oxidase/RNA-binding protein in the fungus that is likely responsible for the disease development [27]. Similarly, a high level of virulence was reported in the presence of a six kbp mycoviral dsRNA in Nectria radicicola, the causal fungus of ginger root rot [28]. The opportunistic fungal pathogen, Aspergillus fumigatus causing lung disease in immunocompromised humans and animals also exhibited hypervirulence in the presence of the uncharacterized A78 mycovirus [29]. We have not explored the roles of PdPV-pa in WNS in the present study, but some indirect evidence, including the difficulties in curing the fungus of PdPV-pa, the stability of the virus after numerous generations of laboratory cultures, the changes in pigmentation and the significantly reduced production of conidia in the virus-free isolate indicate close biological relationships between the fungus and the virus; hence future investigation on potential biological effects of PdPV-pa will be important. In our attempts to cure PdPV-pa, PEG-induced stress on the matric potential was found effective. PEG being non-toxic and metabolically inert to fungi is an ideal compound to manipulate matric-induced water stress in media [30]. Matric potential influences water availability of substrates through capillary actions and particle adsorptive forces [31]. Raudabaugh & Miller [32] showed that Pd is sensitive to matric induced water stress beyond -5MPa, which is consistent with our results. In addition to the Pd growth response, normal growth at lower matric stress and significant growth inhibition as negative values of matric potential increases are characteristic of most soil fungi [32,33]. It is possible that Pd may have originated as a soil fungus and the adaptive pressure due to competition expanded its niche. The capacity of a human pathogenic fungus, Cryptococccus neoformans, to infect several animals including cats, dogs, dolphins, sheep and many birds was explained based on the environmental selective pressures imposed on it while surviving in its primary niche: soil [34]. The recent findings that Pd is capable of surviving on various substrates like harvestmen, fungus gnats, moss, and cave soils in addition to bat skin [32,35,36], support this argument. Whether or not Pd susceptibility to matric stress is related to its origin, the inhibitory effect of the matric stress on both Pd and PdPV-pa confirms parallel biological response of both the virus and the fungus. The genetic variation in the RdRp (<1%) and the CP (2–3%) of North American populations of PdPV-pa seems low, but in fact is quite high for partitiviruses. In studies with plant partitiviruses we find less than 1% divergence after extended periods of evolution (MR, personal observation). This higher level of variation implies a recent introduction of PdPV-pa. According to our results, only one species of this virus appears to occur in the North American isolates of Pd. The phylogenetic analysis based on a Bayesian algorithm of CP nucleotide sequences showed geographical clustering of 45 North American isolates into two main clades: USA and Canada. This indicates the diversification of PdPV-pa isolates is the outcome of geographical separation followed by sequence variation. No bat host specialization was observed. This finding is consistence with the clonal populations of Pd reported previously [10,11] with only one mating type [12] despite its infection in several species of bats in North America. The phylogenetic signatures of PdPV-pa isolates relating to geography provide valuable insights on the spread of WNS. The phylogeny supports two major clusters and many sub-clusters corresponding to US States of PdPV-pa isolation, suggesting connections among North American isolates, which is valuable in tracing WNS. Additionally, clustering of Pd isolates based on location was observed in several occasions within the USA clades followed by divergence, most likely for local adaptation. This analysis can be successfully expanded incorporating CP sequences of PdPV-pa from wider geographical locations to study the spread of WNS. Pseudogymnoascus destructans (Pd) was isolated from diseased bat wing tissue, live bat wing punches (2-5mm diameter) or wing swabs, cultured on 0. 5X (7. 5 g/L) Sabouraud dextrose agar (SDA) plates with 20 μg/ml of ampicillin, streptomycin and tetracycline at 10° C for 3 weeks in the dark. Identification of Pd was confirmed based on the species morphological characters i. e. , the presence of curved conidia [1] and DNA sequences from conserved regions: internal transcribed spacer1 (ITS1), elongation factor 1α (EF-1α) and glyceraldehyde 3-phosphate dehydrogenase (gdp) genes. The pure cultures of Pd were obtained either by single spore isolation or hyphal tip cultures. For single spore cultures, actively growing Pd plates (100 mm X 15 mm) of over three weeks old were flooded with 2 ml of sterile water and gently swirled to release the spores (conidia). The spore suspension was vortexed for one minute to avoid clumping of spores. The spore suspension was then picked using an inoculating loop and spread over water agar plate (19 g/L). About 1 ml of sterile water was added in the process to help to spread the spores uniformly. The plate was viewed under a dissecting microscope and concentration of the spore suspension was adjusted so that each plate had 20–30 spores. The plate was then cultured at 7°-10°C in the dark and checked for germination every alternate day. Once the spores germinated, an agar plug was cut containing hyphae from the single germinating spore without damaging growing hyphae and then plated on a regular SDA plate to culture. For hyphal tip culture, we used the protocols described by Kanematsu et. al. [37] with some modification. We plated spore suspension on regular SDA plates as described above but when spores geminated and mycelia mats were formed they were gently overlaid with sterile Whatman cellulose filter paper soaked in SDB. The plates were then cultured for an additional two weeks until the fungal hyphae penetrated the filter paper and started growing on the upper surface. At that point the filter paper was removed and its upper surface was scraped gently and hyphal segments were suspended in sterile water. The method produced hyphal segments ranging from 4–8 cells in length that were appropriate for the hyphal tip culture. The hyphal segment suspension was then plated on SDA plates adjusting the concentration so that each plate had uniform distribution of 20–30 hyphal segments. Finally agar plugs grown from individual hyphal segments were cultured in separate plates to obtain a pure culture. The fungal isolates were stored in SDA plates for short-term storage at 4°C and at -80°C in the form of mycelia in 50% glycerol for long-term storage. All Pd isolates from Pennsylvania, one from Vermont and one from Indiana used in this study were isolated and cultured in our laboratory. The substrates (bat wings, wing punches, swabs) for these cultures were obtained from routine surveys of the Pennsylvania Game Commission (http: //www. pgc. pa. gov/Wildlife/Wildlife-RelatedDiseases/WhiteNoseSyndrome). The isolates from New York, West Virginia, North Carolina, Ohio, the remaining two isolates from Vermont and all European isolates were obtained as sub-cultures from the Center for Forest Mycology Research, United States Forest Service, Madison, WI (http: //www. fpl. fs. fed. us/research/centers/mycology/culture-collection. shtml). The Canadian isolates were obtained as sub-cultures from New Brunswick Museum collections, New Brunswick, Canada (http: //www. nbm-mnb. ca). In addition, we obtained five isolates of Geomyces sp. collected from Antarctic soil from Dr. Robert A. Blanchette’s collection at the University of Minnesota and we used six isolates of Pseudogymnoascus sp. from cave soil in Pennsylvania for this study. We extracted dsRNAs from lyophilized mycelia of Pd with a minor modification in the protocol described by Márquez et. al. [38], specifically Pd was cultured using mycelial plugs or spores in 150 ml of 0. 5X Sabouraud dextrose broth (SDB) supplemented with 20 μg/ml of ampicillin, streptomycin and tetracycline in a shaker at 10°C under dark conditions for three weeks prior to lyophilization. In addition to binding to CF11 cellulose (Whatman) in the presence of ethanol, the chemical nature of the dsRNA was confirmed by its resistance to DNase and RNase with NaCl concentration > 0. 3M. Approximately 2 μg of dsRNA were mixed with 2 μM of random primer-dN10 with a linker sequence (5' CCTTCGGATCCTCCN103' ), 0. 5 mM of Tris-EDTA (pH 8. 0) and nuclease-free water to a final volume of 12 μl, and boiled for 2 min. The mixture was incubated on ice, and 8 μl of Reverse Transcriptase (RT) mix (SuperScriptTM III RT 200U, 5X First-Strand buffer 4 μl, 0. 1M DTT 1 μl and dNTP 0. 5 mM as recommended by the manufacturer) were added and incubation continued at 50°C for 1. 5 hours. The newly synthesized cDNA mixture was then incubated with 10 μg of boiled RNase A (Sigma) for 15 min. at room temperature and cleaned with E. Z. N. A Cycle Pure Kit (Omega Bio-tech) according to the manufactures instruction. About 0. 5 μg of cleaned cDNA was used as a template for a 25 μl polymerase chain reaction (PCR) with Taq DNA Polymerase (ThermoFisher Scientific), buffers, dNTPs supplied with 1μM concentration of the primer (5' CCTTCGGATCCTCC 3' ). The PCR was completed in a Idaho Technologies Rapid Cycler with a slope setting of 5, using the following cycles: 1 cycle of 94°C, 1 min. ; 25 cycles of 94°C, 0 sec. , 45°C, 0 sec. , and 72°C, 15 sec. ; 1cycle of 72°C, 5 min. ; 1 cycle of 37°C, 5 min. The PCR product was cleaned and cloned into the pGEM-T Easy Vector System (Promega) according to the manufacturers instructions. Sequence analysis of the cDNA plasmid clones were done by the Genomic Core Facility of Pennsylvania State University, University Park, PA. The sequences obtained were trimmed for plasmid and primer sequences and assembled using de novo assembly in Geneious version 8. 0. 2 [39]. All cloning and sequence analysis was based on the dsRNA from the LB-01 isolate cultured from a little brown bat from Pennsylvania. RNA ligase mediated-rapid amplification of cDNA ends (RLM-RACE) was performed to determine the terminal sequences of the PdPV-pa dsRNA segments. A 5' -phosphorylated oligodeoxynucletide (5' -PO4-GGAGGATCCGAATTCAGG 3' ) was ligated to the dsRNA termini as an adaptor before synthesizing cDNAs using a complementary primer (5' CCTGAATTCGGATCCTCC3' ) in combination with the internal primers designed for PdPV-pa RNA1 and RNA2 (RNA 1: 5' TTCAAGTTCGCCCTGTACC3' F, 5' TGAGCGAATGGAAGGTTG3' R; RNA 2: 5' CGCGTAATCATGACGACC3' F, 5' CCGAGGAGCACACACTATC3' R) in RLM-RACE. Ligation reactions were done in 50% PEG with 2 U of T4 RNA ligase 2 (New England BioLabs) mixed with approximately 2 μg of dsRNA along with the primers mentioned above and buffer supplied according to the manufacturers instructions, and incubated at 4°C overnight. RT-PCR of the primer-ligated dsRNA was performed exactly like described in the cDNA synthesis above except the enzyme used was Avian Myeloblastosis Virus (AMV) RT (New England BioLabs). The amplicons were cloned followed by sequence determination using Sanger sequencing. The complete nucleotide sequences of PdPV-pa RNA 1 and PdPV-pa RNA 2 have been deposited in GenBank with accession numbers KY20754 and KY207544, respectively. Consensus sequences for PdPV-pa RNA 1 and RNA 2 were analyzed for the open reading frames (ORFs) using ORF finding operation in Geneious version 8. 0. 2. A sequence similarity search was conducted with BLASTn and BLASTx available online from the National Center for Biotechnology Information (NCBI). Northern blotting was performed using non-radioactive isotopes probes, digoxigenin (DIG) -11-dUTP-labeled DNA fragments according to the manufacturers instructions (Roche Diagnostics). Representative clones of PdPV-pa RNA 1 and RNA 2 in the range of 500–700 bp were selected and the labeling was done in a PCR with DIG-11-dUTP and dNTPs mix (DIG-11-dUTP: dTTP = 1: 3; with equimolar amount of dATP, dCTP and dGTP), Taq DNA Polymerase (ThermoFisher Scientific), specific primers and buffer in Idaho Technologies Rapid Cycler as described above. About 2 μg of PdPV-pa dsRNA was electrophoresed in 1. 2% agarose gels and subsequently denatured by saturating with freshly prepared 50mM NaOH for 30 min followed by neutralization in 50mM sodium borate for 5 min. The cycle was repeated three times before dsRNA was transferred to a nylon membrane (Hybond N+ Amersham) by capillary action overnight. The membranes were UV-cross-linked in a Stratalinker at 200 J. Hybridization and washings were carried out as described by Li et al. [40] except we performed prehybridization and hybridization at 52°C instead of 42°C. The blots were incubated in antibody solution, anti-DIG-AP Conjugate (Roche) and CDP-STAR (Roche) for chemiluminescence detection. Virus particles were purified following methods described by Sanderlin and Ghabrial [41] with some modifications. Eight g of lyophilized mycelia of Pd isolate BB-06 was ground to powder in the presence of liquid nitrogen. The homogenates were mixed with extraction buffer (0. 1 M sodium phosphate. pH 7. 6 containing 0. 5% (v/v) thioglycolic acid) and mixed with chloroform followed by low speed centrifugation at 7000 rpm for 15 min at 4°C. The virus containing supernatant was then subjected to two cycles of differential centrifugations (low speed at 7000 rpm for 15 min and ultracentrifuge at 35,000 for 1. 5 hours). During the ultracentrifuge cycle, the virus containing supernatant was underlaid with a 10% sucrose cushion. The final pellets were suspended in 1 ml of 0. 03 M sodium phosphate buffer pH 7. 6. The virus preparation was examined under JEOL 1400 transmission electron microscope after negatively staining with uranyl formate in the Microscopy and Imaging Facility at Penn State College of Medicine, Hersey, PA. For the heat stress, actively growing Pd plates in three replicates were exposed to room temperature (22–23°C), 37°C and 42°C for 2,6, 12 and 24 hours before culturing the mycelia plugs from each treatments in liquid medium (SDB) under normal laboratory culture conditions for Pd described above. During the treatments, Pd plates in three replicates were also grown under normal culture condition as controls. The fungal mycelia were then harvested after three weeks to extract dsRNAs. However, only samples treated at room temperature and 37°C for 2 hours grew. Single spore isolation and hyphal tip cultures were done as described under the section, fungal isolation and culture. The protoplast isolation from Pd was performed on mycelia (~ 1. 7 g) harvested from SDB culture after two weeks at 10°C in a shaker (200 rpm) in the dark. The fungal mycelia were collected by centrifugation at 90 × g for 5 min followed by washing with KCl buffer (0. 6 M, pH 5. 8) as an osmotic stabilizing agent. The mycelia was treated with lysing enzyme mixture (Lysing enzyme from Trichoderma harzianum 20 mg/ml and driselase 20 mg/ml from Sigma) prepared in KCl buffer and incubated at 10°C at 70 rpm in the dark. Protoplast production was checked every half an hour until 35–40 protoplasts were observed under a 40X field with 10 μl of the mixture. The mixture was then passed through double-layered miracloth (VWR) soaked in STC buffer (1. 2 M Sorbitol; 10 mM Tris-HCl, pH 7. 