Datasets:

Joemgu

/

sumstew

like 9

Summarize: Google has warned changes being proposed to the issue of search warrants in the US could lead to devices being tracked around the world. Google has condemned proposals that will allow the US government to remotely search computers anywhere in the world. An advisory committee plans to change the way search warrants are issued by federal and state judges. The amendment would let the US government obtain a warrant to conduct ‘remote access’ searches of electronic storage media if its location is ‘concealed by technological means.’ But in a blog post strongly opposing these plans, Google has warned this amendment could lead to devices being tracked globally and is calling on the debate to be taken to Congress. The amendment was proposed last year by the Advisory Committee on the Rules of Criminal Procedure, at the request of the Department of Justice. It specifically relates to Federal Rule of Criminal Procedure 41 that governs the issue of search warrants. As it stands, Rule 41 largely prohibits a federal judge from issuing a search warrant outside of the judge’s district. Under the proposals, exceptions to this rule would be added to include computers and networks. In particular, the change would let authorities apply for a warrant and remotely search storage if the media has been hidden. The location of such media can be concealed using private networks, for example, or by rerouting traffic across multiple servers. The committee explained the searches would be useful when investigating botnets, for example, but Google is concerned. Botnets are network of computers that are controlled by hackers to send spam or spread malware. Criminals use malicious software to turn a victim's computer into a bot, also known as a zombie. The computer can then be used to spread files without the owner's knowledge. The California firm’s legal director Richard Salgado said: ‘The implications of this expansion of warrant power are significant, and are better addressed by Congress. ‘First, the proposed amendment would likely end up being used by authorities to directly search computers and devices around the world.’ He continued that even if the committee intends to apply the changes to devices in the US, ‘there is nothing in the proposed change to Rule 41 that would prevent access to computers and devices worldwide.’ Google is concerned the proposal is open to interpretation and said the amendment would 'likely end up being used to search devices around the world’. It said the proposal equally doesn't define what is, or would warrant, a remote search and is therefore calling for the changes to be debated by Congress (filing pictured) Secondly, he believes the proposal threatens to undermine the privacy rights and computer security of internet users. For example, the change would ignore territorial limits on the use of warrants to conduct ‘remote access’, and the proposal does not define under what circumstances a remote search could be undertaken. The amendment was proposed last year by the Advisory Committee on the Rules of Criminal Procedure, at the request of the Department of Justice. It specifically relates to Federal Rule of Criminal Procedure 41 which governs the issue of search warrants. As it stands, Rule 41 largely prohibits a federal judge from issuing a search warrant outside of the judge’s district. Under the proposals, exceptions to this rule would be added to include computers and networks. In particular, the change would let authorities apply for a warrant and remotely search storage if the media has been hidden. The location of media can be concealed using private networks, for example, or by rerouting traffic across multiple servers. The committee explained that the searches would be useful when investigating botnets, for example. ‘It merely assumes such searches, whatever they may be, are constitutional and otherwise legal’ continued Mr Salgado. And this ‘carries with it the spectre of government hacking without any Congressional debate or democratic policymaking process.‘. Mr Salgado also raises concerns that ‘concealed by technological means’ could be applied to the kinds of virtual private networks (VPNs) used by banks and online retailers to keep their networks secure. Google’s specific argument for wanting the issue to be debated in Congress is the risk the proposals could cause to international treaties. For example, the US has diplomatic agreements with other countries to cooperate in investigations, known as Mutual Legal Assistance Treaties (MLATs). ‘Google supports ongoing efforts to improve cooperation among governments, and we are concerned that the proposed change to Rule 41 could undermine those efforts,’ said Mr Salgado. ‘The significant foreign relations issues associated with the proposed change to Rule 41 should be addressed by Congress and the President, not the Advisory Committee. ‘The Advisory Committee is entertaining a dramatic change to electronic surveillance rules. ‘Congress is the proper body to determine whether such changes are warranted, and we urge the Committee to respect Congress’ traditional role in prescribing the substantive rules governing electronic surveillance.’ In addition to voicing its concerns, Google has officially filed its opposition to the changes to the advisory committee

Summary: Proposal was made by a committee on the Rules of Criminal Procedure. It wants to make changes to the Federal Rule of Criminal Procedure 41. This rule specifically governs the issue of search warrants in the US. Proposed change would let the government obtain a warrant to conduct'remote access' searches of media if its location is 'concealed' But Google is concerned the proposal could be open to interpretation. It said amendment would be 'used to search devices around the world' Proposal equally doesn't define what is, or would warrant, a remote search. Google is now calling for the changes to be debated by Congress.

cnn_dailymail

en

Write a title and summarize: Phlebotomine sand flies are blood-sucking insects transmitting Leishmania parasites. In bitten hosts, sand fly saliva elicits specific immune response and the humoral immunity was shown to reflect the intensity of sand fly exposure. Thus, anti-saliva antibodies were suggested as the potential risk marker of Leishmania transmission. In this study, we examined the long-term kinetics and persistence of anti-Phlebotomus papatasi saliva antibody response in BALB/c and C57BL/6 mice. We also tested the reactivity of mice sera with P. papatasi salivary antigens and with the recombinant proteins. Sera of BALB/c and C57BL/6 mice experimentally bitten by Phlebotomus papatasi were tested by ELISA for the presence of anti-saliva IgE, IgG and its subclasses. We detected a significant increase of specific IgG and IgG1 in both mice strains and IgG2b in BALB/c mice that positively correlated with the number of blood-fed P. papatasi females. Using western blot and mass spectrometry we identified the major P. papatasi antigens as Yellow-related proteins, D7-related proteins, antigen 5-related proteins and SP-15-like proteins. We therefore tested the reactivity of mice sera with four P. papatasi recombinant proteins coding for most of these potential antigens (PpSP44, PpSP42, PpSP30, and PpSP28). Each mouse serum reacted with at least one of the recombinant protein tested, although none of the recombinant proteins were recognized by all sera. Our data confirmed the concept of using anti-sand fly saliva antibodies as a marker of sand fly exposure in Phlebotomus papatasi–mice model. As screening of specific antibodies is limited by the availability of salivary gland homogenate, utilization of recombinant proteins in such studies would be beneficial. Our present work demonstrates the feasibility of this implementation. A combination of recombinant salivary proteins is recommended for evaluation of intensity of sand fly exposure in endemic areas and for estimation of risk of Leishmania transmission. Sand flies (Diptera: Phlebotominae) serve as vectors of leishmaniasis, a neglected disease with symptoms ranging from non-lethal cutaneous to life-threatening visceral form. The causative agents of the disease are protozoan parasites of the genus Leishmania which are transmitted to the hosts by the bites of infected sand fly females. The percentage of infected flies in foci of leishmaniasis fluctuates and humans and animals are more frequently exposed to the bites of uninfected sand flies. Repeated exposure to sand fly saliva elicits anti-saliva antibodies that could be used as a marker of exposure to sand fly bites [1]–[5]. Moreover, the antibodies are sand fly species-specific. Therefore they can be utilized to differentiate between exposure to vector and non-vector species [1], [4], [6]–[9]. In several epidemiological studies, anti-sand fly saliva antibodies were already employed as a reliable tool to monitor exposure to sand fly bites, to evaluate the effectiveness of vector control programs, and in some instances to estimate the risk of Leishmania transmission [1], [4], [5], [10]–[14]. In endemic areas sand fly population fluctuate seasonally [15], which may influence host anti-saliva antibody response. However, very little is known about the kinetics and persistence of anti-saliva antibodies in sera of hosts bitten by blood-feeding insects. Few data on antibody kinetics are available from mice, chicken and guinea pigs experimentally exposed to bites of Triatoma infestans [16]–[18], from humans bitten by mosquitoes [19]–[22] as well as from humans [4], [23] and dogs [3], [5], [24] bitten by sand flies. Screening for antibodies is, however, unsuitable for broader use in epidemiological studies until recombinant proteins could be employed instead of the crude salivary gland homogenate, which requires maintenance of sand fly colonies and laboratory dissections of insects. So far, only recombinant salivary proteins from Lutzomyia longipalpis have been tested for reactivity with sera of naturally bitten humans, dogs, and foxes [8], [9]. We studied mice antibody response to P. papatasi, the main vector of Leishmania major, and compared long-term kinetics and persistence of anti-saliva antibodies in BALB/c and C57BL/6 mice that are widely used as model organisms sensitive or resistant to L. major infection, respectively. Furthermore, we characterized and compared main P. papatasi salivary antigens recognized by sera of experimentally bitten BALB/c and C57BL/6 mice. The reactivity of mice sera was also tested with the four P. papatasi recombinant proteins; two Yellow-related proteins (PpSP44/AF335492 and PpSP42/AF335491) and two D7-related proteins (PpSP30/AF335489 and PpSP28/AF335488). BALB/c and C57BL/6 mice were maintained and handled in the animal facility of Charles University in Prague in accordance with institutional guidelines and Czech legislation (Act No. 246/1992 coll. on Protection of Animals against Cruelty in present statutes at large), which complies with all relevant European Union and international guidelines for experimental animals. The experiments were approved by the Committee on the Ethics of Animal Experiments of the Charles University in Prague (Permit Number: 24773/2008-10001) and were performed under the Certificate of Competency (Registration Number: CZU 934/05; CZU 307/09) in accordance with the Examination Order approved by Central Commission for Animal Welfare of the Czech Republic. A colony of Phlebotomus papatasi (originating from Turkey) was reared under standard conditions as described in [25]. Salivary glands were dissected from 4–6-day-old female sand flies, placed into 20 mM Tris buffer with 150 mM NaCl and stored at −20°C. Twelve mice of BALB/c or C57BL/6 strains (6 weeks old) were divided into experimental and control groups of six mice each. Mice in the experimentally bitten groups were exposed individually to 30 Phlebotomus papatasi females (22±0. 6 (standard error) blood-fed females per mouse per exposure on BALB/C mice; 26±0. 7 (standard error) blood-fed females per mouse per exposure on C57BL/6 mice), once a week in a total of 5 exposures (weeks 1–5). Mice in the control groups remained without any exposure to sand flies. Animals in both groups were anaesthetized (ketamin 150 mg/kg and xylazin 15 mg/kg body weight, intraperitoneally). Blood samples were taken weekly from the tail vein of each mouse one day before exposure to sand flies from week 0 (pre-immune serum) to week 12 and than every other week till the end of the experiment (week 28 for BALB/c mice; week 27 for C57BL/6 mice). In total, mice were followed for 29 and 28 weeks, respectively. Two independent experiments were done for each mice strain. To test the presence of memory cells, BALB/c mice were additionally exposed to P. papatasi bites (21±0. 5 (standard error) blood-fed females per mouse) in the week 27. Genes coding for P. papatasi salivary gland secreted proteins PpSP28 (AF335488), PpSP30 (AF335489), PpSP42 (AF335491) and PpSP44 (AF335492) were amplified from VR2001-TOPO vector [26] by PCR. Two specific restriction sites (Nde I and Bam HI) were incorporated into the PCR primers: PpSP28Fw (CATATGAAGTACCCTAGGAATGCCGAT), PpSP28Rev (GGATCCGTACGTTCTTGCGGATTGGTCATC), PpSP30Fw (CATATGCGATTTCCTAGGAATGGAGAC), PpSP30Rev (GGATCCGTATTTCCAAGATTCAATATCAAG), PpSP42Fw (CATATGAAAAGAGATGATGTTGGA), PpSP42Rev (GGATCCCCCTTGACACTTTTCTCC), PpSP44Fw (CATATGAAAAGAGACGATGTTGAA), and PpSP44Rev (GGATCCTTTAGGTTTTCTCACTTC). Afterwards, PCR products were ligated into E. coli pGEM-T Easy Vector (Promega) using TA cloning and the ligation products were transformed into E. coli competent cells TOP10 (Invitrogen). Vectors were replicated in bacteria and after that, genes restricted by Nde I and Bam HI enzymes and restricted E. coli pET-42 Expression Vectors (Novagen) were ligated. Ligation products were transformed into E. coli competent cells TOP10 (Invitrogen) again. Plasmids were isolated from the bacteria, and transformed into E. coli BL21 (DE3) gold (Agilent) for expression. E. coli lysates were prepared under denaturing conditions and His-tagged proteins were purified by FLPC on a Ni-NTA Superflow column with The QUIaxpressionist kit (Quiagen) according to manufacturers manual. Anti-P. papatasi saliva IgG antibodies and IgG subclasses were measured in sera of BALB/c and C57BL/6 mice using indirect ELISA. Microtiter plate wells were coated with P. papatasi salivary gland homogenate (SGH) made by three freeze-thaw cycles (about 60 ng of protein per well). To block free binding sites, washed wells were incubated with 6% low fat dry milk diluted in 20 mM phosphate-buffered saline with 0. 05% Tween 20. Mice sera were diluted 1∶200 in 2% low fat dry milk and incubated for 90 min at 37°C for specific IgG or overnight at 4°C for IgG subclasses. Secondary antibodies (goat anti-mouse IgG, IgG1, IgG2a, IgG2b, IgG2c, and IgG3; Serotec) conjugated with horseradish peroxidase (HRP) were diluted and incubated at 37°C as described in Table S1. Orthophenylendiamine and H2O2 in McIlwein phosphate-citrate buffer (pH 5. 5) were used as substrate solution. Absorbance was measured at 492 nm using an Infinite M200 microplate reader (Tecan). The cut-off value was determined as two standard errors of the mean of the absorbance of pre-immune serum. The intensity of booster effect was measured by increased levels of specific antibodies in sera of bitten mice after the last sand fly exposure (comparing week 24 and 28). Anti-P. papatasi IgE were measured in sera of BALB/c mice as described above with the following modifications. Microtiter plate wells were coated with P. papatasi SGH (about 300 ng of protein per well). To block the free binding sites, washed wells were incubated with 6% fetal calf serum. Mouse sera were diluted 1∶100 in 2% fetal calf serum. Secondary antibody (rat anti-mouse IgE; BD PharMingen) was diluted and incubated as listed in Table S1. Phlebotomus papatasi SGH (about 10 µg of protein per well) was separated on 10% SDS-PAGE gel under non-reducing conditions using the Mini-Protean III apparatus (BioRad). Salivary proteins were blotted onto a nitrocellulose membrane by Semi-Phor equipment (Hoefer Scientific Instruments) and cut into strips. The strips were then blocked with 5% low fat dry milk in Tris-buffered saline with 0. 05% Tween 20 (TBS-Tw) and subsequently incubated with mice sera (week 28 for BALB/c mice; week 5 for C57BL/6 mice) diluted 1∶200 for 1 hour. In the next step the strips were incubated for 1 hour with peroxidase-conjugated goat anti-mouse IgG, IgG1, or IgG2b (Serotec) diluted in TBS-Tw as follows: IgG and IgG1 1∶5000; IgG2b 1∶2000 for BALB/c mice sera and IgG, IgG1 1∶2000 for C57BL/6 mice sera. The chromogenic reaction was developed using a solution containing diaminobenzidine and H2O2. Similar protocol was used for western blot analysis with P. papatasi recombinant proteins PpSP28, PpSP30, PpSP42, and PpSP44. Briefly, recombinant proteins were loaded on the 10% SDS-PAGE gel (3 µg protein per well) and separated under reducing conditions. BALB/c mice sera (week 28) were diluted 1∶50 and secondary antibody (goat anti-mouse IgG from Serotec) was diluted 1∶1000 in TBS-Tw. The proteins from the P. papatasi salivary glands used for mass spectrometric analysis were run on the same gel as salivary glands used for western blot analysis. Proteins were visualized by Coomassie Blue G-250 staining (Bio-Rad). The individual bands were cut and incubated with 10 mM dithiothreitol (DTT) and then treated with 55 mM iodoacetamid. Washed and dried bands were digested with trypsin (5 ng, Promega). Alpha-cyano-4-hydroxycinnamic acid was used as a matrix. Samples were measured using a 4800 Plus MALDI TOF/TOF analyzer (AB SCIEX). A peak list from MS spectra was generated by 4000 Series Explorer V 3. 5. 3 (AB SCIEX) without smoothing. Peaks with local signal to noise ratio greater than 5 were picked and searched by local Mascot v. 2. 1 (Matrix Science) against a database of putative salivary protein sequences derived from GenBank. Database search criteria were as follows – enzyme: trypsin, taxonomy: Phlebotomus, fixed modification: carbamidomethylation, variable modification: methionine oxidation, peptide mass tolerance: 80 ppm, one missed cleavage allowed. Only hits that scored as significant (p<0. 05) are included. The data obtained by ELISA were subjected to GLM ANOVA and Tukey-Kramer Multiple Comparison procedure to analyze differences in kinetics of anti-P. papatasi saliva antibody response between experimentally bitten and control mice at all sampling points. The non-parametric Wilcoxon rank sum test for differences in medians was used for evaluation of booster effect, the comparison of antibody level between week 24 and 28. For correlation tests we used the non-parametric Spearman rank correlation matrix. For all tests statistical significance was regarded as a p-value less than 0. 05. All statistical analyses were performed using NCSS 6. 0. 21 software. To investigate the kinetics and persistence of anti-P. papatasi saliva antibody response, experimentally bitten and control mice were followed for 29 weeks. Mice exposed five times to bites of sand flies at one-week interval had significantly increased levels of specific IgG, IgG1, and IgG2b as compared to control group (Figure 1A, C, E). In contrast, specific IgG2a, IgG3, and IgE levels in sera of bitten mice were comparable to non-exposed controls with some differences only at the last data points (Figure S1). No anti-saliva antibodies were detected in any pre-immune sera tested. In bitten mice, anti-P. papatasi saliva IgG and IgG1 levels increased significantly (p<0. 05) after the fourth exposure (Figure 1A, C). IgG2b levels differed between experimental and control group from week 9 onward, with the exception of weeks 10 and 11 (Figure 1E). Anti-saliva IgG increased steadily till the end of the study, while specific IgG2b increased slowly until week 22 followed by a slight decrease at week 24. Anti-saliva IgG1 increased steadily and peaked at week 7 and persisted on this level until the end of the study. To test the presence of putative memory cells to P. papatasi salivary proteins, BALB/c mice were additionally exposed to sand flies 22 weeks after the last exposure (week 27). One week after the booster (at week 28) anti-P. papatasi saliva antibodies increased significantly in IgG by 43%, in IgG1 by 80% and in IgG2b by 79% (Figure 1A, C, E). Positive correlation was found between the number of blood-fed sand fly females during the individual immunization weeks (sum of the blood-fed females from the relevant week and the weeks before) and the corresponding levels of anti-P. papatasi IgG (r = 0. 62, p<0. 0001), IgG1 (r = 0. 74, p<0. 0001), and IgG2b (r = 0. 29, p<0. 05) (Figure 2A, C, E). Furthermore, positive correlation was detected between the total amount of blood-fed females and the levels of specific IgG (r = 0. 72, p<0. 0001) and IgG1 (r = 0. 8, p<0. 0001) after the fifth sand fly exposure (week 5). Experimentally bitten and control mice of C57BL/6 strain were followed in experiments lasting 28 weeks. Five exposures at one-week interval significantly increased levels of specific IgG and IgG1 in bitten mice (Figure 1B, D). In contrast, specific IgG2b, IgG2c, and IgG3 levels of bitten mice were comparable to controls. No anti-saliva antibodies were detected in any pre-immune sera tested. Similarly to BALB/c mice, anti-P. papatasi IgG and IgG1 levels differed significantly between experimentally bitten and control C57BL/6 mice from week 4 onward (Figure 1B, D). Anti-saliva IgG gradually increased until week 8 and then with a slight fluctuation of antibody levels decreased until the end of the study. Specific IgG1 developed with similar kinetics to IgG, however, it peaked earlier (at week 6) and then slowly decreased till the end of the study. Anti-saliva IgG2b, IgG2c, and IgG3 antibodies did not differ between the exposed and control group throughout the study (Figure 1F; Figure S1B, D) with the exception of week 21 for IgG3 subclass (Figure S1D). We also detected a positive correlation between the number of blood-fed sand fly females during the individual immunization weeks (sum of the blood-fed females from the relevant week and the weeks before) and the corresponding levels of anti-P. papatasi IgG (r = 0. 80, p<0. 0001) and IgG1 (r = 0. 86, p<0. 0001) (Figure 2B, D). Moreover, positive correlation was detected between the total amount of blood-fed females and the levels of specific IgG (r = 0. 85, p<0. 0001), IgG1 (r = 0. 86, p<0. 0001), and IgG2c (r = 0. 5, p<0. 05) after the fifth sand fly exposure (week 5). Phlebotomus papatasi salivary antigens were studied using sera of experimentally bitten BALB/c and C57BL/6 mice. Only the antibody classes and subclasses shown to be produced in high titers by ELISA were tested in a western blot; specific anti-P. papatasi IgG and IgG1 in both mice strains and additionally specific IgG2b in BALB/c mice. BALB/c mice sera recognized up to 10 protein bands with approximate molecular weights of 70,65,51,49,47,35,31,30,23, and 15 kDa, the last three being the most intensively recognized by all BALB/c sera in all IgG subclasses tested. Sera of C57BL/6 mice reacted additionally with the 53 kDa protein but did not recognize the 49 and 47 kDa protein bands. The most intensive reaction in all C57BL/6 mice was detected with the 65,53, and 30 kDa protein bands in IgG as well as in IgG1 (Figure 3). Comparison of two mice strains therefore revealed an interesting difference in recognition of four protein bands of 53,51,49, and 47 kDa. No reaction was detected with any pre-immune mice sera tested (Figure 3). In BALB/c mice, the 51 kDa protein was recognized only by one out of 5 sera tested in IgG and IgG1, while in C57BL/6 mice, this protein band was recognized by all mice sera tested in IgG1 and by two out of five sera tested in IgG. Anti-P. papatasi IgG2b antibodies reacted consistently with the 65,35,31,30,23, and 15 kDa proteins (Figure 3). In C57BL/6 mice, 70,65,53,31, and 30 kDa proteins were recognized by all mice sera tested (IgG as well as IgG1), while the 51,35,23, and 15 kDa antigens were recognized by some sera only (Figure 3). Specific IgG1 of C57BL/6 mice predominantly recognized the 65,53,51,31, and 30 kDa antigens (Figure 3). Mass spectrometry analysis identified the salivary proteins with the same mobility in the SDS-PAGE as the proteins recognized by the sera of experimentally bitten mice as the Yellow-related proteins (GenBank acc. no. AF335492 and AF335491), apyrase (AF261768), D7-related proteins (AF335489; AF335488), antigen-5 protein (DQ205724), and proteins of the SP15 protein family (AY628879, AY628880; AF335486; AF335485) (Table 1). The reactivity of PpSP44 (yellow related protein), PpSP42 (yellow related protein), PpSP30 (D7 related protein), and PpSP28 (D7 related protein) recombinant proteins was studied using sera from BALB/c mice exposed to P. papatasi bites and positive for anti-P. papatasi IgG antibodies. Sera of control mice did not recognize any of the recombinant proteins tested. The most intensive reaction was detected with the PpSP30, although, this protein was not recognized by all sera tested (4 out of 5). Three out of five mice sera reacted with the PpSP42 and PpSP44 recombinant proteins and very weak reaction was detected with the PpSP28 recombinant protein in two out of five mice sera (Figure 4). This study describes in detail long-term kinetics and persistence of anti-P. papatasi saliva antibodies in sand fly-exposed BALB/c and C57BL/6 mice strains that are widely used as model organisms sensitive or resistant to Leishmania infection, respectively (e. g. [27], [28]). Four IgG subtypes have been described in mice: IgG1, IgG2a, IgG2b, and IgG3. Additionally, certain strains such as C57BL/6 produce the IgG2c subclass instead of IgG2a [29]. The nomenclature of murine IgG subtypes does not correlate with the subtypes of human or canine IgG. The most abundant subclass is IgG1; it binds to Fc-receptors of mast cells and basophils, and it mediates the immediate hypersensitivity reactions. Both IgG1 and IgG2a activate the complement cascade via the alternative pathway, whereas IgG2b employs the classical pathway of complement activation [30]. Moreover, production of IgG1 is the marker of Th2 profile of immune response in mice, while IgG2a predicts Th1 type of immune response in these animals [31]. We showed that repeated exposure to sand fly bites elicits increased levels of anti-saliva IgG and IgG1 in both BALB/c and C57BL/6 strains, and additionally IgG2b in BALB/c mice. In comparison, higher levels of specific IgG were detected in BALB/c mice. This finding complies well with the fact that BALB/c mice mostly respond to repeating antigens by Th2 humoral immune response while C57BL/6 mice produce mainly Th1 cellular response [30]. It seems that P. papatasi saliva elicits mainly production of specific IgG1 subclass, which suggests the polarization to the Th2 type of immune response in bitten mice regardless of the strain. The production of anti-sand fly saliva IgG1 was previously described in BALB/c mice repeatedly bitten by Lutzomyia longipalpis, but they did not observe any production of neither IgG2a nor IgG2b [32]. As the composition of sand fly saliva varies in different sand fly species [33] and the sand fly saliva compounds elicit different profile of specific antibody response [34], this could be the feasible explanation for the production of different antibody subclasses in mice bitten by different sand fly species. To our knowledge, there are no data available about the anti-sand fly saliva antibody subclasses elicited by sand fly feeding in the C57BL/6 mice. In Swiss Webster mice immunization by P. ariasi saliva produced also predominantly IgG1 antibodies [34]. Production of specific IgG2b in BALB/c mice compared to the absence of this antibody subclass in C57BL/6 mice may be the result of different cytokine responses in both mice strains against sand fly saliva. The switch to IgG2b subclass is initialized by production of TGF-β [35], a suppressive cytokine that blocks the activation of lymphocytes and monocytes derived phagocytes. This could positively contribute to the susceptibility of BALB/c mice to Leishmania parasites. Importantly, positive correlation was found in both mice strains between the intensity of sand fly exposure and the levels of specific antibodies in aforementioned subclasses. Our results correspond well to previously published data showing that the antibody response in dogs [3], [5] as well as in humans [4] reflected the intensity and the time-course of sand fly exposure. We found that sand fly exposure did not affect the production of IgG2a and IgG3 in BALB/c mice, and IgG2b, IgG2c, and IgG3 in C57BL/6 mice. Neither did the levels of specific IgE differ significantly between non-exposed and exposed groups of mice, and the IgE kinetics showed high variation during the study. Similarly, high fluctuation in specific IgE response was detected in humans [11], [23] and dogs [3] bitten by Lutzomyia longipalpis in the field as well as under laboratory conditions. While some of the individuals and animals presented high levels of specific IgE, others did not mount specific IgE response at all [3], [11], [23]. To mimic the situation commonly occurring in endemic foci of leishmaniases, where sand fly-free periods last up to 6 months [15], BALB/c mice were exposed to P. papatasi bites again 23 weeks after the last sand fly exposure. This single sand fly exposure elicited statistically significant increase of anti-P. papatasi IgG, IgG1, IgG2b which suggests the persistence of memory cells generated during the previous round of exposures. This could be related to the “previous sand fly season” in the field. Furthermore, in both mice strains, the differences between non-exposed and exposed groups of mice in production of specific IgG1 and IgG2b were detectable from week four or nine, respectively, until the end of the study. Similarly, the levels of specific IgG, IgG1, and IgG2 in sera of dogs exposed to L. longipalpis or P. perniciosus bites differed significantly from pre-immune sera for more than 14 weeks after the last sand fly exposure [3], [5]. In individuals repeatedly bitten by P. argentipes, elevated levels of specific antibodies persisted after the 30-day sand fly-free period, although anti-saliva antibodies significantly decreased throughout this time [4]. Thus, regardless the host-sand fly combination, anti-sand fly saliva antibodies can persist in sera of repeatedly bitten hosts until the next sand fly season. We also characterized the reactivity of mice sera with P. papatasi salivary proteins as well as with selected recombinant proteins. Mice sera of BALB/c and C57BL/6 strains reacted with up to eleven P. papatasi antigenic protein bands. The 30 kDa protein band recognized by both mice strains was identified by mass spectrometry as a mixture of a D7-related (AF335489) and an antigen 5-related (DQ205724) protein. The other proteins which were intensively recognized either by BALB/c (47,23, and 15 kDa proteins) or by C57BL/6 mice (65,53, and 51 kDa proteins) were determined as members of the Yellow-related protein family (51 kDa - AF335492,47 kDa - AF335491), D7-related protein family (23 kDa – AF335488), and SP-15 protein family (15 kDa – AY628879, AY628880, AF335486, AF335485). The 70,65,53, and 49 kDa bands were not identified by mass spectrometry. Our results correspond to previously published data, where the human and BALB/c mice IgG antibodies recognized preferentially the P. papatasi 30 kDa protein band [1], [14]. To our knowledge, the only study describing the reactivity of specific IgG subclasses with P. papatasi antigens was performed on humans [14]. In accordance with our results, the 30 kDa D7-related protein was also found to be the most immunogenic antigen in all human antibody subclasses tested [14]. Taken together, our data complies well with previously published studies, where Yellow-related proteins, D7-related proteins, as well as SP-15 proteins from P. papatasi saliva were identified as potent antigens for mice and humans [1], [14]. Sera of BALB/c mice experimentally bitten by P. papatasi were tested also with four bacterially expressed recombinant proteins belonging to two salivary protein families: Yellow-related proteins (PpSP44/AF335492 and PpSP42/AF335491) and D7-related proteins (PpSP30/AF335489 and PpSP28/AF335488). Within the salivary gland homogenate, sera reacted with proteins identified as PpSP42, PpSP30, and PpSP28 proteins, but no reaction was detected with PpSP44. In contrast, PpSP30 and PpSP44 recombinant proteins were strongly recognized and PpSP42 gave a weak reaction. Reaction of anti-saliva IgG with recombinant proteins may, however, differ between mouse strains. For example, the C57BL/6 mice reacted predominantly with PpSP42 and PpSP28 recombinant proteins (data not shown). Although none of the recombinant proteins were recognized by all sera. Each mouse serum tested reacted with at least one of the recombinant proteins. Our data suggest that recombinant proteins could be used as markers of sand fly exposure instead of crude salivary gland homogenates, ideally as a mixture of several different proteins to cope with various host species and individual reactivity of each serum sample. In sand flies this concept has been demonstrated using Lutzomyia longipalpis recombinant proteins; the reactivity of anti-L. longipalpis seropositive human sera with the salivary gland sonicate was comparable to the reaction with the combination of the two L. longipalpis recombinant Yellow-related proteins (LJM11/AY445935 and LJM17/AF132518) [8]. In conclusion, we detected a significant increase of specific IgG and IgG1 in exposed mice of both strains, and of IgG2b in exposed BALB/c mice. The other IgG subclasses were comparable to controls. Specific IgG response was shown to reflect the intensity of sand fly exposure and furthermore, anti-P. papatasi saliva antibody response persisted in mice for more than 5 months. Thus, in endemic areas the antibodies could persist till the following sand fly season. The 30 kDa band recognized by sera of experimentally bitten BALB/c as well as C57BL/6 mice was identified as a mixture of D7-related and antigen 5-related proteins. Moreover, the reactivity of mice sera with PpSP44, PpSP42, PpSP30, and PpSP28 recombinant proteins suggested that their combination could substitute the salivary gland homogenate. Taken together, the kinetics, persistence and the individual variability of anti-sand fly saliva antibody response are important aspects to consider in further experiments, where anti-saliva antibodies are used as the markers of sand fly exposure.

Title: Kinetics of Antibody Response in BALB/c and C57BL/6 Mice Bitten by Phlebotomus papatasi Summary: Leishmania major is the causative agent of zoonotic cutaneous leishmaniasis and Phlebotomus papatasi serve as the major vector. In endemic foci, rodents are the natural reservoirs of this disease. Thus, we studied anti-P. papatasi saliva antibody response in BALB/c and C57BL/6 mice that are commonly used as model organisms sensitive and resistant to cutaneous leishmaniasis, respectively. We followed the kinetics and persistence of specific antibody response in both mice strains and we characterized the main P. papatasi salivary antigens. We demonstrated that sand fly bites elicit production of specific IgG that reflect the intensity of sand fly exposure. In endemic areas, this could provide useful information about the effectiveness of anti-vector control programs. We also examined the reaction of mice sera with four P. papatasi recombinant proteins. Our data indicate that a combination of these proteins could be used instead of crude salivary gland homogenate for the monitoring of anti-sand fly saliva antibodies in natural hosts in endemic foci.

lay_plos

en

Summarize: BACKGROUND AND SUMMARY OF THE INVENTION The present invention relates to chairs, and in particular, to an adjustment mechanism for controlling the height and the tilt of a seat for a chair, as well as the angle of the chair backrest relative to the seat. It is well known in the art to incorporate mechanisms into a chair to permit the tilting of the chair back and/or seat in order to enhance the comfort of a user. In order to control the positioning of the seat and backrest, complicated mechanisms are often required. These mechanisms are actuated by a plurality of handles, buttons, levers and the like in order to control the various movements of the seat. The plurality of handles not only detract from the aesthetic properties of the chair, but also render adjustment of the seat and backrest difficult for a user who is unfamiliar with the operation and function of each actuator. Further, prior art adjustment mechanisms tend to be complicated in that they require many parts. For example, in Miotto, U.S. Pat. No. 5,348,371, a chair is provided which incorporates a mechanical device to effectuate the synchronous movement of the seat and backrest. In order to selectively lock the seat in a user selected stationary position, a plurality of friction discs are provided. By rotation of a handle under the seat of the chair, the discs are compressed so as to prevent movement of the seat by friction. The large number of parts involved in this type of locking arrangement adds to the overall cost and complexity of the mechanism. Therefore, it is a primary object and feature of the present invention to provide a chair control mechanism which is simple to operate and inexpensive to manufacture. It is a further object and feature of the present invention to provide a chair control mechanism for a chair wherein a user may adjust the vertical height of the seat with one lever and the seat and backrest angle with another lever. It is a further object and feature of the present invention to provide a chair control mechanism wherein the angle of the seat with respect to the supporting surface of the chair, and the angle of the backrest relative to the seat, may be easily manipulated and selectively locked into position with a single handle. In accordance with the present invention, a device for adjusting the position of a seat of a chair is adapted for use with a pedestal including a central vertical column. The central column includes a gas piston assembly for varying the length thereof. An enclosure is connectable about an upper end of the central column. An actuator element is pivotably mounted to the enclosure and movable between a first actuating position wherein the actuator element actuates the gas piston assembly thereby allowing the length of the central column to be adjusted to a user selected length, and a second non-actuating position wherein the central column is maintained by the gas piston assembly at the user selected length. A handle extends from the enclosure and is pivotably movable between a first position wherein the handle urges the actuator element into the first, actuating position, and a second position. Means are provided for urging the actuator element toward the non-actuating position. It is also contemplated to provide a plunger housing extending laterally from the enclosure and a plunger element slidably supported therein. The plunger element has a first end engaging the actuator element and a second end engaging the handle wherein movement of the handle between the first and second positions causes the plunger element to slide axially within the plunger housing. The handle is pivotably mounted to the plunger housing such that a first end of the handle extends into the plunger housing and a second end of the handle extends outwardly therefrom. The device also includes a seat bracket interconnected to the seat and a link element pivotably mounted to the seat bracket and to the enclosure, for interconnecting the seat bracket to the enclosure. The link element allows for limited horizontal and vertical movement of the seat bracket with respect to the enclosure. An intermediate bracket is pivotably mounted to the enclosure and to the seat bracket at a location spaced from the link element, and pivotable movement of the seat bracket with respect to the enclosure results in a corresponding pivotable movement of the intermediate bracket with respect to the enclosure over a predetermined range. The intermediate bracket may be locked at a user selected position for selectively fixing the position of the seat bracket to the enclosure, and thereby the position at the seat relative to the pedestal. A back support member is connected to the intermediate bracket, such that movement of the intermediate bracket results in adjustment in the angular position of the back relative to the seat. In this manner, the angle of the back is adjusted synchronously with adjustment of the seat angle. In accordance with another aspect of the invention, a seat adjustment mechanism is provided for controlling movement of a seat of a chair. The seat adjustment mechanism includes a bracket assembly operatively connected to the seat for allowing horizontal and vertical movement of the seat over a predetermined range. A locking element is provided for locking the seat at a user selected position within the predetermined range. In accordance with yet another aspect of the invention, a device is provided for interconnecting a seat to a central support. The device includes an enclosure operatively connected to the support. A seat connection bracket is operatively connected to the seat and a link element interconnects the enclosure and the seat connection bracket. An intermediate bracket is pivotably mounted to the enclosure and to the seat connection bracket wherein a predetermined pivotable movement of the intermediate bracket with respect to the enclosure translates into a corresponding predetermined movement of the seat connection bracket with respect to the enclosure. A locking member is provided for maintaining the intermediate bracket in one of a plurality of predetermined positions with respect to the enclosure. Various other features, objects and advantages of the invention will be made apparent from the following description taken together with the drawings. BRIEF DESCRIPTION OF THE DRAWINGS The drawings furnished herewith illustrate a preferred construction of the present invention in which the above advantages and features are clearly disclosed as well as others which will be readily understood from the following description of the illustrated embodiment. In the drawings: FIG. 1 is a side elevational view of a chair incorporating the chair control mechanism of the present invention; FIG. 2 is a cross-sectional view taken along line 2 — 2 of FIG. 1 showing a bottom plan view of the mechanism of the present invention; FIG. 3 is a cross-sectional view taken along line 3 — 3 of FIG. 2; FIG. 4 is a cross-sectional view taken along line 4 — 4 of FIG. 2 showing a seat height control assembly of the chair control mechanism in a non-actuating position; FIG. 5 is a cross-sectional view, similar to FIG. 4, showing the seat height control assembly in an actuating position; FIG. 6 is a cross-sectional view taken along line 6 — 6 of FIG. 2; FIG. 7 is a cross-sectional view, similar to FIG. 6, showing multiple positions of the chair control mechanism in phantom; FIG. 8 is a cross-sectional view taken along line 8 — 8 of FIG. 6 showing a seat angle locking assembly of the chair control mechanism; FIG. 9 is an enlarged, cross-sectional view showing a portion of the seat angle locking assembly of FIG. 8 in a locked position; FIG. 10 is a cross-sectional view, similar to FIG. 9, showing the seat angle locking assembly in an unlocked position; FIG. 11 is a cross-sectional view taken along line 11 — 11 of FIG. 6; FIG. 12 is a cross-sectional view taken along line 12 — 12 of FIG. 6; FIG. 13 is a cross-sectional view taken along line 13 — 13 of FIG. 6; FIG. 14 is an enlarged, sectional view showing an alternate seat angle locking assembly for the chair control mechanism of the present invention; and FIG. 15 is a cross-sectional view of the alternate seat angle locking assembly taken along line 15 — 15 of FIG. 14. DETAILED DESCRIPTION OF THE INVENTION Referring to FIG. 1, a chair 10 is provided incorporating a chair control mechanism generally designated by the reference 12. Chair 10 includes a seat 13 and a backrest 14 mounted to a back support member 15, commonly known as a “J-bar”, which includes a back mounting portion 16 and seat mounting portion 17 interconnected with chair control mechanism 12. Pedestal 18 includes a plurality of legs 20 diverging from a central hub 22. Each leg 20 terminates at a caster 24 to facilitate the rolling of chair 10 across a supporting surface 25. Each caster 24 includes a forked wheel supporting bracket 26 depending from a leg mounting portion 28. Each bracket 26 defines a wheel receiving cavity for receiving wheel 30 between forks 26 a and 26 b. Each wheel 30 is interconnected to its corresponding bracket 26 by an axle 32 extending between each fork 26 a and 26 b of the bracket 26 so as to allow for rotation of wheel 30 about the axle. A cylindrical housing 32 extends vertically from hub 22 to support chair control mechanism 12. Cylindrical housing 32 includes a first support member 33 which is mounted to hub 22, and a second support member 34 is telescopically mounted to first support member 33, in accordance with conventional technology. A gas piston assembly is interconnected with first and second support members 33, 34, respectively, in a manner as is known. As best seen in FIGS. 3-5, the gas piston assembly 32 includes a conical mounting portion 36 which is mounted to chair control mechanism 12 for controlling the vertical position of seat 13, as hereinafter described. Chair control mechanism 12 includes a fixed position support member in the form of a first lower housing or enclosure 40. Lower enclosure 40 includes a generally flat lower plate 42 having first 44 and second 46 walls extending vertically from opposite sides thereof. A front wall 43 interconnects first and second walls 44 and 46, respectively, and lower plate 42. Lower plate 42 includes a centrally positioned aperture 48 therein for receiving a tapered sleeve 50, which is mounted to lower plate 42 such as by welding. Conical mounting portion 36 of the gas piston assembly engages the internal wall of tapered sleeve 50, to rigidly and stationarily mount lower enclosure 40 to cylindrical housing assembly 32. Lower enclosure 40 further includes an upper plate 54 also having an opening 56 therein for receiving sleeve 50 therethrough, and sleeve 50 is secured to upper plate 54 such as by welding. Upper plate 54 is vertically spaced from lower plate 42 and is interconnected to first and second walls 44 and 46, respectively, and front wall 43. Upper plate 54 includes a channel member 57 (FIGS. 3-5) for pivotably supporting a gas piston actuating element 60. Gas piston actuating element 60 includes a horizontal first end 62 which abuts a gas piston stem 64, and a vertical second end 66. A generally cylindrical plunger housing 68 extends laterally from vertical wall 46 of lower enclosure 40. Plunger housing 68 includes a generally cylindrical inner surface 70 which defines a plunger receipt cavity 72. A generally cylindrical slider element 74 is positioned within plunger cavity 72 and includes an outer cylindrical surface 76 which forms a slidable interface with inner surface 70 of plunger housing 68. A plunger element 80 is supported partially within a cavity 82 in slider element 74 and projects from an inner end 84 thereof. Plunger element 80 extends through an opening 88 in vertical wall 46 of lower enclosure 40 and into contact with vertical end 66 of gas piston actuating element 60. A handle 96 is pivotally mounted via a pivot pin 100 to plunger housing 68. Handle 96 includes a spherical head 97 and a nose-like inner end 98 which extends into the plunger receipt cavity 72 defined by plunger housing 68. Inner end 98 of handle 96 terminates at an angled slider engaging surface 104 which abuts an outer end 106 of slider element 74 having a complementary engagement surface. A portion of head 97 is flattened and coplanar with slider engagement surface 104. Handle 96 also includes an outer end 101 extending outwardly from head 97, terminating in a finger engagement area 102 for engagement by a user. In operation, handle 96 is pivotable about pivot pin 100 between a first, non-actuating position, FIG. 4, and a second, actuating position, FIG. 5. Movement of handle 96 to its actuating position of FIG. 5 engages end 98 with the angled engagement surface defined by outer end 106 of slider element 74, to move slider element 74 axially to the left in FIG. 5 so as to cause plunger element 80 to urge actuator element 60 counterclockwise. As actuator element 60 is urged counterclockwise, end 62 thereof engages and depresses gas piston stem 64, FIG. 5, thereby allowing vertical adjustment of second support member 34 relative to first support member 33, to position seat 13 at a user selected height. In order to maintain the user selected height, handle 96 is pivoted about pivot pin 100 to the first, non-actuating position, FIG. 4, thereby allowing gas piston stem 64 to return to its at-rest position, which functions to move actuator element 60 clockwise about channel member 57 from its FIG. 5 position to its FIG. 4 position. Referring to FIGS. 6-7 and 12, a generally U-shaped intermediate bracket 110 is pivotably mounted to lower enclosure 40 by a centrally located pivot pin 112. Intermediate bracket 110 includes a generally flat base portion 114 and walls 116 and 118 depending from opposite sides thereof. Walls 116 and 118 include corresponding axially aligned openings 120 and 122, respectively. Similarly, vertical walls 44 and 46 of lower enclosure 40 include openings 124 and 126, respectively, in axial alignment with openings 120 and 122 in walls 116 and 118, respectively. As shown in FIGS. 2, 3, 6 and 7, seat mounting portion 17 of back support member 15 is mounted to intermediate bracket base portion 114 by means of a series of bolts 129. As best seen in FIG. 12, end 128 of pivot pin 112 extends through opening 120 in wall 116 and opening 124 in wall 44, while end 130 extends through opening 122 in wall 118 and through opening 126 in wall 46. Pivot pin 112 is fixed to walls 116, 118 adjacent openings 120, 122, such as by welding. As best seen in FIG. 7, intermediate bracket 110 may pivot with respect to lower enclosure 40 about pivot pin 112 throughout a range of angular positions between a forwardly tilted position shown in solid lines and a rearwardly tilted position shown in phantom. Lower enclosure 40 is also interconnected to an upper seat bracket 140 by forwardly located first and second links 142 and 144, respectively, FIG. 13. Upper seat bracket 140 is generally U-shaped and includes a generally flat upper plate 146 having first, 148 and second 150 walls depending therefrom. Walls 148 and 150 include corresponding openings 152 and 154, respectively, which are in axial alignment with each other. A first end 156 of a pivot pin 158 extends through opening 152 in wall 148 and a second end 160 of pivot pin 158 extends through opening 154 in wall 150. Heads 162 and 164 are placed on corresponding ends 156 and 160, respectively, of pivot pin 158 in order to maintain pivot pin 158 in position. Pivot pin 158 passes through an opening in the upper end of each of links 142, 144. Links 142 and 144 interconnect pivot pin 158 with a pivot pin 166 mounted to lower enclosure 40. Pivot pin 166 includes a first end 168 which extends through an opening 170 in vertical wall 44 of enclosure 40, and a second end 172 which extends through an opening 174 in vertical wall 46 of enclosure 40. Walls 150, 152 of upper seat bracket 140 overlap the ends of pivot pin 166, to prevent lateral movement of pivot pin 166 and maintain pin 166 in positive relative to upper seat bracket 140 and enclosure 40. Pivot pin 166 passes through an opening formed in the lower end of each of links 142, 144. Referring to FIG. 11, intermediate bracket 110 and upper seat bracket 140 are interconnected by a rearwardly located pivot pin 180. Pivot pin 180 includes a first end 182 which extends through an opening 184 in wall 116 of intermediate bracket 110 and through an opening 186 in wall 148 of upper seat bracket 140. A second end 190 of pivot pin 180 extends through an opening 192 in wall 118 of intermediate bracket 110 and through an opening 194 in wall 150 of upper seat bracket 140. Heads 196 and 198 are mounted to corresponding ends 182 and 190, respectively, of pivot pin 180 to maintain pivot pin 180 in position. As best seen in FIG. 2, upper seat bracket 140 includes first 204 and second 206 forward flanges extending laterally from walls 148 and 150, respectively, of upper seat bracket 140. In addition, rearward flanges 208 and 210 extend laterally from walls 148 and 150, respectively, of upper seat bracket 140. Flanges 204, 206, 208 and 210 include a corresponding aperture therethrough in order to interconnect upper seat bracket 140 to the underside of seat 13, such as a seat board or other rigid member, by means of screws 212 or the like. Referring to FIG. 7, the tilting or pivoting movement of seat 13 is controlled by links 142 and 144 which interconnect upper seat bracket 140 with lower enclosure 40, and by pivot pin 180 which interconnects upper seat bracket 140 with intermediate bracket 110. When seat 13 is tilted forwardly and downwardly, from right to left in FIG. 7 as shown in solid lines, the forward end of upper seat bracket 140 pivots counterclockwise about pivot pin 166 through links 142, 144, while intermediate bracket 110 pivots counterclockwise about pivot pin 112. When seat 13 is tilted rearwardly and upwardly, from right to left in FIG. 7 as shown in phantom, upper seat bracket 140 pivots clockwise about pivot pin 166 through links 142, 144, while intermediate bracket 110 pivots clockwise about pivot pin 112. As described, movement of seat 13 translates into a corresponding movement of intermediate bracket 110 about pivot pin 112 over a predetermined range. In addition, movement of seat 13 translates into a corresponding movement of upper seat bracket 140 about pivot pin 166 through links 142, 144 relative to lower enclosure 40 and about pivot pin 180 relative to intermediate bracket 110. As shown in FIG. 7, seat bracket 140 moves in a front-rear direction during movement of seat 13 by pivoting action between links 142, 144 and upper and lower pivot pins 158, 166, respectively. That is, clockwise movement of intermediate bracket 110 about pivot pin 112, caused by the user reclining in seat 13 to exert a downward force on the rear end of intermediate bracket 110 through seat bracket 140 and pivot pin 180, causes the forward end of seat bracket 140 to pivot clockwise about pivot pin 166 through links 142, 144. Simultaneously, seat bracket 140 pivots counterclockwise relative to links 142, 144 about pivot pin 158. Conversely, counterclockwise movement of intermediate bracket 110 about pivot pin 112, caused by the user leaning forwardly in seat 13 to exert an upward force on the rear end of intermediate bracket 110 through seat bracket 140 and pivot pin 180, causes the forward end of seat bracket 140 to pivot counterclockwise about pivot pin 166 through links 142, 144. Simultaneously, seat bracket 140 pivots clockwise relative to links 142, 144 about pivot pin 158. During angular movement of seat 13, which results in pivoting movement of intermediate bracket 110 about pivot pin 112, the angle of back 14 is simultaneously and synchronously adjusted along with the angle of seat 13 by the pivoting movement of intermediate bracket 110. As can be seen in FIG. 7, back mounting member 15 pivots about pivot pin 180 during pivoting movement of intermediate bracket 10 about pivot pin 112. When intermediate bracket 110 is in its rearwardmost tilted position shown in phantom in FIG. 7, seat mounting portion 17 of back support member 15 is substantially parallel with the underside of seat 13 and upper wall 146 of seat bracket 140. When seat 13 is pivoted to its forwardmost position as shown in solid lines in FIG. 7, seat mounting portion 17 of back support member 15 is pivoted forwardly relative to upper wall 146 of seat bracket 140, to move backrest 14 forwardly relative to seat 13. As best seen in FIGS. 6-10, in order to maintain intermediate bracket 110 in a user selected position, a locking assembly 218 is provided. Locking assembly 218 includes a generally cylindrical lock member housing 220 extending laterally from vertical wall 44 of lower enclosure 40 in a direction opposite that of plunger housing 68. Lock member housing 220 includes a generally cylindrical inner surface 222 which defines a lock member receipt cavity 224. A generally cylindrical slider element 226 is positioned within lock member receipt cavity 224 and includes an outer cylindrical surface 228 which forms a slidable interface with inner surface 222 of lock member housing 220. A locking pin or element 230 is supported within a passage 232 in slider element 226 and projects from an inner end 234 thereof. A recess 227 is provided in inner end 234 of slider element 226 in order to accommodate a spring 238 positioned about locking element 230. As shown in FIG. 9, spring 238 has a first end 240 embedded in a groove 242 in locking element 230 and a second end 244 abutting the outer surface 246 of lower enclosure wall 44 so as to bias locking element 230, and hence slider element 226, away from wall 44. A spring 247 bears between the inner end of passage 232, shown at 248, and the inner end of locking element 230. Spring 247 functions to bias locking element 230 outwardly relative to slider element 226 and toward wall 44. A handle 250 is pivotally mounted via a pivot pin 252 to lock member housing 220. Handle 250 is constructed similarly to handle 96, and includes a spherical head which extends into the lock member receipt cavity 224. Head 254 of handle 250 defines an angled slider engaging surface 256 which abuts an outer end 258 of slider element 226 having a complementary engagement surface. Head 254 of handle 256 also includes a nose-like inner end or locking tip 260 dimensioned for receipt in a corresponding recess 262 in the outer end 258 of slider element 226. Handle 250 also includes an outer end 266 extending outwardly from head 254, terminating in a finger engagement area 268 for engagement by a user. In operation, handle 250 is pivotable about pivot pin 252 between a first, non-actuating position, FIG. 10, and a second, actuating position, FIG. 9. In the non-actuating position, spring 238 overcomes the bias of spring 247 and forces slider element 226 to the left in FIG. 10 so as to disengage locking element 230 from intermediate bracket 110. In order to lock intermediate bracket 110 in a predetermined position, handle 250 is pivoted clockwise such that slider element 226 is urged to the right in FIG. 9. As slider element 226 is urged to the right in FIG. 9, springs 247 and 238 are compressed and an inner end 280 of locking element 230 extends into one of a series of openings 216 a - 216 c formed in wall 116 of intermediate bracket 110. Each opening 216 a - 216 c in wall 116 of intermediate bracket 110 corresponds to a predetermined angular position of intermediate bracket 110 related to lower enclosure 40. By inserting locking element 230 into a corresponding opening 216 a - 216 c in wall 116 of intermediate bracket 110, intermediate bracket 110 cannot pivot with, respect to lower enclosure 40 on pivot pin 112. This, in turn, prevents movement of upper seat bracket 140 and, consequently, of seat 13. In order to maintain locking element 230 in its selected opening 216 a - 216 c in wall 116 of intermediate bracket 110, locking tip 260 of handle 250 is positioned within corresponding recess 262 in slider element 226. With locking tip 260 of handle 250 received within recess 262 in slider element 226, locking element 230 is retained in the selected one of openings 216 a - 216 c in intermediate bracket 110 against the bias of spring 238. As best seen in FIG. 7, intermediate bracket 110 may also be locked in position by extending inner end 280 of locking element 230 over intermediate bracket side wall 116 such that locking member 230 engages base portion 114 of intermediate bracket 110 to lock seat 13 in its forwardmost tilted position. In addition, locking element 230 may be positioned to engage the lower end of intermediate bracket side wall 116 to lock seat 13 in its rearwardmost tilted position and to fix the position of backrest 14. In this manner, intermediate bracket 116 with its three openings 216 a - 216 c, in combination with locking member 230, provides five locking positions for intermediate bracket 110, and thereby for seat 13. With handle 250 in the non-actuating position, intermediate bracket 110 is free to pivot on pivot pin 112. This allows seat 13 to be moved freely relative to pedestal 18 throughout its entire range of motion, as illustrated in FIG. 7. Referring to FIG. 3, a spring assembly 282 is provided for urging intermediate bracket 110 toward a home position wherein seat 13 assumes a predetermined angle, which may be generally horizontal. Spring assembly 282 includes a conventional coil spring 284 which defines an upper end in engagement with upper plate 54 of lower enclosure 40 at a recess 286 formed therein. Coil spring 284 extends downwardly from recess 286, and defines a lower end which is received in a tension adjustment cap 288. It is contemplated to enclose spring 284 within a bellows 289, FIG. 1, so as to prevent user contact with spring 284 and to enhance the overall aesthetic appearance of mechanism 12. Tension adjustment cap 288 is threaded onto a first end 290 of a rod 292. A second end 294 of rod 292 extends through an opening formed in base portion 114 of intermediate bracket 110. A pin 296 interconnects end 294 of rod 292 to base portion 114 of intermediate bracket 110. In operation, the rearward tilting or reclining of seat 13 of chair 12 causes counterclockwise rotation of intermediate bracket 110 about pivot pin 112. This movement causes tension adjustment cap 288 to be drawn upwardly through rod 292 toward lower enclosure 40, which is resisted by the compression force of spring 284 which bears against tension adjustment cap 288. As the forces causing the counterclockwise rotation of intermediate bracket 110 about pivot pin 112 are relaxed, spring 284 urges intermediate bracket 110 to its home position, FIG. 3. A thrust bearing 298 is mounted between a spring washer 300, which engages the lower end of coil spring 284, and the inner surface of tension adjustment cap 288 in order to facilitate rotation of cap 288. A user may adjust the force exerted by spring 284 by rotating the tension adjustment cap 288 relative to rod 292. This provides an adjustment in the amount of force required to tilt seat 13, and also in the home position of intermediate bracket 110. Referring to FIGS. 14 and 15, an alternate locking assembly 304 in accordance with the present invention is shown. With the exception of the locking assembly, the chair disclosed in FIGS. 14-15 is identical to that previously described, and hence, the previous description of the chair 10 will be understood to apply to the chair shown in FIGS. 14-15, with common reference characters being used. Locking assembly 304 includes a generally cylindrical lock member housing 306 which extends laterally from vertical wall 44 of lower enclosure 40. Lock member housing 306 includes a generally cylindrical inner surface 308 which defines a lock member receipt cavity 310. A generally cylindrical slider element 312 is positioned within lock member receipt cavity 310 and includes an outer cylindrical surface 314 which forms a slidable interface with the inner surface 308 of lock member housing 306. Locking assembly 304 further includes first 316 and second 318 locking elements supported by slider element 312. Locking elements 316 and 318 have first ends 324 and 326, respectively, received within corresponding passages 330 and 332, respectively, in slider element 312. Coil springs 334 and 336 are positioned within passages 330 and 332, respectively, in slider element 312. As best seen in FIG. 15, coil springs 334 and 336 urge corresponding locking elements 316 and 318, respectively, toward wall 116 of intermediate. bracket 110. Locking elements 316 and 318 also include corresponding springs 348 and 350, respectively. Springs 348 and 350 define first ends 352 and 354, respectively, embedded in corresponding grooves 356 and 358, respectively, in locking elements 316 aid 318, respectively. Second ends 360 and 362 of springs 348 and 350, respectively, abut the outer surface 246 of wall 44 of lower enclosure 40 so as to bias locking elements 316 and 318, respectively, and thereby slider element 312, away from wall 44. In the embodiment of FIGS. 14 and 15, a pair of offset, staggered rows of openings are formed in side wall 116 of intermediate bracket 110, in place of openings 216 a - 216 c (FIGS. 6 - 8 ). As shown in FIG. 14, a first row of openings 364 a, 364 b and 364 c is formed in intermediate bracket side wall 116, in alignment with locking element 318. A, second row of openings 364 d, 364 e is offset from first row 364 a - 364 c, in alignment with locking element 316. Openings 364 d, 364 e are staggered in location relative to openings 364 a - 364 c, such that opening 364 d is located between openings 364 a and 364 b, and opening 364 e is located between openings 364 b and 364 c. In operation, as previously described, handle 250 is pivotable about pivot pin 252 between a first, non-actuating position, and a second, actuating position. In the non-actuating position, springs 348 and 350 bias slider element 312 to the left in FIG. 15, through engagement of locking elements 316, 318 with slider element 312 through springs 334, 336, respectively, so as to disengage corresponding locking elements 316 and 318, respectively, from openings 364 a - 364 e in intermediate bracket 110. In order to lock intermediate bracket 110 in a predetermined position, handle 250 is pivoted clockwise such that slider element 312 is urged to the right in FIG. 15. As slider element 312 is urged to the right in FIG. 15, the inner end of each locking element 316, 318 is moved toward and into engagement with intermediate bracket side wall 116. If one of locking elements 316, 318 is in alignment with one of openings 364 a - 364 e, the inner end of the locking element extends into the aligned one of openings 364 a - 364 e under the influence of the outer spring, such as 334, 336. As shown in FIG. 15, locking element 318 is shown with its inner end extending through opening 364 c, with the inward biasing force provided by its outer spring 336 functioning to overcome the outward biasing force provided by its inner spring 350. Locking element 316 is shown with its inner end in engagement with intermediate bracket side wall 116 under the influence of the inward bias provided by its outer spring 334, which overcomes the outward bias provided by its inner spring 348. Each opening 364 a - 364 e in wall 116 of intermediate bracket 110 corresponds to a predetermined position for intermediate bracket 110 relative to lower enclosure 40. By inserting one of the locking elements 316 and 318 into a corresponding one of openings 364 a - 364 e in wall 116 of intermediate bracket 110, intermediate bracket 110 cannot pivot with respect to lower enclosure 40 on pivot pin 112. This, in turn, prevents movement of upper seat bracket 140 and, consequently, of seat 13, to thereby lock seat 13 in a desired user-selected position. In addition, as in the prior embodiment, locking element 318 is engageable with either the upper or lower edge of intermediate bracket side wall 116 to maintain intermediate bracket 110 in its forwardmost and rearwardmost tilted positions, respectively. In this manner, intermediate bracket 110 and the five openings 364 a - 364 e formed in side wall 116 provide seven locking positions for intermediate bracket 110, and thereby for seat 13. As previously described, with handle 250 in the non-actuating position, intermediate bracket 110 is free to pivot on pivot pin 112. Spring assembly 282 urges intermediate bracket 110 to the home position wherein seat 13 may be oriented generally horizontal. In either embodiment of the locking assembly, the locking elements, such as 230, 316 and 318, are retained in their locking position within an opening in intermediate bracket side wall 116 when handle 250 is first moved to its non-actuating position of FIG. 10, due to friction exerted on the locking member by lower enclosure wall 44 and intermediate bracket side wall 116. When the user tilts seat 13 so as to relieve this frictional force on the locking member such as 230, 316 and 318, the spring, such as 238, 348 and 350, respectively, functions to draw the respective locking member outwardly from the opening in intermediate bracket side wall 116 within which the respective locking member was received. In the release operation, the user must have his or her body in contact with back 14 in order to tilt seat 13. This avoids the possibility of back 14 hitting the user while releasing locking assembly 218 when sitting on seat 13 and not in contact with back 14, as was the case with prior art mechanisms of this type. This provides an “anti-shock” feature for chair control mechanism 12. In addition, when handle 250 is first moved to its actuating position of FIG. 9, the locking member such as 230, 316 and 318 may not be in exact alignment with one of the openings in intermediate bracket side wall 116, and will thus initially engage the outer surface of intermediate bracket side wall 116. Subsequent forward or rearward tilting movement of seat 13 by the user will cause angular displacement of intermediate bracket 116 as described previously, and movement of one of the openings in intermediate bracket side wall 116 into alignment with the respective locking element 230, 316 and 318 to enable the locking element to pass into the aligned opening. As can be appreciated, mechanism 12 is relatively simple in its construction and components, and yet provides a wide range of pivoting movement of seat 13 with a large number of user-selectable locking positions for maintaining seat 13 in a desired angular position. Mechanism 12 eliminates the complexity and cost associated with a friction disk-type locking assembly while nonetheless providing a relatively large number of locking positions. In addition, mechanism 12 provides ergonomically advantageous operation by simultaneously translating the seat in a frontward-rearward direction upon pivoting movement of the seat, due to the operation of links 142, 144. Various modes of carrying out the invention are contemplated as being within the scope of the following claims particularly pointing out and distinctly claiming the subject matter which is regarded as the invention.

Summary: A seat adjustment mechanism for a chair includes a first handle which controls the height of the seat above a surface supporting the chair. A second handle allows the user to selectively lock the seat at a user selected angle relative to the supporting surface. As the seat is tilted into a desired position, the seat adjustment mechanism provides limited horizontal and vertical movement of the seat to maintain the chair in an ergonomically correct position. The mechanism includes a housing or enclosure adapted for connection to a pedestal, and a seat bracket for mounting to the underside of the seat. An intermediate bracket is pivotably mounted to the lower enclosure. One end of the seat mounting bracket is pivotably connected to an end of the intermediate bracket, and the other end of the seat bracket is interconnected with the lower enclosure via a link arrangement. A selectively operable locking mechanism is interconnected between the lower enclosure and the intermediate bracket, for selectively preventing and allowing angular movement of the intermediate bracket relative to the lower enclosure, to lock the seat in a predetermined angular position or to enable the seat to pivot relative to the pedestal.

big_patent

en

Write a title and summarize: SECTION 1. SHORT TITLE. This Act may be cited as the ``Buy-American Investment Incentive Act''. SEC. 2. INCREMENTAL INVESTMENT CREDIT. (a) Allowance of Credit.--Section 46 of the Internal Revenue Code of 1986 (relating to amount of investment credit) is amended by striking ``and'' at the end of paragraph (2), by striking the period at the end of paragraph (3) and inserting ``, and'', and by adding at the end thereof the following new paragraph: ``(4) the incremental investment credit.'' (b) Amount of Credit.--Section 48 of such Code is amended by adding at the end thereof the following new subsection: ``(c) Incremental Investment Credit.-- ``(1) In general.--For purposes of section 46, the incremental investment credit for any taxable year is an amount equal to 10 percent of the excess (if any) of-- ``(A) the aggregate bases of qualified investment credit properties placed in service during such taxable year, over ``(B) 80 percent of the base amount. ``(2) Qualified investment credit property.--For purposes of this subsection-- ``(A) In general.--The term `qualified investment credit property' means any eligible property-- ``(i) which is tangible property to which section 168 applies, ``(ii) which is section 1245 property (as defined in section 1245(a)(3)), and ``(iii)(I) the construction, reconstruction, or erection of which is completed by the taxpayer, or ``(II) which is acquired by the taxpayer if the original use of such property commences with the taxpayer. ``(B) Eligible property.-- ``(i) In general.--Except as otherwise provided in this subparagraph, the term `eligible property' means tangible property (other than a building, its structural components, or an air conditioning or heating unit), but only if such property-- ``(I) is used as an integral part of manufacturing, production (including agriculture), or extraction or of furnishing transportation, communications, electrical energy, gas, water, waste disposal, or pollution control services, ``(II) constitutes a research facility or research equipment used in connection with any of the activities referred to in subclause (I), or ``(III) constitutes a facility used in connection with any of the activities referred to in subclause (I) for the bulk storage of fungible commodities (including commodities in a liquid or gaseous state). ``(ii) Imported property not eligible.-- Property shall not be treated as eligible property if-- ``(I) such property was completed outside the United States, or ``(II) less than 75 percent of the basis of such property is attributable to value added within the United States. For purposes of this clause, the term `United States' includes the Commonwealth of Puerto Rico and the possessions of the United States. ``(iii) Certain property not eligible.--Any passenger automobile and any office furnishings shall not be treated as eligible property. ``(3) Base amount.--For purposes of paragraph (1)(B)-- ``(A) In general.--The term `base amount' means the product of-- ``(i) the fixed-base percentage, and ``(ii) the average annual gross receipts of the taxpayer for the 4 taxable years preceding the taxable year for which the credit is being determined (hereafter in this subsection referred to as the `credit year'). ``(B) Minimum base amount.--In no event shall the base amount be less than 50 percent of the amount determined under paragraph (1)(A). ``(C) Fixed-base percentage.-- ``(i) In general.--The fixed-base percentage is the percentage which the aggregate amounts described in paragraph (1)(A) for taxable years beginning after December 31, 1987, and before January 1, 1993, is of the aggregate gross receipts of the taxpayer for such taxable years. ``(ii) Rounding.--The percentages determined under clause (i) shall be rounded to the nearest \1/100\ of 1 percent. ``(D) Other rules.--Rules similar to the rules of paragraphs (4) and (5) of section 41(c) shall apply for purposes of this paragraph. ``(4) Coordination with other credits.--This subsection shall not apply to any property to which the energy credit or rehabilitation credit would apply unless the taxpayer elects to waive the application of such credits to such property. ``(5) Certain progress expenditure rules made applicable.-- Rules similar to rules of subsection (c)(4) and (d) of section 46 (as in effect on the day before the date of the enactment of the Revenue Reconciliation Act of 1990) shall apply for purposes of this subsection.'' (c) Incremental Investment Credit Allowable Against Entire Regular Tax and Alternative Minimum Tax.-- (1) Subsection (c) of section 38 of such Code (relating to limitation based on amount of tax) is amended by adding at the end thereof the following new paragraph: ``(3) Special rules for incremental investment credit.-- ``(A) In general.--In the case of a C corporation, this section and section 39 shall be applied separately-- ``(i) first with respect to so much of the credit allowed by subsection (a) as is not attributable to the incremental investment credit, and ``(ii) then with respect to the incremental investment credit. ``(B) Rules for application of incremental investment credit.-- ``(i) In general.--In the case of the incremental investment credit, in lieu of applying the preceding paragraphs of this subsection, the amount of such credit allowed under subsection (a) for any taxable year shall not exceed the net chapter 1 tax for such year. ``(ii) Net chapter 1 tax.--For purposes of clause (i), the term `net chapter 1 tax' means the sum of the regular tax liability for the taxable year and the tax imposed by section 55 for the taxable year, reduced by the sum of the credits allowable under this part for the taxable year (other than under section 34 and other than the incremental investment credit). ``(C) Incremental investment credit.--For purposes of this paragraph, the term `incremental investment credit' means the credit allowable under subsection (a) by reason of section 48(c).'' (2) Paragraph (2) of section 55(c) of such Code is amended to read as follows: ``(2) Cross references.-- ``(A) For provisions providing that certain credits are not allowable against the tax imposed by this section, see sections 26(a), 28(d)(2), 29(b)(5), and 38(c). ``(B) For provision allowing incremental investment credit against the tax imposed by this section, see section 38(c)(3).'' (d) Technical Amendments.-- (1) Clause (ii) of section 49(a)(1)(C) of such Code is amended by inserting ``or qualified investment credit property'' after ``energy property''. (2) Subparagraph (E) of section 50(a)(2) of such Code is amended by inserting ``or 48(c)(5)'' before the period at the end thereof. (3) Paragraph (5) of section 50(a) of such Code is amended by adding at the end thereof the following new subparagraph: ``(D) Special rules for certain property.--In the case of any qualified investment credit property which is 3-year property (within the meaning of section 168(e))-- ``(i) the percentage set forth in clause (ii) of the table contained in paragraph (1)(B) shall be 66 percent, ``(ii) the percentage set forth in clause (iii) of such table shall be 33 percent, and ``(iii) clauses (iv) and (v) of such table shall not apply.'' (4)(A) The section heading for section 48 of such Code is amended to read as follows: ``SEC. 48. OTHER CREDITS.'' (B) The table of sections for subpart E of part IV of subchapter A of chapter 1 of such Code is amended by striking the item relating to section 48 and inserting the following: ``Sec. 48. Other credits.'' (e) Effective Date.--The amendments made by this section shall apply to-- (1) property acquired by the taxpayer after December 3, 1992, and (2) property the construction, reconstruction, or erection of which is completed by the taxpayer after December 3, 1992, but only to the extent of the basis thereof attributable to construction, reconstruction, or erection after such date.

Title: Buy-American Investment Incentive Act Summary: Buy-American Investment Incentive Act - Amends the Internal Revenue Code to allow an incremental investment credit in an amount equal to ten percent of the excess of the aggregate bases of qualified investment credit properties placed in service over 80 percent of the base amount. Excludes: (1) property if completed outside the United States or if less than 75 percent of the basis of the property is attributable to value added within the United States; and (2) passenger automobiles and office furnishings. Establishes formulas for determining the base amount. Makes the incremental investment credit inapplicable to any property to which the energy or rehabilitation credit would apply unless the taxpayer waives the application of such credits. Establishes special rules for the incremental investment credit in relation to limitations based on the amount of tax. Applies such limitations and provisions concerning carryback and carryforward of unused credits separately, in the case of a C corporation: (1) first with respect to the credit allowed as is not attributable to the incremental investment credit; and (2) then with respect to such credit. Limits the credit, in lieu of current limitations, to the net chapter 1 tax.

billsum

en

Summarize: Le spellature, causate dalle scottature, lasciano delle antiestetiche macchie che rendono il colorito della pelle non uniforme. I rimedi più efficaci per la desquamazione della pelle sono le creme idratanti e lo scrub per il corpo ed il viso. Infatti, utilizzando questi prodotti sarà possibile uniformare il colorito della pelle e nutrirla così che la pelle morta non cada. Comunque, per prevenire a priori la desquamazione della pelle è importante esporsi correttamente al sole utilizzando una protezione solare adeguata. Vediamo insieme tutti i prodotti da provare, i rimedi naturali per la pelle spellata e per mantenere la tintarella più a lungo. Il rimedio migliore per uniformare la pelle spellata è lo scrub corpo o viso. Infatti, spesso quando ci si spella può capitare che alcune zone della pelle diventino più chiare: questa discromia dipende dal fatto che alcune presentano già le cellule nuove, e quindi non abbronzate, mentre in altre è ancora presente lo strato superficiale delle vecchie cellule. Per normalizzare e uniformare il colorito è possibile procedere con uno leggero scrub corpo fai da te a base di olio di oliva, olio di lavanda e limone per esfoliare e nutrire allo stesso tempo. Metti in una ciotola due cucchiai di sale, due di olio di mandorle dolci e due di oliva, poi aggiungi un cucchiaino di succo di limone. Applicalo sulla pelle effettuando un leggero massaggio e poi risciacqua sotto l'acqua fresca. Tampona la pelle con un asciugamano morbida e procedi con l'idratazione. Se le macchie sono molto evidenti puoi aggiungere alla crema idratante alcune gocce di autoabbronzante per uniformare il colorito della pelle. L'aiuto delle creme nutrienti può essere molto importante per l'idratazione del nostro corpo. Nuxe propone il Nuxe Sun, un latte fresco per il corpo e il viso, che grazie ai fiori di acqua e del sole aiuta a mantenere più a lungo l'abbronzatura e, allo stesso tempo, ripara e lenisce la pelle. Bio-Oil Gel è invece il prodotto di Bio-Oil pensato appositamente per idratare la pelle secca e molto secca, rendendola levigata, morbida ed elastica. Lancome propone la mousse detergente riconfortante in crema che grazie all'estratto di rosa e agli attivi nutrienti nutre la pelle, detergendola in profondità ed eliminando le cellule morte. Per un trattamento di bellezza di lusso puoi puntare invece su Total Regenerating Body Cream di Shiseido che rivitalizza la pelle rendendola visibilmente più tonica e compatta: la cute ritrova la sua naturale elasticità e diventa luminosa, per mettere ancora più in risalto la tua abbronzatura. Scopri tutti i cosmetici per non spellare! Per ridare elasticità e compattezza alla pelle bisogna prima di tutto riportare il giusto livello di idratazione: è quindi fondamentale applicare creme ricche e impacchi nutrenti che potrai creare anche a casa tua. Per realizzare una crema nutriente fai da te puoi unire alcune gocce di olio essenziale di calendula al burro di karitè e applicarlo sul corpo con un lieve massaggio per farlo penetrare a fondo. La farina d'avena è un ottimo ingrediente in grado di reidratare la pelle e nutrirla: puoi creare comodamente a casa tua una crema detergente da applicare sotto la doccia con tre cucchiai di farina, un cucchino di miele e dell'acqua; una volta ottenuta una consistenza morbida puoi applicarla sul corpo con un leggero massaggio e poi risciacquare sotto la doccia per ottenere una pelle perfettamente pulita e idratata. L'aloe vera è uno degli ingredienti ideali per idratare e lenire la pelle: crea a casa tua una crema composta da gel di aloe vera (lo puoi estrarre direttamente dalla pianta oppure acquistarlo in erboristeria) al quale unirai miele, limone e olio di mandorle dolci. L'idratazione è fondamentale per nutrire anche la pelle: non solo creme e impacchi, ma anche gli alimenti e soprattutto l'acqua che beviamo possono aiutare dall'interno a rendere la pelle più idratata e compatta. Per prima cosa è fondamentale aumentare la quantità di acqua giornaliera: due litri al giorno sono molto importanti per ristabilire il giusto livello di idratazione dell'organismo. Sceglila naturale e fresca, ma non ghiacciata, e alterna tisane e thè freddi non zuccherati. Anche il cibo può aiutarti: gli alimenti più ricchi di acqua sono senza dubbio l'anguria, l'ananas ma anche la lattuga, il cetriolo, il pomodoro e altre verdure come ravanelli, zucchine e radicchio.

Summary: La desquamazione della pelle è causata dalle scottature dovute ad un'eccessiva esposizione al sole senza un'adeguata protezione. Le creme idratanti e lo scrub delicato per il corpo e il viso sono ottimi rimedi per uniformare il colorito della pelle ed evitare che si formino delle macchie antiestetiche. Ecco i prodotti da utilizzare, le creme naturali, quali cibi mangiare e gli errori da evitare per mantenere la pelle tonica ed elastica.

fanpage

it

Write a title and summarize: SECTION 1. SHORT TITLE. This Act may be cited as the ``Jumpstart VA Construction Act''. SEC. 2. FINDINGS. Congress makes the following findings: (1) The buildings of the Department of Veterans Affairs have an average age of 60 years. (2) Since 2004, use of Department facilities has grown from 80 percent to 120 percent, while the condition of these facilities has eroded from 81 percent to 71 percent over that same period of time. (3) The Department currently manages and maintains more than 5,600 buildings and almost 34,000 acres of land. (4) More than 3,900 infrastructure gaps remain that will cost between $54,000,000,000 and $66,000,000,000 to close, including $10,000,000,000 in activation costs. (5) The Veterans Health Administration has 21 major construction projects dating to 2007 that have been only partially funded. (6) The total unobligated amount for all currently budgeted major construction projects exceeds $2,900,000,000. (7) To finish existing projects and to close current and future gaps, the Department will need to invest at least $23,200,000,000 over the next 10 years. (8) At current requested funding levels, it will take more than 67 years to complete the 10-year capital investment plan of the Department. SEC. 3. PROGRAM FOR THE CONSTRUCTION OF DEPARTMENT OF VETERANS AFFAIRS MAJOR MEDICAL FACILITY PROJECTS BY NON-FEDERAL ENTITIES UNDER PARTNERSHIP AGREEMENTS. (a) In General.--The Secretary of Veterans Affairs shall carry out a program under which the Secretary shall enter into partnership agreements on a competitive basis with appropriate non-Federal entities for the construction of major construction projects authorized by law. (b) Selection of Projects.--The Secretary shall select major construction projects for completion by non-Federal entities under the program. Each project selected shall be a major medical facility project authorized by law for the construction of a new facility for which-- (1) Congress has appropriated any funds; (2) the design and development phase is complete; and (3) construction has not begun, as of the date of the enactment of this Act. (c) Agreements.--Each partnership agreement for a construction project under the program shall provide that-- (1) the non-Federal entity shall obtain any permits required pursuant to Federal and State laws before beginning to carry out construction; and (2) if requested by the non-Federal entity, the Secretary shall provide technical assistance for obtaining any necessary permits for the construction project. (d) Application.--To be eligible to participate in the program established under subsection (a), a non-Federal entity shall submit to the Secretary an application at such time, in such manner, and containing such information as the Secretary may require, including the following: (1) A description of the project manager of each major construction project for which the Secretary enters into a partnership agreement under the program. (2) A description of the non-Federal contributions to the project and how future funding will be secured. (3) A description of the project management plan that the non-Federal entity will use to ensure concise and consistent communication of all parties involved in the project. (4) A description of metrics to monitor change order process times, with the intent of expediting any change order. (5) Expected costs associated with the project. (6) A description of construction timelines and milestones association with the project. (7) Such other information as the Secretary may require. (e) Matching Funds.--The Department of Veterans Affairs shall provide matching funds under this program-- (1) In general.--For any fiscal year, the Secretary shall provide to a non-Federal entity that enters into a partnership agreement with the Secretary under the program established under subsection (a) matching funds in an amount that does not exceed 50 percent of the amount expended by the non-Federal entity. (2) Rule of construction.--Paragraph one shall not be construed as a limitation on the amount that may be expended by a non-Federal entity for a fiscal year for a construction project covered by a partnership agreement under the program. (f) Comptroller General Report.--The Comptroller General of the United States shall submit to Congress a biennial report on the partnership agreements entered into under the program. (g) Deadline for Implementation.--The Secretary shall begin implementing the program under this section by not later than 180 days after the date of the enactment of this Act.

Title: Jumpstart VA Construction Act Summary: Jumpstart VA Construction Act This bill directs the Department of Veterans Affairs (VA) to enter into partnership agreements with non-federal entities for the construction of major medical construction projects authorized by law. Each selected project shall be for construction of a new facility for which: (1) Congress has appropriated funds, (2) the design and development phase is complete, and (3) construction has not begun as of the date of enactment of this Act.

billsum

en

Summarize: What if a blood test could reveal that your child is at high risk for early heart disease years in the future, giving you a chance to prevent it now? A big study in England did that — screening thousands of babies for inherited risk — and found it was twice as common as has been thought. The study also revealed parents who had the condition but didn't know it, and had passed it on to their children. Ninety percent of them started taking preventive medicines after finding out. Researchers say the two-generation benefits may convince more parents to agree to cholesterol testing for their kids. An expert panel in the United States recommends this test between the ages of 9 and 11, but many aren't tested now unless they are obese or have other heart risk factors such as diabetes or high blood pressure. For every 1,000 people screened in the study, four children and four parents were identified as being at risk for early heart disease. That's nearly twice as many as most studies in the past have suggested. "We really need to pay attention to this," said Dr. Elaine Urbina, director of preventive cardiology at Cincinnati Children's Hospital Medical Center and a member of the U.S. expert panel. "It's reasonable to screen for something that's common, dangerous and has a treatment that's effective and safe." Dr. William Cooper, a pediatrics and preventive medicine professor at Vanderbilt University, called it "an innovative approach" that finds not just kids at risk but also parents while they're still young enough to benefit from preventive treatment, such as cholesterol-lowering statin drugs. Statins aren't recommended until around age 10, but certain dietary supplements such as plant sterols and stanols could help younger kids, Urbina said. "We're not talking about putting all these kids on statins," she said. The study was led by Dr. David Wald at Queen Mary University of London. He and another author founded a company that makes a combination pill to prevent heart disease. The work was funded by the Medical Research Council, the British government's health research agency. Results were published Wednesday by the New England Journal of Medicine. Researchers were testing for familial hypercholesterolemia, a genetic disorder that, untreated, raises the risk of a heart attack by age 40 tenfold. They did a heel-stick blood test on 10,059 children ages 1 to 2 during routine immunization visits to check for high cholesterol and 48 gene mutations that can cause the disorder. If a child was found with the disorder, parents were tested. One in 270 children had the gene mutations; others were identified through cholesterol levels alone. "That's a pretty common genetic defect," said Dr. Stephen Daniels, chairman of pediatrics at the University of Colorado School of Medicine and a member of the U.S. expert panel. But many parents balk at the idea of testing children for a disorder associated with middle age, experts say. Karen Teber, a media relations specialist in Madison, Wisconsin, was surprised when a doctor wanted to test her 12-year-old stepson. "My reluctance was really born out of lack of information," she said. "I hadn't heard of it before." The study did not address whether screening is cost-effective. In the U.S., cholesterol tests cost around $80 and usually are covered by health insurance, though much lower prices often are negotiated. The study authors in England estimated that if cholesterol testing costs $7 and gene testing costs $300, it would cost $2,900 for every person identified as having the disorder. ___ Online: U.S. guidelines: http://www.nhlbi.nih.gov/guidelines/cvd_ped/index.htm Cholesterol info: http://tinyurl.com/23dtxvo and http://www.nhlbi.nih.gov/health/resources/heart#cholesterol ___ Marilynn Marchione can be followed at http://twitter.com/MMarchioneAP. Screening strategy could prevent about 600 heart attacks in people under the age of 40 The researchers from QMUL's Wolfson Institute of Preventive Medicine estimate that, with effective treatment, the screening strategy could prevent about 600 heart attacks in people under the age of 40, each year in England and Wales, if the programme was rolled out by public health agencies. Familial hypercholesterolaemia (FH) is a genetic disorder characterised by high cholesterol levels and is the main inherited cause of early heart disease. Without preventive medication young FH adults have about a 10-fold increased risk of a heart attack before the age of 40. In the largest study to date of cholesterol and FH mutations in children, the prevalence of FH mutations in children was found to be about 1 in 270, nearly double that previously reported (1 in 500). Because of the inherited nature of the disorder every child identified with the disorder will have one parent also affected. This offers the opportunity of screening two generations at the same time - so-called child-parent screening. Lead researcher Professor David Wald said: "This is the first demonstration that child-parent screening works on a large scale. It's the only screening method that stands a reasonable chance of covering the whole population and identifying those at highest risk of an early heart attack. "Now that we've demonstrated this as being effective across England, the next step is for public health agencies to consider offering this routinely at the time of childhood vaccination to test all children aged 1-2 years." The study, published in the New England Journal of Medicine and funded by the Medical Research Council, involved screening at 92 general practices across England. 10,059 children were tested for high cholesterol and FH genetic mutations and 40 were found to be FH positive. Once an FH positive child was found, the parents were then contacted for screening, revealing an additional FH positive parent. Overall, one person at high risk of early heart attack was identified for every 125 people tested. The child-parent screening strategy identifies children and their parents together so that early preventive action can be taken. Medication, including statins, can be started immediately in the parents and in children as teenagers, and advice can be given on sensible diets and avoidance of smoking. Professor Wald added: "This is an example of an effective screening strategy being combined with routine vaccination, which has clear advantages. No extra clinic visits are needed and uptake is high because parents are already focussed on the future health of their children and the family as a whole. The one-stop service requires no new clinical infrastructure and is simple and inexpensive to implement." The researchers say that GPs and parents welcomed the screening opportunity, with 84 per cent of families accepting it. ### Notes to the editor Research paper: 'Child-Parent Familial Hypercholesterolemia Screening in Primary Care'. David S. Wald, F.R.C.P., Jonathan P. Bestwick, M.Sc., Joan K. Morris, Ph.D., Ken Whyte, Lucy Jenkins, F.R.C.Path., and Nicholas J. Wald, F.R.S. The New England Journal of Medicine 2016;375:1628-37. DOI: 10.1056/NEJMoa1602777 An ounce of screening now may prevent hundreds of early heart attacks in the UK down the road, suggests a new study published Thursday in the New England Journal of Medicine. Researchers conducted a small-scale screening program across 92 doctors’ offices scattered throughout England. They were specifically looking for children with a rare genetic condition called familial hypercholesterolaemia (FH), which causes high levels of low density lipoprotein (LDL) cholesterol and dramatically increases the chances of a heart attack — many sufferers experience one in their 40s or earlier without treatment, and 85 percent of men with FH have had one by the time they turn 60. Over 10,000 children were tested for high cholesterol and the FH mutation while they got their routine childhood vaccines, and 32 FH positive children were identified. Since the mutation is passed down from one side of the family, doctors also screened these children’s parents, a strategy known as child-parent screening, or cascade testing, and found an extra 40 people with FH. Ultimately, the researchers estimated that for every 125 people screened, the program had found one at high risk of having a heart attack before the age of 40. Expanded to the rest of the country, they calculated the program would prevent around 600 such heart attacks annually. "This is the first demonstration that child-parent screening works on a large scale,” said lead author Professor David Wald of the Queen Mary University Of London in a statement. “It's the only screening method that stands a reasonable chance of covering the whole population and identifying those at highest risk of an early heart attack.” A screening program for a rare genetic condition can reliably find people at high risk of early heart attacks, UK researchers find, and may prevent hundreds of cases annually if expanded further. Pixabay, Public Domain Aside from being life-saving, the program could easily be implemented, explained Wald. "This is an example of an effective screening strategy being combined with routine vaccination, which has clear advantages,” he said. “No extra clinic visits are needed and uptake is high because parents are already focussed on the future health of their children and the family as a whole.” Overall, 84 percent of families asked went through with the screening. FH screening programs have begun in countries elsewhere, such as the Netherlands and Slovenia. In the U.S., the Centers for Disease Control and Prevention has called for a rapid expansion of state and local efforts to test for FH and other common but rarely detected mutations, dubbing them “Tier 1 applications” for genetic screening. Currently, however, only a few states (Texas, Utah, and West Virginia) have started any such programs. West Virginia has offered universal cholesterol screenings to 5th grade children since 1998, while Utah and Texas asked its high school students to fill out “family tree” surveys during the 1980s to find people with a high genetic risk of cancer and heart disease. West Virginia’s program has so far found more than 200 children and parents with the condition, out of 100,000 5th graders screened. Earlier this August, the US Preventive Services Task Force, an independent panel of experts that guide nationwide screening practices, found these programs can lower the LDL levels of children with FH via preventative treatment. As of yet, though, there’s no concrete evidence whether these early efforts prevent later heart disease, they added. It’s estimated that anywhere from one in every 200 to 500 people may have FH. Source: Waid D, Bestwick J, Morris J, et al. Child-Parent Familial Hypercholesterolemia Screening in Primary Care. The New England Journal of Medicine. 2016.

Summary: It's never too early for baby's first cholesterol test. Researchers believe all children between the ages of 1 and 2 should be screened for familial hypercholesterolemia (FH), a genetic condition that drastically increases the risk of heart attacks under the age of 40, according to a press release. In a study published Thursday, researchers screened more than 10,000 toddlers for FH through genetic and cholesterol testing. They found nearly 0.4% of children have FH-nearly twice as many as previously believed. Researchers say early testing could prevent about 600 heart attacks in people under the age of 40 every year in Britain alone. "It's reasonable to screen for something that's common, dangerous, and has a treatment that's effective and safe," one doctor tells the AP. Researchers argue that early screening would be easy to implement, Medical Daily reports. Toddlers can be tested at the same time they're vaccinated, and there's no follow-up visits required. According to AFP, the best treatment for children with FH is exercise and eating right. Testing toddlers also has another benefit. Because FH is passed on genetically, finding a child with FH also means finding at least one parent with the condition who may or may not have been aware of it. Researchers say 90% of parents who found out they had FH during the study sought treatment for it. And early testing is apparently popular with families. During the study, 84% of families asked if they wanted their child screened said yes.

multi_news

en

Summarize: WASHINGTON (Reuters) - The U.S. State Department has approved the potential sale of more than 130 Abrams battle tanks, 20 armored recovery vehicles and other equipment, worth about $1.15 billion, to Saudi Arabia, the Pentagon said on Tuesday. An Abrams main battle tank, for U.S. troops deployed in the Baltics as part of NATO's Operation Atlantic Resolve, leaves Riga port March 9, 2015. REUTERS/Ints Kalnins The approval for land force equipment coincides with Saudi Arabia leading a military coalition in support of Yemeni forces loyal to the exiled government of President Abd-Rabbu Mansour Hadi who are trying to oust Iran-allied Houthi forces from the capital, Sanaa. Human rights groups have criticized the coalition’s air strikes because of the deaths of civilians. The U.S. Defense Security Cooperation Agency, which implements foreign arms sales, said that General Dynamics will be the principal contractor for the sale. “This sale will increase the Royal Saudi Land Force’s (RSLF) interoperability with U.S. forces and conveys U.S. commitment to Saudi Arabia’s security and armed forces modernization,” the agency said in a notice to lawmakers posted on its website. Lawmakers have 30 days to block the sale, although such action is rare. Saudi Arabia and its mostly Gulf Arab allies intervened in Yemen’s civil war in March 2015 after the Houthi movement had pushed the Hadi administration into exile in Saudi Arabia. On Tuesday, the Saudi-led military coalition conducted air strikes on Sanaa for the first time in five months, residents said, after U.N.-backed peace talks to end the conflict broke down at the weekend. Medics said nine civilians were killed in a strike on a potato chip factory in the Nahda district of the capital. Amnesty International and Human Rights Watch called on the United Nations General Assembly in June to suspend Saudi Arabia from the U.N. Human Rights Council until the military coalition stops killing civilians in Yemen. “The Saudi-led coalition’s campaign in Yemen has been devastating for civilians (and) the U.S. should be suspending arms sales to Saudi Arabia, not approving more,” said Kristine Beckerle, a researcher with Human Rights Watch. U.S. Senator Chris Murphy, a Democrat from Connecticut who has been critical of arms sales to Saudi Arabia, said in a statement that he was concerned about the high civilian casualty rate in Yemen. Murphy said Saudi Arabia had “largely backed away from” the fight against Islamic State militants “and I’d like to see them commit to rejoin that fight as part of major new military sales.” Republican Donald Trump criticized U.S. military support for several countries — Saudi Arabia, Japan, Germany and South Korea — during a discussion on nuclear proliferation at a CNN town hall in late March, saying “we can’t afford it.” We’ll answer the question: What exactly does the U.S. provide in terms of military support to these countries? The United States gives very little monetary military aid to those countries — about $10,000 to Saudi Arabia in fiscal year 2014. And Saudi Arabia purchased more than $2 billion of military equipment and construction services that year. The support the U.S. provides to the other countries — Japan, Germany and South Korea — comes from the cost of having U.S. military bases in those countries, and the added cost and benefit of that is difficult to quantify. We’ll go through the available numbers. Trump, the GOP presidential front-runner, made his remarks when CNN’s Anderson Cooper asked him about his statement to the New York Times that he might support Japan and South Korea having nuclear weapons. Here’s an edited portion of that exchange: Trump, March 29: We are supporting nations now, militarily, we are supporting nations like Saudi Arabia. … We are supporting them, militarily, and pay us a fraction, a fraction of what they should be paying us and of the cost. We are supporting Japan. Most people didn’t even know that. Most people didn’t know that we are taking care of Japan’s military needs. We’re supporting … (crosstalk) Trump: Excuse me, excuse me, we’re supporting Germany. We’re supporting South Korea. I order thousands of television sets because I am in the real estate business, you know, in my other life, OK. Cooper: It has been a U.S. policy for decades to prevent Japan from getting a nuclear weapon. Trump: That might be policy, but maybe … Cooper: South Korea as well. … Trump: At some point we have to say, you know what, we’re better off if Japan protects itself against this maniac in North Korea, we’re better off, frankly, if South Korea is going to start to protect itself, we have … Cooper: Saudi Arabia, nuclear weapons? Trump: Saudi Arabia, absolutely. Cooper: You would be fine with them having nuclear weapons? Trump: No, not nuclear weapons, but they have to protect themselves or they have to pay us. Here’s the thing, with Japan, they have to pay us or we have to let them protect themselves. … Anderson, when you see all of the money that our country is spending on military, we’re not spending it for ourselves; we’re protecting all of these nations all over the world. We can’t afford to do it anymore. Cooper: But isn’t there benefit for the United States in having a secure Europe? Isn’t there benefit for the United States in having a secure Asia? Trump: There’s a benefit, but not big enough to bankrupt and destroy the United States, because that’s what’s happening. We can’t afford it. It’s very simple. Military Aid Let’s start with the easy part: what the United States spends on foreign military aid overall, and to these countries in particular. Total foreign aid, of all kinds, was an estimated $35.3 billion in 2014, and $5.9 billion of that was military financing with another $105.6 million for international military education and training, according to State Department figures on foreign assistance (see Table 3b). Most of the military financing (75 percent) went to Israel and Egypt. That’s followed by Iraq, Jordan and Pakistan. The countries Trump mentioned — Saudi Arabia, Japan, Germany and South Korea — didn’t receive any foreign military financing, though Saudi Arabia received $10,000 for military education and training. Total U.S. 2014 spending was about $3.8 trillion, making foreign aid 0.9 percent of federal spending, and foreign military aid plus the military training aid 0.16 percent. There are other categories of spending that could count as foreign military spending, but they don’t increase the numbers for the countries Trump mentioned. We contacted the National Priorities Project, which tracks federal spending, and Research Director Lindsay Koshgarian put together spreadsheets for us with numbers from the USAID Greenbook, which includes data on overseas loans and grants. Those numbers show $10.3 billion in foreign military aid in 2014, but no real difference in terms of the countries Trump mentioned (less than $10,000 went to Saudi Arabia in 2014 and, again, no money went to Japan, Germany or South Korea). The State Department “foreign military financing” category includes money given to foreign governments to purchase U.S. weapons or training, while the USAID figure includes other categories of spending, including military construction, peacekeeping operations and counter-drug activities. The small amount of military education and training money for Saudi Arabia has been requested by the Obama administration so that the country will be eligible for “a substantial discount on the millions of dollars of training it purchases through the Foreign Military Sales program,” according to a 2016 Congressional Research Service Report. This discount may be what Trump was referring to when he said Saudi Arabia pays “a fraction of what they should be paying us,” but we received no response from his campaign when we asked for clarification on his remarks. The CRS report doesn’t explain how “substantial” this discount is. Department of Defense figures show sales agreements for military equipment and construction services totaled an estimated $3.9 billion from Saudi Arabia in 2014, with more than $2 billion of those sales actually delivered that fiscal year. There are also Saudi-funded training and advisory roles for U.S. personnel, aimed at improving anti-terrorism activities, says CRS. We could go back a decade and still see very little in direct U.S. military aid to these countries. To give a broader view, Koshgarian calculated military aid from 2005 to 2014, but even this total, she says, is “barely even pennies” in terms of the federal budget. All told over that decade, Germany, Japan, South Korea and Saudi Arabia received $2.7 million, with most of it consisting of Defense Department funding for Germany for “Drug Interdiction and Counter-Drug Activities.” Michael P. Noonan, director of research and director of the Program on National Security for the Foreign Policy Research Institute, also pointed out that “all of those countries are big buyers of U.S. military equipment.” Military equipment and construction services sales delivered in 2014 totaled $526.8 million for Japan, $641 million for South Korea and $163.7 million for Germany. As Noonan says, in terms of military aid or financing to these countries, “We’re talking a minuscule amount of money.” Where the U.S. really supports Japan, Germany and South Korea is in having U.S. military bases in those countries, but quantifying the extra cost for the U.S. to keep troops there, as opposed to on bases in the United States, is difficult — not to mention the difficulty in putting a price tag on a benefit to the host country versus a benefit to the United States. Keeping Troops Abroad A 2013 Senate Committee on Armed Services report put the cost of supporting the U.S. military presence abroad at more than $10 billion a year, 70 percent — or nearly $7 billion — of which, the report said, was spent in Germany, the Republic of Korea and Japan. Strategically, the report said, this made sense. Senate Armed Services Committee report, April 15, 2013: The fact that such a high percentage of our overseas spending involves those three countries is not surprising. Germany is among our most important partners in the North Atlantic Treaty Organization (NATO), an alliance President Obama has rightly called “indispensable to global security and prosperity.” The U.S.-Japan alliance is, and will continue to be, a cornerstone of our engagement in the Asia Pacific region. And our alliance with the Republic of Korea is central to both our strategic interests in the Asia Pacific and our ability to deal with the unpredictable and frequently aggressive behavior of the North Korean regime. To add some context to the cost of the overseas military presence, the Department of Defense’s total base budget, which excludes funding for combat activities, for fiscal 2014 was $502 billion. There are about 49,000 U.S. troops stationed in Japan, 28,000 in South Korea and 38,000 in Germany. These countries make contributions toward the cost of keeping U.S. military bases there, with Japan contributing $2 billion in 2012 and South Korea giving $765 million. The Senate Committee on Armed Services report concluded that the contributions from those two countries, which were agreed upon by the U.S., hadn’t kept pace with the growth of costs for the United States. (In terms of Germany, the report faulted the U.S. for not seeking cash payments for the return of facilities to Germany, and instead accepting in-kind contributions.) But if those troops — or not as many of them — weren’t stationed in these countries, they would be stationed somewhere else. So, what is the extra cost the U.S. faces to keep those troops abroad? A 2013 RAND Corporation report, commissioned by the Department of Defense, put the additional cost per personnel per year at $10,000 to $40,000, a figure that varied depending on the country and branch of service. RAND called the financial and in-kind support from host nations “substantial,” but not enough to offset the higher cost of basing forces overseas. It said the “fixed costs per base do not appear to be systematically higher overseas, with the exception of the Air Force bases, compared with facilities in the United States,” but the “variable costs per person” were higher overseas. That’s due to “higher allowances related to the cost of living, higher permanent-change-of-station move costs, and the need to provide schools more comprehensively.” Whether $10,000 to $40,000 per personnel per year is expensive or cheap is a matter of opinion. Michael E. O’Hanlon, co-director of the Brookings Institution’s Center for 21st Century Security and Intelligence, told us it’s a reasonable cost, considering the benefits to the U.S. of having troops and bases abroad. “It’s not that expensive to have these forces oversees and most of the additional costs are being paid” by the U.S. allies, O’Hanlon said. The RAND numbers are estimates, and the report describes the difficulty in making such calculations. It says the data “suggest” that Japan, South Korea and Germany “are among the biggest contributors” of host-nation support to the U.S., but even the direct contributions, which Japan makes, “can be difficult to quantify and value.” Indirect contributions, from countries like Germany, “can be even more difficult to quantify and value,” including “forgone rent and lease payments and waivers of taxes, fees, and damage claims.” There are benefits and risks to keeping U.S. troops abroad, as the RAND report outlined. Among the benefits: improved operational response; deterrence to U.S. adversaries; assurance to allies, which influences allies’ strategic decisions; and improved knowledge of cultural differences and foreign military operations. The risks include being vulnerable to attack from hostile actors in the region, facing some uncertainty to accessing military facilities in a time of conflict and paying higher costs. “These countries are giving up some of their sovereignty by allowing U.S. troops to be there,” Noonan told us. There is “a bit of a deterrence value to having U.S. troops there,” but the U.S. also uses those troops in the region, outside the base countries, where the U.S. has security concerns. “It’s not just providing security to those countries, it’s providing troops and equipment to do other things in the region.” It’s difficult, if not impossible, to separate what the U.S. spends defending or supporting these countries from what the U.S. spends for its own interests — particularly given that those two factors are entwined. “We of course do have far and away the most capable military in the world,” O’Hanlon said. “Certainly [it’s the] U.S. that would be defending those countries and not the other way around.” But that “shouldn’t be seen as an act of charity.” The U.S. decided after two world wars that it would be a better strategy to have a military presence in those countries to prevent conflicts, rather than sending troops in later. Some of these countries do have vulnerabilities in terms of common defense, says O’Hanlon. “We spend a lot more than these countries do [on defense] as a percent of our GDP in most cases.” For 2015, Germany and Japan spent 1.2 percent and 1 percent of GDP, respectively, compared with the United States, which spent 3.3 percent of its GDP on the military, according to figures from the Stockholm International Peace Research Institute. But South Korea spent 2.6 percent, close to the United States’ spending, and Saudi Arabia spent 13.7 percent. There’s also history behind Japan’s low amount of military spending — a history that illustrates how supporting another country militarily can be a strategic move on the part of the United States. “Now, for 50 years, we were very happy that Japan has this firm ceiling on military spending,” O’Hanlon said, noting that it would wrong to “lose sight of this history.” After World War II, the U.S. helped write the country’s constitution, which says that military forces for war “will never be maintained,” as a 2016 Congressional Research Service report explains. After the Korean War started, the U.S. encouraged and Japan created a military force called the Self-Defense Forces, interpreting the constitution to allow for self-defense. The one-sided nature of the U.S.-created agreement has been changing. The CRS report describes the Japan-U.S. agreement as “fundamentally asymmetric” as originally constructed, with the U.S. having use of more than 80 military facilities in Japan in exchange for guaranteeing Japan’s security. “[B]ut this partnership has shifted toward more equality,” the CRS report said. “Japanese Prime Minister Shinzo Abe is a strong supporter of the alliance and has had notable success on his ambitious agenda to increase the capability and flexibility of Japan’s military,” the report said. For instance, Abe successfully pushed new laws, which took effect in March, that allow Japan to defend U.S. forces, and those of other allies, if they are attacked. Stars and Stripes said the new legislation “broadens Japan’s ability to work with the United States and other militaries to its greatest extent since World War II. ” The U.S. military is planning troop realignments and base restructurings, with plans for about 9,000 Marines to move from Okinawa to Guam, Hawaii and, on a rotational basis, Australia. Japan agreed to pay $3.1 billion, 36 percent of the total cost, for the development of the facilities in Guam and the Commonwealth of the Northern Mariana Islands. In exchange, the U.S. agreed to allow Japan to use the facilities for training. An April 6 Wall Street Journal editorial mentioned that contribution, as well as billions of dollars that both Japan and South Korea are contributing to U.S. military construction projects in those countries. “Americans should understand that these countries are not free riders and forward deployments in Asia are crucial to U.S. security,” the editorial said, responding to Trump’s criticisms of the U.S. military presence in Japan and South Korea. The 2013 RAND report said that the United States’ ability to respond to national and global security threats, as well as the desire to keep international commitments and maintain relationships with allies, required “at least some forces in Europe, the Middle East, and Asia — but how much in each is less clear.” Trump is entitled to his opinion that the U.S. “can’t afford” military spending in Saudi Arabia, Japan, Germany and South Korea. But the facts are that military spending in these countries is a relatively small percentage of total U.S. military spending and provides strategic benefits that cannot be quantified. Update, April 20: Seth Binder, program manager and research associate for the Center for International Policy’s Security Assistance Monitor, contacted us to say his group calculates a higher total for foreign military assistance than we cite here. The nearly $16 billion total for fiscal year 2014 includes other categories of Defense Department spending, such as funding for foreign military personnel to attend U.S. service academies. Saudi Arabia received $72,000 and South Korea received $520,550 under that program in 2014. Still, the total amount for the four countries Trump mentioned was small: $831,878 in 2014. Graffiti on walls across Sana reads: “America is killing the Yemeni people.” President-elect Donald J. Trump has not said whether he will continue United States support for the war, but has been very critical of Saudi Arabia, saying it does not “survive without us.” At a rally in January, he said Iran was “going into Yemen” and was “going to have everything” in the region, but he did not clarify how he would respond. The sweeping destruction of civilian infrastructure has led analysts and aid workers to conclude that hitting Yemen’s economy is part of the coalition’s strategy. “The economic dimension of this war has become a tactic,” said Jamie McGoldrick, the United Nations’ humanitarian coordinator for Yemen. “It is all consistent — the port, the bridges, the factories. They are getting destroyed, and it is to put pressure on the politics.” In a written response to questions, a coalition spokesman, Maj. Gen. Ahmed Asseri, said the air campaign had halted the rebels’ advance, destroyed 90 percent of their rockets and aircraft and pressured them to join talks aimed at ending the war. He denied that the coalition sought to inflict suffering on civilians and said only facilities connected to the war effort had been hit. He blamed the rebel group, the Houthis, for the humanitarian crisis. “This is primarily the responsibility of the rebels, who have displaced Yemen’s legitimate government and who are impeding the flow of humanitarian supplies,” General Asseri said. Saudi Arabia and other Persian Gulf countries are also among the top donors of aid to Yemen. So even as they undermine its self-sufficiency, they help sustain the population. The air campaign’s civilian toll has led to calls by some American lawmakers to postpone arms sales to Saudi Arabia.

Summary: Saudi Arabia is using American-made weapons in a destructive campaign against Houthi rebels in Yemen, the New York Times reports. The remains of US-made, laser-guided bombs have been found in the wreckage of multiple deadly airstrikes-including an attack on a funeral last month, which killed 140 people. A Saudi-led Arab military coalition intervened to support Yemen's government after Houthi rebels backed by Iran took over the capital city of Sanaa and drove the government into exile in 2014. With the Iranian military supporting the Houthis, and the Saudi-led coalition supporting the government, the conflict quickly ground to a stalemate. As the fight rages on, the NYT reports, the Saudi coalition has taken to targeting bridges, ports, and other infrastructure targets-often with American-made bombs. Saudi Arabia purchased almost $4 billion of military equipment and construction services from the US in 2014, according to FactCheck.org. And in August of this year, the US State Department approved a new sale of $1.15 billion in military equipment to Saudi Arabia, Reuters reports. The US Defense Security Cooperation Agency said the sale "conveys US commitment to Saudi Arabia's security and armed forces modernization." The sale occurred right around the time Saudi Arabia was intensifying its air campaign within Yemen. Despite concerns from human-rights groups, the US State Department refused to address the concern that the weapons would be used against civilians in Yemen, the Guardian reports. A State Department spokesperson would only say: "We regularly talk to our partners and our allies around the world. You know, civilian casualties are obviously of grave concern to us."

multi_news

en

Summarize: CROSS-REFERENCE TO RELATED APPLICATION This is a continuation-in-part application of my co-pending U.S. application Ser. No. 77,342, filed Sept. 20, 1979 for a &#34;Paste Dispensing Toothbrush&#34;, now U.S. Pat. No. 4,277,194 issued July 7, 1981. BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a paste and solid material dispenser and more particularly, but not by way of limitation, to a mechanical apparatus for the dispensing of toiletry and cosmetic materials, such as toothpaste, deodorant and the like. 2. History of the Prior Art There has been a long-felt need to provide a handy toiletry dispensing apparatus which can dispense such items as toothpaste, lipstick, stick deodorant and the like. Many attempts have been made to provide toothbrushes which carry their own supply of toothpaste in the handle or in a compartment associated with the toothbrush primarily for the purposes of portability to obviate the need of carrying a toothbrush and separately carrying a tube of toothpaste. Until the disclosure of my co-pending application, there had been little success in providing such an apparatus that is simple and economical in construction and yet effective in getting the job done. However, even with the apparatus of my co-pending application, after a cartridge of toothpaste has been expelled, it would be necessary to rotate the operator member in order to withdraw the drive member to accept a new cartridge. Other dispensers of toiletry and cosmetic products, such as stick deodorant and lipstick, while being reasonably effective, are wasteful in that the dispenser which moves the product out of the container is typically discarded after the container is empty. These devices usually have a cranking mechanism at one end thereof coupled with either a threaded rod or other mechanical device to move the product out the opposite end. Even though these dispensing devices are relatively unsophisticated, the discarding of the container after it is empty is both wasteful from a natural resource standpoint and it significantly adds to the cost of the material being dispensed, all of which must ultimately be borne by the consumer. SUMMARY OF THE INVENTION The present invention provides a material dispensing apparatus which is reusable, simple and effective in operation and is designed to overcome the above-identified disadvantages. The dispenser primarily comprises a hollow handle member having internal threading over a portion of the length thereof. An elongated sleeve member is rotatably disposed within the handle member for containing a preloaded cartridge of toothpaste, stick deodorant, lipstick or other toiletry product. A rotary drive member is carried by the sleeve member and engaged with the internal threading of the handle member. Each end of the sleeve member is provided with an operator/dispenser nozzle whereby rotation of this operator/dispenser nozzle causes the drive mechanism to move toward the opposite end of the tube which will dispense the product located therein. After the product has been totally dispensed, a new product is simply loaded into the opposite end of the device and the second operator dispenser mechanism may be rotated in order to move the drive member toward the opposite end of the handle member. In this manner, the device is quite easily usable as a toothpaste dispenser by simply having a toothbrush mechanism that will attach to either end of the handle. The device is further readily usable with stick deodorant, lipstick or other toiletry material, without incurring the wastefulness of disposing of the entire mechanism after it has been used. In fact, the present device may be used over and over again and hence, would warrant being constructed from a more durable material, such as high-impact plastic or even metal. In the use of paste material, two embodiments of a collapsible cartridge are taught herein which would be very adept at handling toothpaste or other paste products. The first embodiment relates to a cartridge made of a plurality of flexible bevel units formed in an accordion style which may be easily collapsed by the drive mechanism while forcing the material out of the end of the apparatus. The second embodiment relates to a telescoping cartridge which may be made of very inexpensive plastic material. DESCRIPTION OF THE DRAWINGS Other and further advantageous features of the present invention will hereinafter more fully appear in connection with a detailed description of the drawings in which: FIG. 1 is a side elevational view of a dispensing apparatus embodying the present invention and having a toothbrush attached at one end thereof. FIG. 2 is a side elevational sectional view of the device of FIG. 1 depicting a first embodiment of a collapsible toothpaste container or cartridge therein. FIG. 3 is a side elevational view of the device of FIG. 2 depicting the cartridge in a partially collapsed condition. FIG. 4 is a partial side elevational view of the device of FIG. 3 wherein the cartridge is totally collapsed. FIG. 5 is a side elevational sectional view of the device of FIG. 1 depicting a second embodiment of a collapsible cartridge therein. FIG. 6 is an end elevational sectional view taken along the broken lines 6--6 of FIG. 5. FIG. 7 is a side elevational view of the device of FIG. 1 depicting a stick material, such as deodorant or lipstick, contained therein. DESCRIPTION OF THE PREFERRED EMBODIMENTS Referring to the drawings in detail, reference character 10 generally indicates a material dispensing apparatus comprising an elongated hollow handle member 12 and a pair of oppositely disposed operator nozzle members 14 and 16 rotatably carried at each end of the handle member 12. A portion of the interior of said handle member is provided with internal threading 17. An elongated cylindrical sleeve member 18 is rotatably carried within the handle member 12 by means of sealing or rotating rings 20 and 22 at each end thereof. These rings 20 and 22 may be in the form of bearings, sleeve inserts or the like. The outer ends of the sleeve member 18 are provided with threaded portions 24 and 26 which extend outwardly of the handle member 12 at each end thereof. A pair of elongated longitudinal slots 28 and 30 are provided on opposite sides of the sleeve member 18. An elongated plate member 32 having rectangular cross-section is slidably disposed within the slots 28 and 30. Each end of the plate member 32 is provided with threads at 34 and 36 for threadedly meshing with the internal threading 17 of the handle member. The plate member 32 will be hereinafter referred to as a dispenser device member. The interior of the handle member is provided with gaps in the threading at 38 and 40 at each end thereof for a purpose that will be hereinafter set forth. The operator member 14 comprises a cylindrical roller member having threads at 42 for attachment to the threaded end 24 of the sleeve member 18. The outer end of the collar member 13 is likewise provided with a plurality of internal threads at 44 for a purpose that will be hereinafter set forth. The operator member 16 also constitutes a collar member provided with internal threading 46 at the inner end thereof and internal threading 48 at the outer end thereof leaving a passageway therethrough. When the device 10 serves as a toothpaste dispenser, an elongated toothbrush shank member 50 is provided. The toothbrush shank member 50 has bristles 52 at one end thereof and a threaded coupling portion 54 at the opposite end thereof which is matable with either the threads 44 of the operator member 14 or the threads 48 of the operator member 16. The shank 50 of the toothbrush is also provided with an elongated passageway 56 therethrough having ports 58 for allowing paste traveling through said passageway to enter into contact with the bristles 52. The inner end of the shank member is provided with a cylindrical knife edge cutter 60 for a purpose that will be hereinafter set forth. Referring to FIGS. 2, 3 and 4 of the drawings, reference character 62 generally indicates a collapsible toothpaste or general paste dispenser cartridge which comprises a plurality of oppositely facing bevel members 64 and 66 which are made of a flexible material such as plastic and are arranged in an accordion fashion for containing a paste 68 therein. One end of the cartridge 62 is provided with a sealing membrane 70 thereacross, the opposite end being sealed by a plate member 72 having an inwardly extending mandrel 74 secured thereto or made as a part thereof. In operation, the toothbrush shank 50 is removed from the dispensing apparatus and the loaded cartridge 62 is inserted therein with the plate member 72 being disposed in contact with the dispensing drive member 32. The toothbrush shank member 50 then, by means of its threads 54, is threadedly attached to the coupling member 14 and screwed all the way down so that the knife edge portion 60 thereof pierces the sealing membrane 70 of the cartridge 62. This, therefore, opens the interior of the cartridge 62 to the passageway 56 of the toothbrush shank member. The operator member 16 may then be rotated thereby causing the sleeve member 18 to be rotated therewith. Rotation of the sleeve member 18 causes the drive dispenser member 32 to threadedly move along the internal threading 17 of the handle member thereby causing the cartridge to start collapsing which forces paste out the open end thereof into the passageway 56 of the toothbrush shank member ultimately applying paste to the bristles 58 thereof. After use of the toothbrush, the bristles 58 may simply be washed out or if it is desired to clean the entire toothbrush mechanism, it may be temporarily removed so that the passageway 56 may also be cleaned out. This operation is continued from day to day with each use of the toothbrush until the cartridge is fully expended and in a collapsed position as shown in FIG. 4. At this point it is noted that when the cartridge 62 is collapsed it still has a certain length which would typically be filled with paste that is not dispensed. However, when in a collapsed position as shown in FIG. 4, the mandrel 74 will extend through the collapsed cartridge thereby forcing most of the paste out into the toothbrush shank. It is also noted in FIG. 4 that the drive member 32 has moved into the unthreaded segment 38 or out of contact with the internal threading 17 of the handle member. Therefore, further rotation of the handle will simply cause the drive member 32 to rotate within the unthreaded segment 38 in order to prevent driving the cartridge and collar member beyond their designated point of travel. In order to reload the toothbrush handle, the collar member 16 is removed and a new cartridge 62 is inserted in the opposite end of the handle member. The toothbrush shank member 50 then is inserted into the collar member 16 and the collar member 14 now becomes the operator member in order to drive the dispenser drive member 32 back toward the opposite end of the handle in order to further dispense toothpaste from the new cartridge. Referring now to FIG. 5 of the drawings, reference character 76 generally indicates a second embodiment of the collapsible cartridge comprising a plurality of telescoping sleeve members 78, 80, 82 and 84 for containing paste material therein. One end of the cartridge is provided with a sealing membrane 86 of plastic material that may be severed by the cutting edge 60 of the toothbrush holder 50. The opposite end of the cartridge is closed off by means of a plate member 88 having an inwardly extending mandrel 90 therein which serves to more completely expel the paste when the telescoping cartridge 76 is in its collapsed position. In operation the telescopic cartridge 76 is used in a similar manner to the telescoping cartridge 62 hereinbefore described. Referring now to FIG. 7 of the drawings, reference character 92 generally indicates an embodiment of the dispenser apparatus wherein the handle, internal sleeve member and drive member are identical to that of the dispenser 10 hereinbefore described. However, the dispenser of FIG. 7 is for dispensing solid stick materials, such as deodorant, lipstick and the like. Instead of utilizing the collars 14 and 18 hereinbefore described for carrying a toothbrush member, collars 94 and 96 may be utilized which are attachable directly to the outer threading 24 and 26, respectively, of sleeve member 18. The collar members 94 and 96 are provided with internal threading 98 and 100, respectively, leaving apertures 102 and 104, respectively, at the outer ends thereof. A stick of material to be dispensed, such as deodorant or lipstick, is indicated by reference character 106 and is provided with an end plate member 108 attached thereto for engagement with the dispenser drive member 32. The dispenser 92 works in essentially the same way as the toothpaste dispenser in that rotation of the collar member 96 will cause the dispenser drive member 32 to push against the end plate member 108 thereby forcing the stick material 106 to exit the opposite collar member 94. From the foregoing it is apparent that the present invention provides a mechanical dispensing apparatus which is useful in dispensing both paste and solid products. It is understood that within the scope of the invention, other products not in the toiletry classification may be dispensed using this device. In other words, in place of the toothbrush shown in the drawings, a nozzle might be included for dispensing glue or other paste-type products, including food products. The device may also be utilized to dispense solid products, such as solid lubricant material by utilizing the embodiment shown in FIG. 7. Whereas the present invention has been described in particular relation to the drawings attached hereto, other and further modifications apart from those shown or suggested herein may be made within the spirit and scope of the invention.

Summary: An apparatus for dispensing materials, such as toothpaste, stick deodorant, lipstick and the like, comprising a hollow handle for containing material, a dispenser drive member reciprocally disposed in the handle and at least one rotatable operator provided at one end of the handle and operably connected to the drive member for longitudinally moving the drive member within the handle in order to force the material therein out of the opposite end. Also a disposable, collapsible paste material cartridge for containing material to be dispensed within the handle and cooperating with the drive member.

big_patent

en

Summarize: A teenage cat owner has been devastated to find her beloved pet brutally murdered, hanging from a tree with one eye missing. To make matters worse, it’s believed 19-year old Amelia (who wishes not to share her surname), from Morayfield in Queensland’s Moreton Bay region, was taunted by the cat killer, who placed tufts off the cat’s fur around Amelia’s house every day as Amelia searched for her pet. The RSPCA believe the adored cat, Zeus, was bludgeoned to death with a hammer. It all began when the Morayfield resident made a creepy discovery when her pet was peculiarly found with a shaved back. Amelia was distraught when her cat, Zeus, was found hanging from a tree with his eye missing. Amelia and her partner Mark had owned Zeus since he was six-week-old and adored the feline, who she describes as 'happy and playful' It was just a day after Amelia’s sister-in-law’s cat Theo also turned up mysteriously shaved in their home. ‘We laughed it off when Theo turned up shaved and joked that our cat, Zeus would be next,’ Amelia told Daily Mail Australia. Amelia told Daily Mail that a man across the street’s cat has also been found with its fur shaved. The next day, Amelia, her partner Mark and her partner’s sister Lisa came home to find Zeus was gone. Tufts of fur were found in the house in mysterious locations everyday for the five days Zeus was missing. The day before Zeus went missing, he mysteriously turned up in the family home with his back shaved. ‘It was out of character for Zeus to be missing,’ Amelia said. ‘We saw him before we went out one night but came back and he was gone.’ A day after Zeus went missing, Lisa found a clump of her cat’s fur, which appeared to be carefully placed in their house. ‘While my partner’s sister was cooking dinner, she found a clump of Zeus’ fur in the window.’ ‘It definitely hadn’t been there before. It just appeared.’ Everyday another large clump of ginger fur was found in a different ominous place, and the family immediately knew something was wrong. The family found tufts of Zeus' fur around the home, which they believe were placed by the person who took Zeus before he was killed. On the second day, Lisa came out to the sinister sight of cat fur placed in her car’s windscreen wipers. Three days after Zeus disappeared, fur was found on a toilet paper roll, which was directly under an open window – but there was still no sight of Zeus. The next day, fur is believed to have been placed whilst Amelia was in the house. Fur was found on the home phone, which had not been there when the phone was used moments before. ‘We think someone jumped the fence and came through the backyard,’ Amelia told Daily Mail Australia. ‘Myself and Lisa were both in tears when it happened. We didn’t understand how someone could be so disgusting to bring in our cat’s fur while he was missing.’ The RSPCA conducted an autopsy on the cat, in the hope of finding out more about the killer. They put up posters of Zeus, desperate to bring their ‘friendly, playful’ cat back home. ‘One day, we didn’t find any fur at all and I was kind of glad. But then I got a call,’ explains Amelia. ‘I received a call from someone saying they’d found a cat matching Zeus’ description. ‘I was excited and asked where he was located.’ Amelia’s worst fears were realised. ‘The person told me that Zeus was up a tree, but he is deceased.’ The RSPCA believe Amelia's beloved cat Zeus was bludgeoned to death with a hammer. Amelia’s boyfriend Mark immediately knew something was drastically wrong when he saw her face. Mark ran out of the house first, with Lisa and Amelia behind me, to find out if the awful news was true. ‘I was last to get there but the first thing I saw my partner’s sister crying and I knew it was true. ‘I saw my cat, basically hanging in the tree and he was missing an eye. ‘It was a massive shock, I couldn’t stop crying. My partner told me to go home.’ The cat was high up in the tree and had to be cut out. Zeus was buried by the family, and to their horror they found another tuft of ginger hair placed in their house the next day. The family is devastated and have locked up their home, terrified more harm will come to their other pets. ‘We were kind of worried that if the person watched us bury him, that they might dig him back up.’ The RSPCA conducted an autopsy on the cat and are waiting on more results, having sent more samples to America, according to Amelia. RSPCA spokesman Michael Beatty says the incident is disturbing, particularly the ‘game’ that tauned the cat owners, and confirmed the cat was killed from a strike to the head. The RSPCA is looking for more information about who conducted the heinous killing. "They could face charges of animal cruelty, whether or not they would be in the extreme end, probably not, depending on the circumstances,’ Mr Beatty told Courier Mail. Two other cats in the street have also been found shaved, which happened to Zeus before he disappeared. Cat owners in the street have been advised to keep their animals in doors. ‘We shouldn’t have to keep our cats inside but you kind of have to,’ Amelia said. ‘We also have two dogs and they are stuck inside now. We’ve locked the back door.’ Amelia says she also feels like her own safety and wellbeing in compromised. ‘Everytime we hear something in the middle of the night, we get scared.’ 'It was heartbreaking to see him hanging from that tree.' Amelia and her family are having trouble sleeping and feel their own safety is compromised

Summary: Adored cat Zeus was found dead in a tree, hanging with an eye missing. 19-year-old owner Amelia was taunted for five days after he went missing. Day before Zeus disappeared, he turned up peculiarly partially shaved. Two other cats on the street in Morayfield, Queensland have also been found partially shaved. Everyday after pet disappeared, fur was 'placed' inside Amelia's home. It's believed Zeus was bludgeoned to death with a hammer before he was found hanging from a tree.

cnn_dailymail

en

Summarize: By. Matt Blake. PUBLISHED:. 08:01 EST, 29 March 2013. |. UPDATED:. 11:41 EST, 29 March 2013. Two men were killed when a car crashed into a bridge during a high-speed police chase through the heart of London. Police said the Audi jumped a red light before clipping a van and then hurtling out of control into the wall of a bridge in Haringey, north London, at around 2am. The 30-year-old driver of the Audi tried to run off, but was detained on suspicion of causing death by dangerous driving, driving while disqualified, suspicion of driving under the influence and possession with intent to supply class A drugs. Police and paramedics tried to save two critically injured men, who were both passengers in the Audi. Captured: The 30-year-old driver of the Audi tried to run off, but was detained on suspicion of causing death by dangerous driving and driving while disqualified. However, the men - both in their late twenties or early thirties - were pronounced dead at the scene. The Audi driver was taken to hospital after his arrest, but his injuries are not believed to be serious. The van driver was also treated in hospital. Traffic officers are investigating and officers from the Directorate of Professional Standards have been informed. Several roads near the scene of the crash remained closed throughout the morning. Eye-witness Erzem Salihi, 32, who saw the drama unfold from his bedroom window, said: 'My wife heard a bang and she woke me up. We looked out of the window and saw police trying to open the doors of the Audi. Too late: Police and paramedics tried to save two critically injured men, who were both passengers in the Audi. Suspicious activity: Police say the incident began when officers on routine patrol became suspicious of a car. 'They managed to open the door where the driver came out, the two police officers backed away. They looked like they were scared he was going to attack them. 'He ran around the back of the car, they caught him and wrestled him to the ground. He was very tall and wearing white joggers. 'After they arrested him they were trying to get the passengers out of the car. 'They opened the door on the right. side and they dragged the lifeless body of a man out of it. One of the. police officers pulled the man's clothes off and tried to give him CPR. on the floor. But he was dead. 'Then they ran around to the left. side and they pulled the person out and they tried to give him CPR until. the ambulance crews arrived. Probe launched: Traffic officers are investigating and officers from the Directorate of Professional Standards have been informed. Aftermath: A traffic light lies wrecked in the street as workers clear the scene of debris. The Audi driver was taken to hospital after his arrest, but his injuries are not believed to be serious. Jeff Brown, 44, who rushed to the scene minutes after the crash, said: 'I heard a big bang, but there weren't any police sirens before that. 'We only heard sirens when the ambulance arrived. 'I went down to have a look and there were two bodies lying on the floor. It took them 45 minutes to cover the bodies up. 'There was a man lying on the floor. The police kept telling him 'don't move' but he kept trying to get up.' Police said the incident began when officers on routine patrol became suspicious of a car. A Scotland Yard spokesman said: 'Shortly before 2am, Islington officers on routine patrol in a police vehicle became suspicious of a car that appeared to make off at speed when passed in the opposite direction by police. 'After several minutes searching for the Audi, the officers sighted it several hundred metres away and they sought to catch up. 'The Audi was driven through a red light and a short time later it clipped a white van and subsequently collided with a bridge on Seven Sisters Road near to the junction with St Ann’s Road in Haringey.' Police later said the passengers in the Audi were aged 33 and 38. Their next of kin have been informed of their deaths. The Independent Police Complaints Commission (IPCC) is investigating the circumstances surrounding the pursuit, Scotland Yard said

Summary: Audi jumped a red light before clipping a van and then hurtling out of control. Car then crashed into a bridge in Haringey, north London, at around 2am. Victims, both passengers and in late 20s or early 30s, died at the scene. The 30-year-old driver of the Audi tried to run off but caught and arrested. Witnesses say bodies on road for 45 minutes as police battled to save them.

cnn_dailymail

en

Summarize: CROSS REFERENCE TO CO-PENDING APPLICATION This application is a continuation of U.S. patent application Ser. No. 08/951,647 filed on Oct. 16, 1997 now U.S. Pat. No. 6,080,117. FIELD OF THE INVENTION The present invention relates generally to intravascular guide wires for use in procedures such as angioplasty. More specifically, the present invention relates to an extendable guide wire useful for effecting catheter exchanges. BACKGROUND OF THE INVENTION Guide wires are currently used to position catheters within the arterial system for procedures such as angioplasty and angiography. The guide wire is typically advanced within the vasculature of a patient to a desired position, followed by a catheter, advanced over the guide wire. It is often necessary to remove a first catheter from the patient and advance a second catheter into position. When the catheter is in position within the patient, a proximal segment of guide wire extends from the patient. The extending proximal segment can be grasped and used to maintain the position of the guide wire. Withdrawing a catheter over an in-place guide wire typically requires a guide wire extending from the patient for a length at least as long as the catheter guide wire lumen. This is required so as to present an uncovered portion of the guide wire to grasp. “Over-the-wire” catheters have a guide wire lumen over substantially the entire catheter length. “Single-operator-exchange” catheters can have a shorter guide wire lumen, extending only through the catheter distal region. Withdrawing an over-the-wire catheter over the guide wire would completely cover a standard length guide wire, presenting a problem. This problem has been dealt with in several ways. The original guide wire can be withdrawn and replaced by a double length, exchange guide wire, providing a graspable guide wire portion during the exchange. This can complicate the procedure as the in-place guide wire must be removed and another inserted. Alternatively, a double length guide wire can be used from the start. This can be awkward as the portion of the guide wire extending from the patients body can be unwieldy, and may be unnecessary, if only the first catheter is needed. In another method, an extension guide wire is provided and crimped or otherwise joined to the in-place guide wire, thereby creating a double length guide wire for effecting a catheter exchange. The crimping adds an additional step and requires the joining of two extremely small wires in the operating room. Crimping also raises the possibility of wire separation during catheter exchange. What remains to be provided is a guide wire that is not a double length guide wire, yet does not require the joining of an extension guide wire to effect an over-the-wire catheter exchange. SUMMARY OF THE INVENTION The present invention includes an extendable guide wire for performing catheter exchanges. The extendable guide wire makes possible over-the-wire catheter exchanges without requiring either a double long guide wire for the entire procedure or the coupling of an extension wire to the guide wire. The guide wire of the present invention includes a distal member and a proximal member, the proximal member distal end being coupled to the proximal end of the distal member. A substantial portion of the distal member extends into the patient. The proximal member has a first, compressed or shortened state and a second, extended or lengthened state. The proximal member extended length is substantially longer than the proximal member shortened length. One guide wire in accordance with the present invention includes wire strands wound into a coil in the proximal member. The wire strands can be pulled proximally, drawing out the coiled strands into substantially straighter and longer strands. The proximal member can have one coil counter-wound within another coil, which can increase the number of strands present in the lengthened, proximal member. In one embodiment, the strands in the proximal member are braided about one another. One proximal member includes two, 0.0035 inch diameter wires forming an outer coil, counter-wound over an inner coil formed of two, 0.0025 inch diameter wires. Another proximal member includes two, 0.003 inch diameter wires forming an outer coil, counter-wound over an inner coil formed of a single, 0.0025 inch diameter wire. In one proximal member, the proximal member distal wire ends are secured to the distal member proximal end, and the wire free proximal ends to each other, utilizing brazing. Another proximal member secures the proximal member distal wire ends to the distal member proximal end, and the proximal wire free ends to each other, by inserting the wires within hypotubes and affixing the wires with solder. In one embodiment, a sheath is provided to slide over the proximal member wires after extension, providing a stronger member to advance and retract catheters over. In use, the guide wire, with proximal member in a shortened, coiled state, is advanced into the patient, leaving the proximal member substantially outside of the body. A first catheter can be advanced over the guide wire distal member. When removal of the first catheter is desired, the proximal guide wire member can be grasped at the proximal end and pulled proximally, thereby elongating the proximal member by drawing out the proximal coil members to a length substantially greater than the compressed shorter length. The proximal member, after lengthening, includes one or more wires which can retain some of three dimensional coil structure and can be intertwined, providing support for sliding catheters thereover. With the proximal member lengthened, the first catheter can be withdrawn proximally over the distal and proximal members, and a second catheter advanced distally over both proximal and distal members. In one catheter exchange method, a sheath is provided and advanced distally to substantially cover the lengthened proximal wires prior to sliding any catheters thereover. The sheath provides added strength to support the advancement and withdrawal of catheters over the lengthened proximal wires. The strengthening sheath allows use of smaller diameter wires or a smaller number of wires, which can allow for a smaller, compressed proximal member outside diameter and/or compressed length than possible without the sheath. BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a fragmentary, side cross-sectional view of a guide wire according to the present invention having two outer strands counter-wound over two inner strands; FIG. 2 is a fragmentary, side cross-sectional view of a guide wire according to the present invention having two outer strands counter-wound over a single inner strand, with hypotube at either end, shown in a compressed, shortened state; FIG. 3 is a fragmentary, side cross-sectional view of the guide wire of FIG. 3, shown in an extended, lengthened state; and FIG. 4 is a fragmentary, side cross-sectional view of a guide wire and strengthening extension sheath according to the present invention. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS FIG. 1 illustrates a guide wire 20 having a distal member 22, a proximal member 24, a distal end 26 and a proximal end 28. Distal member 22 includes a distal region 30 and a proximal region 32, where distal region 30 includes a distal tapering core portion 38 and a proximal shoulder portion 40. In one embodiment, proximal shoulder portion 40 is about 2 to 4 centimeters in length. Tapering core portion 38 can include a series of conical tapers and straight sections as illustrated in FIG. 1, imparting increased flexibility to distal member distal region 30. Guide wire distal member 22 can be similar in some respects to guide wires disclosed in U.S. Pat. No. 5,452,726, entitled INTRAVASCULAR GUIDE WIRE AND METHOD OF MANUFACTURE THEREOF, herein incorporated by reference. A preferred guide wire includes a polymeric distal jacket 37 and a distal tip 39. In a preferred embodiment, the length of distal guide wire member 22 is about 180 centimeters long. Proximal guide wire member 24 includes a distal region 34, a proximal region 36, and is fixedly attached to distal member 22 as indicated at 42. Proximal member 24 is preferably secured to distal member 22 utilizing brazing. In one embodiment, proximal member 24 is about 35 to 40 centimeters in length in the shortened, compressed state shown in FIG. 1. Proximal member 24 includes an inner coil 44 and an outer coil 46. As illustrated in FIG. 1, proximal member 24 includes means for length extension within the proximal member itself. In the embodiment illustrated, inner coil 44 includes two, 0.0025 inch diameter wire strands, wound clockwise with a pitch of about 0.0050 inches, and having a coil inside diameter of about 0.003 inches. The pitch is the center to center wire strand spacing. Outer coil 46 includes two, 0.0035 inch diameter wires wound counter-clockwise, with a pitch of about 0.0080, over inner coil 44. Inner coil 44 and outer coil 46 can be attached to each other with brazing, indicated at 48. In a preferred embodiment, coils 44 and 46 are formed of tempered 304 stainless steel wire. While the strands are preferably formed of a metal such as tempered stainless steel, the strands can also be formed of a suitable polymeric material. In one embodiment, both inner coil 44 and outer coil 46 have the two strands in a side-by-side orientation in the coil. In a preferred embodiment, proximal member 24 can be extended to a length about 250 or 300% longer than the length of the member in the compressed state. When in the extended state, the wires in proximal member 24 stay sufficiently tightly bunched to provide enough column strength to support catheter exchanges. In one embodiment, wires having a circular cross-sectional profile are used to form coils 44 and 46. In another embodiment, wire ribbon is used in place of round wire. Distal guide wire member 22 in one embodiment is about 0.014 inches in outer diameter as is proximal member 24 in the compressed, shortened state illustrated in FIG. 1. In another embodiment, distal guide wire member 22 has an outside diameter of about 0.018 inch. Having substantially the same outer diameters for both distal and proximal members allows for sliding catheters having guide wire lumens which are closely matched to the distal member to be slid proximally over the proximal member proximal end. In this way, single-operator-exchange catheters, which do not require the proximal member to be extended, may be slipped proximally over the compressed proximal member. While single operator exchange devices may not require use of the extendable proximal member of the present invention, the present invention, properly sized, is compatible with the use of single operator exchange devices. Referring now to FIG. 2, another guide wire embodiment 50 is illustrated, having a distal member 52 and a proximal member 54. Distal member 52 is similar to distal member 22 of FIG. 1, but has a stepped, tapered shoulder 56 rather than the continuously tapering shoulder 40 of FIG. 1. Proximal member 54 includes an inner coil 58 and an outer coil 60. Inner coil 58 is formed of a single 0.0025 inch diameter wire wound clockwise to have a 0.003 inch inside diameter center and having a pitch of about 0.0028 inch. Outer coil 60 is formed of two, 0.003 inch diameter wires wound counterclockwise about inner coil 58 and having a pitch of about 0.006 inch. Both wires are preferably formed of 304 stainless steel. Distal member 52 is joined to proximal member 54 at a distal hypotube junction 66, having a portion of distal member shoulder 62 and proximal member 54 within, secured with solder as indicated at 72. Distal hypotube section 64 is about 1 centimeter long and has an outside diameter of about 0.015 inch and an inside diameter of about 0.011 inch in a preferred embodiment. A proximal hypotube junction 68 binds the proximal ends of inner coil 58 and outer coil 60. Hypotube 68 is secured to coils 58 and 60 with solder, as indicated at 70. Hyptotube section 68 is about 2 centimeters long and has an outside diameter of about 0.011 inches and an inside diameter of about 0.007 inch in a preferred embodiment. In a preferred-embodiment, proximal member 54 is about 25 centimeters in length. Proximal member 54 has about a 0.014 inch outside diameter in the compressed state, approximately the same outside diameter as distal guide wire member 52. Referring now to FIG. 3, guide wire 50 is illustrated in an extended state. Inner coil 58 and outer coil 60 are extended to a length of about 120 centimeters in one embodiment. Extending proximal member 54 to this length also decreases the outside diameter of outer coil 60 from about 0.014 to 0.009 inches. Proximal member 54 can be extended by holding hypotube 66 while pulling hypotube 60 proximally. In the extended state, wires comprising coils 58 and 60 are substantially plastically rather than elastically deformed. It is preferable that the wires in the extended state exhibit little tendency to return to the compressed, coiled configuration. In the extended state, the wires do retain some of the three-dimensional coil structure from the compressed, tightly coiled state. In the extended state, the wires also are intertwined or braided with one another. The retention of three dimensional structure and intertwining provides added structural support and strength relative to three wires simply running in parallel. The intertwined wires have sufficient column strength to support the withdrawal and advancement of catheters over the wires. Referring now to FIG. 4, another embodiment guide wire 74 is illustrated, having a distal member 52 and a proximal member 76. Proximal member 76 shares some features with proximal member 54 of FIG. 3, but can be formed of smaller diameter proximal member wires 80. This may be preferable when use of a smaller diameter proximal member is desired, as may be the case when a small diameter distal member is used. After extending proximal member 76 to the length shown in FIG. 4, a sheath or tube 78 can be slid over wires 80 as illustrated in FIG. 4. In this way, wires 80 can serve as pilot wires for sheath 78. In a preferred embodiment, sheath 78 is a 3 layer tube, having a polyimide tube with an inner and an outer Teflon® lining. In a preferred embodiment, sheath 78 is about 0.014 inches in outside diameter and has an inner diameter of about 0.012. Sheath 78 can serve to provide increased column strength for wires 80 when advancing and retracting catheters over proximal member 76. The Teflon® inner layer increases the ease of sliding sheath 80 over wires 80, while the Teflon® outer layer allows catheters to be more easily slid over the outside of sheath 80, decreasing the required strength for wires 80. Numerous characteristics and advantages of the invention covered by this document have been set forth in the foregoing description. It will be understood, however, that this disclosure is, in many respects, only illustrative. Changes may be made in details, particularly in matters of shape, size, and arrangement of parts without exceeding the scope of the invention. The inventions&#39;s scope is, of course, defined in the language in which the appended claims are expressed.

Summary: An extendable, guide wire providing an apparatus for effecting exchange of over-the-wire catheters without requiring either a double length guide wire or the addition of an extension guide wire. The guide wire includes a distal member for insertion into the patient and a proximal member for extension from the patient, the proximal member having at least one wire strand coiled into a shorten, compressed state. If a catheter exchange is required, the proximal member coil is irreversibly lengthened by drawing the coil proximally, significantly extending the length of the proximal member. Catheter withdrawal and advancement can follow the lengthening. A sheath adapted to slide over and strengthen the drawn wires prior to catheter exchange is also provided.

big_patent

en

Summarize: Researchers claim a simple blood test could indicate a person’s predisposition to suicide. (Photo by John Moore/Getty Images) A simple blood test could determine a person’s risk of suicide and provide a future tool of prevention to stem suicide rates. In a study published online Wednesday in the American Journal of Psychiatry, researchers say they have discovered a genetic indicator of a person’s vulnerability to the effects of stress and anxiety and, therefore, the risk of suicidal thoughts or attempts. The Johns Hopkins researchers looked at how a group of chemicals known as methyls affect the gene SKA2, which modifies how the brain reacts to stress hormones. If the gene’s function is impaired by a chemical change, someone who is stressed won't be able to shut down the effect of the stress hormone, which would be like having a faulty brake pad in a car for the fear center of the brain, worsening the impact of even everyday stresses. Researchers studied about 150 postmortem brain samples of healthy people and those with mental illness, including some who had committed suicide. They found that those who died by suicide had significantly higher levels of the chemical that altered the SKA2 gene. As a result of the gene’s modification, it was not able to “switch off” the effect of the stress hormone. The researchers then tested sets of blood samples from more than 325 participants in the Johns Hopkins Center for Prevention Research study to see whether they could determine those who were at greater risk of suicide by the same biomarker. They were able to guess with 80 to 90 percent accuracy whether a person had thoughts of suicide or made an attempt by looking at the single gene, while accounting for age, gender and levels of stress or anxiety. Zachary Kaminsky, an assistant professor of psychiatry and behavioral sciences at the Johns Hopkins University School of Medicine who led the study, said that while the biomarker indicates a person’s vulnerability to stress and anxiety, it does not make a person destined to experience suicidal thoughts and could equally show a person’s resilience. It’s like a person trying to cross the street, Kaminsky said. It doesn’t make you destined to be hit, but might encourage you to be a more aware pedestrian. The stress hormone cortisol has a role in performing both daily tasks and responding to extreme situations. “It helps you get up in the morning, it helps you cross the road, and it helps you run away from a lion,” Kaminsky said. There are scales of severity and varying spectrums of contemplating, planning and attempting suicide, and Kaminsky said that the biomarker may not be a determining test for all cases. The study may have just determined the chemical marker of how a person is affected by stress and anxiety. Suicide is the 10th-leading cause of death for Americans, according to the National Action Alliance for Suicide Prevention. The organization aims to reduce the national suicide rate by 20 percent within five years through research and identifying those at greatest risk. “Suicide is complex and many factors affect a person’s risk, including biological, psychological and social factors, as well as access to lethal means,” said Jill Harkavy-Friedman, vice president of research at the American Foundation for Suicide Prevention. She said suicide rates in the United States have remained stable over the past few decades, with slight increases and decreases. She sees the Johns Hopkins study as part of an increasing body of research investigating genetics as a factor, helping to better assess long-term and immediate risk and to eventually reduce rates of suicide. The biomarker could help doctors determine a patient’s risk, but assessment still needs to be individually based, Harkavy-Friedman emphasized. For example, “you wouldn't just look at one cholesterol level, you would look at diet, family history and what they ate that day,” she said. “It’s an important step on the right path.” This biomarker could help with decisions such as whether increased monitoring was necessary. Soldiers returning from war, for example, could be asked to turn in their firearms if they were at higher risk, Kaminsky said. Chemical Alteration In a groundbreaking new genetic discovery, doctors from Johns Hopkins have found a mutation involved in how the brain reacts to stress that can reliably predict suicide risk. With suicide, there’s often talk of “warning signs.” But a new genetic discovery could be the key to creating a blood test that could, for the first time, use DNA to determine a person’s risk of suicide. The research, published in The American Journal of Psychiatry, comes from a group of Johns Hopkins University doctors who in a series of experiments—three with brains, three with blood—found that a mutation in a specific gene involved in how the brain reacts to stress, SKA2, could predict reliably whether a person is at risk of attempting suicide. “We’ve identified a new player in suicide,” Dr. Zachary Kaminsky, lead author and assistant professor of psychiatry and behavioral sciences at Johns Hopkins, told The Daily Beast. This study follows previous research in which Kaminsky and his colleagues identified a chemical alteration that can identify women at risk of postpartum depression. Suicide, like postpartum depression, is associated with an underlying hormonal cause—estrogen for new mothers and the stress hormone cortisol in suicide. “We get stressed out and flooded with cortisol,” Kaminsky explains. “We have to wake up, fight or flight, run away, or just catch a cab to work. Cortisol is going to go up, but it should go back down again. We think SKA2 is important in that. If you have less, which is what we’re finding, then you’re going to have less of an ability to turn that off.” The researchers first noticed the SKA2 mutation during a larger genome scan of postmortem brain samples from both healthy people and those with mental illness. Brains from people who had died by suicide had less of the SKA2 gene. Further, the researchers found evidence of an epigenetic modification, or a chemical change not in the DNA itself but the way it functions in the body. Epigenetics—literally “on top” of the DNA—is the science dealing with the instructions that bind to genes and control genetic expression, or in this case, suppression. Although the gene itself stays unchanged, chemicals called methyl groups alter how that gene works. Higher levels of methylation were found in those who had committed suicide. These methyl groups act like light switches turning genes on and off, dimmer and brighter, and can be affected by environmental factors such as pollution, nutrition, and stress. Armed with the new information, Kaminsky and his team tested blood samples from living people and again found methylation increases, or “bad instructions,” in those with reported thoughts of suicide or attempts. The researchers then used the findings to create a model analysis through which they ran all the previous samples and found they were able to predict those at risk of suicide with 80 percent to 90 percent accuracy based on the severity of the risk. Although previous studies have attempted to identify the biomarkers of suicide that would make such a blood test possible, this is the first to do so with such accuracy. And while Kaminsky is cautious, noting in particular the limitations of a small sample size—about 550—he appears optimistic about the possible implications. “If we can identify who is at risk, we may be able to intervene in effective ways,” Kaminsky said. “Notably, we could identify individuals in military populations who are more vulnerable to stress. We know they’re going to be experiencing stress when they go off to combat.” To that effect, the next step of the research involves a testing hundreds more samples from soldiers pre- and post-deployment as part of a collaboration with the U.S. Army STARRS project, the nation’s largest-ever study of mental health in the military.

Summary: Scientists say they have a new way of determining suicide risk, and it's based on genetics-requiring only a blood test. Researchers running postmortem genome scans of brain samples found that the brains of those who'd committed suicide had less of a gene called SKA2, as well as higher levels of methylation, a chemical process that affects the gene's function, the Daily Beast reports. The gene may play a key role in our response to stress, a researcher says. Researchers applied their findings to blood samples from 325 participants in their study, the Washington Post reports. They sought to predict whether participants had experienced suicidal thoughts, and the results were 80% to 90% accurate. Researchers want to use the findings to help fight military suicide-which occurs at a rate some 50% higher than that of the population as a whole, the Daily Beast notes (though the military reported a decrease in suicides last year). An outside expert points out to the Post, however, that more than just one chemical indicator is needed to assess suicide risk in patients.

multi_news

en

Summarize: A new law placing broad restrictions on protests in Egypt is a serious setback that poses a grave threat to freedom of assembly and gives security forces a free rein to use excessive force, including lethal force, against demonstrators, Amnesty International said today. The law, signed yesterday by Egyptian President Adly Mansour, grants the Ministry of Interior wide discretionary powers over protests and lays out broad circumstances in which demonstrators can be found to violate the law. “It is a dangerous sign that the first piece of legislation regulating rights and freedoms passed since the ousting of Mohamed Morsi curtails freedom of assembly and treats peaceful protesters like criminals. Not only does it allow the police to disperse peaceful demonstrations, but gives them the power to shoot protesters who pose no threat to the lives or safety of others”, said Hassiba Hadj Sahraoui, Middle East and North Africa Deputy Director at Amnesty International. “Granting security forces complete discretion to ban protests or disperse them using excessive and lethal force is a serious setback for human rights in Egypt and paves the way for further abuse.” In practice, the vague and overbroad grounds in the law will not only allow the authorities to prevent or forcibly disperse protests by supporters of the Muslim Brotherhood, but it will essentially allow for a ban on all opposition protests. What is particularly worrying is that it gives the security forces a legal framework for the use of excessive force against any protesters deemed to have committed a “crime punishable by law”. In particular, the law provides for the police to use shotguns and rubber bullets, including to disperse peaceful protesters. Amnesty International has documented cases of protester deaths caused by the use of shotgun pellets, most recently on 6 October. Moreover, the law allows security forces to respond to the use of firearms by protesters by “means proportionate to the level of threat to lives, money and property”. The inclusion of money and property in this provision contravenes international law and standards, which permit security forces to use firearms only when that is the sole means of defence against an imminent threat of death or serious injury. Amnesty International fears that security forces will make use of the authority given to them under the new law to disperse peaceful protests for not complying with the law’s requirements, including on broad grounds such as disrupting traffic and holding demonstrations in places of worship. Moreover, under the new law, any violent act committed by a small minority of protesters, or even just one, can be used as a legal justification for dispersing the entire demonstration. “Instead of using the opportunity to break the pattern where the security forces repeatedly kill protesters with no consequences, the new law will further entrench abuse,” said Hassiba Hadj Sahraoui. The new law grants the Ministry of Interior powers to ban protests on grounds including “threats to security and peace”, “security or public order”, and “influencing the course of justice”, as well as delaying traffic or transport. Protesters found in violation will face up to five years in prison and/or hefty 100,000 Egyptian pound fines (USD$14, 513). These restrictions and punishments, which go well beyond the restrictions permissible under international law, will severely curtail the exercise of the right to peaceful assembly in Egypt. The law also imposes blanket prohibitions on protests and public gatherings of a “political nature” in places of worship. Since the ‘25 January Revolution’, many protest marches began after prayers at mosques – a practice continued by Mohamed Morsi’s supporters since he was ousted in July 2013. The Minister of Interior and Governors can also use the new law to declare public spaces off limits for protest. These include public areas surrounding presidential palaces, parliaments, ministries, diplomatic missions and embassies, court buildings, hospitals, prisons, police stations or points, military zones and heritage sites. Protest organizers are required to submit complete plans for any gatherings of more than 10 people to the Ministry at least three days in advance. Taken together with the Ministry’s powers to cancel a demonstration or change its route, this in effect means that demonstrations can take place only with the Ministry’s prior authorization. “Since the ‘25 January Revolution’, human rights groups and activists have been struggling to defend their hard-won space to protest. A government – which continues to pay lip service to the sacrifices made by protesters during that period – has now provided a legal cover to ban protests outright and give free rein to security forces, with their abysmal record of using excessive and lethal force, to forcibly disperse protesters at their whim,” said Hassiba Hadj Sahraoui. “Instead of investigating the large number of killings of protesters since the ‘25 January Revolution’ and punishing those responsible, the current government seems to be rewarding security forces for their excesses and providing them with further legal means to trample on rights.” Background On 24 October 2013, Amnesty International sent a memorandum to President Adly Mansour urging him not to sign into law the restrictive draft Law 107 of 2013 Regulating the Right to Public Gatherings, Processions and Peaceful Protests. While some amendments were introduced since that draft, the adopted law still breaches Egypt’s obligations under International Covenant of Civil and Political Rights to uphold freedom of assembly, and respect the right to life. Efforts by Morsi’s government to pass similar restrictive legislation earlier this year were thwarted following an outcry by human rights NGOs, political parties, and other stakeholders. Since 3 July, more than 1,300 people have died in protests and political violence in Egypt, many as a result of security forces using excessive and unwarranted lethal force. No adequate investigations have been launched into security force wrongdoing. Instead, thousands of pro-Morsi protesters have been arrested – many during the dispersal of sit-ins and protests – amid concerns on the lack of respect of due process rights. 1 of 5. Students of Cairo University, who are supporters of the Muslim Brotherhood and ousted Egyptian President Mohamed Mursi, shout slogans against the military and interior ministry during a demonstration in front of riot police at the main gate of the university around Al Nahda square in Cairo November 24, 2013, to commemorate the passing of 100 days since security forces cleared the vigils in support of ousted President Mohamed Mursi at Rabaa al-Adawiya and Nahda squares. CAIRO (Reuters) - Egyptian security forces on Monday fired tear-gas to disperse university students who had defied a new law that restricts demonstrations, the state news agency reported. Students of Al-Azhar University and Assiut University in Assiut province, south of Cairo, staged a protest, chanting against the army and police in defiance of the new law, passed on Sunday, which bans protests without prior police approval. In the first application of the new law, the Interior Ministry approved requests on Monday for protests by lawyers and political activists in front of the lawyers' syndicate in Cairo and the State Council in Giza, it said on its Facebook page. In another statement, it issued a warning to supporters of the Muslim Brotherhood, who it said were planning a protest on Tuesday in Giza province, near the pyramids, with the goal of disrupting traffic and harming tourism. "The Interior Ministry is determined to implement the law and confront these attempts with all force and decisiveness according to what is guaranteed by the law," the ministry said. Egypt has experienced some of its worst civilian violence in decades after the army, prompted by mass protests, ousted the country's first democratically elected leader, Mohamed Mursi, on July 3. It has since introduced a political roadmap that will lead to new elections next year. Hundreds of his supporters were killed when security forces stormed two pro-Mursi camps on August 14 and thousands were arrested under a crackdown against members of his Muslim Brotherhood group, whom the government accuses of supporting violence and terrorism. The Muslim Brotherhood denies any links to violence and has called the army's ousting of Mursi a military coup. Activists have described the new law on demonstrations as a violation of their right to protest and have vowed to defy it. Egypt has ousted two presidents in less than three years through mass protests. "The unfair protest law will be broken," said Ahmed Mahler, whose April 6 movement helped lead the uprising against autocratic leader Hosni Mubarak in 2011. (Reporting by Asma Alsharif; Editing by Gareth Jones) CAIRO (Reuters) - Egypt will hold a referendum on an amended constitution in December, the group drafting it said on Tuesday, an important step in an army-backed roadmap meant to lead to elections. A female activist is pictured in front of riot police during a protest against a new law restricting demonstrations, in downtown Cairo November 26, 2013. REUTERS/Amr Abdallah Dalsh Hours before the timing of the referendum was announced, protesters took to the streets in defiance of a law passed on Sunday requiring police approval for gatherings of more than 10 people. Police detained 28 people, the Interior Ministry said. Egypt’s democratic credentials have been called into question since the military toppled the country’s first freely elected president, Islamist Mohamed Mursi, in July, following mass protests against his rule. A committee of 50 members, with few Islamists, began work in September on amending the constitution that was approved in a referendum last year after being drafted by an Islamist-dominated assembly. “The referendum will be held before the end of (December),” Mohamed Salmawy, spokesman of the constituent assembly, said. That contradicts comments made by Prime Minister Hazem el-Beblawi who said on Sunday the referendum would be held in the second half of January. The new constitution will guarantee the right to protest and ensure that demonstrations can be held if protesters notify authorities, rather than wait to be granted permission, Salmawy said, in an apparent effort to ease tension over a new law restricting demonstrations. Army chief General Abdel Fattah al-Sisi, who ousted Mursi, has promised the roadmap will lead to free and fair elections. But the plan has not stabilized Egypt, where protests and attacks by Islamist militants based in the unruly Sinai Peninsula have hammered investment and tourism. Egypt has stumbled on its path to democracy since a popular uprising ousted autocrat Hosni Mubarak in 2011, with the army ousting Mursi and security forces mounting one of the fiercest crackdowns on Islamists in decades. Hundreds have been killed and the Brotherhood’s leadership has been arrested. Khaled Dawoud, a prominent liberal political figure, criticized the government. “They are making more enemies than friends especially among the young revolutionary Egyptian people who have been in the streets for the past three years,” he said. Underscoring differences over the new law, ten members of the body have suspended their work in protest against the detentions, MENA reported. Beblawi promised to follow the results of the prosecutor’s investigations into the detentions, according to an emailed statement from the cabinet. Human rights groups have condemned the law as a major blow to freedom in Egypt, the most populous Arab state and a U.S. ally that has experienced near relentless upheaval since autocratic ruler Hosni Mubarak was toppled by a revolt in 2011. “(The) new protest law gives security forces free rein,” Amnesty International said. Skirmishes broke out between security forces and protesters in downtown Cairo and police fired teargas and water cannon to disperse the demonstrations. They were marking the death of a liberal activist killed in clashes with police two years ago and expressed anger against the protest law. “DOWN WITH MILITARY RULE” Hundreds assembled at the Press Syndicate and parliament. “Down, down with military rule,” they chanted. In Cairo, female students at Al-Azhar University for Islamic learning, which follows the government line, stormed into a dean’s office and destroyed her desk. The United States, which has partially frozen aid to Egypt, on Monday expressed concern over the new law and said it agreed with groups that argued it did not meet international standards and hampered the country’s move toward democracy. A security official said Tuesday’s crowd had not obtained permission to protest and had ignored warnings to disperse. Slideshow (7 Images) The army-backed government has said it is not against peaceful protests but wants to restore order in the streets. It has also complained that protests often disrupt traffic. Some Egyptians cheered police as they broke up protests on Tuesday. “We are implementing the new protest law that requires protesters to seek permission from the Interior Ministry three days before the protest,” a police official said. The protest law will further squeeze members of the Muslim Brotherhood, who have said they will continue demonstrating against what they say is a military coup.

Summary: Egyptian police fired water cannons at protesters outside the Interior Ministry today, in the latest application of a new law that forbids any protest not approved by the government at least three days in advance. The law also gives the Interior Ministry the right to forbid any public meeting of more than 10 people, Reuters reports, and it forbids entirely any protest at a place of worship. If anything, the law has inspired more protests. Muslim Brotherhood supporters in several cities took to the streets today. Elsewhere in Cairo, female students at the pro-government Al-Azhar University for Islamic Learning stormed the dean's office and destroyed her desk today. A day earlier, students teamed with another school for a protest that police dispersed with tear gas, in the first application of the law. The law has also drawn condemnation from human rights groups; Amnesty International said it "poses a grave threat to freedom of assembly and give security forces free rein to use excessive force." But Egypt's prime minister says it is actually intended to "protect the rights of protesters," and said they must give "notice," not seek permission, the BBC reports.

multi_news

en

Summarize: Inhabited since 250 B.C., Djenné became a market centre and an important link in the trans-Saharan gold trade. In the 15th and 16th centuries, it was one of the centres for the propagation of Islam. Its traditional houses, of which nearly 2,000 have survived, are built on hillocks (toguere) as protection from the seasonal floods. Outstanding Universal Value Djenné, chief town of the Djenné Circle, located 130 km south-west of Mopti (the regional capital) and roughly 570 km north-east of Bamako (the national capital), is one of the oldest towns of sub-Saharan Africa. The cultural property “Old Towns of Djenné” is a serial property comprising four archaeological sites, namely Djenné-Djeno, Hambarkétolo, Kaniana and Tonomba, along with the old fabric of the present town of Djenné covering an area of 48.5 ha and divided into ten districts. The property is an ensemble that over many years has symbolised the typical African city. It is also particularly representative of Islamic architecture in sub-Saharan Africa. The property is characterised by the intensive and remarkable use of earth specifically in its architecture. The outstanding mosque of great monumental and religious value is an outstanding example of this. The town is renowned for its civic constructions, with the distinctive style of verticality and buttresses as well as the elegant monumental houses with intricate facades. Excavations carried out in 1977, 1981, 1996 and 1997, revealed an extraordinary page of human history dating back to the 3rd century B.C. They have brought to light an archaeological ensemble which bears witness to a pre-Islamic urban structure with a wealth of circular or rectangular constructions in djenné ferey and numerous archaeological remains(funerary jars, pottery, millstones, grinders, metal scoria etc.). The property « Old Towns of Djenné » comprises the town of Djenné, characterised by a remarkable architecture and its urban fabric, of rare harmony, and four (4) archaeological sites bearing witness to a long-gone pre-Islamic civilization. The property « Old Towns of Djenné » still retains the values which justified its outstanding universal value at its inscription on the UNESCO World Heritage List. First and foremost, the archaeological, historic, religious and architectural values should be mentioned. Criterion (iii): Djenné-Djeno, along with Hambarketolo, Tonomba and Kaniana bears exceptional witness to the pre-Islamic civilizations on the inland Delta of the Niger. The discovery of many dwellings on the site of Djenné-Djeno (remains of traditional brick structures (djénné ferey), funerary jars) as well as a wealth of terra cotta artifacts and metal make this a major archaeological site for the study of the evolution of dwellings, industrial and craft techniques. Criterion (iv): The ancient fabric of Djenné is an outstanding example of an architectural group of buildings illustrating a significant historic period. Influenced by Moroccan architecture (1591), and later marked by the Toucouleur Empire in 1862, the architecture of Djenné is characterized by its verticality, its buttresses punctuating the facades of the two-storey houses whose entrances are always given special attention. The reconstruction of the Mosque (1906-1907) resulted in the creation of a monument representing local religious architecture. The vestiges of the four inscribed archaeological sites remain intact (pottery shards, funerary jars, remains of walls and circular or rectangular dwellings of traditional round mud bricks (djénné ferey), statuettes and mud bricks, metal scoria, millstones, grinders and Islamic burial grounds). The marshes where the small islands are located ensure a relative physical integrity. However, these inscribed archaeological sites are vulnerable to very serious threats such as leaching, erosion and gullying by inclement weather and uncontrolled urbanization. In addition to its prestigious mosque, Djenné still retains its elegant monumental houses of rigorous composition with façades sometimes decorated by a porch, and supporting pilasters with, in the centre, “the potige”, a decorative motif indicating the position of the front door. This earthen architecture, one of the criteria for inscription of the property on the World Heritage List, has for several decades undergone modifications altering its aesthetic values, for example: the introduction of modern materials, namely cement, fired bricks and metal doors and windows; the disappearance of decorative features on the façades, characteristic of the earthen architecture of Djenné. The authenticity of the site, in particular the inscribed ancient fabric, is testified by the use of little-modified construction materials: earth is the overall privileged material. The transmission of construction techniques is entrusted to the Barey Corporation, stone masons from generation to generation. Finally, through spirit, wisdom, welcome and the Great Mosque, Djenné is and remains the “pious town”. The town of Djenné benefits from legal protection through national heritage listing of the property and the creation of a cultural mission for its conservation. The Great Mosque, the Koranic schools and the Tombs of the Saints benefit from customary protection through the establishment of a management committee for the Mosque, the association for Koranic schools and supervision by the village chief, its Council and district chiefs. The site possesses a “conservation and management plan” for a five (5)-year duration, 2008-2012, which has been prepared in cooperation with the communities following a participatory approach. Possible problems could occur with an increase in the population and building speculation. The boundaries of the protection zone are vague. An urban regulation which is under preparation could assist in defining the said boundaries and contribute towards sustainable development of the town and respect the heritage values. The Cultural Mission requires the provision of human and material resources to ensure the control of the property against looting and other threats to the cultural heritage. How to help? The States Parties to the Convention should inform the Committee as soon as possible about threats to their sites. On the other hand, private individuals, non-governmental organizations, or other groups may also draw the Committee's attention to existing threats. If the alert is justified and the problem serious enough, the Committee may consider including the site on the List of World Heritage in Danger. To inform the World Heritage Committee about threats to sites, you may contact the Committee's Secretariat at: World Heritage Centre UNESCO 7, place de Fontenoy 75352 Paris 07 SP France Tel.: 33 (01) 45 68 18 71 E-mail: [email protected] Yet for a Western viewer the Unesco seal of approval may raise expectations that the building doesn’t quite meet. Heritage implies great age, and the mosque, as it now exists, is not ancient. The original mosque, dating from the 13th or 14th century, was a ruin when a French explorer reported seeing it in 1828, and was later demolished. It was only in 1907, by which time Djenné had become a French colonial outpost, that the mosque we see today was constructed on the site of the first one. The architect, Ismaila Traoré, the city’s chief mason and a Muslim, used traditional materials, including the palm-trunk inserts that bristle from the facade. But as historians have noted, the overall design adheres to the neo-Sudanese style being promoted at the time by the French, who wanted to give a uniform look to all their West African properties. Even if you accept the 1907 mosque as the new “original,” heritage-worthy in its own way, on the order of the Cathedral of Notre-Dame in Paris, problems arise, because the building is still changing. The climate in Mali — long hot, dry stretches broken by torrential rains — is rough on mud-brick architecture. Fissures and leaks quickly develop and grow. So every year since the Great Mosque was built, it has required a mud replastering, which the citizens of Djenné undertake as a festival event called the Crepissage de la Grand Mosquée. The replastering, or remodeling, has preserved the structure but also, over time, subtly altered it, rounding and softening its contours, giving it a molten, biomorphic look — the visual equivalent of Malian Islam, some say — insistently powerful without being harsh. More critically, the accumulated layers of plastering have gradually weakened the structure. In 2006 the Aga Khan Trust for Culture, based in Geneva and with a mandate to conserve earthen architecture, declared the mosque in danger of collapse and began an extensive restoration, which changed the shape yet again: curves and irregularities became crisp Modernist angles and straight lines. In addition, the Aga Khan personnel asked that the replastering stop until the restoration was complete. In terms of work, this made sense, but it had social ramifications. Djenné was suddenly deprived not only of a civic holiday and a much needed tourist lure, but also of spiritual earning power: by repairing their mosque the citizens had gained blessings — baraka — year after year. Advertisement Continue reading the main story Many in the city have raised heated complaints about the Unesco status — which, since it went into effect in 1988, has legally prevented residents of the historic zone from modernizing their homes — and about the Aga Khan Trust’s tradition-breaking makeover. At the same time, for the people who use the mosque, gathering in its biscuit-colored prayer halls, anger and aesthetics alike take second place to devotion. To a Western visitor who knew the mosque only from pictures and for the better part of a lifetime had longed to see it, it looked, under the light of a full moon and at dawn, somewhat different from what was anticipated but differently magnificent, a kind of architectural hallucination shaped from common African earth. Meanwhile, politics have also threatened to stall an important project at the Djenné Manuscript Library, directly adjacent to the Great Mosque, where work is under way — sponsored by the British Library Endangered Archives program in London — to preserve physically and digitize the many thousands of Arabic manuscripts that survive in the city. These include many handwritten copies of the Koran, but also medical, scientific and legal treatises; books of magic; and transcriptions of oral history as handed down by the griots, or minstrels, of West Africa. Some of the material dates to the 11th century. A small number of the manuscripts belong to the library; most are still owned by local families and are in precarious condition. Some manuscripts recently on view in the office of the mosque’s imam were kept locked behind screened cabinet doors, which protected them from insects, though the room itself, with its crumbling, water-damaged ceiling, gave clear evidence of other environmental liabilities. A campaign to persuade local owners to entrust their manuscripts to the Djenné library has met with some success, and digitizing goes forward: some 40,000 images are now online. But serious conflicts around the project have arisen. Certain members of the Djenné religious establishment want to preserve primarily Koranic manuscripts, but not those of magic and oral history, which they consider heretical. The British Library team, by contrast, wants to digitize everything possible, giving priority to items rare in age, exceptional in execution and unusual in content, whatever that may be. In play, of course, are differing attitudes toward the handling of potent information, including information in the form of art. The West believes in instant access, full and neutral disclosure; material first, spiritual second. Orthodox Islam believes in ideas discriminately revealed, then slowly absorbed; in mystery over matter, or at least equal to matter. What’s at stake is what beliefs and biases will shape the way history is told, in this case the history of Djenné, which is a crucial part of the history of Islam in Africa. (The United Nations has expressed concern over the safety of similar manuscripts in Timbuktu, since the occupying forces have looted the Ahmad Baba Institute of Higher Islamic Studies and Research.) Advertisement Continue reading the main story The big question is whether any work can go forward, given the drastic uncertainty of Mali’s present political situation. Half of the country, including Djenné’s spiritual twin city, Timbuktu, some 300 miles to the north, has effectively passed into new hands. And the intentions of the military junta in Bamako are unclear. For outsiders much of the country is still a no-go zone. For Malians catastrophe looms. At least Djenné has had some positive news lately. In mid-March, after a three-year halt, the Crepissage de la Mosquée resumed. Few outsiders were present to see it, but the lift in local morale was huge. At around the same time a potential standoff in the archiving project was averted, with the opposing parties at least temporarily reconciled. And there is the hope, even now, that with time new travelers, frightened off by current events, will come to this old, pious African city, with its deep history, contemporary questions and transcendent earth-made art, insha’Allah. These crawls are part of an effort to archive pages as they are created and archive the pages that they refer to. That way, as the pages that are referenced are changed or taken from the web, a link to the version that was live when the page was written will be preserved.Then the Internet Archive hopes that references to these archived pages will be put in place of a link that would be otherwise be broken, or a companion link to allow people to see what was originally intended by a page's authors.The goal is to fix all broken links on the web. Crawls of supported "No More 404" sites. 13 July 2016 – The Committee that establishes the locations that are listed as UNESCO World Heritage Sites, has today added the Old Towns of Djenné in Mali to the List of World Heritage in Danger, due to insecurity, which is affecting the area and preventing the implementation of protective measures for the site. “The Committee expressed concern over the property, which is situated in an area affected by insecurity,” said the United Nations Educational, Scientific and Cultural Organization (UNESCO) in a statement today, referring to the latest decision by the World Heritage Committee. “This situation is preventing safeguarding measures from addressing issues that include the deterioration of construction materials in the historic town, urbanization, and the erosion of the archaeological site,” said UNESCO The statement also noted that Committee appealed to the international community to support Mali in efforts to ensure the protection of the site. Inhabited since 250 B.C., the Old Towns of Djenné became a market centre and an important link in the trans-Saharan gold trade. In the 15th and 16th centuries, it was one of the centres for the propagation of Islam. Its traditional houses, of which nearly 2,000 have survived, are built on hillocks (toguere) as protection from the seasonal floods. The site located, in the Inland Niger Delta region of central Mali, was inscribed on the World Heritage List in 1988. The List of World Heritage in Danger is designed to inform the international community of conditions which threaten the very characteristics for which a property was inscribed on the World Heritage List, and to encourage corrective action. The 40th session of the World Heritage Committee began on 10 July and will continue until 20 July. It is chaired by Ambassador, Director General of Cultural Affairs and Promotion Abroad of the Turkish Ministry of Foreign Affairs Lale Ülker. A Historic Mud City in Mali Has Been Added to the UNESCO Endangered List Located in the city of Djenné, Mali, the Great Mosque of Djenné is the largest mud brick building in the world with definite Islamic influences Located in the city of Djenné, Mali, the Great Mosque of Djenné is the largest mud brick building in the world with definite Islamic influences Jeff Overs—BBC News/Current Affairs/Getty Images An ancient town in central Mali has been added to the UNESCO World Heritage list of endangered sites due to growing insecurity in the country, the U.N. announced Wednesday. The Old Towns of Djenné include nearly 2,000 pre-Islamic mud houses that have been inhabited since 250 B.C. But the World Heritage Committee said that instability — from Islamist militants groups active in the West African country — is thwarting necessary measures to preserve the site. “This situation is preventing safeguarding measures from addressing issues that include the deterioration of construction materials in the historic town, urbanization, and the erosion of the archaeological site,” said UNESCO in a statement. Djenné became a market center and was an important link in the trans-Saharan gold trade during the 15th and 16th centuries. According to UNESCO, it was one of the centers for the propagation of Islam. "The Malian government is coping with a lot of challenges," Edmond Moukala, the head of UNESCO World Heritage in Africa told Reuters. "What is needed right now is to ensure that institutions are in place and receive financial support." In 2012, a radical Islamist militia known as Ansar Dine destroyed shrines and tombs at the world-famous historic Malian city Timbuktu. And in November, 20 people were killed and more than 100 taken hostage by militants in a hotel siege in the country's capital Bamako. DAKAR (Reuters) - A World Heritage site in central Mali that features elaborate pre-Islamic mud houses is in danger of deteriorating because it cannot be protected adequately in the face of insecurity, UNESCO said on Wednesday. Boys recite Quranic verses handwritten on pieces of wood during a religious class in front of the Grand Mosque of Djenne, Mali September 1, 2012. REUTERS/Joe Penney The Old Towns of Djenné includes four archeological sites with nearly 2,000 houses whose decorative facades have remained intact since the 3rd century B.C. The buildings are among the most famous in Mali, a country that also boasts the ancient town of Timbuktu. The World Heritage Committee said insecurity was preventing measures to safeguard the site against the deterioration of construction materials, urbanization and erosion. Mali faces a threat from Islamist militants, as well as volatile separatist politics in the north. “The Malian government is coping with a lot of challenges,” said Edmond Moukala, head of UNESCO World Heritage in Africa, adding concerns were raised when a team visiting the site this year found signs of deterioration. “What is needed right now is to ensure that institutions are in place and receive financial support,” he said. A force led by French troops intervened in 2013 to drive back militants who had hijacked an ethnic Tuareg uprising and seized Timbuktu and other towns in the north. In 2012, militants linked to al Qaeda destroyed ancient shrines and tombs in the World Heritage site at Timbuktu. Violence flared this week as the army opened fire on protesters in the northern city of Gao who opposed an interim authority intended to maintain stability in the desert region. Djenné, a market center and link in the trans-Saharan gold trade, were added to the World Heritage List in 1988. Timbuktu and an ancient tomb in Gao have been on the list of sites in danger since 2012. The 49 properties on the list include archeological sites in Syria, Iraq and Afghanistan.

Summary: The West African country of Mali claims four UNESCO World Heritage Sites, and as of Wednesday, three of them were on the List of World Heritage in Danger-which runs only 54 items long. The Old Towns of Djenné and its 2,000 mud houses, which have been inhabited since the third century BC and a World Heritage site since 1988, joined the list due to "insecurity" in the region, according to a press release. Islamist militant groups have plagued Mali, Time reports, and there were political clashes in the north as recently as this week. Reuters reports troops fired at protesters in the city of Gao, whose Tomb of Askia is also an endangered World Heritage Site (as is the ancient Malian city of Timbuktu). In Djenné, UNESCO says, "This situation is preventing safeguarding measures from addressing issues," with Pravda reporting the flow of building materials used to combat deterioration and erosion has been hampered. The area once served as an "important link" in the gold trade, UNESCO notes. Later, in the 15th and 16th centuries, it operated as a center for the spread of Islam. A testament to that is the Great Mosque of Djenné. A comparatively new structure-built in 1907 at the site that formerly held a mosque built around the 13th century, the New York Times reported in 2012-it is the largest mud brick building in the world, according to Time. The Times noted that Mali's persistent dry spells, interrupted by huge downpours, exacerbate fissures in the mud-brick architecture, and the plastering that repairs it accumulates into layers that can weaken it.

multi_news

en

Summarize: BACKGROUND OF THE INVENTION [0001] The present invention relates generally to agricultural implements and, more particularly, to a forward folding planter having improved maneuverability and hitch loading when in a transport configuration. [0002] Agricultural planters generally consist of a hitch boom to which a pair of wing booms are coupled. The wing booms support a series of spaced seed units that deposit seed, fertilizer or other granular material onto a planting surface, e.g., farm field. Because of the relatively large wingspan of the wing booms, the planter frame will also include a pair of draft links. The draft links extend between the hitch boom and the wing booms, and are designed to add stability to the wing booms as the planter traverses the planting surface. In some planters, the wing booms are designed to fold forward against the hitch boom. For such forward-folding planters, the wing booms will typically be folded forward when the planter is ready for transport. That is, a planter generally has a working position in which the wing booms are fully extended away from the hitch boom and a transport position in which the wing booms are folded forward. In the transport position, the width of the planter is greatly reduced which is advantageous for exiting the planting surface and for storage of the planter. Additionally, when being shipped, the planter will be placed in its transport position. [0003] To expedite particulate matter deposition onto the planting surface, planter manufactures are adding length to the wing booms thereby allowing more seed units to be mounted along the length of the wing booms. As a result of the increases in length of the wing booms, the outer ends of the wing booms may undesirably extend past the hitch of the towing vehicle, e.g., tractor, when the planter is in the transport position. As such, large agricultural planters are typically used with telescoping rather than fixed length hitches. More particularly, the hitch boom is coupled to a telescoping hitch that is extended as the wing booms are folded forward. The telescoping hitch therefore provides clearance for the tractor when the outer ends of the wing booms come together. [0004] When the wing booms have been folded forward and engaged with the telescoping hitch, the telescoping hitch is lifted to provide clearance for the wheels that support the wing booms above the planting surface. This lifting of the hitch loads the rear wheels supporting the hitch boom and the hitch itself with a majority of the weight of the planter, which can result in overloading. In addition, it can be difficult to turn the planter when it is being towed as the elongation of the hitch to accommodate the folded wing booms greatly adds to the length of tow, and thus, the area required for cornering the planter. [0005] When the wing booms are folded forward, the draft links connected between the hitch boom and the wing booms cause the hitch boom to pull on the telescoping hitch to effectively extend the telescoping hitch to provide the aforementioned clearance for the wing booms. As such, the lengths of the draft links and their connection points to their respective wing booms dictate how far the telescoping hitch is extended. The farther out on the wing boom the connection point the more of the telescoping hitch that will be extended when the wing booms are folded forward. Therefore, the desired change in length, dictated by the amount of room required for the tractor to clear the wing booms when the booms are in the fully folded position, dictates the position the connection point of the draft links to the wing booms. However, the amount of length required to extend the hitch often results in a connection point that is structurally insufficient to support the draft links when the wing booms are in their working position. As such, it is generally necessary to use heavy hinges to connect the draft links to the wing booms and undesirably expose the wing booms to greater stress. [0006] Therefore, there is a need for an agricultural planter having a forward folding frame that places less load on the frame itself and the hitch when in a transport configuration. There is also a need for an agricultural planter having improved maneuverability when being transported. SUMMARY OF THE INVENTION [0007] The present invention is directed to a forward folding agricultural planter particularly well suited for use with a telescoping hitch coupled to a towing vehicle, such as a tractor. The planter has a pair of wing booms pivotably coupled to a hitch boom and that fold forward to stow the wing booms in a transport position. Draft links are connected between the hitch boom and the wing booms to provide stability for the wing booms when the wing booms are in an extended, working position but also dictate how far the telescoping hitch is extended when the booms are folded forward. [0008] The wing booms are supported by respective wheels assemblies having wheels that may be rotated downward as the wing booms are folded forward and then allowed to caster as the planter is towed. In this regard, the wheels support the wing booms when the wing booms are in the extended working position as well as the folded transport position. Thus, less load is placed on the hitch as well as the rear wheels that support the hitch boom when the planter is in the transport position. [0009] The wing booms are coupled to the hitch boom by a mounting arrangement that allows the wing booms to rotate or pivot upward relative to the hitch boom when the wing booms are folded forward. Rotating the wing booms slightly upward provides clearance for the seed units that are carried by the wheel booms. To maintain engagement of the wheel assemblies with the planting surface as the wing booms are rotated upward, the wheel assemblies are rotated downward. Thus, as noted above, the wheels maintain continuous engagement with the planting surface as the wing booms are folded from the working position to the transport position. [0010] The placement of the draft links is optimized so that the telescoped hitch is extended by a minimal amount necessary for the outer ends of the wing booms to clear the rear of the towing vehicle when the wing booms are in the fully folded position. [0011] The draft links each include an inner link member and an outer link member connected to one another by a hinge that allows the link members to pivot. The inner link member is connected to the hitch boom and the outer link member is connected to the wing boom. An actuator such as a hydraulic cylinder is connected between the wing boom and the outer link and is designed to draw the outer link inward against the wing boom when the wing boom is being folded forward. As a result, the link members fold upon themselves as the wing booms are being folded forward to the transport position. [0012] The hitch boom includes a wing boom retainer that loosely captures the outer ends of the wing booms when the wing booms are in the fully folded position. The retainer is constructed to retain the outer ends yet allow limited vertical and lateral movement, e.g., oscillation, of the wing booms as the planter is being transported. [0013] Thus, it is one object of the invention to provide a forward folding planter that places less stress on the hitch of the towing vehicle when the planter is being towed in transport. [0014] It is another object of the invention to provide a planter that is more maneuverable when in transport yet that does not impact the rigidity required during working, i.e., seeding or fertilizing. [0015] It is yet a further object of the invention to provide a planter for use with a telescoping hitch that extends the hitch by a minimal amount necessary when the planter is folded forward to a transport position. [0016] Other objects, features, and advantages of the invention will become apparent to those skilled in the art from the following detailed description and accompanying drawings. It should be understood, however, that the detailed description and specific examples, while indicating preferred embodiments of the present invention, are given by way of illustration and not of limitation. Many changes and modifications may be made within the scope of the present invention without departing from the spirit thereof, and the invention includes all such modifications. BRIEF DESCRIPTION OF THE FIGURES [0017] Preferred exemplary embodiments of the invention are illustrated in the accompanying drawings in which like reference numerals represent like parts throughout. [0018] In the drawings: [0019] FIG. 1 is an isometric view of an agricultural planter hitched to a tractor; [0020] FIG. 2 is a partial top plan view of the planter of FIG. 1 showing a hitch boom and a wing boom in an extended position. [0021] FIG. 3 is an isometric view of the portion of the planter show in FIG. 2 in a folded transport position; [0022] FIG. 4 an enlarged top plan view of the planter taken along line 4 - 4 of FIG. 3 ; [0023] FIG. 5 is an isometric view of the planter shown in FIG. 4 ; [0024] FIG. 6 is an isometric view of the planter similar to the view shown in FIG. 5 with a wing boom retainer tilted to a boom release position; [0025] FIG. 7 is an isometric view of the planter shown in FIG. 2 with a draft link in a partially folded position; [0026] FIG. 8 is an enlarged isometric view of a portion of the draft link and wing boom shown in FIG. 7 ; [0027] FIG. 9 is an enlarged isometric view of a wing boom wheel assembly of the planter taken along line 9 - 9 of FIG. 1 ; [0028] FIG. 10 is an isometric view of an underside of the wing boom assembly shown in FIG. 9 ; [0029] FIG. 11 is an isometric view of an underside of the wing boom assembly in a transport position; [0030] FIG. 12 is a front elevation view of the wing boom assembly in the transport position; and [0031] FIG. 13 is a top isometric view of the wing boom assembly in the transport position. DETAILED DESCRIPTION OF THE INVENTION [0032] The present invention is directed to an agricultural planter 10 particularly suited for use with a telescoping hitch 12 carried by or otherwise coupled to a tractor 14 or similar towing vehicle as shown in FIG. 1. The planter 10 includes a frame 16 generally comprised of a hitch boom 18 that connects to the telescoping hitch 12 and a pair of wing booms 20, 22 that are connected to the hitch boom 18. The wing booms 20, 22 are connected to the hitch boom 18 at a mount 24 in a manner that allows the wing booms 20, 22 to fold forward. Although not pictured, seed units, seed/fertilizer hoppers, cabling, and hydraulics are mounted to the hitch boom 18 and the wing booms 20, 22 to control the deposition of seed, fertilizer, insecticide, herbicide, and the like onto the planting surface. [0033] As will be appreciated by one skilled in the art, the hitch boom 18 is generally aligned with the hitch 12 and defines a central axis that generally runs parallel with the direction of travel of the tractor. In this regard, wing boom 20 constitutes a “left-side” wing boom and wing boom 22 constitutes a “right-side” wing boom. The wing booms 20, 22 are oriented symmetrically about the hitch boom 18 and are similarly constructed. As such, for purposes of description, the left-side wing boom 20 will be described but it is understood that the right-side wing boom 22 is of similar construction. [0034] FIG. 2 shows the wing boom 20 in its extended, working position. In this position, the wing boom 20 is generally perpendicular to the path of travel and the central axis of the hitch boom. The wing boom 20 is supported above the planting surface by wheels 26, 28. As will be described more fully below, the wheels 26, 28 provide support for the wing boom 20 when the boom 20 is in its extended position as well as its retracted, transport position, which is shown in FIG. 3. A draft link 30 is connected between the hitch boom 18 and the wing boom 20 at a connection point 33 forward of the mount 24. The draft link 30 provides structural support for the wing boom 20 when the wing boom 20 is in the fully extended position. As will be described more fully below, the draft link 30 has a pair of link members 32, 34 connected to one another by a knuckle 36 that allows the link members 32, 34 to fold relative to one another when the wing boom 20 is folded forward to its transport position. [0035] The hitch boom 18 includes a coupler 38 as known in the art for coupling the hitch boom 18 to the telescoping hitch 12. The hitch boom 18 is supported above the planting surface by a set of wheels 40, which in the illustrated embodiment includes two pairs of wheels, with a pair positioned adjacent each side of the hitch boom 18. The hitch boom 18 extends along a central axis of the planter 10 that is aligned with the hitch of the 12 of the tractor. The wheels 40 are coupled to a central wheel standard 42 that forms part of a steering/elevator assembly that is pinned to the mount 24 at a near vertical pin 46. [0036] Wing boom 20 has a center boom 44 that is pinned to the mount 24 at a pin 48 and an inner boom 50 that is pinned to the center boom 44 by horizontal longitudinal pin 52. The inner boom 50 is pinned to an outer boom 54 by a pin 56. The interconnection of the inner and outer booms 50, 54 allows the outer boom 54 to lifted and folded over the inner boom 50. An inner actuator 57 that in one embodiment includes a hydraulic cylinder 58 is connected to the center boom 44 and a ram 60 is pinned to the mount 24 at pin 62. In addition to inner actuator 57, a draft link actuator 64 is provided that in one embodiment includes a hydraulic cylinder 66 connected to the inner boom 50 and a ram 68 connected to outer draft link member 34. [0037] When rams 60 and 68 are fully extended, the wing boom 20 is in the fully extended position, as illustrated in FIG. 2. However, when the rams 60 and 68 are retracted, the wing boom 20 is pulled inwardly toward the hitch boom 18 about pin 48 and eventually adjacent the hitch boom as shown in FIG. 3. More particularly, the rams 60 and 68 are retracted simultaneously until ram 68 is fully retracted. Ram 68 draws the outer link member 34 inward toward the inner boom 50 as the outer link member 34 is able to pivot relative to the inner link member 32 at knuckle 36. The ram 68 draws the outer link member 34 until the knuckle 36 abuts against the inner boom 50. With the knuckle 36 abutting the inner boom 50, the ram 60 continues to retract until the booms are adjacent and generally parallel to the hitch 12. As will be explained in greater detail below, the wheels 26, 28 rotate under the wing boom 20 when the wing boom 20 is being moved to its retracted position to provide clearance for seed units mounted to the wing boom 20. Thus, as the wing boom 20 is elevated by the wheels 26, 28 rotating under the wing boom 20, the rear end of the hitch boom 18 is elevated relative to the hitch 12 of the tractor 14. As a result, the hitch boom 18 is angled downwardly toward the hitch 12. The near vertical pin 46 is angled in such a way that as the wing boom 20 swings ahead, the angling of the wing boom 20 causes the outer end of the wing boom 20 to angle up relative to the hitch 12. So, while the telescoping hitch boom 18 angles downward, the booms are level and aligned, as illustrated in FIG. 3. This is particularly advantageous for transportation and shipping purposes. [0038] As shown in FIG. 3, when the planter 10 is in the transport position, the draft link 30 is folded alongside the hitch boom 18 and wing boom 20 is folded ahead. The draft link 30 is connected to the hitch assembly 38 rather than connecting the telescoping hitch 12 to the hitch boom 18 because there will motion in the inner boom relative to the center boom as undulating terrain is encountered in transport. As such terrain is encountered, there will be small changes in the position and the draft link 30 will shift slightly from front to back. When this occurs, crank 70 will oscillate relative to pin 72. [0039] With additional reference to FIGS. 4-6, a wing boom retainer 74 is mounted to the hitch boom 18 and includes a vertical post 76 and a retainer plate 78 that defines a U-shaped channel 80 sized to receive and hold boom plate 82 mounted to the wing boom 20, and in particular, a wheel mount assembly 84 to which wheel 28 is coupled by a wheel standard 86. The retainer plate 78 is designed to retain the boom plate 82 adjacent the post 76 but allow limited vertical and lateral movement of the wing boom 20 during transport. In this regard, locking of the wing boom 20 is not solely controlled by the boom folding actuators 57 and 64. [0040] The U-shaped retainer 78 is journalled at pin 88 to the hitch boom 18 and fore of post 76. A hydraulic actuator 90 is mounted to the hitch boom 18 with pin 92 and the retainer 78 at pin 94 such that when the actuator 90 is extended the retainer 78 is pushed forward to envelop post 76 and plate 82, as illustrated in FIGS. 4-5. When actuator 90 is retracted, the retainer 78 is pulled forward and away from the post, as illustrated in FIG. 6. Thus, when the wing boom 20 is folded forward, actuator 90 is retracted until the boom plate 82 is generally flat against the post 76. The actuator 90 is then extended to push the retainer 78 rearward to capture the post 76 and the boom plate 82. [0041] As referenced above and with additional reference to FIGS. 7-8, a draft link 30 generally comprised of an inner link member 32 and an outer link member 34 connected between the hitch boom 18 and the wing boom 20. The inner link member 32 and the outer link member 34 are connected to one another by a knuckle 36 that allows the outer link member 34 to pivot or fold forward relative to the inner link member 32 when the actuator 64 draws the outer link member 34 toward the wing boom 20. In this regard, one end of the outer link member 34 is connected to the knuckle 36 and the opposite end of the link member 34 is pinned to the wing boom at pin 96. In a similar fashion, actuator 64 includes a cylinder 66 connected to the wing boom at pin 98 and a ram 68 linked with cylinder 66 and connected to the outer link member 34 at pin 100. [0042] Thus, when the wing boom 20 is in the working position, shown in FIG. 2, actuators 57 and 64 are in the fully extended position. When the wing boom is to be placed into the transport position, both actuators are retracted thereby causing the outer link member 34 to pivot forward and the wing boom 20 to pivot forward. The actuator 64 will retract until the knuckle 36 is against the wing boom 20, as shown in FIG. 8. Thereafter, the actuator 57 will continue to retract causing further folding of the wing boom 20 and the outer link member 34 until the transport position, shown in FIG. 3, is reached. [0043] One skilled in the art will therefore appreciate that the knuckle 36 provides two axis of rotation. More particularly, the outer link member 34 is journalled to the knuckle 36 via a vertically oriented pin 102 and the inner link member 32 is journalled to the knuckle 36 via a generally horizontal pin 104. In addition, the relative lengths of the inner link member 32 and the outer link member 34 dictate the amount of telescoping of hitch 12. Thus, the lengths of the members 32, 34 can be tailored on a per application basis to accommodate the desired location of support on the wing boom 20 yet also accommodate the amount of extension of the hitch 12 needed to clear the tractor 14 when the wing boom is in the transport position. [0044] Referring now to FIGS. 9-13, the wheels 26, 28 are designed to caster as the wing boom 20 is moved from the working position to the transport position. This castering allows the wing boom to “walk” forward as it is being fold to the transport position. While FIGS. 9-13 only show wheel 26 it is understood that wheel 28 is similar constructed. [0045] Wheel 26 is connected to the wing boom 20 by a wheel mount 106, which is connected to the wing boom in a known manner. The wheel 20 is centered about an axle 108 that is pinned to a caster frame 110. The caster frame 110 is connected to a wheel standard 112 that is connected to the wheel mount 106 via arm 114. The arm 114 may be pivoted by an actuator 116 that is pinned to the arm 114 at pin 118 is pinned to the wheel mount 106 at pin 120. In a preferred embodiment, the actuator 116 is a hydraulic cylinder and ram combination similar to the hydraulic actuators described above. When the wing boom is in the field position, the wheel 26 is locked so as to travel along a fixed line parallel to the path of travel of the hitch boom. However, when the wheel 26 is unlocked, the wheel 26 may caster thereby providing support for the wing boom 20 as the wing boom 20 is folded forward. In this regard, the wheel 26 maintains support of the wing boom 20 when the wing boom 20 is in the working and transport positions. [0046] The wheel 26 is locked by a wheel lock assembly 122 that generally includes a locking plate 124 mounted atop the caster frame 110 and a lock 126 connected to the wheel standard 112, as best shown in FIG. 11. The lock 126 is connected to the wheel standard 112 by a pair of pins 128 and includes a post 130 sized to be received by locking plate 122. More particularly, the locking plate 124 has a U-shaped notch 132 that receives the post 130 when the lock is pivoted downward. When the post 130 is seated in the notch 132, the caster plate 124 and thus the caster frame 110, connected thereto, cannot rotate about standard 112 and therefore locks the wheel 26 into a non-caster position. [0047] As best shown in FIG. 12, an unlocker bar 134 is pinned to the lock 126 at pin 136. When the hydraulic actuator 116 is activated and the arm 114 pivoted upward, the wheel standard 112 is pulled toward the rear of the wing boom 20 effectively causing the wheel standard 112 to be placed in a vertical position, such as shown in FIGS. 11-13. In addition, as the wheel standard 112 moves to the vertical or upright position, the unlocker bar 134 encounters a stop bar 138 mounted to the underside of the wheel mount 106. This forces the unlocker bar 134 to load pin 136. The downward force causes the lock 126 to pivot upward about pin 128 thereby releasing the post 130 from notch 132 of the caster plate 124. The actuator 116 holds the wheel standard 112 in the upright position and the wheel 26 is free to caster as the wing boom 20 is moved to the transport position. When the wing boom 20 is in the transport position, the castering of the wheel 26 allows the wheel 26 to travel parallel to the path of travel of the hitch boom 18 but effectively rotated ninety degrees from its position when the wing boom 20 is in the working position. [0048] When the wing boom 20 is moved from the transport position to the working position, the wheel 26 will similarly caster. Once the wing boom 20 is in the working position, the actuator 116 can lower the wheel 26 to its working position thereby releasing the load on pin 136. As a result, the lock 26 will pivot downward and the post 130 will be received in the notch 132 to lock the wheel into the working position. [0049] Many changes and modifications could be made to the invention without departing from the spirit thereof. The scope of these changes will become apparent from the appended claims.

Summary: An agricultural implement includes a hitch boom to which a pair of wing booms is pivotably connected. The wing booms are designed to fold forward from an extended position to a transport position. The wing booms are supported above a surface by wheels that provide the aforementioned support when the wing booms are in an extended position as well as the transport position. Maintaining surface contact of the wheels in both positions reduces the load placed on the hitch to which the hitch boom is coupled as well as the hitch boom itself. Multi-link draft links are connected between the hitch boom and the wing booms to provide support for the wing booms when the wing booms are in the extended position. The relative length of the draft links dictates how far the hitch telescopes when the wing booms are folded to the stowed or transport position.

big_patent

en

Summarize: Background VA pays monthly disability compensation to veterans with service- connected disabilities (i.e., injuries or diseases incurred or aggravated while on active military duty) according to the severity of the disability. VBA staff in 57 regional offices process disability compensation claims.These claims processors include Veterans Service Representatives (VSR) who gather evidence needed to determine entitlement, and Rating Veterans Service Representatives (RVSR) who decide entitlement and the rating percentage. Veterans may claim more than one medical condition, and a rating percentage is assigned for each claimed medical condition, as well as for the claim overall.decided more than 1 million compensation claims. In fiscal year 2013, VBA Since fiscal year 1999, VBA has used STAR to measure the decisional accuracy of disability compensation claims. Through the STAR process, VBA reviews a stratified random sample of completed claims, and certified reviewers use a checklist to assess specific aspects of each claim. are randomly sampled each month and the data are used to produce estimates of the accuracy of all completed claims. VA reports national estimates of accuracy from its STAR reviews to Congress and the public through its annual performance and accountability report and annual budget submission. VBA also produces regional office accuracy estimates, which it uses to manage the program. Regional office and national accuracy rates are reported in a publicly available performance database, the Aspire dashboard. The STAR review has two major components. The benefit entitlement review assesses whether the correct steps were followed in addressing all issues in the claim, collecting appropriate evidence, and whether the resulting decision was correct, including effective dates and payment rates. Accuracy performance measures are calculated based on the results of the benefit entitlement review. The STAR review also assesses whether claims processors appropriately documented the decision and notified claimants. new issue-based measure. By comparison, under the existing claim- based measure, the claim would be counted as 0 percent accurate unless the error did not affect benefits when considered in the context of the whole claim. In March 2014, VBA reported a national estimate of issue- based accuracy in its fiscal year 2015 annual budget submission and plans to update this estimate in VA’s next performance and accountability report. VBA also produces issue-based estimates by regional office, and reports them in the Aspire dashboard. For fiscal year 2013, the regional office claim-based accuracy rates ranged from an estimated 78.4 to 96.8 percent, and the issue-based accuracy rates ranged from an estimated 87.0 to 98.7 percent. Beyond STAR, VBA has programs for conducting regional office quality reviews and for measuring the consistency of decisions. In March 2012, VBA established quality review teams (QRT) with one at each regional office. A QRT conducts individual quality reviews of claims processors’ work for performance assessment purposes. The QRT also conducts in- process reviews before claims are finalized to help prevent inaccurate decisions by identifying specific types of common errors. Such reviews also serve as learning experiences for staff members. Since fiscal year 2008, VBA has also conducted studies to assess the consistency of disability claims decisions across regional offices. Initially, this initiative used inter-rater reliability (IRR) studies to assess the extent to which a cross-section of claims processors from all regional offices agree on an eligibility determination when reviewing the entire body of evidence from the same claim. In 2013, VBA revised its approach and began using questionnaires as its primary means for assessing consistency. A questionnaire includes a brief scenario on a specific medical condition for which claims processors must correctly answer several multiple-choice questions. VBA’s Approach to Measuring and Reporting Accuracy of Claim Decisions Has Limitations VBA Does Not Follow Accepted Statistical Practices and Thus Generates Imprecise Accuracy Data When calculating accuracy rates, VBA does not always follow generally accepted statistical practices. For example, VBA does not weight the results of its STAR reviews to reflect its approach to selecting claims by regional office, which can affect the accuracy of estimates. According to our analysis of VBA data, weighting would have resulted in a small change to VBA’s nationwide claim-based accuracy rate for fiscal year 2013—from 89.5 to 89.1 percent. At the regional level, 29 of the 57 offices would have experienced a somewhat greater increase or decrease in their accuracy rates. Without taking weighting into consideration, regional office accuracy performance may be misleading and VBA management may focus corrective action or positive recognition on the wrong offices. For example, by taking weighting into account for the 57 regional offices in fiscal year 2013, the Reno regional office would have improved in relative accuracy by 12 places (from 34th to 22nd place), whereas the Los Angeles office would have declined in relative accuracy by 10 places (from 46th to 56th place) (see fig. 1). VBA also does not calculate the confidence intervals associated with the accuracy estimates that it generates, which prevents a complete understanding of trends over time and comparisons among offices. Accuracy estimates for different regional offices, or for the same office over time, are considered statistically different from each other when their confidence intervals do not overlap. As such, meaningful comparisons could be made on the basis of our analysis between, for example, Fort Harrison’s estimated claim-based accuracy rate (ranked #1) and New York’s estimated claim-based accuracy rate (ranked #36) because their confidence intervals did not overlap in fiscal year 2013 (see fig. 2). Conversely, comparisons between Fort Harrison’s and Milwaukee’s or Pittsburgh’s estimated claim-based accuracy rates (ranked #2 and #35 respectively)—which had overlapping confidence intervals in fiscal year 2013—require a statistical test to determine if their differences are statistically meaningful. In effect, the claim-based accuracy rate of Fort Harrison and those of the regional offices with the next 34 highest reported accuracy rates may not be meaningfully different despite being ranked 1 through 35 of 57. Similarly, according to agency officials, VBA also does not calculate the confidence intervals associated with its newer issue-based accuracy estimates, which prevents meaningful comparisons between those estimates as well. Because VBA produces issue-based estimates using the same sample drawn to produce claim-based estimates, it would have to take extra steps to calculate the associated confidence intervals.computing the confidence intervals associated with issue-based As with the claim-based accuracy estimates, not estimates limits VBA’s ability to monitor its regional offices’ relative performance and its overall performance over time. VBA’s approach to measuring accuracy is also inefficient because it reviews more claims than are statistically required to estimate accuracy. VBA randomly selects about 21 claims per month from each of its regional offices for STAR review, regardless of the offices’ varying workloads and historical accuracy rates. According to VBA, this uniform approach allows the agency to achieve a desired level of precision of its accuracy estimates for each regional office. However, accepted statistical practices would allow for fewer cases to be reviewed at regional offices where the number of claims processed has been relatively small or accuracy has been high. According to our analysis of fiscal year 2013 regional office workload and accuracy results, VBA could reduce the overall number of claims it reviews annually by about 39 percent (over 5,000 claims) and still achieve its desired precision for its regional office accuracy estimates. More efficient sampling could allow VBA to select fewer cases for review and free up limited resources for other important quality assurance activities, such as additional targeted accuracy reviews on specific types of error-prone or complex claims. Specifically, reviewing about 5,000 fewer claims could free up about 1,000 staff days because, according to VBA officials, STAR staff review at least 5 claims per day. Calculating weighted estimates and confidence intervals, and adjusting sampling according to shifting workloads and accuracy rates, requires use of statistical methodology. According to VBA officials we interviewed, although STAR management used a statistician to help develop the way in which they measure accuracy, it currently does not use a statistician to, for example, weight STAR results and calculate confidence intervals for accuracy estimates. Further, VBA officials said they did not consult a statistician when developing the new issue-based accuracy measure, but rather relied on the same sampling methodology and approach for estimating accuracy as for the claim-based measure. We have previously reported that to be useful, performance information must meet users’ needs for completeness, accuracy, consistency, and validity, among other factors. In response to our draft July 2014 testimony based on preliminary work, VBA officials stated they are exploring alternatives to their current methodology for estimating accuracy. Beyond not following generally accepted statistical practices, VBA’s STAR review systematically excludes certain claims, which may inflate accuracy rate estimates. Specifically, according to VBA officials, when a claim moves from one regional office to another, because a veteran has moved or workloads are redistributed, the database VBA uses to select claims for STAR review does not always reflect the office responsible for As a result, STAR staff making the final determination for the claim. often select for review, then subsequently de-select, claims that have changed regional office jurisdiction. Of the 14,286 rating claims randomly selected initially by VBA for review in fiscal year 2013, about 10 percent were de-selected because of a change in jurisdiction and replaced with other randomly selected claims. Those de-selected claims are not eligible for STAR review for the regional office that was ultimately responsible for the claim, thereby causing an underrepresentation of these claims in the STAR sample. Such underrepresentation may inflate VBA’s reported accuracy rate because redistributed claims have historically had lower accuracy rates than non-redistributed claims. In responding to our draft report, VBA indicated it is revising its procedures to ensure that claims selected for STAR review are included in the accuracy rate of the responsible regional office regardless of whether a change of jurisdiction occurred. VBA Does Not Report Key Information to Help Users Understand Accuracy Metrics Federal agencies should report clear performance information to the Congress and the public to ensure that the information is useful for decision making. In prior work, we identified clarity as a key attribute to a successful performance measure, meaning that the measure is clearly stated and its associated methodology is identified. Measures that lack clarity may confuse or mislead users, and not provide a good picture of how well the agency is performing. We have also reported on best practices in implementing related federal performance reporting requirements, such as those in the GPRA Modernization Act of 2010. Specifically, agencies must disclose information about the accuracy and validity of their performance information in their performance plans, including the sources for their data and actions to address any limitations. VBA’s accuracy reporting lacks methodological details that would help users understand the distinction between its two accuracy measures and their associated limitations. While VBA’s new issue-based measure provides some additional perspective on the quality of claim decisions to date, VBA has not fully explained in its public reports how the issue- based and claim-based measures differ. For example, the issue-based measure tends to be higher than the claim-based measure because the former allows for claims to be considered partially correct, whereas the claim-based measure does not. According to VBA officials, the issue- based estimate provides a better measure of quality because veterans’ Our analysis claims have increasingly included multiple medical issues.of STAR data confirms that as the number of issues per claim increases, the chance of at least one issue being decided incorrectly within a single claim increases because there are more opportunities for error (see fig. 3). However, VA did not report in its fiscal year 2015 budget request how these measures are calculated and why the issue-based measure might be higher than the claim-based measure. VA has also not reported these distinctions in its Aspire dashboard. VBA also counts claims processing errors differently under its claim- based measure than it does under its issue-based measure but does not report these distinctions, which raises questions about the transparency and consistency of VBA’s accuracy measures. For both measures, VBA differentiates between benefit entitlement errors that may financially affect the veteran and other errors, such as documentation and administrative errors that do not financially affect the veteran. For claim-based accuracy, VBA counts errors that financially affect the veteran now, but does not count errors that may financially affect the veteran in the future, although it works to correct both types of errors. For example, if one of several claimed medical conditions was rated incorrectly (e.g., 10 percent instead of 20 percent), but this error did not immediately affect the overall rating of the claim, VBA would not consider the claim in error because it did not affect the benefits that the veteran would receive. For the issue-based accuracy measure, however, VBA would count this as an error even if the error did not immediately affect the veteran’s benefits. Unlike claim-based accuracy, issue-based accuracy may also include errors that would never affect future payments. For example, an incorrect effective date that is within the same month as the correct effective date does not affect benefits, but is counted as an error in VBA’s issue-based accuracy measure. Conversely, according to VBA officials, this is not counted as an error in its claim-based measure. According to our analysis of STAR data, up to 6.9 percent of reviewed claims in fiscal year 2013 had these types of errors (i.e., benefit entitlement errors that do not immediately and may never affect benefits), and if they were all counted as errors, VBA’s unweighted claim-based accuracy rate would have decreased by about 2 percent. Further, VA has not explained in public reports that its accuracy measures are estimates that have distinct confidence intervals and limitations. Users should be aware of these confidence intervals to make meaningful comparisons, for example, between the two measures or over time for the same measure. In terms of each accuracy measure’s limitations, the claim-based measure does not provide a sense of the proportion of issues that the agency decides correctly because the measure counts an entire claim as incorrect if any error is found. On the other hand, the issue-based measure does not provide a sense of the proportion of claims that the agency decides with no errors. VBA Has Enhanced and Coordinated Its Quality Assurance Activities, Though Gaps in Implementation May Limit Their Effectiveness VBA Has Taken Steps to Enhance and Coordinate Key Quality Assurance Activities In addition to its STAR reviews, VBA’s quality assurance framework includes other complementary activities, which have been enhanced to help meet its goal of 98 percent accuracy in fiscal year 2015. Specifically, VBA (1) established quality review teams (QRT) in March 2012 in regional offices as a means of strengthening its focus on quality where claims are processed, and (2) enhanced efforts to assess the consistency of decisions. Although regional offices were previously responsible for assessing individual performance, QRTs represent a departure from the past because QRT personnel are dedicated primarily to performing these and other local quality reviews. In addition, VBA requires QRT staff to pass a skills certification test annually—similar to VBA requirements for STAR staff and in contrast to requirements for claims processors who must pass a test every 2 years. In July 2013, VBA issued national guidance to ensure consistent QRT roles and practices across regional offices. For example, it included guidance on selecting individual quality review claim samples and conducting additional reviews for claims processors who do not meet their accuracy goals. In addition to conducting individual quality reviews, QRT personnel are charged with conducting in-process reviews of claims that are not yet finalized, looking for specific types of common errors. Quality reviewers are also responsible for providing feedback to claims processors on the results of their quality reviews, typically as reviews are completed, including formal feedback from the results of individual quality reviews and more informal feedback from the results of in-process reviews. In addition, at the four offices we contacted, quality reviewers are available to answer questions and provide guidance to claims processors as needed. VBA’s efforts to assess consistency of claims decisions have also expanded in recent years. Up until 2013, VBA largely relied on inter-rater reliability (IRR) studies to assess consistency, which to date have been time consuming and resource intensive. Claims processors typically required about 4 hours to review an entire claim. The process was administered by proctors in the regional offices and the results were hand-graded by national VBA staff. Given the resources involved, IRR studies have been typically limited to 300-500 (about 25-30 percent) claims processors, randomly selected from the regional offices. In 2009, VBA expanded its consistency program to include questionnaires, which it now relies on more heavily to assess consistency. The more streamlined consistency questionnaires require less staff time to complete because, in addition to a brief scenario on a specific condition, participants have 10 or fewer multiple-choice questions to answer. The questionnaires are administered electronically through the VA Talent Management System, removing the need to proctor or hand-grade the tests, which has allowed VBA to significantly increase employee participation. A recent consistency questionnaire was taken by about 3,000 claims processing employees— representing all employees responsible for rating claims. Further, VBA now administers these studies more frequently, from about 3 to 24 per year. According to VBA officials, they plan to further expand the use of consistency studies from two questionnaires per month to six to eight per month, pending approval of additional quality assurance staff. VBA also has taken steps to coordinate its quality assurance efforts in several ways, such as systematically disseminating information on national accuracy and consistency results and trends to regional office management and QRTs, which in turn share this information with claims processing staff. With respect to STAR, in addition to receiving monthly updates on overall accuracy performance, regional offices receive quarterly reports with analyses of accuracy performance including information by error type. QRT reviewers also participate in monthly conference calls with STAR staff during which they discuss error trend information. While claims processing staff learn about errors they made on claims directly from STAR, managers or QRT members at each of the regional offices we contacted noted that they also share STAR trend data with claims processors during periodic training focused on STAR error trends. With respect to consistency studies, regional offices receive national results; regional office-specific results; and, since February 2014, individual staff results. Officials at each of the four regional offices we visited told us QRT staff share the results of consistency studies with staff and inform claims processors of the correct answers to the questions. Coordination also occurs when QRT personnel disseminate guidance and support regional office training based on error trends identified through STAR and other quality assurance activities. Two of the four offices we contacted cited instances where they have used consistency study results for training purposes. At one office, the results from a consistency study were used to provide training on when to request an exam for certain conditions, such as tinnitus. In general, at each of the four offices, officials told us that QRT reviewers conduct, or work with regional office training coordinators to conduct, periodic training forums for claims processors. Regional offices we contacted also supplement training with other communications informed by quality review results. For example, QRTs at three of the four regional offices we contacted produce periodic newsletters for regional office claims processors, which include guidance based on errors found in all types of reviews. Specifically, at one office, a newsletter was used to disseminate guidance on ensuring that a rating decision addresses all issues in a claim. The need for this guidance was identified on the basis of STAR and local quality review results. Lastly, VBA coordinates its quality assurance activities by using STAR results to guide other quality assurance efforts. According to VBA officials, the agency has used STAR data to identify error trends associated with specific medical issues, which in turn were used to target efforts to assess consistency of decision-making related to those issues. Recent examples are (1) the August 2013 IRR study, which examined rating percentages and effective dates assigned for diabetes mellitus (including peripheral neuropathy); and (2) a February 2014 study on obtaining correct disability evaluations on certain musculoskeletal and respiratory conditions. In addition, according to VBA, the focus of in- process reviews performed by QRTs has been guided by STAR error trend data. VBA established in-process reviews in March 2012 to help the QRTs identify and prevent claim development errors related to medical examinations and opinions, which it described as the most common error type. More recently, VBA has added two more common error types— incorrect rating percentages and incorrect effective benefit dates—to its in-process review efforts. VBA officials stated that they may add other common error types based on future STAR error analyses. Some Gaps in Implementation Persist and the Effectiveness of Quality Assurance Activities Is Unclear While QRTs reflect VBA’s increased focus on quality, during our site visits we identified shortcomings in QRT practices and implementation that could reduce their effectiveness. Specifically, we identified the following shortcomings: (1) the exclusion of claims processed during overtime to assess individual performance; (2) the inability to correct errors identified before a claim is finalized in certain situations; and (3) a lack of pre- testing of consistency questionnaires. Regarding the first shortcoming, we learned that three of the four offices we contacted had agreements with their local unions that prevented QRT personnel from reviewing claims processed during overtime to assess individual performance. As a result, those regional offices were limited in their ability to address issues with the quality of work performed during overtime. Centrally, VBA officials did not know which or how many regional offices excluded claims processed during overtime, or the extent to which excluding cases worked during overtime occurred nationally. According to VBA data, claims processed on overtime represented about 10 percent of rating-related claims completed nationally in fiscal year 2013. After we reported this finding, VBA issued guidance in August 2014 to regional offices stipulating inclusion of claims processed on overtime, and that the regional offices work with their local unions to rescind any agreements that exclude such claims from review. Second, officials at four regional offices we contacted told us that they face a challenge in conducting individual quality and in-process reviews as expected because VBA’s Veterans Benefits Management System lacks the capability to briefly pause the process and prevent claims from being completed while a review is still underway. VBA officials acknowledged that this was a problem for regional offices in completing reviews, based on anecdotal information from regional offices, but did not have information on the extent to which this occurred. VBA officials noted that reviews could be performed after a claim is completed; however, if an error is found, the regional office might need to rework the claim and provide the veteran with a revised decision. The officials also noted that VBA is working toward modifying its Veterans Benefits Management System to address this issue, but is at the initial planning stage of gathering requirements and could not provide a time frame for completion. Thirdly, although VBA has developed a more streamlined approach to measuring consistency, VBA officials told us that consistency questionnaires were developed and implemented without any pre-testing, which would have helped the agency determine whether the test questions were appropriate for field staff and were accurately measuring consistency. Pre-testing is a generally accepted practice in sound questionnaire development for examining the clarity of questions or the validity of the questionnaire results. In the course of our review, VBA quality assurance officials noted that they plan to begin pre-testing consistency questionnaires as a part of a new development process. Specifically, after each questionnaire has been developed, two to three quality assurance staff who have claims processing experience, but were not involved in the questionnaire’s development, would be targeted to pre-test it. Quality assurance staff responsible for the consistency studies would then adjust the questionnaire if necessary before it is administered widely. While initially slated to occur in July 2014, VBA quality assurance staff now anticipate pre-testing to begin in September 2014. Beyond these implementation shortcomings, staff in each of the four offices we contacted said that several key supports were not sufficiently updated to help quality review staff and claims processors do their jobs efficiently and effectively. Staff at these offices consistently described persistent problems with central guidance, training, and data systems. Guidance: Federal internal control standards highlight the need for pertinent information being captured and distributed in a form that allows people to perform their duties efficiently. However, regional office quality review staff said they face challenges locating the most current guidance among all of the information they are provided. Managers or staff at each of the regional offices we contacted said that VBA’s policy manuals are outdated. As a result, staff must search numerous sources of guidance to locate current policy, which is time- consuming and difficult. This, in turn, could affect the accuracy with which they decide claims. One office established a spreadsheet to consolidate guidance because the sources were not readily available to claims processors. VBA officials acknowledged that there are several ways it provides guidance to regional offices. In addition to the existence of relevant regulations and VBA’s policy and procedures manual, VBA provides guidance to claims processors through policy and procedures letters, monthly quality calls and notes from these calls, various bulletins, and training letters and other materials maintained on VBA’s intranet site. While agreeing that having multiple sources of guidance could be confusing to staff, VBA officials noted they face challenges in updating the policy manual and other available guidance materials to ensure that they are as current as possible. After we reported on this issue, VBA officials noted that they are considering streamlining the types of guidance provided. They also plan to develop a system of consolidated links to guidance documents by alphabetized topic to help claims processors access the information more efficiently; however, VBA officials acknowledge that developing a single repository will be a challenging project and have not yet dedicated adequate resources for this effort. Training: Staff in the offices we contacted also said that in some cases national training has not been updated to reflect the most current guidance, which in turn makes it difficult to provide claims processors with the information they need to avoid future errors. For example, staff from one regional office noted that training modules on an error-prone issue—Individual Unemployability and related effective dates of benefits—had not been updated to reflect all new guidance, the sources of which included conference calls, guidance letters, and frequently asked questions compiled by VBA’s central office. Further, officials at regional offices we contacted expressed concern that VBA limits their flexibility to update out-of-date course materials. In response to these concerns, VBA training officials explained that that they are continually updating national training to reflect new guidance, but how long it takes is a function of the extent of the policy change. These officials noted that updating the Individual Unemployability training was particularly delayed because of numerous, unanticipated changes in policy and related guidance that resulted in their setting aside previously updated course materials and starting over. VBA training officials also explained that while VBA does not allow changes to the contents of courses in its catalog, regional offices can propose courses for the catalog, based on their needs identified through quality reviews. Data systems: Regional office quality review staff also told us that they are required to log errors into three systems or databases that do not “speak to one another” and two lack the capability to fully track errors trends, thereby limiting their ability to take corrective actions. At the regional office level, quality assurance information is entered into three different databases or systems. Staff at each of the four offices we contacted said that the Automated Standardized Performance Elements Nationwide system used for tracking individual accuracy for performance management purposes lacks functionality to create reports on error trends by claimed medical issue or reasons for specific types of errors. As a result, three offices maintain separate spreadsheets to identify error trends related to individual accuracy. Regional office staff also noted that one of the two systems used to track in-process reviews does not help track error trends, for example, by employee, resulting in two offices maintaining additional spreadsheets to track this information. At the national level, VBA central office has made some improvements in reporting and now has the ability to analyze regional office information on errors by medical issue. According to VBA officials, they share this information with regional office managers and quality staff during training calls. VBA officials stated that a planned replacement for its Automated Standardized Performance Elements Nationwide system would have addressed reporting limitations at the local level, but was halted. As of September 2014, VBA did not have a timeframe for restarting the process for acquiring a new system. Finally, VBA’s efforts to evaluate the effectiveness of its quality assurance activities have been limited. Specifically, VBA officials told us that although they have not seen an increase in the national accuracy rate in fiscal year 2014, the number of errors related to claim development has declined, demonstrating the success of QRT reviews and training in targeting these errors. Also, VBA identified 13 regional offices whose issue-based accuracy rates improved between the first and third quarters of fiscal year 2014, attributing these improvements to actions taken by However, it was not clear quality assurance staff in fiscal year 2014.from the documentation VBA provided whether and how it monitored the effectiveness of these actions for all regional offices. With respect to consistency studies, VBA also has not evaluated—and lacks plans to evaluate—the efficacy of using consistency questionnaires relative to the more resource-intensive IRR studies. According to a VBA official, the consistency questionnaires have helped identify regional offices and individuals in need of further training on the basis of the percentage of incorrect answers, as well as the need for national training. However, officials could not provide data or evaluations indicating that consistency questionnaires have improved accuracy rates in the areas studied. VBA officials noted that they are considering a new data system that would combine all local and national quality assurance data—including STAR, in-process reviews, and individual quality reviews—and allow for more robust analyses of root causes of errors. Specifically, they expect the system will show relationships across the results of various quality assurance reviews to determine employee competence with various aspects of claims processing. According to VBA officials, this system would also enable them to more easily evaluate the effectiveness of specific quality assurance efforts. Evaluation can help to determine the “value added” of the expenditure of federal resources or to learn how to improve performance—or both. It can also play a key role in strategic planning and in program management, informing both program design and execution. Continuous monitoring also helps to ensure that progress is sustained over time. However, VBA officials indicated that this proposal is still in the conceptual phase and requires final approval for funding and resources. Conclusions VBA’s dual approach for measuring accuracy is designed to provide additional information to better target quality improvement efforts, but its methods and practices lack rigor and transparency, thereby undermining the usefulness and credibility of its measures. By not leveraging a statistician or otherwise following statistical practices in developing accuracy estimates, VBA is producing and relying on inaccurate estimates to make important internal management decisions. Similarly, by using a one-size sampling methodology, VBA is unnecessarily expending limited resources that could be used elsewhere. The systematic exclusion of redistributed claims and those moved between offices further calls into question the rigor of its accuracy estimates. Lastly, VBA’s reporting of its two accuracy metrics lacks sufficient transparency to help members of Congress and other stakeholders fully understand the differences and limitations of each, and thus may undermine their trust in VBA’s reported performance. VBA has enhanced and coordinated other aspects of its quality assurance framework, but shortcomings in implementation and evaluation detract from their overall effectiveness. For example, although VBA is disseminating the results of national STAR reviews and consistency studies, and local QRTs are using those results to focus related training or guidance to claims processing staff, until centralized guidance is consolidated and streamlined, staff lack ready access to information that will help them prevent errors. Moreover, absent adequate system capabilities to support local quality reviews, QRTs are unable to stop incorrect decisions from being finalized, and may not be aware of error trends that could be mitigated through training or other corrective action. Finally, although some of its quality assurance activities are relatively new, VBA lacks specific plans to evaluate their effectiveness and may miss opportunities to further improve or target these activities to more error-prone areas. In general, unless VBA takes steps to improve the rigor of all its quality assurance methods and practices, VBA may find progress toward achieving its goal of 98 percent accuracy in fiscal year 2015 illusive—especially in the face of challenging workloads, limited resources, and expectations of timely claim decisions. Recommendations for Executive Action To help improve the quality of VBA’s disability compensation claim decisions, we recommend that the Secretary of Veterans Affairs direct the Under Secretary for Benefits to: Leverage appropriate expertise to help VBA do each of the following: weight its accuracy estimates to reflect the sample design for determine and report the confidence intervals associated with its reported accuracy estimates; and re-examine its approach to calculating the regional office sample size for STAR. Take steps to ensure that redistributed claims and those moved between regional offices are not underrepresented in the STAR sample. Increase transparency in explaining how the claim-based and issue- based accuracy rates are calculated as well as their key limitations when publicly reporting these metrics. Review the multiple sources of policy guidance VBA provides to determine ways to consolidate them or otherwise improve their availability and accessibility for use by staff in regional offices. Take steps to ensure that any future upgrades to local data systems allow QRTs to pause the claims process when errors are detected and enable QRTs to better track error trends. Take additional steps to evaluate the effectiveness of quality assurance activities to identify opportunities to improve or better target these activities. Agency Comments and Our Evaluation We provided a draft of this report to VA for review and comment, and its written comments are reproduced as appendix III in this report. VA generally agreed with our conclusions and concurred with all of our recommendations. The agency outlined how it plans to address our recommendations as follows: Regarding our recommendations to leverage appropriate expertise to improve its measurement and reporting of accuracy, VA stated that a VBA statistician has begun developing a revised sampling methodology that takes into consideration output and claims processing accuracy at each regional office to determine sample sizes. VBA also plans to appropriately weight accuracy estimates and calculate the margins of error based on the revised sampling methodology. VBA intends to report results based on this new methodology beginning in March 2015. Regarding our recommendation to take steps to ensure that redistributed claims and those moved between regional offices are not underrepresented in the STAR sample, VA stated that VBA’s revised sampling methodology will be based on the office completing the claim, and that no claims will be excluded from samples due to changes in jurisdiction. VBA intends to implement this revised sampling methodology by the end of March 2015. Regarding our recommendation to increase transparency in explaining how the claim-based and issue-based accuracy rates are calculated, VA stated that VBA will describe its sampling, assessment criteria, calculation, and reporting methodologies for claim and issue- level accuracy as part of future performance documents and public reports. VBA anticipates implementing this recommendation by the end of March 2015. Regarding our recommendation to review the multiple sources of policy guidance VBA provides to regional office staff, VA stated that in September 2014, VBA began improving the availability and accessibility of policy guidance, as well as consolidating references to this guidance. VBA anticipates completing this project by the end of April 2015. Regarding our recommendation to take steps to ensure that any future upgrades to local data systems allow QRTs to pause the claims process when errors are detected and enable QRTs to better track error trends, VA stated that VBA is designing a new database that will incorporate all types of quality reviews (i.e., regional office reviews, STAR, and consistency studies) and provide VBA with more data analysis capabilities. Although VA did not outline specific steps VBA plans to take to upgrade local data systems so that QRTs may pause the claims process, VBA plans to implement this recommendation by the end of June 2015. Regarding our recommendation to take additional steps to evaluate the effectiveness of quality assurance activities to identify opportunities to improve or better target these activities, VA stated that VBA’s new database will enable VBA to do so by the end of June 2015. VA also provided technical comments, which we incorporated as appropriate. We are sending copies of this report to the appropriate congressional committees and the Secretary of Veterans Affairs. In addition, the report is available at no charge on the GAO website at http://www.gao.gov. If you or your staff have any questions about this report, please contact me at (202) 512-7215 or [email protected]. Contact points for our Offices of Congressional Relations and Public Affairs may be found on the last page of this report. GAO staff who made key contributions to this report are listed in appendix IV. Appendix I: Objectives, Scope and Methodology The objectives of this report were to examine (1) the extent to which the Veterans Benefits Administration (VBA) effectively measures and reports the accuracy of compensation claim decision-making, and (2) whether VBA’s other quality assurance activities are coordinated and effective. Review of Systematic Technical Accuracy Review (STAR) To assess VBA’s measurement and reporting of the accuracy of compensation claim decision-making, we focused on the STAR process for reviewing disability compensation claims that VBA identifies as rating- related—that is, requiring a decision on the claimant’s eligibility for benefits and the monthly benefit amount. We did not review quality assurance over disability compensation claims that did not involve a rating, including adjustments for additional dependents. We also did not review quality assurance efforts involving appealed cases, aspects of which fall under the Board of Veterans’ Appeals. Finally, we did not review pension claims, which represent a small portion of VBA’s disability benefits workload, because VBA is reviewing its approach to the accuracy assessment of pension claims. To determine the extent to which STAR appropriately reflects the accuracy of claims, we reviewed VBA policy manuals, the STAR checklist, and other tools used in VBA’s STAR review. We interviewed VBA and Office of Inspector General (OIG) officials to learn whether there are claim types that are omitted from STAR review and, if so, the reasons for these omissions. To determine how errors are identified and counted under STAR, we examined the ways in which the checklist and other STAR procedures are used to quantify errors. We visited VBA’s office in Nashville, Tennessee, where the STAR reviews are conducted to observe the review process and program methodology in action. We reviewed checklists used to assess accuracy of claims and identified information VBA uses on the basis of these checklists to calculate accuracy rates. To assess the extent to which VBA uses generally accepted statistical practices to generate accuracy rates, we analyzed VBA data on claims processed and reviewed from October 2012 through September 2013. In analyzing STAR data, we calculated the weighted claim-based annual accuracy rate for each regional office and nationwide. We then calculated the 95 percent confidence intervals associated with these estimated accuracy rates. We applied a statistical sample size formula suitable for use in a stratified random sample and analyzed the differences this approach produced compared to VBA’s sample size estimation methodology for regional offices. We assessed the reliability of VBA’s STAR data by performing electronic data testing, reviewing related documentation, and interviewing knowledgeable agency officials. We also assessed the reliability of VBA’s claim processing data by interviewing knowledgeable agency officials about the data. To electronically assess the reliability of the STAR data, we tested for duplicate benefit records, tested the claim disposition date field to ensure we only analyzed STAR claims from fiscal year 2013, checked the benefit claim end product code to ensure we only included benefit claims with end product codes eligible for inclusion in the STAR accuracy sample, checked for missing data in key analysis variables, and examined the range of values in key variables to check for outliers. We determined that the data were sufficiently reliable for our purposes. To assess how VBA reports accuracy, we identified and reviewed relevant VBA performance reports, such as VA’s Performance and Accountability Report and Aspire dashboard data. We also interviewed VBA officials about the rationale for creating the issue-based accuracy measure, and the agency’s plans for reporting its performance on accuracy and consistency. We compared VBA practices with legal requirements for agency performance reporting such as the GPRA Modernization Act of 2010 and related GAO work (e.g., GAO, Managing For Results: GPRA Modernization Act Implementation Provides Important Opportunities to Address Government Challenges, GAO-11-617T, Washington, D.C.: May 10, 2011). Coordination and Effectiveness of Quality Assurance Activities To determine whether VBA’s quality assurance activities are coordinated and effective, we reviewed VBA quality assurance policies, reports, and guidance to identify key quality assurance activities. Based on this review, we focused on quality review teams (QRT), which are located in each regional office and responsible for local quality assurance, as well as on VBA’s consistency program that is administered by VBA’s centralized quality assurance staff. We then examined each activity’s function and process by reviewing relevant guidance and policy documents and interviewing central office officials. Specifically: We reviewed VBA policy and procedure documents for quality review teams (QRT) to learn the purposes of, and the information generated by, these efforts. In addition, we interviewed VBA central office and regional office officials to gather their perspectives on any redundancy or gaps between quality assurance efforts. We compared the functions of and information yielded by quality assurance components with the framework laid out in VBA’s Quality Assurance Program Plan, as well as standards for internal control in the federal government (see GAO, Standards for Internal Control in The Federal Government, GAO/AIMD-00-21.3.1, Washington, D.C. : November 1999). In addition, we interviewed VBA regional office officials to learn about processes QRTs follow and how these procedures may vary across regional offices. We also reviewed and compared VBA criteria for QRT staff, STAR reviewer, and claims processor certification. We reviewed documents and interviewed VBA officials to learn more about the recent changes to the agency’s approach to assessing consistency. More specifically, we explored the rationale for the change from using inter-rater reliability (IRR) studies to using consistency questionnaires. We assessed the development and implementation of the recent consistency questionnaires by, for example, examining VBA’s consideration of pre-testing the instruments using generally accepted survey procedures, and how pre-testing may affect the resulting measures of consistency. Finally, to further determine how consistency questionnaires are complementary with other quality assurance efforts, we reviewed VBA’s process for determining topics for consistency questionnaires. Specifically, we asked about the methods used to select and prioritize topics, including the extent to which officials use findings from QRTs and STAR. To further determine what and how information is shared among quality assurance components and how this coordination helps to identify problem areas, we interviewed VBA regional office officials to gather their perspectives on how information is shared from STAR, QRT, consistency studies, and regional office compliance visits and how that information- sharing could be improved. We interviewed officials at the regional level to gain their perspectives on coordination and effectiveness of all of VBA’s quality assurance activities. At each office, we spoke with service center managers and quality assurance staff, as well as representatives of local veteran service organizations. The regional offices were selected to reflect a range of characteristics related to: (1) geography (at least one regional office in each of VA’s four areas), (2) number of claims processed annually, (3) claim-based accuracy rates, and (4) issue-based accuracy rates. We did not identify specific quality assurance pilots or initiatives being tested in regional offices. We selected 4 of VBA’s 57 regional offices for review. We visited the Oakland and Newark regional offices and conducted telephone interviews with Nashville and Waco regional office staff. Table 1 provides information about the regional offices we selected to visit. Appendix II: Statistical Sampling Methodology This appendix provides additional technical details on ratio estimation for producing issue-based accuracy rates, as well as the audit work we did to re-estimate the regional office Systematic Technical Accuracy Review (STAR) sample sizes using a formula for stratified random probability samples. Ratio Estimation Because STAR is designed to sample claims and produce an estimate of the claim-based accuracy rate and because the number of medical issues per claim varies, ratio estimation should be used to develop issue-based accuracy rates. Furthermore, during their review of sampled claims, STAR reviewers may find that one or more inferred issues were missed or, conversely, that the review process included one or more issues inappropriately. Thus, the STAR sample of claims must be used to estimate both the total number of issues as well as the number of issues that were processed correctly. With respect to STAR, ratio estimation takes the form shown below. In the formula, the subscript i represents the regional office, the subscript j represents the month of the fiscal year, jin, represents the monthly sample size for regional office i in month j, jiW, represents the stratum sampling weight for regional office i in month j, kjia, number of issues adjudicated correctly on claim k in month j and regional office i and represents the total number of issues on claim k in kjim, month j and regional office i. The ability to calculate a ratio estimate and its associated confidence interval are available in most statistical software applications. Sample Size Re-Estimation Each month the Veterans Benefits Administration (VBA) selects a random sample of benefit claims within each VA regional office to review under the STAR program. The measure of interest is the estimated percent of claims that were processed correctly by VBA regional office staff. The sample size formula used by VBA to derive the number of claims to select in each VBA regional office is shown below. In the formula, Z = the quantile from the Normal distribution for the desired level of confidence. The desired margin of sampling error is denoted by E. The assumed percent of accuracy in the population is denoted by P, and Q is defined as Q = (1 – P). For their calculations, VBA uses the following values:. When these values are plugged into the equation, n = 246. This is VBA’s target annual sample size for each VA regional office. With 57 regional offices, this translates into 14,022 claims selected nationally per fiscal year in the STAR sample. On a monthly basis, when divided by 12, 246/12 = 20.5 which rounds up to 21. Thus, VBA’s monthly sample size for each regional office is 21 claims. By definition, the sample frame for each month is the set of veteran benefit claims completed by the regional office within the previous month. The standard statistical formula for the sample size calculation with a stratified random sample is shown below. We applied this formula to determine an annual total sample size for a regional office in the coming fiscal year using observed monthly accuracy rates and monthly number of claims completed from the previous fiscal year.. In turn, this initial sample size is adjusted with the finite population correction factor. The formula for the adjusted sample size is shown below. Appendix III: Comments from the Department of Veterans Affairs Appendix IV: GAO Contact and Staff Acknowledgments GAO Contact Staff Acknowledgments In addition to the contact named above, Michele Grgich (Assistant Director), Dana Hopings (Analyst-In-Charge), Carl Barden, James Bennett, David Chrisinger, Alexander Galuten, Joel Green, Avani Locke, Vernette Shaw, Almeta Spencer, Walter Vance, and Greg Whitney made key contributions to this report.