5; 20 mM CaCl2) to filter out the cell debris. The filtrate was centrifuged at 90 × g for 5 min to collect the protoplasts which were resuspended in regeneration media (0. 5% yeast extract, 2% glucose, 0. 6 M Sorbitol and 25 mM CaCl2) followed by incubation at 10°C at 70 rpm in the dark. Once the protoplasts recovered completely with cell wall growth, they were transferred to agar supplemented regeneration media (0. 5% yeast extract, 2% glucose, 20% sucrose and 1% agar) and the concentration adjusted so that each plate had 25–30 uniformly distributed cells. The plates were then incubated under normal culture condition for Pd until hyphae developed uniformly around each protoplast without touching each other. Individual colonies were then picked and cultured in SDA. We also treated Pd with the antiviral drugs cycloheximide and ribavirin at different concentrations in SDA media. Cycloheximide was used at 2 μg/ml, 5 μg/ml, 10 μg/ml, 15 μg/ml and 25 μg/ml concentrations. Ribavirin treatment was at 80 μM, 100 μM, 150 μM, 200 μM and 300 μM concentrations. Three passages with both cycloheximide and ribavirin were also performed with higher concentrations. For PEG induced matric stress on water availability we used PEG 8000 (Fisher BioRegents) in a modified Spezieller Nährstoffarmer liquid media (SN: 0. 02 g sucrose, 0. 02 g glucose, 0. 08 g KNo3,0. 08 g KH2Po4,0. 04 g MgSo4. 7H2O and 0. 04 g NaCl/L) to make media with water potential gradients of -1 MPa, -2 MPa, -3MPa, -4 MPa, -5 MPa and -6 MPa. The amount of PEG 8000 in gram/gram of water was calculated based on Michel [42] equation: Ψ (water potential) = 1. 29 [PEG]2T – 140[PEG]2–4 [PEG] and the value was adjusted to the Pd culture temperature of 10°C. An agar plug containing actively growing Pd was placed in 50 ml autoclaved modified SN liquid media with a targeted amount of PEG 8000 (-1 MPa: ~ 0. 075 PEG g/g of water, -2 MPa: ~ 0. 11 PEG g/g of water, -3 MPa: ~ 0. 14 PEG g/g of water, -4 MPa: ~ 0. 16 PEG g/g of water, -5 MPa: ~ 0. 19 PEG g/g of water and -6 MPa: ~ 0. 21 PEG g/g of water) and grown as described above. After three weeks, pieces of newly growing mycelia of Pd were transferred to normal SBD routinely used to culture Pd and the fungus was harvested after a normal culture period. The fungi from different treatments were examined for PdPV-pa both by dsRNAs gel electrophoresis and RT-PCR with PdPV-pa specific primers. In all methods Pd isolate LB-01 was used. Genetic variation in North American PdPV-pa isolates were determined by sequence analysis of RdRp and CP segments amplified in RT-PCR using specific primers. The primer pairs specific to RdRp (5' ATGGAAGTATCTCCTTTCG3' F, 5' GTATAGAAGATTGAGTGCC3' R) and CP (5' ACTCTGTGTTAACGGAGG3' F, 5' CTGTAGTTGACACCTGTACC3' R) were designed from the consensus sequences of RNA 1 and RNA 2 assembled from LB-01 isolate cloned sequences. PCR products using RdRp and CP specific primers from 45 North American PdPV isolates were sequenced and aligned with MUSCLE default settings in the program Geneious 8. 0 [39]. The RdRp sequences have been deposited in GenBank under accession numbers KY207498 to KY207552 and the CP sequences have been deposited in GenBank under accession numbers KY207453 to KY207497. The alignment was visually corrected as necessary before recording segregating and singleton sites. The average percentage identity for each sequence was calculated by taking the average from a pairwise percentage identity matrix generated from the sequence alignment. Phylogenetic analysis was performed using MrBayes [43] implemented via a plug-in in Geneious. The amino acid sequences were used in studying the evolutionary relationships of PdPV-pa within the genus Gammapartitivirus. The tree was constructed using amino acid sequence (RdRp and CP) of 10 approved species of Gammapartitivirus available in the GenBank. The sequences of Pepper cryptic virus 1, type member of genus Deltapartitivirus, which is the closest group to Gammapartitivirus in Partitiviridae family was used as outgroup. We used nucleotide sequences (CP) to study phylogenetic relationships of PdPV-pa in North American population. The nucleotide sequence of PsV-S CP was used as outgroup in the analysis. In Bayesian trees construction using amino acid sequence of the RdRp and CP ORFs, Jukes-Cantor substitution model was applied and for nucleotide sequences of CP General time-reversible (GTR) model with gamma rate variation was used based on the best model tested out of 28 models.	Many species of bats in North America have been severely impacted by a fungal disease, white-nose syndrome, that has killed over 5 million bats since it was first identified in 2006. The fungus is believed to have been introduced into a cave in New York where bats hibernate, and has now spread to 29 states and 4 Canadian provinces. The fungus is nearly identical from all sites where it has been isolated; however, we discovered that the fungus harbors a virus, and the virus varies enough to be able to use it to understand how the fungus has been spreading. This study used samples from infected bats throughout Pennsylvania and New York, and New Brunswick, Canada, as well a few isolates from other northeastern states. The evolution of the virus recapitulates the spread of the virus across these geographical areas, and should be useful for studying the further spread of the fungus.	Abstract Introduction Results Discussion Materials and Methods	sequencing techniques fungal spores vertebrates animals mammals fungi phylogenetic analysis rna isolation molecular biology techniques rna sequencing fungal reproduction research and analysis methods sequence analysis mycology rna sequence analysis bioinformatics molecular biology molecular biology assays and analysis techniques biomolecular isolation dna sequence analysis database and informatics methods bats biology and life sciences amniotes organisms	2016	Using a Novel Partitivirus in Pseudogymnoascus destructans to Understand the Epidemiology of White-Nose Syndrome	9,689	203
Sustainable dengue intervention requires the participation of communities. Therefore, understanding the health beliefs, knowledge and perceptions of dengue among the local people can help to design locally appropriate strategies for effective interventions. A combination of qualitative semi-structured in-depth interviews (SDIs) and quantitative household questionnaire surveys (HHSs) was used to investigate the beliefs, knowledge and perceptions of dengue among the Shan people in Eastern Shan Special Region IV (ESSR4), Myanmar. The SDI was administered to 18 key informants, and the HHS was administered to 259 respondents. Only 14. 7% (95% CI: 10. 6–19. 6%) of the HHS respondents could confirm that mosquitoes transmit dengue; 14. 3% (95% CI: 10. 3–19. 1%) knew that piebald or Aedes mosquitoes transmit dengue; and 24. 3% (95% CI: 19. 2–30. 0%) believed that dengue-transmitting mosquitoes mainly lived in small ponds. Merely ten (0. 4%) of the 259 respondents of the HHS thought that dengue-transmitting mosquitoes bite in the day time. The people in the villages where there were outbreaks of dengue had more knowledge about dengue. This study demonstrates that the health beliefs of the Shan people were closely associated with their lifestyles, social and natural environments. To stay healthy, the Shan people clean their houses and surroundings regularly. However, their knowledge about dengue was not adequate for effective dengue control because it was mostly learned from previous dengue experiences and in a context that lacks systematic health education. Thus, in this setting, with a weak public health structure, more international support should be provided to promote the knowledge of the Shan people about dengue and to increase their sensitive awareness to dengue, which might be beneficial for social mobilization and community participation during future dengue prevention. Dengue fever (DF) is a mosquito-borne disease caused by the dengue virus. It has become a substantially increasing threat to public health and represents a challenge to health services and a burden to economies. It was recently estimated that there are 390 million dengue infections every year (95% confidence interval 284–528 million), of which 96 million (67–136 million) infections manifest clinically [1,2]. The World Health Organization (WHO) estimated that 3. 9 billion people in 128 countries are at risk for infection with dengue viruses [3] and that approximately 75% of the global population who are at risk for contracting dengue is distributed across the Asia-Pacific region [4]. However, dengue is still one of the most neglected tropical diseases, which are caused and maintained by the social and environmental determinants of health [5]. The social determinants of infectious disease control are difficult to address [6]. For that reason, the Special Programme for Tropical Diseases Research and Training from the World Health Organization has called for more research on the interplay between the demographic, social, and environmental factors in infectious disease occurrence [7]. In recent years, outbreaks of DF have occurred along the China-Myanmar-Laos border, and most of these outbreaks affected Dai or Shan ethnic communities [8,9]. Dengue virus is primarily transmitted by Aedes mosquitoes, particularly Aedes aegypti. Water containers and discarded tires are the main productive habitats for Aedes [10]. The population dynamics of Aedes aegypti are influenced by human behavior and by the weather [11]. Outbreaks of DF may also be attributed to the social and environmental characteristics of the residents. Human behavior change communication (BCC) is one of the currently adopted strategies to reduce the Aedes population and dengue virus transmission [4,11–13]. Understanding people’s health beliefs, knowledge and perception about dengue may help to generate better strategies for dengue control [14,15]. Data about people’s health beliefs, knowledge and perceptions about dengue are still lacking at the China-Myanmar-Laos border. This kind of data may help to explore locally adaptive strategies and solutions for the next steps in dengue prevention and control. This study investigated the health beliefs, knowledge and perception of the Shan people about dengue in Eastern Shan Special Region IV (ESSR4), Myanmar. The purpose of using both qualitative and quantitative methods is to triangulate the study outcomes, to try to gain in-depth understanding and to compare any potential differences between the general community and the key informants who are supposed to have more chances to receive health information. Here, we report our findings and provide a discussion on their implications. This investigation was a cross-sectional study that used mixed methods, including a quantitative HHS and qualitative SDI. Based on the number of reported dengue fever cases in 2017, three types of villages (high, low and no dengue incidence) were chosen as sample sites in Mongla Township in ESSR4, Myanmar. The SDI was administered to six key informants in each type of sampled village, so a total of 18 SDIs were conducted. The targeted sample size of the HHS, i. e. , 250 household heads for the questionnaire survey, was determined based on a 95% confidence interval of the standard value normal distribution, a 5% precision and an estimated 20% of adult people who know that mosquitoes transmit dengue virus [16]. Generally, people’s health beliefs are supposed to affect people’s knowledge, perception and preventive behaviors regarding diseases. In this paper, health beliefs are the general perceptions of elements related to health and diseases, not just special beliefs about dengue, i. e. , people’s perception of the effect of religious, socioeconomic and natural elements on their health and their perception of disease causes. More specifically, in this article, the knowledge and perception were specifically about dengue fever, including their knowledge of the clinical symptoms, vectors, dengue virus transmission, preventive methods and their perceived risk of contracting dengue fever. First, two of the main researchers discussed the study themes, including common diseases and health problems in the community, causes of poor health, knowledge of dengue, perceived risks of dengue and preventive methods, and then drafted the guidelines for the qualitative SDI. Second, the guidelines were pretested through discussions with village leaders and health workers and were then revised and finalized according to the results of the pretests. Third, based on the qualitative SDI guidelines, a questionnaire was developed, pretested by interviewing five heads of households, and then revised and finalized. The questionnaire consisted of 55 questions that covered demographics, education, family economics, beliefs on health and disease causes, the knowledge of dengue (including symptoms, transmission, vectors and prevention), perceived risk and attitudes. ESSR4 of Myanmar adjoins the Xishuangbanna Prefecture of China [17] and has three administrative areas, i. e. , Mongla Township, Nanban and Selei County. The total population of ESSR4 is approximately 110,000, and the majority of residents are Shan people (known as Dai in China, Thai in Thailand and Lao in Lao PDR), which is one of the main ethnicities in the Greater Mekong Subregion (GMS). The hot climate and adequate precipitation in ESSR4 provide a suitable environment for the growth and reproduction of mosquitoes, thereby increasing dengue transmission. Outbreaks of DF have recently occurred in Mongla Township each year [8]. The hospital of ESSR4 is the sole health facility that can perform the laboratory-based diagnosis and treatment of DF, and this hospital reported a total of 114 dengue fever cases in 2017. To compare the responses of communities with different DF experiences and to explore the potential reasons behind these responses, this study was deliberately designed to be carried out in three types of villages (V1 = no DF patients, V2 = low DF incidence, and V3 = high DF incidence). After discussion with the hospital of ESSR4, Mangjingpa and Wangnali (V1), Wangmaidao (V2) and Wangdong (V3) were selected for the study, as a common decision between us and the hospital. In 2017, V1 had 867 people and no reported DF cases; V2 had 389 people and nine reported DF cases; and V3 had 487 people and 36 reported DF cases. The qualitative data were collected by interviewing 18 key informants, with six from each type of village (i. e. , V1, V2 and V3). Participants included one health worker, three village leaders and two villager representatives who were chosen by the other villagers. The interview was conducted by following the SDI guidelines. One researcher interviewed the key informants in the Shan language, and another took notes in Chinese. The contents that were discussed included local health problems, villagers’ beliefs, including religion, the causes of diseases, local dengue situations, the name for DF in the Shan ethnic language and its meaning, the linkage between mosquitoes and dengue, the time that mosquitoes bite humans, the breeding sites of dengue-transmitting mosquito larvae and people’s perceptions of the prevention of DF [18,19]. The unit of sampling of this study was a household, which was defined as all those eating from the same cooking pot. The family wealth index (FWI) was determined by the household’s physical assets, such as housing, walls, roofs, and bicycles, and was classified into five groups (Table 1). Households were selected by a simple computer randomization in V1, V2 and V3. The 50% ±10% of the targeted sample size of the HHS (250 household heads) was decided for villages with reported dengue cases and without, respectively. Chinese is the official language in the ESSR4, so the questionnaire was written in Chinese. Researchers first visited each selected household and introduced the purpose of this study, topics and related questions that would be asked. The questionnaire was subsequently administered to each household head only after oral informed consent was obtained. Investigators who understood both the Shan language and Chinese from the Hospital of ESSR4 asked every question in the Shan language and then filled out the questionnaire in Chinese [20,21]. Records of the qualitative SDI were coded according to the contents of the questions and were then entered into cells in Microsoft Office Excel 2007. The same content records were combined by code sequencing. Two researchers independently analyzed the records of every content to generate themes. Finally, the two researchers discussed and compared their findings to finalize the findings. Quantitative data were entered in Excel 2007 and were analyzed in Epi Info 7. 