Summary: With a backlog of disability compensation claims, VBA faces difficulties in improving the accuracy and consistency of the claim decisions made by staff in its 57 regional offices. To help achieve its goal of 98 percent accuracy by fiscal year 2015, VBA recently implemented a new way of measuring accuracy and changed several quality assurance activities to assess the accuracy and consistency of decisions and to provide feedback and training to claims processors. GAO was asked to examine VBA's quality assurance activities. This report evaluates (1) the extent to which VBA effectively measures and reports the accuracy of its disability compensation claim decisions and (2) whether VBA's other quality assurance activities are coordinated and effective. GAO analyzed VBA claims and STAR accuracy data from fiscal year 2013 (the most recent fiscal year for which complete data are available); reviewed relevant federal laws, VBA guidance, and other documents relevant to quality assurance activities; and interviewed VBA staff from headquarters and four VBA regional offices (selected to achieve variety in geography, workload, and accuracy rates), as well as veteran service organization officials. The Veterans Benefits Administration (VBA)-within the Department of Veterans Affairs-measures and reports the accuracy of its disability compensation claim decisions in two ways: (1) by claim and (2) by disabling condition, though its approach has limitations. When calculating accuracy rates for either measure through its Systematic Technical Accuracy Review (STAR), VBA does not always follow generally accepted statistical practices, resulting in imprecise performance information. For example, VBA does not adjust its accuracy estimates to reflect that it samples the same number of claims for review from each regional office-despite their varying workloads-and thus produces imprecise estimates of national and regional accuracy. Further, VBA reviews about 39 percent (over 5,000) more claims nationwide than is necessary to achieve its desired precision in reported accuracy rates, thereby diverting limited resources from other important quality assurance activities, such as targeted reviews of error-prone cases. In addition to issues with its statistical practices, VBA's process for selecting claims for STAR review creates an underrepresentation of claims that are moved between regional offices, which may inflate accuracy estimates because these claims have had historically lower accuracy rates. Finally, VBA has not clearly explained in public reports the differences in how its two accuracy measures are calculated or their associated limitations, as suggested by best practices for federal performance reporting. VBA has taken steps to enhance and coordinate its other quality assurance activities, but GAO found shortcomings in how VBA is implementing and evaluating these activities. To improve local accuracy, VBA created regional office quality review teams (QRTs) with staff dedicated primarily to performing local accuracy reviews. QRTs assess individual claims processor performance and conduct special reviews to forestall certain types of errors. In addition, VBA began using questionnaires for assessing decision-making consistency, which are more efficient to administer than VBA's prior approach to conducting consistency studies. VBA also coordinates quality assurance efforts by disseminating national accuracy and consistency results, trends, and related guidance to regional offices for use in training claims processors. Further, VBA uses STAR results to inform other quality assurance activities, such as focusing certain QRT reviews on commonly made errors. However, GAO identified implementation shortcomings that may detract from the effectiveness of VBA's quality assurance activities. For example, contrary to accepted practices for ensuring the clarity and validity of questionnaires, VBA did not pre-test its consistency questionnaires to ensure the clarity of questions or validity of the expected results, although VBA officials indicated that they plan to do so for future questionnaires. In contrast with federal internal control standards that call for capturing and distributing information in a form that allows people to efficiently perform their duties, staff in the four regional offices that we visited had trouble finding the guidance they needed to do their work, which could affect the accuracy as well as the speed with which staff decide claims. Federal standards also call for knowing the value of efforts such as quality assurance activities and monitoring their performance over time; however, VBA has not evaluated the effect of its special QRT reviews or certain consistency studies on improving targeted accuracy rates, and lacks clear plans to do so.

gov_report

en

Write a title and summarize: SECTION 1. SHORT TITLE. This Act may be cited as the ``Dot Kids Implementation and Efficiency Act of 2002''. SEC. 2. FINDINGS AND PURPOSES. (a) Findings.--The Congress finds that-- (1) the World Wide Web presents a stimulating and entertaining opportunity for children to learn, grow, and develop educationally and intellectually; (2) Internet technology also makes available an extensive amount of information that is harmful to children, as studies indicate that a significant portion of all material available on the Internet is related to pornography; (3) young children, when trying to use the World Wide Web for positive purposes, are often presented--either mistakenly or intentionally--with material that is inappropriate for their age, which can be extremely frustrating for children, parents, and educators; (4) exposure of children to material that is inappropriate for them, including pornography, can distort the education and development of the Nation's youth and represents a serious harm to American families that can lead to a host of other problems for children, including inappropriate use of chat rooms, physical molestation, harassment, and legal and financial difficulties; (5) young boys and girls, older teens, troubled youth, frequent Internet users, chat room participants, online risk takers, and those who communicate online with strangers are at greater risk for receiving unwanted sexual solicitation on the Internet; (6) studies have shown that 19 percent of youth (ages 10 to 17) who used the Internet regularly were the targets of unwanted sexual solicitation, but less than 10 percent of the solicitations were reported to the police; (7) children who come across illegal content should report it to the congressionally authorized CyberTipline, an online mechanism developed by the National Center for Missing and Exploited Children, for citizens to report sexual crimes against children; (8) the CyberTipline has received more than 64,400 reports, including reports of child pornography, online enticement for sexual acts, child molestation (outside the family), and child prostitution; (9) although the computer software and hardware industries, and other related industries, have developed innovative ways to help parents and educators restrict material that is harmful to minors through parental control protections and self- regulation, to date such efforts have not provided a national solution to the problem of minors accessing harmful material on the World Wide Web; (10) the creation of a ``green-light'' area within the United States country code Internet domain, that will contain only content that is appropriate for children under the age of 13, is analogous to the creation of a children's section within a library and will promote the positive experiences of children and families in the United States; and (11) while custody, care, and nurture of the child reside first with the parent, the protection of the physical and psychological well-being of minors by shielding them from material that is harmful to them is a compelling governmental interest. (b) Purposes.--The purposes of this Act are-- (1) to facilitate the creation of a second-level domain within the United States country code Internet domain for the location of material that is suitable for minors and not harmful to minors; and (2) to ensure that the National Telecommunications and Information Administration oversees the creation of such a second-level domain and ensures the effective and efficient establishment and operation of the new domain. SEC. 3. NTIA AUTHORITY. Section 103(b)(3) of the National Telecommunications and Information Administration Organization Act (47 U.S.C. 902(b)(3)) is amended-- (1) in subparagraph (A), by striking ``and'' at the end; (2) in subparagraph (B), by striking the period at the end and inserting ``; and''; and (3) by adding at the end the following new subparagraph: ``(C) shall assign to the NTIA responsibility for providing for the establishment, and overseeing operation, of a second-level Internet domain within the United States country code domain in accordance with section 157.''. SEC. 4. CHILD-FRIENDLY SECOND-LEVEL INTERNET DOMAIN. The National Telecommunications and Information Administration Organization Act (47 U.S.C. 901 et seq.) is amended in part C by adding at the end the following new section: ``SEC. 157. CHILD-FRIENDLY SECOND-LEVEL INTERNET DOMAIN. ``(a) Responsibilities.--The NTIA shall require the registry selected to operate and maintain the United States country code Internet domain to establish, operate, and maintain a second-level domain within the United States country code domain that provides access only to material that is suitable for minors and not harmful to minors (in this section referred to as the `new domain'). ``(b) Conditions of Contract Renewal.--The NTIA may not renew any contract to operate and maintain the domain with the initial registry, or enter into or renew any such contract with any successor registry, unless such registry enters into an agreement with the NTIA, during the 90-day period beginning upon the date of the enactment of the Dot Kids Implementation and Efficiency Act of 2002 in the case of the initial registry or during the 90-day period after selection in the case of any successor registry, as applicable, which provides for the registry to carry out, and the new domain operates pursuant to, the following requirements: ``(1) Written content standards for the new domain, except that the NTIA shall not have any authority to establish such standards. ``(2) Written agreements with each registrar for the new domain that require that use of the new domain is in accordance with the standards and requirements of the registry. ``(3) Written agreements with registrars, which shall require registrars to enter into written agreements with registrants, to use the new domain in accordance with the standards and requirements of the registry. ``(4) Rules and procedures for enforcement and oversight that minimize the possibility that the new domain provides access to content that is not in accordance with the standards and requirements of the registry. ``(5) A process for removing from the new domain any content that is not in accordance with the standards and requirements of the registry. ``(6) A process to provide registrants to the new domain with an opportunity for a prompt, expeditious, and impartial dispute resolution process regarding any material of the registrant excluded from the new domain. ``(7) Continuous and uninterrupted service for the new domain during any transition to a new registry selected to operate and maintain new domain or the United States country code domain. ``(8) Procedures and mechanisms to promote the accuracy of contact information submitted by registrants and retained by registrars in the new domain. ``(9) Operationality of the new domain not later than one year after the date of the enactment of the Dot Kids Implementation and Efficiency Act of 2002. ``(10) Written agreements with registrars, which shall require registrars to enter into written agreements with registrants, to prohibit two-way and multiuser interactive services in the new domain, unless the registrant certifies to the registrar that such service will be offered in compliance with the content standards established pursuant to paragraph (1) and is specifically constructed and operated to protect minors from harm. ``(11) Written agreements with registrars, which shall require registrars to enter into written agreements with registrants, to prohibit hyperlinks in the new domain that take new domain users outside of the new domain. ``(12) Any other action that the NTIA considers necessary to establish, operate, or maintain the new domain in accordance with the purposes of this section. ``(c) Treatment of Registry and Other Entities.-- ``(1) In general.--Only to the extent that such entities carry out functions under this section, the following entities are deemed to be interactive computer services for purposes of section 230(c) of the Communications Act of 1934 (47 U.S.C. 230(c)): ``(A) The registry that operates and maintains the new domain. ``(B) Any entity that contracts with such registry to carry out functions to ensure that content accessed through the new domain complies with the limitations applicable to the new domain. ``(C) Any registrar for the registry of the new domain that is operating in compliance with its agreement with the registry. ``(2) Savings provision.--Nothing in paragraph (1) shall be construed to affect the applicability of any other provision of title II of the Communications Act of 1934 to the entities covered by subparagraph (A), (B), or (C) of paragraph (1). ``(d) Education.--The NTIA shall carry out a program to publicize the availability of the new domain and to educate the parents of minors regarding the process for utilizing the new domain in combination and coordination with hardware and software technologies that provide for filtering or blocking. The program under this subsection shall be commenced not later than 30 days after the date that the new domain first becomes operational and accessible by the public. ``(e) Coordination With Federal Government.--The registry selected to operate and maintain the new domain shall-- ``(1) consult with appropriate agencies of the Federal Government regarding procedures and actions to prevent minors and families who use the new domain from being targeted by adults and other children for predatory behavior, exploitation, or illegal actions; and ``(2) based upon the consultations conducted pursuant to paragraph (1), establish such procedures and take such actions as the registry may deem necessary to prevent such targeting. The consultations, procedures, and actions required under this subsection shall be commenced not later than 30 days after the date that the new domain first becomes operational and accessible by the public. ``(f) Compliance Report.--The registry shall prepare, on an annual basis, a report on the registry's monitoring and enforcement procedures for the new domain. The registry shall submit each such report, setting forth the results of the review of its monitoring and enforcement procedures for the new domain, to the Committee on Energy and Commerce of the House of Representatives and the Committee on Commerce, Science, and Transportation of the Senate. ``(g) Selection of Contractor.-- ``(1) Withdrawal of registry.-- ``(A) Election by registry.--Upon a good faith showing by the registry of the new domain to the NTIA of extreme financial hardship in the operation of the new domain occurring any time after the date of the enactment of the Dot Kids Implementation and Efficiency Act of 2002, the registry may elect to relinquish the right to operate and maintain the new domain. Notwithstanding the time of occurrence of such extreme financial hardship or the time of such election, the registry may not relinquish such right before the expiration of the 3-year period beginning upon such date of enactment. ``(B) Selection of new contractor.--If the registry elects to relinquish such right pursuant to subparagraph (A), the NTIA shall select a contractor to operate and maintain the new domain under the competitive bidding process established pursuant to paragraph (2). ``(C) Extreme financial hardship.--For purposes of this paragraph, the term `extreme financial hardship' means that each quarter, for a period of 6 or more consecutive quarters, the costs of establishing, operating, and maintaining the new domain exceed the revenues generated from registrants by more than 25 percent. ``(2) Competitive bid selection process.--The NTIA shall establish a process for soliciting applications and selecting a contractor to operate and maintain the new domain pursuant to this subsection), which process shall comply with the following requirements: ``(A) Timing.--The selection process shall commence and complete not later than (i) 120 days after the registry elects to relinquish the new domain for extreme financial hardship, or (ii) the expiration of a contract referred to in paragraph (4), as applicable. ``(B) Notice.--The selection process shall provide adequate notice to prospective applicants of-- ``(i) the opportunity to submit such an application; and ``(ii) the criteria for selection under subparagraph (C). ``(C) Criteria.--The selection shall be made pursuant to written, objective criteria designed to ensure-- ``(i) that the new domain is operated and maintained in accordance with the requirements under subsection (b); and ``(ii) that the contractor selected to operate and maintain the new domain is the applicant most capable and qualified to do so. ``(D) Review.--Not more than 60 days after the conclusion of the period established for submission of applications, the NTIA shall-- ``(i) review and apply the selection criteria established under subparagraph (C) to each application submitted; and ``(ii) based upon such criteria and subject to submission of an application meeting such criteria, select an application and award to the applicant a subcontract for the operation and maintenance of the new domain. ``(E) Failure to find contractor.--If the NTIA fails to find a suitable contractor pursuant to the process under this paragraph, the NTIA shall permit the registry to cease operation of the new domain. ``(3) Rights and duties.--A contractor selected pursuant to this subsection shall have all of the rights and duties of the registry specified under this section, except that such duties shall not include the technical maintenance of the new domain. ``(4) Conditions of contract renewal.--In the case of the expiration of a contract for operation and maintenance of the new domain with a contractor selected pursuant to paragraph (2), the NTIA may renew such contract or, subject to paragraph (2), rebid the contract to a new contractor. Nothing in this section shall be construed to prevent the registry of the United States country code Internet domain from bidding to become the contractor of the new domain. ``(h) Suspension of New Domain.--If the NTIA finds, pursuant to its own review or upon a good faith petition by the registry, that the new domain is not serving its intended purpose, the NTIA shall instruct the registry to suspend operation of the new domain until such time as the NTIA determines that the new domain can be operated as intended. ``(i) Definitions.--For purposes of this section, the following definitions shall apply: ``(1) Harmful to minors.--The term `harmful to minors' means, with respect to material, that-- ``(A) the average person, applying contemporary community standards, would find, taking the material as a whole and with respect to minors, that it is designed to appeal to, or is designed to pander to, the prurient interest; ``(B) the material depicts, describes, or represents, in a manner patently offensive with respect to minors, an actual or simulated sexual act or sexual contact, an actual or simulated normal or perverted sexual act, or a lewd exhibition of the genitals or post-pubescent female breast; and ``(C) taken as a whole, the material lacks serious, literary, artistic, political, or scientific value for minors. ``(2) Minor.--The term `minor' means any person under 13 years of age. ``(3) Registry.--The term `registry' means the registry selected to operate and maintain the United States country code Internet domain ``(4) Suitable for minors.--The term `suitable for minors' means, with respect to material, that it-- ``(A) is not psychologically or intellectually inappropriate for minors; and ``(B) serves-- ``(i) the educational, informational, intellectual, or cognitive needs of minors; or ``(ii) the social, emotional, or entertainment needs of minors.''.

Title: A bill to facilitate the creation of a new, second-level Internet domain within the United States country code domain that will be a haven for material that promotes positive experiences for children and families using the Internet, provides a safe online environment for children, and helps to prevent children from being exposed to harmful material on the Internet, and for other purposes Summary: Dot Kids Implementation and Efficiency Act of 2002 - Amends the National Telecommunications and Information Administration Organization Act to direct the Secretary of Commerce to assign to the National Telecommunications and Information Administration (NTIA) responsibility for providing for the establishment, and overseeing operation, of a second-level Internet domain within the U.S. country code domain that provides access only to materials suitable for, and not harmful to, minors. Directs NTIA to require the same registry selected to operate and maintain the U.S. country code Internet domain to establish, operate, and maintain such second-level domain. Prohibits NTIA from renewing any contract to operate and maintain the domain with the initial registry, or to enter into or renew a contract with a successor registry, unless such registry enters into an agreement with NTIA which requires the registry to carry out, and the new domain to operate under, specified requirements.Requires NTIA to publicize the availability of the new domain and to educate parents of minors regarding the process for utilizing such domain in coordination with filtering or blocking technologies.Allows a registry, upon a showing of extreme financial hardship, to relinquish the right to operate and maintain the new domain and requires NTIA to then select, under a competitive bidding process, a contractor to operate and maintain such domain. Prohibits the registry from relinquishing such right before the end of the three-year period following the enactment of this Act.Authorizes NTIA to suspend from new domain operation a registry found not to be serving its intended purpose.

billsum

en

Write a title and summarize: SECTION 1. SHORT TITLE. This Act may be cited as the ``Victims' Rights Constitutional Amendment Implementation Act of 1997''. SEC. 2. CRIME VICTIM RIGHTS. (a) In General.--Except as provided in section 3, each victim of a Federal felony offense or any other Federal crime of violence (as defined in section 16 of title 18, United States Code) shall have the following rights: (1) To notice of, and not to be excluded from, all public proceedings relating to the offense. (2) To be heard, if present, and to submit a written statement at all public proceedings, relating to the offense, to determine a release from custody, an acceptance of a negotiated plea, or a sentence. (3) To the rights described in the preceding portion of this section at a parole proceeding that is not public, to the extent those rights are afforded to the convicted offender. (4) To notice of any release or escape from custody relating to the offense. (5) To seek relief from an unreasonable delay of the final disposition of the proceedings relating to the offense. (6) To an order of restitution from the convicted offender pursuant to law. (7) To consideration for the safety of the victim in determining any release from custody. (8) To notice of the rights established by this section. (9) The right to be treated with fairness and with respect for the victim's dignity and privacy. (10) The right to confer with the attorney for the Government in the case. (b) Affected Proceedings.--The rights established by this section shall apply in-- (1) Federal criminal proceedings (other than military criminal proceedings), including juvenile justice proceedings; (2) collateral proceedings such as habeas corpus; and (3) similar proceedings in the courts of any district or territory of the United States not within a State. (c) Remedies.-- (1) Standing.--The victim shall have standing in the proceeding to assert the rights established by this section. (2) Disciplinary proceedings.--A knowing violation of a right provided in subsection (a) shall be grounds for disciplinary proceedings by the appropriate Federal governmental and professional disciplinary authorities. (3) Contempt.--A knowing violation of a right provided in subsection (a) may be treated by the court having jurisdiction as a contempt of court. (4) Judicial remedies.--This section does not create a cause of action or defense in favor of any person arising out of the failure to accord to a victim a right provided in subsection (a), and nothing in this section-- (A) provides grounds for the victim to overturn a charging decision, a conviction, or a sentence; to obtain a stay of trial; or to compel a new trial; or (B) provides grounds for the accused or convicted offender to obtain any form of relief. SEC. 3. EXCEPTIONS AND LIMITATIONS. (a) Exceptions.--The rights provided under section 2 do not apply-- (1) to informing victims about the release of an alleged or convicted offender-- (A) to go under cover to gather evidence on behalf of law enforcement authorities; or (B) to participate in a witness protection program; (2) to the extent that the court-- (A) determines with respect to a right that the number of victims is so great as unreasonably to delay the proceedings if that right were accorded to each of them; and (B) takes reasonable measures to allow that right to be exercised by representative victims; or (3) if the responsible official determines the victim is a suspect in the case. (b) Limitations.-- (1) Right to notice; when violated.--The rights to notice under this Act are not violated if the proper authorities make a reasonable effort, but are unable to provide the notice, or if the failure of the victim to make a reasonable effort to make those authorities aware of the victim's whereabouts prevents that notice. (2) Right to counsel for victims.--This Act does not create any right to counsel at public expense for any victim. (3) Rights of victims of uncharged offenses.--The decision to charge a defendant with an offense shall not be construed to make the rights under section 2(a) apply to a victim of any related, but uncharged, offense. SEC. 4. RESPONSIBILITY FOR IMPLEMENTATION. (a) Designation of Responsible Officials.--The courts, and the head of each department and agency of the United States engaged in the detection, investigation, prosecution, or adjudication of crimes to which this Act applies, shall designate by names and office titles the persons who will be responsible for identifying the victims of crime, assuring the implementation of the rights provided in section 2, and performing the services described in subsection (c), at each stage of a criminal case. (b) Identification of Victims.--At the earliest opportunity after the detection of a crime at which it may be done without interfering with an investigation, a responsible official shall-- (1) identify the victim or victims of a crime; (2) inform the victims of their right to receive, on request, the services described in subsection (c); and (3) inform each victim of the name, title, and business address and telephone number of the responsible official to whom the victim should address a request for each of the services described in subsection (c). (c) Description of Services.--(1) A responsible official shall-- (A) inform a victim of the place where the victim may receive emergency medical and social services; (B) inform a victim of any restitution or other relief to which the victim may be entitled under this or any other law and manner in which such relief may be obtained; (C) inform a victim of public and private programs that are available to provide counseling, treatment, and other support to the victim; and (D) assist a victim in contacting the persons who are responsible for providing the services and relief described in subparagraphs (A), (B), and (C). (2) A responsible official shall arrange for a victim to receive reasonable protection from a suspected offender and persons acting in concert with or at the behest of the suspected offender. (3) During the investigation and prosecution of a crime, a responsible official shall provide a victim the earliest possible notice of-- (A) the status of the investigation of the crime, to the extent it is appropriate to inform the victim and to the extent that it will not interfere with the investigation; (B) the arrest of a suspected offender; (C) the filing of charges against a suspected offender; (D) the scheduling of each court proceeding that the victim is either required to attend or, under section 2, is entitled to attend; (E) the release or detention status of an offender or suspected offender; (F) the acceptance of a plea of guilty or nolo contendere or the rendering of a verdict after trial; and (G) the sentence imposed on an offender, including the date on which the offender will be eligible for parole. (4) During court proceedings, a responsible official shall ensure that a victim is provided a waiting area removed from and out of the sight and hearing of the defendant and defense witnesses. (5) After trial, a responsible official shall provide a victim the earliest possible notice of-- (A) the scheduling of a parole hearing for the offender; (B) the escape, work release, furlough, or any other form of release from custody of the offender; and (C) the death of the offender, if the offender dies while in custody. (6) At all times, a responsible official shall ensure that any property of a victim that is being held for evidentiary purposes be maintained in good condition and returned to the victim as soon as it is no longer needed for evidentiary purposes. (7) The Attorney General or the head of another department or agency that conducts an investigation of a sexual assault shall pay, either directly or by reimbursement of payment by the victim, the cost of a physical examination of the victim which an investigating officer determines was necessary or useful for evidentiary purposes. (8) A responsible official shall provide the victim with general information regarding the corrections process, including information about work release, furlough, probation, and eligibility for each. (d) Remedies.-- (1) Disciplinary proceedings.--A pattern and practice of knowing failures to provide the service described in subsection (c) shall be grounds for disciplinary proceedings by the appropriate Federal governmental and professional disciplinary authorities. (2) No cause of action or defense.--This section does not create a cause of action or defense in favor of any person arising out of the failure of a responsible person to provide information as required by subsection (b) or (c). SEC. 5. DEFINITIONS. For the purposes of this Act-- (1) the term ``responsible official'' means a person designated pursuant to section 4(a) to perform the functions of a responsible official under that section; and (2) the term ``victim'' means a person (but not including any governmental entity) that has suffered direct physical, emotional, or pecuniary harm as a result of the commission of a crime, including-- (A) in the case of a victim that is an institutional entity, an authorized representative of the entity; and (B) in the case of a victim who is under 18 years of age, incompetent, incapacitated, or deceased, one of the following (in order of preference): (i) A spouse. (ii) A legal guardian. (iii) A parent. (iv) A child. (v) A sibling. (vi) Another family member. (vii) Another person designated by the court. SEC. 6. CONFORMING REPEAL. Sections 502 and 503 of the Crime Control Act of 1990 (42 U.S.C. 10606 and 10607) are repealed.

Title: Victims' Rights Constitutional Amendment Implementation Act of 1997 Summary: Victims' Rights Constitutional Amendment Implementation Act of 1997 - Grants each victim of a Federal felony offense or any other Federal crime of violence the right: (1) to notice of, and not to be excluded from, all public proceedings relating to the offense; (2) to be heard, if present, and to submit a written statement at all public proceedings relating to the offense (and non-public parole proceedings to the extent the convicted offender is afforded such rights) to determine a release from custody, an acceptance of a negotiated plea, or a sentence; (3) to notice of any release or escape from custody relating to the offense; (4) to seek relief from an unreasonable delay of the final disposition of the proceedings relating to the offense; (5) to an order of restitution from the convicted offender pursuant to law; (6) to consideration for the safety of the victim in determining any release from custody; (7) to notice of such rights; (8) to be treated with fairness and respect for the victim's dignity and privacy; and (9) to confer with the attorney for the Government. Makes such rights applicable in: (1) Federal (other than military) criminal proceedings, including juvenile justice proceedings; (2) collateral proceedings such as habeas corpus; and (3) similar proceedings in the courts of any district or territory of the United States not within a State. Grants the victim standing in the proceeding to assert the rights established by this Act. Sets forth: (1) remedies for violations; and (2) exceptions and limitations to such rights. (Sec. 4) Directs the courts, and the head of each U.S. department and agency engaged in the detection, investigation, prosecution, or adjudication of crimes to which this Act applies, to designate the persons who will be responsible for identifying the victims, assuring the implementation of the rights provided in this Act, and performing specified services, at each stage of a criminal case. Requires a responsible official, at the earliest opportunity after the detection of a crime at which it may be done without interfering with an investigation, to identify the victims, inform the victims of their right to receive such services upon request, and inform each victim of the responsible official to whom the victim should address such request. Directs such official to: (1) inform a victim regarding emergency medical and social services, restitution or other relief to which the victim may be entitled, and counseling, treatment, and other support programs; (2) arrange for a victim to receive reasonable protection; (3) provide notices of specified steps or events during the investigation and prosecution of a crime and after trial; and (4) provide the victim with general information regarding the corrections process. Sets forth: (1) provisions regarding protecting the property of a victim being held, and payment or reimbursement of the cost of a physical examination of the victim, for evidentiary purposes; and (2) remedies for violations of this Act.

billsum

en

Summarize: This application is a continuation, of application Ser. No. 278,444, filed 6/29/81, now abandoned. BACKGROUND OF THE INVENTION The present invention relates to an elastic ring applicator for ligating anatomical elements, and more specifically relates to such an instrument which further includes a highly sensitive signaling means for alerting the surgeon when the applicator is about to deposit the elastic ring. The applicator preferably also includes means for intraabdominally anesthetizing an anatomical element and for internally viewing the ligation procedure. Although this instrument is particularly useful for performing female sterilization procedures involving the Fallopian tubes, it may be applied to the vas deferens in the human male, and to other anatomical structures. Tubal ligation instruments have found world wide acceptance for a wide variety of purposes, but in particular have been used for sterilization. In the U.S. Pat. No. 3,834,392, granted to Lampman et al on Sep. 10, 1974, a laparoscope system is disclosed whereby a single unit contains the power source to provide illumination, oscillatory electrical power and CO 2 gas for laparoscopy. CO 2 gas under pressure is passed into the body through a needle. A trocar and cannula are inserted into the gas-filled abdominal cavity. A laparoscope connected to a source of illumination is inserted into the body cavity through the cannula. The Fallopian tubes are then identified and forceps are inserted through the cannula into the body cavity. The forceps are manipulated to successively close the passage through each Fallopian tube either by means of sending electrical oscillations through the forceps to simultaneously cut, seal and cauterize each tube in turn, or by means of a special type of clamp which clamps the passage shut. U.S. Pat. No. 4,230,116 to Watson, granted Oct. 28, 1980, shows a tubal ligation instrument with anesthesia means for ligating anatomical elements such as Fallopian tubes. The utilization of anesthesia capabilities in such an instrument is advantageous since the areas being ligated are otherwise subjected to minor discomfort. Like other tubal ligation instruments the Watson device discloses the use of an inner tube and an outer tube together with a biasing means, typically a helical compression spring, to warn the surgeon of the impending discharge of the elastic ring. Such a spring, however, is not helpful during the loading of elastic rings, particularly when spring resistance is counted upon to provide the necessary resistance for ring loading onto the inner tube. Watson discloses that elastic rings are loaded onto the distal end of an inner tube by forcing them with a conical ring dilator. The inner tube is caused to protrude from the outer tube, a distance equal to the width(s) of the ring(s) placed on the inner tube. However, only the force of the spring causes the inner tube to protrude beyond the outer tube. Thus, after extended use of the instrument the spring sometimes weakens to such an extent that it becomes difficult or impossible to load rings onto the inner tube. Further, the spring plays an important role in the surgeon&#39;s use of the Watson device. Upon intraabdominal insertion of the instrument, the surgeon retracts the slidable gripping means to a position of encountering the resistance of the helical spring. In this way, the surgeon is able to feel when the instrument is in proper orientation for applying anesthesia. Furthermore, the surgeon, upon encountering the resistance due to the spring, is informed by the yieldable resistance that he encounters that the elastic ring is about to be ejected from the inner tube. However, after the spring has become weakened after extended use it is capable of giving a false resistance feel which could even result in the surgeon&#39;s premature ejection of a ring. Thirdly, the spring, with its helical shape and many crevices, presents a cleaning problem. Another cleaning problem encountered in the Watson device concerns the slots and the closed end of the inner tube member. These slots can also become caked with dried blood, etc., hindering use of the instrument. The end can also become caked with blood, etc., resulting in premature release of the ring on subsequent operations. A further problem with the Watson device concerns the size of the incision necessary to insert the instrument. The diameter of the outer housing tube in the Watson device is approximately one-half inch. Thus, a rather large trocar has been necessary to perform the ligation procedure. This sometimes causes serious psychological problems for the patient undergoing the ligation operation. The trauma to the patient is greater due to the incision diameter. There is also a greater chance of herniation due to the larger incision. A further problem with the Watson device concerns the rotation of the device within the cannula. It is advantageous to rotate the device within the cannula to grasp the anatomical element at the proper location. If the device is tightly held by the cannula valve, both the device and the cannula must rotate to grasp the anatomical element in the proper location. If the incision is made as small as possible to prevent gas leakage, it becomes difficult to rotate the cannula in the incision. If the incision is enlarged to permit rotation of the cannula, there may be leakage of gas from the cavity. The alternative method of rotation, holding the cannula while the device is rotated, requires an additional pair of hands which makes use of the instrument more difficult and may result in contamination of the sterile field. A further problem with the Watson device is the disassembly and assembly of the device during maintenance and cleaning. In order to disassemble the device, two steps must be performed; removal of the pin and unscrewing the inner tube. In order to assemble the device, five elements must be aligned; the hole in the inner member, the inner tube slot, the outer tube slot, the hole in the slidable finger grip and the pin. OBJECTS OF THE INVENTION It is an important object of the present invention to provide a tubal ligation instrument capable of having a smaller diameter than the instrument disclosed by Watson, thereby enabling the surgeon to use a smaller incision and a smaller trocar. Another important object of the present invention is to enable the elimination of both the springs and the slots shown in the Watson device, thereby providing easier cleaning of the instrument, easier assembly and disassembly, easier loading and more predictable use of the instrument over an extended period of time. It is a further object of the present invention to provide such a tubal ligation instrument which can also be used in conjunction with a number of other surgical procedures such as internal optical viewing of the operation, intraabdominal application of anesthesia to the element to be ligated, and electrosurgery. It is a further object of the present invention to provide a ring application instrument in which two anatomical tubes are to be ligated in one surgical procedure by the application of two elastic rings, whereby only one elastic ring may be ejected at one time. It is a further object of the present invention to provide a ring application instrument in which the elongated inner member rotates within the outer tube housing allowing the physician to easily grasp the anatomical element without rotating the cannula. SUMMARY OF THE INVENTION A ring application instrument in accordance with this invention includes an elongated inner member having an anatomical grasping means such as forceps at its forward end, said inner member grasping means being slidable in an inner tube which is a support means for one or more elastic rings. An outer tube is provided within which the inner tube fits in a freely slidable and rotatable manner. A manually engagable locking means enables the surgeon selectively to lock the inner tube, relative to the outer tube, in a position to accept loading of one or more elastic rings. In the form of the invention providing for the successive ejection of two or more rings, a manually engagable stop means is provided which is operative between the inner and outer tubes to prevent ejection of a second elastic ring after ejection of a first elastic ring. The elongated inner member may, if desired, be of hollow construction to hold either an optical device for viewing the surgical procedure or for carrying anesthesia to the element to be ligated. The elongated inner member may be further adapted to be used in conjunction with an electrosurgical device. BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a side elevation of a ring applicator comprising one specific embodiment of the present invention. FIG. 2 is an exploded view of the ring applicator of FIG. 1. FIGS. 3A, 3B and 3C are side views of the forward end of the ring applicator of FIGS. 1 and 2, illustrating a preferred procedure for loading the elastic rings. FIG. 4A is a side view of a fully loaded ring applicator with fully extended grasping means ready to grasp an anatomical element. FIG. 4B is an enlarged, fragmentary cross-sectional view of the forward end of the ring applicator shown in FIG. 4A. FIG. 5 is a side view of the ring applicator of FIG. 4A after it has grasped the anatomical element and is drawing it into the inner applicator tube. FIGS. 6A, 6B and 7 are cross-sectional and side views illustrating the operation of one form of ring applicator device in accordance with the present invention. FIG. 8 is a side view of the ring applicator, with certain portions cut away and shown in cross section in order to reveal important details. FIG. 9 is a perspective view of the ring applicator in a locked position. FIGS. 10, 11A and 11B are side (enlarged), and cross-sectional views, respectively, of a ring applicator utilizing an optic viewing system with a fiber optic illumination system in accordance with this invention. FIG. 12 is a cross-sectional view of a modified form of applicator, showing an apparatus for performing electrosurgery in accordance with the present invention. Although specific forms of apparatus embodying the invention have been selected for illustration in the drawings, and although specific terminology will be resorted to in describing those forms in the specification which follows, their use is not intended to define or to limit the scope of the invention, which is defined in the appended claims. DESCRIPTION OF THE PREFERRED EMBODIMENTS Referring to the drawings, the ring applicator device of the present invention is designated as 10. Furthermore, with respect to the ring applicator 10 and/or any individual part thereof, the side or end closest to the patient shall be designated forward, and the side or end closest to the surgeon shall be designated rearward. The ring applicator 10 consists of an outer tube 11 housing an inner tube 12. The diameters of tubes 11 and 12 are such that inner tube 12 has a close sliding fit within outer tube 11. Inner tube 12 houses an inner rod 13 having spring-like forceps 21 at its forward end. Attached to the rearward end of inner tube 12 is flange plate 30 having an additional hole 34. Inner rod 13 is adapted to fit into inner tube 12 by pressing the forceps 21 together and inserting them through the rearward end of inner tube 12. Similarly the inner tube 12 fits within outer tube 11 by sliding the forward end of inner tube 12 into the rearward end of outer tube 11. Ring applicator 10 also includes a pistol grip handle adapted to fit in the surgeon&#39;s hand. The pistol grip handle includes a slidable (with respect to the outer tube 11) forward handle 14 and a stationary rearward handle 15. Rearward handle 15 engages rods 19 and 20 which are fixedly attached to forward handle 14. Thus, rearward handle 15 engages rod 20 in cylindrical passageway 26, and engages rod 19 in cylindrical passageway 35. The axes of rods 19 and 20 and passageways 26 and 35 are parallel so that rods 19 and 20 easily slide in rearward handle 15. Forward handle 14 and rearward handle 15 engage outer tube 11 through cylindrical passageways 24 and 25 respectively. Thus, outer tube 11, containing inner tube 12 and inner rod 13, is fed forward end first through cylindrical passageway 25 and then through cylindrical passageway 24. Flange plate 30, attached to inner tube 12, must be aligned so that hole 34 engages rod 20 attached to forward handle 14. Thus, inner tube 12 is freely slidable over that portion of rod 20 rearward of lip 37. Outer tube 11 is fixedly attached to rearward handle 15 by rings 36. Screw 32 attaches to the rearward end of rod 20, having a threaded bore 70, to accept screw 32 as shown clearly in FIG. 8. Similarly, valve 33 which is adapted to screw into the rearward end of inner rod 13 attaches inner rod 13 to flange plate 31. Thus, by threading screw 32 into the end of fixed rod 20, the inner rod 13 is fixedly attached to forward handle 14. From the above discussion it can be seen that inner rod 13 having forceps 21 at its forward end and flange plate 31 attached to its rearward end is fixedly attached to forward handle 14. Similarly, outer tube 11 is fixedly attached to rearward handle 15. Since forward handle 14 is adapted slidably to engage rearward handle 15, the act of sliding the forward handle 14 rearwardly causes the forceps 21 to be drawn into the outer tube 11. Similarly, by sliding forward handle 14 forwardly, forceps 21 are caused to extend out of the forward end of outer tube 11. The limits of the relative slidable positions of outer tube 11 and inner tube 12 are very important for purposes of ejection of elastic rings. Inner rod 13, fixedly attached to forward handle 14, by necessity has a slidable range equal to the slidable range of forward handle 14. Forward handle 14 can be slid in a rearward direction until the forward face of rearward handle 15 abuts forward handle 14 as shown in FIG. 7. Forward handle 14 also has a forward slidable limit at the point where the forward face of flange plate 31 abuts the rearward face of flange plate 30 which in turn abuts the rearward face of rearward handle 15, as shown in FIG. 4A. Similarly, inner tube 12 has a forward and rearward slidable limit. Assuming that forward handle 14 is in its most rearward slidable position, the forward slidable limit of inner tube 12 occurs when flange plate 30 encounters lip 37 of rod 20, as shown in FIG. 7. Thus, when both forward handle 14 (and thus inner rod 13) are both in their most rearward slidable positions, the forward ends of outer tube 11 and inner tube 12 are flush. As can be seen from FIG. 7, when forward handle 14 (and thus inner rod 13) are in their most rearward slidable positions, a space exists between the rearward face of rearward handle 15 and the forward face of flange plate 30. The distance separating handle 15 and flange plate 30 is approximately equal to the width of two elastic rings. This is very important in conjunction with the ring ejection procedure. By keeping inner tube 12 and flange plate 30 abutted to rearward handle 15, forward handle 14 may be slid forwardly until flange plate 31 abuts flange plate 30. At this point, the forward end of inner tube 12 protrudes beyond the forward end of outer tube 11 a distance approximately equal to the width of two rings and the forceps 21 protrude beyond inner tube 12. With flange plate 30 abutted to rearward handle 15, forward handle 14 may be slid rearwardly until lip 37 of rod 20 encounters flange plate 30. With further rearward movement of forward handle 14, inner tube 12 will slide rearwardly in relation to outer tube 11. This slidable span will result in ring ejection. Forward handle 14 and rearward handle 15 are shown in the drawings as having a shape substantially like a pistol grip. However, the rotatable ring 16 is adapted for engagement by the surgeon&#39;s thumb. The ring 16 is rotatable on rearward handle 15 and attached thereto by a screw 38. The screw 38 is unthreaded in the rearward handle 15 and is only screwed into the ring 16; thus it is rotatable. The rotatable ring 16 provides a comfortable means of grasping the ring applicator 10, whether the surgeon be left or right-handed. Since the ring 16 is rotatable, it can move about to fit comfortably on either a right-hand or left-hand thumb. While forward handle 14, rearward handle 15 and rotatable ring 16 are shown as being in a pistol-grip shape, it should, nevertheless, be appreciated that the handles can have other conventional shapes. For example, the ring 16 can be of a generally U-shaped or generally square-shaped configurations, or others. An important advance over the ligation instruments of the prior art is the latch 18 attached to ring 16 by screws 39. Referring to FIG. 1, ring applicator 10 is shown in a locked position ready to accept loading of elastic rings. Ring applicator 10 is locked into the loading position by sliding flange plate 30 forward until it abuts the rearward face of rearward handle 15. Ring 16 is then rotated until latch 18 engages notch 60 in rod 19. While latch 18 engages rod 19, flange plate 30 is held flush against the rearward face of rearward handle 15. Thus, while the ring applicator 10 is in a locked position, inner tube 12 is unable to slide with respect to outer tube 11. Furthermore, while in this locked position, inner tube 12 extends beyond the forward end of outer tube 11 a distance slightly greater than the width of two elastic rings. With the ring applicator 10 in a locked position it is now ready for ring loading. FIGS. 3A, 3B and 3C illustrate sequentially the ring loading operation. Ring loading (of itself) is known in the art and is described herein only for purposes of illustration. Cone 92 is adapted to fit into the forward end of inner tube 12. An elastic ring 90 is then placed on the tip of cone 92. Elastic ring 90 is then forced down cone 92 by ring sliding device 93. The first elastic ring loaded, ring 90, is slid over inner tube 12 until it abuts the forward end of outer tube 11. The second ring 91 is slid over inner tube 12 until it abuts the first ring 90. Many operations, such as sterilization of females through ligation of Fallopian tubes, require the use of two elastic rings in order to ligate two tubes. Thus, by loading two elastic rings onto ring applicator 10 the surgeon can perform the entire ligation operation without having to withdraw and reload the ring applicator 10 during surgery. Referring to FIG. 4A, a fully loaded ring applicator 10 is shown with fully extended forceps 21 ready to grasp anatomical tube 100. As can be seen from the drawing, forward handle 14 is in its most forward slidable position. Thus, outer tube 11 and inner tube 12 are also in their most rearward slidable positions. Hence, the spring-like forceps 21 are exposed and opened. FIG. 4B is an enlarged cross-sectional view of the forward end of ring applicator 10 shown in FIG. 4A. The open position of the forceps 21 is clearly shown as well as the respective positions of elastic rings 90 and 91. Once the anatomical tube is positioned between the forceps 21, the surgeon closes the forceps by sliding forward handle 14 in a rearward direction. By so doing, inner rod 13 is slid rearwardly with respect to inner tube 12 and outer tube 11 thereby closing the forceps 21 around anatomical tube 100. As forward handle 14 is slid even further rearwardly, anatomical tube 100 is drawn inside inner tube 12. It is important to have pin 17 rotated into a position between the forward side of rearward handle 15 and the rearward side of forward handle 14, prior to and during the ligation with the first ring to be ejected. By making the diameter of rotatable pin 17 approximately equal to the width of elastic ring 90 the surgeon is assured that only the most forward positioned elastic ring 91 will be ejected onto anatomical tube 100 and that elastic ring 90 will remain in place. Pin 17 is in a position between handles 14 and 15 during ligation of the first anatomical tube 100 and ejection of the first ring 91 as shown in FIGS. 4A, 4B, 5 and 6A. Referring to FIG. 6A, the ring applicator 10 is shown immediately after the first ring 91 has been ejected to effect ligation of anatomical tube 100. As can be seen, rotatable pin 17 has been rotated into a position between the forward handle 14 and the rearward handle 15 thereby preventing further sliding of outer tube 11 with respect to inner tube 12 and thereby preventing the ejection of the second elastic ring 90. FIG. 6B is an enlarged cross-sectional view of the forward end of ring applicator 10 of FIG. 6A. Anatomical tube 100 is grasped by forceps 21 and pulled inside inner tube 12 as inner rod 13 is slid rearwardly with respect to inner tube 12 and outer tube 11. Furthermore, inner tube 12 is slid rearwardly a distance approximately equal to the width of one elastic ring 91 with respect to outer tube 11 thereby causing elastic ring 91 to be pushed off the end of the inner tube 12. This sliding movement is accomplished against the friction of the elastic rings on the inner tube 12, signaling to the surgeon the impending discharge of the elastic ring 91. Upon ejection of elastic ring 91 the surgeon feels a slight snap caused by the sudden ejection of ring 91. In this way, the surgeon can feel when the ligation of anatomical tube 100 is about to occur and when it has been accomplished. To release anatomical tube 100 the surgeon merely slides the forward handle 14 in a forward direction thereby causing the forceps 21 to protrude from the end of inner tube 12 thereby allowing the (self-opening) forceps 21 to spring open and release anatomical tube 100. The same basic sequence of events is then undertaken with respect to the second anatomical tube 101 to be ligated. The only difference between the first ligation and the second ligation is that to perform the second ligation the rotatable pin 17 must be rotated out of its position between forward handle 14 and rearward handle 15 in order that inner tube 12 can be slid rearwardly to a position where the forward end of outer tube 11 is flush with the forward end of inner tube 12. This rearward sliding of inner tube 12 with respect to outer tube 11 pushes off the remaining elastic ring 90 (with the same &#34;signals&#34; to the surgeon) into a position around anatomical tube 101 thereby affecting ligation of anatomical tube 101. Anatomical tube 101 is then released by sliding forward handle 14 in a forward direction to expose and spring open forceps 21. Referring to FIG. 8, the absence of any springs or slots in ring applicator 10 is clearly shown. Furthermore, the close sliding fit between tubes 11 and 12 and inner rod 13 is shown. These smooth surfaces present no crevices where dried blood or other debris can accumulate and interfere with the smooth operation of the instrument, or with its subsequent cleaning. The close sliding fit also prevents the escape of gas without requiring use of additional seals. One of the major advantages of the ring applicator 10 of this invention is that the entire device is easily disassembled for cleaning, maintenance, sterilization or replacement. As viewed in FIG. 2, the separate parts contain mostly smooth, open and easily accessible surfaces. Although it is preferred to clean and sterilize the parts separately, they can be cleaned separately, and then reassembled and sterilized as one unit. In disassembling the ring applicator 10, screw 32 is unscrewed. This allows removal of both inner rod 13 and inner tube 12. Thus, the entire ring applicator 10 can be assembled and disassembled in a matter of seconds into three conponent parts, namely, an inner rod assembly, an inner tube assembly and an outer tube with attached pistol grip handles. Such easy assembly and disassembly of the ring applicator 10 permits fast substitution of parts for different embodiments of the present invention. One such preferred embodiment is shown in FIGS. 10, llA and 11B. In this embodiment, the inner rod 13 having two spring-like forceps 21 is replaced with a hollow rod 40 containing lenses 41, window 42 and light-carrying optical fibers 43. Attached to the forward end of hollow rod 40 is a single tong 44 used to hook the anatomical tube 100. Tong 44 has a spherical tip, to avoid cutting or puncturing the anatomical tube 100. The optical fibers run along the length of hollow rod 40 and parallel to its axis. The positioning of the optical fibers 43 around the interior surface of hollow rod 40 is shown in FIG. 11B. At the rearward end of hollow rod 40 is attached a fiber optic connector 45. Fiber optic connector 45 is well known in the art and forms no part of the present invention other than to illustrate the use of the novel forward tip configuration of the present fiber optic embodiment. A light-emitting source is operationally connected to fiber optic connector 45 which in turn directs illumination through the individual optical fibers 43 running through hollow rod 40. In this way, illumination is provided enabling the surgeon to view the anatomical tube to be ligated. Generally the surgeon views the procedure through eyepiece 46. It should be noted that the field of vision for the narrow hollow tube 40 and lenses 41 is inherently limited to the available angle α. However, when inner tube 12 and outer tube 11 are composed of metal or other opaque materials, the field of view which the surgeon is afforded is considerably narrowed when the inner rod 40 is inside inner tube 12. This &#34;tunnel vision&#34; effect can be lessened by providing windows 47 in the sides of tubes 11 and 12. One window 47 is clearly shown in FIG. 10. A second window 47 is on the opposite side of tubes 11 and 12. These windows 47 give the surgeon a fuller field of vision and allow him to view the periphery around the anatomical element 100 being ligated. In addition, the ring applicator 10 of the present invention may be used in conjunction with other optical viewing devices. One such device known to the prior art slidably fits over outer tube 11 and is fastened to ring applicator 10 by threadably engaging fastener 61, A further embodiment of the present invention is illustrated in FIG. 12. In this embodiment the ring applicator 10 is combined with an electrosurgical device. To convert the standard ring applicator 10 to a combined ring applicator and electrosurgical device, inner rod 13 is replaced with a hollow rod 50 composed of a nonconductor (preferably of nylon) carrying electrical wires 52 and 53. Rod 50 is hollow with an inner channel 51 which can be used to convey anesthesia to the ligation area. Furthermore, wires 52 and 53 run within the walls of rod 50. Because the material of rod 50 is an insulator there is no danger of short-circuiting between wires 52 and 53. Wires 52 and 53 are connected to an electrical supply at the rearward end of hollow rod 50. At the forward end of rod 50 the wires are connected to ordinary spring-like forceps 21 as shown in FIG. 1. The inner tube 12 in this configuration is made of an insulating material such as teflon. This mode of using the present invention is helpful in an operation where the surgeon first discovers upon inserting the instrument that the anatomical tubes, due to disease or some other condition, do not have the inherent structural integrity to support an elastic ring. In such a case, the electrosurgical device is a desirable backup system to simultaneously cut, seal and cauterize each anatomical tube. Both hollow rod 40 and rod 50 have the same dimensions as inner rod 13. Thus, both the optical viewing and electrosurgical embodiments of the present invention fit equally well with the ring applicator 10 described herein and in the drawings. This means that the diameter of outer tube 11, being typically and desirably approximately one-fourth inch, determines the size of the incision made by the surgeon&#39;s trocar in the ligation procedure. This is remarkable indeed when compared with available prior art devices. Although this invention has been described in connection with specific forms thereof, it will be appreciated by those skilled in the art that a wide variety of equivalents may be substituted for those specific elements and steps of operation shown and described herein, that certain features may be used independently of other features, and that parts may be reversed, all without departing from the spirit and scope of this invention as defined in the appended claims.

Summary: The tubal ligation instrument of the present invention includes a structure for ligating anatomical tubes within the human or another animal body, structure for anesthetizing the anatomical tubes being ligated and structure for internally viewing the ligation procedure. An example of an anatomical tube is a Fallopian tube. The instrument further includes a structure for grasping the anatomical element. Usually the grasping structure is a rod having forceps at one end. This rod may be hollow with a valve attached in fluid communication with the rod&#39;s rearward end so that anesthesia may be caused to flow through the hollow channel in the rod. The application of anesthesia to an anatomical element is accomplished by introducing the anesthesia through the valve and into the hollow channel of the rod. Thus, a surgeon directing the forward end of the instrument to an anatomical element can apply an anesthetic agent to the anatomical element intraabdominally. In another embodiment of the present invention the hollow rod may contain lenses in its forward end and an eyepiece at its rearward end with light-carrying optical fibers running through the hollow portion of the rod to illuminate the anatomical element being ligated. Thus, a surgeon directing the forward end of the instrument to an anatomical element can view the anatomical element intraabdominally.

big_patent

en

Summarize: Government regulators moved a big step closer on Friday to allowing the first genetically engineered animal — a fast-growing salmon — to enter the nation’s food supply. The Food and Drug Administration said it had concluded that the salmon would have “no significant impact” on the environment. The agency also said the salmon was “as safe as food from conventional Atlantic salmon.” While the agency’s draft environmental assessment will be open to public comment for 60 days, it seems likely that the salmon will be approved, though that could still be months away. The environmental assessment is dated May 4. It is unclear why it took until now for it to be released, but supporters of the salmon say they believe it is because the Obama administration was afraid of an unfavorable consumer reaction before the election in November. Environmental and consumer groups quickly criticized the federal agency’s conclusions. “The G.E. salmon has no socially redeeming value,” Andrew Kimbrell, executive director of the Center for Food Safety, a Washington advocacy group opposed to farm biotechnology, said in a statement. “It’s bad for the consumer, bad for the salmon industry and bad for the environment. F.D.A.’s decision is premature and misguided.” But the decision was long in coming. AquaBounty Technologies, the company that developed the salmon, has been trying to win approval for more than a decade. “We’re encouraged by this,” Ronald Stotish, the chief executive of AquaBounty, said on Friday. However, he added, “We’re not so foolish as to be wildly enthusiastic” that Friday’s action will definitely lead to approval. Among other things, some members of Congress have tried to block the agency from approving the fish. The AquAdvantage salmon, as it is called, is an Atlantic salmon that contains a growth hormone gene from the Chinook salmon and a genetic switch from the ocean pout, an eel-like creature. The switch keeps the gene on so that the salmon produces growth hormone year round, rather than only during warm weather. The fish reach market weight in about 18 months instead of three years. The F.D.A. tentatively concluded in September 2010 that the salmon would be safe to eat and for the environment. A committee of outside advisers, while finding some shortcomings in the analysis, did not contradict those conclusions in general. The agency then embarked on a more detailed environmental analysis that has now come to the same conclusions. The main concern addressed was whether the genetically engineered salmon could escape and establish themselves in the wild, with detrimental environmental consequences. The larger salmon, for instance, could conceivably outcompete wild Atlantic salmon for food or mates. The agency said the chance this would happen was “extremely remote.” It said the salmon would be raised in inland tanks with multiple barriers to escape. Even if some fish did escape, the nearby bodies of water would be too hot or salty for their survival. And reproduction would be unlikely because the fish would be sterilized, though the sterilization technique is not foolproof. The agency also said that approval of the salmon would have no effect on endangered species, including wild Atlantic salmon. The National Marine Fisheries Service and the Fish and Wildlife Service did not disagree. AquaBounty produces its eggs at a facility in Prince Edward Island, Canada. The eggs are shipped to the highlands of Panama, where the fish are grown to market weight. The federal agency said that other facilities for growing the salmon would require separate approvals. It also noted that it did not assess how the salmon would affect the environment in Panama and Canada, only in the United States. Opponents said that the agency should do a more complete environmental impact statement. They also said that not enough samples were studied to conclude that the fish would be safe to eat. Scientists and companies working on animal biotechnology had complained that the failure to approve the salmon was discouraging investment in the industry. An article in Slate earlier this week said the White House had been delaying release of the environmental assessment for political reasons, violating the Obama administration’s pledge to make decisions based on science. The environmental assessment was released soon afterward. An agency spokesman declined to comment on the delay. He said it was not possible to predict when a final decision on the salmon would be made. The F.D.A. is likely to take weeks or months to analyze the comments it receives. Even if it then affirms the conclusions released Friday, that would be a decision that a bigger environmental impact statement is not needed. The agency would still have to take a separate step to approve the salmon for introduction into the food supply, although it is thought there are no other important issues outstanding. Mr. Stotish of AquaBounty said that if the approval came early next year, some salmon could reach American dinner plates late next year. But quantities would be limited by the small capacity in Panama. AquaBounty hopes to sell eggs to other fish farms that would grow larger quantities of salmon, but that is likely to take a few more years. AquaBounty has argued that the faster growth of its fish makes it feasible to rear them in inland tanks rather than ocean pens, reducing the environmental impact. “That allows us not to disturb the oceans whatsoever,” said Elliot Entis, the founder of AquaBounty. Mr. Entis, who no longer works for the company, has formed a new company to rear the salmon in the United States. AquaBounty, which is based in Maynard, Mass., nearly ran out of money waiting for the salmon to be approved. Kakha Bendukidze, an investor from the nation of Georgia who owned nearly half the company’s stock, sold his holdings in October to Intrexon, an American company. Intrexon, which is offering to buy the rest of AquaBounty, is providing it with a $500,000 loan. Intrexon is working on synthetic biology, which is sort of a souped-up form of genetic engineering. It is not clear yet how it plans to apply that technology to AquaBounty’s fish. Federal health regulators say a genetically modified salmon that grows twice as fast as normal is unlikely to harm the environment, clearing the way for the first approval of a scientifically engineered animal for human consumption. The Food and Drug Administration on Friday released its environmental assessment of the AquaAdvantage salmon, a faster-growing fish which has been subject to a contentious, yearslong debate at the agency. The document concludes that the fish "will not have any significant impacts on the quality of the human environment of the United States." Regulators also said that the fish is unlikely to harm populations of natural salmon, a key concern for environmental activists. The FDA will take comments from the public on its report for 60 days before making it final. The FDA said more than two years ago that the fish appears to be safe to eat, but the agency had taken no public action since then. Executives for the company behind the fish, Maynard, Mass.-based Aquabounty, speculated that the government was delaying action on their application due to push-back from groups who oppose genetically modified food animals. Experts view the release of the environmental report as the final step before approval. "We are encouraged that the environmental assessment is being released and hope the government continues the science-based regulatory process," AquaBounty said in a statement. If FDA regulators clear the salmon, as expected, it would be the first genetically altered animal approved for food anywhere in the world. Critics call the modified salmon a "frankenfish." They worry that it could cause human allergies and the eventual decimation of the natural salmon population if it escapes and breeds in the wild. Others believe breeding engineered animals is an ethical issue. AquaBounty has maintained that the fish is safe and that there are several safeguards against environmental problems. The fish would be bred female and sterile, though a very small percentage might still be able to breed. The company said the potential for escape is low. The FDA backed these assertions in documents released in 2010. Since its founding in 1991, Aquabounty has burned through more than $67 million developing the fast-growing fish. According to its midyear financial report, the company had less than $1.5 million in cash and stock left. It has no other products in development. Genetically engineered _ or GE _ animals are not clones, which the FDA has already said are safe to eat. Clones are copies of an animal. In GE animals, the DNA has been altered to produce a desirable trait. The AquaAdvantage salmon has an added growth hormone from the Pacific Chinook salmon that allows the fish to produce growth hormone all year long. The engineers were able to keep the hormone active by using another gene from an eel-like fish called an ocean pout that acts like an "on" switch for the hormone. Typical Atlantic salmon produce the growth hormone for only part of the year. It is still unclear whether the public will have an appetite for the fish if it is approved. Genetic engineering is already widely used for crops, but the government until now has not considered allowing the consumption of modified animals. Although the potential benefits _ and profits _ are huge, many people have qualms about manipulating the genetic code of other living creatures. If the salmon are eventually approved for sale, consumers may not even know they are eating them. According to federal guidelines, the fish would not be labeled as genetically modified if the agency decides it has the same material makeup as conventional salmon. AquaBounty says that genetically modified salmon have the same flavor, texture, color and odor as the conventional fish, and the FDA so far has not shown any signs of disagreeing. Wenonah Hauter, director of the advocacy group Food and Water Watch, said forgoing labeling not only ignores consumers' rights to know what they are eating, but "is simply bad for business, as many will avoid purchasing any salmon for fear it is genetically engineered." Hauter urged members of Congress to block the impending approval of the fish. Congressional opposition to the engineered fish has so far been led by members of the Alaska delegation, who see the modified salmon as a threat to the state's wild salmon industry. Sen. Lisa Murkowski, R-Alaska, said Friday she is working to convince fellow senators that approval for the fish should be stopped. "This is especially troubling as the agency is ignoring the opposition by salmon and fishing groups, as well as more than 300 environmental, consumer and health organizations," she said of the preliminary approval. Barrett & MacKay Photo/Courtesy AquaBounty Technologies. The Food and Drug Administration today released an electronic version of its environmental assessment for a genetically modified salmon developed by AquaBounty Technologies—effectively giving its preliminary seal of approval on the first transgenic animal to be considered for federal approval. According to sources within the FDA, the environmental assessment had been approved by the all the relevant agencies on April 19, 2012, but had been blocked for release on orders from inside the executive branch. The delay has raised both legal and ethical issues of political interference in science and the independent work of federal agencies. Advertisement The decision by the White House to rescind its order to block the FDA from releasing the environmental assessment came within hours after the publication of an investigative report by the Genetic Literacy Project and a story in Slate on Wednesday. "There was no place for the White House to hide anymore," said one FDA insider.

Summary: Americans will likely be digging into the first meal from a genetically modified animal-a salmon-in about a year. The FDA has declared that salmon engineered by AquaBounty Technologies is safe to eat and poses no threat to the environment, reports the AP. The ruling makes it all but certain that the agency will grant final approval for the creature that critics call "Frankenfish," reports the New York Times. Those who partake will be eating an Atlantic salmon that has a growth-hormone gene from Pacific Chinook salmon. Scientists also added a gene from a fish called the ocean pout that keeps the growth-hormone gene on constantly. The upshot is that these salmon get big in a fraction of the usual time. They will be raised in farms and all will be bred to be sterile females, though the AP says a small percentage might be able to breed. That has critics worried about what might happen if they escape. The FDA review was actually completed months ago, and the White House has been accused of delaying its release for political gain. Slate has an investigative piece on that angle.

multi_news

en

Summarize: It has been decades since a California socialite was buried in the front seat of her Ferrari in one of the country's most eccentric burials, but the grave remains a spectacle in Texas after nearly 40 years as thousands have visited the woman's grave. The burial of oil heiress and Beverly Hills socialite Sandra Ilene West drew 300 onlookers to San Antonio's Alamo Masonic Cemetery in May 1977, according to an original report in a 1977 edition of The Register-Guard. West was buried in the front seat of her light blue 1964 Ferrari 250GT - which would cost $2million if bought today - wearing a white nightgown 'with the seat slanted comfortably.' Sandra: Oil heiress and socialite Sandra West (photographed) was buried in the front seat of her Ferrari wearing a white nightgown in 1977, but her grave site still attracts tourists. Following the death of her Texas oil tycoon husband, Ike West, in 1968, West received his $5 million estate and promised it to her brother-in-law Sol West if he granted the burial request she had written in her will four years earlier, according toMy San Antonio. West died on March 10, 1977, according to an obituary. While some reports say West overdosed on prescription pills, others say she died due to complications of a car accident. West and her Italian sports car were flown to San Antonio to be buried next to her late husband in the historic cemetery which boasts the graves of those who helped shape San Antonio, according to My San Antonio. Ferrari: West's light blue Ferrari (with West inside) was placed in a crate and lowered into a grave measuring 19 feet long, 10 feet wide, and nine feet deep (Stock Image) Death: West died on March 10, 1977. While some reports say West overdosed on prescription pills, others say she died due to complications of a car accident. The car carrying West's body was placed in a crate which was then lowered into the ground by a large crane. The grave was 19 feet long, 10 feet wide, and nine feet deep, the Houston Chronicle reports. The large grave was then covered with cement to prevent vandalism and looting. Though few friends and no known members of West's family attended the 24-minute burial, according to the Guard, many went just to see the unusual burial for themselves. 'I just wanted to see how it was done,' one man told the United Press International, as reported by the Guard. 'If you can afford it, why not?' Husband: West and her Italian sports car were flown to San Antonio to be buried next to her late oil tycoon husband, Ike West Jr. West's coffin has since been covered by a grassy patch with only a tombstone commemorating the heiress and her extraordinary burial. However, thousands of tourists and history buffs have visited the historic cemetery since the burial took place to catch a glimpse of the cite that once gained national attention. The historic cemetery is also a stop on many San Antonio tours and West's plot is featured as one of the cemetery's notable graves with a fascinating tale, My San Antonio reports. Other prominent graves in the historic cemetery include John Kampmann, a builder; John Lang Sinclair, composer of 'The Eyes of Texas'; and Clara Driscoll, who is credited by historians to have helped save the Alamo, according to a San Antonio tour website

Summary: Sandra West died in 1977 and was buried in the front seat of her Ferrari wearing a white nightgown in San Antonio, Texas. The burial attracted 300 onlookers then, but has since seen thousands of tourists looking to catch a glimpse of the eccentric grave. The Ferrari (and West) was placed in a crate which was then lowered into a 19-feet-long grave and covered with cement.

cnn_dailymail

en

Summarize: CROSS REFERENCE TO PRIORITY APPLICATION This application is a continuation of U.S. patent application Ser. No. 10/844,746, filed May 13, 2004 now U.S. Pat. No. 7,396,335; which is a divisional of U.S. patent application Ser. No. 09/659,797, filed Sep. 12, 2000 now U.S. Pat. No. 6,805,675; both of which are herein incorporated by reference in their entirety. CROSS REFERENCE TO COMMONLY-ASSIGNED PATENTS Reference is made to commonly-assigned U.S. Pat. No. 6,059,482, filed May 29, 1998, by Baumann; and to commonly-assigned U.S. Pat. No. 6,027,462 issued to Greene et al, which have related subject matter. BACKGROUND OF THE INVENTION The present invention relates generally to implantable leads and catheters and more particularly to mechanisms for deflecting implantable leads and catheters to assist in guiding them through the vascular system. Over the years, quite a number of mechanisms have been disclosed and employed to deflect catheters and implantable leads. These have taken the form of deflectable guidewires and deflectable stylets, typically operable from the proximal end of the lead or catheter, which controllably impart a curve to the distal portion of the catheter. One group of devices comprise deflectable stylets or guidewires which employ a straight, tubular outer member with a curved inner member, the inner and outer members movable relative to one another. Examples of this type of deflection mechanism are disclosed in U.S. Pat. No. 4,136,703 issued to Wittkampf and U.S. Pat. No. 5,728,148 issued to Bostrom et al. Alternatively, deflection devices employing a curved outer member and a relatively straight inner member are also known to the art, as disclosed in U.S. Pat. No. 4,676,249 issued to Arenas and U.S. Pat. No. 5,040,543 issued to Badera et al. In devices of both types, the relative position of the inner member with respect to the outer member determines the degree to which the curved member (inner or outer) is allowed to display its preset curvature. A more commonly employed approach to providing controllable deflection employs a generally straight outer member and a tension or push wire located within the outer member that, upon advancement or retraction, causes the outer member to bend. Examples of such deflection mechanisms can be found in U.S. Pat. No. 4,815,478 issued to Buchbinder et al., and U.S. Pat. No. 4,940,062 issued to Hampton et al. Particularly in the context of deflectable stylets intended for use in conjunction with implantable medical leads such as pacing and cardioversion leads, steerable stylets employing this third type of deflection mechanism are disclosed in U.S. Pat. No. 5,662,119 issued to Brennan et al., U.S. Pat. No. 5,170,787 issued to Lindegren, and U.S. Pat. No. 5,327,906 issued to Fideler et al, all of which are incorporated herein by reference in their entireties. Additional deflectable stylet designs are disclosed in the above-cited Bauman and Greene et al applications. In these designs, the handle for the stylet is provided with a rotatable knob which, like in the above-cited Fideler patent, is employed to curve and straighten the stylet. This knob is provided with a distally facing recess at its distal end. The connector assembly of the lead is located in this distally facing recess. In conjunction with the use of deflectable stylets to implant leads having screw-in fixation mechanisms which require rotation of the connector pin to screw the fixation mechanism into body tissue, it is also known to employ a spinner ball or clamp to rotate the connector pin, as described in the Pacesetter Locator Steerable Stylet User Manual for the Pacesetter Model 4036 Steerable Stylet. The spinner ball, as described, however, does not allow compensation for variations in lead length or allow for ready adjustment of the position of the stylet within the lead body. For example, the spinner ball mechanism must be disconnected from the handle to allow for retraction of the stylet tip within the lead to reduce the stiffness at the lead tip. SUMMARY OF THE INVENTION The present invention is directed toward providing a deflectable stylet system particularly optimized for use in conjunction with a lead of the type having a fixation helix, in which the fixation helix is screwed into body tissue by rotation of the connector pin of the lead. In particular, the invention is intended to provide a deflectable stylet system that allows for differences in length from lead to lead and also provides an easy mechanism for adjusting the position of the stylet within the lead body. The present invention accomplishes the above results by means of an attachment to the stylet handle which includes an affixation device that may be connected to the connector pin of the lead. In one embodiment, the affixation device may be a threaded device such as a screw. In another embodiment, the affixation device is a pushbutton clevis having an unlocked position for receiving the lead, and a locked position for rigidly coupling the lead to the attachment. When the attachment is coupled to the lead, the attachment may be rotated to screw the fixation helix into body tissue, configured such that the knob and the lead to which it is attached may readily be moved longitudinally relative to the remainder of the deflectable stylet handle. In a preferred embodiment, the attachment includes a knob with a recess at its distal end for engaging the connector pin of a lead and an elongated tubular extension at its proximal end, slidably inserted into a corresponding distally facing recess in a deflectable stylet handle. In a more preferred embodiment, the distally facing recess in the stylet handle is formed within the spinner or knob of a deflectable stylet handle generally as disclosed in the above cited Greene et al application. The proximally directed extension on the attachment&#39;s knob allows for it to be moved longitudinally relative to the stylet handle, in turn allowing for longitudinal movement of the lead relative to the deflectable stylet. In one preferred embodiment, the deflectable stylet assembly is also provided with a tubular pin, mounted around the proximal portion of the flexible stylet and mounted in fixed longitudinal relationship with the stylet handle. This tubular pin may engage the interior of the proximally directed tubular extension of the attachment, providing for an additional mechanism to allow longitudinal movement of the attachment knob relative to the deflectable stylet handle, while retaining appropriate alignment of the attachment knob and stylet handle to allow for rotation of the attachment knob. In some embodiments, a bushing may be provided within the attachment to facilitate the free rotation of the attachment around the tubular pin. The attachment may be slip-fit to the tubular pin in a manner that provides for controlled longitudinal repositioning of the attachment with respect to the stylet assembly. The attachment may also be adapted to rigidly couple to the tubular pin at predetermined positions on the pin. BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a plan view of a prior art deflectable stylet similar to that used in conjunction with the present invention. FIG. 2 is a plan view of the deflectable stylet of FIG. 1 shown inserted into an implantable cardiac pacing lead. FIG. 3 is a cut-away view through a partially disassembled control handle of one embodiment of the deflectable stylet illustrated in FIG. 1. FIGS. 4 and 5 are cut-away views through the distal portion of the handle of a deflectable stylet according to the present invention, with a slip-on attachment according to the present invention and a lead with an advanceable fixation helix in place. FIG. 6 is a cut-away view of another embodiment of the handle assembly and the attachment. FIG. 7 is a perspective diagram of the embodiment of the attachment illustrated in FIG. 6, and further includes the pushbutton clevis mechanism. FIG. 8 is a cross-sectional view of the distal end of the attachment illustrating the pushbutton in an unlocked position. FIG. 9 is a cross-sectional view of the distal end of the attachment illustrating the pushbutton in a locked position. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS FIG. 1 illustrates a plan view of a prior art deflectable stylet, similar to that employed in conjunction with the present invention. The deflectable stylet 16 is provided with a control handle assembly 10 provided with a handle 12 and a deflection control which takes the form of a spinner or knob 14, mounted rotatably and slidably with respect to the handle portion 12. The handle 12 is provided with indentations at its proximal end, as is the spinner or knob 14 to assist the physician in maintaining a grip. Ribbing, knurling or other texturing could of course be substituted. The deflectable stylet 16 exits from a distal recess 15, within spinner or knob 14. The rotation of spinner or knob 14 causes deflection of the distal portion of stylet 16 to a curved configuration as illustrated at 16 A. Deflectable stylet 16 may take the form of any known deflectable stylet employing an outer tubular member and an inner tension wire which, when it applies tension to the distal tip of deflectable stylet 16, causes the tip of the stylet to curve. Appropriate designs for the deflectable stylet 16 include those described in the Brennen et al, Lindegren and Fideler patents and Bauman and Greene et al. applications discussed above. Alternatively, deflectable stylet 16 may be replaced by a deflectable guidewire, for example, as disclosed in the above-cited Buchbinder patent, also incorporated herein by reference in its entirety. In all of these various guidewires and stylets, the basic structure of the deflectable stylet or guidewire consists of a generally straight element, and an internal tension wire coupled to the distal portion of this straight element, and arranged such that upon application of tension to the internal tension wire, the distal portion of the guidewire or stylet exhibits a curved configuration as illustrated in broken outline at 16 A. FIG. 2 is a plan view of the deflectable stylet of FIG. 1 inserted into a screw-in cardiac pacing lead 20 of a type not requiring rotation of the connector pin relative to the lead body. Cardiac pacing lead 20 comprises an elongated insulated lead body 24 carrying an internal conductor and provided with a connector assembly 18 located at its proximal end, which typically carries a connector pin as is typical of cardiac pacing leads. For example, the distal portion of the connector assembly 18 may correspond to the IS-1 connector standard as disclosed in U.S. Pat. No. 4,922,607 issued to Doan et al., also incorporated herein by reference in its entirety. However, other connector configurations, such as disclosed in U.S. Pat. No. 4,488,561 issued to Doring or U.S. Pat. No. 4,572,605 issued to Hess et al., both also incorporated herein by reference in their entireties, may also be employed. At the distal end of pacing lead 20 is located a fixed helical electrode 22, such as that disclosed in U.S. Pat. No. 5,473,812 issued to Morris et al. and incorporated herein by reference in its entirety, which is screwed into heart tissue in order to stimulate the heart. As illustrated, the connector assembly 18 of the lead 20 is inserted into the distal facing opening 15 within spinner or knob 14. The spinner or knob 14 is free to rotate with respect to connector assembly 18. Thus, rotation of the spinner knob does not rotate the connector pin of the lead or the lead body itself. However, rotation of the lead body with respect to the deflectable stylet is typically required in order to screw a helical electrode 22 located at the distal end of the lead into heart tissue. Therefore, an alternative mechanism is needed to accomplish the affixation of the helical electrode. This mechanism will be described in detail below. The above discussion relates to the use of a deflectable stylet in conjunction with an implantable lead. The stylet may further be used with any type of steerable catheter, including an ablation catheter. FIG. 3 is a cut-away view of a partially disassembled handle assembly 10, as illustrated in the figures discussed above. The handle 12 is fabricated of two molded plastic parts, joined together essentially along a longitudinal line extending the length of the handle. One of the two handle halves 12 A is illustrated in conjunction with the knob or spinner 14, showing cross-section and the internal slider 200, not visible in the previous illustrations. The internal, distally facing recess 15 in knob 14 is visible in this view, and is sized to be of sufficient length that it inherently serves as a strain relief to the deflectable stylet 16, preventing kinking or bending of the stylet at the point it exits the slider 200. Recess 15 also assists the physician in repositioning his hand when moving between proximal and distal positions relative to the handle, in that the portion of the connector assembly distal to the connector pin is immediately adjacent the distal end of the knob. The slider 200 generally takes the form of a rod provided with external threading 202 which engages internal threading 204 within knob 14. At the proximal end of the slider 200 is a collar 206 that engages corresponding grooves in the molded handle halves, not visible in this drawing, to prevent rotation of the slider 200 relative to the handle. Thus, rotation of the knob 14 relative to the handle causes longitudinal movement, but not rotational movement of the slider 200. The outer tube of deflectable stylet 16 is mechanically coupled to the slider 200, while the tension wire 208 within the stylet 16 is anchored to the handle. Thus, on distal movement of the slider 200 relative to the handle 12 A, the outer tube of the stylet is moved with respect to the tension wire 208, causing tension wire 208 to apply tension to the tip of the stylet and deflecting it, in the manner described above in the various cited patents pertaining to deflectable stylets. Tension wire 208 is anchored to a threaded rod 210 which is adjusted longitudinally by means of a hex nut 212, which is fixedly mounted in the handle. As illustrated, the knob 14 and the slider 200 may be longitudinally slid as a unit without rotation in a distal direction with respect to the handle. This provides an alternative mechanism for applying tension to tension wire 208 and deflecting stylet 216. Deflection of the stylet by this mechanism is convenient in the case in which the physician wants to only very briefly and very quickly induce a curve to facilitate entry of the lead into a desired location, for example, into the coronary sinus or for navigating the lead through the vena cava and through the tricuspid valve. Such deflection may be useful for prolapsing the lead in a manner that allows for easy insertion of the lead tip through a valve, for example. In the embodiment illustrated, the slider is provided with an internal bore 214 which may receive the connector pin of an implantable lead. In this case, the bore 214 should be of larger diameter than the connector pin, so that the lead may be rotated with respect to the stylet 216. Alternatively, the bore 214 may be omitted, with the connector pin simply lying adjacent the distal end of the slider 200. FIG. 4 illustrates a cut-away view through the distal portion of a deflectable stylet handle in conjunction with an attachment according to the invention, to which the connector pin of a lead of the type having a fixation helix is attached. As illustrated, the deflectable stylet control handle corresponds generally to that described in the above cited Greene et al patent and as illustrated in FIGS. 1-3. Handle 12 A, knob or spinner 14, deflectable stylet 16 and tension wire 208 correspond to identically numbered components as illustrated in FIGS. 1-3 and discussed above. Slider 200 A of this embodiment corresponds generally to slider 200. Operation of the deflectable stylet handle in and of itself is identical to that described above in conjunction with FIGS. 1-3. It may be noted that the embodiment of FIG. 4 shows extending screw threads 202 A being cut away in portions. This allows ethylene oxide gas to more easily penetrate the threads during the sterilization process. Also illustrated is an attachment 304 according to the present invention mounted to the stylet handle. Attachment 304 includes a generally cylindrical knob 316 from which a generally tubular member 314 extends proximally. Tubular member 314 is mounted with a slip-fit to tubular pin 300 within the distal facing recess 15 of knob or spinner 14. The attachment 304 may be slid longitudinally within that recess, and may also be rotated with respect to tubular pin 300. At the distal end of the attachment 304 is a distally facing bore in which the connector pin 310 of a pacing lead 312 is inserted and is retained by screw 308. Lead 312 may be of the type having a fixation helix, wherein the fixation helix is advanced by rotation of this connector pin 310. Rotation of the fixation helix is discussed further below. Tubular pin 300 is mounted within recess 214 A, in the distal end of slider 200 A, and is retained therein frictionally, by adhesive or otherwise. Plug 306 is mounted to the proximal end of the tubular member 314. Located within the proximally extending tubular member 314 of attachment 304 is a bushing 302, which surrounds a tubular pin 300 that is in turn mounted around deflectable stylet 16. Bushing 302 is adhesively or otherwise bonded to the interior of the tubular member 314, and is free to rotate with respect to tubular pin 300. Bushing 302 provides the friction fit between attachment 304 and tubular pin 300 to allow attachment 304 to be slid in a controlled manner along tubular pin 300. Pin 300 thereby allows for an increase in the range of available controlled longitudinal movement of attachment 304 relative to a deflectable stylet handle. The current invention provides an efficient mechanism for adjusting the position of the stylet 16 within the body of lead in a controlled manner using only a single hand. In contrast, the prior art mechanisms discussed above for adjusting lead position with respect to the stylet require the detachment of the lead from the handle before longitudinal movement of the lead body is possible. In most cases, these prior art mechanisms require two hands to operate, and do not allow for controlled movement of the lead body with respect to the handle. FIG. 5 is a cut-away view of components that are similar to those illustrated in FIG. 4, with all identically numbered components correspond to those in FIG. 4. In this view, attachment 304 is shown advanced distally on tubular pin 300 out of the recess in knob or spinner 14, for a distance “A” which may be, for example, about an inch. Because tubular pin 300 extends distally to the end of knob or spinner 14, it is possible to move the attachment 304 to a point wherein only the proximal most portion of the attachment is located within the recess within spinner or knob 14, while retaining the correct alignment of the attachment with respect to the deflectable guidewire and deflectable guidewire handle. The current invention may be used to adjust a stylet length to that of a particular lead. The stylet length may be adjusted by a length “A” as shown by extended position 320 of FIG. 5. For example, in some instances, lead lengths may vary by several inches. For leads that are longer, the attachment may be positioned in its most retracted position so that the tip of the stylet is positioned at the end of the lead. For leads that are shorter, the attachment 304 may be positioned at a more extended location within the recess of spinner or knob 14. The attachment therefore allows the flexibility to manufacture longer lead or catheter bodies that may be trimmed and reworked if a defect in the connector is experienced. This reduces overall manufacturing costs, since fewer leads or catheters must be disposed of because of manufacturing defects. In addition to providing an efficient mechanism for adjusting stylet length, the current invention further provides a mechanism for rotating a helical electrode. As stated previously, the connector pin 310 of a pacing lead 312 is inserted and retained by screw 308 of attachment 304. Therefore, rotation of attachment 304 will result in rotation of the connecting pin and any interconnected helical electrode that is positioned at the distal end of the lead. This allows the helical electrode to be attached to, or detached from, adjacent tissue. It may be noted that the current invention is suitable for use with both retractable and fixed-screw helical electrodes, and is particularly useful when retractable helical electrodes are used. FIG. 6 is a cut-away view of another embodiment of handle assembly 10 and attachment 304, as illustrated in the figures discussed above. In this Figure, all components corresponding to those in FIGS. 4 and 5 are labeled with the same reference numbers as used in the previous FIGS. 4 and 5 for ease of reference. As in the embodiments discussed above, this embodiment includes a handle fabricated of two molded plastic parts, joined together essentially along a longitudinal line extending the length of the handle. One of the two handle halves shown as 12 A is illustrated in conjunction with the knob or spinner 14, shown in cross-section, and the internal slider 200, not visible in the previous illustrations. The embodiment of the handle shown in FIG. 6 is very similar to that shown in previous FIGS. 4 and 5, with a few exceptions. For example, tension wire 208 is anchored to wire anchor 330, and is not longitudinally adjustable as is the tension wire shown in FIGS. 4 and 5. Instead, tension wire 208 is adhesively bonded or potted into anchor 330 by epoxy for superior tensile strength. FIG. 6 further illustrates another embodiment of the attachment. As in the embodiments discussed above, the attachment of this embodiment is fabricated of two molded plastic parts, joined together essentially along a longitudinal line extending the length of the handle, with the half of the attachment 304 a being shown in FIG. 6. As with the attachment discussed above in reference to FIG. 5, this attachment includes a generally cylindrical knob 316 from which a generally tubular member 314 extends proximally. Tubular member 314 is rotatably mounted to a tubular pin 334 within the distal facing recess 15 of knob or spinner 14 and is also slidable longitudinally within that recess. In this embodiment, tubular member 314 includes a ball-detent coupling mechanism (not shown in FIG. 6 ) to be described further below. This coupling mechanism is adapted to be rigidly positioned longitudinally with respect to any of the notches 336 included within pin 334. Thus, attachment 304 a may be rigidly re-positioned longitudinally at predetermined intervals along at least a predetermined portion of the length of pin 334 while rotating freely in the notches. This embodiment may further include an elastomeric ring-like structure such as O-ring 360 shown positioned in recess 361. The O-ring allows the attachment to be longitudinally re-positioned at an infinite number of positions using a friction fit with pin 334. O-ring may be used in addition to, or instead of, the ball-detent coupling mechanism discussed below. In the embodiment of FIG. 6, attachment 304 a further includes a lead attachment mechanism that uses a pushbutton clevis to fix the lead pin to attachment 304 a. FIGS. 8 and 9 each illustrate a cross-section of this pushbutton 340 that resides within a recess 338 a and couples the connector pin 310 of a pacing lead 312 to the attachment. The pushbutton clevis is discussed further below. This is an alternative coupling mechanism to screw 308 of FIG. 5. The embodiment of FIGS. 8 and 9 provides the advantage of requiring only a single, one-handed motion to engage and disengage the coupling mechanism as compared to the screw 308 of FIG. 5. FIG. 7 is a perspective diagram of first and second halves 304 a and 304 b, respectively, of the attachment of the embodiment of FIG. 6, including pushbutton clevis 340. Pushbutton 340 is adapted to slidably engage within a recess 338 b of attachment half 304 b, and to further engage in similar recess 338 a (shown in FIG. 6 ) of attachment half 304 a when the attachment halves are coupled together as shown by the dashed lines of FIG. 7. The pushbutton is prevented from falling out of recesses 338 b by a locking travel limit pin 347 shown protruding perpendicularly from a proximal face of the pushbutton. When inserted within the recess, the pushbutton generally resides in either a first loose position, or a second locked position that will be discussed in more detail below. Each of the attachment halves further includes a cut-away area 342 a and 342 b on the distal face of cylindrical knob 316 of attachment halves 304 a and 304 b, respectively. This cut-away area accommodates the positioning of a lead connector pin 310 of lead 312. When the pushbutton is in the loose position, the connector pin 310 of lead 312 may be easily inserted into this cut-away area. Once the lead connector is so positioned, the pushbutton may be snapped into the locked position such that pushbutton 340 traps connector pin 310 within one end of aperture 345. This fixes the implantable lead 312 in a rigid position with respect to the attachment. Rotation of the cylindrical knob 316 will now rotate the entire lead body, allowing for easy fixation of a helical screw that may be carried at the distal end of the lead body within adjacent tissue. This pushbutton mechanism is further discussed below. FIG. 7 further shows the coupling mechanism 348 that is provided to couple to notches 336 included within pin 334. In one embodiment, this coupling mechanism is a protrusion 348 that may be included on one or both of the attachment halves 304 a and 304 b. This protrusion may be, for example, one or more stainless steel balls embedded within a respective wall of one or both of attachment halves 304 a and 304 b. This protrusion is adapted to fit within any of notches 336 to allow the attachment to be selectably positioned at regular intervals along pin 334. Such a positioning mechanism allows for more controlled positioning of the lead body with respect to the stylet. In another embodiment, attachment halves 304 a and 304 b do not include a coupling mechanism such as protrusion 348. Instead, the elastomeric O-ring 360 is positioned in recess 361 between attachment halves 304 a and 304 b to fit over tubular pin 334 as shown in FIG. 6. The O-ring allows the attachment to be longitudinally re-positioned at an infinite number of positions using a friction fit. Because the O-ring fits loosely within recess 361, the attachment is able to rotate freely about O-ring 360, and therefore also rotate freely around pin 334. In yet another embodiment, both the O-ring 360 and protrusion 348 may be employed in conjunction with tubular pin 334 to provide both longitudinally rigid positioning at discrete intervals, and slipped-fit positioning at locations intermediate the discrete intervals. FIG. 8 is a cross-sectional view of the distal end of the attachment with halves 304 a and 304 b coupled together, and further illustrating the pushbutton 340 in a loose position. In this position, a connector pin 310 of lead 312 (not shown in this view) may be easily inserted into the aperture formed by cut-away areas 342 a and 342 b. A connector pin 310 so inserted is not in intimate contact with aperture 345, and may be easily rotated with respect to the attachment. FIG. 9 is a cross-sectional view of the distal end of the attachment halves 304 a and 304 b coupled together, and further illustrating the pushbutton 340 in a locked position. A connector pin 310 of lead 312 (not shown in this view) inserted into the recesses 338 a and 338 b will be intimate contact with recess 345 so that rotation of the attachment rotates the connector pin 310. When using a lead having a fixed-screw helical electrode, this rotation will rotate the lead body and the helical electrode. When using a lead employing a retractable helical electrode, this rotation will extend or retract the electrode so the helix may be attached to, or detached from, respectively, adjacent tissue. The attachment of the current invention provides a mechanism for easily manipulating a lead assembly with a single hand. Only a single hand is needed to grasp handle assembly 10, to further rotate or slide knob 14 to deflect a distal tip of a guidewire inserted within a lead, and to rotate attachment 304 to facilitate rotation of the entire lead. Furthermore, using the embodiment of FIG. 7, affixing the lead to attachment 304 may be accomplished with a quick snap of pushbutton 340 that may also be performed with the same hand. This easy, one-handed control system of the current invention thus frees up one hand of the physician for other tasks. Modifications to the embodiments discussed above are permissible within the scope of the invention, and the possibility of such modification should be understood in conjunction with the claims that follow. For example, in some embodiments, pin 300 might be eliminated, however, in such embodiments, the available range of longitudinal movement of the attachment 304 relative to the deflectable stylet handle would be reduced somewhat. Similarly, in some alternative embodiments, the recess within the knob or spinner 14 might be reduced or eliminated entirely, with the attachment retained in alignment with and mounted to the deflectable stylet handle only by means of tubular pin 300. Similarly, as noted above, other mechanisms for inducing curvature of the deflectable stylet might be substituted for that employed in the handle as illustrated. For example, a knob or handle might be attached directly to the slider 200 A, and employed to directly move the slider longitudinally, eliminating the necessity for a rotatable knob. As such, the embodiment illustrated above should be considered as exemplary, rather than limiting, when interpreted in conjunction with the claims which follow.

Summary: A deflectable stylet system optimized for use in conjunction with a lead of the type having a fixation helix that is screwed into body tissue by rotation of the lead&#39;s connector pin is disclosed. The system includes an attachment that is rotatable and longitudinally slidable with respect to the handle of a deflectable stylet. A lead coupled to the attachment may be moved longitudinally with respect to a stylet to account for slight variances in the lead length. In one embodiment, the attachment couples to the lead via a pushbutton mechanism that can be locked to the lead using one hand. The attachment may be rotated to thereby rotate the lead connector. This allows for retraction and extension of a retractable fixation helix, and for further attachment or detachment of a fixation helix to adjacent tissue. In one embodiment, the attachment may be longitudinally rigidly positioned in predetermined locations with respect to the handle. According to another aspect of the system, a deflection device is coupled to the handle to facilitate deflection of the stylet. In one embodiment, this deflection device may be rotatably and/or slidably activated to accomplish the stylet deflection. The system allows a user to adjust lead length with respect to the stylet length, and to further perform stylet deflection and lead rotation all with one hand.

big_patent

en

Write a title and summarize: SECTION 1. SHORT TITLE. This Act may be cited as the ``Commonsense Auto Recovery Act of 2009''. SEC. 2. CREDIT FOR SALES TAX ON PURCHASE OF AUTOMOBILE. (a) In General.--Subpart B of part IV of subchapter A of chapter 1 of the Internal Revenue Code of 1986 is amended by inserting after section 30D the following new section: ``SEC. 30E. SALES TAX ON PURCHASE OF AUTOMOBILE. ``(a) In General.--In the case of a qualified taxpayer, there shall be allowed against the tax imposed by this chapter for the taxable year an amount equal to the qualified State and local automobile sales taxes paid by the taxpayer with respect to the purchase of a qualified vehicle in such taxable year. ``(b) Limitation.--For purposes of subsection (a), the purchase price taken into account for purposes of determining qualified State and local automobile sales taxes shall not exceed $50,000. ``(c) Qualified State and Local Automobile Sales Taxes.--For purposes of this section-- ``(1) In general.--The term `qualified State and local automobile sales taxes' means any general sales tax in effect on January 1, 2009, imposed on the purchase of a qualified vehicle. ``(2) General sales tax.--The term `general sales tax' has the meaning given such term by section 164(b)(5), determined without regard to subparagraph (F) thereof. ``(3) Qualified vehicle.--The term `qualified vehicle' means a motor vehicle (as defined in section 30(c)(2)) which does not have more than 2 axles. ``(d) Qualified Taxpayer.--For purposes of this section-- ``(1) In general.--The term `qualified taxpayer' means-- ``(A) an individual, and ``(B) a person who employed an average of less than 50 employees on business days during the taxable year. ``(2) Controlled groups.--For purposes of paragraph (1)(B), all persons treated as a single employer under subsection (b), (c), (m), or (o) of section 414 shall be treated as a single employer. ``(e) No Double Benefit.--The amount of the credit allowed under subsection (a) with respect to any vehicle shall be reduced by the amount of the deduction allowed under section 164 for such vehicle for the taxable year. ``(f) Election To Not Take Credit.--No credit shall be allowed under subsection (a) for any vehicle if the taxpayer elects not to have this section apply to such vehicle. ``(g) Application With Other Credits.-- ``(1) Business credit treated as part of general business credit.--So much of the credit which would be allowed under subsection (a) for any taxable year (determined without regard to this subsection) that is attributable to property of a character subject to an allowance for depreciation shall be treated as a credit listed in section 38(b) for such taxable year (and not allowed under subsection (a)). ``(2) Personal credit.-- ``(A) In general.--For purposes of this title, the credit allowed under subsection (a) for any taxable year (determined after application of paragraph (1)) shall be treated as a credit allowable under subpart A for such taxable year. ``(B) Limitation based on amount of tax.--In the case of a taxable year to which section 26(a)(2) does not apply, the credit allowed under subsection (a) for any taxable year (determined after application of paragraph (1)) shall not exceed the excess of-- ``(i) the sum of the regular tax liability (as defined in section 26(b)) plus the tax imposed by section 55, over ``(ii) the sum of the credits allowable under subpart A (other than this section and sections 23 and 25D) and section 27 for the taxable year. ``(h) Termination.--This section shall not apply with respect to any property purchased after December 31, 2010.''. (b) Conforming Amendments.-- (1)(A) Section 24(b)(3)(B) of such Code is amended by striking ``and 30D'' and inserting ``30D, and 30E''. (B) Section 25(e)(1)(C)(ii) of such Code is amended by inserting ``30E,'' after ``30D,''. (C) Section 25B(g)(2) of such Code is amended by striking ``and 30D'' and inserting ``, 30D, and 30E''. (D) Section 26(a)(1) of such Code is amended by striking ``and 30D'' and inserting ``30D, and 30E''. (E) Section 1400C(d)(2) of such Code is amended by striking ``and 30D'' and inserting ``30D, and 30E''. (2) Section 6501(m) of such Code is amended by inserting ``30E(f),'' after ``30D(e)(9),''. (3) The table of sections for subpart B of part IV of subchapter A of chapter 1 of such Code is amended by inserting after the item relating to section 30D the following new item: ``Sec. 30E. Sales tax on purchase of automobile.''. (c) Effective Date.--The amendments made by this section shall apply to vehicles purchased after December 31, 2008.

Title: To amend the Internal Revenue Code of 1986 to provide a credit for the State and local sales taxes paid on the purchase of an automobile Summary: Commonsense Auto Recovery Act of 2009 - Amends the Internal Revenue Code to allow individuals and small employers a tax credit for state and local sales taxes paid on the purchase of a passenger motor vehicle (not more than two axles) the purchase price of which does not exceed $50,000. Terminates such credit after 2010.

billsum

en

Summarize: By. Richard Spillett. Dale Bolinger is accused of grooming someone he believed was a 14-year-old girl in an online chatroom, where he talked of cannibalism and sexual fantasies. A 'fantasist' nurse with a cannibalism fetish who is accused of sexually grooming a 14-year-old girl online is'more Walter Mitty than Hannibal Lecter', his lawyer told jurors. Dale Bolinger, 58, arranged to meet the girl via a fetish website after telling her he would kill her with an axe and then eat her, Canterbury Crown Court has heard. Father-of-three Bolinger bought the axe from a DIY store in Broadstairs, Kent, the day before he planned to meet the Mexican girl called 'Eva' who was living in Hamburg, Germany. Before retiring to consider their verdict today, jurors heard details of Bolinger's alleged attempt to meet the girl. They were told that the night before their planned meeting, Bolinger - who worked as a registered nurse at nearby Margate hospital - told her: 'Got the axe, you ready to get that train?' 'Eva', whose true identity has never been uncovered, failed to show up at Ashford International Station and Bolinger was later arrested after graphic chat logs on the Dark Fetish Network (DFN) were uncovered. Under cross-examination today, Bolinger said he had been'stupid' and made'very serious mistakes' but that he had not intended to kill or eat 'Eva'. He told police he believed the person he was chatting to online was probably a man in his 30s'surrounded by pizza boxes' who would be dead by his 40s. And he said his motivation for going to Ashford International Station following their agreement to meet was out of concern for 'Eva', if she was in fact aged 14. Bolinger told the court: 'I wasn't going to take off anyone's head. It would have been messy, it would have been horrible.' In his closing speech, Bolinger's defence counsel Paul Jarvis said: 'We say that when you look at all the evidence, it's quite clear that Mr Bolinger is far more Walter Mitty than Hannibal Lecter. 'He is a fantasist and sometimes he goes too far and sometimes he stops, and sometimes - when the person encourages him - the fantasy continues.' He urged the jury not to rely on the chat logs as evidence of truth. Mr Jarvis added: 'What happened here is obvious. There is a man, he might be 39, he may well be in Mexico and he may well have a fantasy about children or girls. 'But he hasn't got anyone to play with, so the way he gets his kicks is to pretend to be someone younger so that he can feed off someone else on the DFN.' The court has been shown a'selfie' picture Bolinger took before a planned meeting with the internet user, in which he shows off an axe he had bought from Homebase after discussing 'execution' online. Under cross-examination, Bolinger repeatedly denied that he believed 'Eva' was a 14-year-old girl, saying his intention in striking up contact with her was to 'feed into her fantasy'. He told jurors: 'I was very stupid and I cannot deny that I have been very stupid and made very serious mistakes, but for those mistakes I have pleaded guilty. 'I didn't believe that it was a 14-year-old or a girl or a child at all. I thought it was an adult male.' Prosecutor Martin Yale has said internet chats involving Bolinger on the DFN site about beheading and eating women and girls were discovered by the FBI in New York. Investigators discovered the email address'meatmarketman' was being used in Kent and Bolinger was arrested after the information was passed to Kent Police. In chats with other users, Bolinger - who used a picture of supermodel Naomi Campbell on his profile - allegedly claimed to have eaten a 39-year-old black woman and a five-year-old child, Mr Yale told jurors. His profile, under the name Chris C, listed his interests as 'cannibalism, mainly the hunting and preparation of young but sometimes not so young women', it is claimed. Bolinger, who was working as a nurse around the time of the online chats, denies a charge of grooming. Referring to the graphic chat logs, Bolinger told the court: 'It was really about wanting to shock people...and seeing how far people wanted to go. In fact, I was running out of ideas.' Bolinger said that had 'Eva' turned up at Ashford International Station, he would have taken her home and contacted social services. Mr Yale suggested that he wanted there to be a meeting between them, but Bolinger replied: 'No I didn't, because if there was I would have been in real trouble. 'What I was hoping for was that she wouldn't turn up, and then I would go back and shout at her, and let her believe I was still interested.' Bolinger, formerly from Canterbury, denies one charge of attempting to meet a girl under the age of 16 following sexual grooming in relation to 'Eva'. Jurors have heard that Bolinger previously pleaded guilty to administering a poison or noxious substance after he put a cloth soaked in dry cleaning fluid over his friend Urlene King's mouth in July 2010. He has also admitted one count of making indecent pseudo photographs of children, and seven counts of publishing an obscene article. Sorry we are not currently accepting comments on this article

Summary: Dale Bolinger, 58, is accused of grooming a girl he thought was 14 online. It is said he discussed sexual fantasies including cannibalism in chat room. He arranged meeting at Kent station but says he was 'concerned' about girl. He denies charge of 'attempting to meet a child following sexual grooming' Despite photo of him with axe, he says the online chats were purely 'fantasy' Giving evidence today, he admitted he had made'very serious mistakes' The jury in the case has now retired to consider its verdict.

cnn_dailymail

en

Summarize: First Lady Michelle Obama and guests applaud as President Barack Obama delivers his 2014 State of the Union address. John Shinkle/POLITICO STATE OF THE UNION 2015 Who’s sitting with Michelle Obama at State of the Union First lady Michelle Obama’s guests for Tuesday’s State of the Union address include the man who was jailed in Cuba, an astronaut and an immigration reform advocate, the White House said Monday. The guests are often hints at big applause lines the White House has planned, for the president’s speech, and one of the most enthusiastic responses could come when the president mentions Alan Gross, the U.S. Agency for International Development subcontractor released by the Cuban government late last year amid a shift in the Obama administration’s Cuba policy. Gross spent nearly five years jailed in Cuba, and his wife, Judy, who advocated for his release, will also be seated near the first lady. Story Continued Below Scott Kelly, who is preparing for a yearlong mission aboard the International Space Station, is another guest. Kelly’s twin brother is retired astronaut Mark Kelly, husband of former Rep. Gabrielle Giffords (D-Ariz.), and scientists aim to compare medical data between the two men during the trip. The research will help “support the next generation of space exploration and President [Barack] Obama’s goal of sending humans to Mars by the 2030s,” the White House said. Also on the list are Ana Zamora, an immigration advocate and DREAMer from Dallas, Ebola aid worker Pranav Shetty and Larry Merlo, the CEO of CVS Health, which last year became the first major retail pharmacy to stop selling tobacco products. The guest list Rebekah Erler (Minneapolis) Letter writer Rebekah Erler, 36, is a working mother from Minneapolis. When her husband Ben’s construction business dried up amid the recession, she enrolled in community college and got work as an accountant to help keep her family afloat. Victor Fugate (Kansas City, Mo.) Letter writer Fugate went back to school after losing his job as a financial counselor and now works at the Missouri Department of Mental Health, where he helps low-income people obtain health care. Staff Sgt. Jason Gibson, U.S. Army, Ret. (Westerville, Ohio) Letter writer, wounded warrior Gibson, a veteran of Afghanistan, lost both his legs in the line of duty, but has since taken up surfing, skiing and flying. He first met Obama in 2012 while a patient at Walter Reed. Alan and Judy Gross (Washington, D.C.) USAID subcontractor Gross was imprisoned in Cuba for five years for crimes against the Cuban state. His Dec. 17 release paved the way for the administration to move toward normal relations with the island nation. Nicole Hernandez Hammer (Southeast Florida) Mother and sea level rise researcher Hernandez is an immigrant from Guatemala who researches the consequences of rising sea levels. She’s raised awareness of climate change’s implications for children’s health and its disproportionate impact on American Hispanics. Scott Kelly (Houston) American astronaut Kelly will blast off in March to become the first American astronaut to complete a year-long mission on the International Space Station. He has already spent more than 180 days in space. Anthony Mendez (Bronx, N.Y.) Student, “Reach Higher” Initiative Mendez is a freshman at the University of Hartford. He overcame hardship growing up in the South Bronx, where he lived for a time in a homeless shelter, to become the first member of his family to graduate high school. Larry Merlo (East Greenwich, R.I.) President and CEO, CVS Health Merlo leads CVS Health, formerly CVS, which last year became the first major retail pharmacy to stop selling tobacco products as part of its pivot toward the health care sector. Katrice Mubiru (Woodland Heights, Calif.) Letter writer, career technical education teacher Astrid Muhammad (Charlotte, N.C.) Letter writer Muhammad, a 39-year-old mother from North Carolina, wrote to Obama about her experience obtaining insurance through the Affordable Care Act. In August, she had life-saving surgery to remove a brain tumor, a preexisting condition that would not have been covered by insurance before the law’s passage. Hover over the dots to learn more about Michelle Obama's guests. Getty Image Capt. Phillip C. Tingirides (Irvine, Calif.) Los Angeles Police Department Tingirides, a 35-year veteran of the LAPD, leads the department’s Community Safety Partnership, which encourages dialogue between police and community members in the Watts neighborhoods. The program has contributed to a 50 percent reduction in violent crime in part of the neighborhood. Catherine Pugh (Baltimore City, Md.) Maryland Senate majority leader As a state senator, Pugh worked on passage of Maryland’s $10.10 minimum wage and recently introduced a bill that would grant workers paid sick leave. Pranav Shetty (Washington, D.C.) International Medical Corps Shetty is the Global Emergency Health Coordinator for International Medical Corps, which is working to contain the Ebola outbreak in West Africa. He has also worked on public health crises in Haiti, Libya, South Sudan, Jordan, Iraq, and the Philippines. Ana Zamora (Dallas) Letter writer, student, DREAMer Zamora, a DREAMer from Dallas, came to the United States as an infant and has gained work authorization through the administration’s Deferred Action for Childhood Arrivals program. She has siblings who are citizens, making her parents eligible for the administration’s Deferred Action for Parents of Americans and Lawful Permanent Residents program, announced in November. Malik Bryant (Chicago) Letter writer Chelsey Davis (Knoxville, Tenn.) Student, Pellissippi State Community College William Elder Jr. (Englewood, Colo.) Medical school student LeDaya Epps (Compton, Calif.) Laborer apprentice Kathy Pham (Washington, D.C.) United States Digital Service Carolyn Reed (Denver) Letter writer, small-business owner Prophet Walker (Carson, Calif.) Watts United Weekend, co-founder Tiairris Woodward (Warren, Mich.) Chrysler auto worker — Provided by the White House White House announces State of the Union guests Take a look back at President Obama's last five State of the Union speeches to see the similarities and differences. VPC First lady Michelle Obama and guests at the 2012 State of the Union Address. (Photo: H. Darr Beiser, USA TODAY) Former Cuba prisoner Alan Gross and astronaut Scott Kelly will be among first lady Michelle Obama's guests at Tuesday night's State of the Union Address, the White House announced Monday. The 22 guests also include students and educators, health care officials and recipients, government officials, and a wounded veteran who fought in Afghanistan. Some of the guests wrote letters to Obama about various issues. The invitees symbolize some of the themes of Obama's speech, such as his recent decision to normalize relations with Cuba following Gross' release. The White House list, in alphabetical order: Malik Bryant (Chicago), letter writer The 13-year-old sent a letter to Santa over the holidays, but rather than request the usual gifts, Malik wrote: "All I ask for is for safety I just wanna be safe." Chelsey Davis (Knoxville, Tenn.), student, Pellissippi State Community College A native of Jefferson City, Davis decided that community college was the best path to re-enter her collegiate career with the ideal support and resources. Chelsey Davis, a student at Pellissippi State Community College, will be a guest of the first lady for the State of the Union Address on Jan. 20, 2015. (Photo: Jessie Tipton, Pellissippie State Comm. College) William Elder Jr. (Englewood, Colo), medical school student Elder graduated from Stanford and is currently a third-year medical student at the Boonshoft School of Medicine at Wright State University in Ohio. He was diagnosed with cystic fibrosis when he was 8 years old, at a time when most cystic fibrosis patients were only expected to live to early adulthood. LeDaya Epps (Compton, Calif.), laborer apprentice Epps never had things handed to her. Born in Compton and raised in the Los Angeles foster care system until she was a teenager, Epps graduated high school but found it difficult to secure a stable job, bouncing from job to job as a medical assistant for years. That changed when she was afforded the opportunity to complete a union apprenticeship in construction. Rebekah Erler (Minneapolis), letter writer Erler is a 36-year-old working wife and mother of two preschool-aged boys. Her family was hit hard by the downturn in the housing market when her husband's construction business went under. After relocating from Seattle to Minneapolis and a number of difficult jobs, Erler's husband is now back in the re-modeling industry, gets home in time for dinner each night with their family, and is enjoying continued professional growth. President Obama has lunch with Rebekah Erler at Matt's Bar in Minneapolis on June 26, 2014. (Photo: Pablo Martinez Monsivais, AP) Victor Fugate (Kansas City, Mo.), letter writer Fugate first wrote to the president three years ago, sharing how he went from being an unemployed new father continuing his education to obtaining his degree and working with low-income patients to obtain medical care. Retired Army Staff Sgt. Jason Gibson (Westerville, Ohio), letter writer, wounded warrior Gibson first met Obama in 2012 at Walter Reed while recovering from injuries he sustained serving his country in Afghanistan. In October, Gibson wrote a letter to thank the president for visiting him as he recuperated and to underscore that "there is life after a traumatic event and good can come of all things." Alan and Judy Gross (Washington) After five years of wrongful imprisonment in Cuba, USAID sub-contractor Alan Gross was reunited with his wife Judy and his family on Dec.17. That same day, Obama announced that the United States was changing its relationship with the people of Cuba. Alan Gross holds his wife Judy's hand during a news conference at his lawyer's office in Washington, on Dec. 17, 2014. (Photo: Pablo Martinez Monsivais, AP) Nicole Hernandez Hammer (Southeast Florida), mother and sea level rise researcher Growing up in South Florida, Hammer knows firsthand the impacts of climate change and sea level rise and is raising awareness to the disproportionate effects felt along the coast and beyond. As a sea level researcher, she has studied how cities and regions most vulnerable to the effects of climate change also have large concentrations of Hispanics. Scott Kelly (Houston), astronaut This March, Kelly will launch to the International Space Station and become the first American to live and work aboard the orbiting laboratory for a year-long mission. NASA astronaut Scott Kelly gives a press conference on Dec. 18, 2014, in Paris. (Photo: Patrick Kovarik, AFP/Getty Images) Anthony Mendez (Bronx, N.Y.), student, "Reach Higher" Initiative Growing up in the South Bronx with his mother and three siblings, Mendez names two experiences from his formative high school years. In ninth-grade, his best friend was murdered in his neighborhood, and the next year his family was evicted from their home and moved into a homeless shelter. Living two hours away from school, for six months Mendez had to wake up at 4:30 a.m. to continue his education. Overcoming these experiences, he became the first high school graduate in his family – his story of perseverance represents the core of first lady Michelle Obama's Reach Higher initiative. Larry J. Merlo (East Greenwich, R.I), president and CEO, CVS Health Merlo, 59, is president and chief executive officer of CVS Health, which serves 100 million people each year through its 7,800 retail pharmacies, 900 walk-in medical clinics, and a pharmacy benefits manager with nearly 65 million plan members. Katrice Mubiru (Woodland Heights, Calif.), letter writer, career technical education teacher In January 2012, Mubiru, a career-technical education teacher for the Los Angeles unified school district, sent a letter to the president encouraging him to support K-12, adult and career technical education. Astrid Muhammad (Charlotte, N.C.), letter writer Muhammad, a wife and mother of 6- and 10-year-olds, was diagnosed with a brain tumor in May 2013, but at the time she didn't have health insurance and delayed treatment. Last year, she enrolled in the Marketplace and obtained health insurance. Prior to the Affordable Care Act, insurance companies could have refused treatment for her pre-existing tumor, but on Aug. 28 — now fully insured — she had surgery to remove the tumor. Kathy Pham (Washington), United States Digital Service Pham is a computer scientist with a passion for public service. Throughout her career, she has used technology to tackle pressing challenges. From Google to IBM to Harris Healthcare Solutions, she has designed health care interoperability software, studied disease trends with data analytics, and built data warehouses for hospitals. Capt. Phillip C. Tingirides (Irvine, Calif.), Los Angeles Police Department The south Los Angeles neighborhood of Watts has seen dramatic improvement in the crime rate since the area was tied to the eponymous race riots of 1965 and a spate of gang violence in the '90s — and Tingirides has worked toward and seen a continued decrease in crime since the start of the Community Safety Partnership program in late 2011. Catherine Pugh (Baltimore City, Md.), Maryland Senate majority leader State Sen. Pugh is a small-business owner who currently serves as the Maryland Senate majority leader and is also president-elect of the National Black Caucus of State Legislators. Carolyn Reed (Denver), letter writer, small-business owner Reed wrote to the president about how she was able to expand her small business and open an additional Silver Mine Subs shop in Denver thanks to a loan from the Small Business Administration. Dr. Pranav Shetty (Washington), International Medical Corps Dr. Shetty is the global emergency health coordinator for International Medical Corps, a critical partner in the U.S.-supported effort to bring the Ebola epidemic under control in West Africa. Prophet Walker (Carson, Calif.), Watts United Weekend, co-founder While serving a six-year prison sentence for robbery, Walker, now 27, vowed never to get caught in the revolving door of a life of crime and continued incarceration. He turned his focus to education, starting a program in prison that provides fellow inmates a chance to complete a two-year degree. Prophet Walker, 27, is the co-founder of Watts United Weekend. (Photo: Donato Sardella, Getty Images for Coalition for E) Tiairris Woodward (Warren, Mich.), Chrysler auto worker Working for the local school system, Woodward, 43, wasn't making enough money to support herself and her three children, the youngest of whom has special needs. She started working for Chrysler in 2010 on the assembly line, and after doing both jobs full time, working 17 hours a day, Tiairris was in a position to move solely to Chrysler — a union job that makes her a member of United Auto Workers Local 7. Ana Zamora (Dallas), letter writer, student, DREAMer Zamora wrote to the president in September, "as with any other dreamer, my parents came to this country with a dream of a better future for their children." And through the Administration's Deferred Action for Childhood Arrivals (DACA) program, Zamora is closer than ever to fulfilling those dreams. Read or Share this story: http://usat.ly/1Bt58kS President Obama will deliver his State of the Union address Tuesday enjoying rising approval ratings that have been strengthened by rapidly improving perceptions of the economy and increased optimism about the overall direction of the country, according to a new Washington Post-ABC News poll. For the first time in his presidency, Obama will address a Congress fully in the hands of Republicans. And the divided government reflects a divided America. Along party lines, the public is sharply at odds about whether the country should go in the direction Obama wants to lead or where Republicans prefer to go. Despite the partisan divisions on most issues, a substantial majority of Americans continue to see political dysfunction in Washington as a big problem. After years of political standoffs, there is considerable skepticism about whether the two sides can overcome their political differences to ease what has become a chronic problem. Obama’s overall approval rating now stands at 50 percent, the highest in a Post-ABC poll since spring 2013. His standing is nine points higher than in December and seven points higher than in October, just before Republicans captured control of the Senate, increased their House majority to its highest level in eight decades and recorded advances in the states. The Post-ABC survey puts the president’s approval rating slightly higher than some other recent public polls. But most have shown improvement since the November elections as the president has moved aggressively and unilaterally on issues such as immigration and climate change. View Graphic Reviving economy pays dividends for Obama The bigger factor helping to boost his standing is a series of economic indicators that have shown steadily improving conditions. Sharply lower gasoline prices have contributed to the sense of better economic times. A Washington Post analysis estimates that those plummeting prices put an extra $7.50 into the wallets of average Americans during the first week of this year, compared with the same week last year. Consumer confidence is now at its highest level since the Great Recession began in 2008. Americans see the state of the economy and the direction of the country in negative terms. Roughly 6 in 10 Americans describe the economy as “not so good” or “poor,” and about the same percentage say that things have gotten pretty seriously off-track when it comes to the overall direction of the nation. A majority of Democrats are bullish; a bigger majority of Republicans are bearish. Independents are closer to Republicans than to Democrats in their assessment. But evidence of an easing of pessimism is clear. The 41 percent who say they see the economy in positive terms compares with just 27 percent who expressed that view in October. Those saying the country is headed in the right direction, although still a minority overall, have increased by 11 points in that same time period. The last time public optimism about the direction of things was this high was in spring 2013. Greater optimism also is reflected in Obama’s economic approval ratings, which now stand even, with 48 percent approving and 48 percent disapproving. It is the first time less than a majority of Americans have disapproved of his handling of the economy since summer 2013. Obama enjoys other advantages as he and the new Congress begin the year. On some early confrontations between the White House and congressional Republicans, the president has the public on his side. These include the issue of the Keystone XL pipeline, which Republicans want to build without the president’s approval. Obama, threatening a veto of their legislation, says he will await a review before making a decision. Six in 10 agree with the president’s position. Congressional Republicans favor legislation that would change the new health-care law to say that companies with 50 or more employees must provide health insurance to anyone who works 40 hours or more, rather than the current 30-hour threshold. A slight majority favors leaving it at 30 hours. Obama’s new proposal to provide free tuition for community college also enjoys majority support. But on one big issue, Republicans have public opinion on their side. That is over the question of Obama’s executive action to shield millions of illegal immigrants from the threat of deportation. Many congressional Republicans want to block the move, with the House passing a bill last week that would do just that. The future of the legislation is uncertain, but a majority of Americans (56 percent) say Obama’s action should be blocked. The new poll underscores the nation’s political divisions. Americans are almost evenly divided over who is taking a stronger leadership role in Washington, with 42 percent saying Obama and 40 percent citing congressional Republicans. Divisions are equally sharp over whether the country should follow Obama’s lead or that of the GOP. Those closely divided results, however, are starkly different from those recorded eight years ago after Democrats took full control of Congress heading into the final two years of President George W. Bush’s administration. At that point, the public favored following the lead of congressional Democrats over Bush by more than 2 to 1. But if the president takes some confidence from that, another set of findings signal the depth of the divisions that have led to gridlock in recent years. By narrow margins, Americans say both that the president is justified in taking executive action to achieve his goals if Congress doesn’t act and that congressional Republicans are justified in trying to block those actions in court or through legislation. A plurality of Americans say they trust Obama over the Republicans to handle the nation’s biggest problems (40 percent to 36 percent). That represents a shift toward Obama in the past month. But compared with public sentiment right after he was reelected in 2012, Obama enjoys far less confidence from the public. At that time, the public said they trusted Obama over Republicans by 15 points. On specific issues, Obama is seen as having better ideas for helping the middle class and creating jobs, and he holds big margins on dealing with climate change and helping students afford college. Republicans are seen as having better ideas on encouraging economic development. Neither side has an advantage on who has better ideas to increase homeownership. Nine in 10 Americans say government dysfunction is a problem, with 2 in 3 calling it a major problem. Asked who is responsible, they blame both sides equally. Almost half say things will stay about the same in the next year, with about 3 in 10 saying things will get worse and 1 in 4 saying they will get better. The previous Congress, with Republicans in control of the House and Democrats in control of the Senate, was one of the least productive in history. Asked how they see the future with Republicans now in full control, a third of Americans say they believe the new Congress will do a better job. A fifth say it will be worse, and virtually all the rest say things will stay about the same. Obama owes his rising approval ratings to better economic times, but the shifts among demographic groups also show that his greatest gains have come among those who are part of his coalition. Since December, his numbers have increased by 10 points among Democrats and moderates, by 22 points among Hispanics and by 19 points among those ages 18 to 29. His approval rating is also higher by 11 points among conservatives. Through most of last year, Obama’s approval ratings hovered in the mid- to low 40s, with suggestions that he was following a downward trajectory that was similar to that of Bush in his second term. But the current poll moves him in a different direction, at least for now. Obama’s approval ratings at this point in his presidency are similar to those of Ronald Reagan’s as he began his final two years in office. They are lower, however, than those of Bill Clinton at the start of his second term. One big difference between now and the time of Reagan’s presidency is the sharply polarized political environment and the partisan divisions it has engendered. Obama has a 71-point partisan gap (the difference between his approval among Democrats vs. Republicans) while Reagan’s was 52 points. The Post-ABC poll was conducted Jan. 12 to 15 among a random national sample of 1,003 adults interviewed by telephone, including 311 cellphone-only respondents. The overall margin of error is plus or minus 3.5 percentage points. Peyton M. Craighill contributed to this report.

Summary: President Obama goes into tomorrow's State of the Union address with some momentum: A Washington Post-ABC News poll finds his approval rating now stands at 50%, which is the highest since spring 2013; improving views on the economy are a big factor, the Post reports. Meanwhile, the White House has released a list of Michelle Obama's guests for the event-a list that likely offers a preview of some of the issues the president will address. Among those guests, per Politico and USA Today: Alan Gross, a US subcontractor, was recently freed from five years of detention in Cuba; he rejoined his wife, Judy, the day President Obama announced warming relations with Cuba. Larry Merlo is CEO of CVS Health, which recently stopped selling tobacco products. Pranav Shetty led a pair of Ebola treatment units in Liberia, the White House says. Ana Zamora is one of a number of guests who caught the president's attention through letters. She's a student who has benefited from Obama administration programs to ease restrictions on migrants who arrived in the US as kids. Scott Kelly is an astronaut who's about to spend a year aboard the International Space Station; the work is aimed at helping send people to Mars "by the 2030s," per the White House. Malik Bryant is another letter writer. For Christmas, the boy from Chicago wrote to Santa Claus: "All I ask for is for safety I just wanna be safe." His letter made it to the president. Click for the full list.

multi_news

en

Summarize: FIELD OF INVENTION The present invention relates to a reversible belt, or strap, and its method of manufacture. BACKGROUND OF INVENTION Various type of belts and straps are used for a variety of utilitarian and decorative purposes. For example, a belt or strap is used to bundle material, to hold clothing onto a person, to cinch a garment, such as a dress, etc. In many cases, in addition to serving the utilitarian function the belt is often made to have decorative characteristics. Various types of belts are available and they are made of many type of materials, such as fabric, leather, etc. Where belts are made of fabric it is sometimes desirable to make them reversible so that if one side wears or is permanently stained, the belt can be reversed to show the side without the wear or stain. When the belt also is to have decorative aspects, making the belt reversible permits two types of decorative effects, one on each side of the belt. It is preferred that the manufacture of such reversible fabric belts be carried out in a manner that is economical and efficient. OBJECTS OF THE INVENTION It is therefore an object of the present invention to provide a reversible belt and its method of manufacture. A further object is to provide a reversible fabric belt made of two sections joined together and a method of manufacture. An additional object is to provide a reversible belt of a predetermined thickness made by joining together two sections each formed by a fabric strip folded over and around a strip of filler material which are joined together with an intermediate strip of reinforcing material. SUMMARY OF THE INVENTION The present invention is directed to a reversible fabric belt and its method of manufacture. In accordance with the invention the belt is made of two similar sections. Each of the belt sections is formed by a strip of the fabric that is folded over and around a strip of filler material without being sealed or attached to the filler and, preferably, without the opposing edges of the fabric overlapping after being folded over the filler strip. The two belt sections are arranged with the faces having the edges of the folded fabric facing each other and a strip of reinforcing material is placed therebetween. The sections of the belt are then sewn through along the edges of the fabric and reinforcing material. The resulting belt has the thickness of the two sections, each with its fabric and filler strip, and the intermediate reinforcing strip between the two belt sections. The fabric strip of each belt section can be of the same or different material to produce desired strength and/or decorative characteristics. BRIEF DESCRIPTION OF THE DRAWINGS Other objects and advantages of the present invention will become more apparent upon reference to the following specification and annexed drawings in which: FIG. 1 is a perspective view of one of the belt sections; FIGS. 2(a)-2(d) are end elevational views of the reversible belt showing the various steps in its manufacture; FIG. 3 is a perspective view of a portion of a finished reversible belt in accordance with the invention; and FIG. 4 is a schematic diagram of a system for making the reversible belt on a continuous basis. DETAILED DESCRIPTION OF THE INVENTION Referring to FIGS. 1-3, according to a preferred embodiment, the invention, a reversible belt 10, has two sections 20-1 and 20-2. Each of the sections 20-1 and 20-2 is formed in a similar manner. First, a strip of fabric 30 of the desired length and width is provided. The fabric can be of any desired type. One type found suitable is a 100% polyester fabric that can be of any desired weight (thickness), weave and color, including decorative colors and patterns. A strip 40 of a filler material is placed on the strip of fabric 30 leaving an overhanging part 31 of fabric on each edge of the filler material strip. The filler material strip 40 is to give body to the belt section 20 and can be, for example, of a fibrous polyester material, such as a non-woven polyester material. As seen in FIGS. 2(a) and 2(b), in making a belt section 20, the overhanging part 31 of the fabric strip 30 on each side of the strip of filler material 40 is folded over and around the elongated corresponding edges of the filler material strip. This is shown by the arrows of FIG. 1 and the completed folded sections 20-1 and 20-2 of FIGS. 2(b) and 2(a). The folding of the fabric overhang part 31 can be accomplished by hand, by folding leaves or by other suitable means. It is preferred that the edges of the fabric overhang parts 31 do not overlap when they are folded so that a small gap 32 is left between the opposing edges of the fabric folded over the filler material strip. If desired, the edges of the overhanging part 31 can be left to overlap after being folded over the filler material strip 40. In some cases this is done when it is desired to increase the thickness of the finished belt. At least two of the belt sections 20-1 and 20-2 are needed to form the reversible belt 10 of the invention. The fabric of each of the two sections 20 can be of the same material or of different materials. That is, the fabric 30 of each of the two sections can be of different type, thickness, color, etc. It is preferred that the fabric strip of each of the sections be oriented to optimize the desired strength and/or decorative pattern of the belt. For example, if the fabric has a bias to its weave, the line of the bias can be at an angle to the longitudinal axis of the fabric strip and the direction of the bias line of the two strips reversed. This would achieve maximum strength for the belt in its longitudinal direction. As seen in FIGS. 2(a) and 2(b), the two belt sections 20-1 and 20-2 are placed with the edges of the folded fabric overhanging parts 31, and gaps 32 where used, facing each other. When the sections have the gaps 32 between the edges of the folded fabric strip, it is preferred that the gaps be offset from each other, as shown in FIGS. 2(a) and 2(b) so that the finished belt will have a more uniform thickness across its width. The same is true if the edges of the overhang parts overlap. In FIG. 2(c) it is seen that a strip of reinforcing material 50 is placed between the two opposing belt strip sections 20-1 and 20-2. The reinforcing material strip 50 provides a degree of stiffness to the finished belt and can be made, for example, of PERMAFUZE. This material is a composite of cotton and polypropylene. Other suitable materials can be used. As seen in FIGS. 2(d) and 3, the two belt strip sections 20-1 and 20-2 are brought together and sewn along the side edges of the fabric 30 by any conventional sewing technique with stitches 60. The stitches 60 pass through the fabric and through the reinforcing strip 50. The completed reversible belt is shown in FIG. 3. The two sections 20-1 and 20-2 are shown as is the reinforcing strip 50 and the stitches 60. A part of a metal ferrule 70 that can be placed on the end of the finished belt is shown partly broken away. A buckle, not shown, can be on the other end of he belt. As seen, the completed reversible belt has considerable strength in the longitudinal direction since it effectively formed by four layers of the fabric. The belt is reversible since the outer layer of fabric of each of the sections 20-1 and 20-2 can be the same or have a desired different color or pattern. To increase the thickness of the belt, additional sections 20 can be used. For example, there can be three sections 20 stacked one upon the other. Also, a strip of the reinforcing material 50 can be placed between each pair of belt sections. The reversible belt can be made on sequential basis one at a time by making individual sections 20 of the desired length and joining two of the sections together with the intermediate reinforcing material strip 50. A belt section 20 also can be made on a continuous basis and a system for accomplishing this is illustratively shown in FIG. 4 in schematic form. As seen in FIG. 4, there are two sets of rolls of each of the fabric strip material 30 and the filler strip material 40. The two strips of material 30 and 40 of each set of rolls of the material are fed on a continuous basis through a respective chute 75 that folds the overhanging parts 31 of the fabric strip 30 over the filler material strip 40 to form the respective belt sections 20-1 and 20-2. A roll of the reinforcing strip material 50 is fed between the two belt sections 20-1 and 20-2. The assembly of the two sections 20-1 and 20-2 and intermediate strip of reinforcing material 50 is passed through a collar 78 that presses the components together. A dual needle or dual head sewing machine 80 is located at he outlet end of the collar 78 and makes the stitches 60 on each side of the reinforcing strip 50. The continuous reversible belt leaving the sewing machine is cut to the desired lengths and a ferrule and buckle applied as desired.

Summary: A reversible belt and method of manufacture in which an elongated strip of fabric is folded over and around a strip of filler material to form a belt section and two such sections are stacked in opposing relationship with a strip of a reinforcing material therebetween. The belt sections with the intermediate strip of material are joined together by a row of stitches along each edge of the belt with the stitches passing through the fabric of the sections and the reinforcing material.

big_patent

en

Summarize: Jimmie had an idea it wasn't common courtesy for a friend to come to one's home and ruin one's sister. But he was not sure how much Pete knew about the rules of politeness. The following night he returned home from work at rather a late hour in the evening. In passing through the halls he came upon the gnarled and leathery old woman who possessed the music box. She was grinning in the dim light that drifted through dust-stained panes. She beckoned to him with a smudged forefinger. "Ah, Jimmie, what do yehs t'ink I got onto las' night. It was deh funnies' t'ing I ever saw," she cried, coming close to him and leering. She was trembling with eagerness to tell her tale. "I was by me door las' night when yer sister and her jude feller came in late, oh, very late. An' she, the dear, she was a-cryin' as if her heart would break, she was. It was deh funnies' t'ing I ever saw. An' right out here by me door she asked him did he love her, did he. An' she was a-cryin' as if her heart would break, poor t'ing. An' him, I could see by deh way what he said it dat she had been askin' orften, he says: 'Oh, hell, yes,' he says, says he, 'Oh, hell, yes.'" Storm-clouds swept over Jimmie's face, but he turned from the leathery old woman and plodded on up-stairs. "Oh, hell, yes," called she after him. She laughed a laugh that was like a prophetic croak. "'Oh, hell, yes,' he says, says he, 'Oh, hell, yes.'" There was no one in at home. The rooms showed that attempts had been made at tidying them. Parts of the wreckage of the day before had been repaired by an unskilful hand. A chair or two and the table, stood uncertainly upon legs. The floor had been newly swept. Too, the blue ribbons had been restored to the curtains, and the lambrequin, with its immense sheaves of yellow wheat and red roses of equal size, had been returned, in a worn and sorry state, to its position at the mantel. Maggie's jacket and hat were gone from the nail behind the door. Jimmie walked to the window and began to look through the blurred glass. It occurred to him to vaguely wonder, for an instant, if some of the women of his acquaintance had brothers. Suddenly, however, he began to swear. "But he was me frien'! I brought 'im here! Dat's deh hell of it!" He fumed about the room, his anger gradually rising to the furious pitch. "I'll kill deh jay! Dat's what I'll do! I'll kill deh jay!" He clutched his hat and sprang toward the door. But it opened and his mother's great form blocked the passage. "What deh hell's deh matter wid yeh?" exclaimed she, coming into the rooms. Jimmie gave vent to a sardonic curse and then laughed heavily. "Well, Maggie's gone teh deh devil! Dat's what! See?" "Eh?" said his mother. "Maggie's gone teh deh devil! Are yehs deaf?" roared Jimmie, impatiently. "Deh hell she has," murmured the mother, astounded. Jimmie grunted, and then began to stare out at the window. His mother sat down in a chair, but a moment later sprang erect and delivered a maddened whirl of oaths. Her son turned to look at her as she reeled and swayed in the middle of the room, her fierce face convulsed with passion, her blotched arms raised high in imprecation. "May Gawd curse her forever," she shrieked. "May she eat nothin' but stones and deh dirt in deh street. May she sleep in deh gutter an' never see deh sun shine agin. Deh damn--" "Here, now," said her son. "Take a drop on yourself." The mother raised lamenting eyes to the ceiling. "She's deh devil's own chil', Jimmie," she whispered. "Ah, who would t'ink such a bad girl could grow up in our fambly, Jimmie, me son. Many deh hour I've spent in talk wid dat girl an' tol' her if she ever went on deh streets I'd see her damned. An' after all her bringin' up an' what I tol' her and talked wid her, she goes teh deh bad, like a duck teh water." The tears rolled down her furrowed face. Her hands trembled. "An' den when dat Sadie MacMallister next door to us was sent teh deh devil by dat feller what worked in deh soap-factory, didn't I tell our Mag dat if she--" "Ah, dat's annuder story," interrupted the brother. "Of course, dat Sadie was nice an' all dat--but--see--it ain't dessame as if--well, Maggie was diff'ent--see--she was diff'ent." He was trying to formulate a theory that he had always unconsciously held, that all sisters, excepting his own, could advisedly be ruined. He suddenly broke out again. "I'll go t'ump hell outa deh mug what did her deh harm. I'll kill 'im! He t'inks he kin scrap, but when he gits me a-chasin' 'im he'll fin' out where he's wrong, deh damned duffer. I'll wipe up deh street wid 'im." In a fury he plunged out of the doorway. As he vanished the mother raised her head and lifted both hands, entreating. "May Gawd curse her forever," she cried. In the darkness of the hallway Jimmie discerned a knot of women talking volubly. When he strode by they paid no attention to him. "She allus was a bold thing," he heard one of them cry in an eager voice. "Dere wasn't a feller come teh deh house but she'd try teh mash 'im. My Annie says deh shameless t'ing tried teh ketch her feller, her own feller, what we useter know his fader." "I could a' tol' yehs dis two years ago," said a woman, in a key of triumph. "Yessir, it was over two years ago dat I says teh my ol' man, I says, 'Dat Johnson girl ain't straight,' I says. 'Oh, hell,' he says. 'Oh, hell.' 'Dat's all right,' I says, 'but I know what I knows,' I says, 'an' it 'ill come out later. You wait an' see,' I says, 'you see.'" "Anybody what had eyes could see dat dere was somethin' wrong wid dat girl. I didn't like her actions." On the street Jimmie met a friend. "What deh hell?" asked the latter. Jimmie explained. "An' I'll t'ump 'im till he can't stand." "Oh, what deh hell," said the friend. "What's deh use! Yeh'll git pulled in! Everybody 'ill be onto it! An' ten plunks! Gee!" Jimmie was determined. "He t'inks he kin scrap, but he'll fin' out diff'ent." "Gee," remonstrated the friend. "What deh hell?"

Summary: Jimmie starts to get a little irked about Pete coming by and compromising his sister's reputation. A neighbor provokes Jimmie even more by reporting that she overheard Maggie basically begging Pete to love her. This can only mean one thing: Maggie has not acted so ladylike. He reports to his mom that Maggie has "gone teh deh devil". So much for sibling loyalty, we guess... Mary is thoroughly perplexed about how Maggie could have become such a bad girl after being raised in such a decent and morally upstanding household. Why? Why? Why? It doesn't help that Mary curses her daughter, but Jimmie's off to take care of business in the form of--you guessed it--a brawl. Bring it on.

booksum

en

Summarize: CROSS REFERENCE TO RELATED APPLICATIONS This application is a continuation-in-part of U.S. patent application Ser. No. 11/252,680, filed Oct. 18, 2005, the teachings of which are hereby incorporated by reference, and a continuation-in-part of U.S. patent application Ser. No. 11/737,073, filed Apr. 18, 2007, the teachings of which are hereby incorporated by reference. BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to orthopedic devices and treatment methods. More particularly, the present invention relates to orthopedic devices and methods utilizing a plurality of discrete pressure points. 2. Description of the Related Art Strained, fatigued, or otherwise injured muscles are generally treated by the use of non-steroidal anti-inflammatory, drugs (NSAIDs) prior to, after, or during physical activities. External support devices, such as bandages, slings, or braces, are also often used to treat injured muscles prior to, after, or during physical activities. The aforementioned devices typically elicit a therapeutic benefit on injured muscles by providing support, inhibiting the massive movement of extensor and flexor muscles, absorbing shock, and may enable the warming or cooling of injured muscles. Chinese acupuncture, well known and recognized worldwide, but not fully appreciated, can also be used for treating injured muscles. During acupuncture therapy, needles are inserted into the body at defined bioactive points. The needles usually remain in the body for a defined period of time. The administration of acupuncture therapy requires a skilled, and in some localities a certified, practitioner. Acupressure is a derivation of acupuncture therapy. During acupressure therapy, a skilled practitioner applies mechanical pressure to specific bioactive points, while being careful to not apply a harmful amount of pressure. SUMMARY OF THE INVENTION The present invention is directed towards an apparatus and method for the providing therapy to injured muscles before, during, and/or after physical activity. Capable of self-administration by the user, the present invention avoids the need of skilled and/or certified practitioners. Not requiring the insertion of needles and/or similar devices into the body, the present invention avoids the risk of infection associated with acupuncture therapy. Providing therapeutic pressure simultaneously along multiple points and/or in different directions, such as, but not limited to, radial, longitudinal, and/or any combination thereof, the present invention may elicit superior a therapeutic effect than conventional tension bandages. In addition to the previously enumerated advantages over the short comings of the existing devices and methods, the present invention may also provide additional advantages and improvements that will be recognizes by people of ordinary skill in the art upon review of the present disclosure. The method of the present invention comprises the steps of pressing a plurality of pressure applicators against the skin proximate to and/or over a muscle for a sustained period of time. The pressure applicators pressed against the skin can be either pins, support members, and/or any combination thereof. An apparatus in accordance with the present invention comprises a therapeutic body, a therapeutic surface on one side of the therapeutic body, and plurality of pressure applicators. The pressure applicators comprise a base secured to the therapeutic surface and a distal end extending away from the therapeutic surface. The pressure applicators may apply a generally directed pressure radially and longitudinally to the muscle being treated. The pressure applicators may also absorb shock. When the plurality of pressure applicators comprises in whole or in part a plurality of pins, the density of the pins on the therapeutic surface should be between density between 3 pins/cm 2 and 1,000 pins/cm 2. Each pin is defined as an ordinary pin or similar protrusion providing pressure at a localized region. A plurality of pins with a density between 3 pins/ cm 2 and 1,000 pins/cm 2 may concentrate pressure at multiple locations over the muscle being treated. The use of a plurality pins will typically distribute the force applied to the skin surface by each pin, thereby preventing the insertion, or penetration, of the pins into the body. The use of multiple pins may also stimulate dendrites beneath the area of the skin to which the pins are pressed. Contacting the skin at various orientations with the respect to skin surface, and the use of multiple pins may stretch the skin surface as to open pores within the skin. The pins utilized with the present invention may have a pointed, conical, spherical, or curvilinear distal end. Different configurations of the distal ends of the pins may be useful for different therapeutic purposes. For instance, pins with pointed distal ends may be utilized to relieve acute muscle. Spherical or rounded distal ends may be utilized relieve prolonged pain and/or muscle tension. When the plurality of pressure applicators comprises in whole or in part support members, the support members chosen should have an arced cross section on at least one axis transecting the support member, with the apex of the arc extending away from the therapeutic surface. Before, during, and/or after physical activity, the support members are placed in contact with the body proximate to and/or over an injured muscle, with the therapeutic surface facing the skin. Pressure is then applied to the support members as a whole. The applied pressure is distributed amongst the support members contacting the body. Translating the pressure applied to the support member into a compressive stress, the arched cross-sections of the support members provides a supportive pressure to a muscle. When the present invention is pressed to the skin, the support members may elicit a therapeutic effect on a muscle proximate to and/or over which the present invention is located. Providing supportive pressure, the support members may bring about pain relief in a manner similar to that of acupressure therapy. Supporting the muscle, the support members may absorb shock. Distributing the supportive pressure across the support members may cause the skin over the muscle to stretch as to open pores in the skin surface. The opening of pores in the skin surface may increase absorption of oxygen through the skin. Distributing supportive pressure across the support members may cause stretching of the muscle beneath and/or proximate to the support members. Other therapeutic benefits and/or mechanisms of actions, in addition to those listed, may be elicited by the support members of the present invention. BRIEF DESCRIPTION OF DRAWINGS FIG. 1 depicts three-dimensional views of four embodiments of the apparatus of the present invention. FIG. 2 depicts cross sectional views of four embodiments of the apparatus of the present invention. FIG. 3 depicts a three-dimensional view an embodiment of the apparatus of the present invention secured to a strap. FIG. 4 depicts a cross-sectional view of an embodiment of the apparatus of the present invention secured to a bladder. DETAILED DESCRIPTION FIG. 1 depicts three-dimensional views ( FIG. 1 a FIG. 1 b, FIG. 1 c, and FIG. 1 d ) of four embodiments of the apparatus of the present invention. FIG. 2 depicts three cross-sectional views ( FIG. 2 a, FIG. 2 b, and FIG. 2 c ) of the depicted embodiments of FIG. 1. FIG. 2 a is a cross-sectional view common to both of the embodiments depicted in FIG. 1 a and FIG. 1 b. The present invention comprises a therapeutic body 101, a therapeutic surface 102 on side of the therapeutic body 101, and a plurality of pressure applicators (e.g. 103, 104, 107, and 108 ). Each of the example pressure applicators 103, 104, 107, and 108 comprises a base 105 secured to the therapeutic surface, and a distal end 109 extending away from therapeutic surface 102. The pressure applicators may be support members 103 and 104, as depicted in FIGS. 1 a, 1 b, and 2 a. Support members, such as those depicted in FIG. 1 a, 1 b, and 2 a, comprise an arc 201 spanning the base 105 along at least one axis. As depicted in FIG. 1 a, arc 201 may be extruded along a second axis forming vaults 103. The arc 201 may also be revolved along one axis forming domes 104, as depicted in FIG. 1 b. Other support member configurations are possible and in accordance with the present invention, so long as there is an arc spanning at least one axis of the base. The pressure applicators may be pointed pins 107, as depicted in FIGS. 1 c and 2 b, and/or rounded pins 108, as depicted in FIGS. 1 d and 2 c. When the pressure applicators are pins, the density of the pins on the therapeutic surface should be between density between 3 pins/cm 2 and 1,000 pins/cm 2. In preferred embodiments, the pin density is between 10 pins/cm 2 and 200 pins/cm 2. A density of 100 pins/cm 2 is suggested. Pins utilized as pressure applicators may have a pointed distal end 202 ( FIGS. 1 c and 2 b ) or a rounded distal end 203 ( FIGS. 1 d and 2 c ). The pressure applicators may be made from plastic and/or a polymer. The pressure applicators may also be made from a variety of materials. Precious metals such as, but not limited to, gold, silver, and/or platinum, may be used in constructing the support members. Therapeutic body 101 may be made from a compliant material or rigid material. If a rigid material is used, it may be desirable to segment therapeutic body 101 as to enable therapeutic body 101 to conform to the wearer&#39;s body. Before, during, and/or after physical activity, such as, but not limited to, exercise, playing sports, and/or manual labor, the apparatus of the present invention is pressed against the body, with therapeutic surface 102 facing the body. Preferably, the apparatus of the present invention is pressed proximate to and/or over an injured muscle. The apparatus of the present invention may be pressed against the body and/or secured in place with the use of a strap 301, depicted in FIG. 3. Strap 301 may be fastened around a portion of the body such as, but not limited to, a limb, a shoulder, the trunk, and/or the head by tying ends 302 and 303 together. Alternatively, Velcro attached to end 302 may be used to secure strap 301 to a portion of the body. Strap 301 may also be secured by the use of snaps, a buckle, buttons, and/or numerous other methods readily recognizable to a person of ordinary skill in the art. The apparatus of the present invention may also be secured in place and/or pressed against the body with the use of a sling, brace, bandage, tape, and/or numerous other devices readily recognizable to a person of ordinary skill in the art. Regardless of the device used to secure and/or press the apparatus of the present invention against a portion of the body, it is preferable the apparatus of the present invention be secured to the device. Ideally, therapeutic body 101 is removably secured to strap 301 or a similar device. Therapeutic body 101 may be removably secured to strap 301 or a similar device by including an eye or plurality of eyes on therapeutic 101 through which strap 301 or a similar device is threaded. Therapeutic body 101 may also be removably secured to strap 301 or a similar device by attaching a piece of Velcro on therapeutic body 101 opposite therapeutic surface 102 and a mating piece of Velcro on strap 301 or a similar device. As an alternative to Velcro, temporary adhesives, snaps, and/or numerous other methods readily recognizable to person or ordinary skill in the art may be used to removably secure therapeutic body 101 to strap 301 or similar devices. Vaulted support members 103 may be desirable when the user is experiencing pain localized to a particular muscle or group of muscles during physical activity. In such a situation, vaulted support members 103 should be pressed against the body proximate to and/or over the injured muscles until the pain subsists and/or physical activity is terminated. If a therapeutic body 101 with a therapeutic surface 102 measuring 5 cm by 6 cm is used, seven vaults with a length of 5 cm, a width of 6 mm, and a height of 3 mm may be positioned uniformly over therapeutic surface 102, as depicted in FIG. 1 a. Other vault dimensions and density are equally possible. Furthermore, therapeutic surface 102 may be larger or smaller than the size previously enumerated. When vaulted support members are used, the apparatus present invention should, but need not, be oriented such that vaulted support members 103 run with the thread of the muscle or muscles. Domed support members 104 may be desirable when the user is experiencing a shooting during physically activity. In such a situation, domed support members 104 should be pressed against the body proximate to and/or over the injured muscles from which the shooting pain originates until the pain subsists and/or physical activity is terminated. If a therapeutic body 101 with a therapeutic surface 102 measuring 5 cm by 6 cm is used, 42 domes with a base diameter of 6 mm and a height of 3 mm may be positioned uniformly over therapeutic surface 102, as depicted in FIG. 1 b. Other dome dimensions and density are equally possible. Furthermore, therapeutic surface 102 may be larger or smaller than the size previously enumerated. Pointed pins 107 may be desirable when the user is experiencing an acute pain following and/or prior to physical activity. In such as situation, pointed pins 107 should be pressed against the body proximate to and/or over the injured muscle until the pain subsists and/or for a period of approximately 15 minutes or less. Longer periods of treatment with pointed pins 107 may also be utilized. Rounded pins 108 may be desirable when the user is experience a prolonged pain and/or muscle tension following and/or prior to physical activity. One example of a prolonged pain may be a dull lingering pain in the muscle. Other types of prolonged pain may also be treated with rounded pins 108. In such as situation, rounded pins 108 should be pressed against the body proximate to and/or over the injured muscled until the pain and/or tension subsists and/or for a period of approximately 60 minutes of less. Longer periods of treatment with rounded pin 108 may also be utilized. It should be appreciated that vaulted support members 103, domed support members 104, pointed pins 107, and rounded pins 108 may be utilized in combination or isolation. Regardless of the configuration, size, or density chosen, the pressure applicators may be secured to the therapeutic surface 102 in a variety patterns. Possible patterns of the pressure applicators on the therapeutic surface 102 include, but are not limited to, linear, sinusoidal, triangular, rectangular, circular, spiral, and/or any combination thereof. In some situations, it may be preferable to select a support member pattern that approximates and/or resembles the configuration, shape, and/or thread of the injured muscle. Therapeutic body 101 and/or therapeutic surface 102 may be configured to match the support pattern utilized. As depicted in FIG. 4, a bladder 401 may be secured to therapeutic body 101 opposite therapeutic surface 102. The bladder may be filled with a substance 402 hotter or colder than the body such as, but not limited, gas, solid, fluid and/or gel. Substance 402 within the bladder may contain chemicals that react exothermically or endothermically. Such chemicals are readily recognizable to a people of ordinary skill in the art. When bladder 401 is filled with a substance 402 hotter than the body and/or chemicals reacting exothermically, heat from bladder 401 will be transferred to muscles in contact with and/or proximate to the apparatus of the present invention. Conversely, when bladder 401 is filled with a substance 402 colder than the body and/or chemicals reacting endothermically, heat will be transferred from muscles in contact with and/or proximate to the present invention to bladder 401. Transferring heat from bladder 401 to injured muscles may elicit several therapeutic benefits such as, but not limited to, increasing blood flow to the muscles, and/or relaxing the muscles. Transferring heat from injured muscles to bladder 401 may elicit several therapeutic benefits such as, but not limited to, decreasing swelling, decreasing inflammation, and/or dulling pain. Arc as used herein refers to a segment of a differentiable curve. It should be appreciated that elements described with singular articles such as “a”, “an”, and “the” or otherwise described singularly may be used in plurality. It should also be appreciated that elements described in plurality may be used singularly. Although specific embodiments of apparatuses and methods have been illustrated and described herein, it will be appreciated by people of ordinary skill in the art any arrangement, combination, and/or sequence that is calculated to achieve the same purpose may be substituted for the specific embodiments shown. It is to be understood that above description is intended to be illustrative and not restrictive. Combinations of the above embodiments and other embodiments as wells as combinations and sequences of the above methods and other methods of use will be apparent to individuals possessing skill in the art upon review of the present disclosure. The scope of the present invention should be determined with reference to the appended claims, along with the full scope of equivalents to which such claims are entitled.

Summary: An apparatus and method is provided for treating injured muscles before, during, and/or after physical activity. Practicing the method of the present involves pressing a plurality of pressure applicators against the skin proximate to a muscle for a sustained period of time. The pressure applicators pressed against the body can be either pins, support members, and/or any combination thereof. The support members may be secured to the therapeutic surface of a therapeutic body as to create an apparatus in accordance with the present invention. In such an apparatus, the base of pressure applicator is secured to the therapeutic surface such that the distal end of the pressure applicator extends away from the therapeutic surface.

big_patent

en

Summarize: By. Meghan Keneally. A substitute teacher and an EMT have been arrested after being caught selling drugs. Lisa Testa and Joseph Meyer were arrested on Thursday after they were caught selling heroin and other narcotics. Brooklyn police reportedly caught the two as a result of an undercover sting operation, The New York Daily News reports. Caught: Lisa Testa (left) and her friend Joseph Meyer (right) have been arrested and charged with selling illegal drugs after being caught in an undercover operation. Testa, 33, came under suspicion when police received an anonymous letter saying that she was selling crack cocaine and other drugs. A sting operation was launched from there and police bought prescription medication and heroin on multiple occasions. Police were never able to purchase crack cocaine. The investigation was focused on Testa but it extended to Meyer, 25, when police started trying to track down her supplier and they found that they were selling the same drugs. Testa and Meyer are said to be friends though it has not yet been revealed how they specifically worked together. Tip off: Police reportedly received an anonymous letter saying Testa, 33, was selling crack cocaine and they launched a sting operation where officers were able to buy drugs from her multiple times. Dishonoring the badge: The investigation did not start out involving Meyer, 25, but when they started looking for Testa's supplier they realized her friend Meyer was selling the same drugs. They were both charged with the criminal sale of a controlled substance and other unspecified drug-related charges. Meyer had been working as an emergency medical technician under the purview of the fire department for the past two years but was suspended for 30 days without pay upon his arrest. Testa was not a regular substitute teacher for New York City public schools and only taught for two days back in 2008 but at the time of her arrest she was still listed as a possible substitute in the department's database. The Daily News reports that her name was only placed on the 'do not call list' once she was arrested. Testa's mother, Grace Testa, spoke to the paper and said that her daughter has a history of drug abuse. Dangerous: Police were able to buy prescription pills and heroin from both but not crack cocaine which was the subject of the original tip-off letter. 'I’ve been begging her to go to rehab for a long time,' Mrs Testa told The Daily News. 'It’s not her personality to sell drugs. Maybe to take it, but not to sell it. 'She’s a good girl, that’s all I can tell you.... She never gave me problems. She stays home, she stays with her family. She doesn’t even go out to clubs or anything.' Mrs Testa said that her daughter was not in a relationship with Meyer, calling him 'just a friend', but she did not seem to be surprised that he was involved. 'He has a drug problem, too. They’re trying to stop it,' Mrs Testa said

Summary: Brooklyn police received an anonymous letter tipping them off that Lisa Testa was selling crack cocaine. Undercover agents were able to buy heroin and prescription pills from her on numerous occasions, but never crack cocaine. When they started looking for her supplier, they found out that her friend Joseph Meyer was selling the same drugs. Testa, 33, hadn't worked as a substitute teacher in years but was still listed as a possible fill-in for New York City teachers. Meyer, 25, has worked as an EMT for the past two years. Her mother said they were friends and both have a history of drug abuse.

cnn_dailymail

en

Summarize: FIELD OF INVENTION This invention relates to the art of neurological surgery, and in particular to an improved method and apparatus for the temporary, external drainage of cerebrospinal fluid from the cerebral ventricles. DISCUSSION OF BACKGROUND INFORMATION Temporary, external ventricular drainage (ventriculostomy) catheters are utilized in the treatment of hydrocephalus and intracranial hypertension, when the use of a permanent internal shunting system is not indicated i.e. when the problem is expected to resolve. The catheter is inserted via an incision made in the scalp skin and through a hole drilled in the underlying skull bone. The catheter is passed through the brain substance and into the ventricles which are the chambers deep within the brain that contain the cerebrospinal fluid (CSF). The catheter allows for the monitoring of the intracranial pressure and also for the drainage of CSF, as necessary, to lower the intracranial pressure. The use of a rubber catheter inserted percutaneously into the cerebral ventricles for the drainage of unwanted CSF was first described in 1943. (Crawford AS, Munslow RA: Annals of Surgery 117:798-799, 1943) Since that time, one of the major persisting risks associated with percutaneous ventricular drainage catheters has been infection of the brain or CSF. The catheter provides an open pathway for the migration of bacteria along the catheter and into the brain. A resulting infection (meningitis or ventriculitis), which has been reported to occur in up to 27% of patients with ventricular drainage catheters in place, may be life-threatening. (Mayhall CG, et al: New England Journal of Medicine 310:553-559, 1984) Because of this, many avenues have been explored to reduce the risk of ventricular drain infections. Some neurosurgeons administer prophylactic antibiotics at the time of insertion of a ventricular drainage catheter and for as long as it remains in place. Nevertheless, the only study demonstrating a relative reduction in the rate of infection with the use of prophylactic antibiotics still reported an unacceptably high rate of infection (9%) in patients with ventricular drainage catheters. (Wyler AR, Kelly WA: Journal of Neurosurgery 37:185-187, 1972) Furthermore, many authorities suggest that this practice results in the selection of more virulent organisms that are resistant to the usual antibiotic agents thereby making any infection that does occur more dangerous and more difficult to treat. The routine use of prophylactic antibiotics for ventricular drainage catheters therefore remains controversial. (Stenager E, et al: Acta Neurochirurgica 83:20-23, 1986) In many institutions, protocols have been established requiring that ventriculostomy catheters be changed to a new site every five to seven days, in an attempt to reduce infection by bacteria that colonize the catheter and migrate along its outer surface into the brain. (Mayhall CG, et al: New England Journal of Medicine 310:553-559, 1984) This requires a new scalp incision, a new hole drilled in the skull, and the passage of another catheter through the brain substance. This practice has not been clearly proven to reduce infection rates, and it also carries other risks, especially for those patients requiring external ventricular drainage for several weeks who may undergo four or five ventriculostomy changes. (Kanter RK, Weiner LB: New England Journal of Medicine 311:987, 1984) Each time a new catheter is placed, there is a new risk of injuring brain tissue and of causing dangerous bleeding by disrupting an artery or vein. Additionally, there is a new chance of introducing infection into the brain with each new passage of a foreign body. Ideally, all ventricular drainage catheters are inserted under strict, sterile conditions such as in an operating room or in an intensive care unit setting. But in emergency situations, the catheter may have to be inserted under suboptimal conditions, for example in an emergency room. No matter how much precaution is exercised, the end result is still a percutaneous catheter that establishes a connection between an unsterile outside environment and the brain. This is simply an invitation for infection, and further measures to limit such infections are clearly necessary. All temporary, external ventricular drainage catheter systems currently in use suffer from a number of disadvantages: (a) The catheters pose a serious risk of infection to the brain and cerebrospinal fluid as bacteria can migrate along the open tract, around the catheters, as detailed above; (b) The catheters are routinely changed approximately every five days which increases the chance of injuring the brain tissue or cerebral blood vessels, especially for patients who may require ventricular drainage for prolonged periods of time and thus require multiple catheter changes; (c) The catheter is free at its entrance to the skull and may thus migrate inward, possibly injuring underlying brain tissue, or outward, possibly requiring its replacement and further increasing the risk of infection or injury; (d) There is a free open space in the skull hole around the catheter and thus CSF may leak out around the catheter, invalidating measurements of intracranial pressure, and establishing a direct stream of CSF which connects the cerebral ventricles with the unsterile scalp and provides a patent conduit for migration of bacteria; (e) A chronic leakage of CSF may develop after the catheter is removed, possibly necessitating further repair measures, as the hole drilled in the skull is left unsealed; (f) A skull defect is left by the open drill hole once the catheter is removed. SUMMARY OF THE INVENTION Accordingly, several objects and advantages of the present invention are: (a) To reduce the risk of infection associated with indwelling ventricular drainage catheters by establishing a physical barrier to the migration of bacteria along the catheter; (b) To eliminate the need for, and accompanying risks of, routine changes of ventricular drainage catheters; (c) To prevent the inward or outward migration of the catheter once in place by securing it as it dives through the hole in the skull; (d) To diminish the risk of CSF leakage around the catheter by occluding the free space around the catheter in the skull hole, thereby improving the accuracy of intracranial pressure measurements and further decreasing the risk of cerebral infection; (e) To diminish the risk of chronic leakage of CSF after the catheter is removed, by plugging the skull hole which is otherwise left open after catheter removal; (f) To eliminate the skull defect which remains after the catheter is removed by plugging the skull hole. Still further objects and advantages will become apparent from a consideration of the ensuing descriptions and drawings. BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 shows a lateral view of an external, ventricular drainage catheter with guard, after insertion into a cerebral ventricle, draining ventricular fluid. FIG. 2 shows a ventricular drainage catheter with guard before insertion, and a stylet and trocar. FIG. 3 shows a close-up view of a guard on a ventricular catheter. FIG. 4 shows an en-face view of a catheter guard. FIG. 5 shows an expanded side view of a guard on a ventricular catheter, positioned inside the skull hole. FIG. 6 shows an expanded side view of a guard on a ventricular catheter, positioned inside a larger skull hole. Reference Numerals in Drawings 1--ventricular catheter 2--cerebral ventricle filled with CSF 4--ventricular end of catheter 6--perforations in catheter 8--brain cortical surface 10--dura mater 14--outside surface of skull bone 16--skull bone 18--skull hole 20--guard 22--disc of smaller diameter 22a--anterior face of disc of smaller diameter 22b--lateral surface of disc of smaller diameter 24--disc of larger diameter 24a--anterior face of disc of larger diameter 24b--lateral surface of disc of larger diameter 26--skin incision site for drill hole 28--skin exit site for ventricular drainage catheter 30--scalp skin 32--external end of ventricular catheter 34--connector device 36--connection tubing 38--collection bag 40--stylet 42--trocar DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS Referring now to the drawings in detail, FIG. 2 illustrates a catheter 1 which is made of a soft silicone rubber or of any other suitable, tissue-compatible material. The catheter has a rounded ventricular end 4 with multiple perforations 6 and an open external end 32. The following are exemplary measurements, which may be altered significantly without changing the efficacy of the catheter. Catheter 1 is approximately 34 centimeters in length from ventricular end 4 to external end 32, with an internal diameter of approximately 1.4 millimeters and an outer diameter of approximately 3.0 millimeters. Approximately 12 centimeters from ventricular end 4 of catheter 1, is a repositionable guard 20 that snugly encircles the outside circumference of the catheter, and that may be slipped along the outside of the catheter with gentle traction. Guard 20 may be made of a number of tissue-ingrowth promoting substances such as woven felts, velours, textured polymers, collagens, or sponge-like materials. The surface of guard 20 may be textured and irregular, further promoting tissue ingrowth. The ingrowth of body tissue into the guard matrix forms a seal around the catheter. The guard matrix is initially in a relatively compressed form. As the matrix absorbs body fluids, the guard expands, further sealing the tract around the catheter. A straight, steel stylet 40 and a steel trocar 42, which are used during the insertion of the catheter, are also shown. Stylet 40 should be approximately 2 centimeters longer than catheter 1 and should be of a diameter 0.25 centimeters smaller then the internal diameter of catheter 1 so that stylet 40 fits inside the lumen of catheter 1, to keep the catheter straight during insertion. Trocar 42 should have a needle-sharp tip and a dull end of diameter approximately equal to the internal diameter of catheter 1 so that trocar 42 securely fits inside the lumen of catheter 1 so that it can be temporarily attached to the open, external end 32 of catheter 1 and used to tunnel the catheter as described below. FIG. 3 illustrates a close-up view of the preferred embodiment of guard 20 in which the guard is composed of two circular discs, 22 and 24, of different diameters, concentrically stacked on one another. The height of each disc is approximately 3 millimeters. The discs have diameters of approximately 5 millimeters and 1 centimeter, with the disc of smaller diameter resting on top of the disc of larger diameter. Each disc has a hole in its center of diameter just large enough to encircle the outer circumference of the catheter with frictional gripping contact, with the holes being exactly aligned when the discs are stacked. The disc of smaller diameter 22 projects forward from the anterior face 24a of the disc of larger diameter 24, leaving a circular, outer rim of the anterior face 24a of the disc of larger diameter 24 exposed. Catheter 1 passes through the holes of the attached discs, and thus guard 20 encircles the outer circumference of catheter 1. Guard 20 is oriented with the disc of smaller diameter 22 being closer to ventricular end 4 of catheter 1, and the disc of larger diameter 24 closer to the external end 32 of catheter 1. Guard 20 may be repositioned to any location on catheter 1 by slipping the guard along the outside of the catheter with gentle traction. In FIG. 4, an en-face view of guard 20 is shown. The disc of smaller diameter 22 is seen to project outwards from the anterior face 24a of the disc of larger diameter 24 leaving the outer rim of the anterior face 24a of the disc of larger diameter 24 exposed. It is this outer rim that contacts the outside surface 14 of skull bone 16 just surrounding skull hole 18 after the guard is slipped into position along catheter 1, as will be described below in FIG. 1, and in exploded view, in FIG. 5. The particular two-tiered disc configuration shown in FIGS. 3 and 4 represents just one possible shape for the guard, as a single disc which is advanced into the hole, or a guard of another shape entirely may be subtituted so long as the space around the catheter in the skull hole is effectively occluded. FIG. 1 illustrates catheter 1 with guard 20, after insertion into a cerebral ventricle 2. Ventricular end 4 of catheter 1 rests inside cerebral ventricle 2 which contains CSF. The CSF flows into the catheter lumen via the perforations 6 in catheter 1. The course of catheter 1 may be followed out of the ventricle, through brain tissue, to emerge from the brain cortical surface 8. The catheter passes through an opening in the dura mater 10, a firm membrane that covers the brain, and then out through a hole 18 which has been drilled in skull bone 16. Guard 20 encircles catheter 1 and is positioned at the junction of catheter 1 and skull hole 18, occluding the space in the hole around the catheter. The catheter makes a curve of not quite 90 degrees after emerging from the skull hole, to travel in a subgaleal tunnel, gradually continuing upward through the galeal tissue, to emerge at a scalp skin 30 exit site 28 approximately 5 centimeters from a skin incision 26 overlying skull hole 18. The catheter now travels outside of the body, and external end 32 of catheter 1 is attached, via a conventional plastic connecting device 34 to a drainage tubing 36 made of a suitable vinyl or plastic polymer. The tubing may be of variable length, but it should be long enough to prevent excessive traction on the catheter during routine nursing care. At least 3 feet of tubing is recommended. The tubing 36 runs to a collection bag 38, into which the CSF drips and collects at the bottom of the bag. The bag, like the tubing, may be made of a vinyl or a suitable plastic polymer, but should preferably be made of a transparent material, through which one can see and measure the volume of CSF in the bag. The bag may also be of variable size but a 1 liter bag is recommended. In FIG. 5, guard 20 is illustrated in position in skull hole 18, reflecting the preferred embodiment of the invention. The disc of smaller diameter 22 is positioned inside skull hole 18, occluding the space around catheter 1. The lateral wall 22b of the disc of smaller diameter 22 is flush against the inner wall of skull hole 18. The outer rim of the anterior face 24a of the disc of larger diameter 24 is flush against the outside surface 14 of skull bone 16 surrounding skull hole 18, further preventing CSF leakage around catheter 1, and also promoting subgaleal tissue fibrosis around the catheter. FIG. 6 illustrates another embodiment, in which a hole of larger diameter has been drilled in the skull. In order to fully occlude this larger hole, both the disc of smaller diameter 22 and the disc of larger diameter 24 are advanced into the skull hole, so that the lateral wall 24b of the disc of larger diameter 24 is flush against the inner wall of the skull hole, occluding the space around the catheter. Operation of Invention The temporary, external ventricular drainage catheter with guard is inserted in a fashion similar to conventional, temporary, ventricular drainage catheters. Under sterile conditions, an area of the scalp is shaved, washed with an antiseptic solution, and then draped with sterile towels. An incision 26 is made in the scalp 30 (FIG. 1) in any number of locations which will provide a trajectory to the ventricle that does not traverse eloquent or vital brain tissue. One such site may be found by starting at the midline bridge of the nose, moving approximately 12 centimeters along a line straight back over the forehead, and then moving 3 centimeters laterally in either direction along a line perpendicular to the first line. Of course, the specific site chosen for insertion of the catheter will depend on the reason necessitating its implantation in any given patient. The incision is continued down through the scalp or galeal tissue to skull bone 16. Next, a hole 18 is drilled in the skull, typically using a hand-held twist drill yielding a hole with a diameter of approximately 5 millimeters, although a larger drill bit or an electric drill may be used, yielding a hole with a slightly larger diameter. The dura mater 10, which lies just beneath skull bone 16, is pierced with a needle or with a knife blade to allow for the passage of catheter 1. Stylet 40 is placed within the lumen of catheter 1 to allow for easier, more accurate passage of the catheter. (FIG. 2) Catheter 1 is then passed through scalp incision 26, through skull hole 18, through the dural opening, through the surface 8 and substance of the brain, and into the fluid-filled cerebral ventricle 2. Passing the catheter to a depth between six and eight centimeters will usually place the catheter in the ventricle, although some variability is expected. Stylet 40 is removed, and CSF should flow freely from external end 32 of catheter 1. In the preferred embodiment, shown in FIGS. 1 and 5, guard 20 which encircles the outer circumference of catheter 1 and which is initially positioned 12 centimeters from ventricular end 4 of the catheter, is advanced along the catheter with gentle traction, until the anteriorly projecting, disc of smaller diameter 22 lies within skull hole 18, and the outer rim of the anterior face 24a of the disc of larger diameter 24 is flush with the portion of outside surface 14 of skull bone 16 that just surrounds skull hole 18. In the setting of a larger skull hole, as depicted in FIG. 6, the disc of larger diameter 24 may be advanced into the skull hole as well, so that the hole is plugged by the larger disc. The skull hole should be fully occluded by catheter 1 and surrounding guard 20 so that no CSF may leak around the catheter. The guard matrix is initially in a relatively compressed state which allows for easy insertion into the skull hole. As the matrix absorbs body fluids, it expands and occludes the skull hole. Over several days, the body tissues grow into the guard matrix, causing a solid fibrosis that further seals the skull hole. This acts as a blockade to the inward migration of bacteria or the outward leakage of CSF around the catheter. It also fixes the catheter securely in place. Trocar 42 is inserted into external end 32 of catheter 1, temporarily attaching the catheter to the trocar. Trocar 42 is then used to tunnel the catheter under and then up through the galeal tissue to emerge through the skin at a second site 28 approximately five centimeters from the original scalp incision 26. The catheter is typically secured at the skin site with a suture. The trocar is removed, and drainage tubing 36 is attached to external end 32 of catheter 1 via a conventional connecting device 34. The tubing runs to collection bag 40, into which the CSF drains. The height of the collection system determines the rate of CSF drainage. When the ventricular catheter is no longer required for the drainage of CSF, it is removed by palpating the catheter and guard under the scalp skin where the catheter emerges from skull hole 18, and then applying firm pressure to the skin at this location to hold the guard in place, while applying traction to external end 32 of catheter 1 at skin exit site 28. The catheter is thereby removed, leaving guard 20 in place in skull hole 18. The skull defect is thus eliminated as the guard remains in the skull hole, and continues to encourage the ingrowth of natural fibrous tissue. The risk of chronic leakage of CSF is diminished as well, since the skull hole is occluded by guard 20, preventing the egress of fluid. Accordingly, the reader will see that the external ventricular drainage catheter with guard can be used to establish drainage of unwanted CSF and to monitor intracranial pressure, while significantly reducing the risk of ventricular drain infection by occluding the otherwise open tract around the catheter. It thus provides an important improvement over the prior art and has the following additional advantages: it obviates the need for, and risks of, routine ventricular drainage catheter changes; it will not migrate inward, possibly injuring underlying brain tissue, or outward, possibly necessitating its replacement; it diminishes the risk of CSF leakage around the catheter by occluding the open tract and the open space around the catheter in the skull hole, thereby improving the accuracy of intracranial pressure measurements and further decreasing the risk of cerebral infection; it diminishes the risk of chronic CSF leakage after removal of the catheter by leaving the guard in the skull hole, thereby preventing the continued egress of CSF; it eliminates the skull defect that typically remains after removal of the catheter by leaving the guard in the skull hole; Although the description above contains many specifities, these should not be construed as limiting the scope of the invention but as merely providing illustrations of some of the presently preferred embodiments of this invention. Various modifications to the embodiments described above will be apparent to those skilled in the art. For example, the shape of the guard may be changed without altering its effectiveness, the outer surface of the guard may be impregnated with a substance having antibacterial properties, or the guard may be attached to a permanent internal CSF shunting system. Thus the scope of the invention should be determined by the appended claims and their legal equivalents, rather than by the examples given.

Summary: A method and apparatus for temporary, external, cerebral ventricular drainage in the treatment of hydrocephalus and intracranial hypertension are disclosed in which a flexible catheter having a repositionable guard surrounding its outer circumference with frictional gripping contact is inserted into the cerebral ventricle through a hole drilled in the skull. The guard is then advanced along the outside circumference of the catheter into a position, preferably the junction of the catheter and the skull hole, where the guard fixes the catheter in place and occludes the tract around the catheter by acting as a mechanical blockade and by encouraging a tissue fibrotic seal around the catheter. When the catheter is removed, the guard may be left in place inside the skull hole to eliminate any skull defect and to prevent the leakage of cerebrospinal fluid.

big_patent

en

Write a title and summarize: "Mi cabello se caía en mis manos, en mi ropa y en el baño debajo de mí. Si lo lavaba y luego me cepillaba, se me caía más". "Podía ver mi apariencia cambiar en el espejo, mechón por mechón". Carly Clarke revive su experiencia como paciente de cáncer, mientras muestra uno de los muchos autorretratos que se tomó durante seis dolorosos meses de tratamiento. Eventualmente, le pediría a su padre que le afeitara los últimos pelos de su cabeza. Final de Quizás también te interese Tenía 26 años. "Solía tener mucho cabello. En esta foto me veo como una paciente con cáncer", señala. Seis meses antes de que se tomaran estas fotografías, Carly había estado viviendo un sueño en Canadá, filmando un proyecto de fotografía universitaria en Vancouver. Había estado enferma durante meses, con tos violenta, pérdida de apetito y dolor en el pecho y la espalda. Los médicos le diagnosticaron enfermedades que iban desde neumonía hasta asma y le advirtieron que podría sufrir un colapso pulmonar en el vuelo hacia Canadá. Pero ella los había ignorado. "No iba a dejar que esta enfermedad, fuera lo que fuese, se interpusiera en mi vida", dice. "En Vancouver, podía empatizar con personas con enfermedades y adicciones. Mi preocupación por mi propia vida me hizo sentir compasión durante el rodaje". La aparición del cáncer Muchos de aquellos con quienes habló en las calles casi heladas de Vancouver se volvieron adictos después de tomar fuertes opiáceos en el hospital, ya que fueron tratados por afecciones graves, como el cáncer. Tres meses después, Carly necesitaría morfina para aliviar el dolor en el pecho y la espalda para poder dormir. Persuadida por los médicos canadienses de regresar a casa para recibir atención especializada, finalmente fue diagnosticada con linfoma de Hodgkin, una forma rara y bastante agresiva de cáncer, en marzo de 2012. Un tumor del tamaño de una toronja ya había crecido en su pulmón derecho y la pared torácica. "Lloré en el Hospital de Guy en Londres. No sabía si sobreviviría al tratamiento de quimioterapia, tras haber sido diagnosticada en una etapa tan tardía. Estaba aterrorizada". Fue difícil para su familia aceptarlo. "Mis padres sintieron que se les hundía el mundo. No había habido mucho cáncer en la familia", dice. "Mi novio también estaba devastado y voló de California a Inglaterra para estar conmigo". De vuelta en su casa en Eastbourne, Carly garabateó citas de hospital y horarios de medicamentos en un calendario que no mucho antes había estado repleto de fechas límite para los cursos y sesiones de fotos. "Mi vida se ralentizó para concentrarme en pasar cada momento, de medicamento en medicamento, exámenes interminables, agujas gigantes, biopsias que perforaban profundamente los huesos, me bajaban por la garganta". "Solo esperaba que algún día el dolor terminara", dice. El dolor que sentía en el pecho ahora irradiaba por su brazo, el líquido en los pulmones dificultaba la respiración y no podía sacudirse una "tos horrible e ininterrumpida". "Una manguera plástica a través de mi brazo trataba de matar el cáncer, pero terminó llevándome mi fuerza". "Mi esqueleto se hizo más visible cada día, un recordatorio de cada preciosa libra perdida. De la nada, mi vida estaba en juego". Los cambios Su visión del mundo, y de ella misma, estaba cambiando. Fue entonces cuando decidió hacerse fotos, documentar el proceso. "Pensé que tener una salida creativa me permitiría salir de esa realidad por un momento y pensar en mi trauma actual desde otra perspectiva". Reality Trauma sería una serie de autorretratos que documentarían su apariencia cambiante, su vida dentro y fuera del hospital y su resistencia. Durante las visitas de día o las estancias cortas, en el hospital le dieron la libertad de usar un trípode tan a menudo como pudo. Los médicos y las enfermeras a veces presionaban el obturador para ella. "Pensé en cómo otros podrían ver estas imágenes más adelante y si yo estaría o no para contar mi historia". Carly quería que su trabajo inspirara a otros a "tener el coraje de mirar el cáncer a la cara" y no dejar que se hiciera cargo de su identidad por completo. Imagen por imagen, notó que su piel se estaba volviendo más pálida y apretada alrededor de sus huesos, dándole una apariencia "desconocida, casi extraña". Perdió alrededor de 12 kg en el espacio de dos meses y necesitó transfusiones de sangre regulares para compensar los problemas circulatorios que estaban privando a su cuerpo de oxígeno y volviéndolo azul. "Verme de esa manera me hizo sentir incómoda y asustada". Poco después, se encontró visitando el hospital con tanta frecuencia que fue ingresada a tiempo completo. En el punto más crítico, constantemente con náuseas o dormida, rechazó toda la comida del hospital. No podía estudiar y, algunos días, estaba demasiado cansada para fotografiarse o llamar a su novio. A estas alturas también estaba tosiendo con tanta fuerza que expectoraba sangre. Y a veces se despertaba después de una noche de sudores fríos, con picazón y empapada como si se hubiera duchado en la cama del hospital. La mejoría Pero un día, después de unos tres meses de quimioterapia, la tos se detuvo. Sus otros síntomas también comenzaron a disminuir. El tratamiento estaba funcionando, pensó. Las biopsias lo confirmaron: el cáncer estaba cediendo. Su percepción de la vida cambió de nuevo. "La impotencia se convirtió en esperanza y luego en euforia. Cuando te acercas tanto a la muerte, de repente quieres vivir tu vida al máximo". Tres meses después, Carly dejó de necesitar morfina para aliviar el dolor. La sala del hospital pasó de ser un lugar de dolor a su hogar. El personal y algunos pacientes se volvieron sus amigos. A medida que comenzó a sentirse mejor, también comenzó a conectarse más con el mundo exterior. Su novio y amigos la llevaban a almorzar, a veces conducían a Beachy Head, donde los acantilados blancos se encuentran con el mar, y Carly hablaba sobre el futuro mientras observaba a los barcos moverse lentamente por el horizonte. Supo por sus compañeros de curso y tutores que sus fotografías estaban impactando en otras personas. Y es que las imágenes no solo capturaron los efectos físicos y emocionales del tratamiento contra el cáncer, sino que demostraron que no siempre tenía que ser aterrador, sino que podría ser positivo. "Mirando hacia atrás a las imágenes que había tomado, me hizo sentir más fuerte porque en esas fotos me enfrenté a una situación del fin de mi vida, pero una parte de mí todavía creía que podría superarla". Las fotos Carly comenzó a mostrar su trabajo a otros pacientes con cáncer y tomó retratos de algunos de ellos en la sala. Se convirtió en una forma de comenzar una conversación o poner una sonrisa en sus caras. "Si es verdad que una simple sonrisa, un pequeño gesto de ayuda o una palabra amable pueden cambiar la forma en que una persona se siente y alegrar su día, y tener un efecto positivo en cada célula del cuerpo, entonces una historia fotográfica positiva puede ayudar a cambiar la vida de alguien". "Puede ser el factor definitorio en la fortaleza mental de alguien y afectar su fuerza de voluntad lo suficiente como para mantenerlo atravesando el sufrimiento con la esperanza de que pronto termine. Y eso, en mi opinión, es lo que te ayuda a mantenerte vivo contra viento y marea". Su fotografía también recoge a personas que superaron el tratamiento contra el cáncer. Cuando el tratamiento de Carly llegó a su fin, en septiembre de 2012, pudo mirar hacia atrás a través de cada fase de su viaje, en 15 rollos de película y 150 fotografías, y decir que sobrevivió al cáncer. Fue un momento de celebración, pero regresar a la casa familiar para "reconstruir su vida" no fue fácil. Cuando retiró sus cajas de medicamentos no utilizados, se sintió triste porque ya no estaba en el hospital. "El personal del hospital y algunos de los pacientes me hacían sentir como familia porque habíamos establecido una relación muy estrecha durante muchos meses". Tiempo más tarde, Carly voló a California y se quedó con su novio la mayor parte del año siguiente. Regresó a su casa varias veces y visitó la sala del hospital para el primero de sus controles dos veces al año. Cada vez que volvía, buscaba rostros conocidos: enfermeras que la habían tratado, pacientes con los que había compartido momentos. Nueva pasión Rápidamente redescubrió sus ansias por documentar la vida de las personas en todo el mundo. En 2014, pasó cuatro meses en India. Su trabajo en ese viaje obtendría menciones honoríficas en los International Photo Awards en 2018. Ese mismo año, su fotografía del "Último día de quimioterapia" de Reality Trauma, fue preseleccionada en los Premios Retrato de Gran Bretaña. Consiguió trabajo ayudando al fotógrafo Michael Wharley, en el que producía imágenes promocionales para Summerland, una próxima película protagonizada por Gemma Arterton. Cuando su bandeja de entrada se llenó de invitaciones de premios y su calendario con horarios de rodaje, comenzó a elaborar un concepto de proyecto con su hospital local, St Wilfred's, para tomar retratos de pacientes con cáncer en sus últimas etapas de la vida. Quería documentar cómo las enfermedades terminales afectan el estado psicológico de las personas y las formas en que los pacientes pasan los momentos restantes, probando nuevos pasatiempos o despidiéndose. Pero ese plan se detuvo abruptamente en septiembre del año pasado por una llamada telefónica de su hermano mayor, Lee. Le contó que su hermano menor, Joe, le habían diagnosticado linfoma de Hodgkin, el mismo cáncer que Carly había vencido seis años antes. "Ambos comenzamos a llorar". Joe tenía solo 16 años y comenzaba la universidad. Su cáncer estaba menos avanzado que el de Carly, pero, al igual que su hermana, también había estado enfermo durante meses antes de ser diagnosticado. Los médicos inicialmente habían atribuido su picazón severa a "piel seca" o a su imaginación. "No estaba preparado para su diagnóstico. Ninguno de nosotros lo estaba", dice Carly. Joe trató de vivir tan normalmente como pudo, pasando tiempo con su novia, aprendiendo a conducir y haciendo planes de carrera. Pero a medida que pasaba más y más tiempo viajando al hospital y de regreso, sus calificaciones se vieron afectadas y comenzó a perder el contacto con algunos de sus amigos. Queriendo pasar más tiempo con él, a principios de este año, Carly le preguntó si podía fotografiar su viaje por el cáncer. Él aceptó. Dieciséis años mayor que Joe, Carly se había ido de casa cuando aún era un niño. Pero, como su única hermana, ella siempre había sentido una responsabilidad hacia él. Más tarde, cuando Carly se mudó a Londres para ir a la universidad, se vieron solo ocasionalmente. Con cada visita, ella notaba que él estaba un poco más alto, su voz ligeramente más profunda. Pero ahora que estaba parada detrás de la cámara en su sala de hospital, capturó un cambio rápido con cada fotografía. El cabello teñido de rubio y luego teñido extravagante, sabiendo que se caería, salió en trozos hasta que se lo afeitó, como lo había hecho Carly, para evitar que cubriera toda la ropa y el piso de la habitación. Comenzó a cubrirse la cabeza en las fotos y habló de usar una peluca. Los esteroides que tomó en preparación para la siguiente etapa de quimioterapia lo envejecieron y tuvieron otro efecto dramático. "Joe aumentó de peso hasta el punto en que era irreconocible. Las imágenes también mostraron sus estrías por el aumento de peso", dice Carly. Cada vez más, Joe se acercó a Carly para pedirle apoyo y asesoramiento. Cuando era niño la había visto pasar por cáncer; él sabía lo que la enfermedad le había hecho a su hermana, pero también la vio derrotarla. "Incluso cuando tenía dudas y dudas, el hecho de que me recuperé significaba que podía darle la esperanza y la positividad para continuar su tratamiento", dice ella. Debido a que el cáncer de Joe estaba menos avanzado, ella pensó que su tratamiento sería más rápido y que su serie fotográfica sería más corta. La colección representaría el viaje de un joven superando el cáncer. Pero la primera ronda de quimioterapia de Joe no tuvo éxito. "La noticia conmocionó mucho a todos. Nuestra relación cambió, se volvió un poco más inestable", recuerda Carly. Después de sufrir una recaída, Joe tendría que soportar cuatro meses más de quimioterapia y trasplantes de células madre. Su cabello, que había comenzado a crecer nuevamente, se volvió a caer. Joe dijo que ya no quería ser fotografiado, una decisión que Carly dice que entendió y respetó, pero con el tiempo llegó una mayor determinación y una nueva positividad. Un mes más tarde, cambió de opinión nuevamente. "La imagen que más me gustó fue una en la que mira de manera contemplativa. Allí, él sabía lo que estaba por venir, y sus ojos miraban a lo lejos", afirma Carly. "Mostró cómo había cambiado y cómo se había adaptado a este papel de ser un paciente joven con cáncer". Contra el consejo de su asesor, Joe detuvo el tratamiento con células madre. Temía que los efectos secundarios (problemas respiratorios, problemas de la piel, ictericia y diarrea que pueden ocurrir si las células donantes atacan a las otras del cuerpo) arruinaran su vida. Poco después de tomar esa decisión, en mayo, sus análisis volvieron dar buenas señales. Fue puesto en remisión y pudo reunirse con su familia de vacaciones en Menorca, y luego en la boda de Lee. Tendrá citas regulares durante los próximos meses para controlar su condición, pero ha perdido el peso que ganó y su cabello finalmente está volviendo a crecer. Carly dice que sus imágenes ofrecen una clara evidencia de cómo la realidad cambió para la familia durante un tiempo en el que tanto ella como el "cuerpo, la mente y el alma de Joe fueron probados hasta el final". "Estas fotografías que capturé, tanto de Joe como de mí, evocan algunos recuerdos dolorosos para mí; sin embargo, también me recuerdan la enorme capacidad del cuerpo humano para soportar estos tiempos infernales. "Esta colección de imágenes puede dar solo un vistazo a esos tiempos, pero espero que la audiencia pueda ver no solo los aspectos horripilantes, sino también la promesa de ser un sobreviviente de cáncer y la tremenda esperanza que esto puede ser para otros que enfrentan una condición similar". Ahora puedes recibir notificaciones de BBC Mundo. Descarga la nueva versión de nuestra app y actívalas para no perderte nuestro mejor contenido.

Title: "No iba a dejar que esta enfermedad se interpusiera en mi vida": cómo la fotografía me ayudó a superar mi cáncer y el de mi hermano Summary: Cuando Carly Clarke fue diagnosticada con cáncer en 2012, se propuso fotografiar cómo cambiaba su cuerpo durante lo s que podrían haber sido los últimos días de su vida. Siete años después, por una cruel coincidencia del destino, Carly acompaña ahora a su hermano y lo fotografía, mientras él pasa por la misma prueba de la vida.

xlsum_es

es

Summarize: I deejay sono da sempre l'anima della festa: che si tratti di una grande serata in un locale o di un party a casa di un amico, chi è in grado di manipolare la musica mixando e campionando diversi brani riesce a trasformare ogni serata in una festa da paura. Se sei un dj alle prime armi e non sai quale controller dj o consolle stand alone scegliere come attrezzatura per iniziare, ecco una guida che fa al caso tuo. Dai modelli professionali con le console dj Pioneer, diventate un vero e proprio status symbol e utilizzate dai maggiori disc jokey al mondo, passando per le console dj Numark, Hercules e Gemini, con uno sguardo anche ai modelli economici per amatori e a qualche console dj usata. Terremo d'occhio una serie di caratteristiche che il controller deve avere – dalle dimensioni, con i modelli compatti per il trasporto, alle funzionalità per il proprio stile e agli effetti come lo scratch – con attenzione alla qualità dei materiali, al design e al prezzo per trovare una buona console dj economica. Ecco una guida con tutto ciò che serve sapere per scegliere la tua prima console dj tra quelle disponibili online, per capire come iniziare a fare il dj e a mixare i tuoi brani preferiti. Confronteremo sei tra i migliori modelli di controller e poi procederemo alla spiegazione passo passo di tutte le caratteristiche tecniche. Pronti per iniziare a missare e far ballare amici e colleghi? Potrebbe interessarti anche: i migliori giradischi per ascoltare i tuoi vinili Prima di passare alla vera e propria guida all'acquisto della migliore consolle dj per le tue esigenze, vediamo qual è il funzionamento alla base di questo dispositivo, ovvero come funziona e come si utilizza la consolle da dj. La consolle DJ o il controller sono in grado di riprodurre un brano musicale selezionato da un certo ingresso: lettore CD, ingresso USB, altri supporti rigidi (ad esempio il vinile) o digitali. Una volta acquisito uno o più brani, il mixer interno alla consolle smista le diverse frequenze, e ha a disposizione un numero di canali attraverso cui effettuare questa operazione (di solito i canali sono sempre più di due e mai più di sei).

Summary: Cerchi una console da DJ per iniziare a mixare e campionare brani ed essere l'anima di ogni party che si rispetti? I commander per dj e le consolle nuove e usate sono super ricercate, ma è importante capire bene a cosa servono e come si usano, oltre a quale controller DJ e consolle scegliere. Ecco una guida alle migliori consolle dj per principianti delle migliori marche, come Pioneer, Numark, Hercules e Gemini.

fanpage

it

Write a title and summarize: SECTION 1. SHORT TITLE. This Act may be cited as the ``Lupus Research, Education, Awareness, Communication, and Healthcare Amendments of 2005''. SEC. 2. TABLE OF CONTENTS. The table of contents for this Act is as follows: Sec. 1. Short title. Sec. 2. Table of contents. Sec. 3. Findings. TITLE I--EXPANDING AND IMPROVING RESEARCH ON LUPUS Sec. 101. Expansion of lupus biomedical research. Sec. 102. Strengthening lupus epidemiology; lupus study. TITLE II--ENHANCING LUPUS AWARENESS AND EDUCATION Sec. 201. Increasing public awareness and improving health professional education. SEC. 3. FINDINGS. Congress makes the following findings: (1) Lupus is a serious, complex, debilitating autoimmune disease that can cause inflammation and tissue damage to virtually any organ system in the body, including the skin, joints, other connective tissue, blood and blood vessels, heart, lungs, kidney, and brain. (2) The Lupus Foundation of America, Inc. estimates that approximately 1,500,000 to 2,000,000 Americans live with some form of lupus; lupus affects women 9 times more often than men and 80 percent of newly diagnosed cases of lupus develop among women of child-bearing age. (3) Lupus disproportionately affects women of color; it is 2 to 3 times more common among African-Americans, Hispanics, Asians, and Native Americans and is generally more prevalent in minority populations, a health disparity that remains unexplained. According to the Centers for Disease Control and Prevention, the rate of lupus mortality has increased since the late 1970s and is higher among older African-American women. (4) There have been no new drugs approved by the Food and Drug Administration specifically for lupus in nearly 40 years and while current treatments for the disease can be effective, they can lead to damaging side effects. (5) The pain and fatigue associated with lupus can threaten people's ability to live independently and make it difficult to maintain employment and lead normal lives. One in 5 people with lupus is disabled by the disease, and consequently receives support from government programs, including medicare, medicaid, social security disability, and social security supplemental income. (6) The estimated average annual cost of medical treatment for an individual with lupus can range between $10,000 and $30,000; for people who have the most serious form of lupus, medical costs can greatly exceed this amount, causing a significant economic, emotional, and social burden to the entire family and to society. (7) More than \1/2\ of the people with lupus suffer 4 or more years and visit 3 or more physicians before obtaining a diagnosis of lupus; early diagnosis of, and commencement of treatment for, lupus can prevent or reduce serious organ damage, disability, and death. (8) Despite the magnitude of lupus and its impact on individuals and families, health professional and public understanding of lupus remains low; only 1 of 5 Americans can provide even basic information about lupus, and awareness of lupus is lowest among adults ages 18 to 34, the age group most likely to develop symptoms of lupus. (9) Lupus is a significant national health issue that deserves a comprehensive and coordinated response by Federal and State governments with the involvement of the healthcare provider, patient, and public health communities. TITLE I--EXPANDING AND IMPROVING RESEARCH ON LUPUS SEC. 101. EXPANSION OF LUPUS BIOMEDICAL RESEARCH. Section 441A of the Public Health Service Act (42 U.S.C. 285d-6a) is amended to read as follows: ``expansion of lupus biomedical research ``Sec. 441A. (a) In General.--The Secretary, acting through the Director of the Institute, shall expand and intensify research and related activities of the Institute with respect to lupus. ``(b) Coordination With Other Institutes.--The Director of the Institute shall coordinate the activities of the Director under subsection (a) with similar activities conducted by the other national research institutes and agencies of the National Institutes of Health to the extent that such institutes and agencies have responsibilities that are related to lupus. ``(c) Programs for Lupus.--In carrying out subsection (a), the Director of the Institute shall conduct or support research to expand the understanding of the causes of, and to find a cure for, lupus. Activities under such subsection shall include conducting and supporting the following: ``(1) Basic research to discover the pathogenesis and pathophysiology of the disease. ``(2) Research to determine the reasons underlying the disproportionate prevalence of lupus in African-American, Hispanic, Native American, and Asian women. ``(3) Epidemiological studies to address the frequency and natural history of the disease and the differences between the sexes and among racial and ethnic groups with respect to the disease. ``(4) Clinical research for the development and evaluation of new treatments, including new biological agents. ``(5) Research to validate lupus biomarkers. ``(6) Research to develop improved diagnostic tests.''. SEC. 102. STRENGTHENING LUPUS EPIDEMIOLOGY; LUPUS STUDY. Part B of title III of the Public Health Service Act (42 U.S.C. 243 et seq.) is amended by inserting after section 318B the following: ``strengthening lupus epidemiology ``Sec. 318C. (a) In General.--The Secretary, acting through the Director of the Centers for Disease Control and Prevention, shall work with a consortium of leading United States academic health institutions that have expertise in the epidemiology of lupus to undertake a national scale lupus epidemiological study to determine the true prevalence and incidence of lupus in the United States. ``(b) Use of Funds.--The Director of the Centers for Disease Control and Prevention shall enter into a cooperative agreement with the consortium described in subsection (a) to develop, implement, and manage a system for lupus data collection and analysis, including-- ``(1) the creation and use of a common data entry and management system across all study sites; and ``(2) the enhancement of the 2 study sites involved in the existing lupus patient registry of the Centers for Disease Control and Prevention on the day before the date of enactment of the Lupus Research, Education, Awareness, Communication, and Healthcare Amendments of 2005. ``(c) Geographic Representation.--The Director of the Centers for Disease Control and Prevention shall ensure that the consortium described in subsection (a) represents different geographic regions of the United States that have a sufficient number of individuals of all racial and ethnic backgrounds disproportionately affected by lupus, including Hispanics, Asians, Native Americans, and African-Americans. ``(d) Certain Activities.--In carrying out subsections (a) and (b), the consortium described in subsection (a) shall capture data related to all affected populations on all forms of lupus, including lupus related disorders. ``(e) Authorization of Appropriations.--There are authorized to be appropriated to carry out this section $3,500,000 for each of the fiscal years 2006, 2007, 2008, and 2009. ``lupus study and report by the institute of medicine ``Sec. 318D. (a) Contract.--The Secretary shall enter into a contract with the Institute of Medicine to conduct a study-- ``(1) to evaluate the Federal and State activities related to lupus research, education, and awareness programs and activities and make recommendations for ways in which these initiatives could be expanded; ``(2) to identify the gaps in Federal research related to-- ``(A) the causes of lupus; ``(B) lupus detection and diagnosis; ``(C) lupus treatment; and ``(D) lupus quality-of-life concerns; ``(3) to make recommendations for building and supporting the lupus research enterprise, including recommendations for strategies for future basic, clinical, social, and behavioral research-- ``(A) to determine the pathophysiology and pathogenesis of the disease; and ``(B) to secure the development of new and improved lupus therapies and ways to diagnose the disease; ``(4) to determine the gaps in lupus health professional education programs and public awareness efforts and make recommendations for ways in which the Federal Government can-- ``(A) improve public and health professional awareness of lupus; and ``(B) partner and support nonprofit voluntary health agencies (such as the Lupus Foundation of America, Inc.) and academic institutions and other interested stakeholders whose primary purposes are to increase public awareness of lupus and to improve the diagnosis and treatment of lupus; ``(5) to make recommendations regarding ways to improve the quality of life for people with lupus; ``(6) to summarize the clinical and biological features of lupus and the characteristics and management of major symptoms and make recommendations for disease management and measurement; and ``(7) to make recommendations for epidemiological studies in the various population groups affected by lupus in the United States. ``(b) Report.--Not later than 18 months after the date of enactment of the Lupus Research, Education, Awareness, Communication, and Healthcare Amendments of 2005, the Institute of Medicine shall submit to the Secretary a report containing the information described in paragraphs (1) through (7) of subsection (a).''. TITLE II--ENHANCING LUPUS AWARENESS AND EDUCATION SEC. 201. INCREASING PUBLIC AWARENESS AND IMPROVING HEALTH PROFESSIONAL EDUCATION. Part B of title III of the Public Health Service Act (as amended by section 102) (42 U.S.C. 243 et seq.) is further amended by inserting after section 318D the following: ``increasing public awareness of lupus and improving health professional education ``Sec. 318E. (a) In General.--The Secretary, acting through the Director of the Office on Women's Health and in collaboration with the Lupus Foundation of America, Inc. and the National Center on Minority Health and Health Disparities of the National Institutes of Health, shall conduct and support a sustained national lupus public awareness and health professional education campaign, with an emphasis on reaching populations at highest risk for the disease. ``(b) Use of Funds.--In conducting the sustained national lupus public awareness and health professional educational campaign, the Director of the Office on Women's Health shall-- ``(1) promote increased awareness of early intervention and treatment so as to significantly improve the diagnosis, treatment, and quality of life for people with lupus; ``(2) direct communication and education efforts toward minority communities that may be underserved or disproportionately affected by lupus; and ``(3) target at-risk women and health professionals likely to see women with lupus, including primary care physicians and specialists such as rheumatologists, nephrologists, dermatologists, and immunologists, so as to help reduce the amount of time taken to achieve a correct diagnosis of lupus. ``(c) Certain Activities.--To the extent practicable and appropriate, the Secretary shall ensure that communications under subsections (a) and (b) provide the latest medically sound information related to the signs, symptoms, diagnosis, and disease management of lupus. ``(d) Integration With Other Programs.--To the extent practicable and appropriate, the Secretary shall integrate efforts under this section with other programs carried out by the Secretary. ``(e) Authorization of Appropriations.--There are authorized to be appropriated to carry out this section $1,000,000 for each of the fiscal years 2006 through 2010.''.

Title: A bill to amend the Public Health Service Act to enhance public and health professional awareness and understanding of lupus and to strengthen the Nation's research efforts to identify the causes and cure of lupus Summary: Lupus Research, Education, Awareness, Communication, and Healthcare Amendments of 2005 - Amends the Public Health Service Act to require the Director of the National Institute of Arthritis and Musculoskeletal and Skin Diseases to expand research on lupus to include: (1) basic research to discover the pathogenesis and pathophysiology of the disease; and (2) research to validate lupus biomarkers. Requires the Secretary of Health and Human Services, acting through the Director of the Centers for Disease Control and Prevention (CDC), to work with a consortium of academic health institutions to undertake an epidemiological study to determine the prevalence and incidence of lupus in the United States. Requires the Director of CDC to: (1) enter into a cooperative agreement with such consortium to develop, implement, and manage a system for lupus data collection and analysis; and (2) ensure that such consortium represents different geographic areas and includes individuals of racial and ethnic backgrounds disproportionately affected by lupus. Requires the Secretary to enter into a contract with the Institute of Medicine to study and make recommendations related to lupus, to include: (1) evaluating Federal and State activities related to lupus and recommending ways to expand such activities; (2) identifying gaps in Federal research; and (3) recommending ways to improve the quality of life for people with lupus. Requires the Secretary, acting through the Director of the Office on Women's Health, to conduct and support a national lupus public awareness and health professional education campaign, with an emphasis on reaching populations at highest risk for the disease.

billsum

en

Summarize: CROSS-REFERENCE TO RELATED APPLICATION This application is a continuation of U.S. patent application Ser. No. 13/524,743 filed Jun. 15, 2012, which is a continuation of U.S. patent application Ser. No. 12/760,953, filed Apr. 15, 2010, the contents of which are hereby incorporated by reference in their entirety. FIELD OF THE INVENTION The present invention relates generally to a golf club head with a face insert that is only partially connected to the body of the golf club head. More specifically, the present inventions relates to a golf club head with a face insert, wherein the face insert is only connected to the body of the golf club head at strategic engagement portions increasing the Coefficient Of Restitution (COR) of the golf club head as well as removing unnecessary weight around the perimeter of the face insert. Even more specifically, the present invention relates to a golf club head with a face insert wherein less than 100% of the external perimeter region of the face insert engages the body of the golf club head. BACKGROUND OF THE INVENTION In order to improve the performance of a golf club beyond the current design constraints, golf club designers are often required to think outside the box and experiment with unconventional golf club designs. One example of this type of forward thinking is the recent usage of a face insert that is made out of a different material to replace the striking plate portion of a golf club head. These face inserts can be made out of a completely different material than the remainder of the body, allowing a golf club designer to improve durability of the golf club head, increase COR of the golf club head, and generate more discretionary weight within the golf club head. More specifically, the face insert may be made out of a titanium material that is lighter and more durable, resulting in improved durability, increased COR, and better weight distribution. Durability, weight savings, and additional COR are all important performance factors of a golf club that need to be considered when designing a golf club head to properly incorporate such a face insert design. U.S. Pat. No. 5,362,055 to Rennie (&#39;055 patent) illustrates one of the earlier attempts to utilize a face insert manufactured independently of the body in a metal wood type golf club head. More specifically, the &#39;055 patent discloses a metal wood that has a nonmetallic insert secured to a cavity formed in the ball face insert and reinforced by ribs on the interior of the face and the walls of a cavity formed in the club face insert. The insert is secured in the cavity by adhesion which is enhanced by channels formed in the insert cavity and hollow columns formed in the insert. U.S. Pat. No. 3,970,236 to Rogers (&#39;236 patent) illustrates the same concept of utilizing a face insert that is manufactured independently of the remainder of the body, but in an iron type golf club head. More specifically, the &#39;236 patent discloses a method of manufacturing that comprises casting a head having a hosel, neck, and body dependent thereon and providing the body with an open cavity in its face that extends from at least one edge thereof across a substantial portion of the face and to a first depth therein. The plate is preferably fused to the head by an electron fusion step to produce a homogenous head having an internal cavity. In order to further push the envelope of the design constraints of a golf club, golf club designers have improved upon the usage of a face insert by creating inserts that have a variable face thickness. Having a face insert that has variable thicknesses is advantageous and desirable because it allows strategic areas of the face to deflect as a uniform body when impacting a golf ball, yielding a more evenly distributed ballspeed across a greater region of the face insert. U.S. Pat. No. 6,638,182 to Kosmatka (&#39;182 patent) illustrates one of these attempts to vary the thickness of the face insert by disclosing a golf club head having a thin face insert with a smooth exterior surface and a thin layer disposed on the exterior surface. The face insert has a thickness in the range of 0.010 inch to 0.200 inch, and the thin layer has a thickness in the range of 0.003 inch to 0.050 inch. The face insert may have a uniform thickness or a variable thickness. Despite all of the advantages of utilizing a face insert made out of a separate material independently and separately from the body of the golf club head, utilizing such a face insert comes with significant design challenges. More specifically, because the face insert of the golf club head is the part of the golf club head that is subjected to the most extreme stress, connecting a face insert to the body of the golf club head at such extreme stress areas requires a significant bond strength. U.S. Pat. No. 7,479,070 to Hirano (&#39;070 patent) discusses and confirms the extreme amount of stress at the face insert of the golf club head by indicating that the club face of a golf club head is the point of maximum stress. In order to address this issue of connecting a face insert to the body of the golf club head at an area that has the highest stress levels, it is not uncommon for golf club designers to utilize a strong bonding process such as perimeter welding to affix the face insert to the body of the golf club head. U.S. Pat. No. 6,669,577 to Hocknell et al. (&#39;577 patent) discloses such an approach by initially stating the premise that high performance drivers employ relatively thin, high strength face materials that need to be attached to the body of the golf club head. The &#39;577 patent then goes on to state that these faces are either formed into the curved face shape then are welded into a driver body component around the face perimeter or forged into a cup shape and connected to a body by either welding or adhesive bonding. Hence, as it can be seen from above, despite all the advancement in utilization of face insert, the current art has been unable to sufficiently address this durability issue associated with the connectivity of the face insert with the body of the golf club head in a manner that does not involve excessive perimeter welding. The connection methods used by the current art involve extensive and excessive welding similar to those discussed in the &#39;577 patent, and these methods of excessive perimeter welding generate excessive weight that may hinder the performance of the golf club head itself. Ultimately, it can be deduced that there is a need in the art for a golf club wherein the face insert is connected to the body of the golf club in an unconventional method that is less clunky and burdensome. More specifically, there is a need in the art for a golf club with a face insert wherein the face insert can be connected to the body of the golf club in a way that eliminates the unnecessary bonding weight while at the same time maintain the strength and durability to withstand the impact of a golf ball. BRIEF SUMMARY OF THE INVENTION One aspect of the present invention is a golf club head comprising a body with an opening that defines an internal periphery region and a face insert adapted to be connected to a forward portion of the body around the internal periphery region. The internal periphery region further comprises an engagement portion and a non-engagement portion, wherein the face insert is adapted to be connected to the body around the internal periphery region only via the engagement portion, and wherein the engagement portion encompasses less than about 100% of the internal periphery region. In another aspect of the present invention is a golf club head comprising a body and a face insert adapted to be connected to a forward portion of the body. The face insert here further comprises an external periphery region, wherein less than 100% of the external periphery region of the face insert engages the body. In a further aspect of the present invention is a golf club head comprising a body and a face insert adapted to be connected to a forward portion of the body. The face insert further comprises an external periphery region, wherein the external periphery region further comprises an engagement portion and a non-engagement portion. The face insert is connected to the body in a way such that only the engagement portion of the external periphery region contacts the body, and the engagement portion encompasses less than 100% of the external periphery region of the face insert. Finally, the golf club head has an engagement ratio of less than about 1. The engagement ratio is calculated by dividing a percentage of the external periphery region covered by the engagement portion by a percentage of the external periphery region covered by the non-engagement portion. These and other features, aspects and advantages of the present invention will become better understood with references to the following drawings, description and claims. BRIEF DESCRIPTION OF THE DRAWINGS The foregoing and other features and advantages of the invention will be apparent from the following description of the invention as illustrated in the accompanying drawings. The accompanying drawings, which are incorporated herein and form a part of the specification, further serve to explain the principles of the invention and to enable a person skilled in the pertinent art to make and use the invention. FIG. 1 shows a perspective view of a golf club head in accordance with an exemplary embodiment of the present invention; FIG. 2 shows an exploded perspective view of a golf club head in accordance with an exemplary embodiment of the present invention; FIG. 3 shows a perspective view of the back of a face insert of a golf club head in accordance with an exemplary embodiment of the present invention; FIG. 4 shows a frontal view of a golf club head in accordance with an alternative embodiment of the present invention; FIG. 5 shows a frontal view of a golf club head in accordance with an alternative embodiment of the present invention; FIG. 6 shows a cross-sectional view of an alternative embodiment of the present invention taken along cross-sectional line A-A′ shown in FIG. 4 ; FIG. 7 shows a cross-sectional view of an alternative embodiment of the present invention taken along cross-sectional line A-A′ shown in FIG. 4 ; FIG. 7A shows a cross-sectional view of an alternative embodiment of the present invention taken along cross sectional line A-A′ shown in FIG. 4 ; FIG. 8 shows a cross-sectional view of an alternative embodiment of the present invention taken along cross-sectional line B-B′ shown in FIG. 4 ; FIG. 9 shows an exploded perspective view of a golf club head in accordance with an alternative embodiment of the present invention; FIG. 10 shows a cross-sectional view of an alternative embodiment of the present invention taken along cross-sectional line A-A′ shown in FIG. 4 ; FIG. 11 shows a cross-sectional view of an alternative embodiment of the present invention taken along cross-sectional line B-B′ shown in FIG. 4 ; FIG. 12A shows an exploded perspective view of a golf club head in accordance with an alternative embodiment of the present invention; FIG. 12B shows a cross-sectional view of an alternative embodiment of the present invention taken along cross-sectional line A-A′ shown in FIG. 4 ; FIG. 12C shows a cross-sectional view of an alternative embodiment of the present invention taken along cross-sectional line B-B′ shown in FIG. 4 ; FIG. 13A shows an exploded perspective view of a golf club head in accordance with an alternative embodiment of the present invention; FIG. 13B shows a cross-sectional view of an alternative embodiment of the present invention taken along cross-sectional line A-A′ shown in FIG. 4 ; and FIG. 13C shows a cross-sectional view of an alternative embodiment of the present invention taken along cross-sectional line B-B′ shown in FIG. 4. DETAILED DESCRIPTION OF THE INVENTION The following detailed description describes the best currently contemplated modes of carrying out the invention. The description is not to be taken in a limiting sense, but is made merely for the purpose of illustrating the general principles of the invention, since the scope of the invention is best defined by the appended claims. Various inventive features are described below and each can be used independently of one another or in combination with other features. However, any single inventive feature may not address any or all of the problems discussed above or may only address one of the problems discussed above. Further, one or more of the problems discussed above may not be fully addressed by any of the features described below. FIG. 1 of the accompanying drawings shows a perspective view of the inventive golf club head 100 in accordance with an exemplary embodiment of the present invention. More specifically, FIG. 1 shows a golf club head 100 with a face insert 102 and a body 104 ; wherein the face insert is adapted to be connected to a forward portion of the body 104. One of the most important features to identify in FIG. 1 is the gap between the face insert 102 and the body 104, signifying that the face insert 102 is only partially connected to the body 104 of the golf club head 100. This partial connection between the face insert 102 and the body 104, may improve the performance of the golf club head 100 by increasing the COR while removing unnecessary weight between the face insert 102 and the body 104 of the golf club head 100 used for joining the two components together. This partial connection discussed above may be more clearly separated into an engagement portion 101 portion and a non-engagement portion 103. The engagement portion 101 connects the face insert 102 with the body 104 while the non-engagement portion is shown here as an empty space between the face insert 102 and the body 104. The engagement portions 101 may generally be formed through a welding process that joins the two separate components in accordance with an exemplary embodiment of the present invention. Engagement portion 101, although most preferably formed by a welding process, could also be formed by a swaging process, a gluing process, a burning process, a soldering process, or even utilizing screws, all without departing from the scope and content of the present invention. The swaging process, as described in this current exemplary embodiment of the present invention may generally be accomplished using a forging process in which the dimensions of an item are altered using a die into which the item is forced. FIG. 1 also shows the face insert 102 being only partially connected to the body 104, leaving the non-engagement portions 103 to occupy parts of the perimeter of the face insert 102 where the face insert 102 and the body 104 are not engaged with one another. The empty spaces formed by the plurality of non-engagement portions 103 may generally remain unsupported, resulting in significant weight savings around the periphery regions of the face insert 102. However, in an alternative embodiment of the present invention, the non-engagement portions 103 may not be empty gaps but could be filled with a vibration dampening material that helps dampen the vibration between the face insert 102 and the body 104 without departing from the scope and content of the present invention. The vibration dampening material that could be used to fill in the non-engagement portion 103 gap between the face insert 102 and the body 104 may generally be a polymer type material for its vibration absorption properties; however, numerous other materials such as plastic, urethane, rubber, ceramic, or any other material capable of absorbing the vibration between the face insert 102 and the body 104 may all be used without departing from the scope and content of the present invention. In addition to providing vibration dampening, the vibration dampening material sandwiched between the face insert 102 and the body 104 may also provide structural rigidity and support to the face insert 102, helping absorb and dissipate the forces that can result when the golf club head 100 hits a golf ball. FIG. 2 of the accompanying drawings shows an exploded perspective view of a golf club head 200 in accordance with the exemplary embodiment of the present invention. The exploded view of the golf club head 200 shown in FIG. 2 allows a better visualization of how the face insert 202 interfaces with the body 204 of the golf club head 200. More specifically, the face insert 202 may generally be in the form of a plate that may be inserted into an opening 206 positioned near the forward portion of the body 204 of the golf club head 200. The exploded view of the golf club 200 shown in FIG. 2 allows the external periphery region 230 of the face insert 202 and the internal periphery region 205 of the body 204 be shown in more detail. The external periphery region 230 and the internal periphery region 205 are important to the assembly of the golf club head 200 because those regions may partially engage one another via an engagement portion 101 (shown in FIG. 1 ) to secure the face insert 202 to the body 204 of the golf club head 200. It should be noted that in one exemplary embodiment, the opening 206 of the body 204 may not contain any backing or structural support for the face insert 202. This lack of a backing or structural support in the opening 206 portion of the body 204 leaves the engagement portion 101 (shown in FIG. 1 ) as the only support between the face insert 202 and the body 204, eliminating unnecessary weight around the perimeter of the face insert 204 traditionally reserved for bonding the external periphery region 205 and the internal periphery region 230. Decreasing unnecessary weight within the golf club head 200 may generally be advantageous to the performance of a golf club because the weight savings could be used to improve the Center of Gravity (CG) and Moment of Inertia (MOI) properties of the golf club head 200 by shifting the discretionary weight towards a more strategically beneficial position. FIG. 3 of the accompanying drawings shows the perspective view of the back side of the face insert 302 and more clearly depicts the boundaries of the external periphery region 330 on the face insert 302. External periphery region 330, as shown in the current exemplary embodiment is the region that interfaces with the body 204 (shown in FIG. 2 ), and may include several different surfaces in addition to what is visibly apparent in FIG. 2. More specifically, external periphery region 330 may include the outer region 334 of the back surface of the face insert as well as the side surface 332 of the face insert 302 as shown in FIG. 3. The external periphery region 330 of the face insert 302 may generally exclude the central region 336 of the back of the face insert 302 due to the fact that the central portion of the body 204 (shown in FIG. 2 ) may have a hollow opening 206 (shown in FIG. 2 ) prohibiting it from engaging the face insert 302. FIG. 4 of the accompanying drawings shows a frontal view of a golf club head 400 in accordance with an alternative embodiment of the present invention. The frontal view of the golf club head 400 shown in this alternative embodiment allows cross-sectional lines A-A′ and B-B′ to be shown more clearly. More specifically, cross-sectional lines A-A′ run vertically across the center of the golf club head 400 showing how the engagement portion 401 connects the face insert 402 to the body 404. Cross-sectional lines B-B′ run vertically across the golf club head 400 at a location that is offset from the center of the golf club head 400, showing how non-engagement portion 403 separates the face insert 402 and the body 404. In addition to providing the cross-sectional lines A-A′ and B-B′, FIG. 4 also shows the golf club head with six distinct engagement portions 401 separated by various non-engagement portions 403. By examining the number of engagement portions 101 in FIG. 1 in combination with the number of engagement portions 401 in FIG. 4, it can be concluded that the current invention is not limited by the exact number of engagement portions 404, but can have any number of engagement portions 404 around the perimeter of the face insert 402 all without departing from the scope and content of the present invention; as long as there exists one non-engagement portion 403 leaving less than 100% of the perimeter of the face insert 402 touching the body 404. The frontal view of golf club head 400 shown in FIG. 4 also shows how the various engagement portions 401 may have different widths for the purpose of varying the structural support at different locations along the perimeter of the face plate 402 depending on the amount of impact stresses. Here in FIG. 4, we can see the engagement portion 401 near the sole of the golf club head 400 may be significantly wider than the engagement portion 401 near the top of the golf club head 400 to create a stronger bond near the bottom of the face insert 402, a location where most golfers strike the golf ball. However, the various engagement portions 401 may all have different widths at different locations depending on the structural support needs of the golf club head 400 all without departing from the scope and content of the present invention. FIG. 5 of the accompanying drawings shows a frontal view of a golf club head 500 and illustrates a further alternative embodiment of the present invention wherein engagement portions 501 may encompass a significant portion of the perimeter of the face insert 502 without departing from the scope and content of the present invention. More specifically, engagement portion 501 shown in FIG. 5 may completely cover the toe portion, the heel portion, and the sole portion of the perimeter of the face insert 502 while keeping the top portion relatively unattached, yielding a non-engagement portion 503 near the top perimeter region of the face insert. Having this arrangement may be beneficial to the performance and durability of the golf club head 500, as a significant portion of the face insert 502 is rigidly supported to the body 504 of the golf club head 100. However, the specific size and length of the engagement portion 501 shown in FIG. 5 should not be limited to the configuration shown in FIG. 5 ; various other numbers, length, and proportions of engagement portion 501 relative to non-engagement portion 503 may be used to achieve the same purpose all without departing from the scope and content of the present invention so long as the face insert 502 is only partially connected to the body 504 of the golf club head 500. In one preferred embodiment, the engagement portion 501 may encompass less than about 100% of the external periphery region of the face insert 502. In a more preferred embodiment of the present invention, the engagement portion 501 may encompass less than about 75% of the external periphery region of the face insert 502. In an even more preferred embodiment of the present invention, the engagement portion 501 may encompass less than about 50% of the external periphery region of the face insert 502. Finally, in a most preferred embodiment of the present invention, the engagement portion 501 may encompass less than about 25% of the external periphery region of the face insert 502. Because the relationship between the engagement portion 501 and the non-engagement portion 503 helps determine the performance gains of a golf club head 500, it is important to define that relationship in a quantifiable manner. Equation (1) below shows the relationship between the engagement portion 501 and the non-engagement portion 503 in a quantifiable manner creating an engagement ratio. Engagement ⁢ ⁢ Ratio = % ⁢ ⁢ of ⁢ ⁢ perimeter ⁢ ⁢ covered ⁢ ⁢ by ⁢ ⁢ Engagement ⁢ ⁢ Portion % ⁢ ⁢ of ⁢ ⁢ perimeter ⁢ ⁢ covered ⁢ ⁢ by ⁢ ⁢ Non ⁢ - ⁢ Engagement ⁢ ⁢ Portion ( Eq. ⁢ 1 ) In one exemplary embodiment of the present invention the % of the perimeter covered by the engagement portion 501 may be about 90 percent and the % of the perimeter covered by the non-engagement portion 503 may be about 10 percent, yielding an engagement ratio of less than about 9. In a more preferable embodiment of the present invention, the % of the perimeter covered by the engagement portion 501 may be about 75 percent and the % of the perimeter covered by the non-engagement portion 503 may be about 25 percent yielding an engagement ratio of less than about 3. In an even more preferable embodiment of the present invention, the % of the perimeter covered by the engagement portion 501 may be about 50 percent and the % of the perimeter covered by the non-engagement portion 503 may be about 50 percent, yielding an engagement ratio of less than about 1. Finally, in a most preferred embodiment of the present invention, the % of the perimeter covered by the engagement portion 501 may be about 25 percent and the % of the perimeter covered by the non-engagement portion 503 may be about 75 percent, yielding an engagement ratio of less than about 0.33. FIG. 6 of the accompanying drawings shows a cross-sectional view of a golf club head 600 taken along cross-sectional line A-A′ in FIG. 4. In the cross-sectional view shown in FIG. 6, it can be seen that the engagement portion 601 joins the face insert 602 to the body 604 of the golf club head 600. The engagement portion 601, as shown in this current exemplary embodiment, may generally be weld spots near the frontal surface of the face insert 602. In addition to providing structural support, having the weld spots near the frontal surface of the face insert 602 may be desirable, as excessive weld can be easily removed from the frontal surface of the face insert 602. Although the preferred bonding method shown in FIG. 6 utilizes a welding process, numerous other processes already discussed above may be used to connect the face insert 602 to the body 604 at the engagement portion 601 all without departing from the scope and content of the present invention. FIG. 7 of the accompanying drawings shows a cross-sectional view of a golf club head 700 in accordance with an alternative embodiment of the present invention taken along cross-sectional line A-A′ in FIG. 4. More specifically, FIG. 7 shows an alternate location at the rear surface of the face insert 702 for the engagement portion 701 to connect the face insert 702 and the body 704. Having the engagement portion 701 connecting the face insert 702 to the body 704 towards the rear surface of the face insert 702, although less accessible for post machining operations, has the advantage in that the engagement portion 702 may be hidden from view. Having the engagement portion 702 hidden from view may be a preferred design alternative, as it could significantly save or completely eliminate the amount of post manufacturing processing and machining. FIG. 7A of the accompanying drawings shows a cross-sectional view of a golf club head 700 in accordance with a further alternative embodiment of the present invention taken along cross-sectional line A-A′ in FIG. 4. More specifically, FIG. 7A shows an alternative attachment mechanism to secure the face insert 702 to the body 704 of the golf club head 700 utilizing a plurality of screws 711 for the engagement portion 701. Utilizing a plurality of screws 711 for the engagement portion 701 may be preferred in certain situations wherein the face insert 702 can be easily changed out from its location within the body 704 of the golf club head 700. It should be noted that although FIG. 7A only shows the usage of the plurality of screws 711 at one particular location, the actual location of the plurality of screws 711 that may be used to connect the face insert 702 with the body 704 is not limited to the locations depicted in FIG. 7A. In fact, a plurality of screws 711 may be used to connect the face plate 702 to the body 704 at any engagement portion 701 described in the current specifications all without departing from the scope and content of the present invention. FIG. 8 of the accompanying drawings shows a cross-sectional view of a golf club head 800 taken along cross-sectional line B-B′ in FIG. 4. This cross-sectional view of the golf club head 800 allows the non-engagement portion 803 to be shown in a more clearly defined manner, further accentuating the fact that the face insert 802 is not connected to the body 804 of the golf club head 800 at the non-engagement portion 803. Although the ability to fill the non-engagement portion 803 has already been discussed above, it is worth mentioning again here that the non-engagement portion 803 could very often be filled with a vibration dampening material 820 that helps absorb and dissipate some of the impact forces. Here, in this exemplary embodiment of the present invention shown in FIG. 8, the vibration dampening material 820 is only used to fill the non-engagement portion 803 near the sole portion of the perimeter of the face insert 802. In certain situations, it may be desirable to have the vibration dampening material 820 only fill in the bottom sole portion of the non-engagement portion 803 to further eliminate unnecessary weight; especially in shorter irons wherein the impact forces are not as high. However, it should be noted that the vibration dampening material 820 could be focused at other portions of the perimeter of the face insert 802, or even completely fill the non-engagement portion 803 without departing from the scope and content of the present invention. FIG. 9 of the accompanying drawings shows a further alternative embodiment of the present invention wherein the body may contain a plurality of backing tabs 940 to further provide structural rigidity for the face insert 902 once it has been assembled into the body 904. More specifically, as it can be seen from FIG. 9, the plurality of backing tabs 940 may engage the external periphery region 930 at the back surface of the face insert 902 to provide additional structural support for the face insert 902. However, in order to examine more closely the relationship between the face insert 902 and plurality of backing tabs 904, one has to turn to a cross-sectional view of the golf club head 900 shown in FIGS. 10-11 below. FIG. 10 shows a cross-sectional view of a golf club head 1000 in accordance with the alternative embodiment of the present invention shown in FIG. 9. More specifically, the cross-sectional view of the golf club head 1000 shown in FIG. 10 is taken across the same cross-sectional line A-A′ shown in FIG. 4, illustrating the engagement portion 1001 between the face insert 1002 and the body 1004. It should be noted that the engagement portion 1001 shown in FIG. 10 may generally be at the rear surface of the face insert 1002 engaging the plurality of backing tabs 1040 instead of around the side surfaces of the face insert 1002. Engagement portion 1001, similar to the discussion above, may most preferably be formed by a welding process; however numerous other methodologies such as swaging, gluing, burning, soldering, or even utilization of screws may all be used without departing form the scope and content of the present invention. FIG. 11 of the accompanying drawings shows a cross-sectional view of a golf club head 1100 in accordance with the alternative embodiment of the present invention shown in FIG. 9. More specifically, the cross-sectional view of the golf club head 1100 shown in FIG. 11 is taken across the same cross-sectional line B-B′ shown in FIG. 4, illustrating the non-engagement portion 1103 between the face insert 1102 and the body 1104. In this alternative embodiment of the present invention a vibration dampening material 1120 may completely fill up the entire non-engagement portion 1103 of the perimeter of the face insert 1102, maximizing the vibration dampening capability of the non-engagement portion 1103. However, similar to the embodiments discussed above, the vibration dampening material 1120 need not completely fill the non-engagement portion 1103 and could partially fill the non-engagement portion 1103 at strategic locations without departing from the scope and content of the present invention. FIGS. 12A, 12 B, and 12 C of the accompanying drawings shows a further alternative embodiment of the present invention wherein the plurality of backing tabs 1240 protrude out from the body 1204, creating an engagement portion 1201 that connects the face insert 1202 to the body 1204. This alternative embodiment may be preferred in situations where it is desirable to maintain a face insert 1202 shape that is relatively flat while providing an alternative way to connect the face insert 1202 to the body 1204. It should be noted that although the current exemplary embodiment shows only three backing tabs 1240 to help distribute the impact forces of the face insert 1202, any various number of backing tabs 1240 may be used around the perimeter of the body 1204 to provide support for the face insert 1202 without departing from the scope and content of the present invention. FIGS. 13A, 13 B, and 13 C of the accompanying drawings shows a further alternative embodiment of the present invention wherein the plurality of backing tabs 1340 protrude out from the rear surface of the external engagement portion 1330 of the face insert 1302, creating an engagement portion 1301 that connects the face insert 1302 to the body 1304. This alternative embodiment may be preferred in situations wherein an alternative manufacturing technique mandates a flatter frontal surface for the body 1304. Similar to above, the plurality of backing tabs 1340 is not limited to what can be shown in FIGS. 13A, 13 B, and 13 C, but could be any number of backing tabs 1340 so long as it leaves sufficient room for the non-engagement portion all without departing from the scope and content of the present invention. Other than in the operating example, or unless otherwise expressly specified, all of the numerical ranges, amounts, values and percentages such as those for amounts of materials, moment of inertias, center of gravity locations, loft, draft angles, various performance ratios, and others in the following portions of the specification may be read as if prefaced by the word “about” even though the term “about” may not expressly appear in the value, amount, or range. Accordingly, unless indicated to the contrary, the numerical parameters set forth in the above specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained by the present invention. At the very least, and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques. Notwithstanding that the numerical ranges and parameters setting forth the broad scope of the invention are approximations, the numerical values set forth in the specific examples are reported as precisely as possible. Any numerical value, however, inherently contains certain errors necessarily resulting from the standard deviation found in their respective testing measurements. Furthermore, when numerical ranges of varying scope are set forth herein, it is contemplated that any combination of these values inclusive of the recited values may be used. It should be understood, of course, that the foregoing relates to exemplary embodiments of the present invention and that modifications may be made without departing from the spirit and scope of the invention as set forth in the following claims.