2. The percentage and its 95% confidence interval (CI) were calculated for each health belief, piece of knowledge and perception. A chi-squared test was used to compare the percentage of each health belief, piece of knowledge and perception across the three village categories (V1, V2 and V3) [20,21]. The study was approved by the Bureau of Health of ESSR4, Myanmar. Ethical approval for this study was also granted by the Ethics Committees of the Yunnan Institute of Parasitic Diseases in China. Verbal consent was approved by the Ethics Committee as an acceptable form, as the study was interview-based and did not include any human specimens. All studied participants were adults (over 18-years-old). According to the World Medical Association Declaration of Helsinki, the purpose and procedures of the study were explained and disclosed to the participants before obtaining their consent. Participation was entirely voluntary, and participants could pass on a question, take a break or withdraw their consent from the study without providing any explanation at any time. Their consent was assumed if they did not refuse to answer questions. The SDI was administered to 18 key informants, including nine males and nine females, ranging from 32- to 54-years-old. The questionnaire was administered to 259 household heads, and all completed questionnaires were considered valid. Among the 259 households, 211 (81. 5%, 95% CI: 76. 2–86%) were less poor (FWI 4–5) (Table 1). The respondents were made up of 149 females and 110 males. The mean age of the respondents was 42. 3-years-old (median: 49. 0, range: 18–99). A total of 225 (86. 9%, 95% CI: 82. 1–90. 7%) respondents said that they had not received any formal health education. Most of the participants and their family members were Buddhists. Only two of the HHS respondents were Papists, and the other three were not religious. All 18 key informants were Buddhist and agreed that, “One good turn deserves another. Evil will be recompensed with evil. The Buddha will bless and protect good people. If anyone does bad things, he or she would be punished due to their evil behaviors”. Half of 18 key informants thought that the natural environment in which they were living affected their health. In V1, three of the key informants agreed that, “In hotter weather, more people get ill”. In V2, two key informants agreed that, “Extremely hot or cold weather can make people ill”. In V3, four of the key informants agreed that, “When there are more trees, there are more mosquitoes and therefore more diseases”. Nine of 18 key informants believed that a certain link existed between household economic income and diseases. One of the key informants explained, “In poorer economic conditions, it is easier to get diseases because the poor may more easily suffer from malnutrition and be less healthy”. Fourteen of the key informants thought that clean living and working environments benefited their health. In V1, the key informants agreed that, “Poor hygiene is one of the disease causes”. In V2, the key informants agreed that, “Dirty water leads to diseases”. In V3, the key informants agreed that, “When hygiene is poor, it is easier to contract diseases” (Table 2). The results of the HHS showed that 79. 9% (95% CI: 74. 5–84. 6%) of the respondents believed that Buddha would bless good people; 54. 1% (95% CI: 48. 2–60. 6%) thought that anyone who did evil would be punished; 47. 5% (95% CI: 41. 3–53. 8%) mentioned that poverty was one of the causes of disease; 62. 9% (95% CI: 56. 7–68. 8%) believed that all natural factors, including climate, weather, water and forests, influenced human health; 87. 0% (95% CI: 92. 2–90. 9%) believed that cleanliness and sound hygiene benefited human health; and 21. 7% (95% CI: 16. 7–27. 2%) thought that unpolluted water was healthier than polluted water (Table 3). DF is named “Paya Yong” in the Shan ethnic language, in which “Paya” represents illness and “Yong” represents mosquitoes. Shan people have connected DF to mosquitoes from the literal meaning of this ethnic language phrase. However, most participants did not know the clinical symptoms of DF. Six of 18 key informants regarded fever as one of the symptoms of DF, and one of the key informants also mentioned rash, pantalgia and joint pain (Table 2). The results of the HHS showed that there was a higher proportion of respondents who did not know the DF symptoms or who did not respond to the question in V1 than in V2 and V3 (P = 0. 0453); only 17. 8% (95% CI: 13. 3–23. 0%) of the respondents mentioned fever; 14. 3% (95% CI: 10. 3–19. 1%) mentioned headache; 4. 2% (95% CI: 2. 1–7. 5%) mentioned orbital pain; 9. 7% (95% CI: 6. 3–13. 9%) mentioned pantalgia; and 3. 5% (95% CI: 1. 6–6. 5%) mentioned rash (Table 3). Seven people perceived DF as a serious or deadly disease among the 18 key informants. In V2 and V3, all 12 key informants thought that local people could easily become infected with DF; however, in V1, only one out of the six key informants thought that local people could easily become infected with DF (Table 2). The HHS results revealed that 68. 7% (95% CI: 62. 7–74. 3%) of the respondents either did not know about the risk or did not respond to the question regarding risk; only 27. 8% (95% CI: 22. 4–33. 7%) of the respondents thought of DF as a serious disease; and 24. 7% (95% CI 19. 6–30. 4%) of the respondents considered DF to be deadly (Table 3). Both the quantitative and qualitative data showed similar results. Ten of the 18 key informants regarded DF as a contagious disease, but they thought that DF could be transmitted from person to person directly by breathing, speaking and physical contact, etc. (Table 2). Furthermore, the HHS results revealed that 52. 9% (95% CI: 46. 6–59. 1%) of the HHS respondents did not answer the transmission question; only 25. 0% (95% CI: 19. 4–31%) the respondents thought that DF was transmittable; 20. 0% (95% CI: 14. 0–24. 9%) thought that DF could be transmitted from person to person directly; and only 14. 7% (95% CI: 10. 6–19. 6%) of the HHS respondents confirmed that DF was transmitted by mosquitoes. Some respondents thought that bacteria, viruses, animals and improper or dirty food as one of the causes of DF (Table 3). Six of the 18 key informants knew that dengue-transmitting mosquitoes were piebald or Aedes; they also knew that dengue-transmitting mosquitoes could bite during all 24 hours of the day. Only one key informant asserted that dengue-transmitting mosquitoes bit in the daytime, compared with four informants who thought that dengue-transmitting mosquitoes only bit at night. Thirteen key informants confirmed that dengue-transmitting larvae live in water; an additional eight of the 13 key informants confirmed that containers or small-scale pond water is the principal breeding sites for the larvae. The other five key informants did not know the breeding habitats of the mosquito larvae or they did not respond to the question (Table 2). The HHS results indicated that 79. 2% (95% CI: 73. 7–83. 0%) of the respondents were unable to answer the vector question; only 14. 3% (95% CI: 10. 3–19. 1%) of the respondents knew that piebald or Aedes were dengue-transmitting mosquitoes, and there were more HHS respondents who knew about dengue-transmitting mosquitoes in V2 and V3 than in V1 (P = 0. 0293). Only 21 out of the 259 respondents knew that dengue-transmitting mosquitoes bit people during the day and night, and ten further confirmed that biting could occur during the daytime. More respondents knew that mosquitoes bite in the daytime in V2 and V3 than in V1 (P = 0. 0467). A total of 33. 2% (95% CI: 27. 5–39. 3%) of the HHS respondents thought that all types of water sites were the habitats of dengue-transmitting mosquitoes, and only 24. 3% (95% CI: 19. 2–30. 0%) confirmed that the dengue-transmitting mosquito larvae were only living in containers or in the water of small ponds. More of the HHS respondents in V1 than in V2 and V3 (P = 0. 0018) could not answer this question or did not respond to the habitat question (Table 3). All participants showed a keen interest in this topic and thus actively discussed this issue with the investigators. Thirteen key informants knew that clearing mosquito breeding sites helps to prevent dengue transmission. Ten key informants said that good hygiene was beneficial for their health and expressed their willingness to participate in the cleaning of the community environment (Table 2). In the HHS, only 20 participants did not answer the questions regarding the control of mosquito larvae, and only five had no response to the questions. The HHS results indicated that 43. 6% (95% CI: 37. 5–49. 9%) of the respondents knew that maintaining good hygiene was important for eliminating the habitats of the dengue-transmitting mosquito larvae; 67. 2% (95% CI: 61. 1–72. 9%) knew that turning containers upside down was important for eliminating the habitats of the dengue-transmitting mosquito larvae; and 20. 5% (95% CI 15. 7–25. 9%) knew that draining small-scale pond waters was important for eliminating the habitats of the dengue-transmitting mosquito larvae. More participants in V2 and V3 than in V1 understood that good hygiene helps to control DF. Regarding adult mosquito control, 20. 1% (95% CI: 15. 4–25. 5) of the HHS respondents knew about the use of door and window screens; 79. 9% (95% CI: 74. 5–84. 6) knew about mosquito coils; 27. 8% (22. 4–33. 7%) knew about spraying or fogging with insecticides; and 69. 9% (63. 9–75. 4%) knew about the use of bed nets. More HHS respondents in V2 and V3 than in V1 thought that using window and door screens (P = 0. 02) and spraying with insecticides is helpful (P = 0. 5891). However, more respondents in V1 than in V2 and V3 thought that using mosquito coils (P = 0. 03) and bed nets (P = 0. 1235) helped with dengue prevention. Additionally, more participants in V1 than in V2 and V3 (Table 3) expressed their willingness to eliminate bamboo and tree stump holes (P = 0. 3302), to clean up dumps and to turn containers upside down (P<0. 0001) (Table 3). The dengue burden is growing and has become large enough currently. More than half of the global population lives in territories that are at risk of becoming infected with dengue [2,4]. However, ability to contain epidemics of the dengue virus is still limited. In addition to supportive treatments, effective antiviral therapies continue to be lacking. The only licensed dengue vaccine is only partially protective [22]. Thus, intensified vector control could still be the most important strategy for DF prevention for a long time to come. Adopting protective behaviors is a multifactorial process that depends on both sociocultural and cognitive factors [23]. The Shan people have beliefs that have originated from their primary social living and culture. They believe that health is associated with all natural and social environmental factors, and that regularly cleaning their houses and surroundings to maintain sound hygiene would benefit human health. The name for DF in the Shan ethnic language (Paya Yong) connects dengue with mosquitoes, however, their knowledge and awareness of DF remain at low level. These low levels might be attributed to the fact that the local Shan people are unable to effectively benefit from the services that are provided by both the national health and education systems. Only nine of the participating household heads had completed more than six years of formal education. Thus, the participant’s low levels of knowledge and perceptions about DF might be explained by the lack of health services that they benefitted from and the inadequate formal education that they received. Meanwhile, few actions involving information, education and communication on dengue have been taken, despite the fact that the burden of DF is increasing [8], shortly after the malaria burden was effectively reduced [24]. In V2 and V3, there was a higher response rate and level of knowledge than in V1 about DF symptoms, transmission, vectors, time of day when mosquitoes bite and the breeding sites of dengue-transmitting mosquitoes. This difference might be attributed to the fact that the V2 and V3 communities have suffered from DF and thus have more experience and knowledge regarding dengue. Over half of the participants could not answer questions about the causes of DF. Only a quarter of the participants understood that dengue is transmittable, but most of the participants thought that dengue could be directly transmitted from person to person by breathing, speaking, physical contact, etc. (Tables 2 and 3). What is worse, almost all key informants did not have enough knowledge to communicate with their fellow villagers to prevent future outbreaks. Most of the participants were unsure if they were at risk of being infected by dengue. Both the qualitative and quantitative data show that the participants had difficulty with answering the questions on the risks and seriousness of DF. Only 15. 8% (95% CI: 11. 6–20. 9%) of the participants perceived the risk of becoming infected. Furthermore, less than one-third of the participants (72/259) considered DF to be a serious disease and lethal. People in V2 and V3 were more susceptible to DF than those in V1. This indicates that their perceived risk may have correlated with their previous experience of DF outbreaks too. This Inappropriate preparedness due to the shortage of necessary resources might be one of the reasons for the outbreaks of DF in ESSR4, Myanmar. More of the participants in V1 than in V2 and V3 showed a willingness to eliminate bamboo and tree stump holes, to clean up dumps and to turn containers upside down. Based on some of the SDI data, local governments have frequently required villagers to clean their houses, public spaces in the community and the surrounding environment during DF outbreaks. In response to DF outbreaks, three ten-person teams in V3 would alternate to conduct spraying and fogging with insecticide once a week. During our communications, we felt that people in V2 and V3 became bored while hearing about these requirements. One villager said, “The campaign just stopped a few days ago”. This ennui might lower their willingness to perform environmental management and may become a new challenge for the sustainability of intensive vector control. Because of the malaria control program, the residents’ knowledge of adult mosquito control was improved to a certain level across ESSR4 [24]. In the HHS, 79. 