Summary: A golf club head with a face insert that is only partially connected to the body of the golf club head is disclosed herein. More specifically, the present invention discloses a golf club head with a face insert wherein the face insert is only connected to the body of the golf club head at specific engagement portions around the perimeter of the face insert while keeping the remainder of the perimeter unengaged. The golf club head disclosed in accordance with the present invention will allow for removal of excessive weight traditionally needed to connect the face insert to the body of the golf club head, therefore improving the performance of the golf club head.

big_patent

en

Summarize: A heart-warming photo that captured the moment a group of students helped carry their disabled classmate into the Aegean Sea in Greece has been viewed more than one million times on social media. University of Montana senior Gabrielle Broere was diagnosed with cerebral palsy - a neurological disorder that causes physical disability - when she was just one year old. Never one to let her disability get in the way of doing things, she went to study in Greece with 16 other students for 17 days last year. This heart-warming photo of four students helped carrying their disabled classmate Gabrielle Broere into the Aegean Sea in Greece has been viewed more than one million times on social media. 'I wasn't really sure how people were going to react to me and how helpful they would be and if I was going to get left behind,' she told Montana Kaimin. Most of the time Gabrielle uses a wheelchair to get around although can also use crutches to walk short distances. Several times during her Greek trip she found herself stuck and requiring her friends help. 'There was one time when we were on the ferry and the lift broke so they had four guys carry me down the stairs in my wheelchair,' said Gabrielle. When the class visited the Aegean Sea they soon discovered that they could no longer push Gabrielle's wheelchair, and without her crutches, she had no way of making it to the water. Then four of her friends hoisted Gabrielle by her arms and legs, and carried her into the water so she could stand in the sea and feel the water in between her toes. 'It was surreal,' she said. 'I was in complete awe of where I was and what was happening.' University of Montana senior Gabrielle Broere was diagnosed with cerebral palsy, a neurological disorder that causes physical disability, when she was just one year old. The Greek expedition wasn't her first trip. In 2011, Gabrielle had taken a 10-day trip to Peru where she first encountered how difficult it can be to access historical sites as a disabled person. Despite her disability, Broere doesn't plan to stop traveling hopes to see even more of Europe. 'It sucks getting around and it's hard, but I can do it. I've been through a lot now, and I'll continue going through that the rest of my life,' Broere said. 'I can't let anything hold me back. I would love to go to France and Italy next.' Broere is graduating in the fall with a degree in History, and plans to go to law school

Summary: University of Montana senior Gabrielle Broere was diagnosed with cerebral palsy when she was just one year old. Most of the time she uses a wheelchair to get around although she also uses crutches to walk for short distances. On a trip to Greece last year her friends carried her to the water after. The photo of Gabrielle dipping her toes in the Aegean Sea has been shared more than one million times already on social media.

cnn_dailymail

en

Write a title and summarize: Risk for Atrial Fibrillation (AF), the most common human arrhythmia, has a major genetic component. The T-box transcription factor TBX5 influences human AF risk, and adult-specific Tbx5-mutant mice demonstrate spontaneous AF. We report that TBX5 is critical for cellular Ca2+ homeostasis, providing a molecular mechanism underlying the genetic implication of TBX5 in AF. We show that cardiomyocyte action potential (AP) abnormalities in Tbx5-deficient atrial cardiomyocytes are caused by a decreased sarcoplasmic reticulum (SR) Ca2+ ATPase (SERCA2) -mediated SR calcium uptake which was balanced by enhanced trans-sarcolemmal calcium fluxes (calcium current and sodium/calcium exchanger), providing mechanisms for triggered activity. The AP defects, cardiomyocyte ectopy, and AF caused by TBX5 deficiency were rescued by phospholamban removal, which normalized SERCA function. These results directly link transcriptional control of SERCA2 activity, depressed SR Ca2+ sequestration, enhanced trans-sarcolemmal calcium fluxes, and AF, establishing a mechanism underlying the genetic basis for a Ca2+-dependent pathway for AF risk. Atrial fibrillation (AF) is the most common arrhythmia in humans, characterized by irregularly irregular atrial electrical activity, resulting in asynchronous atrial contraction. AF is a global problem, affecting more than 33 million people and approximately 25% of Americans over the age of forty (Nishida and Nattel, 2014; Weng et al., 2018). AF is associated with significant morbidity and mortality due to thromboembolic events, heart failure, and sudden cardiac death. AF also significantly complicates overall health care management, with AF patients costing five times more to treat than patients without AF (Andrade et al., 2014). The total annual cost to treat AF patients in the US is on the order of 26 billion dollars (Nishida and Nattel, 2014). AF is a highly significant and growing public health concern. A genetic basis for AF risk has been described in the last decade. Large community-based cohort studies indicate that heritability provides between 40% and 62% of AF risk (Nishida and Nattel, 2014; Christophersen et al., 2009). An emerging paradigm describes AF as a multifactorial disease with genetic predisposition that will determine the propensity of secondary clinical insults to cause AF. This model highlights the importance of understanding the molecular mechanisms underlying the genetic predisposition to AF. Genome-wide association studies (GWAS) studies have identified common risk variants and familial mutations at the T-box transcription factor 5 (TBX5) locus that result in increased risk for AF (McDermott et al., 2008; Sinner et al., 2014). Adult-specific Tbx5 knockout mice demonstrate primary spontaneous and sustained AF, providing evidence supporting the genetic implication at this locus. GWAS have also implicated multiple genes involved in cardiomyocyte calcium handling, including Atp2a2, encoding the sarcolemmal calcium ATPase SERCA2, and Sln and Pln, encoding direct binding SERCA2 inhibitors sarcolipin and phospholamban, respectively. We have previously demonstrated that these cardiomyocyte calcium control genes are direct TBX5 targets (Nadadur et al., 2016). These observations suggested that tight transcriptional control of SERCA2 activity may be central to atrial rhythm robustness and that variation in SERCA2 expression and activity may contribute to AF risk. The cellular mechanisms causing the irregular electrical activity in AF are believed to include an abnormal myocardial substrate and formation of an ectopic trigger. Abnormal substrate refers to altered electrical conduction between cardiomyocytes. Ectopic trigger refers to cardiomyocyte ectopy, or initiation of electrical activity at regions outside of the sinoatrial node. Both of these cellular phenomena are observed in Tbx5 adult-specific mutant mice and have been associated with abnormal cellular calcium handling (Dobrev, 2010; Voigt et al., 2012; Voigt et al., 2014; Vest et al., 2005; Shanmugam et al., 2011; Neef et al., 2010; Macquaide et al., 2015; Liang et al., 2008; Lenaerts et al., 2009; Hove-Madsen et al., 2004; Greiser et al., 2011; El-Armouche et al., 2006; Brundel et al., 1999). We described the TBX5-dependent gene regulatory network essential for atrial rhythm control and identified downstream ion channels and transporters potentially important to rhythm control (Nadadur et al., 2016; Yang et al., 2017). Triggered activity in the form of early and delayed afterdepolarizations (EADs and DADs) observed in Tbx5-deficient atrial cardiomyocytes could be rescued by heavy buffering of cytoplasmic calcium (Nadadur et al., 2016). Tbx5-dependent calcium handling has thereby emerged as a potential mediator of the myocardial physiologic abnormalities resulting in AF. We sought to define the Tbx5-dependent cellular mechanisms responsible for abnormal calcium-dependent electrical activity. We found that Tbx5-dependent AF is associated with abnormal sarcoplasmic reticulum (SR) calcium uptake due to depressed SERCA2 expression, depressed SERCA function, and increased phospholamban expression. Decreased SR calcium uptake is compensated by increased Ca2+ extrusion from cardiomyocytes via sodium-calcium exchanger (NCX) current (INCX), which provides a mechanism for TBX5-dependent action potential (AP) prolongation and the propensity for triggered cellular ectopy. In the setting of enhanced NCX mediated Ca2+ efflux and depressed SR uptake, compensatory increases in L-type calcium current (ICaL) balance calcium extrusion to maintain steady state calcium homeostasis. Together these calcium handling alterations contribute to AP prolongation and triggered activity. We further demonstrated that calcium handling abnormalities, AP alterations, and triggered activity are all normalized by knockout of phospholamban, which prevents Tbx5-dependent AF. These results establish a direct link between depressed SR Ca2+ sequestration, enhanced NCX activity, and AF. This model suggests that targeting calcium handling pathways may be a treatment approach for a subpopulation of AF patients. We previously reported that Tbx5-deficient atrial cardiomyocytes demonstrated AP prolongation and myocardial ectopy. We hypothesized that these defects were caused by cellular calcium handling abnormalities. We therefore surveyed the expression of known calcium handling genes in the adult-specific Tbx5 knockout model. We assessed gene expression in Tbx5fl/fl; R26CreERT2 and control R26CreERT2 mice at 10 weeks of age following tamoxifen (TM) treatment at 8 weeks of age. Consistent with previous observations, the adult Tbx5fl/fl; R26CreERT2 but not control mice developed spontaneous AF, showing an irregularly irregular heartbeat, by telemetric electrocardiogram (ECG) recordings (Figure 1A, B). As previously shown, APs and [Ca]i transients were prolonged in Tbx5fl/fl; R26CreERT2 (Figure 1C) (Nadadur et al., 2016). We assessed expression of genes important to cellular calcium handling in the left atrium by quantitative PCR (Figure 1D). mRNA transcripts for RyR2 (Ryr2) and SERCA2 (Atp2a2), two of the main determinants of sarcoplasmic reticulum (SR) calcium flux, were decreased by 61% and 71% respectively in Tbx5fl/fl; R26CreERT2 mice compared to R26CreERT2 controls (p=0. 026 and p=0. 001 for Ryr2 and Atp2a2 respectively) consistent with previous studies (Nadadur et al., 2016). In addition, phospholamban (Pln) mRNA expression was increased by 69% in Tbx5fl/fl; R26CreERT2 compared to R26CreERT2 (p=0. 023), which would be expected to further depress SERCA2 activity. There was no significant difference in mRNA expression of the alpha 1C subunit of the L-type calcium channel (Cacna1c), the cardiac sodium calcium exchanger (Ncx1), or any of the calmodulins 1–3 (Calm1, Calm2, Calm3) (Figure 1C). These data are consistent with the hypothesis that the myocardial electrophysiology deficits in the Tbx5-deficient AF model may be due to abnormal calcium handling. We examined the relationship between myocardial electrophysiology deficits and calcium flux in Tbx5-mutant atria. In steady state, with each cardiomyocyte contraction cycle, calcium entering the cardiomyocyte (L-type calcium channel, ICaL) is extruded from the cell (predominantly via inward INCX). Similarly, calcium leaving the SR via RyR2 release or SR leak pathways is taken back up into the SR via SERCA2. We examined the effect of altered TBX5-dependent gene expression on these aspects of cardiomyocyte calcium flux. Given the observed changes in Ryr2 and Atp2a2 mRNA abundance, we hypothesized that AP prolongation in Tbx5 deficient cardiomyocytes was due to calcium handling defects downstream of initial Ca2+ entry through ICaL. To test this, we recorded APs in the presence and absence of the L-type Ca2+ channel blocker nifedipine. This approach blocks Ca2+ entry into the cell and indirectly removes the effect of Ca2+ entry on downstream Ca2+ handling pathways, including SR Ca2+ release/reuptake as well as the electrogenic effect of calcium transport out of the cell via inward INCX. 30 μM nifedipine completely inhibited L-type calcium current, preventing Ca2+ entry or release of SR calcium in control R26CreERT2 and Tbx5fl/fl; R26CreERT2 (Figure 2—figure supplement 1). In control R26CreERT2 atrial cardiomyocytes, the effect of nifedipine on AP duration (APD) was small, with 19 ± 4% shortening of APD at 90% repolarization (APD90) (p=0. 008) (Figure 2A). However, in Tbx5fl/fl; R26CreERT2 atrial cardiomyocytes, nifedipine had a profound effect: APD at 50% repolarization (APD50) was shortened by 16 ± 6% and APD90 by 61 ± 6% (p=0. 02 and 0. 007 respectively) (Figure 2B, C). Western blot with densitometry analysis for CaV1. 2 showed no significant difference in protein expression (Figure 2D), in line with the qPCR data (Figure 1D), consistent with no TBX5-driven direct transcriptional regulation of L-type calcium channels. However, peak ICaL current was increased 92 ± 34% (p=0. 027) in Tbx5fl/fl; R26CreERT2 atrial cardiomyocytes compared to control R26CreERT2 (Figure 2E and F). The inactivation kinetics at peak ICaL were accelerated Tbx5fl/fl; R26CreERT2 compared to control R26CreERT2 (τ = 26. 7 ± 3. 4 ms vs. τ = 40. 0 ± 3. 0 ms; p=0. 05). Steady-state ICaL inactivation was unchanged (Figure 2—figure supplement 2). These data suggest that increased ICaL may contribute to TBX5-loss associated AP prolongation and EADs. However, nifedipine also blocks SR Ca2+ release as well as downstream Ca2+ extrusion pathways, which also affect AP duration. Further, since late AP repolarization is dramatically prolonged (negative to −30 mV where ICaL is largely inactive) we hypothesized that Tbx5-deficiency disrupts Ca2+ handling pathways downstream of ICaL. Because RyR2 is a critically important sarcolemmal calcium extrusion channel and Ryr2 mRNA was downregulated in Tbx5-mutant atria, we investigated the Tbx5 dependent regulation of RyR2 protein expression and function. RyR2 protein expression was significantly decreased in left atria of Tbx5fl/fl; R26CreERT2 mice compared to R26CreERT2 mice by western blot (Figure 3A), consistent with the observed downregulation of Ryr2 mRNA (Figure 1B). We hypothesized that decreased RyR2 contributed to abnormal Ca2+ release from the SR and tested this by measuring local spontaneous RyR2-mediated Ca2+ release events (Ca2+ sparks) using confocal linescans (Figure 3B). The frequency of Ca2+ sparks in Tbx5fl/fl; R26CreERT2 atrial cardiomyocytes was decreased in comparison with R26CreERT2 atrial cardiomyocytes at different pacing frequencies from 0 to 2 Hz (Figure 3C). A decrease in calcium sparks can be due to either decreased RyR2 open probability or a reduced SR calcium load. To differentiate these possibilities, we first examined RyR2 function in the setting of reduced RYR2 expression by performing a [3H]-ryanodine binding assay. [3H]-ryanodine binding to RyR2 correlates with RyR2 open probability (Dobrev, 2010). Despite reduced ryanodine receptor expression, overall ryanodine binding was unchanged over the majority of the physiological range of calcium values, with no shift in calcium sensitivity (Figure 3D). This observation suggests that the alterations in spark frequency were not due to changes in total RyR2 open probability. Instead, it may be caused by diminished SR Ca2+ uptake, a SERCA-dependent property. We next focused on the balance of diastolic calcium efflux pathways as potential mediators of Ca2+ mishandling by measuring SR Ca2+ content and protein expression and function of SERCA2 and NCX1. We observed that SERCA2 protein expression was decreased while NCX1 protein expression was increased in Tbx5fl/fl; R26CreERT2 in comparison with R26CreERT2 atria (Figure 4A, B). To define steady state SR Ca2+ content, we loaded cardiomyocytes with Fluo-4 AM and paced with a train of field stimuli to achieve a steady state Ca2+ content, peak Ca2+ content, and rate of Ca2+ removal were measured (Figure 4C, D). The [Ca2+]i transient peaks were unchanged, but [Ca2+]i transient decay rates, corresponding to SR Ca2+ uptake and cellular Ca2+ extrusion, were slowed in Tbx5fl/fl; R26CreERT2 compared to R26CreERT2 atrial cardiomyocytes (Figure 4E, F) (Nadadur et al., 2016), consistent with defective Ca2+ removal from the cytosol. We also measured [Ca2+]i transients in voltage clamp mode using 40 ms square wave voltage clamp pulses from −80 to 0 mV (Figure 4—figure supplement 1). Similar to the field stimulation experiments, [Ca2+]i transient decay rates were slowed, but [Ca2+]i transient peaks were decreased by 23 ± 4% (p=0. 02) in Tbx5fl/fl; R26CreERT2 cardiomyocytes compared to R26CreERT2, which suggests that AP prolongation is essential to maintaining peak twitch [Ca2+]i. The latter experiment is also consistent with depressed SR loads in Tbx5fl/fl; R26CreERT2 compared to R26CreERT2 atrial myocytes. We hypothesized that decreased SERCA2 expression caused decreased SR load. We examined SERCA activity by synchronizing the opening of RyR2 channels while preventing Ca2+ extrusion through NCX using caffeine containing, sodium-free, Tyrode solution. This provides a measurement of the maximum release of Ca2+ into the cytosol from the SR, a measure of the SR Ca2+ load (Figure 4C, D). SR [Ca2+] was reduced by 24 ± 8% (p=0. 0005) in Tbx5fl/fl; R26CreERT2 compared with R26CreERT2 atrial cardiomyocytes (Figure 4G). SERCA activity was assessed from [Ca2+]i decay rate after SR release in the absence of external sodium (NCX inactive). Peak SERCA activity was reduced by 31 ± 9% (p=0. 006) in Tbx5fl/fl; R26CreERT2 compared with R26CreERT2 atrial cardiomyocytes (Figure 4C, H). NCX activity was assessed as the rate of change in [Ca2+]i decay in Na+ containing caffeine solution, preventing net SR uptake. Since NCX activity depends on [Ca]i, we plotted NCX as a function of the [Ca]i signal. NCX activity was ~60% higher in Tbx5fl/fl; R26CreERT2 in comparison with R26CreERT2 atrial cardiomyocytes (Figure 4D, I). Thus, removal of Tbx5 causes decreased SR Ca2+ load and decreased SERCA function, but increased NCX mediated Ca2+ extrusion. Increased inward NCX activity promotes cardiomyocyte depolarization, providing a mechanism for prolonged APs and increased ectopy in Tbx5-mutant atrial cardiomyocytes. We hypothesized that Tbx5 deficiency reduces SERCA activity by decreasing SERCA2 protein expression (Figure 4A) and increasing expression of phospholamban (Pln), a negative regulator of SERCA2 (Figure 1D). If these were the primary causes of decreased SERCA function in Tbx5-mutant atria, reduced PLN or PLN phosphorylation (relieving inhibition of SERCA2) would be expected to normalize SERCA function. Western blot analysis showed that PLN expression was significantly increased in Tbx5fl/fl; R26CreERT2 compared with R26CreERT2 atria (Figure 5A). In addition, PLN phosphorylation was also increased at serine 16 in Tbx5fl/fl; R26CreERT2 compared to R26CreERT2. These data suggest PLN phosphorylation may be a compensatory mechanism in response to decreased SERCA expression and activity, but is insufficient to normalize SERCA function (Figure 4). Thus, we hypothesized that reduction of Pln gene expression would be more effective in restoring SERCA function. We assessed if Pln deficiency can affect SERCA function in a dose dependent manner by crossing the Tbx5fl/fl; R26CreERT2 with germline Pln knockout mice (Pln-/-; R26CreERT2) (Luo et al., 1994). We compared SR load and SERCA function in adult-specific Tbx5; Pln double mutant mice versus Tbx5 mutant mice. We measured SR load and SERCA function using caffeine-induced SR release in atrial cardiomyocytes from R26CreERT2, Tbx5fl/fl; R26CreERT2, Pln-/-; R26CreERT2, Tbx5fl/fl; Pln-/+; R26CreERT2 mice, and Tbx5fl/fl; Pln-/-; R26CreERT2 mice. Control Pln deficient mice (Pln-/-; R26CreERT2) had increased steady state SR load and SERCA activity relative to R26CreERT2 (Figure 5C, D). The decreased SR load and SERCA function observed in Tbx5 mutant mice (Tbx5fl/fl; R26CreERT2) was converted to elevated SR load and SERCA function after the removal of Pln (Tbx5fl/fl; Pln-/-; R26CreERT2) (Figure 5C, D). Pln loss alone increased peak twitch calcium. However, in the setting of combined Tbx5; Pln deficiency, peak twitch calcium and tau twitch were normalized to R26CreERT2 values (Figure 5E, F). We next tested the possibility that decreased SERCA function was the mechanism of TBX5-deficiency-driven AP prolongation and triggered activity and that decreased Pln may rescue these defects. As we previously showed, Tbx5fl/fl; R26CreERT2 atrial cardiomyocytes exhibited significantly prolonged APs and frequent EADs and DADs compared to R26CreERT2 atrial cardiomyocytes (Figure 6A, B) (Nadadur et al., 2016). APs of Pln-/-; R26CreERT2 atrial cardiomyocytes were similar to R26CreERT2 controls (Figure 6C). The prolonged AP duration observed Tbx5fl/fl; R26CreERT2 was rescued in both Tbx5fl/fl; Pln+/-; R26CreERT2 and Tbx5fl/fl; Pln-/-; R26CreERT2 atrial cardiomyocytes (43 ± 10% and 38 ± 5% shorter than Tbx5fl/fl; R26CreERT2 respectively; p=0. 01,0. 0007) (Figure 6D, E). Along with normalization of AP duration, we observed significantly fewer EADs and DADs in Tbx5fl/fl; Pln-/-; R26CreERT2 cardiomyocytes (Figure 6F). The data demonstrate the importance of TBX5-driven SERCA activity on cellular electrophysiology and triggered activity in atrial cardiomyocytes and decreased Pln rescues both SERCA function and cardiomyocyte electrophysiological abnormalities in Tbx5-mutant mice. The data above show reducing Pln gene dosage rescues calcium handling defects, AP prolongation and triggered activity observed in Tbx5-mutant atrial cardiomyocytes. We hypothesized that normalizing these cardiomyocyte cellular defects would reduce AF susceptibility in Tbx5 knockout mice (Figure 7). We performed intracardiac burst pacing. All Tbx5fl/fl; R26CreERT2 mice (6/6) paced into AF, compared to none of the R26CreERT2 (0/5) or Pln-/-; R26CreERT2 littermate controls (0/7). Consistent with our hypothesis, AF susceptibility was significantly decreased in Tbx5; Pln compound knockouts: only 1/11 of Tbx5fl/fl; Pln-/-; R26CreERT2 paced into AF (Figure 7F). Thus, Tbx5-deficiency induced AF is due to calcium handling abnormalities, specifically decreased SR load and SERCA activity, and that modulation of the SERCA2 inhibitor, Pln, normalized SERCA activity and AF susceptibility caused by Tbx5 loss. We and others have hypothesized that ectopic triggers of AF can be due to abnormal atrial calcium handling (Greiser et al., 2011; Bers and Grandi, 2011). Here we define this relationship in a model of spontaneous AF. We analyzed the major calcium transport pathways in atrial myocytes and demonstrated that the critical calcium handling deficit associated with Tbx5-loss is depressed SERCA-mediated SR calcium uptake. We report significant reduction of SERCA2 protein expression and function, consistent with human paroxysmal or chronic AF (Voigt et al., 2012; Voigt et al., 2014; El-Armouche et al., 2006; Brundel et al., 1999). The mechanism causing cardiomyocyte depolarizations from depressed SERCA activity must be indirect, given that SERCA2 is localized to the intracellular SR membrane and therefore does not directly contribute to membrane potential itself. Instead, slowed SR calcium uptake from depressed SERCA activity provides higher cytosolic calcium driving force for calcium extrusion from the cell via electrogenic inward INCX. We demonstrate increased NCX1 protein expression with Tbx5 knockout, a finding also observed in human and other animal models of AF (Neef et al., 2010; Lenaerts et al., 2009; Greiser et al., 2011; El-Armouche et al., 2006). Since protein expression, electrochemical driving force, and allosteric calcium regulation can all affect amplitude of inward INCX (Blaustein and Lederer, 1999), we measured NCX activity following loss of Tbx5. NCX activity was significantly increased at all levels of calcium (Figure 4I). Thus, increased NCX function coupled with prolonged [Ca2+]i transients, drives increased inward INCX, providing additional depolarizing current during the AP, contributing to its prolongation. While increased NCX function may partially compensate for the depressed SERCA function to bring down calcium levels, it may also promote calcium-induced DADs in the setting of inappropriately timed SR calcium release events. Previous modeling in ventricular cardiomyocytes predicted countervailing functions of SERCA and NCX (Li et al., 2011), which we observed in Tbx5 knockout mice. Our data further support that DADs, which are classically thought to relate to SR calcium overload can still occur with depressed SR loads in the appropriate context of depressed SERCA and elevated NCX function (Voigt et al., 2012). Modeling suggests that compensatory increases in L-type calcium current in the setting of depressed SERCA function could be required to maintain systolic and diastolic calcium levels (Li et al., 2011). In line with the modeling, we observed enhanced peak ICaL with loss of Tbx5. This may account for early AP prolongation as well as EADs. It is interesting that peak [Ca]i is depressed using controlled square wave voltage clamp pulses (Figure 4—figure supplement 1), which suggests that 40 ms is insufficient to maintain calcium entry in Tbx5 knockout, even in the setting of enhanced ICaL. However, in the setting of AP prolongation (Figure 2E–G) peak twitch calcium levels are maintained. Additionally, the increase in calcium entering the cell through ICaL during the AP would be expected to balance a net increase in NCX mediated calcium extrusion (Figure 4I), a requirement for steady state [Ca2+]i homeostasis. However, our observations that L-type calcium channel expression is TBX5-independent (Figures 1D and 2D) and that genetically targeting only the Ca2+ efflux pathways in our model is sufficient to restore normal electrical activity (Figures 5–7) suggest that the ICaL change is not a primary TBX5-dependent effect. Furthermore, although ICaL is increased, it quickly inactivates in TBX5 knockout cardiomyocytes (Figure 2F). Together with our observation that nifedipine normalizes the APD, this supports that enhanced calcium entry impacts APD via secondary [Ca]i dependent mechanisms. In addition to identifying the role of altered NCX and SERCA function, we assessed the importance of TBX5-driven RyR2 expression. RYR2 is a known susceptibility locus for AF and RYR2 mutations are correlated with AF (Fatkin et al., 2017; Di Pino et al., 2014). We observed that RyR2 protein expression was significantly depressed following Tbx5 loss. Defective RyR2 function has also been associated with AF (Vest et al., 2005; King et al., 2013). Despite TBX5-dependent RyR2 expression, the ryanodine binding assay (Xu et al., 1998) suggested that RyR2 function is generally preserved over the physiologic range of calcium in Tbx5-mutant atria (Figure 3D). This suggests a compensatory mechanism must occur allowing for preserved RyR2 open probability in the setting of depressed protein expression. For example, CaMKII is a potential regulator of RyR2 function which could increase the open probability and thereby increase steady leakage or favor spontaneous local Ca2+ release events from the SR (Vest et al., 2005; Neef et al., 2010; Fischer et al., 2015) in Tbx5-deficient mice. In line with such compensation, we could not detect any differences in the calcium rise kinetics during controlled square wave voltage clamp pulses (Figure 4—figure supplement 1). Nevertheless, RyR2 compensation in the setting of reduced expression could contribute to abnormal triggered activity in the setting of Tbx5 loss, and is an important topic for further investigation. We found that depressed SERCA function in TBX5 knockout was completely normalized with heterozygous or homozygous phospholamban knockout, which normalized AP duration, decreased frequency of afterdepolarizations, and reduced AF inducibility. This finding demonstrates the importance of SERCA2 to the pathophysiology of AF in the Tbx5-loss model. While phospholamban has been associated with AF by GWAS (Fatkin et al., 2017; Federico et al., 2017), its functional role is less clear. Although PLN is predominantly found in the ventricle (Bhupathy et al., 2007), we showed not only its expression is increased in the atria in the context of Tbx5 loss, but also PLN participates in rheostatic control of SERCA activity in the atria, which is sufficient to protect against AF inducibility (Figures 5–7). Our findings are further supported by patient studies. For example, in patients who experience post-operative AF, SERCA2 is significantly decreased in the atrial tissue (Zaman et al., 2016), but those with PLN mutations have decreased AF susceptibility in the context of arrhythmogenic right ventricular cardiomyopathy (Bourfiss et al., 2016). Thus, AF is a heterogeneous disease and there can be variability in how the calcium handling proteins are expressed (Dai et al., 2016) in different disease settings. The genetic background of an individual may be a critical determinant of how calcium handling moieties are disrupted to result in AF. In summary, the most important features of the Tbx5-dependent SERCA2 and PLN regulatory axis are reduced SR uptake and load (Figure 8). In this setting, enhanced inward INCX and ICaL contributes to AP prolongation, and, more importantly, to cardiomyocyte ectopy. Finally, we demonstrate PLN as a potential means to augment SERCA function, restoring normal atrial myocyte electrical activity and normal sinus rhythm in Tbx5 knockout mice. Thus, the Tbx5 knockout model represents an excellent system to study pharmacologic rescue of SERCA activity, prevention of cardiomyocyte ectopy, and AF. AF has become an increasingly common cause of morbidity and mortality, underlying over one-third of stroke cases and significantly increases the risk for heart failure (Nishida and Nattel, 2014). Consequently, AF poses a significant socioeconomic burden. AF does not always exist in isolation, but rather in conjunction with other predisposing factors such as obesity, thyroid hormone alterations, or heart failure. Interestingly, disruptions in calcium handling proteins such as the SERCA2-PLN regulatory axis are implicated as predisposing factors. In AF compounded by heart failure, decreased SERCA2 and phosphorylated PLN, and increased NCX1 expression were observed (Lugenbiel et al., 2015). Decrease in phosphorylated PLN coupled with an increase in total PLN has been found in animal models of obesity, potentially increasing risk of AF (Lima-Leopoldo et al., 2014; Lima-Leopoldo et al., 2008). These findings suggest a need to evaluate an individual’s genetic background as well as changes in calcium handling proteins when considering predisposing factors for AF. Currently, there are few effective and targeted AF therapies, in part due to an incomplete understanding of the mechanisms underlying AF. Recent studies of specific genetic loci for AF susceptibility have opened new opportunities to identify specific mechanisms at play in subpopulations of AF patients. Understanding these specific mechanisms may facilitate more effective personalized therapies to target specific atrial Ca2+ handling abnormalities. Our data is consistent with the knowledge that pharmacologic regulators of NCX1 or SERCA2 may normalize defects in cellular calcium handling in the atrium (Dobrev, 2010; Jost et al., 2013; Nagy et al., 2014; Ferrandi et al., 2013; Parikh et al., 2012). For example, a selective NCX1 inhibitor, ORM-10103, was shown to prevent cellular Ca2+ handling abnormalities in ischemic ventricular cardiomyocytes, possibly by limiting calcium entry through outward INCX (Jost et al., 2013; Kormos et al., 2014). The benefit of NCX inhibition might also be considered in human cases of AF with increased NCX activity. Further, resveratrol, which increases SERCA2 activity, has been shown to decrease AF, suggesting that targeting SERCA2 activity may be a viable therapeutic approach (Bai et al., 2016; Chong et al., 2015). In addition to providing specific insight into treating TBX5-loss associated AF, our findings may be more broadly applied. These data suggest that pharmacological treatment of AF may be improved by assessing for a defect in the TBX5-SERCA2-PLN axis followed by specifically targeting the defect to restore normal cardiomyocyte electrical activity. We expect this work and continued efforts to uncover mechanisms responsible for AF in subpopulations of patients will play a key role in advancing personalized therapeutics for AF. The Tbx5fl/fl, Pln-/- and Rosa26CreERT2 lines have all been previously described and were kept in a mixed genetic background (Luo et al., 1994; Bruneau et al., 2001; Ventura et al., 2007). Double knockout mice were generated by crossing Tbx5fl/fl; R26CreERT2 mice with germline Pln-/- mice. After two generations, we obtained Tbx5fl/fl; R26CreERT2 mice with either loss of one (Pln+/-) or both (Pln-/-) copies of Pln. All experiments were done using age- and genetic strain-matched littermate controls. Tamoxifen was administered for three consecutive days at a dose of 0. 167 mg/kg body weight by intraperitoneal injection at 6–10 weeks of age, as previously described (Nadadur et al., 2016). All experiments were performed in accordance to The University of Chicago Institutional Animal Care and Use Committee (IACUC) approved protocol. 8-to 10- week-old mice were anesthetized using isoflurane, and telemetry transmitters (ETA-F10, Data Science International) were implanted in the back with leads tunneled to the right upper and left lower thorax, as previously described (Wheeler MT et al., JCI 2004). Baseline recordings were obtained for 24 hr after a post-implant recovery period of one day. ECG data was analyzed using LabChart 8 (AD Instruments). Detailed protocols for intracardiac electrograms have been previously described (Nadadur et al., 2016). Briefly, 8- to 10- week-old mice were anesthetized with isoflurane and a vertical skin cut-down at the right jugular vein was performed. A 1. 1 F octapolar catheter (EPR-800, Millar Instruments) was advanced in the right jugular vein to perform electrical stimulation. The catheter was connected to ADI BioAmp and PowerLab apparatus and signals were recorded using LabChart Software (ADInstruments). Atrial induction pacing was performed using burst pacing and the presence of at least three cycles of atrial tachycardia or fibrillation at least twice was considered positive. Langendorff perfusion with 2 mg/mL of Collagenase Type 2 (Worthington Biochemical) at 5 ml/min was used to isolate atrial cardiomyocytes. Cardiomyocytes were then plated on laminin coated glass bottom dishes for 30 min prior to incubation with 10 µM Fluo-4/AM (Molecular Probes/Invitrogen) in normal Tyrode’s solution containing (in mM): 140 NaCl, 4 KCl, 10 glucose, 10 HEPES, and 1 MgCl2,1 CaCl2 pH 7. 4 using NaOH for 20 min at room temperature. Cells were perfused with prewarmed Tyrode for 10 min prior to imaging. Imaging was performed on an Olympus microscope with a 20x objective lens, a LAMBDA DG-4 power source with 488 nm excitation and 515 nm emission filters and a PMT (photomultiplier tube) to record whole cell signal. Electrical field stimulation (Grass stimulator; Astro-Med) was performed at 1 Hz. SERCA and NCX measurements were performed by flowing sodium free Tyrode with 10 mM caffeine followed by sodium free Tyrode alone or Tyrode with caffeine respectively. Cells were returned to normal Tyrode in both cases at the end of the recording. [Ca2+]i transients are presented as total fluorescence intensity normalized to resting fluorescence (F/F0) obtained from steady-state resting conditions before field stimulation. [Ca2+]i transients and sparks were acquired in line-scan mode (3 ms per scan; pixel size 0. 12 µm) using a Zeiss confocal microscope. APs and voltage clamp recordings were recorded using standard ruptured patch protocol (Nadadur et al., 2016). We used current clamp mode with 0. 5 nA ×2 ms current clamp pulses to measure APs. Voltage clamp mode was used to measure capacitance transients and to study [Ca2+]i transients with fixed duration depolarizations. Cardiomyocytes are kept at 37°C and perfused with Tyrode solution (140 NaCl, 4 KCl, 1 MgCl2,1 CaCl2,10 HEPES, 10 Glucose, and pH 7. 4 with NaOH). Internal pipette solution composition was (in mM): 20 KCl, 100 K-glutamate, 10 HEPES, 5 MgCl2,10 NaCl, 5 Mg-ATP, 0. 3 Na-GTP. Patch pipettes (World Precision Instruments) were pulled to have a mean resistance of 3. 5–5 MΩ. An Ag–AgCl pellet and 3M KCl agar bridge was used to ground the bath. Liquid junction potentials, were always corrected after cell rupture. External solution for ICaL contained (in mM): 120 Tetraethylammonium-chloride, 10 CsCl, 10 Glucose, 10 HEPES, 1. 5 MgCl2,1 CaCl2, pH 7. 4 with CsOH. Internal pipette solution contained (in mM): 100 Cs-methanesulfonate, 30 CsCl, 10 HEPES 5 EGTA, 2 MgCl2,5 Mg-ATP, pH 7. 2 with CsOH. ICaL was recorded during 200 ms voltage clamp pulses from a holding potential of −40 mV to test potentials ranging from −40 to 60 mV, with pulses applied every 2 s in 5 mV increments. Peak current amplitudes were normalized to the cell capacitance (Cm) and presented as current density (A/F). Steady-state inactivation of ICaL was investigated using two-pulse protocol. Holding potential was −80 mV. The first pulse depolarized membrane from −60 to 20 mV with 10 mV increments during 500 ms, the second pulse depolarized the membrane to 10 mV for 50 ms. The inactivation curves were fit to a Boltzmann distribution. Acquisition was performed using an Axopatch-200B amplifier connected to a Digidata1550A acquisition system (Axon Instruments, Foster City, CA, USA). In recording filtering at 2 kHz was performed using the amplifier Bessel and sampled at 10 kHz. Analysis was performed using pCLAMP10 (Axon Instruments) and a home written analysis code. Atrial tissue was collected and homogenized as described previously (Alvarado et al., 2017), in a buffer containing 0. 9% NaCl, 10 mM Tris-HCl pH 6. 8,20 mM NaF and protease inhibitors. Equal amounts of protein, as determined by Bradford assay, were loaded. 50 µg of tissue homogenate, in Laemmli buffer, was separated by SDS-PAGE in 4–20% TGX or AnyKD precast gels (Bio-Rad). Proteins were transferred to PVDF membrane using the iblot2 transfer system (ThermoFisher) or wet transfer. Primary antibodies were as follows: anti-RyR2 (1: 2000; MA3-925, ThermoFisher), SERCA2 (1: 1000; MA3-919, ThermoFisher), NCX (1: 1000; MA3-926, ThermoFisher), PLN (1: 5000; A010-14, Badrilla), pT17-PLN (1: 5000; A010-13, Badrilla), pS16-PLN (1: 5000; A010-12, Badrilla), Cav1. 2 (1: 200; ACC-003, Alomone), GAPDH (1: 10000; MAB374, Millipore). Secondary antibodies were: goat anti-mouse-HRP (1: 5000; 31437, ThermoFisher) or goat anti-rabbit-HRP (1: 5000; 31463, ThermoFisher). Secondary antibody concentrations were 5x higher when using the ibind Flex system. SuperSignal ECL reagent (ThermoFisher) was used to develop membranes followed by imaging with a ChemiDoc MP apparatus (Bio-Rad). Band intensities were quantified with the ImageLab software (Bio-Rad) or using ImageJ (NIH). Binding assays were carried out following a protocol previously described (Federico et al., 2017). Binding mixtures contained 100 µg of protein from homogenates prepared from pooled atria (5–7 mice), 0. 2 M KCl, 20 mM Hepes (pH 7. 4), 6. 5 nM [3H]ryanodine (PerkinElmer), 1 mM EGTA and enough CaCl2 to set free [Ca2+] between 10 nM (pCa2+ 8) and 100 µM (pCa2+ 4). The ratio between Ca2+ and EGTA was determined using MaxChelator (WEBMAXCLITE v1. 15 http: //maxchelator. stanford. edu/webmaxc/webmaxclite115. htm). Following a 2 hr incubation at 36°C, reactions were filtered through Whatman GF/B Filters using a Brandel M24-R Harvester. [3H]ryanodine binding was determined using a Beckman LS6500 scintillation counter and BioSafe II scintillation cocktail (RPI Corp). Non-specific binding was quantified in the presence of 2 µM unlabeled ryanodine (MP Biomedicals) and subtracted. Left atrial tissue of Tbx5fl/fl; R26CreERT2 and R26CreERT2 mice was removed two weeks after receiving tamoxifen and RNA was isolated using a Trizol (Invitrogen) based method. Reverse transcription reaction was carried out using the qScript cDNA synthesis kit (Quanta) according to the manufacturer’s protocol. Quantitative RT-PCR was performed using the Power SYBR Green PCR Master Mix (Applied Biosystems) and run on an Applied Biosystems AB7500 machine. Relative fold changes were calculated using the comparative threshold cycle method (2-ΔΔCt), using glyceraldehyde-3-phosphate dehydrogenase (Gapdh) gene expression level as internal control. Values are represented as mean ±standard error of the mean (±SEM). Statistical significance for quantitative metrics of APs, SERCA, NCX, SR load, ICaL, spark frequency, and [Ca2+]i transients were determined using hierarchical statistical methods (Sikkel et al., 2017). Statistical significance for mRNA, and protein expression studies was determined using Student’s t-test. Statistical significance of the nifedipine effect on AP duration was determined using two-tailed paired t-test. A two-tailed Fisher’s exact test was used for statistical significance of count-based analysis of AF inducibility and EAD and DAD count. Statistical significance is designated as *p<0. 05, **p<0. 01, and ***p<0. 001.

Title: A calcium transport mechanism for atrial fibrillation in Tbx5-mutant mice Summary: The human heart contains four distinct chambers that work together to pump blood around the body. In individuals with a condition called atrial fibrillation, two of the chambers (known as the atria) beat irregularly and are unable to push all the blood they hold into the other two chambers of the heart. This can cause heart failure and increases the likelihood of blood clots, which may lead to stroke and heart attacks. Small molecules called calcium ions play a crucial role in regulating how and when the atria contract by driving electrical activity in heart cells. To contract the atria, a storage compartment within heart cells known as the sarcoplasmic reticulum releases calcium ions into the main compartment of the cells. Calcium ions also enter the cell from the surrounding tissue. As the atria relax, calcium ions are pumped back into the sarcoplasmic reticulum or out of the cell by specific transport proteins. Individuals with mutations in a gene called Tbx5 are more likely to develop atrial fibrillation than other people, but it was not clear how such gene mutations contribute to the disease. Here, Dai, Laforest et al. used mice with a mutation in the Tbx5 gene to study how defects in Tbx5 affect electrical activity in heart cells. The experiments found that the Tbx5 gene was critical for calcium ions to drive normal electrical activity in mouse heart cells. Compared with heart cells from normal mice, the heart cells from the mutant mice had decreased flow of calcium ions into the sarcoplasmic reticulum and increased flow of calcium ions out of the cell. These findings provide a direct link between atrial fibrillation and the flow of calcium ions in heart cells. Together with previous work, these findings indicate that multiple different mechanisms could lead to atrial fibrillation, but that many of these involve changes in the flow of calcium ions. Therefore, personalized medicine, where clinicians uncover the specific mechanisms responsible for atrial fibrillation in individual patients, may play an important role in treating this condition in the future.

lay_elife

en

Write a title and summarize: Bartonella species are emerging infectious organisms transmitted by arthropods capable of causing long-lasting infection in mammalian hosts. Among over 30 species described from four continents to date, 15 are known to infect humans, with eight of these capable of infecting dogs as well. B. bacilliformis is the only species described infecting humans in Peru; however, several other Bartonella species were detected in small mammals, bats, ticks, and fleas in that country. The objective of this study was to determine the serological and/or molecular prevalence of Bartonella species in asymptomatic dogs in Peru in order to indirectly evaluate the potential for human exposure to zoonotic Bartonella species. A convenient sample of 219 healthy dogs was obtained from five cities and three villages in Peru. EDTA-blood samples were collected from 205 dogs, whereas serum samples were available from 108 dogs. The EDTA-blood samples were screened by PCR followed by nucleotide sequencing for species identification. Antibodies against B. vinsonii berkhoffii and B. rochalimae were detected by IFA (cut-off of 1∶64). Bartonella DNA was detected in 21 of the 205 dogs (10%). Fifteen dogs were infected with B. rochalimae, while six dogs were infected with B. v. berkhoffii genotype III. Seropositivity for B. rochalimae was detected in 67 dogs (62%), and for B. v. berkhoffii in 43 (40%) of the 108 dogs. Reciprocal titers ≥1∶256 for B. rochalimae were detected in 19% of dogs, and for B. v. berkhoffii in 6. 5% of dogs. This study identifies for the first time a population of dogs exposed to or infected with zoonotic Bartonella species, suggesting that domestic dogs may be the natural reservoir of these zoonotic organisms. Since dogs are epidemiological sentinels, Peruvian humans may be exposed to infections with B. rochalimae or B. v. berkhoffii. Bartonella species are gram-negative bacteria associated with an increasing array of disease manifestations in humans and animals. They are small, obligate intracellular organisms that adhere and invade erythrocytes and endothelial cells of mammalian hosts, causing long lasting bacteremia [1], [2]. These zoonotic organisms are mainly transmitted by blood-sucking arthropod vectors, including fleas, body lice, ticks, sandflies and others [1]. To date, 15 species of Bartonella are known to infect humans. Among these, nine species have been documented in dogs, based on culture isolation or DNA-based methods: B. clarridgeiae, B. elizabethae, B. henselae, B. koehlerae, B. quintana, B. rochalimae, B. vinsonii subsp. berkhoffii (hereafter B. v. berkhoffii), B. volans (including volans-like) and B. washoensis [3], [4]. B. bacilliformis is the most frequent species of Bartonella in Peru. Humans are considered the reservoir host and infection in animals has not been reported [1]. No other species of Bartonella have been detected from Peruvian humans to date. However, a new bacteria, B. rochalimae, was isolated in 2007 from an American woman who became sick 16 days after returning from a 3-week trip to Peru, where she received numerous insect bites [5]. Since this first report, B. rochalimae has been detected by culture and/or molecular techniques from three asymptomatic rural dogs in California [6], one stray dog in Colombia [7], one sick dog in Greece [8] and one dog with endocarditis in California [9]. In addition, an experimental infection of dogs, cats, and guinea pigs with B. rochalimae demonstrated that only dogs became highly bacteremic without any disease expression, suggesting that dogs could be the natural reservoir for this species [10]. Domestic dogs may represent excellent epidemiological sentinels for Bartonella infection in humans due to several factors: exposure to similar household and recreational environments of humans, potential parasitism by the same vectors, wide diversity of Bartonella species identified in canines, development of a strong organism-specific antibody response to many vector-borne pathogens; and accessibility for safe handling and sample collection [11], [12]. Therefore, this study aimed to determine the potential for human exposure to zoonotic Bartonella species by defining the serological and molecular prevalence of these pathogens in asymptomatic domestic dogs in various geographic regions of Peru. Additionally, this study sought to define the genetic relationship among Bartonella species, subspecies and strains detected from Peruvian dogs and previously described Bartonella species from humans and other hosts from Peru and other countries. We have demonstrated that Peruvian dogs are exposed to zoonotic Bartonella species, and this study may suggest that the human population is at risk of infection with the same species detected by DNA amplification and genetic characterization. All animals were humanely treated during sample collection. Dogs were manually restrained during blood withdraw, in accordance with the rules of the Medical Ethics and Animal Care Committee of the Universidad Nacional Mayor de San Marcos (UNMSM), Lima, Peru (no protocol number was assigned), which adheres to the Public Health Service (PHS) policies of the Office of Laboratory Animal Welfare, Office of Extramural Research, National Institutes of Health (OLAW-OER-NIH), USA (PHS approved assurance number A5934-01). In addition, this study was also approved by the Medical Ethics and Animal Care Committee of the Universidad Peruana Cayetano Heredia (UPCH), Lima, Peru (study protocol number 60501), in accordance with the guidelines of the PHS policies, OLAW-OER-NIH, USA (PHS number A5146-01). The purpose of the study was explained to each individual and they were informed that participation was voluntary and data collected were confidential. Informed consent was obtained from all owners of enrolled dogs in the oral format, because some participants were illiterate. In a pilot study of blood cultures of five dogs where Bartonella DNA was detected (data not shown) either lack of isolation of Bartonella or major bacterial contamination was observed. Therefore, the present study only tested canine Peruvian blood samples by DNA-based methods. This was a cross-sectional molecular and serology survey of a convenient sample of dogs from several geographically-diverse areas of Peru naturally exposed to Bartonella species. It was conducted in five cities and three small communities located in four distinct districts of Peru (Figure 1). Locations were selected as part of a study on canine echinococcosis in rural underserved communities in the Central Peruvian highlands (Figure 2), as well as another study on canine ehrlichiosis in underserved communities of Lima (the capital) and in other regions of the country. San Juan de Miraflores (12°9′5″S, 76°58′12″W), a district of the Lima province, is located at the center of the coast at an altitude of 141 m (463 ft.) with a population of approximately 336,000 people. Paita (5°5′6″S, 81°5′58″W), in the Piura region, is located 1,089 km (677 miles) northwest of Lima, at the sea level with a population of approximately 98,000 people. Huaraz (9°31′42″S, 77°31′46″W), in the Ancash region, is located 414 km (257 miles) northeast of Lima, at an altitude of 3,052 m (10,013 ft.) with a population of approximately 53,000 people. Caraz (9°2′54″S, 77°48′54″W), also located in the Ancash region, is located 460 km (285 miles) northeast of Lima, at an altitude of 2,256 m (7,402 ft.) with a population of approximately 20,000 people. Ondores (11°5′11″S, 76°8′46. 53″W), in the Junín region, is located 230 km (143 miles) east of Lima at an altitude of 4,105 m (13,541 ft.) with an estimated population of 2,571 people. Canchayllo, Pachacayo, and San Juan de Pachacayo are three small villages (approximately 11°47′56″S, 75°32′37″W), also in the Junín region, located approximately 200 km (124 miles) from Lima at an altitude of 3,671 m (12,043 ft.) with a combined estimated population of 1,774 people [13]. From the four regions where this study was conducted, autochthonous cases of human bartonellosis caused by B. bacilliformis were frequently reported, representing over 80% of the all notified human cases in that country between 1950 and 2000 [14]. A convenient sample of 219 domestic dogs was included in this study. In December 2009,122 dogs from Ondores, Canchayllo, Pachacayo, and San Juan de Pachacayo were enrolled in this study, whereas in December 2010,97 dogs from San Juan de Miraflores, Paita, Huaraz, and Caraz were enrolled. Healthy dogs were volunteered by their owners for the study. Aggressive dogs, small puppies, and dogs exhibiting clinical signs of disease were not included in this study. The number of dogs per city and village is provided in Table 1. EDTA blood and/or whole-blood samples to obtain serum were aseptically collected from the jugular or cephalic veins, aliquoted, and stored at −20°C until analysis. EDTA blood and serum samples were not available from all dogs enrolled in this study (Table 1). Concomitant EDTA blood and serum samples were available from 94 dogs. Age information was available from 178 dogs, whereas gender information was documented from 202 dogs. The average age was 2. 5 years (SD: 2. 75 years, 95% CI: 2. 1–2. 9 years, median: 1. 5 years, range: 2 months–14 years). Males represented 58. 4% (118/202) of the dogs, whereas females represented 41. 6% (84/202). Samples were shipped frozen on dry ice to the College of Veterinary Medicine at Western University of Health Sciences, Pomona, CA, USA (WesternU), under the import permit number 2009-12-105 from the Center for Diseases Control and Prevention, USA. DNA of samples from Ondores, Canchayllo, Pachacayo, and San Juan were purified using a column-based method (Quick-gDNA Blood MiniPrep, Zymo Research, Irvine, CA, USA) at WesternU. DNA of samples from San Juan de Miraflores, Paita, Huaraz, and Caraz were purified at UPCH using a phenol-chloroform method. A conventional PCR assay designed to amplify a fragment (approximately 700 bp) of the 16S–23S ribosomal RNA (rRNA) intergenic transcribed spacer (ITS) of Bartonella species was performed as previously described [15]. The negative control consisted of molecular-grade water. In order to prevent contamination, sample extraction, reaction setup, PCR amplification, and amplicon detection were performed in separate areas. Quantified genome equivalents (GE) of the DNA from B. quintana strain ND1 (DQ648598) [16] were serially diluted 10-fold from 1,000,000 to 1 GE/uL and used as positive control to determine the limit of detection of the PCR assay. This conventional ITS PCR assay was able to detect 50,25,10 and 5 GE of B. quintana per reaction tube 100% of the time (10/10 times). Canine samples with DNA amplification at the expected size were further genetically characterized by the amplification and DNA sequencing of a fragment (approximately 610 bp) of the heat-shock protein gene (groEL) as previously described [17]. Amplicons were purified from PCR products or from specific bands on the gel (MiniElute kit, Qiagen, Valencia, CA, USA) and sequenced with a fluorescence-based automated sequencing system (Eurofins MWG Operon, Huntsville, AL, USA). Chromatogram evaluation, primer deletion and sequence alignment were performed (Vector NTI Suite 10. 1, Invitrogen Corp., Carlsbad, CA, USA). Bacteria species and strain were defined by comparing similarities with other sequences deposited in the GenBank database using BLAST [18]. Phylogenetic analysis of the data was carried out by using the Maximum Likelihood method based on the Kimura 2-parameter model [19] with the MEGA5 software [20]. Bootstrap replicates were performed to estimate the node reliability of the phylogenetic trees, with values obtained from 1,000 randomly selected samples of the aligned sequence data. DNA amplification and sequencing analysis were performed at the WesternU. Antibodies against Bartonella vinsonii subsp. berkhoffii genotype I (ATCC 51672 [21]) and B. rochalimae (isolate Hoopa Fox8, University of California, Davis, CA, USA [9]) were detected using an indirect immunofluorescent antibody assay (IFA), as previously described [6]. All IFA slides were prepared the same way by infecting Vero cells with one of the strains listed above. Samples with detectable fluorescence at a dilution of 1∶64 were considered positive, with endpoint titers being determined thereafter. Negative and positive control samples were included on each slide. Serology assays were performed at the Veterinary Public Health Laboratory, School of Veterinary Medicine, University of California, Davis, CA, USA. Molecular prevalence of Bartonella species and seroprevalence against B. v. berkhoffii and B. rochalimae are described as absolute frequencies, percentages and 95% confidence intervals (computed using score method). Contingency table analyses were performed to evaluate association with age or gender and any difference in prevalence by geographical region by using the Fisher' s exact test for 2×2 comparisons and the Fisher-Freeman-Halton test for row×column comparisons. Contingency table analysis was also performed to evaluate the correlation between serology and PCR results by Cohen' s Kappa agreement test. A p-value<0. 05 was considered statistically significant. Data analysis was performed using JMP Pro 10 (SAS Institute Inc., Cary, NC, USA). Multiple DNA sequence alignment and phylogenetic analysis of ITS region from Peruvian dogs (Figure 5) demonstrated that DNA sequences from 15 dogs were 100% homologous (534/534 bp) to the original B. rochalimae isolate obtained from the sick woman (ATCC isolate BAA-1498 [5]). This ITS sequence from Peruvian dogs (HQ185696) was also 100% homologous (534/534 bp) to a previously reported DNA sequence from a flea (Pulex sp.) collected in 1998 from a person in the city of Cusco, Peru [22], but different (532/534 bp) from DNA sequences from B. rochalimae detected from fleas (Pulex irritans) from red foxes (Vulpes vulpes) in Andalusia, Spain [23] and from dogs and gray foxes (Urocyon cinereoargenteus) in northern California (531/534 bp) [9]. A 621 bp sequence of ITS region of B. v. berkhoffii was obtained from six Peruvian dogs. Phylogenetic analysis indicated a high homology with DNA sequences from genotype III (Figure 5). Similar to B. rochalimae sequences from this study, the DNA sequence of B. v. berkhoffii from Peruvian dogs (HQ185695) was 99. 6% homologous (562/564 bp) to a previously reported DNA sequence from another flea (Pulex sp.) collected in 1998 from another human in Cusco, Peru [22]. B. v. berkhoffii sequence from Peruvian dogs was 99. 7% homologous (619/621 bp) to B. v. berkhoffii genotype III isolate obtained from a human with endocarditis from the United Kingdom [24], and a dog with endocarditis from the USA [25]. A 614 bp sequence of groEL gene was obtained from eight out of 15 dogs infected with B. rochalimae (JX846497) being 100% homologous (565/565 bp) to the original B. rochalimae isolate obtained from the sick woman [5] (Figure 6). The groEL sequence from Peruvian dogs was also 96. 8% homologous (547/565 bp) to a Bartonella sp. sequence detected from rat fleas from Egypt [26] and it was 96. 5% homologous (545/565 bp) to a Bartonella sp. isolated from an American red squirrel [27]. Other groEL sequences of B. rochalimae were not available in GenBank database at the time of writing. A 614 bp sequence of groEL gene was obtained from two out of the six dogs infected with B. v. berkhoffii (JX846496) being 97. 2% homologous (549/565 bp) to B. vinsonii subsp. vinsonii isolate obtained from a vole from Canada (strain Baker, ATCC VR-152), and 96. 3% homologous (544/565 bp) to B. arupensis isolate obtained from an American cattle rancher with bacteremia (ATCC 700727 [28]). However, the canine Peruvian sequence of B. v. berkhoffii was only 94. 3% homologous to B. v. berkhoffii genotype I isolated from a dog with endocarditis in the USA (ATCC 51672 [21]). Further comparison with genotypes II, III, and IV was not possible due to lack of those groEL DNA sequences in GenBank database at the time of writing. This is the first report of molecular detection of Bartonella species in dogs in Peru, documenting the largest number of domestic dogs infected with or exposed to zoonotic Bartonella species to date. Our study documented that over half of the canine population tested was exposed to B. rochalimae with 1 in every 14 asymptomatic dogs being infected with this zoonotic organism. It is suggested that the natural reservoirs of B. rochalimae are gray foxes, coyotes and raccoons in the United States [6], [29], red foxes in Europe [6], [29], [30], and possibly rodents in Asia [31]. Experimentally, dogs are more permissive than cats or guinea pigs to infection with B. rochalimae [10]; however, prior to this publication, only a very limited number of naturally-infected dogs were reported [6]–[9]. A significant number of seropositive dogs was detected in this study, with one in five dogs presenting reciprocal titers ≥1∶256, suggesting that these companion animals are frequently exposed to this zoonotic organism, and indirectly suggests that the human population may be at risk of infection as well. DNA sequencing of two distinct regions demonstrated that B. rochalimae from Peruvian dogs was 100% similar to the original isolate of B. rochalimae from a sick woman, supporting the zoonotic potential of this organism in Peruvian dogs. The majority of dogs enrolled in this study were located in underserved rural communities or in low-income areas of cities (Figure 2), where ectoparasite control and access to veterinary care are very limited. Collective, the current data suggest the life cycle of this zoonotic pathogen is intrinsically related to dogs, vectors, and humans and may be naturally taking place in the study areas. Of relevance is the fact that all seropositive and/or bacteremic dogs for B. rochalimae in our study were asymptomatic, which was previously demonstrated in an experimental infection study in dogs [10]. The lack of clinical signs poses an epidemiological challenge since these dogs may serve as reservoirs for extended periods of time without the need to seek veterinary care, which would provide the opportunity for diagnostic investigation of this and other vector-borne zoonotic diseases. Additionally, approximately 40% of the dogs in this study were exposed to B. v. berkhoffii, with 6 dogs infected with this pathogen. In contrast, antibodies to B. v. berkhoffii are infrequently detected (<4%) in sick referral or healthy (<1%) dogs in the USA [1]. However, over three quarter of the Peruvian dogs seropositive to this organism had antibody titers between 1∶64 and 1∶128. Possible explanations would include past exposure to B. v. berkhoffii, modulation of the host immunity by the pathogen, or cross-reactivity with other bacteria. B. v. berkhoffii has co-evolved with domestic dogs and wild canids, and we have previously reported that only 50% of dogs infected with B. v. berkhoffii were seroreactive by IFA testing [32]. Therefore, limited antibody response is expected in dogs infected or exposed to this pathogen. Clinical manifestations in immunocompetent dogs and humans infected with this pathogen have been reported, including fatigue, headache, arthritis, muscle pain, neurologic or neurocognitive abnormalities, endocarditis, or epithelioid hemangioendothelioma in humans [24], [33]–[36], and cavitary effusions (pleural effusion, ascitis), endocarditis, cardiac arrhythmias, polyarthritis, anterior uveitis, meningoencephalitis and hemangiopericytoma in dogs [1], [34], [37], [38]. The fact that only asymptomatic dogs infected with B. v. berkhoffii were detected in this study is a consequence of the inclusion criteria used, and does not rule out the possibility that sick dogs or humans in Peru may be infected with this pathogen. The genotype of B. v. berkhoffii documented in the six Peruvian dogs in this study was closely related to genotype III originally detected from an endocarditis case in a human in the United Kingdom and in a dog in the USA [24], [25], but differed from the genotype II, which is the most frequent of the four genotypes to be found in dogs and humans in North America [1]. Unfortunately, IFA testing for other genotypes was not available. Lack of concordance between serology and PCR results for Bartonella species, as detected in this study, has been previously described in humans and animals, and it is suggested to be associated with an anergic immune response of the host based on the “stealth” properties of Bartonella species, or substantial antigenic variation among various Bartonella strains, resulting in false-negative IFA assay results [2], [39]. In our study, 39. 8% of dogs tested by IFA were seroreactive to both B. v. berkhoffii and B. rochalimae. Similar results were recently detected from gray foxes in Texas, where 54. 5% of 132 foxes were seroreactive to antigens of B. v. berkhoffii and B. clarridgeiae, which is a suitable antigen marker for B. rochalimae detection [40]. Cross reactivity between B. v. berkhoffii and B. rochalimae cannot be excluded; however, in an experimental infection with these Bartonella species in two dogs, no cross reactivity occurred between host anti-B. v. berkhoffii or anti-B. rochalimae antibodies and antigens from other Bartonella species by IFA (titers ≤1∶16) [10]. But when the dog previously exposed to B. v. berkhoffii was later experimentally inoculated with B. rochalimae, cross reactivity to other Bartonella species was documented [10]. These and other limited results suggest that infection or re-infection with multiple species of Bartonella could substantially increase the serological cross reactivity between species [10],, which may have occurred within the Peruvian dogs enrolled in this study. However, natural exposure to both pathogens cannot be excluded, as co-infection with more than one species of Bartonella species has been documented in several animal species, including dogs and humans [1], [15]. Infections with B. rochalimae or B. v. berkhoffii have never been described in humans or animals from Peru, even though other known and unknown species of Bartonella have been described from small mammals, bats, body lice, fleas and ticks from Peru [22], [42]–[45]. In our study, we documented 10. 3% of dogs infected with B. rochalimae and 7. 7% of dogs infected with B. v. berkhoffii from Caraz and Huaraz. In that same region, 127 human cases of bartonellosis were documented in 2008 based on serology methods, with the isolation of B. bacilliformis from 11 human specimens [46]. Since humans in Peru are not tested for antibodies against B. rochalimae or B. v. berkhoffii, their exposure status to these pathogens is unknown. In addition, culture methods used for isolation of Bartonella in Peru may bias the detection of B. bacilliformis since culture media and temperature used for isolation of B. bacilliformis (28°C) are different from B. rochalimae and B. v. berkhoffii isolation (35°C). Growth differences between isolates of the Bartonella genus have been shown in vitro, where culture medium and temperature differences as low as only 2°C can select the growth of a given species [47]. Even though B. bacilliformis has been a well-established human pathogen in Peru for over a century, our data suggest that other Bartonella species may also cause illness in humans in Peru. The fact that the DNA sequences of B. rochalimae and B. v. berkhoffii obtained from Peruvian dogs matched 100% and 99. 6%, respectively, with Bartonella sequences obtained from human fleas (Pulex irritans) previously collected from schoolchildren and adults in Peru [22] suggests that human fleas could be the vector for both Bartonella species for dogs and humans in that country. The human flea is an aggressive and promiscuous ectoparasite found on a wide range of hosts, including domestic dogs [48], [49]. In addition, B. rochalimae was also recently detected in a brown dog tick (Rhipicephalus sanguineus) from a dog in the province of Callao [45], located only 25 km (15. 5 miles) northwest of San Juan de Miraflores, the site where the largest number of dogs infected with B. rochalimae was detected in our study. Both Callao and San Juan de Miraflores are suburbs of the country' s capital (Lima), where human and canine population densities and social and economic conditions may favor the multiplication and dissemination of vectors, increasing the risk of human infection. The role of ticks as vector for B. rochalimae or B. v. berkhoffii in dogs or humans is still unclear. However, clinical studies have associated canine infection with B. v. berkhoffii and the presence of R. sanguineus ticks [50]. R. sanguineus is the most frequent urban tick in tropical regions, and its ability to feed on humans have been documented, including its role in a recent outbreak of Rocky Mountain Spotted Fever in humans in the United States [51]. Cat bites and scratches can transmit B. henselae or B. clarridgeiae to humans [3]. However, it is still unclear if dogs are capable to transmit Bartonella species to humans using similar ways. Bartonella DNA was detected in dog saliva [52], and limited case reports have suggested possible direct transmission to humans [53]. In addition, professionals with frequent animal and arthropod exposure, such as veterinarians, veterinary assistants, cattle ranchers and biologists appear to have an occupational risk for Bartonella infection [1]. Therefore, the populations in contact with bacteremic dogs should be instructed to prevent arthropod bites, arthropod feces, dog bites, and scratches and direct contact with bodily fluids from infected animals. In conclusion, our results expand the current knowledge about B. rochalimae and B. v. berkhoffii, suggesting that asymptomatic domestic dogs in Peru are exposed to these zoonotic pathogens and may be their natural reservoir. Consequently, our results indirectly suggest that the local human population may be exposed to infections with B. rochalimae or B. v. berkhoffii and support public health actions for vector control in dogs and humans.

Title: Infection of Domestic Dogs in Peru by Zoonotic Bartonella Species: A Cross-Sectional Prevalence Study of 219 Asymptomatic Dogs Summary: Bartonella are bacteria transmitted by fleas, ticks, sandflies and other insects capable of infecting humans, domestic animals, livestock and wildlife, including marine mammals. In humans, they cause diseases such as trench fever, cat scratch disease, endocarditis, fever of unknown origin and have been recently associated with neurologic and neurocognitive abnormalities. Bartonella bacilliformis was first described in Peru in 1913, and it has never been detected in animals. Despite the fact that 14 other Bartonella species have been detected infecting humans around the world, no other Bartonella species has yet been described from Peruvian humans or domestic animals. We documented a significant number of healthy domestic dogs in Peru infected or exposed to two Bartonella species (B. rochalimae and B. vinsonii subsp. berkhoffii), which are known to cause disease in humans. These same species were previously detected in human fleas and dog ticks in Peru, suggesting that vector transmission between dogs and humans may be possible. While the role of dogs as a source of Bartonella species for direct transmission to humans is not well understood, preventive measures including vector control in dogs should be implemented to prevent human infection.

lay_plos

en

Summarize: BACKGROUND OF THE INVENTION This invention relates to the feeding of cigarette filters comprised of fiber, charcoal, or various combinations thereof to a cigarette making machine. More particularly this invention relates to the feeding of fragile filter elements such as charcoal filters to a cigarette making machine. Even more particularly this invention relates to the agitation of a cigarette filter hopper in the feeding of charcoal filters to a cigarette making machine. The cigarette manufacturing industry utilizes automated machines to interconnect cigarette filter rods with tobacco rods. One method of joining the cigarette rods to the filters is by using a filter tip attachment machine by aligning the distal ends of a single filter rod with a pair of tobacco rods, wrapping the joint with tipping paper, and cutting the filter in the center forming two cigarettes. In the manufacture of filter tip cigarettes prior to the feeding of filter rods into a filter tip attachment machine, a filter hopper is provided to store cigarette filters and is a source of supply for the filters when the filter attaching machine is operating. Moreover, in order to maintain a uniform supply of these filters into the feed end of a filter attachment machine, bins have been provided to maintain the agitation of the cigarette filters in the feed hopper so that uniformity of feed to the filter attaching machine is maintained. For example, U.S. Pat. Nos. 3,081,778 and 3,308,833 teach the use of an oscillating agitating flap mounted within the feed hopper which prevents the weight of the bulk of filters in the hopper to press on the region where the filters are discharged and also tends to break up the bridging of the filters over the discharge. U.S. Pat. No. 4,069,930 teaches a feed hopper including an agitator translatable in the hopper; and U.S. Pat. No. 4,063,633 teaches an agitator disposed within the hopper which is mounted to rotate or oscillate in order to break up clumps of rods which may form in the hopper. Moreover, it has been known to employ a cam mechanism to the frame of a feed hopper or directly to the feed hopper wherein the cam oscillates the hopper in response to the operation of the mechanism for discharging the filter rods from the filter hopper. Because of variations in the rate of production, the filter feed conveying equipment and hopper agitating equipment is routinely stopped and started for various reasons, such as when the quantity of filters exceeds a predetermined amount in the hopper due to a faster rate of supply than demand with the filter attachment machine. Since the supply of filter rods may be from a conveyor mechanism located several feet from the filter attachment machine, the number of rods in transit at any instant may be considerable. Thus, where the supply unit is stopped in response to a command from the filter tip attachment machine all of the filter rods in transit will continue to be delivered to the hopper which has been stopped from delivery of filters to the attachment machine. Typically, these devices are adequate for feeding cigarette filters including a porous fiber filter element attached to the cigarette such as shown and described in U.S. Pat. No. 4,498,488. However, carbon filled cigarette filters generally tend to be heavier, yet more fragile than porous fiber filter elements. Because charcoal filters are made in segments they tend to break when fed using conventional hopper feeding apparatus. When charcoal filters are fed to the hopper via a pneumatic conveyor system after the agitator and hopper feed mechanism have been turned off due to a problem with the cigarette attachment machine, the charcoal filters will tear because of the extra pressure of the heavier &#34;charcoal&#34; filters already in the hopper. Also, the filter wrap for charcoal have a much higher friction ratio than standard filter wrap. Because the charcoal filters are made in segments the filters tend to tear and break during the feed process to conventional hopper filter dispensing system, when the filter attachment machine stops running because the conventional agitator systems are designed to stop running at the same time the filters are still being fed to the hopper through the pneumatic conveying system. Furthermore, when the agitator is not running the excessive weight from the charcoal filters cause the filters to lock up and jam the hopper instead of sliding across each other. Thus, the existing operation of conventional agitators presents a problem when feeding charcoal filters pneumatically. The filter vibratory devices described in the aforementioned references are designed to utilize existing gear drive means and to run only in the event the filter attachment machine is running in order not to overfill the cigarette filter hopper. These agitating devices perform adequately using standard light weight, one piece, fibrous cigarette filters. However, pneumatic feeding of fragile, heavier, segmented charcoal filters by these aforementioned devices presents a problem in that the agitators tend to damage and tear apart the carbon filled filter elements resulting in jamming of the hopper feed mechanism, lost time, increased maintenance, and damaged material. The present invention solves the problems associated with the agitation of fragile filters by providing a novel means to maintain a consistent flow of carbon filled filters through the feed hopper to the filter attachment machine regardless of the density or material of construction of the filter elements. The system allows the filter elements to move up and down and side to side within the hopper more freely without binding and allows more room for the incoming filters from the receiver. Moreover, the present invention utilizes a means to agitate the filter elements even when the filter attachment machine is not operating, but is still receiving filters from the pneumatic filter conveyors. SUMMARY OF THE INVENTION The present invention provides an apparatus for delivery of cigarette filter rods from a feed hopper holding the rods to a discharge means from the feed hopper. The present invention further provides the feed hopper apparatus for feeding fragile, segmented charcoal type filters from a feed hopper into a filter attaching machine. The present invention even further provides means for agitating a cigarette filter hopper wherein the hopper is agitated in response to the operation of the means for feeding filters into the hopper. The present invention further allows the agitator to continue running after the hopper filter attachment machine feed has been stopped, until the hopper is full, until the hopper feed conveyor is empty, or after a predetermined programmed period of delay. By agitating the filters in the hopper, additional usable space is generated in the hopper. The agitation of the filters in the hopper prior to feeding also prevents jamming of the filters together causing damage to the filters resulting in jamming of the cigarette attachment machine feed mechanism. Furthermore, a buffer system consists of a conveyor system wherein filters are stacked in the filter hopper above the receiver where the filters are being pneumatically fed to the hopper. The height of the buffer determines how long the filter attachment machine can run without running out of filters if the filter making machine stops running. The present invention utilizing an active agitator enables the buffer height to be higher to give the normal extra run time on the filter attachment machine if the filter making machine stops running. The present invention provides an apparatus for agitating cigarette filters in a filter hopper comprising a filter hopper having a feed inlet and a feed outlet, means to feed filters to the feed inlet, means to discharge filters through the feed outlet, and means to agitate the feed hopper in response to the means to feed filters to the hopper. More particularly, the present invention provides a means to agitate filters, such as charcoal filters, when used in conjunction with feeding filters pneumatically to a filter attachment machine. The hopper drive apparatus consists of an independent drive and speed reducer system that activates the filter agitators and continues to operate independent of operation of the filter attachment machine until the receiver stops feeding filters to the feed hopper. The present invention replaces the conventional gear driven system which is operable in response to start-up and shut-down of the filter attachment machines. The vibratory apparatus motor of the present invention operates independent of the filter attachment machine and the drive motor of the present invention is electrically responsive to a signal from a control panel which controls the motors for the filter receivers, so that whenever the pneumatic feed system for the filter hopper and the filter receivers are conveying filters into the hopper, the agitator is activated regardless of whether the filter attachment machine is running or not running. Further features and advantages of the present invention will become more apparent from the following description taken in conjunction with the accompanying drawings which illustrate, by way of example, the principles in the invention. BRIEF DESCRIPTION OF THE DRAWINGS For a better understanding of the nature and objects of the present invention, reference should be made to the following detailed description and the accompanying drawings, in which: FIG. 1 is a side elevation, partly in section, showing the components parts of the filter feed hopper feed mechanism in flow communication with the tobacco rod feed system and filter attachment apparatus of the present invention; FIG. 2 is a plan side view of the hopper filter receiving system, the hopper filter feeding mechanism, and the hopper agitation mechanism of the present invention; FIG. 3 is a top view of the hopper, drive train, and crank arm assembly and cam mechanism associated with the vibratory filter agitation device of the present invention; FIG. 4 is a side view showing a drive motor and a speed reducer device for the vibratory filter agitation apparatus of the present invention; and FIG. 5 is an elevated side view showing the control panel linking the receiver motors with the vibratory drive motor of the present invention. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT FIGS. 1 and 2 show the feed hopper 10 of the present invention and a means for feeding cylindrical rod type cigarette filters 12 therein comprised of charcoal and/or fibrous material into the feed hopper 10. The filters 12 utilized in the preferred embodiment are of the segmented charcoal type selected to show the advantages of the present invention. In the preferred embodiment, filters 12 are pneumatically conveyed from a pair of overhead conveyor systems or buffers 14, 16 downwardly to a pair of pneumatic filter rod receivers 18 and 20 actuated by receiver motors 19 and 21, respectively. The filters 12 are conveyed through hopper feed inlets 22 and 24 through the receivers 18 and 20, then through a pair of receiver accelerating rollers (not shown) which are apart from one another and used for feeding the filters 12 into the hopper 10 individually to prevent damage to the filters 12 and jamming of the filters 12 in the hopper 10 feed mechanism. The filters 12 extend transversely with respect to the sides of the hopper 10 so that the ends of the filters 16 contact the walls of the hopper 10. A magazine or plug tray 30 is mounted onto the top of the hopper 10 to accommodate hopper overflow of filters 12. A generally pyramid or diamond shaped baffle 31 is secured to the sides of the hopper 10 and centrally located between the ends of the hopper 10, and the bottom of the plug tray 30 to prevent bridging of the filters 12 flowing downward into the hopper 10 from the plug tray 30. The filters 12 converge downwardly from the top sides of the hopper 10 feeding the filter rods 12 in succession around and over a first grooved filter receiving feed roll 32 positioned at the discharge outlet 40 at the bottom of the hopper 10 which is in flow communication with a feed mechanism 42 for a filter attaching means. A pair of compression rollers (not shown) may be mounted spaced apart from the feed roll 32 in order to urge the individual filters 12 into the grooves 38 of the grooved filter receiving feed roll 32. The filter feed mechanism 42 comprises a plurality of grooved filter rollers 44 in spaced apart vertical relationship so that the filters 12 are transferred by gravity from one grooved roller 44 to an adjacent grooved roller 44. As shown in FIG. 1, tobacco rods 46 are conveyed to a filter attachment means through a tobacco rod transfer system 48 comprising a series of spaced apart grooved rollers 50. The filter rods 12 are joined with the tobacco rods 46 by a filter attachment machine or mechanism 52 wherein a tobacco rod roller 54 and filter rod roller 56 mesh in a cooperative relationship to join the tobacco rod 46 to a filter rod 12 forming a cigarette 58. A cigarette transfer system 60 utilizes a plurality of spaced apart grooved rollers 62 to transfer the cigarettes 58 for further processing. In order to maintain an orderly and consistent flow of filters 12 to the grooved feed roll 32, the feed hopper 10 is vibrated or agitated in response to an agitation means 64 as shown in FIGS. 1 and 2. The agitation means 64 comprises a first vibratory baffle plate 66 and a second vibratory baffle plate 68. The first vibratory baffle plate 66 comprises a generally flat strip of material extending downwardly at an angle from the top of one side of the hopper 10 toward the center of the hopper 10, wherein the distal end 70 of the first baffle plate 66 is positioned slightly below the centerline, adjacent to, and spaced apart from the grooved roll 32 a distance less than the width of a filter 12. A second vibratory baffle plate 68 comprises a generally flat strip of material extending downwardly at an angle from the top of the opposite side of the hopper 10 toward the center of the hopper 10, wherein the distal end 72 of the second baffle plate 66 is positioned slightly above the centerline, adjacent to, and spaced from the grooved roll 32 a distance less than the width of a filter 12. Rotation of the grooved roll 3 toward the distal end 72 of the second plate 68 urges individual filters 12 into the grooves 38 of the grooved roller 32. Each one of the baffle plates 66 and 68 are removably mounted to an oscillating frame 74 movably secured within the hopper 10. FIG. 2 shows a cutaway side view of the hopper filter receiving mechanism, the hopper filter feeding mechanism, and the hopper agitation mechanism comprising vibratory plates 66 and 68 attached to the vibratory frame 74 and the attachment of a crank arm 76 driven by an independent external power source. As shown in phantom lines, the generally rectangular vibratory frame 74 is generally trapezoidal in shape. The vibratory frame 74 is movably secured within the hopper 10 by mounting means such as pins 73 which extend outwardly from the sides of the vibratory frame 74 through grooves or slots formed at a selected position within the sides of the hopper 10. Oscillation of the vibratory frame 74 vibrates the first and second vibratory plates 66 and 68, respectively, either up and down, from back and forth, or by a combination of vibratory motions when in a vibratory mode. FIGS. 2 and 3 show the hopper 10, drive train assembly, and cam mechanism associated with the vibratory filter agitation device. A vibratory frame 74 is mounted within the hopper 10 by a plurality of pins 73 extending through the wall of the hopper 10 supporting the vibratory frame 74 in a moveable manner. The vibratory frame 74 is connected to a drive means by a crank arm 76 located on the exterior of the hopper 10. A portion of the vibratory frame 74 within the hopper 10 is connected to an exterior crank arm 76 by a bell pin 78. The other end of the crank arm 76 is connected to a tooth timing belt pulley 80 having an eccentric pin 82 mounted offset from the center of the pulley 80 to form a cam mechanism. A first variable rate transmission or speed reducer 84 includes a shaft 85 therethrough extending outwardly on each side thereof, with a first seventy-two tooth pulley 86 being on the end of one shaft and a second twenty tooth pulley 90 being on the end of the opposite shaft. The timing belt pulley 80 with the eccentric pin 82 is connected to the first seventy-two tooth pulley 86 of the speed reducer 84 by a timing belt 88. The second speed reducer pulley 90 is connected to a second variable rate transmission or speed reducer 92 mounted within the same housing as the drive motor 100 as shown in FIG. 4. The second speed reducer 92 comprises a shaft 95 extending through the housing outwardly on one side thereof. The shaft 95 has an outer twenty tooth pulley 94 and an inner seventy-two tooth pulley 98 mounted thereon. The first pulley 94 is connected to the second speed reducer pulley 90 by a drive belt 96. The second speed reducer pulley 98 is connected to a twenty-four tooth pulley 102 on the vibratory drive motor 100 by a timing belt 104. The vibratory motor 100 drives the second speed reducer 92 which drives the first speed reducer 84 which drives the cam mechanism of the agitator or vibratory frame 74. The agitator or vibratory motor 100 is actuated in response to the receiver drive motors 19 and 2 of the receivers 18 and 20 which pneumatically feed filters 12 into the feed hopper 10. The operation of the motor 100 drives the eccentric pulley 80 at a preselected rate so that rotational motion transferred from the eccentric pin 82 to the crank arm 76 moves the vibratory plates 66 and 68 in the hopper 10 at a desired rate of agitation. When the pneumatic conveying system or receivers motors 19 and 21 are not operating to feed filters 12 to the hopper 10, the vibratory motor 100 is automatically deactivated and agitation of the filters 12 in the feed hopper 10 is discontinued. With reference to FIG. 5, the vibratory motor 100 is connected to the control relay panel 106 through a twin line plug receiver panel 108. The control relay is connected to each of the pneumatic plug motors 19 and 21 for receivers 18 and 20 respectively. The control relay panel 106 may be set so that the vibratory motor 100 is turned on whenever the motors 19 and 21 for the receivers 18 and 20 are turned on. The control relay panel 106 may also be set so that the activation of the vibratory motor 100 is delayed for thirty seconds after the motors for receivers 18 and 20 have stopped running. Although the invention has been described in detail with reference to a specific preferred embodiment, various modification exist within the scope and spirit of the present invention and it is not intended that the aforementioned discussion in any way limits the scope of the present invention as set forth in the following claims appended hereto.

Summary: An apparatus for agitating filters in a feed hopper from which the filters are fed pneumatically to a filter attaching machine. The hopper drive apparatus includes an independent drive and speed reducer mechanism that drives the filter agitators as long as the filter attaching machine receives filters. The agitation system uses a stand alone independent drive system that uses a timing belt to drive the agitators. This agitation system provides a means for operating with fragile, segmented charcoal filters in that the filters are permitted to move up and down more freely than with conventional agitation devices, allowing more room for incoming filters from the receiver and reducing damage to the filters and jamming of the filters in the transfer system.

big_patent

en

Summarize: TECHNICAL FIELD [0001] This invention relates to retinal imaging systems such as scanning ophthalmoscopes and optical coherence tomography (OCT) systems. BACKGROUND ART [0002] Scanning ophthalmoscopes provide real-time imaging of the living eye of a subject. Conventional ophthalmoscopes employ flood illumination which results in a lower contrast in the final image than using a scanning source (typically a laser source) and a confocal pinhole. [0003] Diseases and damage to the eye most frequently occurs at the front elements (cornea and lens) or the rear elements (retina and optic nerve). The former elements are easier to access, visualise and surgically treat than the latter. When damage occurs at the retina or optic nerve it is often untreatable. Accordingly early diagnosis is important. Currently, however, imaging in vivo of the fovea (central part of the retina where the photoreceptors are most tightly packed) is not possible with a resolution high enough to see individual photoreceptors. [0004] Roorda et al. have disclosed a scanning laser ophthalmoscope which uses adaptive optics to correct for higher order aberrations of the human eye (Roorda, A., Romero-Borja, F., Donnelly III, W. J., Queener, H., Hebert, T. J., Campbell, M. C. W. “Adaptive Optics Scanning Laser Ophthalmoscopy” Opt. Express 10(9) 405-412 (2002)). [0005] The system disclosed by Roorda et al. employs a diode laser coupled into a fibre providing a point source, collimated by a lens. A series of mirror telescopes relays light via a deformable mirror to horizontal and vertical scanning stages, and finally to the eye. A wavefront sensor sees light reflected from the retina and measures any aberration, and a deformable mirror is driven by the wavefront sensor to correct aberrations. The light from the retina is de-scanned and focused onto a confocal pinhole before being detected with a photomultiplier tube and fed to an analog frame grabbing board. [0006] A drawback with this system is that the resolution is limited, even with the introduction of adaptive optics and a larger eye pupil. With near-infrared light, the focused spot size is limited to approximately four microns and is thus too large to probe individual central fovea photoreceptors or small rod photoreceptors. One solution is to use a shorter wavelength of light, but this runs the risk of damaging the front elements of the eye. [0007] Optical coherence tomography has also been used in retinal and other biomedical imaging. In OCT systems, an interferometer is used to image reflected light from a tissue such as the retina. OCT systems may operate in the time domain or frequency domain. OCT systems typically give very high depth resolution, but as with scanning ophtalmoscopes, lateral resolution of detected features is a limiting factor in the imaging process. DISCLOSURE OF THE INVENTION [0008] The invention provides a scanning ophthalmoscope comprising: (a) a coherent light source (b) focusing optics to direct light from said light source along a path to a target area in which a subject&#39;s eye is to be located; (c) one or more scanning stages located along said path for directing said light in a scanning pattern within said target area; (d) an imaging detector for receiving a reflected light signal returned along said path following retinal reflection in a subject&#39;s eye; and (e) an adaptive optics system comprising a detector for detecting aberrations in the wavefront of light caused as the light travels along the path to and from the retina and a wavefront correction system located along said path for compensating for said aberrations; characterised by (f) means for providing said light directed along said path as an annular beam at a plane which is conjugate with the pupil of a subject whose eye is located in said target area. [0016] The use of an annular beam at the entrance pupil allows the light to be focused to a central spot which is smaller than the diffraction limit of a fully illuminated pupil. [0017] Thus, the beam of light which is focused by the eye onto a spot on the retina is conical and tapers to a point on the retina, as with conventional systems, but with the difference that the “cone” is effectively hollow as opposed to solid. In other words, the path along the central axis of the “cone” and immediately surrounding this central axis is not illuminated. This means that all ray paths reaching the retina are constrained to impinge on the retinal surface at an oblique angle, i.e. no rays strike the retina on a path which is normal or perpendicular to the retina. In turn this means that the definition of the interference pattern resulting from interaction of the rays is more highly defined with a central peak or point having a far smaller lateral spread, surrounded by higher definition rings where higher order interference fringes are formed. [0018] The narrower focus of the scanning light spot is accompanied by increased ringing of light away from the central bright spot. The imaging system can exclude such rings from the final image due to the spatial separation from the central bright point. In contrast, systems which do not exclude light rays from impinging on the retinal along a normal or perpendicular path give rise to a far less sharply defined interference pattern, with a brighter central spot, but where this spot is spread over a greater lateral area, and usually without any distinct separation from less bright higher order interference fringes. [0019] The means for providing the light as an annular beam can be integral with the coherent light source, whereby the light source outputs an annular beam. One example of this is to use a laser operating in the so-called doughnut mode or TEM01 mode. [0020] Alternatively, the means for providing the light as an annular beam comprises a beam shaping system positioned to receive light from the light source and to shape the light into an annular beam at an output of the system, the output being located in a plane conjugate with the pupil of a subject whose eye is located in the target area. [0021] Preferably, the beam shaping system comprises an annular filter, an axicone system, a phase plate or a hologram. [0022] An annular filter or an axicone telescope are the preferred options. The former is the simplest, but the latter provides less attenuation of the light. [0023] Preferably, the detector of the adaptive optics system is positioned to receive a first portion of reflected light from the retina and wherein the imaging detector is positioned to receive a second portion of reflected light from the retina, and further comprising a beam splitter for dividing the reflected light into the first and second portions. [0024] Further, preferably, the wavefront correction system is located along the path between the beam splitter and the target area. [0025] The ophthalmoscope may further comprise a confocal pinhole sized to eliminate interference rings reflected from a subject&#39;s retina around a central focal point. [0026] The invention also provides an optical coherence tomography system in which a low coherence source is employed and is imaged onto a target area in which a subject&#39;s eye is to be located, characterised in that the illumination arm of the system comprises means for providing light from the low coherence source as an annular beam at a plane which is conjugate with the pupil of a subject whose eye is located in said target area [0027] Using such an illumination system, and in a corresponding manner to the illumination portion of the FIG. 1 ophthalmoscope, a high transverse resolution will be obtained simultaneously with the high depth resolution that is characteristic of the OCT. BRIEF DESCRIPTION OF THE DRAWINGS [0028] FIG. 1 is a schematic layout of the optical components of a scanning ophthalmoscope; [0029] FIG. 2 is a light ray diagram showing the focusing of a conventional scanning ophthalmoscope on a surface such as a retina; [0030] FIG. 3 is a light ray diagram, corresponding to that of FIG. 2, but showing the focusing of the scanning ophthalmoscope of FIG. 1 on a surface such as a retina; and [0031] FIG. 4 is a dual plot of normalised intensity against diameter for the light patterns produced by the systems of FIGS. 2 and 3 respectively. DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS [0032] In FIG. 1 there is shown a scanning ophthalmoscope which uses a coherent light source 10 directed to the eye 12 of a human or animal subject. Incident light reflected from the retina 14 of the eye is collected at a light detector 16. [0033] The coherent light source 10 takes the form of a near-infrared laser 785 nm wavelength, 100 mW power (Newport, LQC785-100C). Light from the laser is collimated and spread out into a parallel beam 18 by a pair of lenses 20, 22. The beam 18 in incident on an annular filter 24 which is shown in a front view at 26. Thus, the light emerging from annular filter 24 is an annular beam of light. A first beam splitter 28 directs a portion of the light upwards and through a second beam splitter 30 to a first telescope comprising a pair of concave mirrors 32, 24. (It is to be understood that directional terms such as “upwards” are used for convenience in describing the drawing, and the orientation of the system is immaterial.) Each mirror pair is a 4f system that images the eye pupil plane 56 onto conjugate planes containing a spatial wavefront modulator such as a deformable mirror 36, the wavefront sensor 60, and the annular filter 24. This ensures that all corrections and changes are performed in a plane conjugate with the eye pupil (otherwise there would be diffractive propagation effects). [0034] A wavefront modulator 36 modulates the beam of light on both the forward and return passes. The wavefront modulator is a deformable mirror membrane (Boston Micromachines Corporation) with 140 actuators and a total 3.5 micron stroke. The modulator corrects for aberrations introduced by the eye and by the optical system itself. [0035] The annular beam from the wavefront modulator is directed to a further telescope consisting of a pair of mirrors 38, 40 and a Badal system 42. The Badal system has been included to correct for defocus of the subject&#39;s eye and bring the aberrations within the operative range of the wavefront modulator used. After mirror 40, the light is directed to a horizontal resonant scanner 44 from GSI Lumonics operating at a scan rate of 12.0 kHz, and from there via a further telescope 46, 48 to a vertical scanner from GSI Lumonics operating at a rate of approximately 23.5 Hz identical to the frame rate. The horizontal and vertical scanners 44, 50 operate together to sweep the light in a raster pattern across the retina. The horizontal and vertical scanners work together like a TV raster scan, “painting” the scan pattern line by line, i.e. for a 512×512 picture, the horizontal scan rate is continuous, while the vertical scan operates to deflect the beam stepwise after each forward and backward horizontal scan, so that 512 small deflections of the vertical scanner fill out the full scan area. The system shown scans a retinal area of 2×2 visual (this being adjustable). Image pixels are only recorded in the forward scan direction of the resonant scanner but can easily be recorded also in the return path. [0036] A final telescope consisting of a pair of mirrors 52, 54 directs the scanning annular beam into the subject&#39;s eye 12. Each of the mirrors 32, 34, 38, 40, 46, 48, 54 has a focal length of 200 mm, while the mirror 52 forming part of the final telescope has a focal length of 100 mm, such that the diameter of the annular beam is increased from 3 mm (this being the diameter of the annular aperture in filter 26 ) to 6 mm (this being the dilated pupil diameter of an adult eye). A real image of the annular aperture is shown in dotted outline at 56. The image of the annular aperture 56 is located in a plane conjugate with the wavefront modulator 36, the wavefront sensor 60, and the annular filter 26. [0037] The cornea and lens 58 of the eye 12 focuses the annular beam of light into a “hollow cone” of light whose apex is at the fovea of the retina 14. (The ophthalmoscope can of course be manipulated to focus on other parts of the retina.) [0038] Reflected light from the fovea passes back through the optical system of the ophthalmoscope in a reverse path until it meets beam splitter 30 where a first portion of the reflected light is directed to the Hartmann-Shack wavefront detector 60 (Thorlabs WFS 150C) and a second portion is directed towards beam splitter 28. The first portion of light is used by the Hartmann-Shack detector to control the adaptive mirror 36 in order to maintain as closely as possible a planar wavefront. The second portion of light is partly reflected by beam splitter 28, but the majority passes through beam splitter 28 to a focusing lens 62 onto a confocal pinhole 64, the function of which will be described below. Light passing through the confocal pinhole reaches the detector 16 which is a photomultiplier tube (Sens-Tech) or avalanche photodiode. [0039] Image acquisition is done at a frame rate of 24 Hz set by the resident galvanometric scanner of the system (12 kHz). The detector builds up a 512×512 pixel image which is sent to a PC 66 where appropriate video hardware and software produces a moving image for display, recordal and analysis using conventional video techniques. The detector takes a series of 262, 144 snapshots, each of which is one pixel of the final 512×512 image. [0040] Referring now to FIGS. 2 and 3, the effect of the annular aperture 24 in the system of FIG. 1 can be illustrated. FIG. 2 shows the effect of focusing a circular beam of light into a cone, indicated generally at 70, which is focused as tightly as possible on a surface 72, such as a retina. The highly ordered coherent beam ensures that all rays within the illumination cone intersect the retina in an ordered arrangement. Constructive interference on axis ensures that the net result is a normally incident wavefront on the retina or similar. [0041] In contrast, FIG. 3 shows how an annular beam of light is focused into a “hollow cone” onto a similar sized area. In contrast to FIG. 2, it can be seen that all of the light is confined to the “surface” of the hollow cone of light 80. All rays are constrained to follow a path (due to the annular aperture) which leads them to impinge on the surface 72 at a similar oblique angle. The approximate half-cone-angle for the rays from an annular 6 mm pupil is 8 degrees. [0042] The effect of these different approaches, as illustrated in FIGS. 2 and 3, is shown in FIG. 4. FIG. 4 shows a graph of intensity of light, as seen at the surface 72, i.e. the intensity of the spot of light generated due to interference of the incident rays. The upper plot 86 is illustrative of the interference pattern resulting from the approach of FIG. 2, where light rays arriving at a wide range of angles combine to produce a poorly defined interference pattern which is spread out over a considerable area (in FIG. 4, the horizontal axis represents distance along the surface 72 while the vertical axis represents intensity of light). Thus, it can be seen that in general, interference effects mean that the spot of light produced on surface 72 is far greater than the geometrical projection of the cone apex onto the surface, simply as a result of the interference pattern “smearing” the light spot. [0043] In contrast, the continuous line plot 88 in FIG. 4 shows a much better defined interference pattern, with a zero-order peak 90 localised and distinguishable from first order peaks 92 and higher order peaks 94. [0044] It should be noted that the plots 86, 88 have been normalised along the intensity scale. In actuality, the spot produced in FIG. 2 will be much brighter than that produced in FIG. 3, all else being equal, due to the occlusion of a portion of the light by the annular aperture and the accompanying reduction in intensity. [0045] As indicated by bracket 96, it is possible to filter out the first and higher order peaks 92, 94 from the reflected intensity pattern 88, so that just the zero-order peak 90 is observed. The reflected image from the retina of intensity pattern 88 shows a brighter central spot surrounded by fainter rings representing the higher order fringes. The confocal pinhole 64 in FIG. 1 is positioned and sized to allow through the zero-order peak (bright central spot) and to intercept the surrounding rings, so that only the bright spot is imaged, this having a spatial extent which is of the same order as the width of the photoreceptors of the fovea. [0046] It has been experimentally verified that the diameter of the bright spot produced by an annular aperture as opposed to a full unobstructed pupil (i.e. produced by the approach of FIG. 3 as opposed to FIG. 2 ), results in an approximately three-fold reduction in the area of the light spot produced on the retina. [0047] The ideal coupling of incident light to an individual photoreceptor is obtained when the width of the incident beam is perfectly matched to the width of the photoreceptor. When the size of the spot at the focus is larger, or even smaller, the amount of coupled light is reduced and in consequence the reflected light power is less. Also, when the spot is wider than the individual photoreceptors it will interpret more than one at a time, preventing them from being resolved in the recorded image, which is typically the case for commercially available current systems. [0048] The system of FIG. 1 can be modified in various ways, in particular by using beam transforming elements other than a simple annular filter. A telescopic set of axicons can provide a similar annular beam of light, which will allow a less powerful laser source to be used as it transmits light more efficiently. [0049] Furthermore, to provide optimal interference conditions for the incident light, pre-compensation for corneal birefringence will lead to a linear polarisation state of the light reaching the retina and thus an optimally reduced light spot. At present, wavefront aberrations across the entire pupil are corrected and kept at a minimum in real time with the adaptive optics system consisting of the deformable membrane mirror and the Hartmann-Shack wavefront sensor. Since optimal focusing is achieved with a narrow annular beam of light, it is also possible to control the adaptive optics only in the annular ring, whereby the resources of the adaptive optics can be concentrated on the most critical parts of the wavefront. [0050] The invention is not limited to the embodiment(s) described herein but can be amended or modified without departing from the scope of the present invention.

Summary: A scanning ophthalmoscope focuses coherent light to a target area in which a subject&#39;s eye is located. One or more scanning stages direct the light in a scanning pattern within the target area, and an imaging detector receives a reflected light signal returned following retinal reflection in the subject&#39;s eye. Adaptive optics compensate for aberrations in the wavefront. The light is provided as an annular beam at a plane which is conjugate with the pupil of a subject whose eye is located in the target area, whereby the annular beam is focused from an annulus at the pupil of the eye to a spot at the fundus of the eye. The spot size resulting from using an annular beam in this way is significantly reduced providing enhanced resolution.

big_patent

en

Summarize: L'associazione temporanea di imprese Il rapporto creato con l'Ati non determina di per sé una nuova società o una nuova associazione (come si potrebbe pensare leggendo solo l'acronimo Ati) fra le imprese riunite, infatti, ogni impresa partecipante all'ati conserva la propria autonomia ai fini della gestione e degli adempimenti fiscali e degli oneri sociali. Il motivo di questa peculiarità si può spiegare se si analizza la natura giuridica dell'ati, infatti, l'ati è un mandato con rappresentanza conferito dalle imprese riunite nell'ati ad uno delle stesse (denominata capogruppo) per partecipare ad un appalto (partecipando alla gare ed eventualmente per eseguire l'opera), la capogruppo agisce in nome e per conto proprio e delle mandanti. Nei rapporti esterni (tra committente e appaltatore) l'ati comporta che le imprese riunite sono responsabili solidalmente nei confronti del soggetto appaltante. Il mandato conferito all'impresa capogruppo dalle altre ditte riunite è gratuito e irrevocabile e al mandatario spetta la rappresentanza esclusiva, anche processuale, delle imprese mandanti nei confronti del soggetto appaltante per tutte le operazioni e gli atti di qualsiasi natura dipendenti dall'appalto, anche dopo il collaudo dei lavori, fino alla estinzione di ogni rapporto. Può capitare che le imprese riunite nell'ati decidono, in seguito, di creare una vera e propria società per eseguire l'apparto a cui ha partecipato l'ati (e vinto dall'ati), in questa situazione si pone il problema di quale è il rapporto tra committente e nuova società (se la nuova società sostituisce o meno l'ati) e quale sarebbe la differenza tra l'ati e questa nuova società (costituita tra gli stessi partecipanti all'ati). Quanto al rapporto tra ati e nuova società (costituta tra le stesse imprese partecipanti all'ati) è possibile affermare che non c'è sovrapposizione o confusione tra le due figure giuridiche, infatti, il regime giuridico e le norme applicabili all'associazione temporanea d'imprese sono diverse da quelle della società costituita, infatti, nell'ati s'instaura tra la capogruppo e le altre un rapporto di mandato gratuito e irrevocabile e la stessa ati è retta dalle norme sul mandato, mentre la società costituita (tra le stesse partecipanti all'ati) è retta e regolata dalle disposizioni societarie del codice civile. Quanto detto si ripercuote anche nel rapporto (esterno) tra committente e società costituita (tra le stesse partecipanti all'ati). Occorre premettere che il contratto di appalto è stato stipulato tra ati (impresa capogruppo mandataria) e il committente, quindi in assenza di una qualsiasi cessione di contratto ad un altro soggetto (anche se fosse una nuova società costituita tra le stesse parti partecipanti all'ati) debitore e creditore restano quelli indicati nel contratto. Chiarito questo aspetto eventuali norme che permettono alla nuova società l'esecuzione dell'appalto devono essere interpretate nel senso che hanno una porta limitata ed esclusiva di legittimare la società nei confronti dell'ente appaltante nella esecuzione delle prestazioni oggetto del contratto a carico dell'ATI, ma non ne comporta la sostituzione o cessione del contratto o ad una successione nel rapporto giuridico sorto con la convenzione con l'ente appaltante.

Summary: La Cassazione del 24.2.2015 n. 3651 ha stabilito che se le imprese partecipanti all'Ati costituiscono una nuova società (consortile), resta sempre esclusivo il ruolo dell'impresa capogruppo Ati, quale mandataria (1720 c.c.) delle imprese riunite in Ati, nel rapporto con il committente, nel contratto di appalto e per l'amministrazione dello stesso rapporto (es. riscossione dei crediti, gestione del contenzioso), per questi atti è preposta solo la capogruppo indicata nell'Ati.

fanpage

it

Summarize: Angelina Jolie & Brad Pitt Child Visitation Changes in Hands of Therapist Angelina Jolie and Brad Pitt's Child Visitation Changes in Hands of Therapist EXCLUSIVE Brad Pitt's child custody arrangement with Angelina Jolie is in the hands of one man... according to docs filed by Jolie. Right now, the exes and their 6 kids are operating under a temporary custody deal agreed upon by both sides. As we've reported... she has primary custody and Brad gets monitored visits, but the docs Angelina filed spell out the details. According to the docs... when and how Brad sees the children is determined by a psychologist who specializes in child custody issues. The deal says, the "frequency and conditions of the therapeutic visitation shall be determined by Ian Russ, Ph.D." Brad and Angie also must participate in group therapy sessions with the kids. The terms of this deal must stay in place until there's a court order, or both parents agree to change it. Additionally, the docs say Brad will submit to random drug and alcohol tests at least 4 times per month. Pitt and Jolie made this arrangement in October, while Brad was still under investigation by the DCFS, but as we've reported... the agency cleared him of any wrongdoing a month ago. Jolie's filing essentially memorializes the temporary deal with the court. The judge signed it on Friday. Angelina Jolie Angling for London with Kids and U.N.'s Top Job... Sources Say Angelina Jolie is Angling for London Move with the Kids EXCLUSIVE Angelina Jolie has an endgame in her claims Brad Pitt abused one or more of their children -- she wants to move to London with the kids and score a top position in the United Nations... sources connected with the couple tell TMZ. Several well-placed sources say Brad and Angelina have not gotten along for more than a year, and she's been looking for an opportunity to end the marriage and bolt for her dream job... with all 6 children in tow. We're told she knew that would be nearly impossible unless Brad's right to joint custody was in jeopardy. As we reported... Angelina told L.A. County Dept of Child and Family Services officials Brad brutalized Maddox on a private jet and engaged in other conduct that endangered the children. We know Brad strongly denied intentionally striking Maddox or engaging in any abuse, and DCFS clearly saw it his way... closing out the investigation without taking any action. Our sources say Angelina's move to involve DCFS was orchestrated by 2 women she's been relying on for advice for more than a year. One is a member of England's House of Lords, and the other also holds a U.K. government position. We're told they've been in Angelina's ear, convincing her she could become Secretary General of the U.N. if she plays her cards right. Angelina, who has been paying both women handsomely for their consulting services, is all in and taking their cue that a move to London would help get her closer to the U.N. gig. The rub, of course, is in order to take her kids out of the country... she'd have to prove some sort of parental unfitness on Brad's part. So far she's struck out. Jolie's rep denies there's a move planned and says Angelina is focused on the health and well being of her children. The rep adds, Angelina wants to continue therapy with the kids and Brad. Our sources are clear and insist Europe and the U.N. post is the ultimate goal. The custody war is now in family court -- she wants sole physical custody and he wants joint. We're told Angelina has a slim to none chance of taking the kids 6,000 miles away from Brad.

Summary: Brad Pitt filed a request to seal details of his child custody dispute with Angelina Jolie, but at an emergency hearing Wednesday, a judge denied that request, TMZ reports. Earlier this week, Jolie filed documents that spelled out details of her temporary custody agreement with Pitt, an agreement that requires Pitt only have monitored visits with the kids. Those documents revealed that a psychologist specializing in child custody issues is the one who makes the call as to when and how Pitt can see the couple's six children, and that Pitt has agreed to undergo random alcohol and drug testing four times a month. Sources tell TMZ Pitt's request to seal the custody dispute details was a direct response to her filing of those documents. Jolie sources say she filed the document because she fears Pitt is going to attempt to be allowed to see the children with no monitoring, but Pitt sources say he's made no such move and that the filing publicized details of the custody dispute for no reason other than to air the couple's dirty laundry in public, hurting Pitt-but also causing their kids unnecessary pain. Some sources connected to the case say that since Pitt was cleared of wrongdoing by the Department of Children and Family Services, he wants solo time with the kids, and that he's been acting like a "celebrity who is used to getting whatever he wants" and trying to "push past the process" in order to get that solo time. Other sources, predictably, deny that. And then there are the sources who told TMZ this week that Jolie has been plotting for more than a year for how to get out of the marriage, take the kids to London, and work for the UN.

multi_news

en

Summarize: Your Family's Germs May Move With You Study found that bacteria followed people into their new home WebMD News from HealthDay WebMD News Archive By Robert Preidt HealthDay Reporter THURSDAY, Aug. 28, 2014 (HealthDay News) -- Your family carries its own unique population of bacteria that accompany you when you move to a new home, a new study finds. Over the course of six weeks, seven families -- with a total of 18 people, three dogs and one cat -- swabbed their hands, feet and noses every day to collect samples of bacteria living in and on them. The participants also collected samples from household surfaces such as doorknobs, light switches, countertops and floors. The samples underwent DNA testing to identify the different species of bacteria they contained. "We wanted to know how much people affected the microbial community on a house's surfaces and on each other," study leader Jack Gilbert, a microbiologist at the U.S. Department of Energy's Argonne National Laboratory, said in a government news release. The results showed that people have a major impact on the bacterial populations in their homes. For example, when three of the families moved, it took less than a day for their new homes to have the same bacteria populations as their old homes. The researchers also found that regular physical contact between people had a strong effect. For example, in a home where there was a couple and another person, the couple shared many more bacteria. Married couples and their young children also shared many of the same bacteria. Within homes, people's hands were most likely to have similar bacteria, while there was more variation in the types of bacteria in their noses. Homes with indoor-outdoor dogs or cats had more plant and soil bacteria, according to the study published Aug. 28 in the journal Science. The findings suggest that by analyzing bacteria in a home, it would be possible to "predict whether a person has lived in this location, and how recently, with very good accuracy," Gilbert said. In one case, the researchers tracked a potentially harmful strain of bacteria called Enterobacter. It first appeared on one person's hands, then the kitchen counter, and then another person's hands. WASHINGTON (AP) — Sorry, clean freaks. No matter how well you scrub your home, it's covered in bacteria from your own body. And if you pack up and move, new research shows, you'll rapidly transfer your unique microbial fingerprint to the doorknobs, countertops and floors in your new house, too. In this undated photo provided by the Gilbert family shows Dylan Gilbert, 7, of Naperville, Ill., demonstrating how he helped collect samples of bacteria from his foot during a 2012 study. Dylan’s father,... (Associated Press) In fact, researchers who studied seven families in Illinois, Washington and California could easily match up who lived where using their microscopic roommates, almost like CSI for germs. Thursday's study is part of an effort to understand how the trillions of mostly beneficial bacteria that live in and on our bodies — what's called the human microbiome — interact with bugs in the environment to affect our health. "We have so little information about where the microbes come from that shape our microbiome, whether it's for health or disease," said microbiologist Jack Gilbert of the Argonne National Laboratory and University of Chicago. Where do people spend most of their time? "It's the indoor environment. The best place to look at that was the home," said Gilbert, who led the Home Microbiome Project and included his own family. Right at birth, babies start picking up microbes on the skin, in the nose, in the gut that eventually make up living communities that will share their bodies throughout life. Many of these bugs play critical roles in digestion, the immune system and other health-inducing factors. Others may make it easier to gain weight, or influence disease. What shapes the balance of good bugs and bad is a huge scientific question. Hospital studies make clear that someone who already is sick can catch a new infection from pathogenic bacteria left behind by a previous patient. In contrast, the new study examines healthy people, and it marks an important step: Beginning to show what's normal in a regular home, said Dr. Lisa Helbling Chadwick of the National Institutes of Health. That's a key question before scientists can explore how to possibly create healthier homes. "You have to think about the microbiome of your home as part of your home's immune system," said Chadwick, of NIH's National Institute of Environmental Health Sciences, who wasn't involved with Gilbert's project. "Instead of relying on killing bugs to stop the spread of infection, maybe we need to cultivate better bugs." For the study, Gilbert recruited seven households that included 15 adults, three children, three dogs and a cat. For six weeks, participants collected samples of the microscopic bugs living on and around them by swabbing the hands, feet, noses and paws of everyone in the household, plus doorknobs, light switches, floors and countertops. Back in the laboratory, Gilbert's team identified the bugs by their DNA, and they reported Thursday in the journal Science that people substantially affect the microbial communities in their homes. Different homes harbored markedly different bacterial populations, but they closely matched the microbiomes of their residents. The big surprise: How quickly the bugs settled in. Like Pigpen's trailing cloud of dust in the Peanuts comic strip, when three families moved — one of them from a hotel room to a house — it took about a day for the microbes in their new homes to closely resemble those in the old ones. "The speed at which that colonization happens was quite remarkable," Gilbert said. Sure, there are some leftover bacteria from previous occupants, he said. But many bacteria die or go dormant after a while on a hard, air-conditioned surface. At the same time, the oil in your skin readily transfers your own bacteria to surfaces. That's not counting all those tiny flakes of dead skin that people constantly shed, microbe-filled dust that probably just blankets the bugs that were there first, Gilbert noted. "It changed my perspective almost on hotel rooms," he added with a laugh. In another home, someone went on a three-day trip, and that person's contribution to the usual household microbe mix dropped noticeably. And dogs moved the bacteria from surface to surface even more rapidly. As for potentially dangerous bacteria, in one house, the scientists tracked a germ called Enterobacter from one person's hands to the kitchen counter and then to another person's hands. No one got sick, possibly because the residents were healthy and hadn't recently used antibiotics, Gilbert said. It will take more research to figure out where the different bugs that people and their pets bring into their homes originally come from. And Gilbert pointed to the study's other implication: Maybe people should make sure they're regularly getting outside to expose themselves, and their immune systems, to a wider variety of bugs.

Summary: It doesn't matter how much we scrub-our bodies are home to trillions of bacteria. And a new study finds that they travel with us: Even when we move to a new location, they colonize those surfaces within about a day, reports WebMD. But the vast majority that comprise what's called our microbiome seem to do helpful things, like keep our immune and digestive systems healthy. And because one family's microbiome is unique from another's, the researchers say that comparing them among the seven families they tracked (including three kids, three dogs, and a cat) was a reliable way to tell them apart, much like fingerprints. "The speed at which that colonization happens was quite remarkable," the head researcher tells AP. His team found that a place's old germs largely go dormant or die when new people arrive and their own bacteria take over, which "changed my perspective almost on hotel rooms," he says. Within homes, similar bacteria was most often found on people's hands, while variation peaked when found in people's noses. Not surprisingly, indoor-outdoor cats and dogs bring plant and soil bacteria into the environment. One open question: Where do the bugs we bring into our homes come from?

multi_news

en

Summarize: A mother-of-five has told of her horror and humiliation after a fellow diner in a McDonald's restaurant hurled insults at her and her disabled son for making too much noise. Melodie Daly was in the middle of moving houses when she decided to have an early dinner with her five children - including five-year-old Rylee who has severe autism, dyspraxia and sensory processing disorder. Rylee is non-verbal and makes noises to express himself. Wednesday afternoon was no exception. The 28-year-old mother says she was shocked when a middle-aged woman approached her in the diner at Cobram, north of Melbourne, to complain about her disabled son. 'You need to leave... the noise is too loud. This is a noise complaint,' the woman told Ms Daly. What then ensued left the mother-of-five disgusted. Ms Daly told Daily Mail Australia that the woman then proceeded to call Rylee: 'a spastic' and a 'f****** c***'. Scroll down for video. A mother-of-five is appealing for witnesses after her disabled son (pictured) became a victim to vile taunts by a McDonald's customer near Melbourne. Melodie Daly (pictured) was in the middle of moving houses when she decided to have an early dinner with her five children, including five-year-old Rylee. The 28-year-old mother says she was shocked when a middle-aged woman approached her to complain about her disabled son (pictured together) It had already been a stressful day for Ms Daly, having to move houses with five children. But that day had particularly been a good one for Rylee. 'I'm not sure if you've seen meltdowns by autistic children but that day Rylee was happy,' Ms Daly said. 'He was in a good mood that day because he was quite animated by a toy. 'So he can't help making the noises that he makes. He is non-verbal. He doesn't know he's making those kind of noises.' Ms Daly says she was at McDonald's at 4.50pm with her children for an early dinner. 'Then this family walked in with a little boy who was covering his ears because of the noise Rylee was making,' Ms Daly said. 'I really didn't think Rylee was being that loud so I saw no reason for this but I just let it go.' That's when Ms Daly says a woman, described as being in her 50s, came over to her table and said: 'You need to leave... the noise is too loud. This is a noise complaint.' Embarrassed by the confrontation, Ms Daly said she explained to the woman that her son was autistic. 'She then just turned around and walked back to her table with the little boy and another younger woman, to which she started to call Rylee some really horrible thing.' According to Ms Daly, the woman called Rylee a'spastic' and a 'f****** c***' but had her back turned to Ms Daly and her family. 'It was obvious that she was saying it about Rylee,' Ms Daly said. She then recalled the woman say: 'I can't believe you would bring him out in public'. Ms Daly is hoping that her online appeal will help identify the woman. Ms Daly says she was at McDonald's in Cobram, north of Melbourne, at 4.50pm with her children for an early dinner. Rylee who has severe autism, dyspraxia and sensory processing disorder. Rylee (second left) with his siblings (from left) Lily, 7, Violet, 18 months, Calen, 8, and Noah, 4. This prompted Ms Daly to put her kids back in the car and asked to speak with the manager at the fast food outlet's drive-thru. 'As I was talking to him the woman came out and walked past us with a smile and waved,' Ms Daly said. 'It was as if she knew exactly what she had done but just had no remorse. 'But my son, being the beautiful boy he is, smiled and waved back at her. That's when she and the other younger woman who was with her started laughing called him a "f****** spastic".' After reporting the incident to police, the distraught mother-of-five took to Facebook just hours after the incident with hopes that any witnesses may be able to help identify the woman at McDonald's. Ms Daly says she won't be silenced by those who bully her and her son. Ms Daly's children (from left) Noah, Violet, Rylee and Lily. 'I am going to stand up and fight for my son because I know nobody else will do it,' Ms Daly said. 'This kind of behaviour is just disgusting - I can't even begin to say how angry and upset it made me feel,' Ms Daly told Daily Mail Australia. 'I just wouldn't treat another person like that. 'I want this woman to feel ashamed for what she has done and that it's not okay to do this.' However Ms Daly says this isn't the first incident of its kind, as she is constantly given judgmental looks when she takes Rylee or her other eldest son Calen - who is also autistic - out in public places. 'Sometimes I just want to walk around in a shirt saying "I have a son with special needs" because of the kind of looks and snide comments I get when I'm out with my kids,' Ms Daly said. 'I would just like people to be more considerate and more aware that although some children may look normal they might have special needs. 'And you know, we are just as welcome to such public places like anybody else.' So in an attempt to stand up for her five-year-old son, Ms Daly says she won't be silenced by those who bully her and her son. 'He can't say how he feels so I have to be his voice because it's never okay to be treated like this,' she said. 'I am going to stand up and fight for my son because I know nobody else will do it.'

Summary: Melodie Daly was at McDonald's near Melbourne on Wednesday afternoon. She was with her five children, including her autistic son Rylee. Rylee is non-verbal and makes noises to express himself, Ms Daly said. She says when Rylee was making noises, a woman told her to leave. 'You need to leave... the noise is too loud. This is a noise complaint,' the woman in her 50s allegedly told Ms Daly. The woman then went on to call Rylee a'spastic' and 'c***', Ms Daly said. The distressed mother-of-five shared her experience on Facebook. She is hoping to help police identify the woman who was at McDonald's. The Facebook post has since gained more than 8,600 shares.

cnn_dailymail

en

Summarize: CROSS-REFERENCE TO RELATED APPLICATIONS This application is a divisional of U.S. Patent Application No. 12/511,387 filed Jul. 29, 2009 and claims priority to provisional patent application 61/034,450 which was filed on Jul. 29, 2008, which applications are incorporated by reference herein. BACKGROUND Dr. Ignacio Ponseti is an internationally famous physician and surgeon specializing in the treatment and management of a childhood deformity commonly know as a club foot. Dr. Ponseti has for many decades promoted the use of a foot and ankle abduction device, or orthosis, that is used to correct and prevent relapses of the club foot deformity. These abduction devices typically consist of a rigid bar connected between, shoes worn by the child which bar separates the feet of the child and holds the feet in an outward rotation or abduction. Typically, if the condition is diagnosed early enough, this device is worn full-time for a period of months, but during the period of treatment, the angle of outward rotation, is periodically adjusted. The Ponseti technique, as it has become known throughout the world, has been highly successful in treating club feet without the necessity of corrective surgery. Many devices have been designed and used for many, many years in applying the Ponseti technique. Currently used devices that apply the Ponseti technique are shown in U.S. Pat. No. 7,267,657. In this patent, there are disclosed improvements in such devices which provide for quick release of the shoes from the abduction bar and which also provide a method for varying the abduction angle and locking it in place at a selected angle. Devices of this type have been extremely successful and are widely used by those who treat patients using the Ponseti technique. However, the devices allow the user limited movement in the horizontal and vertical planes. Typically the user must pivot on his or her feet to move forward or backward. Additionally, the rigid current foot abduction apparatuses make any movement difficult for the user. There is; therefore, a need for an improved orthosis that allows greater mobility in the horizontal and vertical planes for use in treating club feet and other gait issues using the Ponseti technique. SUMMARY OF THE INVENTION The improved abduction apparatus system for correcting gait issues allows the user, typically a patient with a club foot, greater mobility while wearing the brace. The at least two pivot points allow a greater range of movement in at least one of the horizontal and vertical planes. Several embodiments of the invention are possible to obtain the preferred result. A first embodiment consists of a metal or plastic bar with connection means on the far sides of the bar. One coupling device is attached to each side of the metal bar and the coupling devices are pivotable in a vertical plane. Each coupling device is then attached to either a left footplate or a right footplate. The footplates are attached to the coupling device such that the angle of outward rotation may be periodically adjusted. The selected angle of outward rotation, may be maintained once the footplate is firmly secured to the coupling device. The user of the foot abduction apparatus can lift up each foot in the vertical plane via the pivot point while maintaining the corrective angle of outward rotation. The user may achieve horizontal movement by manipulating the device in a “waddling” motion. The same embodiment also allows a user to more easily crawl if the user is unable to walk. A second embodiment of the invention allows a user to manipulate the device in a horizontal plane. This embodiment consists of two rigid bars connected to coupling devices on both ends of the bars. The coupling device maintains the rigid members in parallel. Also attached to the coupling device are footplates which can receive a shoe. The rigid bars are attached to the coupling devices such that they are selectively pivotable at the point of connection. A user of the second embodiment attaches the shoes to the footplates. The user then manipulates the device by pushing one foot forward. The force causes the rigid bars to pivot allowing horizontal movement of the user&#39;s feet. A third embodiment of the invention is similar to the first two and contains at least a second pivot point and an additional metal or plastic bar. The two bars are substantially in parallel and contain a means for attachment at each end. A connecting device is attached to each side of the bars. The bars may pivot about the coupling device in a horizontal direction while maintaining the bars in parallel. Each coupling device contains a third pivot point which may be attached to either a left footplate or a right footplate. The third pivot point allows movement in the vertical plane. Again the footplate contains a means to adjust and maintain the angle of outward rotation. A left shoe may then be attached to the left footplate and a right shoe attached to the right footplate. The user of this embodiment of the invention may simultaneously manipulate the device in a vertical and horizontal direction without the “waddling” motion associated with the first embodiment. The coupling devices of the embodiments are preferably a one-piece plastic made from rotomolding or injection molding techniques. The attachments means may be of any of several know techniques for attachment but preferably the means is a standard screw. Additionally, the preferred embodiment contains a metal or rigid plastic base with means for attachment to the left or right footplate. The base is contained within a soft substance on all sides. The soft substance is preferably silicone rubber which allows greater comfort and reduces the potential of an allergic reaction to the wearer of the invention as it cushions the foot. BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a perspective view generally from the top-rear of the invention showing the single bar embodiment; FIG. 2 is a perspective view of possible connecting devices for the invention; FIG. 3 is a top view of the double bar design without vertical movement; FIG. 4 is a side view of the double bar design without vertical movement; FIG. 5 is a top view of the double bar design with vertical movement; FIG. 6 is a rear view of the double bar design with vertical movement; FIG. 7 is a right side view of the shoe; FIG. 8 is a cross-sectional view of the shoe taken at line 8 ; FIG. 9 is a bottom perspective of the boot in which the rigid sole is inserted on the top of the silicone rubber; FIG. 10 is a right side view of the shoe; FIG. 11 is a cross-sectional view of the shoe taken at line 11 ; and FIG. 12 is a bottom perspective of the boot in which the rigid sole is placed within the silicone. DETAILED DESCRIPTION Now referring to the drawings, FIG. 1 shows a single bar foot abduction system 2 comprising a rigid member 4, a first coupling device 6, a left shoe receiving member 8, a left plate 12, a second coupling device 14, a right shoe receiving member 16 and a right plate 18. The system 2 allows the user of the device to lift and lower each foot independently through a first pivot point 20 and a second pivot point 22. The rigid member 4 may be comprised of a left rigid member 24 and a right rigid member 26. The left rigid member 24 and the right rigid member 26 substantially overlap one another and are housed in the bar adjuster device (not shown). The bar adjuster device allows the length of the overlap of the left rigid member 24 and the right rigid member 26 to be varied; thus, controlling the overall length of the rigid member 4. The greater the overlap of the left rigid member 24 and the right rigid member 26, the shorter the overall length of the rigid member 4. The rigid member 4 further comprises a first end 28 and a second end 30. The first end 28 may be selectively attachable to the first coupling device 6 by several known methods; however, the preferred mode of attachment is by a nut and bolt (not shown in order to demonstrate shape of coupling device 6 ). The first coupling device 6 may then be selectively attachable to the left plate 12 by the preferred means of a nut 9 and bolt 11. The left plate 12 may then be attached to the left receiving shoe member 8. The angle of the left shoe receiving member 8 in relation to the rigid member 4 may be adjusted by loosening the attachment mechanism securing the first coupling device 6 to the left plate 12, manipulating the left plate 12 to the desired angle, and then retightening the attachment mechanism. The second end 30 may be selectively attachable to the second coupling device 14 in the same manner as the first end 28 is attached to the first coupling device 6. Similarly to the left plate 12 and its attachment to the first coupling device 6 and its attachment to the left shoe receiving member 8, the right plate 18 is selectively attachable to the second coupling device 14 and the angle between the right shoe receiving member 16 in relation to the rigid member 4 may be adjusted. Referring additionally to FIG. 2, the first coupling device 6 and the second coupling device 14 may be of a variety of configurations that allow movement in a vertical plane. After the angle between the left shoe receiving member 8 and the rigid member 4, and the angle between the right shoe receiving member 16 and the rigid member 4 are set; the user inserts his left shoe and right shoe (neither shown) into the appropriate shoe receiving member 8 or 16. Once inserted, the shoes are held in place by any of several known attachment means including a snap-on means. As the user elevates or lowers his right foot, the rigid member 4 pivots about a first pivot point 20 located at the point where the rigid member 4 and the first coupling device 6 selectively attach. As the user elevates or lowers his left foot, the rigid member 4 pivots about a second pivot point 22 located at the point where the rigid member 4 and the second coupling device 14 selectively attach. The user may move in a horizontal direction by pivoting on the bottom of the left plate 12 or the right plate 18 in a shuffling type motion. Now referring to FIG. 3 and FIG. 4, a second embodiment of a foot abduction system 202 is detailed. The system 202 comprises a first rigid member 204, a second rigid member 206, a first coupling device 208, a second coupling device 210, a left plate 212, a right plate 214, a left shoe receiving member 216, and a right shoe receiving member 218. The first rigid member 204 and the second rigid member 206 lie within the same horizontal plane and are spaced such that they are substantially parallel with one another. Each rigid member 204, 206 are preferably made of metal or a rigid plastic and further comprise a first end 220, 222 respectively and a second end 224, 226 respectively. The first ends 220, 222 are selectively attachable to the first coupling device 208, while the second ends 224 and 226 are selectively attachable to the second coupling device 210. The first coupling device 208 and the second coupling device 210 are preferably made of plastic and each further comprise three segments 230, 231, 232. The coupling devices are preferably made by rotomolding or injection molding techniques. The segment 232 is preferably substantially perpendicular to segments 230, 231. The segment 230 of the first coupling device 208 is selectively attachable to the first end 220 of the first rigid member 204 ; and the segment 230 of the second coupling device 210 is selectively attachable to the second end 224 of the first rigid member 204. The segment 231 of the first coupling device 208 is selectively attachable to the first end 222 of the second rigid member 206 ; and the segment 231 of the second coupling device 210 is selectively attachable to the second end 226 of the second rigid member 206. Again referring to FIG. 3 and FIG. 4, the segment 232 of the first coupling device 208 is selectively attachable to the left plate 212. The means for attachment is preferably two standard screws. The segment 232 of the second coupling device 210 is selectively attachable to the right plate 214, again with a two screw attachment. Once each of the segments 230, 231, 232 of each coupling device 208, 210 are selectively attached, the preferred embodiment has the rigid members 204, 206, the left plate 212 and the right plate 214 in a position such that they remain in a fixed angle position. The first coupling device 208 and the second coupling device 210 may be located on an underside 250 of the rigid members 204, 206 or on an upper surface 252 of the rigid members 204, 206, although the preferred embodiment is on the underside 250 of the rigid member. The left shoe receiving member 216 may be attached to the left plate 212 by a variety of known techniques including a screw. Similarly, the right shoe receiving member 218 is attached to the right plate 214. The left shoe receiving member 216 and the left plate 212 define an angle which may be adjusted and selectively fixed. The right shoe receiving member 218 and the right plate 214 define an angle which may be adjusted and selectively fixed. A shoe (not shown) may be of any of those well known in the art which have the capability of attaching to the left shoe receiving member 216 or right shoe receiving member 218. Additionally, the left plate 212 is preferably angled downward such that the bottom of the left shoe receiving member 218 is the same elevation as the bottom of the first coupling device 208 when the left plate 212 is attached to the left shoe receiving member 216 and the first coupling device 208. Similarly, the right plate 214 is preferably angled such that the bottom of the right shoe receiving member 218 is the same elevation as the bottom of the second coupling device 210 when the right plate 214 is attached to the right shoe receiving member 218 and the second coupling device 210. The points at which the rigid members 204, 206 attach to the first coupling device 208 and second coupling device 210 define pivot points 260. The rigid members 204, 206 are pivotable upon the first coupling device 208 and the second coupling device 210. A user can then manipulate the device 202 in a first plane which would typically be the horizontal plane. As the user moves the right shoe receiving member 218 or the left shoe receiving member 216 in the horizontal plane, the rigid members 204, 206 pivot allowing horizontal movement. As the rigid members 204, 206 are substantially in parallel and there are at least four pivot points 260, the rigid members 204, 206 remain substantially in parallel with one another during operation. The horizontal movement is depicted by the first position of the device 202 evidenced by the dashed lines and the second position, indicated by solid lines. Additionally, the fixed positions of the left plate 212 and the right plate 214 ensure the angle defined by the left plate 212 and the left shoe receiving member 216 remain constant as well as the angle defined by the right plate 214 and the right shoe receiving member 218 remain constant during operation of the system 202. Now referring to FIG. 5 and FIG. 6, a third embodiment of a foot abduction system 302 is detailed. The system 302 comprises a first rigid member 304, a second rigid member 306, a first coupling device 308, a second coupling device 310, a left plate 312, a right plate 314, a left shoe receiving member 316, and a right shoe receiving member 318. The first rigid member 304 and the second rigid member 306 lie within the same horizontal plane and are spaced such that they are substantially parallel with one another. Each rigid member 304, 306 are preferably made of metal or a rigid plastic and further comprise a first end 320, 322 respectively and a second end 324, 326 respectively. The first ends 320, 322 are selectively attachable to the first coupling device 308, while the second ends 324 and 326 are selectively attachable to the second coupling device 310. The first coupling device 308 and the second coupling device 310 are preferably made of plastic or metal alloy and each further comprise three segments 330, 331, 332. The coupling devices are preferably made by machining or injection molding techniques. The segment 332 is preferably substantially perpendicular to segments 330, 331. The segment 330 of the first coupling device 308 is selectively attachable to the first end 320 of the first rigid member 304 ; and the segment 330 of the second coupling device 310 is selectively attachable to the second end 324 of the first rigid member 304. The segment 331 of the first coupling device 308 is selectively attachable to the first end 322 of the second rigid member 306 ; and the segment 331 of the second coupling device 310 is selectively attachable to the second end 326 of the second rigid member 306. Again referring to FIG. 5 and FIG. 6, the segment 332 of the first coupling device 308 is selectively attachable to the left plate 312. The segment 332 further comprises a slot 340. The slot 340 is of a size and shape which allows left plate 312 to slide within the confines of the slot 340. The segment 332 of the second coupling device 310 is selectively attachable to the right plate 314. The segment 332 further comprises a slot 342 which is a size and shape which allow right plate 314 to slide within the confines of the slot 342. The attachment means for connecting left plate 312 to the first coupling device 308 or the right plate 314 to the second coupling device 310 is preferably a bolt 350 and a nut 352 or a screw pin. (not shown). Once each of the segments 330, 331, 332 of each coupling device 308, 310 are selectively attached the preferred embodiment has the rigid members 304, 306, the left plate 312 and the right plate 314 in a position such that they remain in a fixed position to one another. The first coupling device 308 and the second coupling device 310 may be located on an underside 370 of the rigid members 304, 306 or on an upper surface 372 of the rigid members 304, 306, although the preferred embodiment has the coupling devices on the upper surface 372 of the rigid members 304, 306. The left shoe receiving member 316 may be attached to the left plate 312 by a variety of known techniques including a screw. Similarly, the right shoe receiving member 318 is attached to the right plate 314. The left shoe receiving member 316 and the left plate 312 define an angle which may be adjusted and selectively fixed. The right shoe receiving member 318 and the right plate 314 define an angle which may be adjusted and selectively fixed. A shoe (not shown) may be of any of those well known in the art which have the capability of attaching to the left shoe receiving member 316 or right shoe receiving member 318. Additionally, the left plate 312 and the right plate 314 are preferably angled downward such that the bottom of the left shoe receiving member 316 and the right shoe receiving member 318 are the lowest elevation points of the device 302. The points at which the rigid members 304, 306 attach to the first coupling device and second coupling device define pivot points 380. The rigid members 304, 306 are pivotable upon the first coupling device 308 and 310. A user can then manipulate the device 302 in a first plane which would typically be the horizontal plane. As the user moves the right shoe receiving member 318 or the left shoe receiving member 316 in the horizontal plane, the rigid members 304, 306 pivot allowing horizontal movement. As the rigid members 304, 306 are substantially in parallel and there are at least four pivot points 360, the rigid members 304, 306 remain substantially in parallel with one another during operation. Additionally, the fixed positions of the left plate 312 and the right plate 314 ensure the angle defined by the left plate 312 and the left shoe receiving member 316 remain constant as well as the angle defined by the right plate 314 and the right shoe receiving member 318 remain constant. The dashed lines of FIG. 5 indicate a first horizontal position while the solid lines indicate a second position. In addition to movement in a horizontal plane, unique pivot points 362, 364 allow vertical movement as well. As a user lifts the left shoe receiving member 316, the right plate 314 pivots about pivot point 362 allowing vertical movement. Similarly, when the user lifts the right shoe receiving member 318, the left plate 312 pivots about pivot point 364 which allows vertical movement. The vertical movement is depicted in FIG. 6 in which a first position is shown by solid lines and a second position is shown by dashed lines. A user may manipulate the device in both the horizontal and vertical planes simultaneously. Now referring to FIG. 7, FIG. 8 and FIG. 9, a boot 400 which may be attached to the foot abduction apparatuses 2, 202, 302 detailed above is shown. The boot 400 comprises a flexible portion 402 and a rigid sole 404. Specifically referring to FIG. 8, a cross-sectional portion of the boot 400 is shown. A cavity 406 is formed within the flexible portion 402. The shape of the cavity 406 corresponds to the shape of the rigid sole 404. The rigid sole 404 is inserted into the cavity 406. Once in place, the flexible portion 402 surrounds a bottom surface 408 of the rigid sole 404. The flexible portion 402 is preferably made of silicone which possesses a cushioning characteristic. The cushioning characteristic allows the user of the boot 400 more comfort and greater shock absorption. Again referring to FIG. 7, the rigid sole 404 is substantially planar. Once the rigid sole 404 is inserted into the cavity 406, attachment means 410 may be used to connect the boot 400 to the shoe receiving members described in the embodiments described above. Preferably, the attachment means 410 are standard screws that may be counter sunk in the rigid sole 404. Any number of attachment means 410 may be utilized, but the preferred embodiment has three attachment means 410. The flexible portion 402 comprises a heel extension 412 which is at a substantial perpendicular in relation to the rigid sole 404. The heel extension 412 is shaped such that it conforms to a user&#39;s bank ankle, heel and lower back calf. The heel extension 412 also allows straps (not shown) to be connected to stabilize and support a user&#39;s foot and ankle. A heel hole 414 in the flexible portion 404 allows a doctor or parent to observe the placement of a user&#39;s ankle and heel to verify the correct positioning of the user&#39;s foot. Additionally, the flexible portion 402 comprises two flaps 414 which substantially cover the user&#39;s foot. The flaps 415 also allow straps to span the width of the shoe while protecting the user from the friction created by such straps. Now referring to FIG. 10, FIG. 11 and FIG. 12 another embodiment of a shoe 500 for a foot abduction apparatus is detailed. The boot 500 comprises a flexible portion 502 and a rigid sole 504. Specifically referring to FIG. 8, a cross-sectional portion of the boot 500 is shown. A cavity 506 is formed within the flexible portion 502. The shape of the cavity 506 corresponds to the shape of the rigid sole 504. The rigid sole 504 is inserted into the cavity 506. The flexible portion 502 further comprises an edge 522 which is flexible. The cavity 506 and the edge 522 may be manipulated in such a way that the rigid sole 504 can be placed in the cavity 506. The flexible portion comprising a groove, the groove extending in an oblong elliptical shape. The rigid sole comprising a first segment and a second segment, the first segment extending a greater distance than the second segment thereby creating a lip, the lip positioned within the groove whereby the rigid sole is secured in the flexible portion. The silicone is located under the first segment providing additional cushioning. The edge 522 maintains the rigid sole 504 in the flexible portion 502. The flexible portion 502 is preferably made of silicone which possesses a cushioning characteristic. The cushioning characteristic allows the user of the boot 500 more comfort and greater shock absorption. Again referring to FIG. 10, the rigid sole 504 is substantially planar. Once the rigid sole 504 is inserted into the cavity 506, attachment means 510 may be used to connect the boot 500 to the shoe receiving members described in the embodiments described above. Preferably, the attachment means 510 are standard screws that may be counter sunk in the rigid sole 504. Any number of attachment means 510 may be utilized, but the preferred embodiment has three attachment means 510. The flexible portion 504 comprises a heel extension 512 which is at a substantial perpendicular in relation to the rigid sole 504. The heel extension 512 is shaped such that it conforms to a user&#39;s bank ankle, heel and lower back calf. The heel extension 512 also allows straps (not shown) to be connected to stabilize and support a user&#39;s foot and ankle. A heel hole 514 in the flexible portion 504 allows a doctor or parent to observe the placement of a user&#39;s ankle and heel to verify the correct positioning of the user&#39;s foot. Additionally, the flexible portion 502 comprises two flaps 514 which substantially cover the user&#39;s foot. The flaps 515 also allow straps to span the width of the shoe while protecting the user from the friction created by such straps. Having thus described the invention in connection with the preferred embodiments thereof, it will be evident to those skilled in the art that various revisions can be made to the preferred embodiments described herein with out departing from the spirit and scope of the invention. It is my intention, however, that all such revisions and modifications that are evident to those skilled in the art will be included with in the scope of the following claims.

Summary: An improved foot abduction apparatus allowing movement in a horizontal and vertical plane. The embodiments allow a user to more easily manipulate the apparatus in one or both planes through the use of strategically placed pivot points. The device utilizes at least one rigid member attached to coupling devices which contain at least one pivot point. The specialized coupling devices may be selectively attached to shoe receiving member or plates which are well known in the art. Additionally the shoe receiving members are able to receive an improved shoe containing a sole member contained with a silicone boot.

big_patent

en

Summarize: Five elephants were killed last week by poachers using cyanide in Matabeleland North, Forestry Commission information and communications manager Ms Violet Makoto has said. In a statement, Ms Makoto said Forestry Commission guards who were on patrol discovered the cyanide which was planted on salt licks. "A total of five elephants have been killed this week. "Forest Protection Unit guards who were patrolling the Amandundumela area of Gwaai Forest on Wednesday afternoon discovered cyanide planted on salt licks around Simunyu water point. There is no water pumping taking place at this water-pan but game animals like licking the soils around it," she said. She said Forestry Commission protection personnel and the Zimbabwe Republic Police were alerted and started searches. "More Forestry Commission protection personnel together with ZRP officers were alerted to this incident and upon tracking the spoor, five elephant carcasses were discovered with the tusks already removed. Ms Makoto said a duiker was also found dead on Thursday. "On Thursday, the search team came across a place where a duiker was killed and skinned and it is presumed to have been killed for food by the poachers. "It appears the poachers are doing their business on foot as the spoor is heading towards Block O of Gwaai Forest," she said. She said the Forestry Commission was working hard to find the suspected poachers. "The Forestry Commission team is still hard at work to bring the culprits to book," she said. "We are suspecting a team of about five poachers. We came across a camp sometime ago, which looked like it accommodated about five people and we think it is the same team," she said. Zimbabwe has so far lost nearly 400 elephants in the last two years. Cyanide is a highly poisonous chemical, used in processing gold. It kills in the most painful, yet silent fashion, a method that helps poachers to avoid the attention of game rangers, whose mandate is to guard the animals from danger. HARARE, Zimbabwe (AP) — Zimbabwean officials say poachers killed five elephants by poisoning them with cyanide. Violet Makoto, spokeswoman for Zimbabwe's forestry commission, said Monday that rangers discovered the carcasses of the elephants with their tusks removed in a western forest last week. No arrests have been made. Makoto said the poison was laced on salt licks, a method now regularly used by poachers to kill elephants in Zimbabwe. She says poachers killed four other elephants in the same area in February. The wildlife-rich southern African country has battled cyanide poisoning of wildlife by poachers for the past three years. Poachers killed 62 elephants by that method in October. Harare - Five elephants have been poisoned with cyanide in a protected forest area in western Zimbabwe, the first reports of poisonings in months, according to reports on Saturday. The dead elephants were found by a patrol tracking poachers in the Amandundumela area of the Gwaai Forest. "Forest protection personnel together with ZRP [police] officers were alerted to this incident and upon tracking the spoor, three elephant carcasses were discovered with the ivory already removed," Forestry Commission spokesperson Violet Makoto told the state-run Chronicle. "The team also discovered two more elephant carcasses [on Friday]," she added. Cyanide widely available on black market In 2013 Zimbabwe experienced its first major cyanide poisoning incidents. More than 200 elephants were killed in and around Hwange National Park. Last October, more than 60 elephants were reported killed in another spate of cyanide poisonings in Hwange and Kariba, in the north of the country. Makoto told the Chronicle that four elephants were killed in February in the Gwaai Forest. In March forestry guards seized 5kgs of cyanide from three suspected poachers who managed to escape, she said. Cyanide, used in gold mining, is reported to be widely available on Zimbabwe's black market. Authorities say that some areas, including Hwange and Gonarezhou National Park in the south-east of the country have too many elephants. But in other areas, including the Zambezi Valley in northern Zimbabwe, elephants have been hard-hit by poachers.

Summary: Zimbabwean officials say poachers killed five elephants by poisoning them with cyanide, the AP reports. Violet Makoto, spokeswoman for Zimbabwe's forestry commission, said Monday that rangers discovered the carcasses of the elephants with their tusks removed in a western forest last week. Makoto says the poison was laced on salt licks, a method now regularly used by poachers to kill elephants in Zimbabwe. She says poachers killed four other elephants in the same area in February. No arrests have been made, but Makoto tells AllAfrica.com that "we are suspecting a team of about five poachers. We came across a camp sometime ago, which looked like it accommodated about five people and we think it is the same team." The wildlife-rich southern African country has battled cyanide poisoning of wildlife by poachers for the past three years. Poachers killed 62 elephants by that method in October. Cyanide kills painfully but quietly, enabling poachers to work without attracting game rangers. Used in gold mining, cyanide is said to be readily available on the black market in Zimbabwe, News 24 reports.

multi_news

en

Summarize: An aerial assessment of the flood-ravaged forest lands on Kauai has yielded some interesting results, according to the Department of Land and Natural Resources. An aerial assessment of the flood-ravaged forest lands on Kauai has yielded some interesting results, according to the Department of Land and Natural Resources. A San Diego family caught in the deluge of historic Kauai flooding this weekend was able to make their way to safety with the help of a legendary waterman who knows his way around Garden Isle waters. The record 27 inches of rain that fell on Kauai in just 24 hours stranded the Gwilliam family on their last day of their vacation. "We tried not to let the kids see, but I was terrified," Erin Gwilliam said. “It was kind of like scary, and I just wanted to go home,” added her daughter, Elin. In the middle of the flooding and mudslides came help from an unexpected nearby resident: famed big wave surfer Laird Hamilton, who swooped in to save the stranded vacationers that were staying just across the river from his home. The Gwilliams had rented a house along the river, but when the rain flooded the river past its banks and washed out a nearby bridge and surrounding roads, the Gwilliams with only one way out of the North Shore. Hamilton, the pioneering leader of big wave tow-in surfing – where a person uses a personal watercraft to catch giant waves – came to the rescue. "He just kind of boated right up and was like, 'OK, come through the mud and the slime and come throw your bags in and let's go,'" Erin said. Hamilton's big wave reputation is well documented, but the Gwilliams got to know his good nature first hand. The family says Hamilton comforted the Gwilliam kids during the ferry ride, and they took many pictures and videos along the way. "Now it just confirms him as being a total legend in my book," Jamas said. Turns out, it wasn't just the Gwilliams that Hamilton managed to ferry off the North Shore. He spent the entire day Saturday helping stranded visitors. Copyright 2018 Hawaii News Now, NBCUniversal Media, All rights reserved. A record 28 inches of rain has fallen on Kauai, Hawaii causing flash flooding and landslides leading the U.S. Army and National Guard to airlift over 220 people to safety on Monday after the rains subsided.According to AccuWeather, dozens of people were briefly stranded without food at a Red Cross shelter on Sunday due to flooding. Several homes and roads have been completely destroyed.Most of the rain fell in just 24 hours from 2 a.m. Saturday to 2 a.m. Sunday, leading water levels to rise 5-8 feet above the average level along the north shore of the island. Water and supplies are seen aboard a U.S. Army CH-47 Tuesday, April 17, 2018 in Princeville, Kauai. Rescue and relief operations commenced in the morning from Princeville Airport for people still stranded... (Associated Press) Water and supplies are seen aboard a U.S. Army CH-47 Tuesday, April 17, 2018 in Princeville, Kauai. Rescue and relief operations commenced in the morning from Princeville Airport for people still stranded in Haena, Wainiha, and other parts of north Kauai. (Jamm Aquino/Honolulu Star-Advertiser via AP) (Associated Press) HONOLULU (AP) — The Latest on severe flooding that hit Hawaii's Kauai Island (all times local): 4:30 p.m. Hawaii lawmakers are appropriating $125 million to help with flood relief efforts on Kauai and elsewhere in the state. House and Senate leaders said Wednesday the money would support road, bridge and infrastructure repairs. Kauai will receive $100 million of the money. The remainder will go to sites statewide. House Finance Committee Chairwoman Rep. Sylvia Luke says the state and counties are assessing the damage. But she says it's important to supply the immediate cash infusion to support the people of Kauai. The funds will be allotted to the state Department of Defense budget for this fiscal year. At least 2 feet (71 centimeters) of rain dumped on Hanalei on Kauai's north shore during a 24-hour period over the weekend. ___ 10 a.m. Kauai residents struggling with the aftermath of torrential rains are bracing for the possibility of more flooding. The National Weather Service says a flash flood watch is in effect for the Hawaiian island starting Thursday. Mayor Bernard Carvalho says officials will be keeping a close eye on the weather. At least 2 feet (71 centimeters) of rain dumped on Hanalei on Kauai's north shore during a 24-hour period over the weekend. The rain left people stranded in a shelter that became surrounded by water, homes damaged or washed off foundations and landslides along roadways. Since Monday, military and county emergency workers have airlifted more than 340 people from the isolated north shore towns of Haena and Wainiha. Evacuations are ongoing. Hawaii Gov. David Ige on Sunday declared Kauai a disaster. What was supposed to be a fun gathering of friends along Kauai's Na Pali Coast turned into an adrenaline-pumping fight for life as the island endured historic amounts of rain and flooding over the weekend. What was supposed to be a fun gathering of friends along Kauai's Na Pali Coast turned into an adrenaline-pumping fight for life as the island endured historic amounts of rain and flooding over the weekend. For hikers on the Na Pali Coast, floods were like an 'apocalyptic moment' For hikers on the Na Pali Coast, floods were like an 'apocalyptic moment' On Saturday, the storm targeted Kauai, where floodwaters and quick-moving mudslides destroyed homes, officials said. On Saturday, the storm targeted Kauai, where floodwaters and quick-moving mudslides destroyed homes, officials said. Kauai residents grappling with devastating floods and landslides are getting some tax relief. Kauai residents grappling with devastating floods and landslides are getting some tax relief. An aerial assessment of the flood-ravaged forest lands on Kauai has yielded some interesting results, according to the Department of Land and Natural Resources. An aerial assessment of the flood-ravaged forest lands on Kauai has yielded some interesting results, according to the Department of Land and Natural Resources. Kauai police and prosecutors are investigating multiple complaints from people who say they were rescued during the island’s historic rain and flood event over the weekend — only to be extorted for money by those who they thought were simply good Samaritans. Kauai police and prosecutors are investigating multiple complaints from people who say they were rescued during the island’s historic rain and flood event over the weekend — only to be extorted for money by those who they thought were simply good Samaritans. Four days after historic flooding on Kauai, Red Cross and county assessment teams are still trying to get a scope of the disaster, traversing into communities cut off by mudslides and devastated by floodwaters that ripped homes from foundations and washed away roads. An aerial survey conducted Wednesday of state-owned lands showed that the damage in some areas was much worse than previously thought. Meanwhile, clean-up and recovery efforts continue alongside a push to ensure that flood victims in the hardest hit areas have access to the basics — bottled water, food, and a ride out on a helicopter if they want it. On Thursday, power was cut to all of Kauai for several hours as crews made repairs to a transmission repair. Power was restored by 10 a.m., and crews were also able to replace two or three downed poles Wednesday near the Waikoko landslides, restoring power to hard-hit areas in Wainiha and Haena. County officials were also able to lift a "do not drink" advisory for some areas of Kauai, but residents along a portion of Kuhio Highway in Haena are still being told they shouldn't drink or cook with tap water. And Education Department officials are hopeful they'll be able to reopen Hanalei Elementary by Monday. The school has been closed for repairs. Though life is slowly returning to normal in some spots, Kauai leaders continue to stress that the road to recovery will be a long one — and that simply reopening Kuhio Highway could take weeks. Meanwhile, forecasters say another round of wet weather is set to move in starting Thursday. And while Kauai isn't expected to get the brunt of the heavy rains, they say that even moderate showers in flood-ravaged areas could trigger big problems. “While this system isn’t expected to be as severe as the last one, we will be keeping a close eye on the weather and make the necessary adjustments to keep all our people and visitors safe,” Mayor Bernard Carvalho said, in a news release. Since Monday, upwards of 500 people have been rescued from devastated communities on Kauai's north shore, some of whom escaped rising floodwaters by climbing to their rooftops. Over 446 people were airlifted to safety, and crews plan to resume rescue efforts on Thursday. The push to get supplies to those who need it is also ongoing. Government agencies and volunteers have come out in force to deliver pallets of water, canned goods, toilet paper, even blankets and clothes to those in communities cut off by severe damage to major roadways. State and county officials say landslides that continue to block Kuhio Highway make it impossible to predict when evacuees might be able to return home. The state Transportation Department said there's no timeline for repairs to the highway, and some think it could take months. Two areas of the road are severely damaged in Waikoko and Wainiha. The state confirms six minor and six large landslides. “We’re going to have people stranded across the river in Wainiha probably closer to a month — so this is not going to end," said Kauai Councilman Mel Rapozo. "They’re going to need food and water and supplies." The torrential rains that hit Kauai over the weekend and into Monday have been called unprecedented, and many were unprepared for the flooding that followed. "People were stuck and the door, you couldn't push open because the water was right there," said Ehukai Gois-Mederios, describing the flooding in Koloa. "And water was already in their house. So we had to open screens, we had to open back doors, we had to do whatever we could to get them out." Now, as the floodwaters recede, residents are coming to terms with the damage. Some have lost everything. "There's a lot of stuff that we didn't pay off yet and everything's totaled," Koloa resident Qiana Quinn said, through tears. MORE COVERAGE: ► Police investigate claims'rescuers' demanded money from Kauai flood victims ► Legendary surfer Laird Hamilton among those who came to rescue on Kauai ► Take a look at the landslides blocking north shore families on Kauai ► What you can do: How to help Kauai flood victims ► PHOTOS: Widespread flooding destroys homes, closes roads on Kauai But flood victims are being buoyed by the help of friends, community members — and complete strangers. Ekolu Chong doesn't know anyone in Koloa, but wanted to drop off dumpster bins to help. "Why not? I mean look at these guys," he said. "They no more one house right now. They cannot sleep in their house. So speed up the process to get damaged goods out to get new stuff in." In Kalaheo, kumu Hula Leina’ala Pavao-Jardin organized a community donation drive two nights in a row. She said it’s a perfect example of the Kauai spirit coming through. “Kauai is full of aloha,” Pavao-Jardin said. "Last night, the donations that came in were beyond anything we ever expected, and then again today. Just spectacular our people.” And thousands of people have donated money to a number of funds aimed at getting help to those who need it. Among them: Facebook founder (and part-time Kauai resident) Mark Zuckerberg, who pledged $1 million for storm recovery. For a full list of ways to donate and get involved, click here. This story will be updated. Copyright 2018 Hawaii News Now. All rights reserved.

Summary: Kauai was hit with historic flooding over the weekend-a record 28 inches of rain fell in just about 24 hours-but a legendary surfer was there to save the day for many who were stranded. Laird Hamilton, who pioneered the art of big wave tow-in surfing, spent Saturday helping people caught in the downpour and ensuing mudslides, including one San Diego family that was on the island for a vacation. The Gwilliams were stuck in their rented house along a river, which flooded its banks and washed out surrounding roads and a bridge. "I was terrified," mom Erin Gwilliam tells Hawaii News Now. That's when Hamilton, who lives across the river, showed up in a boat with his daughter and their dog. "He just kind of boated right up and was like, 'OK, come through the mud and the slime and come throw your bags in and let's go,'" Erin says. He reassured their kids and took photos and videos with the family as he ferried them off the North Shore. "Now it just confirms him as being a total legend in my book," says dad Jamas. Meanwhile, evacuations are still ongoing; more than 340 people have been airlifted to safety so far. And the crisis may not be over yet: The AP reports a flash flood warning is in effect starting Thursday. Hawaii News Now reports that power to Wainiha and Haena was cut Thursday so repairs can be made to a transmission line as crews work to restore full power service. It could be weeks before some roads reopen.

multi_news

en

Summarize: By. Associated Press. PUBLISHED:. 12:50 EST, 13 February 2014. |. UPDATED:. 15:21 EST, 13 February 2014. Slayer: Matthew Ondo was arrested Wednesday evening after allegedly chopping off his family dog's head with a machete. A Pittsburgh man is facing animal cruelty charges after he allegedly used a machete to decapitate his mother's chihuahua. Authorities said they were called to the home Wednesday evening around 6;15pm, and Matthew Ondo's parents showed them the remains of the dog, named Izzy, along with a bloody machete and butcher knife. Ondo's parents told police their 30-year-old son is an unemployed heroin addict who may have undiagnosed psychological problems. His mother, Debra Ondo, said she was playing upstairs with the 14-month-old dog when she heard her son call for Izzy. She didn't realize the dog was killed until her husband came home and began yelling when he discovered what had happened. The dog's body was discovered by police in the backyard near a picnic table and its head was about six inches away. According to a criminal complaint, Ondo at first denied killing the dog, then claimed the devil, Allah or. 'the Mexican' did it. Ondo is being held at the Allegheny County jail, unable to post $25,000 bond. No attorney was listed on court papers. A preliminary hearing was scheduled for February 26. Ondo has a criminal record which includes prior convictions for drunk driving, possessing a controlled substance and acting disorderly

Summary: Matthew Ondo, 30, was arrested Wednesday on charges of animal cruelty and possessing instruments of crime. His mother Debra Ondo told police that she was playing with the chihuahua when her son called the dog named Izzy downstairs. When her husband came home he found the dog dead with its head cut off in the backyard. Mrs Ondo says her son is an unemployed heroin addict who may have undiagnosed psychological problems.

cnn_dailymail

en

Summarize: FIELD OF THE INVENTION [0001] The present invention relates to a multi-purpose table for furnishing, usable in particular in public and meeting places, of stackable type and comprising a top with a thickness and perimeter edges, and support means on the underside of the top. DESCRIPTION OF THE PRIOR ART [0002] As is known, tables for furnishing present a support surface defined by a top or the like. Said top is important in determining the exterior appearance and functionality of tables for furnishing and it is thus opportune that it is in harmony with the surrounding furnishings, or fit for the required uses. [0003] The colours or colour combinations and physical characteristics of the support surface are particularly important. For instance, a non-porous, non-absorbent and easily cleanable surface is necessary when the table is used for meals or contact with food, while a surface with a suitable robustness is necessary when the table is also used to support heavy or sharp-edged objects, a smooth surface is suitable for writing, a relatively soft surface which is pleasant to touch is suitable for a simple hand rest, etc. [0004] However, once chosen, the top cannot be varied in terms of appearance or functional characteristics, except partly in a dimensional sense when it is composed by foldable, hinged parts. In practice the appearance and functionality of the tables in question are for the most part permanently fixed at the time of their production and purchase. [0005] It is also known that the tables intended to furnish public places, in particular those placed outside, must present accentuated characteristics of simplicity, solidity and low cost. For this reason tables with main tops composed of hinged and foldable parts are generally unsuitable. [0006] Furthermore, in public spaces or places it is often opportune for tables to be stackable upon one another. [0007] This property is useful because it permits the tables to be accumulated in a restricted space, to then be taken when necessary. Public places can thus prepare only the number of tables sufficient for the clientele at that time, avoiding unnecessary space restrictions. [0008] If the tables are stackable then cleaning or maintenance of the available places or spaces becomes much easier. [0009] Similar requirements of solidity, simplicity, low cost and stackability must be anticipated for tables to be hired, together with relative chairs, for occasional events or gatherings, typically in open spaces. [0010] Stacking of tables having a single piece top requires the tables&#39; supporting legs to be suitably expanded external to the top, to avoid interference with the top of the table below upon stacking. [0011] The aesthetics of these tables, with supporting legs protruding from the perimeter edge of the main tops, is not very satisfactory and furthermore the described stacking method presents an important drawback: to be stacked or taken, the tables must be lifted to a height above that of the table or pile of tables underneath. [0012] The known tables forming part of the furnishings of a public space or meeting place also have the drawback of not being inter-distinguishable and therefore require special movable added countersigns to indicate booked tables, tables connected to a given clientele, tables in the charge of diverse attendants, etc, as needed. [0013] In the case of tables hired for a fee for shows and events it may also be useful to distinguish each time diverse types of place and diverse costs connected with them. [0014] The additional countersigns are a supplementary cost and are not very suitable for tables placed outside, where they can easily be displaced or disordered by the wind, or damaged by the rain. SUMMARY OF THE INVENTION [0015] In this situation the technical aim at the base of the present invention is to design a multi-purpose table able to overcome the cited drawbacks. [0016] In the context of said technical aim an important object of the invention is to realise a table whose support surface can be varied in its aesthetics, in particular its colour, or its functionality. [0017] Another aim is to make available a table having precise and reliable identifying features, also suitable for public spaces or outside meeting places. [0018] A further aim of the invention is to realise a table which can be easily and quickly stacked. [0019] Yet another object of the invention is to make available a solid, simple, low cost table. [0020] The specified technical aim and objects are achieved with a multi-purpose table for furnishing comprising: a top with a thickness and perimeter edges, said perimeter edges delimiting a support surface of said top, means of support on the underside of said top, at least one clearance aperture passing through said top and developing in such a way as to interrupt both said support surface and said perimeter edges, at least one mobile element substantially counter-profiled to said clearance aperture and aimed at substantially re-forming said support surface and said perimeter edges, and fixing means between said top and said mobile element aimed at constraining said mobile element in a removable way in said clearance aperture. BRIEF DESCRIPTION OF THE DRAWINGS [0021] Reported below, as an example, is the description of the preferred embodiments of a table according to the invention, with reference to the attached drawings, wherein: [0022] FIG. 1 shows the table according to the invention in axonometric and partially exploded projection; [0023] FIG. 2 illustrates the stacking of the tables of FIG. 1 ; [0024] FIG. 3 highlights a portion of the top of the table of FIG. 1, with a mobile element in the inserted position; [0025] FIG. 4 shows said top from below in a further embodiment, with the mobile element in the out-of-use position; [0026] FIG. 5 shows a further embodiment of the invention, with two adjoining tables in position of use; [0027] FIG. 6 illustrates the two tables of FIG. 5 in stacking position; [0028] FIG. 7 illustrates a further embodiment of the top of the table according to the invention in perspective view, and [0029] FIG. 8 presents another embodiment of the table according to the invention. DESCRIPTION OF THE PREFERRED EMBODIMENTS [0030] With reference to the cited Figures, the multi-purpose table according to the invention is globally indicated with the number 1. [0031] It includes a main top or top 2, which presents a thickness and is externally bordered by perimeter edges 2 a. The latter delimit an internal area 2 b and a support surface 3 of top 2. [0032] Table 1 also includes means of support 4, which sustain the top 2 in a raised position with respect to the ground. [0033] At least one clearance aperture 5 is anticipated on top 2. Said clearance aperture 5 develops for the entire thickness of top 2 and extends from the perimeter edges 2 a to the internal area 2 b, so as to interrupt the continuity of the support surface 3 and perimeter edges 2 a. [0034] Numerous clearance apertures 5 are also possible, such as to define together a prevalent portion of the support surface 3 and perimeter edges 2 a. [0035] At least one mobile element 6 is anticipated, counter-profiled to the clearance aperture or apertures 5 and aimed at substantially re-forming the integrity and continuity of support surface 3 and perimeter edges 2 a. [0036] Said at least one mobile element 6 is constrained in a removable way to top 2 by appropriate fixing means 7. [0037] The fixing means 7 defines a movement of insertion and removal of mobile element 6 in the relative clearance aperture 5 directed substantially parallel to the support surface 2. [0038] In particular, the fixing means 7 can be composed of internal flanks 5 a of aperture 5 and external sides 6 a of the mobile element 6, whenever the second are interconnectable with the first. [0039] The figures highlight the internal flanks 5 a presenting a complementary profile to that of the external sides 6 a. [0040] For instance, the internal flanks 5 a of aperture 5 may present a rounded, protruding profile which is counter-profiled to a rounded recession of the external sides 6 a of the mobile element 6, as illustrated in FIG. 3. [0041] Another possible profile anticipates that the outer sides 6 a and internal flanks 5 a have a stepped structure 9, as shown in FIG. 7. [0042] In this case the external sides 6 a and internal flanks 5 a preferably have a stepped profile 9 which impedes any displacement in a perpendicular direction to the support surface 3 : it presents alternate protruding and receding portions along the internal flanks 5 a and, in a complementary manner, along the external sides 6 a. [0043] Diverse other profiles are possible, for instance it is possible that the internal flanks 5 a and external sides 6 a have ledges or grooves 10 of a slot type, as schematised in FIG. 1. [0044] The mobile element 6 may be realised in diverse materials and/or colours. Preferably said materials and/or colours are different to those of the support surface 3 of top 2. [0045] In this way the mobile element 6 can at least partly vary the functional characteristics of support surface 3. [0046] It is also flattened and presents opposite main faces 13, one of which remains in sight when the element is inserted into the clearance aperture 5. [0047] Furthermore the face of the mobile element 6 in view can vary the aesthetic appearance of table 1 by introducing one or more distinctive elements which may be a colour, a brand, advertising material or useful indications. [0048] To this aim the same distinctive elements may be prepared slightly in relief or slightly embedded or simply defined by graphic elements 14. [0049] Furthermore the mobile element 6 may have distinctive elements, in particular the graphic elements 14, in correspondence with each of the main faces 13 and possibly the distinctive elements of one face may be different to those of the other face, to obtain the maximum functionality and multi-purposing. [0050] To achieve the anticipated aims the mobile element 6 is preferably realised in a polymeric material, which permits less friction and thus easy sliding insertion into the aperture 5, and a possible colour variation and economical printing of the graphic elements in relief or the like. [0051] The preferred embodiment of the table 1 anticipates an efficient stacking when the support means 4 includes a central post 4 a as in FIG. 1, or three or more posts 4 a as in FIGS. 5 and 6. [0052] The posts 4 a may be directly in contact with the ground or floor, or additional ground supports 4 b may be anticipated. [0053] To permit stacking it is expected that the aperture or apertures 5 are sized in such a way as to permit the insertion within it or them of the upper part of a post 4 a. [0054] Thanks to this solution a table 1 may be stacked on a table below by a slight lift and horizontal push as illustrated in FIG. 2, where this displacement defines the insertion trajectory 8. [0055] With the aim of permitting stacking, any ground supports 4 b must not present any obstacle to the insertion trajectory 8. [0056] For instance, the ground supports 4 b may be realised by arms radiating out from the base of a central post as in FIG. 1, or by poles which diverge in an upturned calyx shape from the same post, in the direction of the ground. [0057] According to a further aspect of the invention, coupling means 12 on top 2 may also be anticipated, aimed at holding the mobile element 6 in place when it is not inserted into the clearance aperture 5. [0058] Said coupling means 12, illustrated in FIGS. 3 and 4, are preferably positioned on top 2 on the part opposite support surface 3, so as not to interfere with the same. [0059] There are opportunely composed of joints or the like made to measure for the mobile element 6 and are also preferably positioned in correspondence to a thinned portion of top 2, so as not to impede stacking. If the mobile element 6 has a thickness less than that of top 2, all protrusions towards the bottom of mobile element 6 are eliminated in the position removed from the clearance aperture 5. [0060] The mobile element 6 may also present a recess 11. Said recess 11 is aimed at defining a cavity in top 2 aimed at surrounding a post 4 a when the mobile element 6 is inserted in the clearance aperture 5. [0061] Said recess 11 can be placed in the section of the mobile element 6 which is most deeply inserted into top 2, as shown in FIG. 8. [0062] In this way when the tables are stacked the mobile element 6 can still be fixed to the top 2 in aperture 5 and can thus constitute an obstacle to the dislodging of the stacked tables 1. [0063] In summary, the mobile element 6 may be inserted, removed or changed as desired by means of a simple insertion of the same in aperture 5. [0064] If the tables 1 are stacked, the mobile element 6 is removed to enable stacking of the tables 1, and is re-inserted in the aperture 5 when the tables 1 are used. When the coupling means 12 are anticipated, the mobile element 6 may be held in place by this while the tables are stacked, thus avoiding the risk of losing the mobile element 6. [0065] If the mobile element 6 instead presents the recess 11, said element 6 may be inserted in opening 5 even when the tables are stacked. [0066] The invention permits important advantages. [0067] In fact the perfected table for furnishing 1 enables the aesthetics and functionality of the support surface 3 to be varied. [0068] In fact it is possible to use mobile elements 6 of different colours, so as to vary the appearance of the table itself, or again it is possible to indicate the table brand or any advertisement or various indications. [0069] Furthermore, especially in public spaces, mobile elements 6 may be used which distinguish the table itself. Said elements may for instance highlight a booking or the table&#39;s availability, or still more. [0070] The mobile element 6 may also present special surfaces suitable for specific requirements, so that the same table may at least partly be adapted for use for meals or the like, to support heavy or sharp-edged objects, to write, and still more, always presenting a suitable surface for the current use. [0071] The same mobile element may be used for different uses, if its main faces 13 are different to one another, and multiple clearance apertures 5 and corresponding mobile elements 6 may be placed on the same table.

Summary: A multi-purpose table for furnishing is anticipated, comprising: a top ( 2 ) with a thickness and perimeter edges ( 2 a ) delimiting a support surface ( 3 ) of the top ( 2 ), supports ( 4 ) on the underside of the top ( 2 ), a clearance aperture ( 5 ) passing through the top ( 2 ) and developing in such a way as to interrupt both the support surface ( 3 ) and perimeter edges ( 2 a ), a mobile element ( 6 ) counter-profiled to the clearance aperture ( 5 ) and aimed at re-forming the support surface ( 3 ) and perimeter edges ( 2 a ), and fixing means ( 7 ) between the top ( 2 ) and mobile element ( 6 ) to constrain the mobile element ( 6 ) in a removable way in the clearance aperture ( 5 ).

big_patent

en

Summarize: CROSS-REFERENCE TO RELATED APPLICATIONS [0001] This Application claims priority to and incorporates by reference in its entirety, U.S. Provisional Application No. 61/811,769, filed on Apr. 14, 2013. STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT [0002] Not applicable BACKGROUND [0003] Guardians of dependent living creatures, including but not limited to pets, children, domestic animals, livestock, or elderly or disabled adults, face a set of common problems. Dependent creatures can become misplaced or lost, and, once misplaced or lost, often lack the ability to clearly and accurately convey information necessary for their recovery and reunification with a guardian. Dependent creatures also often lack the ability to use communication devices such as phone or email, with the result that, when separated from a guardian, they are unable to communicate their status, ownership information, health information, or other relevant, information. Dependent creatures are further often unable to convey relevant information to third parties, including but not limited to conveying location information, conveying ownership information, conveying lineage information, or conveying medical information to medical care providers. This inability to convey important information results in inconvenience in many contexts. In the context of medical care, for example, the inability to transport or convey important information requires a dependent creature&#39;s guardian to transport and convey sometimes extensive medical information or records to doctors or veterinarians. [0004] Several methods have been attempted to resolve some or all of these problems, however, none have succeeded entirely. When the dependent creature is a pet or domestic animal, for example, it is known to the art to use animal information tags with the pet&#39;s name and address written or engraved on the tag. The amount of information that can be legibly displayed by a typical pet tag is, however, limited and such tags do not directly apprise guardians of the whereabouts or status of their pets, or to convey information too voluminous to be displayed on the tag. The limited information contained on a typical tag is often insufficient to ensure reliable recovery of the pet. When the dependent creature is a human, bracelets and other jewelry have been used to serve a similar function to a pet tag. Such jewelry, however, suffers the same limitations in data quantity and data sufficiency as are suffered by a pet tag. [0005] It is further known to the art to encode more extensive information about a dependent creature such as a pet or domestic animal within a microchip and then to implant the chip in the dependent creature. Such chips can also be used to locate the dependent creature. The implantation procedure is, however, expensive, inconvenient, and uncomfortable to the dependent creature. And, when the dependent creature is a human, many consider chip implantation undesirable for medical, aesthetic, or moral reasons. In another attempted solution, U.S. Pat. No. 7,578,433 discloses animal tags that utilize one-dimensional bar-codes to encode information about the animal. Such a tag does not resolve fully the problems known to the art, however, since the animal cannot be identified as the subject of the animal tag; and, more importantly, use of the tag depends on the finder possessing a personal digital assistant capable of reading one-dimensional bar codes. This makes it unlikely that a common person who finds an animal wearing such a tag will be able to access the information encoded in the bar code at the time of the find. SUMMARY [0006] The present invention overcomes problems known to the art by providing a method for reuniting lost dependent creatures with a guardian using equipment typically carried by many individuals, while simultaneously automatically alerting the guardian that the lost dependent creature has been found. The present invention further overcomes problems known to the art by providing a method for storing and easily transporting large amounts of medical or other information pertaining to a dependent creature in a manner easily accessible to anyone given access to the dependent creature&#39;s information tag. BRIEF DESCRIPTION OF THE DRAWINGS [0007] These and other features, aspects, and advantages of the present invention will become better understood with regard to the following description and accompanying drawings, where: [0008] FIG. 1 shows an embodiment of an information tag that can be used in accordance with embodiments of the methods of the present invention [0009] FIG. 2 shows a block diagram of the flow of information pertaining to a dependent creature according to one embodiment of the methods of the present invention DETAILED DESCRIPTION [0010] A “dependent creature” according to versions of the present invention refers to any animal, person, or thing wearing or intended to wear an information tag within the scope of versions of the present invention. A dependent creature includes, but is not limited to a pet, domestic animal, livestock, child, disabled adult, or elderly individual. A dependent creature may optionally include a wild animal, a healthy adult, or an object. [0011] An “information tag” according to versions of the present invention refers to a tag, badge, pin, or other object adapted to be worn by, carried by, or affixed to a dependent creature, that bears a scannable two-dimensional bar-code unique to that dependent creature. Preferably, the two-dimensional bar code is a QR code scannable by a variety of suitable handheld electronic devices. An information tag can be of any size or shape, however, an information tag is preferably sized and shaped to balance convenience of wear with ease of access for scanning of its two-dimensional bar code. An information tag according to versions of the present invention can be configured as, by way of non-limiting example, as necklace, is bracelet, is tab, a key ring, a buckle, is bangle, a clip, a pin, an ornament, a dog tag, a pet tag, a nametag, or an article of clothing. The two-dimensional bar code displayed by the information tag may be located anywhere on the information tag where it is accessible for scanning. For example, in an embodiment where the information tag is a bracelet, the two-dimensional bar code can be located on the outer surface of the bracelet, the inner surface of the bracelet, or a side of the bracelet. Alternately, the two-dimensional bar code could be located on a tag, tab, bangle, ornament, or other attachment to the bracelet. In a preferred embodiment, the information tag comprises a tab attached to a wearable neck band, wherein a QR code is displayed on one or both surfaces of the tab, and said QR code can be scanned or interrogated by a suitable handheld device. Scanning or interrogating said two-dimensional barcode and scanning or interrogating said information tag are used interchangeably herein, and both refer to scanning or interrogating said two-dimensional barcode. [0012] “Device” or “devices,” as used herein, refers to handheld or stationary electronic devices adapted to scan or interrogate the two-dimensional bar code displayed on an information tag. Suitable devices include, but are not limited to camera-equipped cellular or “smart” phones, or any other device equipped to scan or interrogate a two-dimensional bar-code. It will be appreciated by one skilled in the art that camera-equipped handheld phones are commonly equipped to scan, decode, and receive instructions from, for example, QR codes. Preferably, the device is a camera-equipped smart phone capable of scanning or interrogating a QR code and then responsively accessing the website page or URL to which the QR code directs it. [0013] Embodiments of methods of the present invention include the use of databases, data within those databases, and means of conveying data from those databases via website pages or URLs for display on devices. In preferred embodiments hereof, selected data concerning a dependent creature and, optionally, its guardian, is inputted for storage in a database. Data pertaining to a specific dependent creature is associated with a specific information tag registered or assigned to that dependent creature. Preferably, when an information tag is scanned or interrogated by a device, selected data associated with that information tag is displayed on one or more website pages or URLs, and the scanning or interrogating device is directed to said websites pages or URLs. Optionally, the data content of said website pages or URLs is persistent, and a device is directed to them upon scanning or interrogating an information tag. Alternately, the data content of said website pages or URLs is not persistent, and is generated for display in conjunction with the scanning or interrogating of the associated information tag. [0014] In a preferred embodiment, selected data pertaining to a dependent creature is stored in a database. This data is associated with the information tag assigned or registered to that dependent creature. When the two-dimensional bar code displayed on that dependent creature&#39;s information tag is scanned or interrogated by a device, the scanning or interrogating device is instructed by the two-dimensional bar code to access a website or URL displaying selected data pertaining to the dependent creature. Optionally, the website or URL may also display data pertaining to the dependent creature&#39;s guardian. Preferably, said selected data is pre-selected by the guardian. [0015] Preferably, when the two-dimensional bar code displayed on a dependent creature&#39;s information tag is scanned by a device, the dependent creature&#39;s guardian or other authorized representative is further provided with automatic electronic notice that the information tag was scanned or interrogated. Such electronic notice may be provided to one or more of the guardian, the guardian&#39;s agent or designee, a medical provider, police, social agencies, or other government or charitable organizations. Preferably, such electronic notice is provided to the guardian or their designee. Such electronic notice may be provided, for example, through email, text message, or telephone call, automatically generated upon the occurrence of scan or interrogation of the information tag by a device. [0016] Most preferably, such electronic notice includes information concerning the location of the device that scanned or interrogated the dependent creature&#39;s information tag. It will be appreciated by one skilled in the art that when, by way of example, a camera-equipped smartphone scans or interrogates a QR code, the QR code can instruct the smartphone to provide approximate location data to a specified website or URL. In a preferred embodiment hereof, the two-dimensional bar code displayed on the information tag instructs a scanning or interrogating device to provide approximate location information for the device to a specified website or URL, and to further provide data adapted to associate said location information with the identity of the information tag scanned or interrogated. Said specified website or URL is preferably configured to, upon receipt of such location information, generate automatic electronic notice including such location information to parties associated with the dependent creature. [0017] The data displayed to a scanning or interrogating party may be selected and determined by the guardian. Such data can include, but is not limited to, one or more of the dependent creature&#39;s photograph, name, address, telephone number, email address; guardian&#39;s name, guardian&#39;s address, guardian&#39;s telephone number, guardian&#39;s email address; secondary contact name, secondary contact address, secondary contact telephone number, secondary contact email address; dependent creature&#39;s medical provider&#39;s name, medical provider&#39;s address, medical provider&#39;s telephone number, medical provider&#39;s email address; dependent creature&#39;s medications, medical conditions, medical records, medical history, allergies, habits, preferences, gender, breed, likes, dislikes; or other special instructions or conditions. [0018] Versions of the present invention may provide selected access to data pertaining to a single information tag, with the selected data displayed to a specific device dependent upon permissions granted to that device. It will be appreciated by one skilled in the art that a website page or URL can be programmed to collect identifying information from a scanning or interrogating device, to determine what permissions, if any have been granted to that device, and to display data commensurate with the permissions granted to that device. As will be appreciated by one skilled in the art, the website page or URL that determines the permissions granted to a scanning or interrogating device need not be the same website page or URL displaying data. It will be further appreciated to one skilled in the art that such permissions can be granted to a device by providing the device with a specific URL, username, or passcode to register or authorize the device as having specified permissions. [0019] In one optional embodiment, when an information tag is scanned or interrogated by a device without any permissions, the device is directed to a website page or URL displaying only data suitable to reunite a dependent creature with its guardian. Such information may include the dependent creature&#39;s photograph, dependent creature&#39;s name, guardian&#39;s name, or guardian&#39;s contact information. Preferably, the guardian is substantially simultaneously provided electronic notice that the information tag was scanned or interrogated, including the information pertaining to the approximate location of the scanning or interrogating device. Optionally, this same information tag may be simultaneously associated with other data in the database including more extensive or more private information, wherein only scanning or interrogating devices with specific permissions are directed to URLs or websites displaying such more extensive or more private information. [0020] In one embodiment hereof, such more extensive or more private information may include the dependent creature&#39;s medical information, including medical history, medication, and medical records. In one embodiment herein, when the dependent creature&#39;s information tag is scanned or interrogated by a device without permissions to view such more extensive or more private information, the device is directed to a URL or website displaying only information suitable to reunite the dependent creature with its guardian and, optionally, the guardian is provided simultaneously provided notification that the information tag was scanned or interrogated, including the location of the scanning or interrogating device. When said information tag is scanned or interrogated by a device with permissions to view such more extensive or more private information, the device is directed to a website or URL displaying the more extensive or more private information. In a preferred embodiment hereof, the device possessing permissions to view such more extensive or more private information is registered to or associated with the dependent creature&#39;s medical provider, and such more extensive or more private information includes said dependent creature&#39;s medical records, medical history, and medications. [0021] Embodiments of the present invention are directed towards methods of reuniting a lost dependent creature with its guardian. In general, these embodiments of the present invention comprise the following steps: (1) entering information pertaining to the dependent creature into a database, wherein said data is selectively displayable via a website page or URL; (2) equipping a dependent creature with an information tag displaying a two-dimensional barcode unique to that dependent creature; (3) associating that dependent creature&#39;s data within the database with the information tag such that devices that scan or interrogate the information tag are directed to website pages or URLs displaying selected data pertaining to that dependent creature or its guardian; (4) a device scans or interrogates the information tag; (5) the scanning or interrogating device is directed to one or more website pages or URLs displaying selected data suitable to assist with reuniting the dependent creature with its guardian and, optionally; (6) substantially simultaneously with the scanning or interrogating of the information tag by the device, one or more of the guardian, guardian&#39;s designee, medical provider, police, social agency, or other government or charitable official receives electronic notice that the information tag has been scanned via one or more of email, text message, or telephone call. [0022] Embodiments of the present invention are further directed to methods of transporting and displaying specific data pertaining to a dependent creature. In general, these embodiments comprise the following steps: (1) entering data pertaining to the dependent creature into a database, wherein said data is selectively displayable via a website page or URL; (2) equipping a dependent creature with an information tag displaying a two-dimensional barcode unique to that dependent creature; (3) associating data within the database pertaining to said dependent creature with the dependent creature&#39;s information tag such that devices that scan or interrogate said information tag are directed to one or more website pages or URLs displaying selected data pertaining to that dependent creature or its guardian; (4) a device scans or interrogates the information tag (5) the scanning or interrogating device is directed to one or more website pages or URLs; and (6) website pages or URLs displaying selected data pertaining to the dependent creature or its guardian are displayed. Optionally, (7) said one or more website pages or URLs first determines the permissions of said scanning or interrogating device; and (8) said websites or URLs displaying selected data commensurate with the permissions of the scanning or interrogating device. [0023] Optionally, websites or URLs displaying data pertaining to a dependent creature may be accessed without using a device to scan or interrogate an information tag. An information tag may optionally further comprise as unique visual identifier. Unique identifiers include, but are not limited to, unique URLs, passcodes, passwords, or user IDs that can be entered into an internet browser and which are adapted to direct said internet browser to a website or URL displaying selected data from the database pertaining to the dependent creature or its guardian. In these embodiments of the invention, a user enters said unique identifier into a computer terminal. The computer terminal then displays selected data pertaining to said dependent creature or its guardian. [0024] Although the present invention has been described in considerable detail with reference to certain preferred versions thereof, other versions are possible. For example, other categories of data, methods of web access, or methods of data display may be used within the scope and spirit of this invention. Additionally, the steps of the methods disclosed herein may be performed in any order. Therefore, the spirit and scope of the foregoing should not be limited to the description of the preferred versions described herein.

Summary: A method for reuniting lost dependent creatures with a guardian, or, alternatively, to store and transport information pertaining to a dependent creature, where the dependent creature is equipped with a unique identification tag bearing a two-dimensional bar code scannable using smartphones and other equipment typically carried by many individuals and a scan of the unique identification tag provides information to the scanning individual about the dependent creature and substantially simultaneously provides information about at least the location of the scanning device to the guardian.

big_patent

en

Summarize: Tony Blair signed a'secret contract' with a Saudi Arabian oil firm - which promised him £41,000 a month and a cut in successful negotiations. Tony Blair has amassed a personal fortune since standing down as prime minister – often acting as an adviser to controversial businesses and regimes. But yesterday the hefty fees he charges to act as a go-between were revealed. A previously secret contract with a Saudi oil company headed by a member of the country’s royal family has been leaked showing Mr Blair charging £41,000 a month and 2 per cent commission on any of the multi-million-pound deals he helped broker. The emergence of the Saudi deal led to new criticism of Mr Blair’s role as a Middle East envoy, but he strongly denied there is a conflict of interest. The contract between Tony Blair Associates (TBA) and PetroSaudi signed in November 2010, said Mr Blair would personally arrange introductions to his contacts in China, such as senior politicians. He had already attracted scathing criticism after it emerged that he had given Kazakhstan’s autocratic president, Nursultan Nazarbayev, advice on how to manage his image after the slaughter of 14 unarmed civilians. Mr Blair has said claims that he is worth £100million are ‘greatly exaggerated’. But the Saudi contract shows how much he has been able to charge for his services. Since leaving Downing Street in 2007, he has amassed a fortune including a property portfolio of 31 homes worth at least £25million. He is one of the world’s best paid speakers – earning up to £150,000 a speech – and has secured advisory roles with US investment bank JP Morgan and Swiss insurer Zurich International. The Saudi contract stated that TBA would help find potential sources of new investment and added that Mr Blair would make ‘introductions to the senior political leadership, industrial policymakers, corporate entities and other persons in China identified and deemed by us and you to be relevant to PetroSaudi’s international strategy’. The firm agreed it would not divulge his role without permission. Deal: Tony Blair in 2010 with King Abdullah of Saudi Arabia, right. Mr Blair signed a contract with PetroSaudi, a firm founded by his son. Tony Blair and his wife Cherie, pictured yesterday walking through Downing Street on their way to the annual Remembrance Sunday service at the Cenotaph memorial in Whitehall, London. The former Labour Party leader (centre) stands shoulder to shoulder with George Osborne, Ed Miliband, Nick Clegg and John Major at the service amid claims he'signed a secret contract' with the oil firm. The former Labour Party leader signed the deal with PetroSaudi, which was co-founded by the son of the King of Saudi Arabia - Prince Turki bin Abdullah Al Saud (pictured centre, shaking hands) The contract read: ‘Each party will ensure that no announcements, statements or documentation containing any reference to either party or to Tony Blair will be published or made without the prior express written consent of the other party.’ The oil firm was founded by Saudi businessman Tarek Obaid and Prince Turki bin Abdullah Al Saud, a son of Saudi Arabia’s King Abdullah, and has projects in Ghana, Indonesia, Venezuela and Tunisia. Critics have already said Mr Blair is not suitable for his role as a Middle East peace envoy, in which he is a representative of the quartet of the UN, the EU, the US and Russia, because of his business interests in the region. Oliver Miles, a former ambassador to Libya, who signed a letter in June that argued Mr Blair’s responsibility for the Iraq crisis and lack of transparency of his interests, said this was the latest example of why he was wrong for the unpaid role. PetroSaudi (pictured is one of its ships) asked that Blair personally introduce them to his Chinese contacts. ‘The fact this was kept a secret, or was intended to be kept secret, was a mistake,’ he told the Sunday Times. But a spokesman for Mr Blair stressed the consultancy work was related to China not the Middle East. He said: ‘Tony Blair Associates worked for PetroSaudi for a period of months over four years ago. ‘This was in connection with an issue in the Far East and nothing whatsoever to do with the Middle East or the unpaid ex-officio role of Tony Blair for the quartet in Palestine.’ PetroSaudi said Mr Blair was engaged on a confidential basis to help develop business in China and the work lasted ‘about four or five months maximum’. Saudi Arabia has come under fire over its human rights record. Amnesty International has said that more than 2,000 people were executed there between 1985 and 2013. Mr Blair was criticised over his decision in 2006 to halt a Serious Fraud Office investigation into alleged corruption over a multi-billion-pound arms deal between BAE Systems and Saudi Arabia

Summary: Tony Blair signed contract with PetroSaudi to promote it to Chinese leaders. The firm, founded by senior member of Saudi royal family, proposed fees of £41,000 and a 2% commission on any successful deals he brokered. In turn the Saudi oil firm was told it was not allowed to disclose Blair's role. It is the first time a detailed contract by his office has been disclosed. Revelations may bring fresh criticism to his role as Middle East peace envoy. Blair's office maintains work with firm had 'nothing to do with Middle East'

cnn_dailymail

en

Write a title and summarize: The vector-borne disease leishmaniasis is transmitted to humans by infected female sand flies, which transmits Leishmania parasites together with saliva during blood feeding. In Iran, cutaneous leishmaniasis (CL) is caused by Leishmania (L.) major and L. tropica, and their main vectors are Phlebotomus (Ph.) papatasi and Ph. sergenti, respectively. Previous studies have demonstrated that mice immunized with the salivary gland homogenate (SGH) of Ph. papatasi or subjected to bites from uninfected sand flies are protected against L. major infection. In this work we tested the immune response in BALB/c mice to 14 different plasmids coding for the most abundant salivary proteins of Ph. sergenti. The plasmid coding for the salivary protein PsSP9 induced a DTH response in the presence of a significant increase of IFN-γ expression in draining lymph nodes (dLN) as compared to control plasmid and no detectable PsSP9 antibody response. Animals immunized with whole Ph. sergenti SGH developed only a saliva-specific antibody response and no DTH response. Mice immunized with whole Ph. sergenti saliva and challenged intradermally with L. tropica plus Ph. sergenti SGH in their ears, exhibited no protective effect. In contrast, PsSP9-immunized mice showed protection against L. tropica infection resulting in a reduction in nodule size, disease burden and parasite burden compared to controls. Two months post infection, protection was associated with a significant increase in the ratio of IFN-γ to IL-5 expression in the dLN compared to controls. This study demonstrates that while immunity to the whole Ph. sergenti saliva does not induce a protective response against cutaneous leishmaniasis in BALB/c mice, PsSP9, a member of the PpSP15 family of Ph. sergenti salivary proteins, provides protection against L. tropica infection. These results suggest that this family of proteins in Ph. sergenti, Ph. duboscqi and Ph. papatasi may have similar immunogenic and protective properties against different Leishmania species. Indeed, this anti-saliva immunity may act as an adjuvant to accelerate the cell-mediated immune response to co-administered Leishmania antigens, or even cause the activation of infected macrophages to remove parasites more efficiently. These findings highlight the idea of applying arthropod saliva components in vaccination approaches for diseases caused by vector-borne pathogens. As a vector-borne parasitic and tropical disease, leishmaniasis has been reported in 98 countries (in 4 continents) with an annual incidence level of 0. 9–1. 6 million individuals, and 350 million individuals are at the risk of this infection [1,2]. The Leishmania parasite, as the causative agent of this disease, is delivered to the host during blood-feeding by infected female sand flies, namely, the Phlebotomus species in the Old World (Asia, Africa and Europe) and the Lutzomyia species in the New World (Central and South America). Various clinical symptoms, in visceral, mucocutaneus and cutaneous forms have been reported for leishmaniasis. The most commonly observed type of this disease is CL, which results in ulcers and permanent scars on the affected regions of the body and serious disabilities for the patient. Clinical forms of leishmaniasis are geographically distributed depending on the availability of the pathogenic species of Leishmania and their vectors. For example, CL has been mainly observed in Afghanistan, Brazil, Iran, Iraq and Syrian Arab Republic [1]. The fact that infection with certain species, including L. major or exposure to live Leishmania (leishmanization) results in long-term protection, in addition to the high costs of current treatments, drug toxicity and parasite resistance emergence intensify the need for producing a vaccine for this disease [3–5]. However, despite numerous investigations, no human vaccine for Leishmania is yet available [6]. Studies on development of Leishmania vaccines have focused on Leishmania antigens. In the past two decades, researchers started to examine sand fly salivary proteins [7], which are transmitted along with the parasite during blood feeding, as an alternative or a component of a vaccine against leishmaniasis. Different molecules are present in sand fly saliva which alter the hemostatic, inflammatory and immune response of the host, thereby facilitating parasite infection [8]. Simultaneous inoculation of Leishmania parasite and sand fly saliva has been reported to increase the parasite burden and cause exacerbation of the generated lesions [7,9–12]. However, immunization of animals with salivary components [13–15] or salivary gland homogenate (SGH) [12,16,17] from sand flies or exposing them to the bites of uninfected sand flies [18–25] resulted in protection against infection with Leishmania [26]. A cell-mediated immune response (CIR), as a form of a DTH response to sand fly salivary proteins, was shown to provide protection against Leishmania infection. This anti-salivary immunity appears to be important, considering that the parasite is unavoidably naturally injected along with salivary proteins into the biting site. Hence, similar to an adjuvant, a Th1 anti-saliva immunity can accelerate the induction of a protective Th1 immunity against Leishmania [27]. In Iran, zoonotic CL is caused by L. major, which is usually transmitted by the Ph. papatasi vector. On the other hand, anthroponotic CL is caused by L. tropica mainly transmitted by the Ph. sergenti sand fly [28]. According to the literature, exposing mice to the bites of uninfected sand flies or immunizing them with Ph. papatasi SGH can protect them against L. major infection caused by needle inoculation [7] or the bites of infected sand flies [13]. Immunization with PpSP15, a salivary protein from Ph. papatasi, provides protection in mice against L. major infection [20,21,29,30]. The immunity induced by Ph. sergenti salivary proteins and their effects on L. tropica infection have not been previously reported. Therefore, in this work, the immunogenicity of Ph. sergenti salivary components were assessed and we tested whether immunizing BALB/c mice with Ph. sergenti SGH or DNA plasmids coding for Ph. sergenti salivary proteins can lead to an appropriate immunity to control L. tropica infection. Apyrogenic deionized water (Milli-Q System, Millipore, Molshem, France) was used to prepare all needed solutions. The Endo-Free Plasmid Mega kit, RNeasy Mini Kit, Quanti Nova SYBR Green Master Mix and Anti-His antibody were purchased from QIAGEN, Germany. TRIzol Reagent and SuperScript III First-Strand Synthesis system were from Thermo Fisher Scientific (Invitrogen Company, USA). The materials needed for PCR reaction, agarose gel electrophoresis and enzymatic digestion were all provided by Roche Applied Sciences, Germany. Diaminobenzidine (DAB) powder, Bovine Serum Albumin (BSA) and acrylamide were provided by Merck, Germany. Horseradish peroxidase-conjugated goat anti-mouse IgG, Urea, Ponceau-S, Sodium dodecyl sulfate (SDS), Tris-base, Tris-HCL, M199 medium, RPMI-1640, DMEM, gentamicin, kanamycin, L-glutamine, hemin, HEPES, adenosine and Ficoll-400 were purchased from Sigma, Germany. Fetal Calf Serum (FCS) and Schneider insect media were provided by Gibco (Life Technologies, Germany). Goat anti-mouse IgG1-HPR and IgG2-HPR were obtained from Southern Biotech, Canada. Peroxidase Substrate System as an ELISA substrate was from KPL (ABTS, USA). Linear Polyethylenimine was purchased from Polyscience, Germany. Protran Nitrocellulose Transfer Membranes was from Schleicher & Schuell BioScience, Germany. GF-1 Tissue DNA Extraction Kit was purchased from Vivantis Technologies, Malaysia. The Agilent RNA 6000 Nano reagent kit were purchased from Agilent Technologies, USA. The Agilent 2100 Bioanalyzer instrument (Agilent Technologies, USA), ELISA reader (Tecan, USA), NanoDrop (Nanodrop, ND-1000, USA) and Speed Vac (Thermo Scientific, USA) devices were also used in this investigation. Ph. sergenti were kept in the insectary at the Laboratory of Malaria and Vector Research, National Institutes of Health, NIH (Rockville, MD, USA). The salivary glands were dissected from 5- to 7-day-old and non-blood fed female sand flies and then transferred to PBS for subsequent storage at −70 °C. After disruption by ultra-sonication and centrifugation, the produced supernatant was collected and dried in a Speed Vac device and reconstituted before use. Female BALB/c mice, (6–8 weeks old) with weight range of 18–20 g were obtained from Pasteur Institute of Iran. The animals under investigation were maintained, handled, anesthetized and euthanized under the approval of Institutional Animal Care and Research Advisory Committee of Pasteur Institute of Iran (ethical code: IR. RII. REC. 1394. 0201. 6417, dated 2015). All experiments were designed and carried out according to the Specific National Ethical Guidelines for Biochemical Research (2005) by the Research and Technology Deputy of Ministry of Health and Medicinal Education (MOHM) of Iran. Mice were euthanized through cervical dislocation method. Animals were anesthetized via intraperitoneal (i. p.) administration of Xylazine/Ketamine anesthetizing cocktail [31] in order to minimize suffering animals under investigation. The mammalian codon optimized nucleotides encoding the N-terminus to the stop codon of the most abundant secreted proteins from Ph. sergenti salivary gland proteins were cloned in a modified mammalian expression plasmid (VR1020-TOPO) through T/A cloning strategy and topoisomerase technology and then transformed into the DH5α strain. The VR1020-TOPO plasmid has features such as a CMV promoter, the signal-secretory peptide of tissue plasminogen activator (TPA), replacing the sand fly specific-secretory signal peptide and a 6×His-tag, downstream from the target insert. This modified vector enables efficient production of the secreted proteins in animal tissues and other mammalian-based expression systems. The fourteen cloned transcripts used in this study are PsSP7 (HM560864, D7-related proteins), PsSP9 (HM569364, PpSP15-like protein), PsSP14 (HM560870, PpSP15-like protein), PsSP15 (HM560868, PpSP15-like protein), PsSP20 (HM560866, yellow-related proteins), PsSP26 (HM569362, yellow-related proteins), PsSP40 (HM560860, apyrase), PsSP41 (HM560862, apyrase), PsSP42 (HM560861, apyrase), PsSP44 (HM569368, PpSP32-like protein), PsSP52 (HM537134, antigen 5-related proteins), PsSP54 (HM569365, PpSP15-like protein), PsSP73 (HM569367, unknown), and PsSP98 (HM569366, unknown). In order to purify all recombinant plasmids and the empty control plasmid (VR1020), an Endo-Free Plasmid Mega kit was used according to the manufacturer’s protocol. In order to confirm the expression of the 14 plasmids harboring each Ph. sergenti salivary protein, COS-7 cells (ATCC CRL-1651) were used as an expression host. Briefly, COS-7 cells were cultured in six-well plates (Greiner) in complete RPMI medium supplemented with 10% FCS at 37 °C in the presence of 5% CO2. For cell transfection, we used PEI/DNA complexes, prepared through mixing Linear Polyethylenimine (LINPEI, MW = 25 kDa, 10 μM) and 5 μg of each recombinant plasmid or VR1020 (as the control) [32]. Expression of Ph. sergenti salivary proteins in transfected COS-7 cells were confirmed by western blot analysis. In brief, forty eight hours after transfection, the supernatant of transfected COS-7 cells were harvested, then mixed with SDS-PAGE sample buffer and boiled for 5 min, and run on a 12. 5% or 15% SDS-PAGE gel. Proteins were then transferred from gel to nitrocellulose membranes by electro-blotting. Free binding sites on nitrocellulose membrane were blocked with blocking solution (PBS with 0. 05% Tween 20 and 2. 5% BSA) for 2 hours. After three washes, the membrane was incubated with HRP-conjugated goat anti-mouse IgG (1: 2000) for 2 hours at room temperature and visualized using the 3,30-diaminobenzidine substrate (DAB). In order to assess the immunogenic characteristics of DNA plasmids coding for Ph. sergenti salivary proteins, 6–8 weeks old BALB/c mice (6 mice in each experimental group) were i. d. immunized three times at two-week intervals using 30-gauge needle in the right ear. For this purpose, we used 10 μg of plasmid (either the empty plasmid control or a recombinant plasmid encoding a Ph. sergenti salivary protein), an equivalent of 0. 5 Ph. sergenti salivary gland pair or PBS; all in a total volume of ~10 μl with PBS. ELISA microplates were coated with 100 μl of SGH diluted to two pairs of SGHs/ml in coating buffer (Na2CO3 0. 02 M, NaHCO3 0. 45 M, pH 9. 6) overnight at 4 °C. Following rinsing with PBS-0. 05% Tween, wells were blocked using 100 μl of 1% BSA in PBS for 2 h at 37 °C. Wells were incubated for 3 h with sera from mice immunized with recombinant or control plasmids obtained two weeks after the last immunization and diluted (1: 50) in PBS-0. 05% Tween-1% BSA. After one more washing step, wells were incubated with Horseradish peroxidase-conjugate goat anti-mouse IgG diluted (1: 5000) in PBS-0. 05% Tween-1% BSA for 2 h at 37 °C. Following another washing step, plates were incubated with Peroxidase Substrate System (KPL) as the substrate for 30 min at 37 °C. After stopping the reactions with 1% SDS, the absorbance was measured at 405 nm using an ELISA reader. The cut off value was determined by measuring anti-saliva IgG of plasmid control mice group (mean + 3 SD). Two weeks after the last step of immunization, the animals were inoculated i. d. into the left ear dermis with Ph. sergenti SGH (0. 5 salivary gland pair per mouse) using a 30-gauge needle. Forty eight hours later, we measured ear thickness (DTH response) using a digital caliper (with a resolution of 0. 01 mm). For histopathological assessment at this time point, after fixing the dissected ears in 10% phosphate-buffered formalin, they were processed, embedded in paraffin, and then the 5-μm sections prepared by microtome were stained using hematoxylin and eosin (H & E) and analyzed using light microscopy. For morphometric analyses, inflammatory cells were counted in three fields/section using a 400× magnification, covering a total area of 710 mm2. After screening the Th1 DTH response in BALB/c mice which was triggered by the saliva proteins of Ph. Sergenti, the animals (10 mice per group) were immunized three times with two-week intervals using the selected plasmid encoding Ph. sergenti salivary protein, SGH, empty plasmid or PBS in the right ear using a 30-gauge needle. Two weeks after the last immunization, animals were challenged i. d. into the left ear dermis with 107 metacyclic L. tropica parasites plus Ph. sergenti SGH (0. 5 salivary gland pair) using a 30-gauge needle in an almost 10 μl total volume. The L. tropica parasite named as MOHM/IR/09/Khamesipour-Mashhad was isolated from patient in city of Mashhad, Iran, in 2009 (provided as gift by Dr. Ali Khamesipour). L. tropica promastigotes were cultured in M199 medium supplemented with 10% hi-FCS. The Ficoll-400 step-gradient was used to isolate the L. tropica metacyclic promastigotes [33]. To mimic the natural model of infection and examine whether immunity to the salivary proteins of the sand fly can protect the animals against CL, mice were infected by injection of parasites together with Ph. sergenti SGH into their ear dermis. The ear thickness was monitored and measured weekly using a digital caliper. To measure the disease burden (area under the curves, AUC), the ear thickness of each individual immunized mouse was recorded once per week. A disease course curve for each mouse in the experimental and control groups was separately obtained. Prism (GraphPad Software) was used to calculate AUC. Cytokine profiles were analyzed at two time points: once after Ph. sergenti SGH inoculation (to screen the Th1 DTH response against each DNA plasmid), and once after infectious challenge with L. tropica plus Ph. sergenti SGH. For this purpose, total RNA was extracted from the mouse dLN using TRIzol reagent and then RNeasy Mini Kit. The quality of extracted RNA was confirmed using an Agilent RNA 6000 Nano reagent kit. For first-strand cDNA synthesis, approximately 2 μg of RNA reverse-transcribed in a total volume of 20 μl using SuperScript III reverse transcriptase according to the manufacturer’s instructions. For quantification of gene expression, the 1: 10 diluted cDNA was subjected to the reaction containing 5 pmol of each forward and reverse primer and 12. 5 μl Quanti Nova SYBR Green Master Mix in a 25 μl total volume. Real-time PCR reactions were performed in duplicates on an Applied Biosystems 7500 instrument. Thermal cycles with an initial incubation step at 95 °C for 5 min followed by 45 cycles at 95 °C for 10 s, at 60 °C for 15 s, and at 72 °C for 35 s. The mRNA levels of each target gene were normalized to that of HPRT. The results are shown in fold change compared to the PBS control. Gene expression was analyzed based on the comparative method. The cycle threshold (Ct) values for cytokines were normalized to the expression of HPRT based on the following formulation: ΔCt = Ct (target gene) −Ct (HPRT gene). We obtained the fold change using 2−ΔΔCt, in which ΔΔCt = ΔCt (test) −ΔCt (control) [34]. We used the following primers for real-time PCR: HPRT (Forward: 5′-GTCCCAGCGTCGTGATTAG-3′; Reverse: 5′-GAGCAAGTCTTTCAGTCCTGTC-3′); IFN-γ (Forward: 5′-TCTGAGACAATGAACGCTACAC-3′; Reverse: 5′-CTTCCACATCTATGCCACTTGAG-3′); IL-5 (Forward: 5′-TGACAAGCAATGAGACGATGAG-3′; Reverse: 5′-CTCCAATGCATAGCTGGTGA-3′). Quantification of the parasites in the infected ear of animals in different groups was performed using Real-time PCR at one and two months after challenge. After euthanizing animals in each group (5 mice per group) the genomic DNA was extracted from each infected ear using GF-1Tissue DNA Extraction Kit according to manufacturer’s instruction. DNA concentration was measured by a NanoDrop device. The following primer set was used to target a part of L. tropica kinetoplastid minicircle DNA: (KDNA1F: (5' -GGGTAGGGGCGTTCTGC-3' ) and KDNA1R (5' -TACACCAACCCCCAGTTTGC-3' ) ) [35,36]. The absolute copy number corresponding to the target sequence was measured on an Applied Biosystems 7500 real time PCR system. Standard L. tropica genomic DNA was used in 10-fold dilution corresponding to 2×108 to 2×101 parasites for drawing the standard curve. To quantify the parasites in tissues, 50 ng of DNA was applied to a reaction containing 5 pmol of each of the forward and reverse primers and 12. 5 μl of Quanti Nova SYBR Green Master Mix in a 25 μl total volume. The PCR program was as the following: at 95 °C for 5 min; 40 cycles at 95 °C for 10 s, at 60 °C for 15 s, and at 72 °C for 35 s. All reactions were performed in duplicate. We replicated each measurement twice and averaged the obtained results. Shapiro-Wilk test was used to check the distribution of DTH response, Antibody response, IFN-γ, IL-5 and ratio of IFN-γ to IL-5 mRNA expression in dLN as well as parasite burden and disease burden (area under the curves, AUC). Due to the non-normality of all data, non-parametric van der Waerden’s normal score test and Dunn’s multiple comparison tests were used to compare the distribution of these variables between experimental and control group. To assess the effect of variables on ear thickness, we used Linear Mixed Models for repeated measured data. The significant interaction between time and group factors implied that the experimental groups were changing with time, with different manners. A statistically significant interaction effect may indicate that the overall patterns of differences at the level of main effects are not likely to be consistent across all groups. The p values below 0. 05 were considered as significant. Statistical analyses were carried out using Stata (14. 0) (StataCorp. 2015. Stata Statistical Software: Release 14. College Station, TX: StataCorp LP) and R 3. 4. 3 (R Core Team (2017). R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria) using the Rfit, PMCMR, nparcomp and multcomp packages. Before screening the 14 different plasmids coding for Ph. sergenti salivary proteins in animals, we tested the protein expressions of these DNA constructs in COS-7 cells. The construct has a signal secretory peptide and we added to each transcript a histidine tag. We observed expression of protein in COS-7 cells from all plasmids (Fig 1). The 14 different DNA plasmids coding for Ph. sergenti salivary proteins were screened to select a plasmid that can induce a Th1 cellular immune response. We also compared these plasmids to Ph. sergenti salivary gland homogenate. The parameters for selection were 1) The presence of a distinct DTH response associated with mononuclear cell infiltration in the ear and 2) increased levels of IFN-γ and low levels of IL-5 expression in dLN in comparison with the empty plasmid control group. Surprisingly, immunization with the whole Ph. sergenti salivary gland homogenate (SGH) did not induce a detectable DTH response (Fig 2A). In contrast, seven plasmids induced a positive DTH and showed greater ear thickness than the control plasmid that produced a median of 0. 18 mm (Fig 2A). The median ranks of DTH responses were in the following descending order: PsSP40 (0. 26 mm), resulting in the greatest measurable response in animal skin; PsSP52 (0. 24 mm), PsSP44 (0. 23 mm), PsSP9 (0. 23 mm), PsSP26 (0. 22 mm), PsSP41 (0. 22 mm) and PsSP42 (0. 21 mm), as the smallest detectable levels. Groups immunized with PsSP40 (p <0. 01), PsSP52 (p <0. 01), PsSP9 (p <0. 01), PsSP44 (p <0. 01), PsSP26 (p <0. 01), PsSP41 (p = 0. 04) and PsSP42 (p = 0. 03) showed significantly higher DTH responses compared to the control plasmid (Fig 2A and S1 Table). Specific total IgG antibody responses against Ph. sergenti SGH in the sera of all groups was measured. In comparison with the control groups (PBS and VR1020), the Ph. sergenti SGH-immunized mice group produced higher levels of anti-saliva-IgG than the cut off value (median at OD405 nm = 0. 40, S1 Table and Fig 2B). Moreover, the group immunized with PsSP26-encoding plasmid had the highest level of total IgG antibody production against Ph. sergenti SGH in comparison with the control plasmid group (median at OD405 nm = 1. 53, p<0. 01). In addition, the two other groups encoding the PsSP7 and PsSP44 proteins also produced higher levels of total IgG than the cut off value (PsSP44 with median OD405 nm = 0. 30, p = 0. 04 and PsSP7 with median OD405 nm = 0. 45, p = 0. 07) as demonstrated in Fig 2B and S1 Table. Based on histological analysis 48 h after Ph. sergenti SGH injection in the ear dermis of plasmid-immunized animals, PsSP9- and PsSP40-immunized groups were characterized by a robust mononuclear infiltration mainly containing macrophages, lymphocytes and a lower number of neutrophils compared to the PBS- and plasmid- control groups (Fig 3). The number of inflammatory cells recruited in the Ph. sergenti SGH-immunized mice group was moderate and there were fewer cells than in the PsSP9- and PsSP40-immunized groups (Fig 3). Furthermore, the number of inflammatory cells recruited in PsSP41- and PsSP52-immunized mice was similar to that of Ph. sergenti SGH-immunized mice. No detectable increase in the number of inflammatory cells recruited in PsSP42-immunized mice was observed, compared to the PBS- and plasmid- control groups (Fig 3). Based on the outcome of the DTH response, the antibody response (as shown in Table 1) and histological analysis against various salivary proteins, PsSP9, PsSP40, PsSP41, PsSP42, and PsSP52 plasmids were selected for further evaluation of the cellular immune response in BALB/c mice. Forty-eight hours after Ph. sergenti SGH injection, mice immunized with the above-mentioned plasmids were euthanized and IFN-γ and IL-5 cytokine expression was evaluated in their dLN by Real-time PCR (Fig 4). PsSP9 immunized mice was the only group that induced a statistically significant increase in IFN-γ mRNA expression, compared to the control plasmid group (median of fold change = 22. 30, p = 0. 04, Fig 4A, S2 Table), and was the group exhibiting the lowest level of IL-5 (Fig 4B, S2 Table), which translated to the highest ratio of IFN-γ to IL-5 expression (median of fold change = 17. 12, p = 0. 16, Fig 4C, S2 Table). In PsSP52-, PsSP41- and PsSP42-immunized mice, IL-5 expression was significantly higher compared to the control plasmid group (p<0. 01 in PsSP52, p = 0. 01 in PsSP41 and p = 0. 03 in PsSP42, Fig 4B, S2 Table). Furthermore, neither the IFN-γ expression nor the ratio of IFN-γ/IL-5 expression in these groups was significantly different from the control plasmid group (Fig 4A and 4C, S2 Table). The data also revealed that there was no significant difference in terms of IL-5 and IFN-γ expression between the PsSP40-immunized mice and the control plasmid group (Fig 4A and 4B, S2 Table). The exact p values and median (Q1-Q3) for the six tested samples are presented in S2 and S3 Tables. Based on the findings that the PsSP9-immunized group induced a Th1 immune response, we examined whether immunization with DNA coding for PsSP9 salivary protein can lead to protection of animals against L. tropica infection. BALB/c mice were immunized intradermally in their ears three times (with two-week intervals) with either Ph. sergenti SGH, plasmid encoding a PsSP9 salivary protein, PBS, or empty plasmid. Two weeks after the last immunization, animals were challenged with metacyclic forms of L. tropica plus Ph. sergenti SGH. PsSP9-immunized mice had significantly smaller nodules, indicated by ear thickness measurements, compared to the control plasmid group which showed a significantly greater ear thickness (Fig 5A, S4 and S5 Tables). The disease burden was determined based on the area under the curves (AUC) as shown in Fig 5B. The data indicated that there was a significant reduction in the disease burden after PsSP9 immunization, in comparison with the plasmid control group (p = 0. 02, Fig 5B, S6 Table). One-month post-infection, the parasite load in the ear of PsSP9-immunized mice was significantly lower than the control plasmid group (7. 2×105 parasites in the control plasmid group and 1. 4×105 parasites in the PsSP9-immunized group, p = 0. 02, Fig 5C, S7 Table). At two months post challenge, the parasite load in the ear in PsSP9-immunized mice remained lower than that in the plasmid control mice group, but the difference was not statistically significant (1. 0×106 parasites in control plasmid group and 2. 7×105 parasites in PsSP9-immunized group, p = 0. 36, Fig 5D). The reduced parasite load correlated with the observed lower ear thicknesses in PsSP9-immunized mice. SGH-immunized mice showed no significant differences in ear thickness or disease burden compared to the control groups (Fig 5A and 5B, S4–S6 Tables). In addition, at one and two month post-infection, there were no statistically significant differences in the ear parasite burden in SGH-immunized mice compared with the control groups (Fig 5C and 5D, S7 Table). The cytokine profile expression in the dLN was assessed at one and two months post-challenge. At one-month post-challenge, no significant differences in IFN-γ and IL-5 expression levels or in the ratio of IFN-γ to IL-5 expression were observed in any of the groups (Fig 6A–6C, S8 Table). At two months post-infection, IFN-γ expression was higher in the dLN of PsSP9-immunized mice than in the control plasmid group, although the difference was not statistically significant (median of fold change = 13. 29, p = 0. 05, Fig 6D, S9 Table). At this time point, the expression of IL-5 in dLN of PsSP9-immunized mice was not different from that in the control plasmid group (Fig 6E, S9 Table). Importantly, a significant increase in the ratio of IFN-γ to IL-5 expression was observed in PsSP9-immunized mice compared with the control plasmid group (median of fold change = 17. 06, p = 0. 04, Fig 6F, S9 Table). Exact p values and median (Q1, Q3) for the 5 studied samples are presented in S4–S9 Tables. It has been previously reported that bites of Ph. papatasi [13] and Ph. duboscqi [15,24], as well as the injection of Ph. papatasi [7], Lu. longipalpis [17], and Lu. whitmani SGH [16], protected rodents against leishmaniasis, manifested by reduced lesion size and decreased parasite burden. Moreover, exposure to sand fly SGH has been reported to result in a DTH response which is associated with the enhanced production of IFN-γ and IL-12 [13,37] or a higher IFN-γ to IL-4 ratio [7]. The current study demonstrated that immunization with whole Ph. sergenti SGH did not confer protection against L. tropica infection. Indeed, the ear thickness, disease burden and parasite load in the Ph. sergenti SGH-immunized mice were similar to those of the mice in the control groups. The lack of protection in the Ph. sergenti SGH-immunized mice against infection correlates with a low ratio of IFN-γ to IL-5 production in the dLN during infection. The current results were similar to the findings of Moura et al., who reported that the immunization of BALB/c mice with Lu. intermedia SGH resulted in a non-protective Th2 immunity [38]. In contrast to whole SGH immunization, a single sand fly salivary protein was shown to influence the outcome of leishmaniasis. Moura et al. observed that DNA immunization with Lu. intermedia salivary protein Linb-11 resulted in an intense protective cell-mediated immunity against infection with L. braziliensis [23] in contrast to the whole Lu. intermedia saliva that exacerbated L. braziliensis infection [38]. The current results from our work also suggest that distinct Ph. sergenti salivary proteins induce different immune responses. Immunization with 14 plasmids coding for Ph. sergenti secreted salivary proteins resulted in the identification of 9 salivary proteins which produced either a positive DTH response, an antibody response, or both responses in BALB/c mice (Table 1). The triggering of a humoral immunity by such proteins is not necessary for anti-leishmaniasis protection. As demonstrated by Gomes et al., LJM19 was the only saliva protein that induced strong DTH in hamster without any detectable antibodies and DNA immunization with this plasmid protected the animal against VL [19]. Salivary proteins that result in a Th1 type cellular immune response can be considered as suitable candidate for producing an anti-leishmaniasis vaccine. In this study, the type of immune response generated by the protective plasmid PsSp9 was characterized by a DTH response with no detectable antibody response and a significantly high ratio of IFN-γ to IL-5 expression in the dLN compared to the control group. The current study reveals that DNA immunization with the Ph. sergenti salivary protein PsSP7 can induce an antibody response, but no detectable DTH response. Moreover, DNA immunization with PsSP41, PsSP42 and PsSP52 produced a DTH response but induced high IL-5 expression in the dLN after Ph. sergenti SGH inoculation. Therefore, DNA immunization with these proteins shifted the immune response to a Th2 type. Hence, application of such salivary proteins of Ph. sergenti (i. e. PsSP7, PsSP26, PsSP41, PsSP42, PsSP44 and PsSP52) may exacerbate L. tropica infection or cause no protective impact. Interestingly, DNA immunization with Ph. sergenti salivary protein PsSP9 (among the 14 tested Ph. sergenti salivary proteins) produced a DTH with high mononuclear infiltration in the ear, a high ratio of IFN-γ to IL-5 expression in the dLN and no detectable antibodies 48 h after Ph. sergenti SGH inoculation. Therefore, this protein directed the immunity toward a Th1 response and was chosen as a candidate for producing an experimental vaccine against L. tropica. The mice immunized with PsSP9 displayed a smaller ear thickness, lower disease burden, and a lower parasite load in the ear in addition to a high IFN-γ to IL-5 expression ratio in the dLN compared with the empty control plasmid group two months after challenge. The draining lymph node is a part of the immune system, where the induction of specific immunity against an antigen occurs and where effector cells migrate to the skin and contribute to protection [39]. The protection observed in the PsSP9-immunized mice against CL can be explained by the anti-PsSP9 immunity at the parasite transmission site in the ear dermis, which may facilitate direct parasite killing by macrophage activation through IFN-γ. In fact, IFN-γ acts to restrict Leishmania growth in macrophages of mice and humans as well as the progression of leishmaniasis [40]. Vinhas et al. [41] demonstrated that the peripheral blood mononuclear cells (PBMC) of individuals who were subjected to uninfected Lu. longipalpis sand fly bites, exhibited IFN-γ expression after SGH stimulation. The production of IFN-γ was also associated with L. chagasi parasite killing in a macrophage-lymphocyte autologous culture [41]. This implies that after PsSP9 DNA immunization, the effector cells (IFN-γ+) might have migrated to the site of L. tropica and Ph. sergenti SGH inoculation, activating the macrophages and causing parasite killing which led to smaller lesions and reduced parasite load. The presence of an immune response against PsSP9 at the site of the parasite plus SGH injection in the dermis of the ear may act as an adjuvant to accelerate the triggering of a proper host immune response against Leishmania. Macrophage activation induces inflammatory responses and prevents the growth of Leishmania [42] by increasing the production of ROS, antigen presentation and maturation of phagosome [43]. After taking the L. tropica parasite and transporting the antigen, macrophages and Langerhans cells migrate and then differentiate into the APCs within the LNs and trigger a DTH response by CD4 expressing T cells. According to the findings of Oliveira et al., the immune response caused by the salivary protein induces a protective immunity against Leishmania. The DNA immunization of mice with PpSP15 resulted in a Th1 immunity against L. major [20]. In the current study, it was also hypothesized that DNA immunization with PsSP9 may act similarly. Only two critical cytokines in the dLN of immunized mice were analyzed (i. e. IFN-γ and IL-5). Further investigation of early time points in the dLN and the ear skin at the site of parasite challenge are needed to determine precisely the contribution of anti-saliva immunity in direct parasite killing and its indirect role in accelerating the induction of immunity against Leishmania. It is noteworthy that as a PpSP15-like protein family member, the PsSP9 is related to a salivary protein (14 kDa) which has no structural or sequential homology to identified proteins in humans or other organisms. PsSP9 protein is closely similar to PpSP12 (70% identity), PdSP14 (69% identity), PpSP14 (51% identity) and PpSP15 (46% identity) salivary proteins. PpSP15 was the first salivary protein considered as a candidate for an anti-leishmaniasis vaccine [21]. Oliveira et al. showed that DNA immunization of mice with PpSP15 triggered a DTH response and induced high levels of IL-12 and IFN-γ expression 2h post exposure to Ph. papatasi bites [20,21]. This immune response was associated with the accelerated induction of an immunity and protection against Leishmania [20,21]. Recently, DNA immunization with PdSP15 from Ph. duboscqi salivary protein, as a member of the PpSP15 family, was demonstrated to protect non-human primates against L. major which was delivered through the bite of an infected sand fly [24]. Furthermore, PdSP15 has been reported to exhibit immunogenic characteristics in humans, considering that PdSP15 was recognized by PBMC and sera in individuals exposed to the bites of Ph. duboscqi [24]. In this regard, it is suggested that among different Ph. sergenti salivary proteins, PsSP9 would be a better inducer of a Th1 protective immune response in a mouse model. Further investigations are still required to assess the immunogenic characteristics of PsSP9 as a recombinant protein vaccine for mice and whether it exhibits immunogenicity in human subjects, so as to be nominated as a potential candidate or as a component of a human anti-leishmaniasis vaccine. In summary, the current study demonstrated that while the whole Ph. sergenti SGH did not induce any protective immune response against L. tropica infection, a particular salivary protein from Ph. sergenti, PsSP9, induced a powerful protection against L. tropica in BALB/c mice. These findings highlight the application of specific salivary proteins from sand flies in anti-leishmaniasis vaccination approaches, which would be improved when used in combination with a Leishmania antigen and/or another prophylactic agent.

Title: DNA plasmid coding for Phlebotomus sergenti salivary protein PsSP9, a member of the SP15 family of proteins, protects against Leishmania tropica Summary: Leishmaniasis is a vector-borne disease transmitted to humans by an infected sand fly bite, through which Leishmania parasites and saliva are co-delivered into the host skin. Despite the numerous studies performed in this area, no vaccine is yet available to control this neglected disease in humans. During the past two decades, saliva of sand flies has been tested for possible application as a vaccine against leishmaniasis. Exposure to specific salivary proteins or sand fly bites can induce a protective cell-mediated immunity. Immunization with Ph. papatasi saliva or recombinant PpSP15 has been previously reported to provide protection against L. major infection. In this study, the efficiency of immunization with Ph. sergenti saliva or plasmid coding for Ph. sergenti salivary proteins in protecting the BALB/c mice against L. tropica was explored. Here we show that although immunization with whole saliva induces a humoral response, this immune response is unable to protect mice against infection; in contrast, immunization with a plasmid coding for Ph. sergenti PsSP9 salivary protein induces a Th1 immune response characterized by a strong DTH response, no detectable antibody response, and a high expression ratio of IFN-γ to IL-5 in lymph nodes. The Th1 induced immunity in PsSP9-immunized mice correlates with the protection observed against infection with L. tropica, which was associated with a significant reduction in ear thickness and decrease in parasite load in the ear of protected animals in comparison to control group. Our data suggest that instead of using the whole sand fly salivary proteins, a more effective approach is the use of a single Ph. sergenti salivary protein.

lay_plos

en

Summarize: Gunmen have stormed a luxury hotel in the Malian capital of Bamako, iniating a nine-hour siege that may have left as many as 18 people dead. The Radisson Blu hotel, to the west of the centre of the city, is believed to have been “90 per cent full” when the two gunmen stormed the building. A security source told AFP the attack was unfolding “on the seventh floor, jihadists are firing in the corridor”. Additional reports from local media indicated an explosion may have been heard, with district residents reporting hearing on-going gunfire. Malian army commander Modibo Nama Traore told the Associated Press news agency as many as 10 gunmen were involved in the assault. Mr Traore also claimed the men shouted “Allah Akbar” before they fired on the guards and took hostages. A hotel spokesperson confirmed they were aware of the hostage situation, and that they believed 140 guests had been “locked inside” with around 30 members of staff. (CNN) Heavily armed gunmen on Friday fired indiscriminately at guests at a hotel hosting diplomats and others in Mali's capital, the maître d' told CNN. At least 21 people were killed in the attack in which an al Qaeda-affiliated group is taking partial responsibility. "These people started shooting. They were shooting at everybody without asking a single question. They were shooting at anything that moved," Tamba Couye said of the attack at the Radisson Blu Hotel in Bamako. One man did yell "Allahu akbar," said Couye, who was working in the restaurant where breakfast was underway. The attackers sounded like they were from northern Mali, he told "Erin Burnett OutFront." Couye said an attacker chased him from the hotel but he came back later to help because his instincts told him he needed to do so to save lives. Dozens of people were trapped in the building for hours, officials in the West African nation said, before Malian and U.N. security forces launched a counterattack and rushed guests away. Olivier Salgado, a spokesman for the United Nations peacekeeping mission in Mali, put the death toll at 21. At least six people injured in the attack have been hospitalized, Health Minister Marie Madeleine Togo told state broadcaster ORTM. JUST WATCHED Mali: Coups, clashes and terror Replay More Videos... MUST WATCH Mali: Coups, clashes and terror 01:49 Al Mourabitoun, an Islamist militant group, claimed it was jointly responsible for the attack, according to Mauritanian news agency Al Akhbar. The group announced it carried out the attack with al Qaeda in the Islamic Maghreb (AQIM), the news agency reported. Al Mourabitoun said the attack was carried out in retaliation for government aggression in northern Mali, Al Akhbar reported. The group also demanded the release of prisoners in France. Algerian jihadist and the leader of the group, Mokhtar Belmokhtar, is "probably" behind the attack, French Defense Minister Jean-Yves Le Drian said in an interview on France's TF1, but the French are not "entirely sure." Belmokhtar was the target of a June U.S. airstrike in Libya. Libyan officials said he had been killed but U.S. officials never confirmed his death publicly. Hotel was hosting peace negotiators The assault began about 7 a.m., when two or three attackers with AK-47 rifles exited at least one vehicle with diplomatic plates and entered the hotel with guns firing, Salgado said. The attack, Salgado said, came as the hotel hosted diplomatic delegations working on a peace process in the landlocked country, a former French colony that has been battling Islamist extremists with the help of U.N. and French forces. The Radisson chain said that as many as 170 people -- 140 guests and 30 employees -- had been there as the attack began. CNN Map Malian soldiers and U.N. troops had the hotel surrounded, a journalist for ORTM told CNN from the scene. Two security personnel were injured, Security Minister Salif Traore said on ORTM. "We're still hearing erratic gunfire," journalist Katarina Hoije told CNN from near the scene Friday afternoon. No group immediately claimed responsibility for the attack. The Radisson Blu Hotel is in an upscale neighborhood outside the center of Bamako, rising high above the dusty streets and surrounding houses. With 190 rooms and suites, it is known as a hub for international guests such as diplomats and businesspeople, and it is a 15-minute drive from Bamako-Senou International Airport. Mongi Hamdi, head of the U.N. mission in Mali, said the diplomats' meetings, which began Thursday, were a possible reason for the attack. "I think this attack has been perpetrated by negative forces, terrorists, who do not want to see peace in Mali," Hamdi said. U.S. President Barack Obama said Saturday that the United States is still accounting for Americans who may have been inside the hotel. Speaking in Malaysia, Obama said that thanks to the swift action of Malian and other security forces, lives were saved. He said the victims were "innocent people who had everything to live for." Mali's struggle for stability JUST WATCHED Witness describes scenes at Mali hotel attack Replay More Videos... MUST WATCH Witness describes scenes at Mali hotel attack 02:09 The hotel attack, and the diplomats' meeting, came in a country that has struggled with Islamist extremists, especially since 2012. Taking advantage of a chaotic situation after a military coup in March 2012, Islamist extremists with links to al Qaeda carved out a large portion of northern Mali for themselves. When the militants tried to push into the south, France, at the Malian government's request, sent thousands of troops in 2013. The ground and air campaign sent Islamist fighters who had seized the northern region fleeing into the vast desert. The United Nations then established a peacekeeping mission in Mali that year, hoping to keep the government secure enough to continue a peace process. Though military pressure largely drove Islamist militants from cities, they have regrouped in the desert areas, said J. Peter Pham, director of the Africa Center at the Washington-based Atlantic Council. "Unfortunately, this (hotel) is a likely target" because it is popular with international guests such as U.N. workers, Pham said. France sends paramilitary group JUST WATCHED U.N. official: Gunmen had diplomatic plates Replay More Videos... MUST WATCH U.N. official: Gunmen had diplomatic plates 02:56 France said it dispatched to Mali an elite paramilitary group trained in hostage rescue and counterterrorism operations. President Francois Hollande, speaking to reporters in Paris, pledged to provide "necessary support" to help Mali resolve the situation. U.S. special operations forces were helping "move civilians to secured locations as Malian forces clear the hotel of hostile gunmen," said Lt. Cmdr. Anthony Falvo, a spokesman for U.S. Africa Command. The attack comes just a day after Hollande praised his troops for successfully fighting Islamists in the former French colony. It also comes a week after France suffered its own high-profile terror attack: Shootings and suicide bombings, claimed by the terror group ISIS, that killed 130 people in and near Paris 'I saw... bullets' Michael Skapoullis, who lives near the Radisson Blu, told CNN he was using the hotel's gym Friday morning when he noticed fellow exercisers leaving. He hadn't heard anything because he was listening to music, but he decided to follow. He walked to a door leading to the hotel lobby, and that's when he saw something was wrong. "When I opened the door, I saw, on the floor, bullets," Skapoullis said. "So I gently closed the door, and... I went back into the gym" and eventually left the complex. Another man who'd been in the hotel told ORTM that he heard gunshots that he initially thought were fireworks. "Then we heard the hotel alarm.... I walked out into the hallway, and I saw a lot of smoke," said the man, whom ORTM didn't name. "Then I went back into my room to stay there. "Later, the Malian forces came to get us.... Thank God we are now healthy and safe." Diplomats, airline employees were at hotel As news of the attack spread, media outlets and officials from a number of nations reported that some of their citizens were in the hotel or had been freed. A summary: • One U.S. citizen was killed, a senior State Department official told CNN. "We express our deepest condolences to the family and friends of the deceased.... Out of respect for the family, we have no further information at this time." Of Anita Datar, her brother Sanjeev Datar, said. "Everything she did in her life she did to help others -- as a mother, public health expert, daughter, sister and friend." • "About a dozen" Americans were rescued, U.S. State Department spokesman John Kirby said. • Geoffrey Dieudonne, an administrative counselor for Belgium's Parliament, died as a result of the attack, Parliament said. Details about his death weren't immediately clear; he was in Bamako as part of a three-day French-language convention. • Three Chinese nationals were killed, the political counselor at the Chinese Embassy in Bamako told media in his country. State-run CCTV reported that four other Chinese guests were rescued. • Seven Algerians, including six members of an Algerian diplomatic delegation, are safe after being trapped in the hotel, the state-run Algerie Presse Service reported. The Algerians were freed during a counterassault by U.N. and Malian forces. • Twenty Indian nationals, working for a Dubai-based company and staying at the hotel long-term, were safely evacuated, Vikas Swarup, a spokesman for India's Ministry of External Affairs, said on Twitter. • Twelve Air France crew members who were staying at the hotel were safely extracted, the airline tweeted. Air France has canceled all its flights to and from Bamako as a precaution, the airline said. • Turkish Airlines said at seven of its employees were staying at the hotel, and all had been freed by the afternoon. • Two German nationals were able to leave the hotel, Germany's Foreign Office said. August attack Friday's attack comes about three months after 12 people, including five Malian soldiers, were killed in a hostage situation and ensuing battle at a hotel in Sevare in central Mali in August. The soldiers stormed the hotel to end a daylong siege that started when gunmen raided the hotel after attacking a military site nearby, witnesses said. At the time, the Malian army said the attackers were affiliated with the Macina Liberation Movement. Human Rights Watch has described the group as Islamists who commit "serious abuses in the course of military operations against Mali's security forces."