9% (95% CI: 74. 5–84. 6%) and 69. 9% (95% CI: 63. 9–75. 4%) of the participants mentioned that they had used coils and bed nets, respectively. More of the participants in V1 than in V2 and V3 knew how to use mosquito coils and bed nets. However, only a few people knew that dengue-transmitting mosquitoes bite during the day and that small-scale pond water is the main breeding site of dengue-transmitting mosquito larvae. Most participants knew to protect themselves from the bites of adult mosquitoes, but they did not know that eliminating the habitats of dengue-transmitting mosquito larva is beneficial for the control of dengue vectors (Tables 2 and 3). Combining effective interventions against multiple arboviral diseases has been suggested by some scholars as one of the most cost-effective and sustainable strategies for the reduction of vector-borne diseases [25,26]. However, another study that conducted a meta-analysis documented that indoor residual spraying (IRS) did not significantly impact DF infection risk [27]. Both this literature and our study results illustrate that knowledge regarding the control of adult mosquitoes is not sufficient for controlling the dengue vector. Unavoidably, this study was constrained by two obvious limitations. First, one of the objectives of the qualitative SDI was to triangulate the study outcomes of the quantitative methods. Much more attention was paid to this objective in the qualitative SDI, and not enough nuanced data were collected. This limited our ability to delineate the outcome differences between the qualitative SDI and the quantitative HHS despite the qualitative and quantitative outcomes also showed that the key informants had better knowledge than overall community people. Further qualitative study should been needed. Second, the response rates of the HHS participants to certain questions were not high enough, and thereby might have caused information bias. However, all investigators felt that the Shan People were very friendly, and we very much enjoyed collaborating with them during the field research. This means that the Shan people may have been unlikely to reject answering questions that they could answer. When the individuals had no response to a specific question it was mainly because they did not know the answer. To add to this disclosure, we combined the answers of “I don’t know” and no response into a single category during analysis. In conclusion, the Shan people believe that health is associated with all natural and social environmental factors, and that regularly cleaning their houses and surroundings to maintain sound hygiene would benefit human health. However, their knowledge and aware sensitivity of DF remains at low level, and most of their knowledge and awareness was learned from previous experiences in controlling malaria and dengue. Thus, in this setting with a weak public health structure, more international support should be provided to promote the knowledge of the Shan people about dengue and to increase their aware sensitivity to dengue. With proper guidance, social mobilization and community participation might help increase the perception of DF and the involvement of the Shan people for dengue control.	The burden of dengue has been increasing over the last five decades, and dengue fever (DF) has become one of the most rapidly spreading mosquito-borne diseases. DF has become another disease that threatens public health after malaria has become successfully controlled along the China-Myanmar border. However, it is currently not easy to contain epidemics of the dengue virus. As part of an integrated vector management approach, a community-based method is effective in the prevention of DF by tailoring the approach in a local context. Consequently, mixed methods comprising qualitative semi-structured in-depth interviews (SDIs) and quantitative household questionnaire surveys (HHSs) were used to study the health beliefs, knowledge and perceptions about dengue among the Shan people in Eastern Shan Special Region IV, Myanmar. This study found that the Shan people believed that their health was closely associated with their lifestyle and the social and physical environment in which they lived. Their beliefs originated from their primary social activities and cultural heritage. Most of their knowledge about DF was learned from previous outbreaks and interventions for the disease. The Shan people had a relatively higher level of knowledge about adult mosquito control, which they learned from previous malaria control programs, but they lacked knowledge on DF symptoms, transmission, vectors and Aedes larval breeding sites. Their knowledge about the methods of adult mosquito control could not effectively control DF. More sound health education is urgently needed to increase the local people’s knowledge of dengue and to rouse community awareness and participation in cleaning vector breeding sites. In the context of a lack of the necessary technical and financial resources, these interventions might rely more on international aid and help from neighboring countries, such as China.	Abstract Introduction Methods Results Discussion	invertebrates medicine and health sciences behavioral and social aspects of health tropical diseases social sciences ponds neuroscience animals health care developmental biology cognitive psychology bodies of water neglected tropical diseases insect vectors language public and occupational health infectious diseases dengue fever marine and aquatic sciences life cycles hygiene disease vectors insects arthropoda socioeconomic aspects of health mosquitoes psychology eukaryota earth sciences biology and life sciences species interactions viral diseases cognitive science larvae organisms	2019	The Shan people’s health beliefs, knowledge and perceptions of dengue in Eastern Shan Special Region IV, Myanmar	6,512	364
Despite the central role of estrogen exposure in breast and endometrial cancer development and numerous studies of genes in the estrogen metabolic pathway, polymorphisms within the pathway have not been consistently associated with these cancers. We posit that this is due to the complexity of multiple weak genetic effects within the metabolic pathway that can only be effectively detected through multi-variant analysis. We conducted a comprehensive association analysis of the estrogen metabolic pathway by interrogating 239 tagSNPs within 35 genes of the pathway in three tumor samples. The discovery sample consisted of 1,596 breast cancer cases, 719 endometrial cancer cases, and 1,730 controls from Sweden; and the validation sample included 2,245 breast cancer cases and 1,287 controls from Finland. We performed admixture maximum likelihood (AML) –based global tests to evaluate the cumulative effect from multiple SNPs within the whole metabolic pathway and three sub-pathways for androgen synthesis, androgen-to-estrogen conversion, and estrogen removal. In the discovery sample, although no single polymorphism was significant after correction for multiple testing, the pathway-based AML global test suggested association with both breast (pglobal = 0. 034) and endometrial (pglobal = 0. 052) cancers. Further testing revealed the association to be focused on polymorphisms within the androgen-to-estrogen conversion sub-pathway, for both breast (pglobal = 0. 008) and endometrial cancer (pglobal = 0. 014). The sub-pathway association was validated in the Finnish sample of breast cancer (pglobal = 0. 015). Further tumor subtype analysis demonstrated that the association of the androgen-to-estrogen conversion sub-pathway was confined to postmenopausal women with sporadic estrogen receptor positive tumors (pglobal = 0. 0003). Gene-based AML analysis suggested CYP19A1 and UGT2B4 to be the major players within the sub-pathway. Our study indicates that the composite genetic determinants related to the androgen–estrogen conversion are important for the induction of two hormone-associated cancers, particularly for the hormone-driven breast tumour subtypes. Estrogen exposure is critical for the development of both breast and endometrial cancers and represents the most well-established risk factors for both diseases. Estrogen is a metabolic product whose circulating level is determined by de novo synthesis, conversion from other steroid hormones, and mechanisms of estrogen elimination. These metabolic processes are regulated by a network of enzymes encoded by different genes, suggesting that genetic variation within these metabolic genes may impact on breast and endometrial cancer risk. Genetic variation within the estrogen metabolic pathway has been intensively investigated, mostly by analyzing single variant effects in a limited number of candidate genes, SNPs and study subjects. The inadequacies of study design and analytical methodology have caused these studies to be underpowered for detecting moderate genetic effects which, not surprisingly, has led to inconsistent results [1]–[8]. We surmised that strategies for assessing the synergistic effect of multiple genetic variants within the estrogen metabolic pathway may provide a more realistic determination of genetic effect than a single gene, single SNP approach. Herein, we present a comprehensive analysis of genetic variation in the estrogen metabolism pathway and its association with breast and endometrial cancer risk using a pathway-based approach. We performed single SNP association analysis in 1596 breast cancer cases, 719 endometrial cancer cases and 1730 population controls from Sweden. Of the 239 tagSNPs analyzed, 17 SNPs (7. 1%) had p-values less than 0. 05 for breast cancer, and 18 SNPs (7. 5%) had p-values less than 0. 05 for endometrial cancer (Table S4 and Table S5). For breast cancer, the smallest p-value was 0. 00034 at rs7167936 within CYP19A1, and for endometrial cancer, the smallest p-value was 0. 00017 at rs12595627 in CYP19A1. The single-SNP associations were all moderate. Only rs12595627 (for endometrial cancer) survived the conservative Bonferroni correction for multiple testing at α = 0. 05. Overall, however, the single-SNP p values appeared to deviate from their null distribution of no association (formally tested below). The single-SNP associations were suggestive, but instead of any single variant having a strong effect, there appeared to be multiple weak associations within the metabolic pathway. To evaluate the cumulative effect from multiple variants we employed the AML method [9] that assesses the experiment-wide significance of association by analyzing multiple SNPs through a single global test. The whole metabolic pathway can be sub-divided into three a priori defined sub-pathways, each performing specific metabolic function (Figure 1). Sub-pathway 1 is involved in the synthesis of androgen, sub-pathway 2 is involved in the conversion of androgens to estrogens, and sub-pathway 3 is responsible for removing estrogens. To investigate whether there is multi-SNP association for the whole pathway and whether any of the three sub-pathways is particularly important in influencing disease risk, we performed the progressive pathway-based global test on the whole metabolic pathway as well as the three sub-pathways using the AML method. The global test yielded marginally significant association for the whole metabolic pathway in both breast (pglobal = 0. 034) and endometrial (pglobal = 0. 052) cancers (Table 1). Dividing the metabolic pathway into three functional sub-pathways for the global test revealed strong association between the androgen-to-estrogen conversion sub-pathway and both breast (pglobal = 0. 008) and endometrial (pglobal = 0. 014) cancer (Table 1). The association evidence survived correction for performing 4 pathway-based tests in each cancer (pglobal corrected = 0. 032 for breast and 0. 056 for endometrial). In contrast, the other two sub-pathways showed no association with either form of cancer. For approximately half of the Swedish subjects in the breast cancer study (797 cases and 764 controls) we have genome wide association study (GWAS) data available. We used this to assess the possible influence of population stratification on our results. For the GWAS dataset, the genomic inflation factor, λgc, was1. 015. Assuming an equal level of population stratification (in terms of the fixation index FST) in the current study and the GWAS sub-study, we estimated the genomic inflation factor, λgc, to be 1. 030 in the current study, using the relationship between FST, sample size and λgc described in [10]. Using the λgc value of 1. 030 for genomic control-based correction of population stratification, the corrected global AML p-values for breast cancer are 0. 052 for the entire pathway and 0. 011 for the androgen-estrogen conversion sub-pathway, leaving our results largely unchanged. Even if λgc was as large as 1. 05 in the current study, the global test p-value for the androgen-estrogen conversion sub-pathway would still be as low as 0. 014. To further ensure that the observed associations could not be due to the employment of 319 paraffin-embedded tissue samples in the analysis, we re-ran analyses excluding 319 paraffin-embedded tissue samples, and (at the same time) excluding 33 SNPs with call rates of less than 95%. Results were very similar. For example, for breast cancer, p-values were 0. 028 and 0. 009 for the entire pathway and for the androgen-estrogen conversion sub-pathway, respectively. To validate the association in the androgen-to-estrogen conversion sub-pathway, we genotyped the 120 SNPs of this sub-pathway in an additional 2245 breast cancer cases and 1287 controls from Finland and performed the same AML analysis by using the 118 successfully genotyped SNPs. The validation analysis in the Finnish sample revealed similar evidence of association between the androgen-to-estrogen conversion sub-pathway and breast cancer (pglobal = 0. 015) (Table 1). The non-centrality parameter from the AML analysis of the androgen-to-estrogen conversion sub-pathway, which represents the size of the common effect of the associated SNPs, was estimated as 2. 90 for the Swedish sample and 2. 94 for the Finnish sample. The similar values indicate a consistent size of the genetic effect in the two samples. A joint analysis of the Swedish and Finnish samples further yielded a global p-value of 0. 001 (Table 1). The SNPs with the lowest p-values in the Finnish sample are listed in Table S6. Hormone-related risk factors may play a differential role in breast cancer subtypes. In particular, estrogens appear to drive the development of ER positive tumors. This prompted us to investigate the association in the androgen-to-estrogen conversion sub-pathway in hormone-related breast tumor subtypes. As surrogate markers for hormone driven tumour subtypes we constructed variables as combinations of menopausal status, family history and estrogen receptor (ER) status and divided all the patients into subgroups. We then compared subgroups of patients, defined on values of these variables, with controls, to evaluate the role of the androgen-to-estrogen conversion sub-pathway in different patient subgroups. First, we compared patient subgroups against all the controls in the combined Swedish and Finnish samples. The subgroup results showed that in the combined samples, significant association was observed in postmenopausal patients (pglobal = 0. 009 and 0. 018 respectively), postmenopausal patients without family history (pglobal = 0. 001 and 0. 04 respectively), and postmenopausal patients with estrogen receptor positive (ER+) tumors (pglobal = 0. 0006 and 0. 05 respectively) (Table 2). No significant association was observed in either premenopausal patients or postmenopausal patients with family history or estrogen receptor negative (ER−) tumors. Then, to rule out the possibility that the above subgroup results were caused by the mismatch between the patient subgroups and the controls in terms of the variables which defined patient subgroups, we performed the second subgroup analysis where the controls were also divided into subgroups according to family history and menopausal status (Table 3). The second subgroup analysis was only performed in the Swedish sample, because the Finnish controls lack information on family history and menopausal status. This yielded similar evidence for the association of the sub-pathway with the hormone-driven subtypes of breast cancer as in Table 2. We further investigated the impact of reproductive risk factors on the genetic association of the androgen-to-estrogen conversion sub-pathway with breast cancer. Because the risk factor information is not available for the Finnish controls, the analysis of the reproductive risk factors was performed in the Swedish samples where information on such factors is available. We performed the AML analysis of the androgen-to-estrogen conversion sub-pathway with adjustment for the reproductive risk factors (parity, age at the first birth, age at menarche and age of menopause) and HRT use. We investigated this primarily to assess whether any of the reproductive risk factors could be in the causal pathway. Since p-values remained almost unchanged in all analyses (Table 4), it appears that none of the reproductive risk factors are likely to be in the causal pathway. Attempting to refine the association within the androgen-to-estrogen conversion sub-pathway, we performed a gene-based AML analysis in the combined Swedish/Finnish breast cancer sample and the Swedish endometrial cancer sample. Among the 15 genes tested (Table 5), strong association was observed for CYP19A1 with both breast (pglobal = 0. 003) and endometrial (pglobal = 0. 006) cancer and UGT2B4 (pglobal = 0. 002) with breast cancer only. The associations in breast cancer survived correction for multiple testing of 15 genes (pglobal corrected = 0. 045 for CYP19A1 and 0. 03 for UGT2B4). We also observed suggestive association for UGT2B11 in breast and endometrial cancer as well as for HSD11B1, SULT2A1 and SULT2B1 in breast cancer. Consistent with the pathway-based associations, the gene-based associations are generally more significant in sporadic postmenopausal patient samples than in the whole breast cancer sample (except SULT2B1). Furthermore, the importance of CYP19A1 and UGT2B4 in breast cancer risk is supported by the fact that excluding either gene from the global test of the sub-pathway reduced the global significance of association for the sub-pathway, from 0. 0015 to 0. 011 for CYP19A1, and to 0. 010 for UGT2B4. However, the fact that the association for the sub-pathway remained significant, after excluding either gene, suggests that, although CYP19A1 and UGT2B4 are the major players, genetic variation within other genes also contributes to the association within the sub-pathway. Our pathway-based multi-SNP association analysis revealed a significant association between genetic variants in the androgen-to-estrogen conversion sub-pathway and the risk of two hormone dependent cancers. The association was particularly strong for ER+, sporadic breast cancer. Single SNP analysis did not reveal a similar association. We used the AML-based multi-SNP analysis, which has been shown to be more powerful than single SNP tests to yield significant and consistent association, when genetic risk is carried by multiple risk alleles each with moderate effect [11]. Pathway-based approaches are just beginning to be applied in association analysis [12]. Recently, an association study of 9 candidate gene groups (involving 120 candidate genes) was performed in breast cancer by using the AML approach, and interestingly, only the group of 8 genes involved in the steroid hormone signalling were significantly associated [13]. Our study has moved one step further and highlights the fact that the power of the pathway-based association analysis can be increased when analysis is guided by well-defined biological information. We believe that pathway approaches have potential to move genome-wide association studies beyond their initial success of identifying some ‘low-hanging fruits’ to revealing many weak genetic risk alleles that have been missed by single SNP analysis. Unless one enzyme is the rate limiting step for the entire metabolic pathway, it is not likely that small functional perturbations of individual variants would have a major impact on the overall effect of the metabolic pathway. To test the hypothesis that several genetic variants, each conferring weak to moderate effects, contribute to genetic risk, we adopted a systematic pathway-based approach for association analysis by testing the joint effect of multiple genetic variants in a progressive fashion from the whole metabolic pathway to biochemical sub-pathways and further down to individual genes. Such a progressive approach allows us to not only establish consistent association in three cancer samples from two different populations but also to refine the association of the androgen-to-estrogen conversion component of the metabolic pathway. Our study may therefore have advanced our understanding of the role of estrongen metabolism in breast and endometrial cancers by 1) accounting for the ambiguity surrounding the genetic association results and 2) indicating the androgen-to-estrogen conversion to be the important component of the metabolic pathway in modulating the risk and therefore to be a worthy focus for future studies. After menopause, ovarian estrogen production dramatically declines and conversion of adrenal androgens to estrogens in peripheral tissues becomes the major source of circulating estrogens. The final step of this conversion is catalyzed by aromatase, encoded by CYP19A1 [11]. Thus, there is biological plausibility in the association between CYP19A1 polymorphisms and postmenopausal breast cancer. Moreover, pharmacological inhibition of aromatase prevents recurrences in postmenopausal women with estrogen-receptor-positive breast cancer and new contralateral primaries [14], which has challenged the previous routine of a 5-year course of tamoxifen alone [15]. Our study has advanced our understanding of CYP19A1 by suggesting that the modulation of aromatase activity by either germ-line variation or pharmacological agents can influence the development of ER+ tumour in postmenopausal women. Furthermore, the convergence of genetic and pharmacological effects of CYP19A1 also raises therapeutic possibilities. For example, other genes implicated by our genetic study, such as UGT2B4, might also be pharmacological targets for treating breast cancer. Hormone exposure is a common risk factor for breast and endometrial cancer. Our employment of the three samples of two different hormone-related cancers from two different populations allowed us to apply a very stringent criterion for declaring an association. Furthermore, results of our breast cancer patient subgroup analysis indicate that the genetic determinants within the androgen-to-estrogen conversion sub-pathway may play a more prominent role in postmenopausal women with sporadic ER+ tumors, further suggesting that the modulation of hormone exposure by genetic variation may have a differential impact on breast tumor subtypes. Endogenous sex hormone level appears to be associated with breast cancer risk in postmenopausal women [16], and particularly with the risk of ER+/PR+ breast tumors [17]. The effect of hormone-related factors on breast cancer risk apparently differs by ER status [18] and menopause status [19], [20]. It could also differ by the status of family history of the disease, as suggested by a recent study showing that most cases of hereditary breast cancer are probably not related to cumulative hormone exposure [21]. Our findings may have therefore advanced the development of a general model for breast cancer risk: hormonal factors, both genetic and reproductive, can play a key role in the genesis of post-menopausal and “sporadic” breast cancer, whereas genes involved in DNA repair, checkpoints, and genetic stability (such as BRCA1, BRCA2, p53, ATM, CHK2) appear to be more involved in predominantly breast cancers associated with family history of disease. It is worth noting that the contribution of genetic polymorphisms to risk is a function of both their prevalence and penetrance and thus the relative importance of individual SNPs may vary from population to population. More studies in different populations are needed to fully understand the role of the androgen-to-estrogen conversion sub-pathway in breast cancer. We also want to highlight that our results are of genetic association in nature, and further studies are needed to confirm the findings and to identify functional variants causally linked to cancer risk. Swedish subjects were from a population-based case control study of breast and endometrial cancer as described [22], [23]. Briefly, the study included all incident primary invasive breast and endometrial cancers among Swedish-born postmenopausal women between 50 and 74 years of age at diagnosis, diagnosed with breast cancer between October 1993 and March 1995 and endometrial cancer between January 1994 and December 1995. All cases were identified through six regional cancer registries in Sweden, and all controls were randomly selected from the Swedish Registry of Total Population and frequency matched to the expected age distribution of the cases. Finnish breast cancer cases consist of two series of unselected breast cancer patients and additional familial cases ascertained at the Helsinki University Central Hospital. The first series of 884 patients was collected in 1997–1998 and 2000 and covers 79% of all consecutive, newly diagnosed cases during the collection periods [24], [25]. The second series, containing 986 consecutive newly diagnosed patients, was collected in 2001–2004 and covers 87% of all such patients treated at the hospital during the collection period [26]. An additional 538 familial breast cancer cases were collected at the same hospital as described [27]–[30]. 1287 anonymous, healthy female population controls were collected from the same geographical regions in Southern Finland as the cases and have been used in several studies previously [31]–[33]. Risk factor information and tumour characteristics were available for all the Swedish samples and the Finnish cases, but were missing for the Finnish controls. The Finnish samples (mean age = 56 for the cases and 41 for the controls) were younger than the Swedish samples (mean age = 63 for both the cases and controls). All the risk factor and tumour characteristics information of the subjects are summarized in Table S1 and Table S2. Written informed consent was obtained from all participating subjects, and the study was approved by the Institutional Review Boards in Sweden, Finland and at the National University of Singapore. DNA was extracted from 4 ml of whole blood using the QIAamp DNA Blood Maxi Kit (Qiagen) and non-malignant cells in paraffin-embedded tissue using a standard phenol/chloroform/isoamyl alcohol protocol [34]. We selected 35 genes involved in estradiol or estrone metabolism and expressed in the breast (based on published literatures). We selected 1007 single nucleotide polymorphisms (SNPs) in these genes and their 30kb flanking sequences from the dbSNP (build 124) and Celera databases, aiming for a marker density of at least one SNP per 5kb (Table S3). These SNPs were genotyped in 92 Swedish control samples to assess linkage disequilibrium pattern and coverage. Haplotypes were reconstructed using the PLEM algorithm [35] implemented in the tagSNPs program [36]. A subset of SNPs, tagSNPs, were selected based on the R2 coefficient, which quantifies how well the tagSNP haplotypes predict the genotype or haplotypes an individual carries. We chose tagSNPs so that common SNP genotypes and haplotypes (frequency ≥0. 03) were predicted with R2≥0. 8 [37]. To evaluate our tagSNPs' performance in capturing unobserved SNPs within the genes, we performed a SNP-dropping analysis [38], [39]. In brief, each of the genotyped SNPs was dropped in turn and tagSNPs were selected from the remaining SNPs so that their haplotypes predicted the remaining SNPs with an R2 value of 0. 85. We then estimated how well the tagSNP haplotypes of the remaining SNPs predicted the dropped SNP, an evaluation that can provide an unbiased and accurate estimate of tagSNP performance [38], [39]. Overall, we selected and genotyped 302 tagSNPs from the 35 genes in all the Swedish cases and controls. Genotyping was performed using the Sequenom system (San Diego, California). All genotyping results were generated with positive and negative controls and checked by laboratory staff unaware of case-control status. Of the 302 tagSNPs, 42 SNPs failed in the development stage of Sequenom genotyping assays. SNPs with a call rate <85% (8 SNPs), minor allele frequency <1% (9 SNPs) or out of Hardy-Weinberg Equilibrium (p<0. 05/252,4 SNPs) were excluded from further analysis. Overall, 239 tagSNPs from the 35 genes were successfully genotyped (Table S3). The genotype concordance was >99%, suggesting high genotyping accuracy. The Cochran-Armitage trend test was performed for each of the 239 SNPs. One approach for assessing the departure of the distribution of the (Cochran-Armitage) test statistics from the (global) null distribution (no SNPs associated) has been described by Tyrer et. al. [9]. The approach is based upon fitting a mixture model to the distribution of the test statistics, with two components, one representing SNPs which are independent of the case-control status, the other representing SNPs associated with case-control status. The Cochran-Armitage test statistics for the associated SNPs are assumed to all have the same (chi-squared) non-centrality parameter value. The distributed software for the “admixture maximum likelihood” (AML) test of Tyrer et. al. [9] calculates empirical p-values based on a “pseudo-likelihood ratio” test, comparing the ratio of values of the optimized likelihoods under the null and alternative hypotheses for the observed data, with the corresponding values obtained from a large number of data sets with case-control status permuted randomly. It also provides an estimate of the non-centrality parameter which is a measure of the common effect size of the associated SNPs within the pathway. We performed the AML-based global test of association for the full metabolic pathway as well as for 3 sub-pathways (see results section). In addition, we performed gene-specific analyses, using the AML-based global test on SNPs within genes, within the androgen-estrogen conversion sub-pathway. We also carried out AML tests adjusted for a non-genetic risk factor using software provided by the authors of Tyrer et al. [9].	Estrogen exposure is the most important risk factor for breast and endometrial cancers. Genetic variation of the genes involved in estrogen metabolism has, however, not been consistently associated with these two cancers. We posited that the genetic risk associated with the estrogen metabolic genes is likely to be carried by multiple variants and is therefore most effectively detected by multi-variant analysis. We carried out a comprehensive association analysis of the estrogen metabolic pathway by interrogating SNPs within 35 genes of the pathway in three tumor samples from Sweden and Finland. Through pathway-based multi-variant association analysis, we showed that the genetic variation within the estrogen metabolic pathway is associated with risk for breast and endometrial cancers and that the genetic variation within the genes involved in androgen-to-estrogen conversion is particularly important for the development of ER–positive and sporadic breast tumors in postmenopausal women. Our study has demonstrated that the influence of genetic variation on hormone exposure has an impact on breast cancer development, especially on the development of hormone-driven breast tumor subtypes. Our study has also highlighted that future genetic studies of the estrogen metabolic genes should focus on the androgen-to-estrogen conversion process.	Abstract Introduction Results Discussion Materials and Methods	oncology/breast cancer oncology/gynecological cancers genetics and genomics/genetics of disease genetics and genomics/cancer genetics genetics and genomics/population genetics	2010	Multi-Variant Pathway Association Analysis Reveals the Importance of Genetic Determinants of Estrogen Metabolism in Breast and Endometrial Cancer Susceptibility	5,791	263