Summary: Men shouting "God is great" and armed with guns and throwing grenades stormed into the Radisson Blu Hotel in Mali's capital Friday morning and initially seized 170 hostages. "They have locked in about 140 guests and about 30 employees," a rep for the company that owns the hotel told NBC News. Malian special forces reacted quickly, and were freeing hostages "floor by floor," army commander Modibo Nama Traore tells the AP. At least 30 had been freed, and Malian security forces were trying to make contact with the assailants, he said. The US Embassy in Mali asked citizens to shelter in place amid reports of an "ongoing active shooter operation" at the hotel in Bamako. People in the area ran for their lives along a dirt road as a soldier in full combat gear directed them to safety. The Malian commander says 10 gunmen stormed the hotel shouting "Allahu Akbar," or "God is great," in Arabic before firing on the guards and taking hostages. A United Nations official tells CNN that two Malian nationals and a French citizen have been killed. The Independent puts the number of dead at five and reports that the gunmen have been releasing hostages who are able to recite verses from the Koran. Hotel guests include an Air France team and a group of UN staff members, some of whom were rescued by special forces, CNN reports.

multi_news

en

Summarize: Portia de Rossi says it's the diet in Arrested Development, not the knife Arrested Development Season 4 Trailer Critically acclaimed series Arrested Development is back for it's much-awaited fourth season. PORTIA de Rossi has faced a fan backlash following the long-awaited arrival of new episodes of cult comedy Arrested Development, with devotees complaining the Aussie actress looks unrecognisable and accusing her of having plastic surgery. A number of US media outlets have cited doctors saying she appears to have had a nose job, sparked by comments of viewers on Twitter. The former Ally McBeal star told People that it has been seven years since Arrested Development was last on screen, and credited her vegan diet for her youthful appearance. "As women we're so conditioned to think that beauty and age are very important - that you stay kind of youthful in order to be beautiful," she said. "I don't think it's fair for people to think that women are just vain because they're worried about getting older. It's actually really linked in with a lot of very primitive stuff for women." It seems like everyone who binged on Arrested Development's Season 4 the moment it hit Netflix (i.e. the entire Internet) has been sipping on some hot ham water and talking about how different Portia De Rossi's face looks on the show. As is often the case in these situations, plastic surgeons were called upon to scrutinize Lindsay Bluth's dome: they speculate that she's had rhinoplasty, a coronal brow lift, eyelid surgery, various lipo "fillers," Botox, and a partridge in a pear tree. It's kind of interesting that nobody seems to be considering that de Rossi was made up to look like she had work done, especially since Buzzfeed ran a shot of a natural-looking de Rossi just a few months back. Lindsay's plastic surgery is something that's been repeatedly referenced on AD — it's easy to imagine she'd get work done in the seven years since the show's final Fox season, and it's just the kind of subtle joke Mitch Hurwitz and co. would let go unmentioned. [The Daily Beast, lede image via Buzzfeed] Just when we thought America was finally done with Farrah Abraham, she's still throwing shade at her co-star in the very private sex tape she made for her grandkids someday — the very private, never-has-sex-on-camera-for-money James Deen. “He was gentle because I made him be gentle, but I think in life he has more of an anger issue which makes him not so gentle,” Farrah said of James. “I’m OK with my choice of having my one and only video with James. Now that I know him more, I would never do it with him again and I’m not interested in any other public figures in entertainment to get physical with, but wish them all the best on their love life.” [Radar Online] GIF Beyonce's reaction to Kelly Rowland's "Dirty Laundry," which airs just that, will leave you a little teary if u r humanz: "[Beyonce] was just like, 'I never left. Which was so sweet. It was endearing. She heard how real I was and she was just like 'I'm so proud of you.'" [Us Weekly] In case you didn't watch the last episode of What Would Ryan Lochte Do (I DON'T FORGIVE YOU): Sex Idiot got dumped by his girlfriend of four years via phone, now has something in common with Taylor Swift besides possessing the sparkly heart of the truly optimistic. Video at the link. [NYDN] Ever since Season 4 of Arrested Development premiered on Netflix last week, many viewers have been scratching their heads — and not just about the new recurring ostrich motif. Portia de Rossi, who reprised her role as "activist" Lindsay Bluth-Funke, looks vastly different on screen than she does in more recent interviews and photos. The noticeable change in her appearance has led many viewers to wonder whether de Rossi had had plastic surgery. A painfully honest review of Arrested Development Season 4 But that's not the case, according to E! Online. "She's absolutely not had plastic surgery," a source tells the site. "Her character is clearly wearing a wig, which ended up altering her entire look." It seems to be a lot more than a wig that's different about Lindsay's look, but de Rossi and showrunner Mitch Hurwitz have yet to comment on the rumors. Some fans speculate that the jarring difference may have been intentional, to imply that the vain and self-absorbed Lindsay had a botched plastic surgery in the seven years between Seasons 3 and 4. Do you think de Rossi looks different in the new season of Arrested Development? Jason Kempin/Getty Images Contrary to a string of rumors suggesting otherwise, Portia De Rossi has not gone under the knife. Shortly after the 40-year-old actress reprised her role as Lindsay Bluth-Funke on Arrested Development's season four premiere, rumors sparked that she had some work done on her face. WATCH: Arrested Development sneak peek In spite of the plastic surgery chatter though, a source tells E! News those rumors are simply not true. "She's absolutely not had plastic surgery," the source said. "Her character is clearly wearing a wig, which ended up altering her entire look." De Rossi couldn't be happier with the way she looks, according to the source, who added, "It's no secret she credits her youthful look to her being a vegan for the last five years." PHOTOS: Inside Ellen DeGeneres and Portia de Rossi's gorgeous 26-acre ranch A rep for de Rossi could not be reached for comment. A rep for Mitch Hurwitz has not yet responded. The entire fourth season of Arrested Development hit Netflix May 26. PHOTOS: The best lines ever from Arrested Development!

Summary: Since the return of Arrested Development, fans have been wondering one thing: What happened to Portia de Rossi's face? Her character looks so different in the new episodes that speculation ran rampant de Rossi must have had some work done in the intervening years. No official word from the actress, but Australia's News Network points to an April People interview in which de Rossi says the vegan diet she's followed for the past five years has caused her face to look so youthful. Added the 40-year-old, "People do think I look younger than I am because I dress like a teenager." Need more convincing? An anonymous source tells E!, there's no way the buzz is true. "She's absolutely not had plastic surgery. Her character is clearly wearing a wig, which ended up altering her entire look." One other theory, by way of TV Guide: Maybe it's a subtle joke. "Some fans speculate that the jarring difference may have been intentional, to imply that the vain and self-absorbed Lindsay had a botched plastic surgery between Seasons 3 and 4," writes Liz Raftery.

multi_news

en

Summarize: By. John Hall. PUBLISHED:. 05:42 EST, 11 February 2014. |. UPDATED:. 12:21 EST, 11 February 2014. This is the shocking moment a police officer shot a dog dead because it wouldn't stop barking. Officer Tarek Hassani, of the Filer Police Department in Idaho, was filmed firing his gun at point blank range after being called to the scene of a nine-year-old's birthday party where dogs were said to be wandering in the street. The clip, filmed on the police patrol car's dashboard recorder, outraged the seven-year-old Labrador's owner who accused the officer of being 'trigger happy', but incredibly the local police force will take no action as they say the officer was left with 'no choice' but to kill the 'aggressive' dog. Shooting: Tarek Hassani, of the Filer Police Department in Idaho, was filmed firing his gun a point blank range after being called to reports of dogs wandering in the street. Death: After being shot at point blank range, the dog is seen twitching on the floor and yelping in agony, before shuffling out of shot and dying. Beloved: Mr Clubb's labrador was called Hooch. The incident took place at around 5.30pm on Saturday after officers were called to reports of number of dogs escaping from a home in the town of Filer during a child's birthday party. One of the dogs in question was a seven-year-old black Labrador named Hooch, who acted as a service dog for Parkinson's disease sufferer Rick Clubb. It was Mr Clubb's son who was celebrating his ninth birthday at the time. Within seconds of arriving at the scene, the police officer was greeted by the barking Labrador, a Chihuahua and another unidentified dog, although none appeared to be displaying a particularly high level of aggression until Officer Hassani began shouting 'get back' and kicked one of them. When the dogs began snarling and barking in a more threatening way, Officer Hassani was seen pulling out his gun and shooting the Labrador at point blank range. Working: The seven-year-old black Labrador named Hooch acted as a service dog for Parkinson's disease sufferer Rick Clubb. The dog is then seen twitching on the floor and yelping in agony, before shuffling out of shot and dying. The shooting subsequently led to a heated exchange between Officer Hassani and Mr Clubb, who was not just unhappy that his dog was dead, but also that the killing took place directly outside his son's bedroom window. Mr Clubb was later given a fine for allowing his dogs to run loose in the neighbourhood. Revealing that Officer Hassani would not be facing any punishment over the incident, Filer Police Chief Tim Reeves said: 'He had to kick one to keep him away... Hassani had no choice but to put the Lab down after it kept taking an aggressive posture behind him.'

Summary: Officer Tarek Hassani was filmed shooting the dog at point blank range. He had been called to reports of three loose dogs on a street in Filer, Idaho. They included a service Labrador named Hooch and a tiny Chihuahua. Dogs escaped from a nearby house during a child's ninth birthday party. Black Labrador was a working dog for Parkinson's sufferer Rick Clubb. Officer Hassani shot the dog dead when it wouldn't stop barking at him. But local police chief says Hassani was left 'no choice' but to kill Hooch.

cnn_dailymail

en

Summarize: FIELD AND BACKGROUND OF THE INVENTION This invention relates to a surface active material having a new chemical composition, a method of producing the same, and a pharmaceutical composition useable for the treatment of respiratory distress syndrome comprising the surface active material as active ingredient. Respitatory distress syndrome (hereinafter referred to as RDS) is a highly fatal disease which frequently occurs in premature infants born after approximately 28-36 weeks of gestation and in adult patients with septicemia, uremia, postoperative shock, or toxicosis due to inhalation of poisonous chemicals and the like. It has been demonstrated that the main cause of RDS is atelectasis caused by a deficiency of the so-called pulmonary surfactant (i.e., the material that reduces intra-alveaolar surface tension quickly and lastingly and thereby makes respiratory movement smooth) and the deficiency arises from immature lung function or basic diseases. As a substitute for such deficient pulmonary surfactant, a surface active material (hereinafter referred to as TA-546) comprising, in specific proportions, phospholipid, neutral fat, total cholesterol, carbohydrate and protein which are all obtained from the lung tissue of mammals has been disclosed in U.S. patent application Ser. No. 152048, filed May 21, 1980, now U.S. Pat. No. 4,338,301. SUMMARY OF THE INVENTION The present inventor has continued confirmatory studies on TA-546 and has found that it further contains less than 1.0% of free fatty acids in addition to the above-described components. This finding has led to the discovery that several important properties (i.e., surface tension-reducing capacity, spreadability over a liquid surface, and adsorbability to a gas-liquid interface) of TA-546 can be enhanced by increasing the relative amount or content of free fatty acids to 1.0-27.7% based on the total weight of TA-546. The present invention is concerned with the improvement of TA-546 on the basis of the above-described discovery, as well as the provision of a pharmaceutical composition useable in the treatment of RDS in adults and premature infants. According to one feature of the present invention, there is provided a surface active material comprising (1) phospholipid, neutral fat, total cholesterol, free fatty acids, carbohydrate, protein and water, all of which are obtained from the lung tissue of a mammal, and (2) optionally at least one additional component selected from the group consisting of a phosphatidylcholine, a neutral fat and a free fatty acid, characterized in that the overall phospholipid content is 68.6-90.7%, the overall neutral fat content is 0.3-13.0%, the total cholesterol content is 0.0-8.0%, the overall free fatty acid content is 1.0-27.7%, the carbohydrate content is 0.1-2.0%, the protein content is 0.0-3.5%, and the water content is 2.1-5.2%, all based on the dry weight of the material, the surface tension of the material as measured at 15°-25° C. by Wilhelmy&#39;s method in which the material is added dropwise to the surface of physiological saline in an amount of 0.3-0.8 μg per square centimeter of the surface area thereof being 30.1- 47.5 dynes/cm when the surface area is 54.0 cm 2. According to another feature of the present invention, there is provided a method of producing a surface active material as set forth above, which comprises the steps of (a) bringing the minced lung tissue of a mammal into contact with an electrolyte solution to obtain an extract; (b) centrifuging the extract to collect a crude sediment; (c) adjusting the specific gravity of an aqueous suspension of the crude sediment by the addition of sodium chloride and centrifuging the adjusted suspension to isolate a top layer comprising an emulsified scum layer; (d) dialyzing an aqueous suspension of the top layer and lyophilizing the dialyzed suspension to obtain a crude dry product; (e) bringing the crude dry product into contact with an acetic acid ester to collect a material insoluble in the acetic acid ester and then bringing the insoluble material into contact with an organic solvent mixture to obtain a purified filtrate; and (f) concentrating the purified filtrate to obtain a solid residue, optionally adding to the solid residue at least one additional component selected from the group consisting of phosphatidylcholines, neutral fats and free fatty acids, so as to provide an overall phospholipid content of 68.6-90.7%, an overall neutral fat content of 0.3-13.0%, and an overall free fatty acid content of 1.0-27.7%, all based on the dry weight of the final product, as well as an overall phosphatidylcholine content of 58.4-85.0% based on the total weight of phospholipid, and then lyophilizing the resulting mixture. According to still another feature of the present invention, there is provided a pharmaceutical composition useable for the treatment of RDS comprising an effective amount of a surface active material as set forth above and a pharmaceutically acceptable carrier thereof. For an understanding of the principles of the invention, reference is made to the following description of typical embodiments thereof as illustrated in the accompanying drawings. BRIEF DESCRIPTION OF THE DRAWINGS In the drawings: FIGS. 1 to 4 are diagrammatic illustrations of hysteresis curves showing the surface tension of physiological saline against the surface area thereof. FIG. 5 is an infrared absorption spectrum of the surface active material of the invention; and FIG. 6 is an ultraviolet absorption spectrum of the surface active material of the invention. DESCRIPTION OF THE PREFERRED EMBODIMENTS FIGS. 1 to 4 diagrammatically illustrate hysteresis curves recorded by measuring the surface tension of physiological saline with an Acoma Wilhelmy surface tension balance (Acoma Igaku Kogyo Co., Ltd.) and plotting the measured data with an X-Y recorder (Model F-3D; Riken Denshi Co., Ltd.). In each figure, the shaded portion indicates the region into which the recorded hysteresis curves fall, and the bold solid line represents an exemplary hysteresis curve. In FIGS. 1 and 2, measurements were made at 15°-25° C. after the surface active material of the invention and TA-546, respectively, were added dropwise to the surface of physiological saline in an amount of 0.3-0.8 μg per square centimeter of the surface area. In FIGS. 3 and 4, measurements were made at 37° C. after the material of the invention and TA-546, respectively, were added dropwise to the surface of physiological saline in an amount of 1.0-2.0 μg per square centimeter of the surface area. In these figures, the surface tension is plotted as ordinate and the surface area expressed in percentage of the maximum surface area (54.0 cm 2 ) as abscissa. FIG. 5 is an infrared absorption spectrum of the material of the invention as measured in a KBr tablet. FIG. 6 is an ultraviolet absorption spectrum of the material of the invention as measured in a 0.1% (w/v) solution in cyclohexane-ethanol (with a volume ratio of 1:1). The chemical composition, physicochemical properties and pharmacological properties of the surface active material provided by the present invention are described in detail below. For purposes of comparison, the data on TA-546 are also given which have been disclosed in the aforementioned U.S. patent application or were obtained in the above-described confirmatory studies. [I] Chemical Composition The surface active material of the invention comprises those specific components (i.e., phospholipid, neutral fat, total cholesterol, free fatty acids, carbohydrate and protein) which are obtained from the lung tissue of mammals such as cattle, horses, sheep, and pigs. Table I shows the contents (in percent by weight) of the above-enumerated components (including acylglycerols constituting the neutral fat as well as free and esterified cholesterols constituting the total cholesterol) based on the total dry weight of the material, the contents (in percent by weight) of phospholipid constituents based on the total weight of phospholipid, and the content (in percent by weight) of phosphatidylcholine having two saturated fatty acid residues based on the total weight of phosphatidylcholine. The phospholipid content was estimated by measuring its phosphorus content according to a procedure based on the method of King et al. (Biochemical Journal, 26, 292, 1932) and then multiplying the measured value by 25. The carbohydrate content was measured according to a procedure based on the phenol-sulfuric acid method (Analytical Chemistry, 28, 350, 1956) and expressed in terms of glucose. The protein content was measured according to a procedure based on the method of Lowry et al. (Journal of Biological Chemistry, 193, 265, 1956) and expressed in terms of bovine serum albumin. The water content was measured according to Karl Fischer&#39;s method. The chemical composition of the phospholipid comprised in the material was analyzed as follows: The constitutes of the phospholipid were separated by two-dimensional thin-layer chromatography using a 20 cm×20 cm thin layer of silica gel 60 (0.25 mm in thickness; manufactured by Merck Co.). Then, each fraction was taken and estimated by a modification of the above-described procedure for the measurement of phospholipid content. Two-dimensional development was carried out with chloroform-methyl alcohol-water (in the volume ratio of 65:25:4) as the first solvent and chloroform-methyl alcohol-7 N aqueous ammonia (in the volume ratio of 230:90:15), and the spots were made visible with iodine. The content of phosphatidylcholine having two saturated fatty acid residues was measured as follows: Using the method of shimojo et al. (Journal of Lipid Research, 15, 525, 1974), the constituents of the phosphatidylcholine comprised in the material were separated according to the type of fatty acid residues. Then, the fraction containing phosphatidylcholine having two saturated fatty acid residues was taken and estimated by a modification of the above-described procedure for the measurement of phospholipid content. In estimating the neutral fat, total cholesterol and free fatty acid contents, the surface active material of the invention was fractionated by thin-layer cromatography using a thin layer of Silica Gel 60 (0.25 mm in thickness, 5×20 cm in size; Merck Co.). Then, the fractions corresponding to each component were isolated and subjected to quantitative analysis. A mixture of petroleum ether and ether (in a volume ratio of 3:1) was used as the developing solvent, and iodine as the color developer. The neutral fat content was estimated by determining the fractionated mono-, di- and triacylglycerols according to the acetylscetone colorimetric method (Clinica Chimica Acta, 22, 393, 1968), expressing them in terms of mono-, di- and trioleoylglycerols, and then calculating the sum total thereof. The total cholesterol content was estimated by determining the fractionated free cholesterol and cholesterol esters according to the o-phthalaldehyde method (Analytical Biochemistry, 29, 143, 1969), expressing them in terms of free cholesterol and chlesterol palmitate, and then calculating the sum total thereof. The free fatty acid content was estimated by determining the fractionated free fatty acids according to the method of Itaya et al. (Journal of Lipid Research, 6, 16, 1965) and expressing them in terms of palmitic acid. TABLE I______________________________________ Surface active material of the invention TA-546______________________________________Composition of surface activematerialPhospholipid 68.6-90.7% 75.0-95.5%Neutral fat 0.3-13.0% 1.8-14.0% ##STR1## ##STR2## Total cholesterol 0.0-8.0% 0.0-3.0% ##STR3## ##STR4## Free fatty acids 1.0-27.7% (Less than 1.0%)Carbohydrate 0.1-2.0% 0.1-1.5%Protein 0.0-3.5% 0.5-5.0%Water 2.1-5.2% 1.7-6.0%Phospholipid constituentsPhosphatidylcholine 58.4-85.0% 63.0-85.5%Phosphatidylglycerol 0.1-12.0% 3.0-12.0%Phosphatidylethanolamine 3.5-12.6% 2.5-7.7%Sphingomyelin 3.2-12.1% 5.7-7.0%Phophatidylinositol 1.2-6.6% 2.4-7.4%Phosphatidylserine 1.0-6.4%Lysophosphatidycholine 0.1-2.9% 0.5-2.1%Others 0.0-5.0% 1.0% or lessContent of phosphatidylcholine 61.3-87.5% 67.5-90.3%having two saturated fatty acidresidues______________________________________ [II] Physicochemical Properties (i) Surface tension-reducing capacity The surface active material of the invention was added dropwise to the surface of physiological saline having a surface area of 54.0 cm 2, in an amount of 0.3-0.8 μg/cm 2 at a temperature of 15°-25° C. or 1.0-2.0 μg/cm 2 at a temperature of 37° C. Then, according to Wilhelmy&#39;s method, the surface tension of the physiological saline was continuously measured while its surface area was being decreased and then increased between 54.0 cm 2 and 21.6 cm 2 over a period of 2-5 minutes (FIGS. 1 and 3). The results thus obtained are shown in Table II. The surface tension of physiological saline alone was 72.0 dynes/cm at 15°-25° C. and 70.5 dynes/cm at 37° C. TABLE II______________________________________ Surface active mate- rial of the invention TA-546______________________________________Highest surface tension(dynes/cm)at 15-25° C. 30.1-47.5 48.2-58.0at 37° C. 21.0-35.6 32.3-47.5Lowest surface tension(dynes/cm)at 15-25° C. 1.5-10.3 2.1-8.6at 37° C. 1.8-12.0 2.0-12.2______________________________________ It can be seen from Table II that the material of the invention reduced the maximum surface tension of physiological saline by factors of 48.0 at a maximum and 1.5 at a minimum when measurements were made at 15°-25° C., and by factors of 39.2 at a maximum and 1.9 at a minimum when measurements were made at 37° C. (ii) Spreadability over a liquid surface The surface active material of the invention was added dropwise to the surface of physiological saline kept at 37° C., in an amount of 0.8-1.5 μg/cm 2 of surface area. As soon as the material was added, the change of its surface tension with time was measured according to the vertical plate method. The surface tension of physiological saline decreased from an initial value of 70.5 dynes/cm and, after 10 seconds, reached a constant value in the range of 18.0-35.1 dynes/cm. This indicates that, within only 10 seconds after addition of the material of the invention, a monomolecular film having great capacity for reducing surface tension was formed in the gas-liquid interface. In other words, the material of the invention spread very rapidly over the liquid surface. When the surface tension of physiological saline was measured in the same manner except that the material of the invention was replaced by TA-546, the time required for the surface tension to reach a constant value was as long as 120 seconds and the constant value was as high as 26.3-48.1 dynes/cm. (iii) Adsorbability to a gas-liquid interface A suspension containing 20-100 μg of the surface active material of the invention per ml of physiological saline and having no floating matter was prepared at 37° C. Thus, the adsorption rate of the suspended material to the gas-liquid interface was estimated according to the method of King et al. (American Journal of Physiology, 223, 715, 1972). Specifically, as soon as the suspension was prepared, the change of its surface tension with time was measured. The surface tension decreased from an initial value of 70.5 dynes/cm and, after 30 seconds, reached a constant value in the range of 16.8-39.9 dynes/cm. This indicates that, within 30 seconds after being suspended, the material of the invention rose and became adsorbed to the gas-liquid interface and formed a monomolecular film having strong surface activity. When the surface tension of a suspension was measured in the same manner except that the material of the invention was replaced by TA-546, the time required for the surface tension to reach a constant value was as long as 150 seconds and the constant value was as high as 33.2-55.0 dynes/cm. (iv) Optical activity When measured with an automatic polarimeter (Model DIP-180; Nihon Bunko Co., Ltd.), the specific rotatory power [α] D 26 of the material of the invention was found to be +2.0 to +7.2 (C=0.2 in benzene). (v) Solubility Aqueous suspensions of the material of the invention were found to be weakly acidic. The solubility of the material of the invention in various solvents is shown in Table III. Specifically, 10 mg of the material was added to 10 ml of each solvent and the resulting mixture was stirred for approximately 10 seconds. The solubility was expressed as positive (+) when the material dissolved visually, or as negative (-) when the material did not dissolve visually. TABLE III______________________________________Solvent Volume ratio Solubility______________________________________Chloroform +Benzene +Water -Methanol -Ethanol -Acetone -Ethyl acetate -Cyclohexane-ethanol 1:1 +Ethyl ether-ethanol 1:1 +Petroleum ether-ethanol 1:1 +Acetone-methanol 1:1 -Chloroform-methanol 2:1 +______________________________________ (vi) Absorption spectra Infrared and ultraviolet absorption spectra of the material of the invention are illustrated in FIGS. 2 and 3, respectively. [III] Pharmacological Properties (i) Acute toxicity The acute toxicity of the surface active material of the invention was tested by administering it orally or intraperitoneally to 5-weeks-old male ICR mice and Wistar rats. For mice, the oral and intraperitoneal LD 50 values were not less than 3.0 g/kg and not less than 2.0 g/kg, respectively. For rats, the oral and intraperitoneal LD 50 values were not less than 4.0 g/kg and not less than 2.5 g/kg, respectively. (ii) Subacute toxicity The surface active material of the invention was administered intraperitoneally to mature Wistar rats in a daily dose of 0.5 g/kg of body weight for a period of one month. No significant change in body weight was noted. Moreover, visual observation and histological examination revealed no abnormalities. (iii) Intra-alveaolar surface tension-reducing capacity (a) Alveolar volume-maintaining effect Using 7 rabbit fetuses removed after 27 days of gestation, the alveolar volume change at decreasing endotracheal pressures (hereinafter referred to as the PV curve) was measured. Specifically, the neck of each fetus was incised to expose the trachea, to which a water monometer was connected directly. Beginning at 5 minutes after treatment with the surface active material of the invention, the alveolar volume was measured continuously. The endotracheal pressures was varied by means of an independently-acting 2-channel syringe pump (No. 940; Harvard Inc.) connected to the trachea. The treatment with the material of the invention was carried out by preparing a 1.0-1.5% (w/v) suspension of the material in physiological saline and instilling 0.4-0.5 ml of the suspension directly into the trachea. These measuring conditions were substantially the same as those described in the aforementioned U.S. patent application. In a control group, measurements were made in the same manner except that the suspension of the material of the invention was replaced by physiological saline. The alveolar volume was expressed as the number of milliliters per kilogram of body weight. The results thus obtained are shown in Table IV. TABLE IV______________________________________ Alveolar volume (ml/kg) Group treated withEndotracheal the surface activepressure Control material of the Group treated(cmH.sub.2 O) group invention with TA-546______________________________________35 14 ± 5 72 ± 10 55 ± 225 12 ± 5 71 ± 11 49 ± 320 11 ± 4 70 ± 9 47 ± 315 10 ± 4 66 ± 9 44 ± 310 6 ± 3 58 ± 8 39 ± 4 5 2 ± 2 46 ± 10 25 ± 3 0 0 24 ± 9 17 ± 4______________________________________ (b) Intra-alveolar pressure-reducing effect Using 5 rabbit fetuses removed after 27 days of gestation and placed under artificial respiration, the endotracheal pressure required to maintain the ventilation volume per respiration at 10 ml/kg of body weight was measured with a respirometer (MFP-1100; Nihon Koden Co., Ltd.). This measurement was made 5 minutes after instilling into the airway 0.4 ml of a 1.0% (w/v) suspension of the surface active material of the invention in physiological saline. The value of endotracheal pressure obtained with the material of the invention was 8 cmH 2 O, while that obtained with TA-546 was 12 cmH 2 O. (iv) Respiratory function-improving capacity (a) Effects on RDS arising from septicemia The respiratory function-improving capacity of the surface active material of the invention was tested on mature rabbits suffering from septicemia which had been induced by intraperitoneal inoculation of Escherichia coli and further complicated by RDS. Specifically, 32 rabbits in the abovedescribed morbid state were divided into 4 groups including one control (or no-treatment) group. The other groups were treated with kanamycin sulfate alone, the material of the invention alone, and a combination of kanamycin sulfate and the material of the invention, respectively. Then, all groups were comparatively examined for the degree of improvement in respiratory function. The morbid rabbits were prepared and the degree of lung injury was evaluated according to the methods of Cuevas et al. (Archives of Surgery, 104, 319, 1972), and the circulating titer of endotoxin in blood was determined according to the method of Reinhold et al. (Proceedings of the Society for Experimental Biology and Medicine, 137, 334, 1971). The treatment with the material of the invention and/or kanamycin sulfate was carried out within 24 hours before and after the onset of RDS. The material of the invention was instilled 1-6 times into the airway in a dose of 50-100 mg/kg for each treatment, while 80-150 mg/kg of kanamycin sulfate was intramuscularly injected in 2-8 divided doses. Two days after treatment, the subjects were examined for survival and the degree of lung injury. The results thus obtained are shown in Table V. With regard to the animals that had died, the degree of lung injury observed immediately before their was employed. The degree of lung injury becomes severer as the value increases. TABLE V______________________________________ Subject Circulating Degree of Sur-Group No. titer (μg/ml) lung injury vival______________________________________Control group 1 3.00 3 No 2 0.10 3 No 3 0.20 2 No 4 0.10 3 No 5 1.00 1 No 6 1.00 3 No 7 0.40 3 No 8 0.40 2 NoGroup treated with 9 0.10 3 Nokanamycin sulfate 10 0.01 0 Yesalone 11 0.00 1 Yes 12 0.40 2 No 13 0.10 2 No 14 0.10 1 No 15 0.02 0 Yes 16 0.10 1 YesGroup treated with 17 0.02 0 Yesthe material of 18 0.10 3 Nothe invention alone 19 0.01 0 Yes 20 0.50 1 No 21 0.40 2 No 22 0.10 0 Yes 23 0.02 0 Yes 24 0.20 1 NoGroup treated with 25 0.01 1 Yeskanamycin sulfate 26 0.02 2 Yesand the material of 27 0.05 0 Yesthe invention 28 0.00 0 Yes 29 0.10 2 No 30 0.01 1 Yes 31 0.05 0 Yes 32 0.01 1 Yes______________________________________ It is evident from Table V that, when used alone, the material of the invention brought about a greater improvement in respiratory function than might have been expected. Moreover, the combined use of the material of the invention and kanamycin sulfate almost completely restored the respiratory function to normal. (b) Effects on a model for RDS in adult patients The respiratory function-improving power of the surface active material of the invention was tested on guinea pigs suffering from RDS experimentally induced by lavage of the lungs. Specifically, 16 guinea pigs in the above-described morbid state were divided into two groups. In one group, the animals were placed under respiratory management and allowed to stand for 6 hours. In the other group, the surface active material of the invention was administered to the animals 3 hours after the commencement of respiratory management. Thereafter, the animals were allowed to stand for an additional 3 hours. The animals of both groups were killed by exsanguination and used to measure their PV curves, which were compared with the PV curve measured separately with normal guinea pigs. The morbid guinea pigs were prepared and the respiratory management was done according to the methods of Lachmann et al. (Acta Anaesthesiologica Scandinavica, 24, 231, 1980), and the PV curves were measured in substantially the same manner as described above. The treatment with the material of the invention was carried out by preparing a 1.0% (w/v) suspension of the material in physiological saline and instilling the suspension into the airway in a dose of 60 mg/kg. The results thus obtained are shown in Table VI. TABLE VI______________________________________ Alveolar volume (ml/kg) Group treated withEndotracheal the surface activepressure Control material of the(cmH.sub.2 O) group invention Normal group______________________________________30 7.2 ± 3.3 17.2 ± 2.7 17.5 ± 3.125 6.8 ± 2.8 16.4 ± 2.5 16.3 ± 2.820 5.2 ± 2.1 15.8 ± 2.4 16.0 ± 2.715 4.6 ± 1.7 14.2 ± 2.2 14.4 ± 2.510 3.8 ± 1.6 13.8 ± 2.0 13.6 ± 2.0 5 1.5 ± 0.9 10.6 ± 1.8 10.2 ± 1.6 0 0 5.4 ± 1.2 5.2 ± 1.6______________________________________ It is evident from Table VI that the material of the invention almost completely restored the respiratory function to normal. Judging from the chemical composition, physicochemical properties and pharmacological properties described in detail above, pharmaceutical compositions comprising the surface active material of the invention can be regarded as markedly effective and quick-acting remedies for RDS. In the treatment of RDS, the pharmaceutical composition of the invention is used in such a dose as to provide 50-400 mg or 500-3,000 mg of the surface active material of the invention for premature infants or adults, respectively. This dose is administered by suspending it in water or an electrolyte solution such as physiological saline so as to give a concentration of 1.0-5.0% (w/v), and then instilling or spraying the resulting suspension into the airway of the patient. For premature infants, the treatment should be carried out within 72 hours after their birth, while for adult patients, within 120 hours before or after the onset of respiratory distubance. The number of treatments preferably ranges from 1 to 10. The above-described dosage, method of administration, and number of treatments may be modified depending on the symptoms of the patient and the concomitantly used remedies. For adult patients, it is desirable to use the pharmaceutical composition of the invention in combination with a suitable remedy for the basic disease. The pharmaceutical composition of the invention may contain suitable additives (e.g., stabilizers, preservatives, osmotic pressure regulators, buffering agents and/or suspending agents) and germicides as required. Preferably, the pharmaceutical composition of the invention is in the form of a liquid or a powder which is intended to be made into a suspension prior to use. The pharmaceutical composition of the invention is charged into hermetically sealed containers such as vials and ampules, and thereby stored aseptically. The method of producing the surface active material of the present invention is specifically described below with reference to a preferred embodiment thereof. (a) Lungs which have been excised from a mammal are cut into fist-sized lumps, free of unnecessary blood vessels, windpipes, fat bodies, blood and the like, and then minced finely with a meat grinder. The resulting lung mince is brought into contact with an electrolyte solution such as physiological saline. This contact is effected, with stirring, at 0°-20° C. for 15-120 minutes. The mixture so prepared was filtered under pressure to obtain an extract. As the mammal, cattle, horses, sheep or pigs are suitably used. It is more advantageous to use their sucklings. If desired, the lung mince may be lyophilized and stored until it is subjected to the extraction procedure. (b) The above extract is centrifuged at 8,000-20,000 r.p.m. at 0°-10° C. to collect a crude sediment. The unnecessary lung fragments remaining in this crude sediment are removed by re-suspending the crude sediment in an electrolyte solution such as physiological saline and centrifuging the resulting suspension at 500-2,000 r.p.m. (c) The crude sediment obtained as above is suspended in water. To the resulting suspension is added sodium chloride or the like so as to adjust its specific gravity to 1.10-1.20. The adjusted suspension is centrifuged at 5,000-13,000 r.p.m. at 0°-10° C. for 20-180 minutes to divide it into three layers, the top layer being an emulsified scum layer. This top layer is isolated and purified by re-suspending it in a 12.5-26.0% (w/v) aqueous sodium chloride solution and centrifuging the resulting suspension at a medium speed. If necessary, this purification procedure may be repeated several times. (d) The purified top layer is suspended in water and the resulting suspension is dialyzed at 4°-10° C. for 6-24 hours through a cellophane membrane against water. Thereafter, the dialyzed suspension is lyophilized to obtain a crude dry product. The dialysis is carried out for the purpose of removing the unnecessary inorganic salts and low-molecular water-soluble organic materials contained in the top layer. The purity of the crude dry product can be enhanced by resuspending the crude dry product in an electrolyte solution such as physiological saline, laying the resulting suspension on a 0.25-0.80 M sucrose solution, and centrifuging them at 22,000-50,000 r.p.m. at 0°-6° C. for 1-24 hours. However, this purification procedure is not essential to the method of the invention. (e) The above crude dry product is suspended in a cold acetic acid ester at a temperature of -10° to 10° C., the amount of acetic ester used being equal to 20-300 times the weight of the crude dry product. The resulting suspension is allowed to stand for 30-60 minutes. Thereafter, a material insoluble in the acetic acid ester is separated and dried. Then, this insoluble material is brought into an organic solvent mixture, the amount of organic solvent mixture used being equal to 20-200 times the weight of the insoluble material. The resulting mixture is allowed to stand for 10-20 minutes and then filtered to obtain purified filtrate. The treatment with an acetic acid ester serves to remove the total cholesterol remaining in excess, and the treatment with an organic solvent mixture serves to remove any unnecessary protein. Useful acetic acid esters include methyl acetate, ethyl acetate, propyl acetate and butyl acetate, and useful organic solvent mixtures include chloroform-methanol (with a volume ratio of 2:1), chloroform-ethanol (with a volume ratio of 2:1), chloroform-isopropanol (with a volume ratio of 2:1) and ether-ethanol (with a volume ratio of 1:3). The sterility of the purified filtrated thus obtained is confimed by testing it according to the procedure described in the Japanese Pharmacopoeia (9th edition), p. B-232. Thereafter, all subsequent operations are carried out under sterile conditions. (f) The above purified is washed for 1-24 hours with sterile water and then concentrated under reduced pressure to obtain a solid residue. Where the chemical composition of this solid residue falls within the range defined hereinabove, the solid residue is directly lyophilized to obtain a final product which is within the scope of the invention. However, it commonly happens that, in the chemical composition of the solid residue, the phospholipid content is less than 68.6%, the neutral fat content is less than 0.3%, and/or the free fatty acid content is less than 1.0%. Moreover, it may happen that, even if the phospholipid content is not less than 68.6%, the content of phosphatidylcholine as the main constituent thereof is less than 58.4% based on the total weight of phospholipid. Furthermore, both may be the case. In such circumstances, at least one additional component selected from the group consisting of a phosphatidylcholine, a neutral fat and a free fatty acid is added so as to make up for the deficient component or components and thereby provide an overall phospholipid content of 68.6-90.7%, an overall neutral fat content of 0.3-13.0%, and an overall free fatty acid content of 1.0-27.7%, all based on the total dry weight of the final product, as well as an overall phosphatidylcholine content of 58.4-85.0% based on the total weight of phospholipid. Thereafter, the resulting mixture is lyophilized to obtain a final product. The phosphatidylcholines, neutral fats and free fatty acids which can be used as additional components include both synthetic materials and materials extracted from animals or plants. Preferably, the phosphatidylcholine used as an additional component is dipalmitoylphosphatidylcholine; the neutral fat used as an additional component is a member selected from the group consisting of tripalmitoylglycerol, tristearoylglycerol, trioleoylglycerol and mixtures thereof; and the free fatty acid used as an additional component is a member selected from the group consisting of palmitic acid, stearic acid, oleic acid and mixtures thereof. Some examples of the pharmaceutical compositions prepared according to the present invention are given below. PHARMACEUTICAL COMPOSITION 1 One thousand mg of the surface active material of the present invention was accurately weighed out and charged into a 30-ml vial under sterile conditions according to a conventional powder filling technique, followed by sealing the vial with a metal-clamped rubber stopper. This vial was accompanied with 25 ml of sterile physiological saline in order to prepare a suspension therewith prior to use. PHARMACEUTICAL COMPOSITION 2 Sixty mg of the surface active material of the present invention was accurately weighed out and charged into a 10-ml ampule together with 6 ml of physiological saline. Then, the ampule was sealed under sterile conditions. The present invention is further illustrated by the following examples. Unless otherwise indicated, percentages are by weight. EXAMPLE 1 (a) Lungs (32.0 kg) excised from cattle were washed with water to remove any blood and other contaminants adhering thereto. Then, the lungs were cut into fist-sized lumps and freed of unnecessary blood vessels, windpipes and the like with the aid of scissors. These lumps were finely minced with a meat grinder to obtain 30 kg of lung mince. This lung mince was mixed with 120 liters of physiological saline. The resulting mixture was stirred under ice-cold conditions, placed in a filter bag, and filtered under pressure to obtain an extract. This procedure was repeated four times. The combined volume of the resulting extract was 130 liters. (b) The above extract was centrifuged at 8,000 r.p.m. at 4° C. for 1 hour to collect a crude sediment. This crude sediment was suspended in 20 liters of physiological saline and then centrifuged at 2,000 r.p.m. for 10 minutes to precipitate off any residual tissue fragments and the like. The suspension obtained as the top layer was centrifuged again at 8,000 r.p.m. to collect a crude sediment. This purification procedure was repeated three times. (c) The crude sediment obtained as above was suspended in 20 liters of water. To the resulting suspension was added 5.7 kg of sodium chloride so as to adjust its specific gravity to approximately 1.20. The adjusted suspension was centrifuged at 8,000 r.p.m. for 45 minutes to divide it into three layers, the top layer being an emulsified scum layer. This top layer was isolated and purified by re-suspending it in 10 liters of a 26.0% (w/v) aqueous sodium chloride solution and centrifuging the resulting suspension at 8,000 r.p.m. for 45 minutes. (d) The purified top layer was suspended in distilled water and the resulting suspension was dialyzed through a cellophane membrane against distilled water. Thereafter, the dialyzed suspension was lyophilized to obtain 220 g of crude dry product. (e) To this crude dry product was added 11 liters of cold ethyl acetate at 5° C. The resulting mixture was stirred for 30 minutes and then filtered under reduced pressure to separate an insoluble material. After this insoluble material was dried, 7 liters of an organic solvent mixture or chloroform-methanol (with a volume ratio of 2:1), was added thereto. The resulting mixture was stirred for 30 minutes and then filtered through filter paper to obtain a purified filtrate. To the filtration residue was added 7 liters of the same mixed solvent. The resulting mixture was stirred for 30 minutes and then filtered through filter paper to obtain a secondary purified filtrate. This procedure was repeated once more to obtain a tertiary purified filtrate. The combined volume of the purified filtrate thus obtained was 21 liters. When a sterility test was made on a small sample of this purified filtrate, it was found to be sterile. Accordingly, all subsequent operations were carried out under sterile conditions. (f) The above purified filtrate was concentrated under reduced pressure to obtain 37.0 g of solid residue. When a small sample of this solid residue was lyophilized and then analyzed, the solid residue was found to have a phopholipid content of 78.5%, a neutral fat content of 10.3%, and a free fatty acid content of 0.5%, all based on the total dry weight thereof, as well as a phosphatidylcholine content of 50.8% based on the total weight of phospholipid. Accordingly, 12.3 g of dipalmitoylphosphatidylcholine and 5.1 g of palmitic acid were added to the solid residue, and the resulting mixture was suspended in distilled water and then lyophilized to obtain a yield of 54.4 g of surface active material. On analysis, this material was found to have a chemical composition as shown in Table VII. EXAMPLE 2 The procedure of Example 1 was repeated except that the centrifugation of step (b) was carried out at 15,000 r.p.m. instead of 8,000 r.p.m. and the centrifugation of step (c) at 5,000 r.p.m. instead of 8,000 r.p.m. Thus, 44.2 g of solid residue was obtained in step (f). This solid residue had a phospholipid content of 86.3%, a neutral fat content of 0.1%, and a free fatty acid content of 0.8%, all based on the total dry weight thereof, as well as a phosphatidylcholine content of 55.8% based on the total weight of phospholipid. Accordingly, 28.1 g of dipalmitoylphosphatidylcholine, 1.2 g of tripalmitoylglycerol, 1.3 g of trioleoylglycerol, 6.4 g of palmitic acid, and 4.0 g of stearic acid were added to the solid residue, and the resulting mixture was lyophilized to obtain a yield of 85.2 g of surface active material. On analysis, this material was found to have a chemical composition as shown in Table VII. EXAMPLE 3 The procedure of Example 1 was repeated except that the centrifugation of step (b) was carried out at 18,000 r.p.m. instead of 8,000 r.p.m. and the centrifugation of step (c) at 12,000 r.p.m. instead of 8,000 r.p.m., the specific gravity of the crude sediment suspension prepared in step (c) was adjusted to 1.10 instead of 1.20, and the concentration of the aqueous sodium chloride solution used in step (c) was altered from 26.0% (w/v) to 13.0% (w/v). Thus, 24.0 g of solid residue was obtained in step (f). This solid residue had a phospholipid content of 92.8%, a neutral fat content of 0.2%, and a free fatty acid content of 1.5%, all based on the total dry weight thereof, as well as a phosphatidylcholine content of 57.9% based on the total weight of phospholipid. Accordingly, 11.0 g of dipalmitoyl phosphatidylcholine, 1.0 g of tripalmitoylglycerol, and 0.7 g of tristearoylglycerol were added to the solid residue, and the resulting mixture was suspended in distilled water and then lyophilized to obtain a yield of 36.7 g of surface active material. This material had a chemical composition as shown in Table VII. EXAMPLE 4 The procedure of Example 1 was repeated except that, in step (e), the 11 liters of ethyl acetate and 7 liters of chloroform-methanol (with a volume ratio of 2:1) were replaced by 15 liters of propyl acetate and 10 liters of chloroform-ethanol (with a volume ratio of 2:1), respectively. Thus, 32.8 g of solid residue was obtained in step (f). This solid residue had a phospholipid content of 72.8%, a neutral fat content of 10.5%, and a fatty acid content of 0.2%, all based on the total dry weight thereof, as well as a phosphatidylcholine content of 48.1% based on the total weight of phospholipid. Accordingly, 5.9 g of phosphatidylcholine, 2.1 g of palmitic acid, and 0.5 g of oleic acid were added to the solid residue, and the resulting mixture was suspended in distilled water and then lyophilized to obtain a yield of 41.3 g of surface active material. This material had a chemical composition as shown in Table VII. EXAMPLE 5 The procedure of Example 1 was repeated except that the centrifugation of step (b) was carried out at 20,000 r.p.m. instead of 8,000 r.p.m. and the 7 liters of chloroform-ethanol (with a volume ratio of 2:1) used in step (e) was replaced by 10 liters of ether-ethanol (with a volume ratio of 1:3). Thus, 28.3 g of solid residue was obtained in step (f). This solid residue had a phospholipid content of 85.5%, a neutral fat content of 0.1%, and a free fatty acid content of 0.6%, all based on the total weight thereof, as well as a phosphatidylcholine content of 54.2% based on the total weight of phospholipid. Accordingly, 8.9 g of phosphatidylcholine, 5.9 g of tristearoylglycerol, and 2.5 g of palmitic acid were added to the solid residue, and the resulting mixture was suspended in distilled water and then lyophilized to obtain a yield of 45.6 g of surface active material. This material had a chemical composition as shown in Table VII. EXAMPLE 6 The procedure of Example 1 was repeated except that 35.5 kg of lungs excised from horses were used in place of the 32.0 kg of lungs excised from cattle. Thus, 34.5 g of solid residue was obtained in step (f). This solid residue had a phospholipid content of 80.1%, a neutral fat content of 0.2%, and a free fatty acid content of 0.9%, all based on the total dry weight thereof, as well as a phosphatidylcholine content of 53.8% based on the total weight of phospholipid. Accordingly, 21.0 g of dipalmitoylphosphatidylcholine, 6.0 g of tripalmitoylglycerol, 2.0 g of trioleoylglycerol, 1.0 g of palmitic acid, 0.3 g of stearic acid, and 0.5 g of oleic acid were added to the solid residue, and the resulting mixture was suspended in distilled water and then lyophilized to obtain a yield of 65.0 g of surface active material. This material had a chemical composition as shown in Table VII. EXAMPLE 7 The procedure of Example 1 was repeated except that 28.5 kg of lungs excised from sheep were used in place of the 32.0 kg of lungs excised from cattle. Thus, 28.3 g of solid residue was obtained in step (f). This solid residue had a phospholipid content of 55.6%, a neutral fat content of 13.9%, and a free fatty acid content of 17.4%, all based on the total dry weight thereof, as well as a phosphatidylcholine content of 70.1% based on the total weight of phospholipid. Accordingly, 15.5 g of dipalmitoylphosphatidylcholine was added to the solid residue, and the resulting mixture was suspended in distilled water and then lyophilized to obtain a yield of 40.8 g of surface active material. On analysis, this material was found to have a chemical composition as shown in Table VII. EXAMPLE 8 The procedure of Example 1 was repeated except that 30.0 kg of lungs excised from pigs were used in place of the 32.0 kg of lungs excised from cattle. Thus, 29.8 g of solid residue was obtained in step (f). This solid residue had a phospholipid content of 89.3%, a neutral fat content of 0.2%, and a free fatty acid content of 0.7%, all based on the total dry weight thereof, as well as a phosphatidylcholine content of 76.8% based on the total weight of phospholipid. Accordingly, 1.0 g of tripalmitoylglycerol, 0.5 g of tristearoylglycerol, 4.2 g of palmitic acid, and 1.3 g of oleic acid were added to the solid residue, and the resulting mixture was suspended in distilled water and then lyophilized to obtain a yield of 36.8 g of surface active material. This material had a chemical composition as shown in Table VII. EXAMPLE 9 (a) The lungs (2.8 kg) excised from a 0-month-old calf were washed with water to remove any blood and other contaminants adhering thereto. Then, the lungs were cut into fist-sized lumps, freed of unnecessary blood vessels, windpipes, fat bodies and the like with the acid of scissors, and washed again with water. These lumps were finely minced with a meat grinder to obtain 2.5 kg of lung mince. This lung mince was added to 15.0 liters of physiological saline. The resulting mixture was stirred at 4° C. for 2 hours, placed in a filter bag, and filtered under a pressure of 120 kg/cm 2 to obtain an extract. Thereafter, 5.0 liters of physiological saline was poured over the filtration residue and diltered again under pressure to obtain an additional extract. The combined volume of the extract thus obtained was 19.5 liters. (b) The above extract was centrifuged at 13,000 r.p.m. at 5° C. for 40 minutes to collect a crude sediment. This crude sediment was suspended in 2.0 liters of physiological saline and then centrifuged at 700 r.p.m. at 5° C. for 10 minutes to precipitate off any residual tissue fragments and the like. (c) To the suspension obtained as the top layer was added sodium chloride in small portions so as to adjust its specific gravity to approximately 1.15. The adjusted suspension was centrifuged at 10,000 r.p.m. at 5° C. for 30 minutes to divide it into three layers, the top layer being an emulsified scum layer. This top layer was isolated and purified by re-suspending it in 1.0 liter of a 25.5% (w/v) aqueous sodium chloride solution and centrifuging the resulting suspension at 10,000 r.p.m. for 30 minutes. (d) The purified top layer was suspended in distilled water and the resulting suspension was dialyzed through a cellophane membrane against distilled water. Thereafter, the dialyzed suspension was lyophilized to obtain 19.5 g of crude dry product. (e) This crude dry product was added to 1,200 ml of cold ethyl acetate at 5° C. The resulting mixture was stirred for 20 minutes and then filtered under reduced pressure to separate an insoluble material. After this insoluble material was dried, 650 ml of an organic solvent mixture, or chloroform-methanol (with a volume ratio of 2:1), was added thereto. The resulting mixture was stirred for 20 minutes and then filtered through filter paper to obtain 630 ml of purified filtrate. When a sterility test was made on a small sample of this purified filtrate, it was found to be sterile. Accordingly, all subsequent operations were carried out under sterile conditions. (f) The above purified filtrate was concentrated under reduced pressure to obtain 1.6 g of solid residue. This solid residue had a phospholipid content of 83.6%, a neutral fat content of 6.4%, and a free fatty acid content of 5.7%, all based on the total dry weight thereof, as well as a phosphatidylcholine content of 75.8% based on the total weight of phospholipid. Accordingly, the solid residue required no further treatment and could be regarded as a final product. This product had a chemical composition as shown in Table VII. EXAMPLE 10 The procedure of Example 9 was repeated except that the lungs (3.5 kg) excised from a 4-months-old calf were used in place of the lungs (2.8 kg) excised from a 0-month-old calf. Thus, 3.4 g of solid residue was obtained in step (f). This solid residue had a phospholipid content of 94.8%, a neutral fat content of 0.4%, and a free fatty acid content of 0.5%, all based on the total dry weight thereof, as well as a phosphatidylcholine content of 80.2% based on the total weight of phospholipid. Accordingly, 1.3 g of palmitic acid was added to the solid residue, and the resulting mixture was suspended in distilled water and then lyophilized to obtain a yield of 4.7 g of surface active material. This material had a chemical composition as shown in Table VII. EXAMPLE 11 The procedure of Example 9 was repeated except that the lungs (2.0 kg) excised from a 3-months-old young pig were used in place of the lungs excised from a calf. Thus, 2.8 g of solid residue was obtained in step (f). This solid residue had a phospholipid content of 78.3%, a neutral fat content of 1.8%, and a free fatty acid content of 15.5%, all based on the total dry weight thereof, as well as a phosphatidylcholine content of 54.8% based on the total weight of phospholipid. Accordingly, 0.6 g of phosphatidylcholine was added to the solid residue, and the resulting mixture was suspended in distilled water and then lyophilized to obtain a yield of 3.4 g of surface active material. This material had a chemical composition as shown in Table VII. TABLE VII__________________________________________________________________________Example No. 1 2 3 4 5 6 7 8 9 10 11__________________________________________________________________________Composition of surface activematerial (%)Phospholipid 76.0 77.8 90.7 72.1 72.6 74.8 76.6 72.3 83.6 68.6 82.1Neutral fat 7.0 3.0 4.8 8.3 13.0 12.4 9.6 4.2 6.4 0.3 1.5 ##STR5## ##STR6## 2.5 0.4 0.1 4.3 0.5 0.0 7.2 1.1 0.0 10.0 2.5 0.5 9.8 2.0 0.6 7.6 1.5 0.5 3.0 0.8 0.4 5.5 0.8 0.1 0.2 0.1 0.0 ##STR7## Total cholesterol 0.6 1.3 0.4 8.0 1.2 3.1 0.1 0.0 0.0 0.7 0.8 ##STR8## ##STR9## 0.7 0.6 0.4 0.0 6.5 1.5 1.0 0.2 2.7 0.4 0.1 0.0 0.0 0.0 0.0 0.0 0.4 0.3 ##STR10## Free fatty acids 9.7 12.6 1.0 6.5 5.9 2.8 12.0 15.5 5.7 27.7 12.8Carbohydrate 0.5 0.4 0.5 0.3 1.3 1.0 0.1 2.0 1.0 0.2 0.6Protein 1.3 0.0 1.0 1.1 3.5 2.1 0.2 0.7 0.9 0.5 0.3Water 4.8 5.0 1.8 3.8 2.5 4.5 1.6 5.2 2.4 2.1 2.0Phospholipid constituents (%)Phosphatidylcholine 65.4 74.5 71.8 58.4 66.5 73.8 85.0 76.8 75.8 80.2 64.5Phosphatidylglycerol 8.5 1.3 5.3 7.7 12.0 2.2 1.1 6.9 3.0 0.1 7.3Phosphatidylethanolamine 8.7 9.5 12.6 6.4 8.0 5.7 7.1 4.8 3.5 7.1 11.5Sphingomyelin 7.8 3.2 5.2 10.1 4.0 5.1 4.0 7.8 11.1 5.9 12.1Phosphatidylinositol 1.2 3.8 1.9 6.6 2.1 3.9 1.5 2.0 4.5 2.7 2.8Phosphatidylserine 6.4 4.2 2.0 5.5 5.7 1.4 1.0 1.1 1.5 2.1 1.2Lysophosphatidylcholine 0.5 1.1 0.3 1.8 1.7 2.9 0.1 0.1 0.2 0.5 0.4Others 1.5 2.4 0.9 3.5 0.0 5.0 0.2 0.5 0.4 1.4 0.2Content of phosphatidylcholine 75.6 70.9 77.6 69.4 61.3 73.2 83.1 73.8 82.6 87.5 78.9having two saturated fatty acidresidues (%)__________________________________________________________________________

Summary: A surface active material having the capacity of reducing the surface tension in pulmonary alveoli significantly is provided. This material comprises, based on the dry weight of the material, 68.6-90.7% of phospholipid, 0.3-13.0% of neutral fat, 0.0-8.0% of total cholesterol, 1.0-27.7% of free fatty acids, 0.1-2.0% of carbohydrate, and 0.0-3.5% of protein. The material is produced by subjecting mammalian lung tissue to a series of procedures including acetic acid ester treatment, organic solvent mixture treatment, differential centrifugation, density gradient centrifugation and dialysis, and optionally adding a phosphatidylcholine, a neutral fat, and/or a free fatty acid to the resulting product. A pharmaceutical composition comprising the surface active material is usable for the clinical treatment of respiratory distress syndrome.

big_patent

en

Summarize: BACKGROUND OF INVENTION 1. Field of Art The present invention relates to pull-type agricultural implements which are conceived for attachment to a pulling vehicle, and more particularly to implements having a pair of steerable wheels. 2. Description of Prior Art Traditionally, agricultural tractors have been designed for low road speeds, not exceeding 25 km/h. However, more and more modern tractors are capable of attaining top speeds of 50 km/h without discomfort to the user or danger for the tractor structure. In practice however, the speed of the tractor still has to be limited because the implements attached to the tractor do not allow high speeds. This certainly is the case where no suspension is provided for the wheels of the implement. Accordingly, adequate suspension systems have been fitted to pull-type implements, permitting road speeds in excess of 25 km/h for the whole tractor-implement combination. In one embodiment the implement has been provided with a kind of bogie which is attached by two sets of leaf springs to the frame of the implement. The bogie comprises four wheels mounted to a front and a rear axle. Such structure behaves satisfactorily during road travel, where large turns are to be made, but seriously hampers the operation in the field, where the implement sometimes must take very short turns. The second pair of wheels then seriously hampers the movement of the baler and may even deteriorate the earth on headlands. In response thereto it has been suggested to make the rear wheels of the implement steerable such that they can adapt freely to the short turns. However, for road travel all wheels have to be held in a fixed position to keep the wheels from fluttering in an uncontrolled movement, especially at high speeds. Moreover, the free movement of the rear wheels may complicate the rearward movement of the implement, as the wheels tend to turn over and deviate the implement to the left or right. Hence there is a need for means disabling the free movement of the steerable wheels. SUMMARY OF INVENTION According to one aspect of the present invention there is provided an agricultural implement, comprising a main frame and a hitch attached to the main frame for attaching the implement to a towing vehicle. There are a pair of steerable wheels supporting the main frame and a means for blocking the steerable wheels in a fore-and-aft direction. The hydraulic circuitry for controlling functions of the implement comprises a feed line and a return line for connection to a hydraulic pump and an oil tank respectively, the connection enabling normal operation of said functions. Finally the circuitry comprises a means for actuating said blocking means by providing hydraulic pressure from said pump to said return line. According to another aspect of the present invention, there is provided a method for blocking steerable wheels on an agricultural implement. The implement having a main frame, a hitch attached to the main frame for attachment of the implement to a towing vehicle and a pair of steerable wheels supporting the main frame. There is a means for blocking the steerable wheels in a fore-and-aft direction consisting of hydraulic circuitry for controlling functions of the implement. The circuitry comprising a feed line and a return line for connection to a hydraulic pump and an oil tank, respectively. The method comprising the step of actuating said blocking means by providing hydraulic pressure from said pump to said return line. BRIEF DESCRIPTION OF THE DRAWINGS An embodiment of the present invention will now be described in further detail, by way of example, with reference to the following drawings. FIG. 1 is a side elevational view of a rectangular baler, having a frame mounted to a bogie having fixed and steerable wheels. FIG. 2 is a top view of the bogie of FIG. 1, showing a pair of hydraulic rams for blocking the steerable wheels. FIG. 3 is a side elevation view of the bogie of FIG. 2. FIG. 4 is a cross sectional view of one of the rams of FIG. 2. FIG. 5 is a hydraulic scheme, illustrating the operation of the blocking rams. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT It will be appreciated that the present invention will be described with reference to a rectangular baler, but that the invention is not limited thereto and that it readily can be adapted to other kinds of wheeled agricultural equipment which are adapted for attachment to a towing vehicle. The terms “front”, “rear”, “forward”, “rearward”, “left” and “right” used throughout this description are determined with respect to the normal direction of travel of the machine in operation. However they are not to be construed as limiting terms. FIG. 1 shows an agricultural baler 10 comprising a frame 11 which is equipped with a forwardly extending tongue 12 provided with hitch means (not shown) at its front end for coupling the baler 10 to a towing vehicle such as an agricultural tractor. A conventional pick-up assembly 14 lifts windrowed crop material off the field as the baler 10 is traveled thereover and delivers such material into the front end of a rearwardly and upwardly curved, charge-forming feeder duct 16. The duct 16 communicates at its upper end with an overhead, fore-and-aft extending baling chamber 18 into which crop charges are loaded by a cyclically operating stuffer mechanism 20. A continuously operating packer mechanism 22 at the lower front end of the feeder duct 16 continuously feeds and packs material into the duct 16 as to cause charges of the crop material to take on and assume the internal configuration of the duct 16 prior to periodic engagement by the stuffer 20 and insertion up into the baling chamber 18. Each action of the stuffer 20 introduces a “charge” or “flake” of crop material from the duct 16 into the chamber 18. A plunger 24 reciprocates in a fore-and-aft direction within the baling chamber 18 under action of a pair of pitman rods 25 which are linked to the crank arms 26 of a gearbox 27 driven by a shaft 29 which is connected to the PTO shaft of the tractor. The reciprocating plunger 24 pushes each new charge introduced into the baling chamber 18 rearwardly and forms the subsequent charges into a package of crop material, which is pushed by the plunger 24 toward a rearmost discharge aperture 28 of the chamber 18. The baling chamber 18 comprises at least one movable wall portion 30 of which the position can be adjusted to vary the cross section of the aperture 28. The position of the wall portion 30 is controlled by a pair of actuators in the form of hydraulic cylinders 31 (only one shown in FIG. 1) which are installed between the frame 11 and the wall portion 30. Reduction of the cross section increases the resistance to rearward movement of the crop packages and hence the density of the crop material contained therein. Similarly an increase in cross section will reduce the resistance to the movement and the density of the newly formed packages. Each package is securely bound in its final compacted form by a tying mechanism 32 before leaving the confines of the baling chamber 18. The length of each bale produced by the baler 10 can be adjustably predetermined by conventional means not shown. The baler is equipped with bale discharge means 36 in the form of a bale chute, mounted to the rear of the frame 11, adjacent the discharge aperture 28 of the baling chamber 18. The completed bale is received thereon and sustained thereby at least until the rear end of the bale has completely left the confines of the baling chamber 18. The discharge means 36 embrace a front chute portion 37 and a rear chute portion 38. The front portion 37 is attached by a pair of pivot pins 43 to the rear end of the baler frame 11. In turn, the rear portion 38 is mounted via a pair of pivot pins 46 to the rear end of the front chute portion 37. The bale discharge means 36 can be moved into a transport position by means of a hydraulic cylinder 74, which is mounted below the front chute portion 37, between a support 75 welded to the rear end of the baler frame 11, and a lever arrangement 76, affixed to the front and rear chute portions 36, 37. As shown in FIG. 5, the cylinder 74 is linked via a manually operated valve 77 on the left hand side of the baler frame 11 to hydraulic circuitry 78 of the baler, comprising a pressure line 79 and return line 83, 80. The one line 79 has a pressure connection 81 and the other 80 a return connection 82 for coupling the lines 79, 80 to corresponding lines of the hydraulic circuit of the tractor, comprising a hydraulic pump and an oil tank. Hydraulic valve 77 can be operated to pivot the rear chute portion 38 upwardly about pivot pins 46 at an angle of 90° to the front chute portion 37 and then to pivot both portions 37, 38 upwardly and forwardly about pivot pins 43 until the rear chute portion rests on a cradle 92 on top of the baling chamber 18. The baler 10 further is equipped with a system for removing completed bales from the baling chamber 18, even when no fresh crop material is introduced in the front area of the baling chamber to be engaged by the plunger 24. The system comprises a pair of longitudinally arranged slats (not shown) equipped with pivotable tines (equally not shown) which are arranged below the baling chamber 18. A hydraulic double-acting cylinder 60 (FIG. 5) can be actuated to raise the tines into the baling chamber through slots in the bottom wall thereof. In this position the tines are operable to engage the bottom of the bale in the chamber 18. A further double-acting cylinder 61 is operable to reciprocate the slats. Both cylinders 60, 61 are linked to the circuitry 78, wherein an orifice 62 makes cylinder 60 receive priority oil flow when line 63 is pressurized by actuation of a valve 65, which links line 63 to pressure line 79. The cylinders 60, 61 raise the tines and force the slats and tines rearwardly, thereby driving the bale out of the baling chamber 18. In this condition, return oil from both cylinders can flow back to return line 80 via line 64 and valve 65. When the valve 65 is reversed, pressurized oil flows through line 64 to the rod ends of the cylinders 60, 61 to retract the tines and pull the slats forwardly to their home positions. Repeated actuation of the valve 65 drives the bale completely out of the baling chamber 18. The maximum pressure in the hydraulic circuitry 78 is defined by the pressure relief valve 86, installed between the pressure line 79 and the return line 83. The baler frame 11 is mounted to the mounting plates 101 of a bogie 100, shown in FIGS. 2 and 3. The bogie comprises two sets of leaf springs 103, attached to the mounting plates 101, a front axle 107 equipped with two fixed front wheels 102, and a rear axle 108 with two steerable rear wheels 104. The latter are rotatably mounted to the axle 108 by means of king pins 105 which can be pivoted about substantially vertical axes. A connection rod 106 ensures equal and simultaneous movement of the king pins 105. The rear wheels 104 are not actively steered; they adapt freely to the path followed by the towing vehicle and the front wheels 102. As such they allow sharp turns of the baler without “digging” of the rear wheels 104 into the earth. The rear beam 108 of the bogie 100 is provided with two extendable blocking rams 110, shown in further detail in FIG. 4. Each ram has a cylindrical body 111, which is mounted in a transverse direction along the beam 108. The body 111 has a chamber which contains a rod 112 provided with a head 113 directed to the hub of the steerable wheel 104. A spring 114 mounted inside the body 111 exerts an inward force on a foot 115 of the rod 112. A port 116 links the chamber of the ram 108 to a line 119 branched to the return line 80 of the circuitry 78 (FIG. 5 ). When no hydraulic pressure is applied to the rams 110, the springs 114 ensure that the heads 113 do not engage the wheels 104, such that they are still free to pivot about the axes of the king pins 105. When pressurized oil is fed to the rams 110, the rods 112 will be urged outwardly against the force of the springs 114. They contact one or other of the rear wheels 104 and force it outwardly to a fore-and-aft direction. The rams 110 pivot the rear wheels until the rod feet 115 contact shoulders 117 inside body 111. In this position, the rear wheels 104 are in alignment with the front wheels 102. As shown in FIG. 5, both rams 110 are connected via branch line 119 to the return line 80 of the baler circuitry 78. The branch line 119 has a manually controlled shut-off valve 120. During normal operations, the valve 120 is open for permitting remote control of the rams 110. A non-return valve 121 is disposed between the sections 83 and 80 of the return line, permitting free flow of oil from the control valves 65, 77 to the return connection 82. When the baler 10 is operated in the field, it is not necessary to block the rear wheels 104 of the bogie 100. The valve 120 is opened and the return connection 82 is linked to the return line of the tractor circuitry, draining oil to the oil tank. No pressurized oil is available at the ports 116 and the springs 114 of the rams 110 keep the ram heads 113 in their retracted position, such that the wheels 104 can adapt to the movement of the baler 10. The pressure connection 81 receives pressurized oil from the tractor for possible actuation of the bale eject cylinders 60, 61 or the bale chute cylinder 74. Free pivotment of the rear wheels 104 is not always desired: e.g. it may be required to block them on order to stabilize the towed baler 10 during road transport. This can be accomplished easily by reversing the direction of the oil flow at connections 81 and 82. By providing pressurized oil at return connection 82, non-return valve 121 is forced to its closed position, thereby cutting line 80 from line 83. Pressure builds up in the chambers of the rams 110 and urges ram heads 113 outwardly. In this manner the wheels 104 are blocked, such that they cannot flutter when the baler 10 is driven at high speeds during road transport. It is also advantageous to block the wheels 104 when driving the baler 10 along a slope or hill-side in order to keep the baler on track behind the tractor. Furthermore, blocking is required when the baler has to be driven rearwardly: otherwise the free rear wheels 104 would turn and deviate the baler 10 to the left or the right. When one wants to block the wheels 104 during a longer period and/or while no continuous hydraulic pressure is available, the pressurized rams 110 may be held in place by locking the shut-off valve 120. When the valve 120 is opened, the rams 110 can be retracted immediately by linking the return connection 82 to the return line of the tractor circuitry. The control of the rams 110 can be realized advantageously by having connections 81, 82 linked to hydraulic circuitry comprising a valve of the same type as valves 65 and 77, i.e. with four ports and three positions. Such valve in the tractor circuitry enables immediate switching between a locked and an unlocked condition of the rear wheels 104. It will be appreciated the invention is not limited to the described embodiment, but readily can be used in other types of pull-type agricultural equipment, such as carts, forage wagons, mowers, etc. It is also envisageable to connect the branch line 119 to the return line of other hydraulic circuitry, e.g. of the system controlling the position of the cylinders 31 for adjustment of the bale density. It will be obvious to those skilled in the art that various changes may be made without departing from the scope of the invention and the invention is not to be considered limited to what is illustrated in the drawings and described in the specification.

Summary: An agricultural implement, such as a baler comprises a main frame and a hitch for attachment of the implement to a towing vehicle. The frame is supported on a bogie comprising a pair of steerable wheels. A pair of hydraulic rams can block these wheels in a fore-and-aft position for reversing the baler or for preventing fluttering during road transport. Hydraulic circuitry, which is used for controlling functions of said implement, such as the retraction of a bale chuteor the operation of a bale eject apparatus can be used to actuate the rams. The rams are loaded by providing pressurized oil to the return line and using a non-return valve for making the oil flow to the guiding the said circuitry to the rams.

big_patent

en

Summarize: A mother had to have a hysterectomy at 19 after doctors missed a minor infection which could have been treated with antibiotics. Hayley Sanders has now been awarded a five-figure settlement from her local NHS trust. Miss Sanders underwent the operation to remove her womb barely a fortnight after having her first child, Jayden, by Caesarean section on December 27, 2009. Hayley Sanders developed an infection after the birth of her son, Jayden, in December 2009. Despite having a high temperature, she was discharged from hospital. Four of the checks carried out immediately after the birth revealed high temperature readings – a warning sign of an infection. Despite that, Miss Sanders was discharged from Birmingham’s Heartlands Hospital three days later. But on New Year’s Day, Miss Sanders. was rushed back into hospital after developing severe abdominal pain and. spent several days in the high dependency unit. She fell into a coma as her body. fought the deadly infection. It is thought it was caused by one of the. internal examinations she was given during labour. It could have been treated with a. simple course of antibiotics. Instead, doctors were eventually left with. no choice but to perform a complete hysterectomy to save her life. Ms Sanders was rushed back to hospital two days after being discharged. As the infection took hold of her body, she fell into a coma and doctors were forced to perform a hysterectomy to save her life. If Ms Sanders had been given antibiotics as soon as she developed a high temperature, she would not have needed a hysterectomy and she would be able to have more children in future. The. 23-year-old was awarded a ‘five-figure’ pay-out from Heart of England. NHS Foundation Trust, shortly before the case was due to be heard in the. High Court. Miss Sanders says she is ‘disgusted’ by her treatment. She has been left with ongoing health problems as a. result of her hysterectomy, including Irritable Bowel Syndrome. She will also require specialist scar revision surgery to her stomach. Ms Sanders has now received a five-figure pay-out from Heart of England NHS Foundation Trust - it will cover her loss of earnings and pay for the counselling she has required as a result of the incident. Ms Sanders said: 'I couldn't believe that if staff had only given me antibiotics I would never have needed a hysterectomy' She said: ‘I just could not believe that at 19 years of age I wouldn’t be able to have children again. ‘I was devastated and determined to. get to the bottom of how it could have happened. When I heard the. evidence I was absolutely appalled. ‘I couldn’t believe that if staff had. only given me antibiotics I would never have needed a hysterectomy, I. would have been able to make the most of bonding with Jayden in the. first weeks of his life and I would have, one day, been able to give him. a little brother or sister. Ms Sanders now hopes that the hospital has learnt from its mistakes and that no other women will go through the same trauma she experienced. ‘Instead I was robbed of this and have. been left with a host of ongoing problems that are a constant reminder. of the failings in my care. ‘The whole situation has been made. worse by the fact the Trust has never taken responsibility for its. actions or even just said sorry. Nothing can make up for what happened. but it would at least give me some closure to allow me to begin. rebuilding my life.’ Emma Rush, of law firm Irwin Mitchell,. said: ‘Hospital staff missed multiple opportunities to recognise that. Hayley’s high temperature was the result of an infection that is not. uncommon in maternity patients and that simple antibiotics would have. treated [it]. ‘Instead she became critically ill as. the infection took over her body and the only option of saving her was. to perform a hysterectomy to remove the source of the infection.’ ‘This is obviously a horrendous ordeal. for any person to go through, but particularly difficult for a. 19-year-old who hoped to have more children.’ A spokesman for the Heart of England. NHS Trust said: ‘A detailed action plan is developed to improve and. learn from the findings of investigations and this is monitored and. inspected by senior teams of doctors nurses and midwives. Unfortunately,. Hayley Sanders suffered complications during the course of the delivery. of her son. ‘Whilst no admissions of liability. were made, a financial settlement was achieved and we wish Hayley and. her family all the best for the future.’ The body can be vulnerable to some infections after birth. The most common is endometritis - an infection of the lining of the womb. Some women also develop infections of the breast, C-section scar, or urinary tract. Women who have C-sections are at significantly higher risk of endometritis than those who have a natural delivery. Symptoms of an infection include fever, chills and malaise. Some women with endometritis also develop abdominal pain. Other symptoms of a breast infection (mastitis) include a painful, hard, warm, red area on one breast, a headache and fatigue. Other symptoms of a urinary tract infection include painful urination and bloody or cloudy urine. An infection can quickly become serious if untreated so sufferers should be given an immediate course of antibiotics

Summary: Hayley Sanders, now 23, developed an infection after the birth of her son, Jayden, at Birmingham's Heartlands Hospital in December 2009. Despite having a temperature, she was discharged shortly after the birth. Two days later she was rushed back to hospital where she fell into a coma. 13 days after being readmitted, she had a hysterectomy to save her life. Situation could have been prevented had she been given antibiotics earlier. She now needs counselling to come to terms with what happened to her.

cnn_dailymail

en

Summarize: A small plane made an emergency landing Thursday on a busy street in the heart of Silicon Valley, surprising morning commuters but touching down and stopping without injuring anyone. The Bellanca Citabria took off from a San Jose airport just before 8 a.m., but the pilot soon notified air traffic controllers that he needed to go back, Federal Aviation Administration spokeswoman Laura Brown said. Instead, he ended up needing to use the eight-lane Capitol Expressway as a runway and successfully navigated a landing through power lines and cars before pulling over into a right-hand turn lane, San Jose police Sgt. Heather Randol said. "It required some skill on (the pilot's) part," Randol said. "We're just thankful nobody got injured." The fixed-wing, single-engine aircraft is owned by Amelia Reid Aviation LLC. The company operates a flight school, Aerodynamic Aviation, out of the Santa Clara County-owned Reid-Hillview Airport, according to the FAA. The plane took off from that airport. The school's owner, Zdravko Podolski, told KGO-TV in San Francisco ( http://bit.ly/18y3rSB) that a student was behind the controls of the aircraft when it experienced engine trouble at takeoff. The instructor immediately took over and landed the plane. Podolski declined to name the instructor but described him as an experienced pilot. "The nice thing is there are traffic lights, so there was a whole empty stretch where cars were stopped, and it was able to land just fine without getting in the way of any cars," Podolski said. Cesar Molina of San Jose was filling up at a gas station when he saw the plane roll to an intersection and feared it might explode. "It's a scary thing when you see a plane land near a gas station," Molina told the San Jose Mercury News ( http://bit.ly/16kI5Z7). The landing comes three months after a small plane landed on a dirt embankment next to a Southern California freeway, just short of the Long Beach airport. The plane avoided contact with vehicles, and the pilot walked away with minor injuries. In August 2012, the pilot of another small plane died after crashing into a West Los Angeles neighborhood 2 miles northeast of the Santa Monica Airport. No one else was injured. A year earlier, a pilot suffered a broken leg after crashing a small plane into the yard of a home about a block from that same airport. And the year before that, a pilot practicing touch-and-go landings at the Santa Monica airport died when his small plane slammed nose-first into a nearby golf course. Click photo to enlarge « 1 2 3 4 » SAN JOSE -- A small private plane was forced to make an emergency landing on Capitol Expressway in the middle of the Thursday morning commute -- about a half mile from the local airport where it's housed -- but there were no reported injuries or damage, authorities said. The green and white single-engine Bellanca Citabria touched down in the southbound lanes just before 8 a.m., coming to a stop in the right-turn lane onto Quimby Road near Eastridge Mall. According to the owner of the flight-training school that operates the plane, during takeoff from Reid-Hillview Airport, a pilot instructor and trainee noticed that, for an unknown reason, the engine was not accelerating sufficiently to climb. View View Plane lands in a larger map "It stopped developing enough power to climb so they looked to see where to put it down," said Zdravko Podolski, owner of AeroDynamic Aviation. "They turned around thinking they could make it back to the airport, but elected to put it down on a gap in the expressway." Podolski said because the engine was idling at best, an attempt to return to the airport would have been riskier than descending immediately. He lauded the performance of his instructor, who he declined to name but described as a San Jose man in his 20s with an accomplished teaching pedigree and over 3,000 hours in the air. Once it was clear that the aircraft was struggling, the instructor took over the controls, and it was on the ground three minutes after it took off. Advertisement "It was an excellent performance," he said. "He notified the tower, avoided obstacles and when it was safe to do so, he set it down on the ground in a big empty space. There wasn't even a scratch. That's primarily the reason for lots of training." Among those obstacles were overhead power lines. Podolski said his mechanics are examining the plane to determine the source of the trouble, which was likely mechanical. "We'll figure out what it was and sort it out," he said. Cesar Molina of San Jose was pumping gas at the Arco station at the intersection of Capitol and Quimby when he saw the small plane land. "It's a scary thing when you see a plane land near a gas station," he said. He said his first thought was that the plane might explode, but the aircraft safely came to a stop. San Jose police Sgt. Heather Randol said traffic on the southbound lanes of Capitol are typically -- and Thursday morning, fortuitously -- lighter than the northbound lanes. Randol said no one was injured and that the occupants cooperated with investigators. Fire crews were initially summoned but were quickly called off, Fire Capt. Cleo Doss said. The plane was towed around 9 a.m. According to Federal Aviation Administration records, the aircraft is registered to Amelia Reid Aviation LLC, a training school based at Reid-Hillview Airport that now operates under the name AeroDynamic Aviation. Amelia Reid was a renowned aviator and her family is one of the namesakes of the airport. Police said the FAA and National Transportation Safety Board were alerted to the landing, but any investigation will likely be delayed to the federal government shutdown. A message sent to a spokesman for the western region of the FAA elicited an automated response that he's "not in the office due to a lapse in federal funding." An FAA spokeswoman in Washington later confirmed the basic details of the emergency landing. Since the airport opened nearly 80 years ago, there have been intermittent incidents where planes have landed off the runway, including a similar instance on Capitol Expressway in 2007. The adjacent Eastridge Mall has seen a smattering of short landings: since it opened in 1971, there have been at least six instances of planes touching down either in the parking lot or on top of the actual structure. Contact Mark Gomez at 408-920-5869. Follow him at Twitter.com/MarkMGomez. Contact Robert Salonga at 408-920-5002. Follow him at Twitter.com/robertsalonga.

Summary: A small plane took off from an airport near a San Jose-area expressway yesterday-and three minutes later, it had to land on the road amid morning commuters. Fortunately, the whole thing happened safely: "There wasn't even a scratch," the owner of the flight school in charge of the plane tells the Mercury News. The plane's single engine wasn't generating the power necessary for the climb, so a flight teacher took over the controls and brought it down on the Capitol Expressway just before 8am. "It required some skill on (the pilot's) part," a police official tells AP. "We're just thankful nobody got injured." The pilot ended up pulling over into a right-hand turn lane, and it helped that cars were stopped thanks to a red light. Final note: The Mercury News checked in with an FAA official about the incident, but the paper got a message that he was "not in the office due to a lapse in federal funding."

multi_news

en

Summarize: Tra le armi più efficaci per combattere una malattia infettiva come il nuovo coronavirus emerso in Cina (2019-nCoV) c'è sicuramente il vaccino, tuttavia sviluppare una preparazione di questo tipo può richiedere molto tempo, come specificato ai nostri microfoni dal virologo Fabrizio Pregliasco dell'Università degli Studi di Milano; in media, infatti, per la messa in commercio di un nuovo vaccino si impiegano dai 6 agli 8 anni. Tale procedura, come affermato dallo specialista, in determinate circostanze di necessità può essere accelerata; è ciò che è avvenuto per il contrasto del virus Ebola, una malattia altamente letale per la quale è stato necessario tagliare i passi della filiera standard. Ma il nuovo coronavirus è responsabile di una “influenzona”, i cui sintomi più diffusi sono febbre, tosse e dolori muscolari, e pur potendo precipitare in una grave forma di polmonite nei pazienti più suscettibili, i possibili effetti collaterali di un vaccino non testato possono essere decisamente più rischiosi, come indicato dallo stesso Pregliasco. In altri termini, il gioco non varrebbe la candela. Dunque quando sarà pronto un vaccino per il nuovo coronavirus? Difficile dare una risposta precisa a questa domanda. Il professor Giuseppe Ippolito, direttore scientifico dell'Ospedale Spallanzani di Roma dove si trovano i due pazienti cinesi colpiti dalla patologia (i primi casi in Italia di coronavirus), durante una conferenza stampa ha specificato che a causa dei tempi necessari per metterne a punto uno, il preparato potrebbe diventare disponibile dopo la chiusura di questo focolaio. Quindi mesi, se non anni nel peggiore dei casi. Secondo il professor Pregliasco potrebbero volerci dai 6 agli 8 mesi per far fronte a questa emergenza sanitaria, ma al momento si tratta soltanto di stime. Il dottor Rino Rappuoli, vaccinologo di fama internazionale e dirigente presso il Dipartimento di Ricerca e Sviluppo della società GSK Vaccine, ha sottolineato che con le conoscenze e le tecnologie attuali un vaccino contro 2019-nCoV può essere sviluppato entro una settimana, ma si tratterebbe del prototipo basato sull'identificazione dello stipite virale. Prima di vedere un simile prodotto sugli scaffali della farmacia possono volerci mesi, perché sono necessari fondamentali test di sicurezza. “Non puoi sparare a milioni di persone un vaccino che non hai controllato”, ha affermato Pregliasco. La vicinanza genetica del nuovo coronavirus con quello della SARS (Severe acute respiratory syndrome) sta agevolando il lavoro degli scienziati, che sperano di arrivare a una soluzione in tempi rapidi. Tra i laboratori più avanti nello studio del 2019-nCoV c'è il Peter Doherty Institute for Infection and Immunity (Doherty Institute) dell'Università di Melbourne, in Australia, il primo istituto al di fuori della Cina a disporre del virus. Gli scienziati guidati dal dottor Julian Druce lo hanno ottenuto isolandolo da un campione del primo paziente identificato nella “terra dei canguri”; le colture saranno utilizzate per studiare il comportamento del virus, mettere a punto test diagnostici e appunto un possibile vaccino.

Summary: Per la messa a punto di un nuovo vaccino, come specificato dal professor Fabrizio Pregliasco dell'Università degli Studi di Milano, sono necessari anche dai 6 agli 8 anni, tuttavia in casi di particolare necessità i tempi possono essere sensibilmente ridotti. Alla luce delle caratteristiche del coronavirus 2019-nCoV, diversi esperti - tra i quali il professor Giuseppe Ippolito dello Spallanzani di Roma - ritengono che la preparazione possa essere resa disponibile al termine del focolaio. Ecco cosa sappiamo.

fanpage

it

Summarize: By. Associated Press. and Alexandra Klausner. A vacant luxury house appears on the verge of tumbling 75 feet into a Central Texas lake because a cliff is collapsing beneath the property. WFAA-TV in Dallas-Fort Worth reported Wednesday that the 4,000 square-foot-home above Lake Whitney has been condemned and the owners evacuated about two weeks ago. Hill County Sheriff's Office Chief Deputy Mark Wilson says another chunk of cliff broke off on Tuesday night. SCROLL DOWN FOR VIDEO. About to drop? A luxury house teeters on a cliff about 75 feet above Lake Whitney in Whitney, Texas where homeowners have been forced to evacuate and watch their $700,000 mansion crumble. The 4,000 square-foot-home was condemned a year ago after people noticed a crack in the cliff below about a year ago. Soil and other debris have been falling from beneath the home at White Bluff Resort, some 60 miles south of Fort Worth. Tax records show the house was built in 2007 and is worth more than $700,000. Neighbors Connie Ash and Jackie McNamara live across the lake and told reporters that they heard a cliff crash into the water at around 6:30 p.m yesterday. 'I immediately thought it was an earthquake or blasting; it was loud, really loud,' said Connie Ash said. 'And then I saw smoke, dust, water... I don't know, it was a huge cloud of stuff.' 'You used to look flush at the roof but then I could see it was somewhat down,' she said. 'You could see it... more and more of the top of the house that's moved. You're looking through the binoculars, just watching it.' WFAA-TV published aerial photos of the home which show a massive hole under the center of the house. Huge fissures could also be seen on a nearby cliff. A sign reading, 'EXTREME DANGER, STAY OFF PREMISES,' greeted visitors in the front yard. The Hill County Sheriff said that people noticed a crack in the cliff about a year ago and that afterwards the house was condemned. The owners of the crumbling mansion evacuated two weeks ago and they've moved all their things out. The Sheriff told reporters that the home was shifting quickly on Tuesday night and there's no knowing is the house will fall down with it. Soil and Debris can be seen hanging from the nearly dilapidated luxury home. Despite not being able to live in the home, the owners will be responsible for the clean-up. The owners also have an address in Aubrey so this house may be their vacation home. Soil and debris hang ominously from the luxury home dangling by a thread above Lake Whitney in Texas. The homeowners evacuated two weeks ago and even though they are not allowed to live in the home they will be responsible for cleaning it up if it falls

Summary: The homeowners evacuated the property two weeks ago but will be responsible for cleaning it up should it fall. The Sheriff told reporters that the home. was shifting quickly on Tuesday night and there's no knowing if the. house will fall down or when. Neighbors Connie Ash and Jackie McNamara. live across the lake and told reporters that they heard part of the cliff crash. into the water at around 6:30 p.m yesterday and that it sounded like an 'earthquake blasting' The owners also have an address in Aubrey so this house may be their vacation home.

cnn_dailymail

en

Summarize: 1 of 19. A member of the Muslim Brotherhood and supporter of ousted Egyptian President Mohamed Mursi wears a makeshift gas mask as others run away from shooting during clashes in front of Azbkya police station during clashes at Ramses Square in Cairo August 16, 2013. CAIRO (Reuters) - The Muslim Brotherhood defiantly called for a week of protests across Egypt starting on Saturday, a day after more than 100 people died in clashes between Islamists and the security forces that pushed the country ever closer to anarchy. Undeterred by the bloodshed in which about 700 have been killed since Wednesday, the Brotherhood urged its supporters back onto the streets to denounce the overthrow of Islamist President Mohamed Mursi and a crackdown on his followers. "Our rejection of the coup regime has become an Islamic, national and ethical obligation that we can never abandon," said the Brotherhood, which has accused Egypt's military of plotting the downfall of Mursi last month to regain the levers of power. Many Western allies have denounced the killings, including the United States, but Saudi Arabia threw its weight behind the army-backed government on Friday, accusing its old foe the Muslim Brotherhood of trying to destabilize Egypt. Violence erupted across Egypt after the Brotherhood, which has deep roots in the provinces, called for a "Day of Rage". Roughly 50 people died in Cairo and more than 20 in the country's second city, Alexandria, security sources said. Automatic gunfire echoed around the capital throughout Friday afternoon, army helicopters swooped over the roof tops and at least one office block was set ablaze, lighting up the night sky long after the violence had subsided. The Brotherhood announced a series of daily rallies over the next six days, starting on Saturday. "We will not leave the squares. And we will not be silent over our rights, ever," said Cairo resident Abdullah Abdul Fattah, adding that he was not a Brotherhood voter. "We are here because of our brothers who died," he said. An interim cabinet, installed by the army after it removed Mursi during rallies against his often chaotic rule, has refused to back down. It has authorized police to use live ammunition to defend themselves and state installations. ANGER After weeks of futile, political mediation, police moved on Wednesday to clear two Brotherhood protest sit-ins in Cairo. Almost 600 people, most of them Islamists, were killed in the mayhem. With no compromise in sight, the most populous Arab nation - which is often seen as leading events in the entire region - looks increasingly polarized and angry. "Egypt fighting terrorism," said a new logo plastered on state television, reflecting tougher language in the local media that was once reserved for militant groups such as al Qaeda. The government said in a statement it was confronting the "Muslim Brotherhood's terrorist plan". Undermining Brotherhood pledges of peaceful resistance, armed men were seen firing from the ranks of pro-Mursi supporters in Cairo on Friday. A security official said at least 24 policemen had died over the past 24 hours, and 15 police stations attacked. The Brotherhood suggested the gunmen had been planted by the security forces, saying it remained committed to non-violence. Witnesses also said Mursi backers had ransacked a Catholic church and set fire to an Anglican church in the city of Malawi. The Brotherhood, which has been accused of inciting anti-Christian sentiment, denies targeting churches. Christians make up roughly 10 percent of Egypt's 84-million population and the Coptic Church authority issued a statement on Friday saying it "strongly supports the Egyptian police and armed forces". The streets of Cairo fell quiet after nightfall, with the government warning the dusk-to-dawn curfew would be vigorously enforced. Neighborhood watch schemes sprouted up, and residents stopped and searched cars driving past their communities. Egypt has lurched from one crisis to another since the downfall of the autocratic Hosni Mubarak in 2011, dealing repeated blows to the economy, particularly tourism. A number of tour operators have suspended all holidays to Egypt until at least next month and the United States has urged its citizens to leave the country. The European Union asked its states to consider "appropriate measures" to take in reaction to the violence, while Germany said it was reconsidering its ties. (Additional reporting by Michael Georgy, Alexander Dziadosz, Tom Finn, Yasmine Saleh, Mohamed Abdellah, Ahmed Tolba and Omar Fahmy in Cairo, Writing by Crispian Balmer; Editing by David Stamp) Egypt's capital descended into chaos Friday as vigilantes at neighborhood checkpoints battled Muslim Brotherhood-led protesters denouncing the ouster of President Mohammed Morsi and a deadly crackdown. The fiercest street clashes the city has seen in more than two years of turmoil left more than 60 people dead, including several policemen. A man, center, holding a gun takes his position while having gunfire with other civilians in Cairo, Egypt, Friday, Aug. 16, 2013. Gunfire rang out over a main Cairo overpass and police fired tear gas... (Associated Press) Egyptian government employees clean up as members of the Egyptians Army patrol among the smoldering remains of the largest protest camp of supporters of ousted President Mohammed Morsi, that was cleared... (Associated Press) An Egyptian walks in front of an army armored vehicle that guards an entrance of Tahrir Square, in Cairo, Egypt, Friday, Aug. 16, 2013. Egypt is bracing for more violence after the Muslim Brotherhood... (Associated Press) Egyptian Army soldiers stand guard outside the Rabaah al-Adawiya mosque, in the center of the largest protest camp of supporters of ousted President Mohammed Morsi, that was cleared by security forces,... (Associated Press) Two civilians holding guns walk on a street in the Zamalek neighborhood of Cairo, Egypt, Friday, Aug. 16, 2013. Gunfire rang out over a main Cairo overpass and police fired tear gas as clashes broke out... (Associated Press) Supporters of Egypt's ousted President Mohammed Morsi carry a coffin, covered with national flag, of their colleague who was killed during Wednesday' clashes, in Amr Ibn Al-As mosque before funeral prayers... (Associated Press) A woman holds a poster of Egypt's ousted President Mohammed Morsi pasted on a Yemeni flag as she and others attend a rally supporting Morsi in Sanaa, Yemen, Friday, Aug. 16, 2013. Arabic writing reads,... (Associated Press) Supporters of Egypt's ousted President Mohammed Morsi surround a coffin, covered with national flags, of their colleague who was killed during Wednesday' clashes in Amr Ibn Al-As mosque before a funeral... (Associated Press) A poster left by supporters of ousted Egyptian President Mohammed Morsi remains outside Rabaah al-Adawiya mosque, in the center of the largest protest camp of Morsi supporters that was cleared by security... (Associated Press) An Egyptian Army soldier takes his position on top of an armored vehicle while guarding an entrance to Tahrir Square, in Cairo, Egypt, Friday, Aug. 16, 2013. Egypt is bracing for more violence after the... (Associated Press) Egyptian Army soldiers stand guard outside the Rabaah al-Adawiya mosque, background, in the center of the largest protest camp of supporters of ousted President Mohammed Morsi, that was cleared by security... (Associated Press) Egyptian Army soldiers stand guard outside the Rabaah al-Adawiya mosque, in the center of the largest protest camp of supporters of ousted President Mohammed Morsi, that was cleared by security forces,... (Associated Press) Egyptian army soldiers take their positions on top and next to their armored vehicles while guarding an entrance to Tahrir Square, in Cairo, Friday, Aug. 16, 2013. Egypt is bracing for more violence after... (Associated Press) Egyptians lay on the ground after being injured during clashes between security forces and supporters of Egypt's ousted President Mohammed Morsi in Ramses Square, near the Al-Fath mosque, in Cairo, Egypt,... (Associated Press) Egyptian government employees clean up outside the Rabaah al-Adawiya mosque, at the site of the largest protest camp of supporters of ousted President Mohammed Morsi, that was cleared by security forces,... (Associated Press) Egyptian army soldiers take positions on top of their armored vehicles while guarding a street that leads to Rabaah al-Adawiya mosque, at the site of the largest protest camp of supporters of ousted President... (Associated Press) Egyptians evacuate a wounded man during clashes between security forces and supporters of Egypt's ousted President Mohammed Morsi in Ramses Street, downtown Cairo, Egypt, Friday, Aug. 16, 2013. Gunfire... (Associated Press) Egyptian Army soldiers take their positions on top of their armored vehicles while guarding an entrance to Tahrir Square, in Cairo, Egypt, Friday, Aug. 16, 2013. Egypt is bracing for more violence after... (Associated Press) The sight of residents firing at one another marked a dark turn in the conflict, as civilians armed with pistols and assault rifle clashed with protesters taking part in what the Muslim Brotherhood called a "Day of Rage," ignited by anger at security forces for clearing two sit-in demonstrations Wednesday in clashes that killed more than 600 people. Military helicopters circled overhead as residents furious with the Brotherhood protests pelted them with rocks and glass bottles. The two sides also fired on one another, sparking running street battles throughout the capital's residential neighborhoods. There was little hope that an evening curfew would curb the violence as the Muslim Brotherhood called on supporters of the country's ousted Islamist president, Mohammed Morsi, to stage daily protests. Unlike in past clashes between protesters and police, residents and possibly police in civilian clothing battled those participating in the Brotherhood-led marches. There were few police in uniform to be seen as neighborhood watchdogs and pro-Morsi protesters fired at one another for hours on a bridge that crosses over Cairo's Zamalek district, an upscale island neighborhood where many foreigners and ambassadors reside. Across the country, at least 56 civilians were killed, along with eight police officers, security officials said. They spoke on condition of anonymity in line with regulations. The violence erupted shortly after midday weekly prayers when tens of thousands of Brotherhood supporters answered the group's call to protest across Egypt in defiance of a military-imposed state of emergency following the bloodshed earlier this week. Armed civilians manned impromptu checkpoints throughout the capital, banning Brotherhood marches from approaching and frisking anyone wanting to pass through. At one checkpoint, residents barred ambulances and cars carrying wounded from Cairo's main battleground, Ramses Square, from reaching a hospital. The scenes highlighted how dangerous the divisions in Egypt have become. At least nine police stations were attacked Friday, officials said. Egypt's police force was rocked by the country's 2011 uprising that ousted longtime leader Hosni Mubarak from power and has not fully recovered since. On Thursday, the Interior Ministry said it had authorized the use of deadly force against anyone targeting police and state institutions. But the threat appeared not to intimidate protesters. The Brotherhood-led marches in Cairo headed toward Ramses Square, near the country's main train station. The area is near Tahrir Square, where the army put up barbed wire and deployed 30 tanks outside the Cairo Museum overlooking the square as a buffer between the protesters and a small anti-Brotherhood encampment in the square. Several of the protesters were seen writing their names and relatives' phone numbers on one another's chests and undershirts in case they were to die in Friday's clashes. Tawfik Dessouki, a Brotherhood supporter, said he was ready to fight for "democracy" and against the military's ouster of Morsi. "I am here for the blood of the people who died. We didn't have a revolution to go back to a police and military state again and to be killed by the state," he said during a march headed toward Ramses Square. At least 12 people were killed near the square after police fired on protesters. Some appeared to be trying to attack a nearby police station, security officials said. Inside Al-Fath mosque near Ramses Square, where the Brotherhood urged its Cairo supporters to converge, blood-soaked bodies with bullets to the head and chest lay next to one another. Associated Press photographers saw many of the dead inside the mosque-turned-morgue, which was also acting as a field hospital where the wounded were being wheeled in on wooden crates. One corpse had a name and phone number scribbled on the chest. The upper floors of a commercial building towering over Ramses Square caught fire later in the day, with flames engulfing it for hours. It was not immediately clear what caused the fire at the building housing the Arab Contractors' construction company, but no injuries were reported. Similar scenes played out in Egypt's second-largest city of Alexandria, where at least 10 people were killed in clashes between protesters and their rivals, according to a security official. Violence was also fierce in the province of Fayoum, just west of Cairo, where 11 people died during an attempt to storm the main security building there. Fighting also broke out in at least five other provinces. In the southern province of Minya, two churches were attacked by protesters, security officials said. At churches across the country, residents formed human chains to protect them from further assaults, and a civilian was killed while trying to protect a church in Sohag, south of Cairo, authorities said. Many of Morsi's supporters have voiced criticism at Egypt's Christian minority for largely supporting the military's decision to oust him from office, and dozens of churches have been attacked this week. Also Friday, security officials said assailants detonated explosives on train tracks between Alexandria and the western Mediterranean Sea province of Marsa Matrouh. There were no injuries and no trains were damaged, officials said, speaking on condition of anonymity in line with regulations. Egypt, the Arab world's most populous nation, has been in turmoil since Morsi was removed from power by the military on July 3, following days of mass protests against him and his Brotherhood group. But Morsi's supporters have remained defiant, demanding the coup be overturned. The international community has urged both sides to show restraint and end the turmoil engulfing the nation. On Wednesday, riot police backed by armored vehicles and bulldozers cleared two sprawling encampments of Morsi supporters, sparking clashes that killed at least 638 people. Some 40 police officers also were killed. The Brotherhood's political wing, the Freedom and Justice Party, said in a statement Friday that the group is not backing down. "The struggle to overthrow this illegitimate regime is an obligation, an Islamic, national, moral and human obligation which we will not steer away from until justice and freedom prevail, and until repression is conquered," the statement said. The group also asserted that its protests were peaceful. The revolutionary and liberal groups that helped topple Morsi have largely stayed away from street rallies in recent weeks. Meanwhile, state-run and private television stations have been broadcasting footage from Wednesday's violence they say shows armed men firing toward security forces. Graphic videos have emerged online portraying the violence from the vantage point of the protesters. One video, authenticated by The Associated Press based on landmarks and reporting from Wednesday's crackdown, shows armored personnel carriers driving protesters back from an area near the main sit-in as continuous volleys of automatic gunfire rang out. In the footage, the crowd was shown retreating after throwing stones at the approaching vehicles, leaving several bloodied men motionless on the ground. After a loudspeaker announcement instructed the crowd to evacuate, promising safe passage, a vehicle approached and the barrel of a weapon emerged from one of its gun ports. ___ Associated Press writer Mariam Rizk contributed to this report.

Summary: Supporters of Mohamed Morsi have turned out in force on the streets of Cairo and elsewhere in Egypt in a "day of rage" to protest this week's crackdown. The usual chaos is evident in attempts to get a count on casualties, but a Reuters correspondent reports seeing 27 bodies in Cairo, where the biggest demonstrations were taking place in Ramses Square. The news service reports a total of 50 killed in the city today, and at least 20 additional deaths elsewhere in the nation; the AP reports that 68 have died. Unlike past clashes between police and protesters, today's include civilians and maybe plainclothes police fighting the Muslim Brotherhood. In fact, few uniformed police officers could be seen as pro-Morsi protesters exchanged shots for hours with neighborhood watchdogs over a bridge in Cairo. Meanwhile, the upper floors of a downtown commercial building caught fire for several hours, but no one was said to be hurt.

multi_news

en

Write a title and summarize: SECTION 1. SHORT TITLE. This Act may be cited as the ``Federal Reserve Audit and Accountability Act''. SEC. 2. APPOINTMENT OF FEDERAL RESERVE BANK PRESIDENTS BY THE PRESIDENT BY AND WITH THE CONSENT OF THE SENATE. (a) In General.--Section 4 of the Federal Reserve Act is amended by inserting after the 4th undesignated paragraph (12 U.S.C. 341; relating to general corporate powers) the following new subsection: ``(e) Bank Presidents and 1st Vice Presidents.-- ``(1) Appointment of president.--The President shall appoint, by and with the consent of the Senate, a president for each Federal reserve bank. ``(2) Appointment of 1st vice president.--The president of each Federal reserve bank shall appoint a first vice president for the bank. ``(3) Terms.--The president and first vice president shall be appointed for terms of 5 years. ``(4) Duty of president.--The president of a Federal reserve bank shall be the chief executive officer of the bank. ``(5) Duty of 1st vice president.--In addition to any other duties of the first vice president of a Federal reserve bank, the first vice president shall, in the absence or disability of the president or during a vacancy in the office of president, serve as chief executive officer of the bank. ``(6) Vacancy.--Whenever a vacancy shall occur in the office of the president or the first vice president, it shall be filled in the manner provided for the original appointment and the person so appointed shall hold office until the expiration of the term to which such person's predecessor was appointed.''. (b) Transition.-- (1) President.--The first appointment of the president for each Federal reserve bank which is made in accordance with the amendment made by subsection (a) shall take place upon the earlier of-- (A) the expiration of the term of the president of the bank who is serving in such office on the date of the enactment of this Act; or (B) the occurrence of the first vacancy in the office of president of the bank after the date of the enactment of this Act. (2) 1st vice president.--Notwithstanding any provision of the Federal Reserve Act, the term of the first vice president of any Federal reserve bank who was appointed to such position before the date of the enactment of this Act shall end as of the date on which the president of the bank is first appointed in accordance with the amendment made by subsection (a) and a first vice president shall be appointed in the manner provided by such amendment. (c) Technical and Conforming Amendment.--The subdivision designated ``Fifth.'' of the 4th undesignated paragraph of section 4 of the Federal Reserve Act (12 U.S.C. 341) is amended-- (1) in the 1st sentence, by striking ``a president, vice presidents, and''; and (2) by striking the 2d, 3d, and 4th sentences and inserting the following new sentence: ``All executive officers and all employees of the bank shall be directly responsible to the president of the bank.''. SEC. 3. GAO AUDITS OF FEDERAL RESERVE BOARD AND FEDERAL RESERVE BANKS REQUIRED; ITEMIZED BUDGETS. (a) Removal of Limitation on GAO Audits.--Section 714(b) of title 31, United States Code, is amended by striking the 2d sentence and inserting the following new sentence: ``In the case of any audit of the Board of Governors of the Federal Reserve System or any Federal reserve bank pursuant to the preceding sentence, the audit may not include transactions for or with a foreign central bank, government of a foreign country, or nonprivate international financing organization or any part of any discussion or communication among or between members of the Board of Governors of the Federal Reserve System or officers or employees of such Board which is related to any such transaction.''. (b) Itemized Budgets.--The Federal Reserve Act (12 U.S.C. 221 et seq.) is amended by inserting after section 11A the following new section: ``SEC. 11B. ITEMIZED BUDGETS. ``(a) In General.--During the first 15 days of each regular session of Congress, the estimated receipts and proposed expenditures of the Board of Governors of the Federal Reserve System and all Federal Reserve Banks for the following fiscal year and the 2 succeeding fiscal years shall be transmitted to the Congress. ``(b) Form of Budget.--The budget submitted pursuant to subsection (a) shall be transmitted in the same form and shall meet the same requirements, other than the requirement relating to the budget message, as the budget of the United States Government transmitted in accordance with section 1105 of title 31, United States Code.''. SEC. 4. PROMPT PUBLIC DISCLOSURE OF OPEN MARKET COMMITTEE MEETINGS. Section 12A of the Federal Reserve Act (12 U.S.C. 263) is amended by adding at the end the following new subsection: ``(d) Prompt Public Disclosures of Meetings.-- ``(1) Transcription of each meeting.--Subject to paragraph (3), a written verbatim transcript of the discussion at each meeting of the Federal Open Market Committee shall be maintained by the Board and made available to the public before the end of the 1-year period beginning on the date of the meeting and shall be treated as a Government publication for purposes of making such material available to depository libraries through the facilities of the Superintendent of Documents in accordance with chapter 19 of title 41, United States Code. ``(2) Prompt disclosure of policy actions.--An explicit, written description of any determination, decision, directive, or other conclusion made by the Federal Open Market Committee at any meeting of the committee, including any directive or instruction sent to any Federal reserve bank or Federal reserve agent in connection with any open market operation, shall be made available to the public by the end of the 1-hour period beginning at the time the Board or any such bank or agent begins to implement any such determination, decision, directive, conclusion, directive, or instruction. ``(3) Limited redaction authority.-- ``(A) In general.--No verbatim transcript made available to the public pursuant to paragraph (1) may be redacted in any way other than to redact a specific reference to a foreign central bank. ``(B) Compliance audit.--The Comptroller General of the United States shall periodically audit compliance by the Board with the requirements of subparagraph (A). ``(4) Release of prior transcripts.--All transcripts maintained by the Board of any meeting of the Federal Open Market Committee which was held more than 1 year before the date of the enactment of the Federal Reserve Audit and Accountability Act shall be made available to the public in the manner provided under paragraph (1) no later than July 1, 1995. ``(5) Meeting includes executive session.--For purposes of this subsection, the term `meeting' includes any executive session of the Federal Open Market Committee or any informal meeting, teleconference call, or other occasion at which a quorum of the members of the committee are participating.''. SEC. 5. STUDY OF PRIVATIZATION OF THE FEDERAL RESERVE PAYMENT SYSTEM. (a) In General.--The Comptroller General of the United States shall conduct a study, in consultation with all interested parties, on-- (1) whether or not the Board of Governors of the Federal Reserve System has set prices for payment system services provided by such Board in a manner which fully and accurately reflects all direct and indirect costs incurred by the Board in providing such services; and (2) the ability of the private sector to fully provide payment system services, including the services being provided as of the date of the enactment of this Act by the Board, and the costs and benefits of privatizing the services which are being provided by the Board as of such date. (b) Report.--The Comptroller General shall prepare and submit a report to the Congress before the end of the 12-month period beginning on the date of the enactment of this Act on the findings and conclusions of the Comptroller General in connection with the study conducted pursuant to subsection (a).

Title: Federal Reserve Audit and Accountability Act Summary: Federal Reserve Audit and Accountability Act - Amends the Federal Reserve Act to declare that the president and first vice-president of each Federal reserve bank shall be appointed by the President, with the consent of the Senate. (Currently such appointment authority is exercised by each Federal reserve bank's board of directors.) Amends Federal law to remove specified limitations placed upon General Accounting Office audits of the Federal Reserve Board and Federal reserve banks. Requires the Board of Governors of the Federal Reserve System and all Federal reserve banks to transmit their estimated receipts and proposed expenditures to the Congress during the first 15 days of each regular session. Mandates prompt public disclosure of Federal Open Market Committee meetings and actions, including policy actions and prior transcripts. Directs the Comptroller General to study and report to the Congress on the feasibility of privatizing the Federal Reserve payment system.

billsum

en

Write a title and summarize: Import (auch: Einfuhr; lateinisch in [wird wegen des nachfolgenden "p" zu im] "in... hinein " und lateinisch portare "tragen, bringen": "hineintragen, einführen") ist im Außenhandel der grenzüberschreitende Kauf von Gütern oder Dienstleistungen aus dem Ausland und deren Lieferung ins Inland. Gegensatz ist der Export. == Allgemeines Grundformen des Außenhandels sind Transithandel, Import und Export, wobei beim Import die Güterströme vom Ausland ins Inland und die Zahlungsströme vom Inland ins Ausland fließen. Die importierenden Wirtschaftssubjekte (Unternehmen, Privathaushalte, der Staat und seine Untergliederungen wie öffentliche Verwaltung und Staatsunternehmen) heißen Importeur und stehen in Handelsbeziehung zum ausländischen Exporteur. Beim Import ist Voraussetzung, dass der Exporteur dem Importeur aufgrund der Lieferungsbedingungen die Güter/Dienstleistungen (im folgenden: Güter) durch Lieferung zum Eigentum überträgt (Eigentumsvorbehalt schadet nicht) und der Importeur aufgrund der Zahlungsbedingungen dem Exporteur den Kaufpreis entrichtet (Lieferantenkredit/Kundenkredit schadet nicht). Die Beschaffung der Güter muss aus dem Ausland erfolgen, wobei es sich auch im gleichen Währungsraum (etwa Deutschland/Frankreich) um Importe handelt. Importe liegen nur bei der vollständigen Eigentumsübertragung vor, so dass die Miete, Leihe, Pacht oder das Leasing allenfalls einen Import von Dienstleistungen darstellen. Zu den Importgütern gehören vor allem Rohstoffe, Handelswaren (beispielsweise Commodities) oder Investitionsgüter (Maschinen). Bei Dienstleistungen gilt als Import der Tourismus ins Ausland, wenn etwa ein Deutscher eine Urlaubsreise ins Ausland unternimmt. Der Import von Buchgeld und Kapital heißt Kapitalimport. == Wirtschaftliche Aspekte Im Hinblick auf die Verarbeitungsstufe gibt es Importe von Rohstoffen oder Halbfabrikaten in der Produktionswirtschaft zwecks Weiterverarbeitung im Inland oder Importe von Fertigerzeugnissen im Handel (Groß- oder Einzelhandel). Importe finden im Rahmen der Außenhandelsfinanzierung statt, weil der Importeur bei Vorschusszahlungen (Vorauszahlung), Zahlung Zug um Zug gegen Lieferung oder bei vorhandenen Zahlungszielen die Güter nach Lieferung zu bezahlen und dabei Kreditinstitute einzuschalten hat. Die Außenhandelsfinanzierung unterstützt hierbei durch Importakkreditiv, Dokumenteninkasso oder Auslandsüberweisung. Der Importwert wird nach internationalen Gepflogenheiten an der Landesgrenze ermittelt, wobei der CIF-Preis zugrunde gelegt wird. Bei der Berechnung des Imports in Deutschland geht das Statistische Bundesamt von Statistiken des Generalhandels aus. Die Deutsche Bundesbank ergänzt den Außenhandelssaldo um den Saldo der Primäreinkommen, die Ergänzungen zum Warenhandel und den Saldo der laufenden Übertragungen zur Leistungsbilanz. Ein Import wird bei gegebener Inlandsnachfrage notwendig, wenn das importierende Land die Güter nicht oder in zu geringen Mengen selbst produziert oder die Produktqualität/Dienstleistungsqualität oder die Preise ungünstiger sind als beim Import (komparativer Kostenvorteil). Im importierenden Staat ergänzt der Import das fehlende Güterangebot. Einfuhren können deshalb im importierenden Staat eine Unterversorgung, Qualitätsmängel oder Preisnachteile ausgleichen. Importlastige Staaten können versuchen, mit Hilfe einer Importsubstitutionspolitik den Außenbeitrag zu Gunsten der Exportquote zu verschieben. Die Einfuhr wirkt sich auf die Handelsbilanz aus, wo sie auf der Passivseite verbucht wird. Importiert ein Staat mehr als er exportiert, liegt entsprechend eine "passive Handelsbilanz" vor. Die Zahlung des Importeurs wird in der Devisenbilanz als Zahlungsausgang berücksichtigt. Sie löst entweder bei Zahlung in Fremdwährung eine Devisennachfrage auf dem Devisenmarkt oder bei Zahlung in Inlandswährung eine Geldnachfrage auf dem Geldmarkt aus. Eine Zahlung in Fremdwährung führt zu einem Abfluss von Devisen, so dass bei hoher Importquote sich ein bestehender Handelsbilanzüberschuss in ein Handelsbilanzdefizit verwandeln kann, das mittelfristig zur Abwertung der Inlandswährung führen kann. Devisenmangel wiederum wirkt sich hemmend auf künftige Importe aus. Das anzustrebende Außenhandelsgleichgewicht ist erst erreicht, wenn Importe I {\displaystyle I} und Exporte E {\displaystyle E} in einem Staat gleich sind: Entsprechend ergibt sich ein Importüberschuss als Ein Importüberschuss führt zu einer passiven Handelsbilanz mit Devisenabflüssen, die die Währungsreserven schmälern und das Volkseinkommen vermindern. Der Import bewirkt zudem eine Erhöhung des Güterangebots auf dem importierenden Gütermarkt. Da gleichzeitig durch die Bezahlung des Imports die inländische Geldmenge abnimmt, kommt es durch Importe zu einem Ungleichgewicht auf Geld- und Gütermärkten, was wie ausländische Preissteigerungen eine Inflation auslöst ("importierte Inflation"). == Rechtsfragen Das Außenwirtschaftsrecht kennt als Rechtsbegriffe die Einfuhr und Ausfuhr. "Einführer" (Importeur) ist gemäß § 2 Abs. 10 AWG jede natürliche oder juristische Person oder Personengesellschaft, die Waren aus Drittländern ins Inland liefert oder liefern lässt und über die Lieferung der Waren bestimmt. Entsprechend ist Einfuhr die Lieferung von Waren aus Drittländern in das Inland (§ 2 Abs. 11 AWG). Der Einfuhr gleichgestellt ist die Übertragung von Software oder Technologie einschließlich ihrer Bereitstellung auf elektronischem Weg. Auch Elektrizität gilt als Ware, Wertpapiere und Zahlungsmittel sind dagegen keine Waren (§ 2 Abs. 22 AWG). Zur Ausgestaltung der Importverträge hinsichtlich Kostenübernahme für Transport, Verpackung, Versicherung und den Gefahrenübergang am Kaufgegenstand werden meist die von der Internationalen Handelskammer (ICC) in Paris seit 1936 veröffentlichten Incoterms (Aktuelle Fassung von 2010) als standardisierte Vertragsklauseln angewandt. Der Importeur hat bei der Einfuhr in das Wirtschaftsgebiet der Europäischen Union für die Entrichtung der fälligen Zölle und Einfuhrumsatzsteuer Sorge zu tragen. == Regulierung Der Staat hat ein Interesse daran, Importe und Exporte zu kontrollieren (Schutz der heimischen Märkte etwa vor Dumping, Waffenhandel). Die Marktregulierung besteht bei Importen aus Einfuhrkontingenten, Einfuhrbewilligungen oder Importzöllen. Ein Handelsembargo kann den Import ganz oder teilweise beschränken. Sie alle wirken restriktiv auf den Import und begrenzen ihn quantitativ und/oder qualitativ. Die von George Stigler 1971 verfasste Theorie der Regulierung lässt erwarten, dass Handelshemmnisse als eine Form von Regulierungen - gleichgültig, ob sie tarifärer oder nicht-tarifärer Natur sind - vom Importland eingeführt und aufrechterhalten werden. Während tarifäre Handelshemmnisse durch die Bestimmungen des GATT bzw. der Welthandelsorganisation (WTO) in der Vergangenheit zunehmend abgebaut wurden, ist die Bedeutung nicht-tarifärer Handelshemmnisse gewachsen. == Schweiz Als Nicht-EU-Land erhebt die Schweiz Zölle auch auf Waren der angrenzenden EU-Länder. Für verschiedene Waren, beispielsweise Kriegswaffen oder Medikamente ist häufig eine Einfuhrbewilligung erforderlich. Für den Import von vielen landwirtschaftlichen Produkten benötigen man eine Generaleinfuhrbewilligung (GEB). Sie wird unter anderem vom Bundesamt für Landwirtschaft auf Gesuch hin natürlichen und juristischen Personen sowie Personengemeinschaften erteilt, die im schweizerischen Zollgebiet Wohnsitz oder Sitz haben. Die GEB gibt kein automatisches Anrecht auf die Einfuhr eines Produkts zum tiefen Kontingentszollansatz (KZA) bzw. Nullzoll; dazu benötigt man eine Zuteilung eines Kontingentanteils oder eine Ausnützungsvereinbarung. Bei vielen landwirtschaftlichen Produkten werden Zollkontingente verteilt z. B. durch Versteigerungen. Besitzt ein Importeur einen Kontingentsanteil, so kann er die entsprechenden Waren zum tieferen KZA/Nullzoll einführen. Besitzt ein Importeur keinen Anteil am Kontingent, muss er den wesentlich höheren Ausserkontingentszollansatz (AKZA) bezahlen. Importe zum AKZA sind jederzeit und in unbeschränkter Menge möglich. == Internationaler Vergleich In der Abbildung sind für die Länder der Triade, also die drei größten Volkswirtschaften der Welt, die Exporte im Verhältnis zum jeweiligen BIP dargestellt, außerdem der Nettoexport im Verhältnis zum BIP. Die Importquoten sind auch im Bild versteckt als Differenz zwischen Exportquote und Nettoexportquote. Steigende Export- und Importquoten sind ein Hinweis auf zunehmende internationale Verflechtung des Welthandels im Zuge der Globalisierung.