Macrophage migration inhibitory factor (MIF) has emerged as a pivotal mediator of innate immunity and has been shown to be an important effector molecule in severe sepsis. Melioidosis, caused by Burkholderia pseudomallei, is an important cause of community-acquired sepsis in Southeast-Asia. We aimed to characterize the expression and function of MIF in melioidosis. MIF expression was determined in leukocytes and plasma from 34 melioidosis patients and 32 controls, and in mice infected with B. pseudomallei. MIF function was investigated in experimental murine melioidosis using anti-MIF antibodies and recombinant MIF. Patients demonstrated markedly increased MIF mRNA leukocyte and MIF plasma concentrations. Elevated MIF concentrations were associated with mortality. Mice inoculated intranasally with B. pseudomallei displayed a robust increase in pulmonary and systemic MIF expression. Anti-MIF treated mice showed lower bacterial loads in their lungs upon infection with a low inoculum. Conversely, mice treated with recombinant MIF displayed a modestly impaired clearance of B. pseudomallei. MIF exerted no direct effects on bacterial outgrowth or phagocytosis of B. pseudomallei. MIF concentrations are markedly elevated during clinical melioidosis and correlate with patients' outcomes. In experimental melioidosis MIF impaired antibacterial defense. Macrophage migration inhibitory factor (MIF) was one of the first cytokines to be discovered almost half a century ago [1]–[4]. Since then MIF has emerged as a pivotal mediator of innate immunity in various inflammatory diseases such as rheumatoid arthritis and atherosclerosis [5], [6] and is considered to be an integral component of the host antimicrobial alarm system [4], [7]. MIF, a classical proinflammatory cytokine, is constitutively expressed by many tissues with environmental contact such as the lung and the gastrointestinal tract, and by numerous cell types, among others T- and B-lymphocytes, monocytes and macrophages [4]. MIF-deficient macrophages are hyporesponsive to lipopolysaccharide (LPS) due to a down-regulation of Toll-like receptor (TLR) -4 [8], [9]. In line, MIF knockout mice were resistant to LPS induced toxic shock [8]–[10]. Recently it was shown that blood concentrations of MIF are elevated in patients with sepsis and able to predict early mortality [11]–[14]. Similarly, MIF is increased in patients with meningococcal disease and highest in the presence of shock [15]. Excitingly, treatment with anti-MIF antibodies protected mice from lethal peritonitis induced by Escherichia coli or cecal ligation and puncture (CLP) [16]. Furthermore, ISO-1 and OXIM-11, new small molecule inhibitors of MIF, offered significant protection to mice from CLP-induced sepsis [17], [18]. These data identified MIF as a potential mediator of lethality following abdominal sepsis. In Southeast-Asia and Northern-Australia the gram-negative bacillus Burkholderia pseudomallei is an important cause of community-acquired sepsis [19], [20]. More than half of these cases of melioidosis, as this severe infection is named, habitually presents with pneumonia, frequently associated with bacterial dissemination to distant sites [19]–[21]. In the present study we aimed to characterize the expression and function of MIF in melioidosis. For this we analysed MIF expression patterns in patients with melioidosis and in a mouse model of B. pseudomallei infection. MIF function was investigated in experimental murine melioidosis using anti-MIF antibodies and recombinant MIF. The patient study was approved by both the Ministry of Public Health, Royal Government of Thailand and the Oxford Tropical Research Ethics Committee, University of Oxford, England. We obtained written informed consent from all subjects before the study. The Animal Care and Use of Committee of the University of Amsterdam approved all murine experiments. We included 34 individuals with sepsis caused by B. pseudomallei and 32 healthy controls in this study. Individuals were recruited prospectively at Sapprasithiprasong Hospital, Ubon Ratchathani, Thailand in 2004. Sepsis due to melioidosis was defined as culture positivity for B. pseudomallei from any clinical sample plus a systemic inflammatory response syndrome (SIRS) [22]. Study design and subjects have been described in detail [23]. Human MIF was measured by ELISA, as described elsewhere [24]. In addition, MIF mRNA levels were measured as follows. Heparin blood samples were drawn from an antecubital vein and immediately put on ice. Leukocytes were isolated using erylysis buffer, dissolved in Trizol and stored at –80°C. Thereafter, RNA was isolated and analyzed by multiplex ligation-dependent probe amplification (MLPA) as described [25], [26] (MRC-Holland, Amsterdam, the Netherlands). Levels of mRNA were expressed as a normalized ratio of the peak area divided by the peak area of the β2 microglobulin (B2M) gene [25]. Male C57BL/6 mice (age 8–10 weeks) were purchased from Harlan Sprague Dawley Inc. (Horst, The Netherlands). Age-matched animals were used in each experiment. For the inoculum, B. pseudomallei strain 1026b, kindly provided by Dr. Don Woods [27], [28], was used and prepared as described [23], [29]–[31]. Pneumonia was induced by intranasal inoculation of a 50 µl (5×101,2. 5×102 or 7. 5×102 colony forming units (CFU) /50 µl) bacterial suspension. 48 hours after infection, mice were anesthetized and sacrificed by bleeding from the vena cava inferior [23], [30], [32]. CFUs were determined from serial dilutions of organ homogenates as described [23], [29]–[31]. In some experiments mice were injected intraperitoneally with 2 mg of anti-MIF or non-immune IgG 2 hours before bacterial inoculation or with 50 µg recombinant mouse MIF or control buffer at the onset of infection as described previously [16], [33], [34]. Rabbit polyclonal anti-MIF and recombinant MIF were generated as described [16], [34]. The ELISA for mMIF developed according to the 4-span approach was used as described in detail [35]. Tumor necrosis factor (TNF) -α, interferon (IFN) -γ, interleukin (IL) -6, IL-10 and IL-12p70 were determined using a cytometric bead array (CBA) multiplex assay in accordance with the manufacturer' s instructions (BD Biosciences, San Jose, CA). Four-µm thick lung tissue sections were sampled 48 hours after infection and mounted on aminopropylmethoxysilane-coated glass slides, deparaffinized in xylol, taken through to absolute alcohol and blocked for endogenous peroxidase with 0. 1% hydrogen peroxide in methanol. They were boiled in 10 mM citrate buffer in a microwave oven and rinsed in Tris-buffered saline (TBS). To reduce non-specific binding, sections were incubated in normal goat serum (Pel-Freez Biologicals, Rogers, AK) 1∶30 in TBS. After 40-minutes incubation with polyclonal rabbit anti-MIF purified IgG diluted 1∶200 in TBS containing 2% bovine serum albumin (final immunoglobulin concentration: 25 mg/l), the sections were incubated with biotinylated goat anti-rabbit IgG (Vector, Burlingame, CA) diluted 1∶400 and then with ABC-peroxidase complex solution (Vector). Peroxidase activity was revealed with 5-5′-diaminobenzidine as chromogen and the sections were counterstained in Meyer' s acid-free hematoxylin. As a negative control, the primary antibody was replaced by pre-immune rabbit purified IgG. Furthermore, to score inflammation, lung and livers from infected mice were harvested 48 hours after infection, fixed in 10%-formalin and embedded in paraffin. Four µm sections were stained with hematoxylin and eosin and analyzed by a pathologist blinded for groups exactly as described previously [23]. B. pseudomallei strain 1026b was used and prepared as described above. In short, B. pseudomallei at concentrations from 3×103–3×106 CFU/ml was grown in the presence of recombinant MIF (dose range from 5 to 50 µg/ml) diluted in LB-growth medium. Phagocytosis was evaluated as described [36], [37]. Heat-killed B. pseudomallei was labeled with carboxyfluorescein-diacetate-succinimidyl-ester (CFSE dye, Invitrogen, Breda, The Netherlands). Peritoneal macrophages (derived from 5 different mice per group) were incubated with CFSE-labeled B. pseudomallei (2. 5×107 CFU/ml) for 0,60 and 120 minutes. Phagocytosis was stopped by placing cells on ice; thereafter cells were washed in PBS and suspended in Quenching solution (Orpegen, Heidelberg, Germany). To determine the neutrophil phagocytosis capacity, 50 µl of whole blood was incubated with bacteria after which cells were suspended in Quenching solution, incubated in FACS lysis/fix solution (BecktonDickinson) and neutrophils were labeled using anti-Gr-1-PE (Pharmingen). Phagocytosis was determined using FACS. Values are expressed as means ± standard error of the mean (SEM). Differences between groups were analyzed by Mann-Whitney U test or Kruskal-Wallis analysis with Dunn' s posthoc test where appropriate. For survival analysis, Kaplan-Meier analysis followed by log rank test was performed. These analyses were performed using GraphPad Prism version 4. 00, GraphPad Software (San Diego, CA). Values of P<0. 05 were considered statistically significant. To obtain an insight into MIF expression during melioidosis, we first measured MIF in plasma from 34 patients with culture proven B. pseudomallei infection and in plasma from 32 local healthy controls. The mortality rate in this cohort of patients was 44%. MIF was markedly elevated in melioidosis patients with mean plasma concentrations that were approximately 2-fold higher than in those of healthy subjects (Figure 1A, P<0. 01). Plasma concentrations of MIF were associated with an adverse outcome: on admission patients who went on to had higher MIF concentrations than those who survived (Figure 1B, P<0. 01). In line, MIF mRNA levels were significantly higher in peripheral blood leukocytes from patients than in leukocytes from healthy controls (Figure 1C, P<0. 001). Since the majority of severe melioidosis cases presents with pneumonia with bacterial dissemination to distant body sites [19]–[21] and considering the fact that it is not feasible to study MIF expression at tissue level in patients with melioidosis, we used a well-established murine model of pneumonia-derived melioidosis in which mice are intranasally infected with B. pseudomallei [23], [29], [31]. In agreement with the data obtained in patients with melioidosis, infected mice showed an abundant upregulation of MIF expression, both in the pulmonary and systemic compartment (Figure 2, both P<0. 01). Immunohistochemical staining of lung tissue was performed to further identify the distribution of MIF expression during melioidosis. Positive immunostaining for MIF was observed in untreated control animals in alveolar macrophages and within the bronchial epithelium (Figure 3A). Granulocytes did not stain positive for MIF. After infection with B. pseudomallei there was a marked increase in immunostaining of the epithelial submucosa, bronchial epithelial cells and inflammatory cells, most notably of alveolar macrophages (Figure 3B). To obtain a first insight into the function of MIF during experimental melioidosis, we treated mice infected with 2. 5×102 CFU B. pseudomallei mice with 50 µg recombinant MIF using a dose similar to that used previously in an experimental septic shock model [16], [33]. Treatment of mice with recombinant MIF at the time of infection resulted in increased MIF concentrations in lung homogenates 48 hours later (from 33±1. 3 to 729±56. 6 ng/ml; P<0. 001). Mice were sacrificed 48 hours after inoculation to determine bacterial loads in lungs (the primary site of the infection), liver and blood (to evaluate to which extent the infection disseminated to distant body sites) (Figure 4). Relative to infected but non-treated controls, mice treated with recombinant MIF displayed almost 10-fold higher bacterial loads in the liver (Figure 4, P<0. 01). In addition, a clear trend was seen towards higher bacterial loads in the pulmonary and systemic compartments of recombinant MIF treated mice, although the differences with control mice did not reach statistical significance (Figure 4). Having found that administration of supra physiological doses of MIF results in a partially impaired bacterial clearance during experimental melioidosis, we next hypothesized that treatment with anti-MIF antibodies would result in decreased bacterial outgrowth and performed the reverse experiment by examining the effect of anti-MIF treatment. Therefore, before inoculating mice with B. pseudomallei, we injected mice with anti-MIF antibodies using a dosing schedule previously found be protective in a mouse model of E. coli or CLP-induced peritonitis [16], [33]. To evaluate whether anti-MIF treatment interferes with bacterial clearance, we first determined bacterial loads 48 hours after infection with an inoculum of 2. 5×102 CFU B. pseudomallei (Figure 5). At this dose no significant differences in bacterial outgrowth in either lungs, liver or blood were observed. To determine whether the effect of anti-MIF therapy is dependent on the size of the infectious dose, we next infected mice with a higher (5×102 CFU B. pseudomallei) and lower (5×101 CFU B. pseudomallei) inoculum (Figure 6). At the highest dose no effect of anti-MIF treatment was seen on the bacterial outgrowth in the lungs, liver or blood (Figure 6B). However, at the lowest inoculum mice treated with anti-MIF had almost 10-fold less B. pseudomallei CFU in their lungs compared to control mice (Figure 6A, P<0. 05). With this low inoculum, none of the mice showed positive Burkholderia cultures in liver or blood, suggesting that anti-MIF treatment inhibits the growth of B. pseudomallei in the lungs after infection with a relatively low bacterial dose. Lastly, we performed a survival experiment in which mice were injected intraperitoneally with 2 mg of anti-MIF or non-immune control IgG 2 hours before intranasal inoculation with B. pseudomallei. In accordance with the modest protective effect of anti-MIF treatment on bacterial outgrowth a limited survival advantage was seen in the anti-MIF treated group (Figure 7). Since cytokines are important regulators of the inflammatory response to acute lower respiratory tract infection [38] and given the observation that protective anti-MIF treatment reduced TNFα concentrations in mouse model of sepsis induced by E. coli or CLP [16], [33], we measured the concentrations of TNFα, IL-6, IL-10, IL-12 and IFNγ in lung homogenates and plasma obtained 48 after infection with 2. 5×102 CFU B. pseudomallei (Table 1). Anti-MIF treatment did not influence pulmonary cytokine concentrations in our model of experimental melioidosis (Table 1). Previously it was shown that plasma TNFα concentrations induced by LPS were lower in MIF-deficient mice compared to wild-type mice [10], [33]. However also in plasma no differences in TNFα or IL-6, IL-10, IL-12 and IFNγ concentrations were seen between anti-MIF treated and control mice after inoculation with B. pseudomallei (data not shown). In addition treatment with 50 µg recombinant MIF did not influence cytokine concentrations in either the pulmonary (Table 1) or systemic compartment (data not shown). Considering that MIF is regarded as an important proinflammatory mediator, we determined whether modulation of MIF concentrations could have an effect on organ inflammation during experimental melioidosis. Therefore, we performed histopathological analyses of lung and liver tissues in control mice and mice treated with anti-MIF or recombinant MIF and infected with B. pseudomallei. Although all mice showed evidence of inflammation as characterized by diffuse infiltrates, interstitial inflammation and bronchitis there were no differences in total organ histopathological scores between groups (data not shown). Having found that anti-MIF treated mice showed lower bacterial loads in their lungs upon infection with a low inoculum while mice treated with recombinant MIF displayed a modestly impaired clearance of B. pseudomallei, we next wished to determine whether MIF has a direct effect on bacterial outgrowth and/or phagocytosis. Therefore, B. pseudomallei (at concentrations from 3×103–3×106 CFU/ml) was grown in the presence of recombinant MIF diluted in the growth medium (dose range from 5 to 50 µg/ml). However, no effects of recombinant MIF on bacterial outgrowth could be observed at any time point (up to 2 hours; data not shown). Lastly, we studied whether MIF contributes to phagocytosis of B. pseudomallei. However no effects of anti-MIF treatment on phagocytosis of B. pseudomallei by peritoneal macrophages or whole blood neutrophils could be observed (data not shown). In the present study we aimed to characterize the expression and role for MIF in melioidosis, linking observational studies in patients with culture-proven disease with functional studies in mice in which we modulated the concentrations of MIF during experimentally induced melioidosis. Our study shows that patients with severe melioidosis have strongly increased MIF plasma and MIF mRNA leukocyte levels. High plasma MIF concentrations were associated with mortality. Similarly, mice intranasally inoculated with B. pseudomallei displayed a strong increase in pulmonary and systemic MIF expression. The functional role of MIF in our model of experimental melioidosis however was modest given the fact that modulation of MIF levels only moderately influenced the innate immune response towards B. pseudomallei. Anti-MIF treatment resulted in a modest survival benefit. Anti-MIF treatment only decreased bacterial outgrowth when mice were inoculated with a low dose of B. pseudomallei whereas - conversely - mice treated with recombinant MIF displayed a modestly impaired clearance of B. pseudomallei. These data are the first to report on the expression and function of MIF during melioidosis. MIF expression is increased in a wide variety of infectious diseases, ranging from viral infections, such as Dengue, HIV and West Nile virus infection [39]–[41], malaria [42], tuberculosis [43] and various forms of sepsis [11], [12], [15]. Our study further extends these findings by demonstrating increased plasma and blood leukocyte mRNA levels of MIF in patients with severe melioidosis. Importantly, we demonstrated a strong association between elevated MIF levels and increased mortality. This is in line with a recent study among pediatric and adult patients with severe sepsis or septic shock caused predominantly by Neisseria meningitides and other gram-negative bacteria in which elevated MIF levels were shown to be predictive of early mortality [12]. MIF, however, is not always upregulated after acute infection or inflammation. For instance, in children with acute malaria circulating MIF levels were significantly lower compared with healthy, malaria-exposed children [44]. Furthermore, MIF release could not be detected in a human endotoxemia model and is not produced by whole blood cells incubated with LPS [15]. Also in HIV seropositive patients low serum MIF levels were associated with a high 1-month mortality [41]. This further highlights the potential diverse roles MIF can play in the host response against various invading pathogens. Melioidosis, which is the most common form of community-acquired sepsis in Northern-Australia and Eastern-Thailand, is associated with a mortality of up to 50% in endemic areas [19], [20]. Severe pneumonia with bacterial dissemination to distant body sites is a common presentation of melioidosis [20], [21]. Sepsis caused by B. pseudomallei is characterized by a markedly proinflammatory cytokine profile; in the current cohort of patients we have demonstrated increased plasma concentrations of IL-6, IL-8 and IL-18 when compared to controls [31], [45]. In addition, high throughput mRNA profiling in these patients suffering from severe melioidosis furthermore demonstrated increased transcription of a whole array of proinflammatory genes in whole blood leukocytes [26]. In light of the proinflammatory properties attributed to MIF in sepsis, we studied the expression and function of MIF in a well-established mouse model of melioidosis [23], [29], [31]. In line with our patient data and in line with various other murine models of sepsis induced by LPS, E. coli or CLP [4], [16], [46], we observed a strong upregulation of MIF expression in both the lungs and blood of mice inoculated with B. pseudomallei. However, MIF seems to play a less important role in the innate immune response in melioidosis, which is in contrast with previous studies pointing towards a central role of MIF in other forms of infection. With regard to bacterial infection, the role of MIF has been first studied in abdominal sepsis caused by either intraperitoneal injection of E. coli or CLP [9], [16]. In these models, anti-MIF from the same source and administered in the exact same dose protected mice from mortality, reduced TNFα concentrations and diminished bacterial growth. Very recently it was shown that polymorphisms associated with higher MIF expression may have a beneficial effect in community-acquired pneumonia [47]. In addition, modulation of MIF may have therapeutic advantages in treating acute lung injury in patients with acute pancreatitis complicated by bacterial infection [48]. The fact that anti-MIF only has a minor impact on the immune response to B. pseudomallei could be related to differences in the primary site of infection and/or differences in the pathogens involved [9], [16]. In this respect it is worthwhile noting that MIF regulates innate immune responses in gram-negative infections through modulation of Toll-like receptor 4 [8]. We obtained recent evidence - counter intuitively for a gram-negative infection - that TLR2 impacts on the immune response of the intact host in vivo, whereas TLR4 does not contribute to protective immunity in melioidosis [23]. As such, the minor role of TLR4 in the innate immune response towards B. pseudomallei could be an explanation for our present findings revealing an equally limited role for MIF in melioidosis. Interestingly, during murine Listeria monocytogenes infection, the elimination of bacteria from the spleen and liver was not affected by anti-MIF antibody although this treatment was able to rescue mice from lethal infection [49]. In reverse experiments we found that treatment of B. pseudomallei infected mice with recombinant MIF caused impairment of the bacterial clearance capability. Earlier studies showed that recombinant MIF increased mortality during E. coli sepsis when co-injected with bacteria in mice [16], [33], [50]. In these investigations the effect of recombinant MIF on bacterial loads was not reported. These findings imply that increased concentrations of MIF can be harmful in the acute host response against invading bacteria. In this respect it is of interest that during the immune suppressed state which occurs in the late phase of the septic response and which is characterized by a reduced capacity of immune cells to produce proinflammatory cytokines such as TNFα, it was shown that treatment with recombinant MIF could protect animals from bacterial superinfection in a mouse model of CLP-induced peritonitis [51]. This further highlights the potential diverse nature of MIF function during the course of sepsis. Our study has several limitations. Our observations were done in patients with sepsis caused by B. pseudomallei and caution is required when extending these findings to less severe or chronic melioidosis, since we focused on the early acute phase of melioidosis. Furthermore, although our in vivo model of melioidosis has been important in elucidating the role of other inflammatory mediators in melioidosis [23], [29], [31], data obtained from a mouse model by definition should be extrapolated to patients with melioidosis with great caution. In addition, it would be of interest to confirm our results in MIF knockout mice, although we consider it less likely that the use of these mice will yield strongly different data in light of the modest differences observed in the different treatment groups. Lastly, obtaining new biological insights from studies using antibodies and recombinant proteins of interest remains a challenge, limited by the notion of considerable cooperation between inflammatory factors involved and extensive redundancy in the host response against invading pathogens [52]. In conclusion, MIF concentrations are markedly increased during melioidosis, and elevated levels correlate with mortality. Although mice with experimentally induced melioidosis showed strongly upregulated expression of MIF in lungs and blood, inhibition of MIF with a specific antibody only modestly influenced the host response. Similarly, administration of recombinant MIF did not strongly impact on the immune response to B. pseudomallei infection. These data argue against an important role for MIF in the pathogenesis of melioidosis.	Melioidosis is a severe tropical infection caused by the bacterium Burkholderia pseudomallei. B. pseudomallei is the major cause of community-acquired septicemia in northeast Thailand with a mortality rate in severe cases of around 40% Little is known, however, about the mechanisms of the host defense to B. pseudomallei infection. Macrophage migration inhibitory factor (MIF) is a proinflammatory cytokine that has emerged as an important mediator of the host defense in severe bacterial infections. In this article, we studied the expression and function of MIF both in patients with melioidosis and in mice during experimental melioidosis. We found that MIF concentrations were elevated in patients with melioidosis. Furthermore, high MIF concentrations are associated with poor outcome in patients with melioidosis. Also, in mice with experimentally induced melioidosis, we observed an upregulation of MIF concentrations. Furthermore, mice with melioidosis that were treated with a MIF blocking treatment showed lower bacterial counts in their lungs during infection. In conclusion, MIF seems to impair host defense mechanisms during melioidosis.	Abstract Introduction Methods Results Discussion	immunology/cellular microbiology and pathogenesis respiratory medicine/respiratory infections infectious diseases/neglected tropical diseases microbiology/innate immunity pathology/histopathology immunology/innate immunity critical care and emergency medicine/sepsis and multiple organ failure pathology/immunology immunology/immunity to infections	2010	Expression and Function of Macrophage Migration Inhibitory Factor (MIF) in Melioidosis	6,418	275
"At present, screening of the population at risk for gambiense human African trypanosomiasis (HAT) i(...TRUNCATED)	"Control of the chronic form of sleeping sickness or gambiense human African trypanosomiasis (HAT) c(...TRUNCATED)	Abstract Introduction Materials and Methods Results Discussion	"medicine\ninfectious diseases\ntest evaluation\ndiagnostic medicine\nafrican trypanosomiasis\nnegle(...TRUNCATED)	2012	"Identification of Mimotopes with Diagnostic Potential for Trypanosoma brucei gambiense Variant Surf(...TRUNCATED)	10,563	207
"Accurate forecasts of influenza incidence can be used to inform medical and public health decision-(...TRUNCATED)	"Influenza is responsible for an estimated 3–5 million cases and 300–650,000 deaths each year wo(...TRUNCATED)	Abstract Introduction Materials and methods Results Discussion	"medicine and health sciences\nstatistics\ninfluenza\ngeographical regions\natmospheric science\ntem(...TRUNCATED)	2019	Development and validation of influenza forecasting for 64 temperate and tropical countries	4,897	210
"The cell wall of Gram-positive bacteria is a complex network of surface proteins, capsular polysacc(...TRUNCATED)	"Gram-positive bacteria such as the opportunistic pathogen Staphylococcus aureus have their cell wal(...TRUNCATED)	Abstract Introduction Results Discussion Materials and Methods	"medicine\ninfectious diseases\nmodel organisms\nimmunology\nbiology\nmicrobiology\nmolecular cell b(...TRUNCATED)	2011	"Wall Teichoic Acids of Staphylococcus aureus Limit Recognition by the Drosophila Peptidoglycan Reco(...TRUNCATED)	10,765	302
"In convergent-extension (CE), a planar-polarized epithelial tissue elongates (extends) in-plane in (...TRUNCATED)	"The development of an embryo from a fertilized egg to an adult organism requires not only cell prol(...TRUNCATED)	Abstract Introduction Methods Results Discussion	"cell physiology\nclassical mechanics\nfluid mechanics\ncondensed matter physics\nanisotropy\nsurfac(...TRUNCATED)	2016	Filopodial-Tension Model of Convergent-Extension of Tissues	9,185	196
"Recent outbreaks of locally transmitted dengue and Zika viruses in Florida have placed more emphasi(...TRUNCATED)	"Aedes aegypti (Yellow-fever mosquito) and Aedes albopictus (Asian Tiger mosquito) can vector a vari(...TRUNCATED)	Abstract Introduction Methods Results Discussion	"united states\ninvertebrates\ndengue virus\nmedicine and health sciences\npathology and laboratory (...TRUNCATED)	2018	"Quantification of permethrin resistance and kdr alleles in Florida strains of Aedes aegypti (L.) an(...TRUNCATED)	7,836	265

End of preview. Expand in Dataset Viewer.

scientific_lay_summarisation - PLOS - normalized

This dataset is a modified version of tomasg25/scientific_lay_summarization and contains scientific lay summaries that have been preprocessed with this code. The preprocessing includes fixing punctuation and whitespace problems, and calculating the token length of each text sample using a tokenizer from the T5 model.

Original dataset details:

Repository: https://github.com/TGoldsack1/Corpora_for_Lay_Summarisation
Paper: Making Science Simple: Corpora for the Lay Summarisation of Scientific Literature

Data Cleaning

The text in both the "article" and "summary" columns was processed to ensure that punctuation and whitespace were consistent. The fix_punct_whitespace function was applied to each text sample to:

Remove spaces before punctuation marks (except for parentheses)
Add a space after punctuation marks (except for parentheses) if missing
Handle spaces around parentheses
Add a space after a closing parenthesis if followed by a word or opening parenthesis
Handle spaces around quotation marks
Handle spaces around single quotes
Handle comma in numbers

Tokenization

The length of each text sample was calculated in terms of tokens using the T5 tokenizer. The calculate_token_length function was used to encode each text sample using the tokenizer and return the number of resulting tokens. The resulting token lengths were added as new columns to the dataframes.

Data Format

The resulting processed data files are stored in Apache parquet and can be loaded using the pandas' library or the datasets' library from the Hugging Face transformers package. The relevant column names and data types for summarization are

DatasetDict({
    train: Dataset({
        features: ['article', 'summary', 'section_headings', 'keywords', 'year', 'title', 'article_length', 'summary_length'],
        num_rows: 24773
    })
    test: Dataset({
        features: ['article', 'summary', 'section_headings', 'keywords', 'year', 'title', 'article_length', 'summary_length'],
        num_rows: 1376
    })
    validation: Dataset({
        features: ['article', 'summary', 'section_headings', 'keywords', 'year', 'title', 'article_length', 'summary_length'],
        num_rows: 1376
    })
})

Usage

Load the desired parquet file(s) using pandas or datasets. Here is an example using pandas:

# download the dataset files by clicking on 'use in datasets' and cloning 
import pandas as pd

# Load train set
df = pd.read_parquet("scientific_lay_summarisation-plos-norm/train.parquet")
print(df.info())

And here is an example using datasets:

from datasets import load_dataset

dataset = load_dataset("pszemraj/scientific_lay_summarisation-plos-norm")
train_set = dataset['train']
# Print the first few samples
for i in range(5):
    print(train_set[i])

Token Lengths

For train split:

Downloads last month: 107

Edit dataset card

Size of the auto-converted Parquet files:

561 MB

Number of rows:

27,525

Models trained or fine-tuned on pszemraj/scientific_lay_summarisation-plos-norm