Title: Import und Export Summary: Importe sind Waren, die aus dem Ausland ins eigene Land gebracht und dann verkauft werden. Wenn Dinge ins Ausland verkauft werden, spricht man vom Export. Wenn die Handelswaren keine Landesgrenzen überschreiten, ist von Binnenwirtschaft die Rede. Manche Länder importieren eher, andere exportieren eher. Das Land, das momentan am meisten exportiert, ist China, gefolgt von Deutschland und den USA. Viele Länder stellen bestimmte Waren besonders gut oder besonders billig her. Deshalb wollen viele Menschen in anderen Ländern solche Waren von dort kaufen. Einige Schweizer Unternehmen zum Beispiel können besonders gute Turbinen für Kraftwerke bauen. Die exportieren sie in viele andere Länder. Den Stahl dazu haben sie aber nicht aus dem eigenen Land. Den müssen sie aus dem Ausland importieren. Manche Dinge gibt es nur in bestimmten Ländern. Bananen, Kaffee oder Kakao wachsen nur in warmen Ländern. Zudem braucht es viel Handarbeit, bis diese Produkte zum Versand bereit sind und exportiert werden können. Oft bezahlen die Importländer dann auch für diese Waren keinen fairen Preis, deshalb bleiben viele arme Länder arm. Dies gilt auch für viele andere Rohstoffe, die aus dem Bergbau kommen. Europa importiert auch sehr viel Energie, also Erdöl aus dem Nahen Osten oder Erdgas aus Russland. Eine Ausnahme bilden zum Beispiel die Niederlande mit ihren eigenen Gasfeldern. Dadurch wurde Europa von diesen Ländern abhängig: Sie können den Öl- oder Gashahn auch zudrehen. Dann steht unsere Industrie still, wir können nicht mehr heizen und Auto fahren. Import und Export bringen noch weitere Schwierigkeiten mit sich. Es fallen Kosten wie Zölle und Steuern an. Ausserdem verändert sich das Verhältnis zwischen den Währungen täglich: Heute muss man vielleicht mehr Euros für einen Dollar bezahlen als morgen. Das kann beim Handel über die Grenze zu grossen Gewinnen oder Verlusten führen. Importe und Exporte bringen also ein ziemliches Risiko mit sich. Des Weiteren braucht es Unternehmen, die die Waren transportieren. Kleider und Schuhe kommen heute meist per Schiff von Asien nach Europa und werden dann auf dem Lastwagen weiter verteilt. Das braucht viel Platz auf den Strassen und belastet die Umwelt durch Abgase. Noch schlimmer ist es mit Nahrungsmitteln oder Blumen, die mit dem Flugzeug importiert werden. Immer mehr Menschen kaufen darum mittlerweile lieber regional ein. Das heisst sie kaufen bei Händlern, die ihre Ware in der näheren Umgebung herstellen.

klexikon_de

de

Summarize: THE knowledge I had now obtained as to the intention of the savages deeply affected me. Marnoo, I perceived, was a man who, by reason of his superior acquirements, and the knowledge he possessed of the events which were taking place in the different bays of the island, was held in no little estimation by the inhabitants of the valley. He had been received with the most cordial welcome and respect. The natives had hung upon the accents of his voice, and, had manifested the highest gratification at being individually noticed by him. And yet despite all this, a few words urged in my behalf, with the intent of obtaining my release from captivity, had sufficed not only to banish all harmony and good-will; but, if I could believe what he told me, had gone on to endanger his own personal safety. How strongly rooted, then, must be the determination of the Typees with regard to me, and how suddenly could they display the strangest passions! The mere suggestion of my departure had estranged from me, for the time at least, Mehevi, who was the most influential of all the chiefs, and who had previously exhibited so many instances of his friendly sentiments. The rest of the natives had likewise evinced their strong repugnance to my wishes, and even Kory-Kory himself seemed to share in the general disapprobation bestowed upon me. In vain I racked my invention to find out some motive for them, but I could discover none. But however this might be, the scene which had just occurred admonished me of the danger of trifling with the wayward and passionate spirits against whom it was vain to struggle, and might even be fatal to do go. My only hope was to induce the natives to believe that I was reconciled to my detention in the valley, and by assuming a tranquil and cheerful demeanour, to allay the suspicions which I had so unfortunately aroused. Their confidence revived, they might in a short time remit in some degree their watchfulness over my movements, and I should then be the better enabled to avail myself of any opportunity which presented itself for escape. I determined, therefore, to make the best of a bad bargain, and to bear up manfully against whatever might betide. In this endeavour, I succeeded beyond my own expectations. At the period of Marnoo's visit, I had been in the valley, as nearly as I could conjecture, some two months. Although not completely recovered from my strange illness, which still lingered about me, I was free from pain and able to take exercise. In short, I had every reason to anticipate a perfect recovery. Freed from apprehension on this point, and resolved to regard the future without flinching, I flung myself anew into all the social pleasures of the valley, and sought to bury all regrets, and all remembrances of my previous existence in the wild enjoyments it afforded. In my various wanderings through the vale, and as I became better acquainted with the character of its inhabitants, I was more and more struck with the light-hearted joyousness that everywhere prevailed. The minds of these simple savages, unoccupied by matters of graver moment, were capable of deriving the utmost delight from circumstances which would have passed unnoticed in more intelligent communities. All their enjoyment, indeed, seemed to be made up of the little trifling incidents of the passing hour; but these diminutive items swelled altogether to an amount of happiness seldom experienced by more enlightened individuals, whose pleasures are drawn from more elevated but rarer sources. What community, for instance, of refined and intellectual mortals would derive the least satisfaction from shooting pop-guns? The mere supposition of such a thing being possible would excite their indignation, and yet the whole population of Typee did little else for ten days but occupy themselves with that childish amusement, fairly screaming, too, with the delight it afforded them. One day I was frolicking with a little spirited urchin, some six years old, who chased me with a piece of bamboo about three feet long, with which he occasionally belaboured me. Seizing the stick from him, the idea happened to suggest itself, that I might make for the youngster, out of the slender tube, one of those nursery muskets with which I had sometimes seen children playing. Accordingly, with my knife I made two parallel slits in the cane several inches in length, and cutting loose at one end the elastic strip between them, bent it back and slipped the point into a little notch made for the purse. Any small substance placed against this would be projected with considerable force through the tube, by merely springing the bent strip out of the notch. Had I possessed the remotest idea of the sensation this piece of ordnance was destined to produce, I should certainly have taken out a patent for the invention. The boy scampered away with it, half delirious with ecstasy, and in twenty minutes afterwards I might have been seen surrounded by a noisy crowd--venerable old graybeards--responsible fathers of families--valiant warriors--matrons--young men--girls and children, all holding in their hands bits of bamboo, and each clamouring to be served first. For three or four hours I was engaged in manufacturing pop-guns, but at last made over my good-will and interest in the concern to a lad of remarkably quick parts, whom I soon initiated into the art and mystery. Pop, Pop, Pop, Pop, now resounded all over the valley. Duels, skirmishes, pitched battles, and general engagements were to be seen on every side. Here, as you walked along a path which led through a thicket, you fell into a cunningly laid ambush, and became a target for a body of musketeers whose tattooed limbs you could just see peeping into view through the foliage. There you were assailed by the intrepid garrison of a house, who levelled their bamboo rifles at you from between the upright canes which composed its sides. Farther on you were fired upon by a detachment of sharpshooters, mounted upon the top of a pi-pi. Pop, Pop, Pop, Pop! green guavas, seeds, and berries were flying about in every direction, and during this dangerous state of affairs I was half afraid that, like the man and his brazen bull, I should fall a victim to my own ingenuity. Like everything else, however, the excitement gradually wore away, though ever after occasionally pop-guns might be heard at all hours of the day. It was towards the close of the pop-gun war, that I was infinitely diverted with a strange freak of Marheyo's. I had worn, when I quitted the ship, a pair of thick pumps, which, from the rough usage they had received in scaling precipices and sliding down gorges, were so dilapidated as to be altogether unfit for use--so, at least, would have thought the generality of people, and so they most certainly were, when considered in the light of shoes. But things unservicable in one way, may with advantage be applied in another, that is, if one have genius enough for the purpose. This genius Marheyo possessed in a superlative degree, as he abundantly evinced by the use to which he put those sorely bruised and battered old shoes. Every article, however trivial, which belonged to me, the natives appeared to regard as sacred; and I observed that for several days after becoming an inmate of the house, my pumps were suffered to remain, untouched, where I had first happened to throw them. I remembered, however, that after awhile I had missed them from their accustomed place; but the matter gave me no concern, supposing that Tinor--like any other tidy housewife, having come across them in some of her domestic occupations--had pitched the useless things out of the house. But I was soon undeceived. One day I observed old Marheyo bustling about me with unusual activity, and to such a degree as almost to supersede Kory-Kory in the functions of his office. One moment he volunteered to trot off with me on his back to the stream; and when I refused, noways daunted by the repulse, he continued to frisk about me like a superannuated house-dog. I could not for the life of me conjecture what possessed the old gentleman, until all at once, availing himself of the temporary absence of the household, he went through a variety of of uncouth gestures, pointing eagerly down to my feet, then up to a little bundle, which swung from the ridge pole overhead. At last I caught a faint idea of his meaning, and motioned him to lower the package. He executed the order in the twinkling of an eye, and unrolling a piece of tappa, displayed to my astonished gaze the identical pumps which I thought had been destroyed long before. I immediately comprehended his desire, and very generously gave him the shoes, which had become quite mouldy, wondering for what earthly purpose he could want them. The same afternoon I descried the venerable warrior approaching the house, with a slow, stately gait, ear-rings in ears, and spear in hand, with this highly ornamental pair of shoes suspended from his neck by a strip of bark, and swinging backwards and forwards on his capacious chest. In the gala costume of the tasteful Marheyo, these calf-skin pendants ever after formed the most striking feature. But to turn to something a little more important. Although the whole existence of the inhabitants of the valley seemed to pass away exempt from toil, yet there were some light employments which, although amusing rather than laborious as occupations, contributed to their comfort and luxury. Among these the most important was the manufacture of the native cloth,--'tappa',--so well known, under various modifications, throughout the whole Polynesian Archipelago. As is generally understood, this useful and sometimes elegant article is fabricated from the bark of different trees. But, as I believe that no description of its manufacture has ever been given, I shall state what I know regarding it. In the manufacture of the beautiful white tappa generally worn on the Marquesan Islands, the preliminary operation consists in gathering a certain quantity of the young branches of the cloth-tree. The exterior green bark being pulled off as worthless, there remains a slender fibrous substance, which is carefully stripped from the stick, to which it closely adheres. When a sufficient quantity of it has been collected, the various strips are enveloped in a covering of large leaves, which the natives use precisely as we do wrapping-paper, and which are secured by a few turns of a line passed round them. The package is then laid in the bed of some running stream, with a heavy stone placed over it, to prevent its being swept away. After it has remained for two or three days in this state, it is drawn out, and exposed, for a short time, to the action of the air, every distinct piece being attentively inspected, with a view of ascertaining whether it has yet been sufficiently affected by the operation. This is repeated again and again, until the desired result is obtained. When the substance is in a proper state for the next process, it betrays evidences of incipient decomposition; the fibres are relaxed and softened, and rendered perfectly malleable. The different strips are now extended, one by one, in successive layers, upon some smooth surface--generally the prostrate trunk of a cocoanut tree--and the heap thus formed is subjected, at every new increase, to a moderate beating, with a sort of wooden mallet, leisurely applied. The mallet is made of a hard heavy wood resembling ebony, is about twelve inches in length, and perhaps two in breadth, with a rounded handle at one end, and in shape is the exact counterpart of one of our four-sided razor-strops. The flat surfaces of the implement are marked with shallow parallel indentations, varying in depth on the different sides, so as to be adapted to the several stages of the operation. These marks produce the corduroy sort of stripes discernible in the tappa in its finished state. After being beaten in the manner I have described, the material soon becomes blended in one mass, which, moistened occasionally with water, is at intervals hammered out, by a kind of gold-beating process, to any degree of thinness required. In this way the cloth is easily made to vary in strength and thickness, so as to suit the numerous purposes to which it is applied. When the operation last described has been concluded, the new-made tappa is spread out on the grass to bleach and dry, and soon becomes of a dazzling whiteness. Sometimes, in the first stages of the manufacture, the substance is impregnated with a vegetable juice, which gives it a permanent colour. A rich brown and a bright yellow are occasionally seen, but the simple taste of the Typee people inclines them to prefer the natural tint. The notable wife of Kamehameha, the renowned conqueror and king of the Sandwich Islands, used to pride herself in the skill she displayed in dyeing her tappa with contrasting colours disposed in regular figures; and, in the midst of the innovations of the times, was regarded, towards the decline of her life, as a lady of the old school, clinging as she did to the national cloth, in preference to the frippery of the European calicoes. But the art of printing the tappa is unknown upon the Marquesan Islands. In passing along the valley, I was often attracted by the noise of the mallet, which, when employed in the manufacture of the cloth produces at every stroke of its hard, heavy wood, a clear, ringing, and musical sound, capable of being heard at a great distance. When several of these implements happen to be in operation at the same time, near one another, the effect upon the ear of a person, at a little distance, is really charming.

Summary: Mehevi and the other chiefs seem slightly angry at Tommo after Marnoo leaves. Even Kory-Kory appears to bear him a small grudge. Tommo now has been in the valley for about two months and his leg feels so well that he moves around easily. One day he makes a small "pop-gun" out of bamboo for a six-year old boy, which shoots items out when one blows on it. The boy is fascinated. Soon after, groups of men and women appear and beg Tommo to make more. He does so, and they all run around like children playing with the guns. Their excitement continues for almost ten days. Tommo stops wearing the shoes that he brought from the ship and he ties them in his bundle near the roof. One day Marheyo suggests interest in them and Tommo gives them to him. Marheyo starts wearing the shoes on a strap around his chest, as a bizarre necklace. The Typees do not work very frequently, but one task with which most women assist is the making of the cloth, or "tappa. Tappa making involves boiling branches from trees and stretching fibers. The process is described in full.

booksum

en

Summarize: By. Kerry Mcdermott and Daily Mail Reporter. PUBLISHED:. 19:30 EST, 28 March 2013. |. UPDATED:. 09:19 EST, 29 March 2013. Thousands of North Koreans have turned out for a mass rally at the main square in Pyongyang in support of their leader's call to arms. Chanting 'Death to the U.S. imperialists' and 'Sweep away the U.S. aggressors,' soldiers and students marched through Kim Il Sung Square in downtown Pyongyang during a 90-minute rally. State media reported early today that leader Kim Jong Un called an emergency military meeting to order the army's rocket unit to prepare to strike the U.S. and South Korea in case of a'reckless provocation' by Washington or Seoul. Scroll down for video. Kim Jong-un giving instructions while inspecting the North Korean army's landing exercise on the eastern coast on Monday. 'Deterrence': A B-2 stealth bomber (right) soars through the sky over a U.S. air base in Pyeongtaek, South Korea, amid rising tension between the country and its neighbour to the North. A full-blown North Korean attack is unlikely, though there are fears of a more localized conflict. Pyongyang has railed against the U.S. decision to send B-2 bombers for military drills with South Korea. The country's official KCNA news. agency reports that Kim Jong Un has signed off on orders to train sights on. bases in South Korea and the Pacific following a meeting with top. generals. The news comes just hours after U.S. stealth bombers with. nuclear-capability took to the skies over South Korea on Thursday. Relations between South Korea and its neighbor to the North have continued to. deteriorate in recent days and KCNA reports that Kim Jong Un had 'judged the. time has come to settle accounts with the U.S. imperialists in view of. the prevailing situation.' The agency said: 'He finally signed. the plan on technical preparations of strategic rockets of the KPA,. ordering them to be standby for fire so that they may strike any time. the U.S. mainland, its military bases in the operational theaters in the. Pacific, including Hawaii and Guam, and those in South Korea.' Nuclear-capable: The U.S. has said previous drills were prompted by escalating North Korean rhetoric. Practice runs: A U.S. Air Force B-2 Spirit bomber is seen landing at Whiteman Air Force Base in Missouri earlier this month. These images - which show a pair of. U.S. Air Force B-2 bombers soaring over an American military base south. of Seoul - were taken after it emerged North Korea had digitally. doctored a state photo of military hovercraft to make the fleet appear. bigger than it was. The drill over the base in Pyeongtaek today is likely to aggravate already simmering tensions on the Korean peninsula. The drill was carried out after North. Korea declared it was severing its key hotline to Seoul yesterday, amid. anger over joint U.S. and South Korean military drills and tough. sanctions imposed in the wake of Pyongyang's recent nuclear test. The South Korean news agency Yonhap said the drills were described by the U.S. as 'deterrence missions'. It quoted a military source as saying the drill involved the bomber - capable of deploying both nuclear and conventional weapons - striking a mock target. This week Pyongyang, which is dealing with tightened economic sanctions following its internationally condemned decision to launch a third nuclear test last month, repeated threats to target U.S. military bases in response. Tensions: The drill involved the bomber striking a mock target, according to South Korean news agency Yonhap. 'Target': North Korea has previously threatened the U.S. with nuclear war and rehearsed drone attacks on South Korea. The rhetoric from North Korea - which. has threatened the United States with nuclear war and rehearsed drone. attacks on South Korea - and Washington's hardening reaction, has drawn. more concern from China, Pyongyang's only major ally. China has described the situation as'sensitive'. Pyongyang says United Nations sanctions,. agreed after North Korea carried out a third nuclear test in February,. are part of a Washington-led plot to topple its leadership. 'From this moment, the Supreme. Command of the Korean People's Army will be putting into combat duty. posture No. 1 all field artillery units, including long-range artillery. units and strategic rocket units, that will target all enemy objects in. U.S. invasionary bases on its mainland, Hawaii and Guam, the North's. KCNA news agency said on Tuesday. The order was issued in a statement from the North Korea's military'supreme command'. The Pentagon condemned North Korea's rhetoric, saying it was designed to 'raise tensions and intimidate others'." Bomber: One of the U.S. Air Force B-2 Spirit stealth bombers is seen in the skies over the Korean peninsula today. Drills: Relations between the two Koreas have continued to deteriorate since the North's latest nuclear test. 'They need to stop threatening peace. on the peninsula. That doesn't help anyone... and we stand ready to. respond to any contingency,' Pentagon spokesman George Little told. reporters. South Korea's defense ministry has. said it saw no sign of imminent military action by North Korea and most. military analysts say Pyongyang will not risk a conflict with the United. States that it would lose. South Korea and the U.S. military are. conducting military drills until the end of April, which they have. stressed are strictly defensive in nature. The North accused Washington of war. preparations in the wake of drills carried out earlier this month which. saw bombers soaring over the peninsula. The latest show of strength in the. South comes after a photograph of North Korean army hovercraft issued by. the country's state media was found to have been digitally doctored. Close examination of the suspicious. photograph suggested officials had resorted to Photoshop to turn five. military hovercraft into eight. Suspicious: North Korea's state-issued photograph purported to show eight military hovercraft storming a beach, but close inspection suggests some vessels were digitally added

Summary: Thousands of North Koreans have turned. out for a mass rally at the main square in Pyongyang in support of their. leader's call to arms. State media reports that Kim Jong Un has ordered rocket units be placed on standby to attack bases n South Korea and the Pacific. Move comes hours after images show U.S. Air Force stealth bombers in the skies over Pyeongtaek. Drill came after North Korea declared it was severing last hotline to South. Tensions on Korean peninsula rising after Pyongyang's latest nuclear test.

cnn_dailymail

en

Summarize: The morbidly obese woman who became known as the 'Half-Ton Killer' has revealed why she falsely confessed to the murder of her toddler nephew. In a new trailer for TLC special Half-Ton Killer: Transformed, 33-year-old Mayra Rosales' lawyer Sergio Valdez visits her in the hospital and tells her: 'You know, all of this was brought. upon because you wanted to take the blame.' 'She's my sister,' Mayra says of why she took the fall for the crime. 'And it hurts to know that she's there,' she adds while choking back tears, referring to her sister Jaime's current 15-year prison sentence for abusing her child. Scroll down for video. Protective sibling: Mayra Rosales, who became known as the 'Half-Ton Killer', has revealed why she falsely confessed to the murder of her toddler nephew to cover for her sister Jaime. Consolation: 'I know she was your sister, and I know it was a hard decision,' says her lawyer Sergio Valdez in an upcoming TV special, holding her hand to comfort her as she lies in a hospital bed. 'I know she. was your sister, and I know it was a hard decision,' says her lawyer, holding her hand to comfort her as she lies in a hospital bed. He adds that his next step to help Mayra - who weighed 1,000 pounds at her heaviest - is to get her criminal record expunged of the false murder charges. In 2008, Mayra rose to fame when she confessed to the murder of her two-year-old nephew Eliseo, claiming that she accidentally rolled on top of him and smothered him with her 1,000-pound body. She was acquitted in 2011, however, after evidence concluded that the boy had multiple injuries to his skull that were not indicative of being smothered. Transformation: Mayra, once the world's heaviest woman, has lost a staggering 600lbs in the five years since she shot to fame as the 'Half-Ton Killer' (pictured at her heaviest weight of 1,000lbs) Then and now: She displays a much slimmer figure in a number of recent Facebook selfies, and she revealed to ABC News on Monday that she currently weighs about 200lbs. Today: The upcoming TV special, which airs tonight at 9pm, reveals how Mayra's life has changed since the murder trial that rocked her life. At the time, Mr Valdez told the court: 'It would have required her to have to swing her arm to strike the child on the head but she could never move her arm in that manner.' Mayra then testified that she witnessed her sister Jaime using a brush to hit her son Eliseo repeatedly on his arms, legs and head. 'I thought I was dying anyway so I decided to admit that I'd done it to protect my sister because I love her,' she told the court. WATCH: Mayra Rosales, the 'Half-Ton Killer' Not guilty: Mayra was acquitted of murder in 2011 after evidence concluded that the boy had multiple injuries to his skull that were not indicative of being smothered. Her sister Jaime was later found guilty. Emergency: In another trailer for the TV special, Mayra is wheeled out of her home and transported to hospital in a U-Haul because she is too big for an ambulance. Since then, Mayra has embarked on a grueling endeavor to lose weight with the help of diet, exercise and surgery, so she can be fit enough to adopt and look after her sister's three surviving children. But despite the fact that she had lost an incredible 400lbs at the time this scene in the episode was filmed, Mayra can't help tearing up when she thinks about what her sister is going through. In the clip, Mr Valdez tries to reassure her, saying: 'You know what? You were. going to die in there. You live, you get the medical attention you need,. and everybody moves on.' Mayra nods as he continues: 'The kids are fine with grandma, and you will be. much better.' Mr Vandez reaches in for a hug, and Mayra whispers: 'Thank you.' Weight loss: Despite the fact that she had lost an incredible 400lbs at the time this scene was filmed, Mayra can't help tearing up when she thinks about what her sister is going through. Support: Mayra gives her and lawyer a triumphant high five to demonstrate her improved mobility. Mayra tips the scale at 600lbs in the. episode, but recent pictures on her Facebook page show just how. dramatic her weight loss is today. Indeed,. the former 'fattest woman in the world' displays a much slimmer figure. in a number of selfies, and she revealed to ABC News on Monday that she. currently weighs about 200lbs. The. upcoming TV special, which airs tonight at 9pm, reveals how Mayra's. life has changed since the murder trial that rocked her life. Real criminal: Mayra's sister Jaime (pictured) was found guilty of causing injury to her own child, and is currently serving a 15-year sentence. Taking the blame: 'I thought I was dying anyway so I decided to admit that I'd done it to protect my sister because I love her,' Mayra said of confessing to the murder of her nephew Eliseo (pictured) In it, she will explain that her effort to get fit has mostly been driven by her desire to take care of her nieces and nephews. 'They were the first to know when I was able to stand up for the first time, and then when they saw me walking, they saw me walk in the door, they were very excited,' she told ABC News. 'They are my motivation.' Half-Ton Killer: Transformed airs on TLC on December 4 at 9/8c

Summary: Mayra Rosales became known as the 'Half-Ton Killer' in 2008 when she told police she accidentally killed her nephew Eliseo, two, by rolling on top of him with her 1,000-pound body. She was found not guilty after evidence proved she was 'too fat' to cause the injuries that led to his death. Her sister Jaime is currently serving a 15-year sentence for abusing the child.

cnn_dailymail

en

Summarize: In this month's GLAMOUR magazine, our brand new cover star Kate Winslet talks all about being a working mum, the perils of Hollywood and why she still thinks acting is scary. As you all probably know by now, the Reading-born actress has just given birth to a baby boy with Ned RocknRoll, the nephew of Richard Branson. The couple met while holidaying on Branson's Necker Island. Surely everyone remembers THAT holiday, y'know, when Kate carried Branson's elderly mother to safety after a house fire - yeah, that one! The baby, Kate's third, has been named Bear, and in this month's GLAMOUR, she's pretty matter-of-fact about the whole thing. On being asked if they'd take Ned's surname, she said: "We haven't ever really had that conversation; it was always going to have my name. Mia and Joe have it as part of their name, so it would be weird if this baby didn't. Of course we're not going to call it RocknRoll. People might judge all they like, but I'm a fucking grown-up." On the subject of new parenthood, Kate reveals her body is the last thing on her mind, so don't be expecting any Kim Kardashian-style belphie anytime soon. "Having just had a baby, I'm not going to be thinking about my arse," Kate says. The Oscar-winning actress admits that being a parent is what drew her to her latest movie, Labor Day. She told GLAMOUR that it's "a part I could not have played had I not been a parent. Ultimately, I was drawn to it because it's a film about the desire for a family - and family has played such a role in my life. It's my core, really." But if you think Kate is all confident about her successful acting career, think again! "Acting is bloody scary. I still have moments when I think 'I can't do this - everybody thinks I'm absolutely shit.'" Labor Day is out in cinemas from 7 February. Read the FULL interview in this month's GLAMOUR magazine, on newsstands NOW! SUBSCRIBE TO GLAMOUR AND GET FREE DIGITAL ACCESS Kate Winslet‘s announcement that she was expecting a baby with husband Ned Rocknroll proposed a very popular question: would there be a new little rocknroller in the world? But the actress, who welcomed son Bear on Dec. 7, tells Glamour U.K. that, despite the speculation, there was never a choice to be made when it came to her baby boy’s last name. “We haven’t ever really had that conversation; it was always going to have my name,” Winslet, 38, says. “Of course we’re not going to call it Rocknroll. People might judge all they like, but I’m a f—— grown-up.” Winslet adds that her children from previous relationships, Mia, 13, and Joe, 10, “have it as part of their name, so it would be weird if this baby didn’t.” Chris Craymer The mom-of-three is well-aware of the fact that her decision to wed for a third time and welcome a third baby did not sit well in the press. However, despite the criticism, Winslet refuses to defend her choices. “No one has a right to comment on anyone’s life or the choices I do or don’t make. It’s very easy to be judgmental until you know someone’s truth. People have no idea at all,” she says. “It baffles me, truly, that you can publicly treat a person like that. It’s not very nice.” Winslet adds, “I’m really sorry to the nation’s press that I fell in love and got pregnant; I do apologize if you deem that irresponsible.” Calling her growing family her “core,” the actress credits her three children for providing her with the tools needed to star in her new movie, Labor Day. “[It's] a part I could not have played had I not been a parent. Ultimately, I was drawn to it because it’s a film about the desire for a family — and family has played such a role in my life,” she says. And it’s a role Winslet is not willing to relinquish, preferring to juggle her responsibilities as a mother without much hired help. “The reality is I absolutely love my little life … I trundle along; we have friends over; I make dinner,” she says. Chris Craymer “Sure, I could have lots of people who do the cooking, the driving, all that jazz — but I would be unhappy. I wouldn’t want my children raised that way.” Reveling in her recent professional and personal successes leaves little time for Winslet to worry about her post-pregnancy assets. “Having just had a baby, I’m not going to be thinking about my arse,” she explains. Instead, she is focused on providing her children with a “childhood like I had, where you climb trees and graze your knee.” She adds, “All our families are so excited [about Bear]. And it’s Ned’s first baby — I can’t wait for that bit, actually.” – Anya Leon

Summary: For all of you who were waiting with bated breath to see whether Kate Winslet and Ned Rocknroll would saddle their child with his father's unfortunate last name, well, that was never an option. "It was always going to have my name. [Her first two children] Mia and Joe have it as part of their name, so it would be weird if this baby didn't. Of course we're not going to call it Rocknroll," Winslet tells Glamour UK. "People might judge all they like, but I'm a f---ing grown-up." (The couple will, however, force their son to go through life with the name Bear.) People reports that an indignant Winslet also discusses her treatment in the media, which didn't take well to the idea of her marrying for a third time and having another baby. "I'm really sorry to the nation's press that I fell in love and got pregnant; I do apologize if you deem that irresponsible," she says. "No one has a right to comment on anyone's life or the choices I do or don't make. It's very easy to be judgmental until you know someone's truth. People have no idea at all. It baffles me, truly, that you can publicly treat a person like that. It's not very nice."

multi_news

en

Summarize: A boy who aimed a laser pointer from a toy at the rearview mirror inside a public bus in Germany permanently damaged the retina of the bus driver's right eye, a new case report reveals. The boy was playing with a laser pointer while sitting about 50 feet (15 meters) away from the driver, according to the case report. When the child pointed the laser at the rearview mirror inside the bus, a beam of red light emitted by the toy reflected off the mirror and into the eye of the 44-year-old bus driver, according to a report published online Oct. 5 in the journal BMJ Case Reports. Laser pointers are handheld, penlike devices typically used in lectures and business presentations to emphasize information. They are also used by astronomy buffs to point out planets and stars in the sky, and the devices are present in some children's toys as well. The boy's laser was part of a toy, and initially, the light caused blurred vision in the bus driver's right eye. After this blurriness had continued for six months, the driver sought help from an eye doctor. After examining the driver, an ophthalmologist diagnosed a subtle but detectable injury to the macula, an area near the center of the retina that is responsible for central vision. However, the vision in the driver's left eye remained normal. [9 Odd Ways Your Tech Devices May Injure You] The driver had looked into the rearview mirror about three or four times, to try to identify the passenger who was holding the laser, causing additional exposure that increased his chances for an eye injury, the report said. This is the first reported case of retinal injury caused by the laser beam of a toy, the doctors wrote in the man's case report. Laser dangers The light from a laser beam, even if it is reflected off a mirror, can be absorbed by pigmented structures within the retina that can generate heat, and cause a tiny burn, said Dr. Vincent Patalano, chief of ophthalmology at Cambridge Health Alliance and an assistant professor of ophthalmology at Harvard Medical School in Boston, who was not involved in the case. That tiny burn can destroy a small area of the retina, which damages the central part of a person's visual field, he said. Although lasers can be used to treat some vision problems, such as the damage to the retina that sometimes occurs in people with diabetes, patients are told to never stare directly at the light, and the laser is used for a very short time, Patalano told Live Science. The light that lasers emit has several properties that can make it dangerous to unprotected eyes. Laser-produced light stays together in one narrow path, and it is focused on one small point, Patalano said. Laser light is also one color, and the eyes are more sensitive to certain colors of light than others, he said. In this case, though, the laser was red, which is not as harmful to the eyes as blue or green lasers, he said. The intensity of laser light also makes a difference, Patalano said. Although the exact energy output of the boy's toy laser pointer was not known, it was likely a low-energy laser, the case report said. There's not much that can be done to correct this type of vision damage, Patalano said. It's not clear why the laser affected the man's right eye only, but it could be that the beam reflected at a slightly different angle in each eye, Patalano suggested. There have been other reported incidents of laser pointers being misused, causing eye problems or putting people at risk of injury. According to a report by the Federal Aviation Administration (FAA), fans have disrupted sporting events by aiming laser pointers at athletes, and people have shined laser pointers at airplanes or helicopters. This is a federal crime in the United States because the glare can temporarily blind pilots, making it difficult for them to safely fly and land an aircraft. Pilots reported about 3,900 laser incidents to the FAA in 2014, and nearly 4,000 of them in 2013, according to the agency. The case report authors conclude by recommending that because kids are unlikely to understand the possible risks of lasers, children should not be allowed to use the devices. Follow Live Science @livescience, Facebook & Google+. Originally published on Live Science. BMJ Case Reports 2015; doi:10.1136/bcr-2015-210311 Retinal damage induced by mirror-reflected light from a laser pointer Next Section Summary The safety of laser pointers is a major public health issue since class I and II laser pointers are available worldwide and used as toys by children despite several reports cautioning such use. Here we present the first case of retinal injury caused by the laser beam of a toy laser pointer operated by a school boy and directed via the rear-view mirror of a bus into the eye of the driver. This case emphasises the great importance of cautious and appropriate use of low-energy laser pointers. Laser pointers of any class should not be made available to children because they are unlikely to understand the risks of such lasers when using them in play. Previous Section Next Section Case presentation A 44-year-old public bus driver who was previously healthy with a full bilateral best-corrected visual acuity (BCVA) of 1.0 (20/20) was exposed to the laser beam of a toy laser pointer handled by a school boy (figure 1B) from a distance of about 16.5 m (figure 1A). The beam was reflected in the inside rear-view mirror of the bus, and the driver stared into the laser light several times in order to locate the person holding the laser. Immediately after this exposure the driver complained of blurred vision in his right eye that had persisted for 6 months when the first complete ophthalmological examination was carried out. View larger version: Download as PowerPoint Slide Figure 1 (A–D) Reconstruction of the laser beam reflection in the public bus (A). The laser beam travelled 16.5 m from its source into the driver's eye when he viewed it several times via the inside rear-view mirror. (B) Typical handheld toy laser pointer with an output power of 5 mW. (C) Maximum permissible exposure (MPE) as power density versus exposure time for various wavelengths. (D) Maximum allowed exposure time to a laser with an optical power of 1 and 5 mW.11 The maximum permissible power density of laser beams versus exposure time for various wavelengths is shown in figure 1C, while the maximum allowed exposure time of a laser pointer with output powers of 1 and 5 mW is shown in figure 1D. Upon presentation, the driver's BCVA was 0.8 OD and 1.0 OS. Slit-lamp biomicroscopy revealed no abnormalities in the anterior segment of either eye. Intraocular pressure was normal. Dilated ophthalmoscopy revealed barely visible retinal pigment epithelium disturbances within the temporal macula of his right eye (figure 2A) and no pathological changes in his left eye (figure 2B). A paracentral scotoma extended at up to 25° of eccentricity in his right eye (figure 2H,J), with a normal visual field in his left eye (figure 2I,K). Optical coherence tomography revealed spot-like retinal pigment epithelium disturbances temporal to the fovea of the right eye (figure 2G), with no abnormalities in his left eye (not shown). Infrared and autofluorescence images of both eyes showed normal macula patterns (figure 2C–F). Visual evoked potentials were normal and identical in both eyes (figure 2L). However, multifocal electroretinography (mfERG) showed paracentral focal disturbances with altered sum peak in the right eye (figure 2M). The mfERG of his left eye was normal (figure 2N). View larger version: Download as PowerPoint Slide Figure 2 Fundus photography of the right eye (A) and left eye (B) with subtle pigment epithelium disturbances temporal to the fovea of the right eye. (C–F) Infrared image and autofluorescence photographs of both eyes without detectable changes in the central retinas. (H–K) Visual fields of the right eye (H and J) and left eye (I and K). A clear nasal paracentral scotoma in the left eye was detected with a Humphrey 30–2 device (H) and microperimetry (J). The visual field of the left eye was normal. (I and K) (G) Optical coherence tomography of the right eye with subtle pigment epithelium defects and interruption of the photoreceptor layer (arrow) correlating with the location of the paracentral scotoma in the right eye. The configuration of the left eye was normal (not shown). (L) Visual evoked potentials were normal in both eyes. (M and N) Multifocal electroretinography (mfERG) of the right eye (M) with focal paracentral disturbances and sum-peak reduction (left) compared to the reference (right) and the normal mfERG of the left eye (N) compared to the reference (right). Previous Section Next Section Global health problem list The subjective complaints and objective ophthalmological findings of this patient were consistent and strongly suggested that the repetitive exposure of the eye to the reflected laser spot 6 months previously had caused subtle but detectable injury to the macula. Although the exact energy of the handheld laser pointer was not determined, the descriptions and reports of those involved suggested that it was a class II or class 3R laser device (1 or 5 mW). In addition, the bus driver had looked at least three or four times into the mirror in order to locate the laser source, implying that he had received a minimum of least 10 s of cumulative exposure to the laser beam. Most cases of laser-induced maculopathies are based on accidental exposure to high-energy class IV lasers with laboratory, medical, recreational,1–3 or civil and military applications.4 Lower-energy class IIIa lasers pose little risk of retinal damage5 when used properly, but there are case reports of retinal damage caused by direct exposure to class IIIa commercial laser pointers,6–9 and to higher-energy class IIIb laser pointers.8–10 The risk of damage to the retina varies with the energy of the laser device and the duration and number of exposures. Repeated exposure to a low-energy green laser pointer can result in maculopathy and delayed choroidal neovascularisation.4 Handheld laser pointers typically have output energies in the range of 1–5 mW; the output power of toy laser pointers is limited to 1 mW.

Summary: Bus drivers already have to put up with so much; maybe we shouldn't let children shine laser pointers in their eyes on top of everything else. Live Science reports a German bus driver suffered permanent eye damage when a child bounced a toy laser off his rearview mirror and directly into his right eye from approximately 50 feet away. It must have been a one-in-a-million shot, as it's the first-ever reported case of someone being injured by the laser from a child's toy, say doctors in a report published in BMJ Case Reports. "The safety of laser pointers is a major public health issue," the report states, adding that they should be off limits to kids. The driver had blurry vision for six months before finally going to an eye doctor, who discovered he had a "subtle" injury to his retina. The injury affects the center of the driver's field of vision, and not much can be done to fix it. If hit at the right angle, lasers can cause small burns when they are absorbed by "pigmented structures" in the retina, according to Live Science. The bus driver apparently increased his likelihood of injury by looking in the rearview mirror multiple times to figure out who was shining a laser around. The incident left the authors of the report with one conclusion: "Laser pointers of any class should not be made available to children because they are unlikely to understand the risks of such lasers when using them in play."

multi_news

en

Summarize: Background Created by Congress in 1934, SEC’s primary mission is to protect investors; maintain fair, honest, and efficient securities markets; and facilitate capital formation. To fund its operations, SEC collects fees that are deposited into a special SEC appropriations account to be used as offsetting collections. These fees are charged to (1) public companies for the registration of stocks and bonds for sale to investors, (2) national securities exchanges and national securities associations when registered securities and security futures are sold on or off exchanges through any member of such an association, and (3) persons filing proxy solicitations for mergers, consolidations, acquisitions, or sales of a public company’s assets. In carrying out its mission, the agency has established four major goals: (1) promote and enforce compliance with federal securities laws, (2) sustain a flexible and effective regulatory environment, (3) promote informed investment decision making, and (4) maximize its use of resources. SEC works to achieve these goals through its various divisions and offices. GAO has issued a number of reports and testimonies addressing SEC’s staffing and workload and certain aspects of its human capital and budget challenges. Organizational Overview As of September 30, 2003, SEC had 3,208 staff working in four divisions and 18 offices in Washington, D.C., and in 11 regional and district offices. Of these, approximately 44 percent were attorneys, 22 percent were accountants or financial analysts, and 6 percent were investigators or examiners. The remaining 28 percent included other professional, technical, administrative, and clerical staff. SEC oversees the activities of a variety of key market participants. In 2003, SEC was responsible for overseeing 13 registered exchanges, the over-the- counter market, approximately 70 alternative trading systems, 11 registered clearing agencies, about 6,800 registered broker-dealers employing over 700,000 registered representatives, almost 8,000 transfer agents, over 5,000 investment companies, and approximately 8,000 registered investment advisers. In addition, over 17,000 companies that have issued securities filed annual reports with SEC. SEC’s oversight includes rule making, surveilling the markets, interpreting laws and regulations, reviewing corporate filings, processing applications, conducting inspections and examinations, and determining compliance with federal securities laws. SEC Staffing and Workload Issues In our previous reports on SEC, we found that SEC faced high staff turnover, ongoing vacancies, and increasing resource needs. Specifically, in our September 2001 report, we noted that over 1,000 employees, or about one-third of SEC staff, left the agency from fiscal years 1998 to 2000, and that 280 positions remained unfilled in September 2001. In our March 2002 report, we stated that since 1996, SEC’s staff resources had not grown commensurate with its workload. We noted that SEC tended to develop its annual budget request based on the previous year’s appropriation rather than on what it would actually need to fulfill its mission. The result was that the modest growth in staff resources in the 1990s at SEC was insufficient to manage its workload. In addition, we reported that additional funding was necessary to meet SEC’s IT needs. Like the rest of the government, SEC’s challenges in the area of IT continue to increase, and SEC staff must have the necessary tools to successfully meet the agency’s increasing demands. Changes in the securities markets contributed to the increase in SEC’s workload. U.S. capital markets have experienced substantial growth in the last two decades. The increased volume of shares traded in the U.S. stock market in this period and an array of new products and market participants have led to increasing demands on SEC’s regulatory capacity. The 1990s also witnessed tremendous growth in the internationalization of the U.S. securities market. In addition, many more individuals became investors in the U.S. stock market through buying shares in mutual funds. This further elevated SEC’s importance as a regulator. Congress Takes Action to Address SEC’s Human Capital and Budget Challenges SEC’s staff issues and a series of corporate failures and accounting scandals, including the bankruptcies of Enron in December 2001 and WorldCom in July 2002, caught Congress’s attention and raised significant concern about SEC’s ability to effectively carry out its mission. Congress recognized SEC’s challenges and enacted a number of legislative changes to address them, including the Investor and Capital Markets Fee Relief Act, which rationalized SEC’s fee structure and exempted SEC from general federal pay restrictions and provided the agency with pay parity—the authority necessary to bring salaries in line with those of other federal financial regulators. Sarbanes-Oxley, which authorized appropriations of $776 million to the agency in the fiscal year 2003 budget. SEC increased its initial fiscal year 2003 budget request of $466 million to $769 million in part because of the level authorized in Sarbanes-Oxley. The Consolidated Appropriations Resolution, 2003, in which Congress appropriated $716 million to the agency for fiscal year 2003, directed the additional funding to be used in certain areas. First, it directed SEC to fund pay parity, which at that time had not yet been fully implemented. Sarbanes-Oxley also directed that the new funding be used to fund information technology, security enhancements, and recovery and mitigation activities in light of the terrorist attacks of September 11, 2001. In addition, SEC was directed to fund no fewer than 200 additional professional staff positions to strengthen existing program areas, and to increase its oversight of auditors and audit services. Figure 1 shows the change in SEC’s budget between fiscal years 2002 and 2004. the Accountant, Compliance and Enforcement Staffing Act of 2003, which provided SEC with relief from competitive hiring requirements for certain positions. The legislation was intended to enable SEC to expedite the hiring of accountants, economists, and examiners so that the agency could more quickly fill new positions, including those created after Sarbanes- Oxley. Budget Increases Have Funded New Staff Positions, but Many Remain Unfilled SEC used much of its fiscal year 2003 increased appropriations to fund over 842 new staff positions. SEC’s financial disclosure, enforcement, and examinations areas received most of the newly funded positions. Among the divisions receiving the largest increases were the Divisions of Enforcement, Corporation Finance, and the Office of the Chief Accountant (OCA), which received double-digit increases to their budgets in 2003 and are expected to receive even greater increases in 2004. In addition, SEC used part of its fiscal year 2003 appropriations to fund pay parity for existing staff, which gave the agency additional flexibility to recruit and retain staff. However, many of these newly funded positions remain unfilled because SEC continues to face hiring challenges for certain positions. Officials say that while certain laws have helped speed up the hiring process, they are facing increased competition from the private sector. Budgetary Resources Were Focused on New Staff Positions for Financial Disclosure, Enforcement, and Examination Activities SEC used its increased appropriations between 2002 and 2004 in its financial disclosure, enforcement, and examination areas primarily to fund new positions. As shown in table 1, the offices and divisions showing the largest increases in spending between 2002 and 2003 were the Divisions of Enforcement and Corporation Finance, regional offices, OCA, and IT. Between 2003 and 2004, the areas expected to receive the largest increases in spending are OCA, the Divisions of Corporation Finance and Enforcement, regional offices, IT, and the Office of Compliance Inspections and Examinations (OCIE). As we reported in July 2003, SEC made its allocation decisions without the benefit of an updated strategic plan. In lieu of using an updated strategic plan, it appears that a special study of SEC operations has provided a basis for SEC in determining the need for 842 new positions in 2003. In 2002 the former Chairman directed SEC staff to conduct an internal study of SEC’s current operations, workload, resource allocations, methods for assigning and managing work, and measures of performance, productivity, and quality of effort. Soon after the current Chairman joined SEC in February 2003, he asked that the division and office heads prepare analyses to justify their staffing requests. This included the total number of staff needed to accomplish each division/office’s objectives, the organizational changes needed to accommodate the new staff being requested, and a breakdown of the types of staff being requested by profession. In addition, an SEC official said that the Chairman ultimately approved each division’s and office’s justification to arrive at the final allocation for the 842 new positions. Table 2 shows SEC’s final allocation of the 842 new positions among divisions/offices. SEC’s staff allocations appear generally consistent with legislative expectations and what is known about SEC’s current operating environment. However, because SEC’s staff positions were allocated without the benefit of an updated strategic plan, it will be difficult for SEC to assess the appropriateness or effectiveness of the use of its much larger budget. Since 2002 we have reported that although SEC had a strategic plan and had periodically adjusted staffing to fulfill basic obligations, the agency traditionally had not engaged in a systematic re-evaluation of its programs and activities in light of current and emerging challenges. We further noted that with a current strategic plan that identifies the agency’s key mission-related goals and outlines the agency’s priorities, SEC could better determine and deploy resources needed to fulfill its mission. In response to our concerns and the significant budget increase in fiscal year 2003, the current SEC chairman instructed SEC staff to draft a new strategic plan. SEC’s new strategic plan was approved by the commission on July 9, 2004. SEC plans to use the majority of its additional staff resources within the Division of Corporation Finance, OCA, Division of Enforcement, and OCIE in order to enhance its regulatory and oversight activities. Corporation Finance and OCA Between 2002 and 2003, Corporation Finance and OCA’s spending increased 17 percent and 25 percent, respectively, and planned spending is expected to increase by 39 percent and 55 percent in 2004. Both Corporation Finance and OCA administer SEC’s full disclosure program. These programs are responsible for ensuring that investors are provided with material information from reporting public companies. They also help to deter fraud and misrepresentation in public offerings, trading, voting, and tendering of securities. As shown in table 2, Corporation Finance, which is responsible for reviewing corporate disclosures of public companies such as initial stock offerings and quarterly financial statements in order to monitor and enhance compliance with disclosure and accounting requirements, received funding for 175 new accountants and attorneys. This increase in the number of staff was due primarily to a Sarbanes-Oxley requirement for SEC to conduct reviews of reporting public companies once every three years or approximately one-third of all reporting public companies per year. According to budget estimate documents, SEC was able to review only 23 percent of all reporting issuers in 2003, thus falling short of its mandated goal of 33 percent. OCA received funding for 20 new positions. OCA is responsible for establishing and enforcing accounting and auditing policy in order to enhance transparency, relevance, and reliability of financial reporting and to improve the professional performance of public company auditors. According to an SEC official, these new positions would assist with OCA’s increased responsibility to oversee activities associated with the newly created Public Company Accounting Oversight Board, which is expected to be heavily involved in the quality review process and development and interpretation of auditing standards, among other things. Division of Enforcement Division of Enforcement spending increased 22 percent in 2003 and is projected to increase an additional 26 percent in 2004. The division analyzes information from diverse sources that may indicate past or immediate violations of federal securities laws, investigates possible violations of federal securities laws, recommends SEC action when appropriate in federal court or before an administrative law judge, and negotiates settlements on behalf of SEC. Of the SEC’s 842 new positions, the division was authorized to hire 83 staff in Washington, D.C., and 111 positions in SEC’s regional and district offices. According to SEC budget documentation, staffing will increase in the division by approximately 19 percent over 2003 levels in order to help implement Sarbanes-Oxley. The additional positions will add to the program’s accounting and litigation efforts, as well as investigative and surveillance activities. Division of Enforcement officials told us that the division has reorganized staff in its Office of Chief Counsel by functional lines rather than by geographical location. The functional lines include investment adviser and mutual funds, broker-dealers and markets, and corporate accounting. The intent of this reorganization is to increase the staff’s subject matter expertise and better detect emerging issues. Office of Compliance Inspections and Examinations Between 2003 and 2004 OCIE’s spending is expected to increase by 47 percent. OCIE is responsible for administering SEC’s nationwide examination and inspection program for self-regulatory organizations, broker-dealers, transfer agents, investment companies, and investment advisers. Similar to the Division of Enforcement, OCIE staff is primarily located in Washington, D.C., and SEC’s 11 regional and district offices. OCIE was allocated 42 new positions for Washington, D.C., and approximately 233 new positions among SEC’s 11 regional and district offices, for a total of 275 new positions. According to information provided by SEC, the additional staff would allow SEC to implement a new risk- based inspection program of the riskiest investment advisers and to allow SEC to have more frequent oversight of internal controls of large broker- dealers, a greater on-site presence, and more frequent inspections of self- regulatory organization surveillance and disciplinary systems. Budgetary Resources Were Also Used to Fund Pay Parity In addition to funding new positions, SEC used part of its increased appropriations to fund pay parity. Sarbanes-Oxley authorized $102.7 million for increases associated with pay parity. However, SEC officials said they could not provide the specific amounts that were allocated to fund pay parity in 2003 for two reasons. First, in May 2002, acting on its new compensation authority, SEC implemented a new system that established a pay structure more comparable with other federal financial regulators. This new pay structure increased base pay for attorneys, accountants, and examiners to levels similar to those of other federal financial services regulators. More specifically, the structure of this new system consists of 20 grade levels, some with 31 steps. This new system has also provided additional compensation based on performance and has established new pay categories to compensate staff in supervisory positions. Second, a large number of employees came on board in 2003 under the new pay structure that had already incorporated pay parity. As a result, SEC officials said it would be difficult to segregate the funding amounts associated with the new pay structure and salaries for new employees from the actual amounts used to fund pay parity. SEC Continues to Face Challenges in Hiring for Certain Positions SEC continues to face agencywide challenges in hiring and retaining sufficient numbers of quality staff to achieve its mission. As shown in table 3, between September 2003 and March 2004, SEC filled 328 of 782 vacancies, which amounted to a 42 percent decrease in the number of vacancies within that time. The regional/district offices made the most progress in hiring, decreasing their vacancies 72 percent by filling 210 out of 294 vacant positions. The Division of Corporation Finance appears to face the most difficulty in filling its vacancies, filling only 56 out of the 193 vacant positions between September 2003 and March 2004. According to an SEC official, Corporation Finance has continued to focus on its hiring efforts and as of March 31, 2004, the division had 41 pending hires scheduled to come on board by August 2004, of which 29 were accountants and the remaining 12 were attorneys. Further, the official said the division’s goal is to hire as many qualified certified public accountants as soon as possible, with a goal of having 250 accountants within the division. The remaining staff will be attorneys and legal staff for support in providing information to the public, and other functions not requiring an attorney. As we reported in July 2003, SEC was able to expedite hiring under the Accountant, Compliance and Enforcement Staffing Act of 2003. SEC staff told us that bypassing competitive processes has helped them hire individuals for accountant, compliance examiner, and economist positions more quickly. However, officials in the Corporation Finance, Investment Management, and Enforcement divisions said they still face considerable difficulty in hiring accountants. This is due to competition from the private sector—resulting from public companies needing to comply with Sarbanes-Oxley requirements—as well as from competition with the Public Company Accounting Oversight Board. An official from the Division of Corporation Finance told us that they had retained the services of a national recruiting firm in order to recruit accountants. In addition, SEC officials explained that operating under a continuing resolution in fiscal year 2003 and the timing of SEC’s new hiring authority did not allow much time for recruiting activities before the end of the year. Given the late appropriation and hiring challenges in 2003, SEC had difficulties filling its new positions and was unable to spend $120 million of its increased appropriations during 2003. In the fiscal year 2004 appropriations act, this unobligated balance was appropriated to SEC for use in 2004. Similarly, SEC budget documents reported that $20 million would carry over from 2004 into the 2005 budget. According to an SEC official, the $20 million carryover included in the 2005 budget represents 106 new positions requested for 2005, in anticipation of bringing those new employees on board in 2005 or subsequent years. As of June 2004, SEC has yet to staff its new Office of Global Security Risk. In the Conference Report on the 2004 appropriations legislation, SEC was directed to establish an Office of Global Security Risk within the Division of Corporation Finance. This was due in part to concerns that American investors may be unknowingly investing in companies with ties to countries that sponsor terrorism and countries linked to human rights violations. According to language in the Conference Report, a company’s association with sponsors of terrorism and human rights abuses, no matter how large or small, can have a material adverse effect on a public company’s operations, financial condition, earnings, and stock prices. As a means of protecting American investors’ savings and to disclose these business relationships to investors, this office is required, among other things, to (1) establish a process by which the SEC identifies all companies on U.S. exchanges operating in State Department-designated terrorist- sponsoring states, (2) ensure that all companies sold on U.S. exchanges operating in State Department-designated terrorist-sponsoring states are disclosing such activities to investors, and (3) coordinate with other government agencies to ensure the sharing of relevant information across the federal government. In addition, SEC was directed to provide Congress with quarterly reports on the activities of the Office of Global Security Risk. According to an SEC official, in May 2004 SEC filled the Chief position for the office. The next steps will be for the Chief to begin the process of developing plans for the office, including staffing needs. According to SEC, it plans to provide its first report to the Subcommittee on Commerce, Justice, State, the Judiciary, and Related Agencies, House Committee on Appropriations, by late July. SEC Allocated Majority of Information Technology Budget to System Maintenance and Infrastructure; Concerns Exist about Investment Decision- Making Process Sarbanes-Oxley directed SEC to provide additional funding for IT in 2003, with the general goal of improving operational efficiency. SEC continued to use most of the additional funding to address hardware and software maintenance and technology infrastructure needs. The remaining portion of the agency’s IT resources was used to fund new mission-related initiatives. With regard to SEC’s decision-making process for IT capital investment, SEC’s OIG has recently issued a report stating that while SEC has made progress in establishing an IT investment process that complies with applicable laws and regulations, and incorporates best practices from the public and private sectors, the process is not in full compliance with applicable laws and regulations. Further, the OIG report pointed out that SEC has not finalized its IT strategic plan. SEC Continues to Allocate the Majority of Its Information Technology Budget to Hardware and Software Maintenance and Technology Infrastructure Needs We reported in March 2002 that SEC’s IT systems and funding gaps were contributing to inefficiencies at the agency. SEC officials at the time stated that SEC’s 2002 IT budget of $46.6 million had been used primarily for hardware and software maintenance and technology infrastructure needs, and that additional funding was needed for capital improvements such as a nationwide network to support the examination and inspection functions. Similarly, in 2004 officials said they needed to spend most of the funding to upgrade SEC’s IT infrastructure to support new mission-related IT programs. Sarbanes-Oxley highlighted the importance of improving SEC’s technological capabilities by authorizing SEC to increase its IT budget. As a result, SEC’s 2003 IT budget was increased by over 100 percent, to $100.9 million. In 2004, SEC’s IT budget was increased again to $120.5 million, or another 20 percent. SEC’s IT budget is under the purview of both its Office of Information Technology (OIT) and a separate council of senior staff from the major program divisions and offices. OIT is responsible for managing costs associated with ongoing operations and maintenance, application and infrastructure upgrades, and enhancements to existing systems. SEC’s Information Officers Council (IOC) and the Information Technology Capital Planning Committee (ITCPC) manage the remainder of its IT budget, which consists of new technology initiatives requested by SEC’s program offices. With a significant increase in its IT budget, SEC continues to allocate the majority of these resources to fund hardware and software maintenance and infrastructure needs. As shown in figure 2, in 2003, about 76 percent, or $68.2 million, of SEC’s IT budget went to hardware and software maintenance and infrastructure needs, and a planned 70 percent, or $84.1 million, is budgeted for the same needs in 2004. Approximately 24 percent, or $21.4 million, of SEC’s IT budget in 2003 was used to fund new IT initiativesprojects that have the potential to improve the efficiency of SEC’s operationsand a planned 30 percent, or $36.4 million, is planned for 2004. In addition, figure 2 also shows that while most of the funding for new technology initiatives went to mission officessuch as the Division of Enforcement and OCIE—a notable amount of funding also went to mission-support offices, such as the Office of Economic Analysis and the Office of Filings and Information Services. Specifically, in 2003 approximately $14 million went to fund projects in mission offices, and $7.3 million was used to fund projects in mission-support offices. Of the $21.4 million of SEC’s IT budget allocated to new technology initiatives in 2003, SEC funded 40 separate IT projects. As of May 2004, SEC is scheduled to fund six additional IT projects. A number of these new initiatives provide for the electronic filing of reports, documents, and information, which had previously been paper-based. For example, one project provides for the electronic filing of ownership reports through the EDGAR (Electronic Data Gathering Analysis and Retrieval) system, a specific requirement of Sarbanes-Oxley. Other projects provide for the electronic filing of materials from transfer agents, self-regulatory organizations, alternative trading systems, and broker-dealers. In addition, some of the projects are designed to improve SEC’s ability to review and analyze large amounts of data. For example, one project would establish an improved framework for the gathering, formatting, and analyzing of information collected by OCIE. Currently, the gathering and analysis of information in OCIE is burdened by data collection in a variety of formats. This makes it difficult and time consuming to combine the data sets into one in order to conduct analysis. In addition, SEC continued to fund a number of its multiyear IT initiatives, including Electronic Document Management System. Officials stated that the document management and imaging initiative is currently being piloted in Division of Enforcement offices in Washington, D.C., Boston, Philadelphia, New York, and Chicago and that electronic imaging has been completed for approximately 50 percent of all documents in Washington and 25 percent of all documents in New York. They stated that for the remaining pilot offices, documents would continue to be reviewed to determine what should be imaged. The officials noted that the pilot should be completed by the early fall of 2004. EDGAR Modernization. SEC has taken a first step toward making EDGAR a database with more analytical capabilities for end users. SEC officials stated that within the last year, SEC established the capability for EDGAR to accept certain data from users in a structured format. According to SEC officials, SEC’s Chairman established a task force to look into data tagging, which would allow users to retrieve information from EDGAR in order to conduct trend analysis. The task force is expected to report by the end of July 2004 on how to proceed. Disaster Recovery. SEC officials stated they have made progress in addressing business continuity planning efforts related to disaster recovery. Officials stated they have established alternative data centers and continuity planning sites, have upgraded the network to prevent the possibility of a single point of failure in the network, and are currently building a facility to allow senior staff to move off site in the event of a disaster. Telecommuting. SEC officials stated that SEC’s capacity for telecommuting continues to improve across the agency. These officials stated that due to improved dial-up and wireless connection access, SEC employees’ remote access to certain software applications has improved with the deployment of new laptops in the Division of Enforcement offices. SEC’s Office of Inspector General Raised Concerns about SEC’s Information Technology Capital Investment Decision- Making Process In the summer of 2001, SEC began revising its IT capital investment decision-making process. The revisions were based on recommendations in an audit report issued by SEC’s OIG in August 2001 that reviewed SEC’s IT capital investment decision-making process in order to improve communication between OIT and SEC staff. Beginning in 2002, SEC developed a new decision-making process for IT investments, with SEC’s IOC and ITCPC responsible for managing the portion of SEC’s IT budget related to new technology initiatives. Specifically, IOC, which includes program office senior staff familiar with both the business and IT needs within their programs, receives and evaluates specific IT investment proposals submitted by SEC’s divisions and program offices. Based on their review, IOC makes recommendations regarding which projects should be approved for funding. These recommendations are forwarded to ITCPC, a more senior council of division directors and program office heads, for final funding decisions. Although SEC has taken steps to develop a formal decision-making process for IT investments, in a 2004 follow-up report, OIG raised concerns about the current state of this process. According to the OIG report, OIG evaluated SEC’s compliance with the Clinger-Cohen Act of 1996 (CCA) by applying GAO’s IT Investment Management Framework for Assessing and Improving Process Maturity (IT IM Maturity Model). In general, GAO’s framework includes standards for the selection, control, and evaluation of federal information technology investments, in accordance with the fundamental IT governance mandates of the CCA. OIG found that SEC has made progress in establishing an IT investment process that complies with applicable laws and regulations and incorporates best practices from the public and private sectors. However, OIG also identified some concerns. For example, OIG found that SEC’s process still did not meet the minimum criteria of GAO’s IT IM Maturity Model because SEC had not assigned specific responsibility or delegated appropriate authority for establishing a compliant and effective decision- making process in order to strengthen the governance over the process. Based on this review, OIG concluded, and we generally agree, that the lack of clearly defined and formally approved IT governance policies, criteria, and procedures resulted in an undisciplined IT investment decision- making process subject to broad interpretation by SEC management, which lacked auditable and enforceable standards and controls. OIG made a number of recommendations to address SEC’s IT investment decision-making governance issues, including (1) the development of a work plan for implementing the OIG’s recommendations; (2) formalizing charters, roles, and responsibilities for the Chief Information Officer (CIO), IOC, ITCPC, and other relevant IT governance bodies, including delegating to the CIO sufficient authority to effectively administer, control, implement, and enforce the IT capital planning responsibilities; (3) revising the project funding process and associated investment thresholds and criteria; (4) improving the strategic planning for IT investments, which includes finalizing an IT specific strategic plan that establishes the strategic direction for IT capital planning and tactical operations within SEC and establishing a single agencywide IT control process and structure for the entire IT budget to select, prioritize, and fund all IT investments to be managed by IOC and ITCPC; (5) linking IT project planning with SEC’s enterprise architecture; (6) improving the tracking of IT projects in progress; and (7) supporting IOC and ITCPC with adequate staff. SEC has taken steps to implement some of the recommendations contained in the OIG’s report. According to SEC officials, staff are in the process of formalizing the charters, roles, and responsibilities for the CIO, IOC, ITCPC, and other relevant governance bodies by reviewing the pertinent legislation, Office of Management and Budget requirements, and other relevant guidance. Further, the SEC Chairman recently delegated to the CIO the necessary authority to issue and enforce agencywide IT policy and regulations, and to implement the recommendations in the OIG report. In addition, SEC officials stated that starting with the 2004 IT budget, SEC will establish a single agencywide IT control process and structure for the entire IT budget, managed by IOC and ITCPC, to select, prioritize, and fund all IT investments. SEC officials have articulated a preliminary plan to respond to the remaining OIG recommendations. SEC officials stated that their ability to respond to the OIG’s recommendation depends on how quickly they can hire the staff responsible for managing the capital planning process. Most importantly, the Senior Program Manager position for the project management/capital planning groupwho will be responsible for seeing that the OIG’s recommendations are responded tois currently vacant. Therefore, officials stated that they would most likely be able to address 25 percent to 33 percent of the OIG’s recommendations by the end of fiscal year 2004. Observations Since Congress increased SEC’s budget to improve the agency’s oversight of financial markets in fiscal year 2003, SEC has made significant progress in hiring staff and is continuing its efforts to fill the remaining vacancies. The number of vacancies appears reasonable, given that SEC had to contend with competition from the private sector and a continuing resolution that limited the time SEC had for recruiting. SEC has also taken steps to improve its information technology by using the increased funding to augment its budget for technologyand, in turn, upgrade its infrastructureand by continuing to address the OIG’s concerns about the agency’s decision-making process on IT spending. Although SEC’s staff allocations appear to be consistent with Sarbanes-Oxley, these allocations were made without the benefit of a strategic plan. As we have previously noted and the SEC Chairman has agreed, a comprehensive strategic plan could provide SEC management with a basis for determining whether SEC’s resource level and allocations, as well as its processes and organizational structure, are tied to the mission and goals of the agency. Subsequently, SEC completed updating its strategic plan on July 9, 2004. Agency Comments and Our Evaluation SEC provided written comments on a draft of this report that are reprinted in appendix II. SEC commented that while more work remains, our review of SEC activities acknowledged the progress the agency has made within a constrained time frame. As discussed in its letter, the SEC has taken a number of actions to address some of the issues raised in our report. First, since March, SEC has made additional progress hiring about 130 new employees, and approximately 130 others have committed to start with SEC before the end of the fiscal year. SEC anticipates that by the end of the fiscal year, it will be able to reduce the vacancy level to its normal attrition. Second, we are pleased that the Commission has recently approved the agency’s strategic plan for fiscal years 2004-2009. This strategic plan could serve as a basis to guide SEC in using its additional resources effectively and for its congressional overseers to evaluate SEC’s progress in fulfilling its mission and meeting its goals. We look forward to reviewing and commenting on this updated strategic plan as part of our ongoing review of SEC’s operations. Third, SEC noted that in the past few months, it has imaged, and made available electronically, investigatory materials formerly available only in paper throughout headquarters and regional and district offices. SEC also acknowledged it is “keenly aware” of the need to respond promptly and comprehensively to concerns raised by the SEC OIG and GAO and to ensure that its IT resources are used wisely and effectively. We continue to believe that leveraging information technology will effectively support SEC’s activities, and we are encouraged by the agency’s ongoing efforts. Finally, SEC reiterated the steps it has taken in launching the Office of Global Security Risk. SEC noted that it plans to provide the first quarterly report to the Subcommittee on Commerce, Justice, State, the Judiciary, and Related Agencies, House Committee on Appropriations, by late July. SEC officials also provided us with some technical comments, which we incorporated as appropriate. We are sending copies of this report to the Chairman and Ranking Minority Member of the Senate Committee on Governmental Affairs; the Chairman and Ranking Minority Member of the House Committee on Government Reform; and the Chairman and Ranking Minority Member of the Subcommittee on Government Efficiency and Financial Management, House Committee on Government Reform. We are also sending copies to the Chairman of SEC and will make copies available to others upon request. The report is also available at no charge on the GAO Web site at http://www.gao.gov. Please contact me or Karen C. Tremba at (202) 512-8678 if you or your staff have any questions concerning this report. Toayoa D. Aldridge, James Lawrence, David Pittman, and Marc Molino made key contributions to this report. Appendix I: Scope and Methodology To describe budget and staff allocations, we collected budgetary data for the major Securities and Exchange Commission (SEC) divisions and offices from SEC’s Office of the Controller and staffing data for the major offices and divisions from the SEC payroll system. We also obtained information from SEC’s annual budget request and internal memos regarding staff allocations. We interviewed Office of the Executive Director officials to obtain information on SEC’s process for distributing positions and corroborated this information using existing GAO work, including interviews with officials from various SEC divisions and offices. We performed limited data reliability testing of SEC budget data by interviewing knowledgeable agency budget officials and comparing the data with other published budget data. Based on this analysis, we determined that the data were sufficiently reliable for the purpose of this report. To describe SEC’s allocation of funding for information technology (IT), we analyzed documents from the Information Officers Council/Information Technology Capital Planning Committee (IOC/ITCPC) proceedings. The various documents included project requests from program offices, meeting minutes, project approval memoranda (including funding amounts), and Office of Information Technology (OIT) budget documents. We verified IOC/ITCPC information by interviewing OIT officials in order to corroborate our findings. We relied on SEC’s Office of Inspector General (OIG) to describe the process for making IT investments and the related problems identified within this process. In addition, we reviewed the SEC OIG’s evaluation of SEC’s IT capital investment decision-making process using GAO’s IT Investment Management Framework. We also relied on previous GAO work on SEC’s IT systems. We conducted our work from February 2004 to July 2004 in accordance with generally accepted government auditing standards. Appendix II: Comments from the Securities and Exchange Commission

Summary: This report responds to a statement in the Conference Report on the Securities and Exchange Commission's (SEC) fiscal year 2004 appropriations directing GAO to study SEC's allocation of its increased funding for fiscal years 2003 and 2004. Historically, SEC has faced high staff turnover rates, long stretches of unfilled staff positions, and growing resource needs. Additionally, the agency has faced significant needs in its information technology area. In response to these trends and several high-profile corporate failures and financial scandals, Congress approved significant increases in SEC's appropriations to help improve oversight and increase public confidence in financial markets. This report builds on several reports GAO has issued on these issues. GAO was asked to review SEC's (1) allocation of its fiscal year 2003 and 2004 funds and (2) use of its information technology funding in fiscal year 2003 and its plan for 2004. Congress addressed SEC's human capital and workload challenges with a significant increase to SEC's appropriations for fiscal year 2003. SEC used over half of that increase to fund over 800 new positions primarily within its financial disclosure, enforcement, and examination areas. Although these allocations appear consistent with legislative directions, they were made without the benefit of an updated agencywide strategic plan, which was not approved until July 9, 2004. Although SEC received more flexible pay and hiring authority, SEC continues to face challenges filling critical vacancies, such as accountants. Officials cite competition from the private sector as a major factor. SEC's information technology (IT) budget increased from $46.6 million in fiscal year 2002 to over $100 million in fiscal year 2003. It increased another 20 percent to $120 million in fiscal year 2004. SEC used most of these large increases for maintenance and infrastructure needs, compared with new technology initiatives. Also, SEC's Office of Inspector General (OIG) issued a report detailing its concerns, which we share, about the decision-making process for IT capital investments. OIG made several recommendations to improve this process, and SEC staff have begun to take actions to address some of them. SEC commented that our review of its activities acknowledged the progress the agency has made and provided additional information about its activities since March.

gov_report

en

Write a title and summarize: Rhythmic voltage oscillations resulting from the summed activity of neuronal populations occur in many nervous systems. Contemporary observations suggest that coexistent oscillations interact and, in time, may switch in dominance. We recently reported an example of these interactions recorded from in vitro preparations of rat somatosensory cortex. We found that following an initial interval of coexistent gamma (∼25 ms period) and beta2 (∼40 ms period) rhythms in the superficial and deep cortical layers, respectively, a transition to a synchronous beta1 (∼65 ms period) rhythm in all cortical layers occurred. We proposed that the switch to beta1 activity resulted from the novel mechanism of period concatenation of the faster rhythms: gamma period (25 ms) +beta2 period (40 ms) = beta1 period (65 ms). In this article, we investigate in greater detail the fundamental mechanisms of the beta1 rhythm. To do so we describe additional in vitro experiments that constrain a biologically realistic, yet simplified, computational model of the activity. We use the model to suggest that the dynamic building blocks (or motifs) of the gamma and beta2 rhythms combine to produce a beta1 oscillation that exhibits cross-frequency interactions. Through the combined approach of in vitro experiments and mathematical modeling we isolate the specific components that promote or destroy each rhythm. We propose that mechanisms vital to establishing the beta1 oscillation include strengthened connections between a population of deep layer intrinsically bursting cells and a transition from antidromic to orthodromic spike generation in these cells. We conclude that neural activity in the superficial and deep cortical layers may temporally combine to generate a slower oscillation. The synchronous activity of neural populations results in voltage fluctuations observable in macroscopic (e. g., scalp electroencephalography) and mesoscopic (e. g., local field potential or LFP) recordings. Rhythmic voltage fluctuations—or oscillations—have been observed in the mammalian brain for over a century [1]. Although the purpose of these oscillations remains unknown, neural rhythms appear to temporally organize network activity patterns, and pathological changes in these rhythms often accompany disease [2], [3]. What mechanisms produce these neural rhythms? The complexity of the vertebrate brain—resulting not only from the sheer number of neurons (approximately 109) and their connections (approximately 1011 [4]), but also from the many different neuron classes (e. g., the diversity of inhibitory interneurons [5]) —affords no simple answers. Yet, simple characteristic structural patterns appear fundamental to the brain' s organization [5], [6]. From these elementary network building blocks (i. e., structural and functional motifs) more complicated structures may be generated in an efficient way [7]–[9]. Perhaps a similar strategy may be used to understand the rhythmic electrical activity of the brain. For example, the simplest (yet biophysical) model of the 40 Hz (gamma) rhythm involves only two interconnected cells (one excitatory and the other inhibitory) with reciprocal synaptic connections. In this “gamma –motif” the decay of inhibition paces the rhythm [10]–[12]. This motif, and its variations, may be used to construct more complicated gamma networks [13]–[15]. Here we consider how the elementary dynamic building blocks (or dynamic motifs [16]) of the gamma (∼40 Hz) and beta2 (∼25 Hz) rhythms may combine to generate a slower beta1 oscillation. To do so, we develop computational models motivated by a novel method of rhythm generation—period concatenation—as we now describe. We recently observed that application of 400 nM kainate to rat somatosensory cortex in vitro resulted, initially, in distinct rhythms in different cortical layers [17]. In the superficial cortical layers (layers II and III, or LII and LIII) we observed gamma frequency rhythms (38±3 Hz, n = 25 observations), and in the deep cortical layers (layer V or LV) nonsynaptic beta2 rhythms (24±2 Hz, n = 25 observations). The dominant mechanisms that regulate these two rhythms in secondary cortex are known; the decay time of GABAA IPSPs dictates the gamma period [12], and an outward potassium current in LV pyramidal axons sets the beta2 period [18]. The initial interval of coexistent gamma and beta2 rhythms preceded the transition to a slower beta1 oscillation (15±2 Hz, n = 10). This new rhythm appeared in both cortical layers upon reduction of glutamatergic excitation with 2. 5 µM NBQX (an AMPA receptor antagonist that also reduces kainate drive [19]). We note that the initial interval of kainate application—and its associated network activity at gamma and beta2 frequencies—was an essential prerequisite to the generation of the beta1 rhythm. If we bathed the slices in kainate and NBQX initially (not kainate alone) then we found no persistent rhythms. Both the population activity (observed in the LFP) and the spiking activity of individual neurons suggested that the beta1 rhythm resulted from period concatenation; the period of the slower beta1 rhythm (∼65 ms) equaled the sum of the periods of the two faster rhythms (gamma ∼25 ms and beta2 ∼40 ms). The ordering of the neural activity in each layer supported the period concatenation hypothesis: in the population and single unit activity of both layers we found delays consistent with individual cycles of the gamma and beta2 rhythms during a single beta1 oscillation. In particular, during the beta1 rhythm, the LII activity followed the LV activity by approximately one gamma cycle (≈1/ (40 Hz) or 25 ms), and the LV activity followed the LII activity by approximately one beta2 cycle (≈1/ (25 Hz) or 40 ms). To help illustrate these relationships between the cortical layers, we show a cartoon representation of the activity in Figure 1. The in vitro observations suggest that concatenation of the faster gamma and beta2 rhythms (through a summation of their periods) may generate the slower beta1 oscillation. How might such a concatenation occur? As a simple illustrative model we consider two excitable oscillators, one tuned to spike at gamma frequencies and the other to spike at beta2 frequencies. With enough excitation, both oscillators independently fire at their natural frequencies. If we reduce this excitation and connect the separate oscillators in a particular way, we can generate the slower beta1 rhythm as the concatenation of the gamma and beta2 periods. To do so, we connect the oscillators so that a spike in one resets and causes the other to fire one cycle later. For example, if the beta2 oscillator fires, it resets the gamma oscillator, which then fires 25 ms (one gamma cycle) later. Subsequently, the gamma oscillator spike resets the beta2 oscillator, which then fires 40 ms (one beta2 cycle) later. Connected in this way, both oscillators fire at beta1 frequency; the period (65 ms) is the sum of the natural periods (25 ms and 40 ms) of the excitable oscillators. Of course, biophysical cells are more complicated than simple excitable oscillators. In what follows, we examine the cell types, intrinsic currents, and synaptic connections that support the beta1 rhythm in vitro. In an ideal model of period concatenation, the mechanisms that support the faster rhythms combine to generate the slower oscillation. We will show that this scheme is nearly—but not quite—met in the computational model. The phenomenon of rhythm generation through period concatenation could be modeled in many different ways (involving, for example, different cell types, ionic currents, and synaptic connections [20].) Here we implement the elementary dynamic building blocks of the gamma and beta2 oscillators (i. e., a gamma motif and beta2 motif) and combine these to generate the beta1 rhythm. In doing so we describe how in vitro observations guide construction of the model and test its predictions. We begin by discussing the coexistent gamma and beta2 activity observed in vitro and simulated in the model. We then describe the transition to beta1 and propose that this transition requires a shift in the deep layer pyramidal cells from antidromic to orthodromic activity. Analysis of the cross-frequency interactions during the beta1 oscillation (without access to the underlying mechanisms) might simply suggest that the slower rhythm modulates the faster activity. As we will show, the combined approach of in vitro recordings, data analysis, and mathematical modeling reveals more detailed information about the intrinsic currents and synaptic connections that generate the beta1 rhythm through period concatenation of the faster oscillations. During the high kainate condition in vitro, coexistent gamma and beta2 rhythms occur in the superficial and deep cortical layers, respectively [17]. To model the superficial layer activity, we implement a population of Pyramidal-Interneuron-Network-Gamma (or PING) type oscillators, each consisting of a basket and RS cell. We show the voltage dynamics of a single gamma oscillator (i. e., the gamma-motif) in Figure 2A. The gamma activity results from the interactions between these two cell types, and the decay time of the inhibitory basket cell synapse determines the period of the gamma rhythm [12]. We also include a population of LTS interneurons in the superficial layer [21]–[23]. Under the high kainate conditions, these interneurons fire infrequently and have a disorganizing influence on the gamma oscillator, as we show in Figure 2B. But, following application of NBQX, the LTS interneurons play a vital role in establishing the beta1 motif, as we discuss below. We replicate the RS-basket-LTS circuit (shown in Figure 2B) twenty times and connect the RS neurons with electrical synapses to create a population of superficial layer cells, as described in the Methods section. To model the deep layer activity, we simulate a population of IB cells, each consisting of four compartments: an apical dendrite, basal dendrite, soma, and axon. We show a cartoon representation of a single IB cell model in Figure 3A. Recent experimental and modeling work has shown that the axonal M-current controls the period of the antidromic beta2 oscillation [18]. The same is true in the reduced model presented here; during beta2 activity, bursts of action potentials occur in an IB cell axon and travel antidromically to produce bursts of full action potential spikes and subthreshold “spikelets” in the soma (Figure 3B). The dynamics of the M-current determine the interburst interval [18]. When the axon generates an action potential, the M-current increases. After enough sequential action potentials, the M-current becomes large enough that the outward, hyperpolarizing current prevents further spiking. The M-current then slowly decays and, after sufficient time, another burst of action potentials can begin (Figure 3B). We may increase (or decrease) the interburst interval by decreasing (or increasing) the backward rate function of the M-current (Figure 3C). A decrease in the backward rate function causes the M-current to decay more slowly and the interburst frequency decreases (dotted curve). Conversely, an increase in the backward rate function increases the interburst frequency (dashed curve). We model the dendrites of an individual deep layer IB cell with two compartments: a basal dendrite and an apical dendrite (Figure 3A). This is, of course, a crude approximation to the true dendritic form. We utilize the two compartments to mimic changes in ionic currents and synaptic inputs that occur across the dendritic structure. In particular, we increase the conductance of hyperpolarization activated currents (h-currents) in the apical dendrite [24], [25], and will connect excitatory NMDA synapses from IB cell axons to IB cell basal dendrites [26], [27] to generate the beta1 rhythm, as we describe below. Two types of inhibitory input also target the IB cell dendrites; the superficial layer LTS interneurons target the ascending apical dendrites, and a Poisson source of IPSPs target the basal dendrites (we provide an interpretation of these random inhibitory inputs below.) Although a crude approximation to the actual pyramidal morphology, we find that this simple model captures the essence of the observed dynamics, as we now describe. We show a cartoon representation of the entire reduced model in Figure 4A. We note that ascending excitatory synapses (from the deep layer IB cells to the superficial inhibitory cells) and descending inhibitory synapses (from the LTS interneurons to the IB cell apical dendrites) connect the two layers. In Figure 4B we show a typical simulation result for the 80 cells in the model (twenty of each type). We plot the spiking activity of the three superficial layer cell types, and the spiking activity of the dendrites, somata, and axons of the IB cell population. We find that the individual IB cell dendrites generate action potentials infrequently and remain in a mostly inactive state. The IB cell axons generate bursts of action potentials at beta2 frequencies that are weakly synchronized across the population. The weakly organized beta2 activity results in a noisy synaptic input to the superficial layer inhibitory cells. The result is a disorganization of the dynamic motifs that define the gamma rhythm; the basket cells are perturbed directly by the deep layer excitatory inputs, while the the RS cells are perturbed indirectly through the deep layer excitation of the LTS interneurons. We illustrated the effects of these disorganizing deep layer inputs on the gamma rhythm in Figure 2B and will show below that removing the noisy synaptic inputs from the IB cells increases the superficial layer gamma power. We plot in Figure 4D the population average power spectra (see Methods section) of the RS cells (green curve) and IB cell axons (red curve) and find broad spectral peaks in the gamma range (40–50 Hz) in the superficial layer and in the beta2 range (20–30 Hz) in the deep layer. We also show the average cross-correlation (see Methods section) between the spike times of the IB cell axons and RS cells in Figure 4C. We find no obvious correlation between the activity of the two layers. Thus, although the layers interact through chemical synapses, these interactions are too weak to correlate the spike times of the two layers. In particular, the disorganizing beta2 frequency input from the IB cells to the superficial layer inhibitory cells does not phase lock (and therefore correlate) the rhythmic activity of the two layers. That the model generates coexistent gamma and beta2 rhythms is not surprising—we include in the model components necessary to produce these two rhythms and allow only weak interactions between the two layers. Having established that the reduced model can generate gamma and beta2 oscillations, we now determine how these model rhythms respond to a series of experimental manipulations performed in vitro. In each challenge the experimental results test and constrain the computational model. In addition, we use the model to suggest more detailed information not accessible in experiment. Our manipulations focus on the synaptic connections and intrinsic currents that support (or disturb) each rhythm. Analysis of in vitro slice preparations revealed a statistically significant increase in the gamma power of the superficial layers (215±29%, n = 6, P<0. 05) following a lesion through layer IV. We show example LFP recordings and power spectra for these in vitro results in Figure 5C. These observations suggested some functional connectivity between LV cells and superficial layer neurons involved in generating the gamma oscillation [17]. In the computational model, the superficial layer PING oscillators produce the gamma rhythm. We expect that ascending excitatory synapses from the IB cell axons perturb these superficial layer oscillators (both directly and through activation of superficial LTS interneurons) and therefore disturb the gamma rhythm. To test this expectation we separate the cortical layers in the model and observe the resulting activity. Specifically we remove the ascending excitatory synapses from the IB cells to the inhibitory cells, and we disconnect the apical dendrites from the IB cells (we assume that a slice through layer IV severs the ascending dendrites of the IB cells.) We suggest the associated parameter changes in Figure 5A. Following separation and elimination of the disorganizing inputs, the spiking activity of the superficial PING oscillators becomes more synchronized (Figure 5B). This increased synchronization boosts the superficial gamma power (Figure 5D), in agreement with the in vitro results. In experiment, separating the superficial and deep cortical layers requires a resection through the intervening layer IV. This physical separation necessarily destroys all interlaminar connections. In the model, we may study specific interlaminar connections to determine those that most disturb the superficial gamma rhythm. To do so we remove, one by one, the three types of interlaminar connections: (i) excitatory synapses from the IB axons to the basket cells, (ii) excitatory synapses from the IB axons to the LTS interneurons, and (iii) the apical dendritic compartments of the IB cells. We find that eliminating the first two connections (but not the last) increases the superficial gamma power (data not illustrated). The excitatory input from the IB cells disturbs the gamma oscillators directly by depolarizing the basket cells, and indirectly by exciting the LTS interneurons (which spike and hyperpolarize the RS cells.) Without the disorganizing effects of the deep layer input, the RS cells drive the population of PING oscillators in synchrony. Inhibition plays a vital role in pacing the gamma and beta1 rhythms [12], [17]. To determine the effect of inhibition on the beta2 oscillation, we applied 250 nM of gabazine to the in vitro slice preparation and found a statistically significant (n = 5 observations, p<0. 05) increase in the deep layer beta2 power (Figure 6C) consistent with previous results [18]. In the model, IPSPs (from the superficial layer LTS interneurons and deep layer random sources) target the IB cell dendrites. We think of the random inhibitory inputs as representing a noisy motif, perhaps important for other deep layer rhythms, but disruptive to the beta2 activity. Therefore, we expect that blocking IPSPs will eliminate these inputs and reduce the orthodromic, disruptive influence on the antidromic, beta2 rhythm. We determine the effect of blocking IPSPs in the model by setting the conductance of all inhibitory synapses to zero, as we indicate in Figure 6A. We find that elimination of IPSPs in the model reduces the orthodromic disruption of the beta2 rhythm. The IB cell dendrites now burst in response to the antidromic propagation of axonal activity. Without the disruptive inhibitory input to the IB cell dendrites, the IB cell axons burst with greater synchrony (Figure 6B), and thus boost the beta2 power (Figure 6D) in agreement with the experimental results. We note that removing the basket cell IPSPs causes the electrically coupled RS cells to establish a positive feedback loop and fire rapidly (Figure 6B). In the simple model of the gamma -motif implemented here, the RS cells spike on each cycle of the gamma rhythm. In vitro, individual RS cells spike much more sparsely during gamma activity [17]. We do not model this sparse activity here, which would require a much larger population of RS cells [12], [13]. Therefore the model of superficial layer activity is not valid after removing the IPSPs that pace the gamma rhythm. We also use the model to investigate the type of inhibitory synapse most disruptive to the beta2 rhythm. To do so, we determine the individual effects of removing inhibitory synapses from: (i) the basket cells alone, (ii) the LTS cells alone, and (iii) the random sources (to the IB dendrites) alone. We find that, of the three, removing the latter two increases the beta2 power (simulations not illustrated). Again we conclude that eliminating the disruptive activity of the IB cell dendrites (here by removing disruptive inhibitory inputs to these compartments) boosts the beta2 activity. The beta2 rhythm in the deep layer IB cell population originates in the axonal compartments (in fact, the axonal M-current sets the period of this rhythm [18]). Input from the IB cell dendrites disturbs this rhythm, and we expect that silencing the dendritic compartments would boost the deep layer beta2 power. We test this hypothesis in the mathematical model by blocking a current important to both the dendrites and their superficial layer inputs (the LTS interneurons): the h-current. We do so by setting the h-current conductance to zero in the RS cells, LTS interneurons, and IB cell dendrites. We shade the affected cells and compartments gray in Figure 7A and plot an example of the model spiking activity in Figure 7B. We find that blocking all h-currents eliminates the disruptive effect of the IB cell dendrites on the beta2 rhythm. The IB cell axons burst with increased synchrony and therefore the beta2 oscillations in the IB cell population increase in magnitude. The result is an increase in beta2 power, as we show in Figure 7D. We tested the effect of h-current block in vitro by applying 10 µM ZD-7288 to the slice preparation and found a dramatic increase in the beta2 power (Figure 7C). This increase was statistically significant (n = 5 observation, p<0. 05) and verified the model prediction. The global blockade of h-current does not suggest which particular cell type (if any) is most important to this effect. Therefore, we consider in the model the effects of h-current block: (i) in the RS cells alone, (ii) in the LTS interneurons alone, (iii) in the IB cell basal dendrites alone, and iv) in the IB cell apical dendrites alone. Of these three, only the middle two increase the beta2 power. By eliminating the h-current in the IB cell basal dendrites, we essentially silence these compartments and reduce the effects of the random inhibitory synaptic inputs to them. By eliminating the h-current in the LTS interneurons, we silence these cells and their disturbing inputs to the IB cells. We conclude that eliminating the disruptive inputs to the IB cells enhances the deep layer (antidromic) beta2 rhythm. In vitro, the initial interval of coexistent gamma and beta2 rhythms must precede the slower beta1 activity. Without this initial interval (i. e., with immediate application of NBQX to the slice preparation) no beta1 activity occurs. We therefore expect that the coexistent fast rhythms change the network in a way that supports the slower beta1 oscillation. In addition, we know that NMDA receptor-mediated synaptic events support the beta1 activity—blocking NMDA before or after NBQX application prevents the beta1 oscillations (as we discuss in detail below). To model the change in network structure that occurs during the fast rhythms, we assume a strengthening of all-to-all NMDA synapses from each IB cell axon to all IB cell basal dendrites [26], [27]. We note that potentiation of NMDA synapses has been observed in LV pyramidal cells with bursting behavior [28]. We expect that these NMDA synapses between the IB cells strengthen gradually during the interval of coexistent gamma and beta2 activity. What effect does this gradual change have on the faster rhythms? In vitro we observed that the patterns of field potentials remained constant from the onset of gamma and beta2 activity to immediately before application of NBQX. Whatever changes occurred in the network to support the beta1 activity had no impact on the faster rhythms. We test this in the model by strengthening the NMDA synapses between the IB cell population under the high kainate conditions. In agreement with the experimental observations, we find no change in the gamma and beta2 activity of each layer; the power spectra in the deep and superficial layers match those shown in Figure 4D (results not shown.) We conclude that the strengthening NMDA synapses between the IB cells do not impact the network dynamics until a reduction of excitation (induced by NBQX) occurs in the model, as we now describe. After an initial interval of coexistent gamma and beta2 rhythms in vitro, the transition to beta1 activity followed application of NBQX, resulting in a reduction of glutamatergic excitation via AMPA and kainate receptor subtypes. In both the deep and superficial layers, population activity (as observed in the LFP) oscillated at beta1 frequency and a consistent lead/lag relationship appeared between the two layers: LII activity preceded LV activity by ∼40 ms, and LV activity preceded LII activity by ∼25 ms (see Figure 1). We note that the timing of these lead / lag relationships suggests that the faster dynamics motifs (i. e., the gamma-motif [25 ms period] and beta2-motif [40 ms period]) collaborate to generate the beta1 rhythm [17]. We now consider whether such collaborative interlaminar interactions can produce the beta1 oscillation in the model. We first assume that reduction of glutamatergic excitation decreases excitation in the network and inactivates the gamma and beta2 motifs [29]. We approximate this reduction by decreasing the depolarizing input current to the superficial layer cells, and the deep layer IB cell dendrites and axons. We also halt the Poisson distribution of IPSPs to the IB cell dendrites, thereby eliminating these disruptive inputs. We indicate these changes in Figure 8A by shading blue the affected cells and compartments. As described above, we also include NMDA synapses (decay time constant 100 ms) within the deep layer IB cell population that target the IB cell basal dendrites; we indicate these slowly decaying excitatory synapses with red lines and filled circles in Figure 8A. Producing the beta1 rhythm requires many mechanisms that support the superficial gamma and deep beta2 activity. To describe these mechanisms, we follow a cycle of the simulated oscillation as it propagates from the deep to superficial layer and back (Figure 8B). We start at a burst of activity in the IB cell axons (red dots, see Label 1 in Figure 8B). This burst delivers strong excitatory input to the superficial layer inhibitory cells. The basket cells spike (blue dots, Label 2 in Figure 8B), thus inhibiting the RS cells and the LTS interneurons. We note that the basket cells fire and inhibit the LTS interneurons before the ascending NMDA synapses can depolarize these interneurons. This occurs in the model because we make the rise time of the NMDA synapse longer for the LTS interneurons than for the basket cells (see Methods section). After receiving inhibitory input, the h-currents of the RS cells activate and depolarize these cells on a slow time scale. The RS cells recover from inhibition and spike (green dots, Label 3 in Figure 8B), inducing the population of LTS interneurons to fire. Only a weak excitatory input from an RS cell is required to push an LTS interneuron past spike threshold; the slowly decaying excitatory input from the deep layer and the intrinsic h-current have steadily depolarized each LTS interneuron. Upon spiking (purple dots, Label 4 in Figure 8B), the LTS interneurons inhibit the RS cells and the IB cell apical dendrites, temporarily halting the slow depolarization of the deep layer cells due to NMDA synaptic input. The slow depolarization of the dendrites continue—due to both h-currents and NMDA synapses—and the IB cells spike (Label 5 in Figure 8B), inducing a synchronous burst in the deep layer population and restarting the beta1 cycle. Computing the population average power spectra of the deep and superficial layer cells, we find peaks near 13 Hz and higher order harmonics (e. g., 26 Hz, 39 Hz, 52 Hz, and so on; Figure 8D). For the RS cell, we note that the largest peak occurs near 26 Hz. The power of this peak includes two contributions: (1) harmonic power of the 13 Hz oscillation (note 2×13 = 26 Hz), and (2) power resulting from the interval between an RS cell spike and the subsequent inhibitory input (one beta2 cycle). The model of beta1 activity agrees with the observed rhythm in a fundamental way: this rhythm results from period concatenation. To show this we plot in Figure 8C the population average cross-correlation between the spiking activity of the RS cells and the IB cell axons. We find two intervals of increased correlation: between approximately −35 ms and −20 ms, and between approximately 45 ms and 60 ms. Thus, the deep layer population activity precedes the superficial layer activity by approximately 30 ms. The reason for this delay is that the bursting IB cell axons activate the superficial basket cells that inhibit the superficial RS cells. We also conclude that the superficial pyramidal activity precedes the deep layer activity by approximately 50 ms. The reason for this delay is that the RS cells activate the superficial LTS interneurons which inhibit the deep IB cell apical dendrites. These correlation results show that the temporal distributions of the superficial and deep layer activities in the model agree with those of the experiments. In both the model and experiments, during the beta1 rhythm the LII activity follows the LV activity by approximately one gamma cycle (30 ms or ≈33 Hz), and the LV activity follows the LII activity by approximately one beta2 cycle (50 ms or ≈20 Hz) [17]. We note that the rhythmic activity of the model IB cells differ during the high kainate and low kainate drive conditions. During high kainate conditions, antidromic activity generates the beta2 rhythm. The M-current in the axons sets the period of the IB cell bursting [18], and the dendritic activity interferes with this rhythm. During low kainate drive conditions, following potentiation of the NMDA synapses, orthodromic activity generates the beta1 rhythm. The h-current contributes to the dendritic depolarization following inhibitory input from the superficial layer and induces the axons to fire, thus continuing the beta1 oscillation. The intrinsic currents of, and synaptic inputs to, the IB cell dendrites play an important role in the beta1 activity. We illustrate the dynamics of these currents and inputs within the dendritic compartments of a single IB cell in Figure 9. During a burst of activity in the IB cell axons (e. g., a strip of red dots in Figure 8B) the slowly-decaying NMDA current (red in Figure 9) activates and depolarizes the basal dendrite (near t = 25 ms in Figure 9). Approximately 30 ms later, inhibitory synaptic input from a superficial LTS interneuron hyperpolarizes the apical dendrite (arrow, upper figure) and activates the apical dendritic h-current (blue). Both the h-current and NMDA current continue to depolarize the IB cell until a fast sodium current quickly activates (gray) and the neuron fires a burst of spikes near t = 100 ms. During spiking, dendritic calcium and potassium currents activate (not shown), the h-current and NMDA current reset, and the beta1 cycle restarts. We note that the slowly decaying NMDA input depolarizes the basal dendrites, and that the population of dendrites enters a more active state than during the high kainate conditions (compare the dendritic activity shown in Figures 4 and 8). The synchronous bursts of activity strengthen the postsynaptic effect of the IB cells and effectively strengthen the ascending synapses from the deep to superficial layer. To illustrate the interplay of the M-current and h-current during beta1, we plot in Figure 10 examples of the apical dendritic voltage (yellow) and axonal voltage (orange) of an IB cell, and the gating variables for the h-current (dotted curve) and M-current (dashed curve). When the apical dendrite receives an IPSP (from a superficial LTS interneuron), the h-current gating variable opens and depolarizes the dendrite, thus promoting spiking. When the IB cell generates an action potential, this gating variable closes and removes this depolarizing influence. The M-current in the axon behaves in an opposite way. When the axon bursts, this gating variable opens and hyperpolarizes the axon, thus preventing further spiking. The axon may spike again only after the M-current decays sufficiently. This example illustrates the complementary effects of the M-current and h-current in the IB cell model. The M-current acts to prevent spiking in the axon, while the h-current acts to promote spiking in the dendrite. In an ideal model of period concatenation, the mechanisms that generate the two fast rhythms would combine to produce the slow oscillation. This statement is nearly—but not quite—appropriate for the model proposed here. In the model of superficial layer activity, the inhibitory synapse from the basket cell to the RS cell paces the gamma rhythm. Increasing the decay time of this synapse slows the gamma rhythm. A population of these basket cell synapses participates in the beta1 rhythm, and if we increase the decay time of these synapses, then we also slow the beta1 oscillation. Thus, a fundamental mechanism pacing the fast gamma rhythm—namely the basket cell inhibitory synapses—also paces the beta1 rhythm. A more complicated relationship exists between the beta2 rhythm and its contribution to beta1. During beta2 activity, M-currents in the IB cell axons pace the deep layer rhythm. But, during beta1 these M-currents have less influence on the frequency of the deep layer activity. More important are the h-currents, excitatory synaptic inputs, and inhibitory synaptic inputs to the IB cell dendrites. The transition from beta2 to beta1 involves a switch in the IB cell from antidromic to orthodromic activity. Therefore the beta2 component of the beta1 rhythm is dominated by mechanisms in the IB cell dendrites, not the IB cell axon. Thus, in the model, the concatenation depends on having two mechanisms (an M-current and an h-current combined with excitatory and inhibitory synaptic inputs) with the same time scale. In the model, the same cells generate the coexistent fast rhythms and combined slow oscillation, although the biophysical mechanisms important to each rhythm change in the deep layer IB cells. Simpler period concatenation models may be developed, but we do not believe that these models would agree in all ways with the in vitro data. In what follows, we compare the model with an additional set of experimental manipulations. We show that the two are consistent and verify a model prediction of the fundamental role for the h-current in vitro. We also use the model to suggest specific mechanisms important to the beta1 activity and its propagation between cortical layers. We begin with the observation that: Analysis of the in vitro data allowed us to constrain the computational model in many ways, but not completely. In the model of beta1 activity described above, we considered a strengthening of NMDA synapses between the population of deep layer IB cells. As a second model for the change in network connectivity that supports the beta1 rhythm, we consider NMDA synapses that descend from the superficial to deep layer pyramidal cells. In this case, we include slow excitatory synapses (rise and decay times of 10 ms and 150 ms, respectively) from each superficial layer RS cell to all IB cell apical dendrites [15]. Performing simulations identical to those described above, we find that the model produces beta1 activity with the characteristics of period concatenation. Moreover, we find that separating the cortical layers, blocking IPSPs, blocking NMDA synapses, or blocking the h-current destroys the beta1 activity. Thus, this second model—with potentiating NMDA synapses originating in the superficial layer RS cells and targeting the deep layer apical dendrites—also produces results consistent with the in vitro experiments and modeling results described above. The essential ideas of the previous model can be captured in a simpler model, but at the expense of becoming more abstract. To construct a simpler model, we do not replicate the cells and dynamic motifs to create neural populations. Instead, we employ single copies of the gamma-motif, the beta2 -motif (a single IB cell), and the LTS interneuron. In addition, we represent the IB cell dendrite as a single compartment (and do not distinguish between the apical and basal dendrites.) In each cell and compartment we implement the same currents and synaptic connections utilized in the more detailed model (e. g., an M-current in the IB cell axon and ascending excitatory synaptic connections from the IB cell to the superficial inhibitory cells.) The goal of creating such a simple model is to understand the fundamental mechanisms that support the beta1 oscillation. We show a cartoon representation of the simple model in Figure 12A. In the superficial layer, the RS and basket cells form a single (PING) oscillator that generates gamma activity, and in the deep layer a single IB cell axon generates the beta2 rhythm. The mechanisms that support the gamma- and beta2-motifs are identical to those in the more detailed model. We simulate the transition to beta1 activity in two ways. First, we decrease the excitability of the network by reducing the depolarizing input currents to all cells and compartments except the IB cell dendrite and soma; we indicate these hyperpolarizations by shading the affected cells and compartment blue in Figure 12B. Second, we depolarize the IB cell dendrite (yellow) and strengthen the ascending synapses from the IB cell to superficial inhibitory cells (thick black lines, Figure 12B). Both changes mimic effects in the more detailed model. For the population of cells described above we included excitatory NMDA synapses between the IB cells. These synapses act to depolarize the IB cell basal dendrites and help synchronize the IB cell bursting, thus effectively strengthening the ascending synapses. In the simple model, we approximate the effect of increased IB cell synchronization as increased ascending synaptic input. The result is stronger synapses from excitatory to inhibitory cells, which we might also interpret as potentiation of these synapses between the two cell populations. We find that the simple model can reproduce all of the in vitro observations (e. g., blocking the h-current boosts beta2 activity and eliminates beta1 activity; data not shown). We suggest that this greatly reduced model reveals the fundamental mechanisms of the rhythms and period concatenation with four (rather than 80) cells. We have constructed a computational model, consisting of four cell types, and compared it with in vitro observations from rat somatosensory cortex [17]. In those recordings, we observed a transition from coexistent gamma and beta2 rhythms in the superficial and deep cortical layers, respectively, to a common beta1 oscillation in both cortical layers. We proposed that the slower rhythm resulted from the concatenation of periods of the two faster rhythms: gamma period (25 ms) +beta2 period (40 ms) = beta1 period (65 ms). Both the fast and slow rhythms were sensitive to numerous experimental manipulations (e. g., separating the cortical layers boosted the gamma power under high kainate conditions and eliminated the beta1 power under conditions of low kainate drive.) In this manuscript, we showed that a biologically realistic, yet simplified, computational model could reproduce the coexistent gamma and beta2 rhythms, the transition to beta1, and numerous experimental manipulations. Moreover, we used the model to suggest the specific mechanisms important for the generation and modification of each rhythm. In the superficial layer, reciprocal synaptic connections between an RS and basket cell created the inhibition-based gamma rhythm; the decay time of the basket cell inhibitory synapse determined the period of this oscillation. In the deep layer, the M-current in the IB cell axons paced the beta2 rhythm. We proposed in the model that these dynamic motifs combined to create the slower beta1 oscillation. During beta1 activity, the LTS interneurons (initially disruptive to the coexistent gamma and beta2 oscillations) served a vital role, and the rhythm propagated between the cortical layers. Thus, unlike the coexistent gamma and beta2 rhythms, the beta1 rhythm represented a state in which activity in both deep and superficial layers of neocortex temporally combined to produce oscillations in which interlaminar interactions were vital. We considered four manipulations of the model and in vitro preparation during beta1 activity. The outcome of each manipulation—separating the cortical layers, blocking the h-current, blocking IPSPs, or blocking the NMDA synapses between IB cells—was the same: elimination of the beta1 rhythm. We noted that the loss of beta1 activity occurred when the rhythm could not propagate between the cortical layers; thus, connections between layers were essential to the beta1 rhythm. We also noted that the beta1 rhythm is not quite a concatenation of the gamma and beta2 rhythms. Instead, we found that two different mechanisms support the beta2 and beta1 oscillations. In the high kainate condition, the beta2 rhythm resulted from antidromic activity in the IB cell axons. In the subsequent low kainate drive condition, the beta1 rhythm resulted from orthodromic activity in the IB cell dendrites. We noted that the initial interval of coexistent gamma and beta2 activity must precede the beta1 rhythm. If we start the in vitro slice preparation in the low kainate drive condition (i. e., with kainate+NBQX) we find no oscillatory activity. Therefore, the initial interval of fast rhythms must change the network to support the slower beta1 oscillation. In the model, we assumed that the coexistent fast rhythms facilitated a potentiation of NMDA synapses between the population of IB cells [28]. In developing the computational model, we also proposed two additional scenarios for the change in network connectivity that supports the beta1 rhythm. First, we suggested strengthening the descending synapses from the superficial RS cells to the deep layer IB cells. Second, for the reduced model, we strengthened ascending synapses from the deep layer IB cells to the superficial inhibitory neurons. Each model was sufficient to generate the beta1 activity through period concatenation and agreed with the observational data. In vitro the transition to beta1 may perhaps incorporate aspects from all three scenarios, and future studies may suggest more general conditions for period concatenation incorporating all three models. In the population models proposed in this work, we considered the activity generated in a single cortical column of somatosensory cortex. An improved model would describe the activity of multiple, interacting cortical columns. Including interactions between columns would permit synaptic connections not present in the single-column model (for example, excitatory synapses from deep layer IB cells to superficial RS cells observed in rat motor cortex [30]). Multi-column models incorporating adjacent cortices (and their region-specific oscillatory circuits and agonists [31]) may reveal even richer phenomena. What computational roles might the separate gamma and beta2 rhythms, and the transition to a slower beta1 oscillation, serve? In the in vitro observations and computational models considered here, the initial faster rhythms coexisted in different cortical layers. The transition to the slower beta1 oscillation established a common rhythm that propagated between both layers. We might therefore interpret the transition to the beta1 oscillation as binding the superficial and deep layers of a cortical column. This binding organizes subnetworks of neurons within the input (superficial) and output (deep) layers of a cortical column [32]. Transitions between gamma, beta2, and beta1 oscillations are also observed in vivo [33], [34] although the role of rhythms in these cognitive functions remains unknown. However, beta oscillations (12–29 Hz) have been associated with long-range synchronization [35], which may be relevant to the interlaminar beta1 oscillation analyzed here. Recent observations suggest that rhythms within distinct frequency intervals interact, and that these interactions may occur in different ways [36]–[45]. Given the increasing amount of evidence supporting cross-frequency interactions, the mechanisms involved in generating multi-frequency oscillatory states at the cellular and network level become fundamental to understanding brain rhythms. In this work, we described these mechanisms for a particular example of rhythm generation through period concatenation. Because the slow rhythm (beta1) resulted from the concatenation of two faster rhythms (beta2 and gamma), the fast activity was necessarily locked to a specific phase of the beta1 rhythm. For example, the interval between the basket cell firing and the RS (or LTS) cell firing defines (approximately) one gamma cycle. This fast activity is locked to a particular phase of the IB cell population bursts; this locking is apparent in Figure 8B. Analysis of these data alone suggests that the slow rhythm (beta1) modulates the faster rhythm (gamma). One might therefore conclude that the slow oscillation drives the faster rhythms. This conclusion is only partially correct; in the model the faster rhythms combine to create the slower oscillation. Data analysis alone cannot distinguish the mechanisms producing each rhythm. Instead, a combined approach of data analysis and biophysical modeling is required. Using this combined approach we suggest that faster rhythms, of different coexistent frequencies in different cortical laminae, may be present to maintain independent temporal processing of cortical input in each lamina. If synaptic potentiation occurs then these faster rhythms may concatenate, producing a slower rhythm representing the temporally correlated activity patterns in both deep and superficial laminae—thus uniting previously independent, lamina-specific activity patterns into a single cortical dynamic process. Slices of parietal neocortex (450 µm thick), were prepared from adult male Wistar rats and maintained in an interface chamber. Details of artificial cerebrospinal fluid composition and recording techniques are in [18]. Spectra were all calculated from 60 s epochs of LFP data using MATLAB. All drugs were applied directly to the slice perfusate. All procedures were performed in accordance with the UK animals (scientific Procedures) act. The model consists of four cell types in two cortical layers. We describe the cells, synapses, and analysis methods in this section (detailed equations may be found in the Text S1. The model cells are reductions [46] of detailed multi-compartment representations of rat cortical neurons [15]. To construct the reduced model, we first include explicitly the mechanisms essential for gamma and beta2 rhythm generation observed in the superficial and deep cortical layers, respectively. We then include an additional cell type observed in vitro and chemical synapses to connect the two cortical layers. We begin with a description of the superficial layer model. A simple model of the superficial layer gamma rhythm consists of two neurons—one excitatory and one inhibitory—interacting through reciprocal synapses (the so-called Pyramidal-Interneuron-Network-Gamma or PING rhythm [12].) For the excitatory neuron, we implement a reduction of a superficial regular spiking (RS) pyramidal cell [15]. The reduced model consists of one compartment with four intrinsic membrane currents: a leak current, a transient inactivating sodium current (NaF current), a delayed rectifier potassium current (KDR current), and a hyperpolarization activated (or anomalous rectifier) current (h-current). The first three currents facilitate the generation of action potentials (or spiking) in the model [47]. The last current slowly depolarizes the RS cell following inhibitory input [48] and serves a vital role in the beta1 oscillation, as we describe in the Results section. The form of these intrinsic membrane currents, the reversal potentials, and the dynamics of the gating variables follow [49]. For the inhibitory neuron, we implement a superficial basket cell [15]. The reduced model consists of one compartment with three intrinsic membrane currents: a NaF current, a KDR current, and a leak current. The dynamics and reversal potentials for these currents follow the intrinsic interneuron properties stated in [50]. We note that the traditional spiking currents (the NaF, KDR, and leak currents) are similar (but not identical) for the RS cell and basket cell models. We connect the RS and basket cells with reciprocal synapses. The equations governing the synaptic dynamics are similar to those described in [35] and [51]. The rise and decay times of the fast excitatory (AMPA) synapse are 0. 25 ms and 1 ms, respectively. The rise and decay times of the fast inhibitory (GABAA) synapse are 0. 5 ms and 5 ms, respectively. We also include a fast inhibitory autapse on the basket cell with the same GABAA dynamics. We did not include fast rhythmic bursting (FRB) neurons in the reduced gamma model. Recent experimental and modeling results suggest that these cells provide excitation via axonal plexus activity to drive neocortical gamma rhythms [50]. To avoid the complexity of such a system (which requires a large cell population with axonally interconnected principal cells) while maintaining sufficient phasic drive to generate gamma activity, we include tonic input currents injected to both cells. Each cell also receives a weak stochastic input with normal distribution that results in fluctuation of ±0. 25 mV. The final cell type we include in the superficial layer is a low threshold spiking (LTS) interneuron [21]–[23]. Our reduced model of this cell consists of a single compartment with four currents: a NaF current, a KDR current, a leak current, and an h-current. The dynamics and reversal potentials for these currents follow the intrinsic interneuron properties stated in [50]. We form reciprocal synaptic connections between the LTS interneuron and RS cell. The rise and decay times of the excitatory synapse are 2. 5 ms and 1. 0 ms, respectively, and the rise and decay times of the inhibitory synapse are 0. 5 ms and 20 ms, respectively. We also include an inhibitory synapse from the basket cell to the LTS interneuron (rise time 0. 5 ms and decay time 6. 0 ms) and an inhibitory autapse on the LTS interneuron (rise time 0. 5 ms and decay time 20 ms). A weak stochastic input (normally distributed) perturbs the voltage and results in fluctuation of ±0. 25 mV. To establish a population model of the superficial layer gamma activity, we create twenty replications of the RS-basket-LTS cell circuit described above and shown in Figure 2B. We make all parameters identical for each cell type of the population except for the depolarizing input currents which we independently vary for each cell of each triad. This heterogeneity causes the twenty RS cells to spike at different frequencies, ranging from 30 Hz and 50 Hz. We connect the RS-basket-LTS cell triads with a single type of connection: all-to-all electrical coupling between the RS cells [15]. To model the deep layer beta2 rhythm, we implement a reduction of the LV tufted intrinsically bursting (IB) pyramidal cell [15]. This cell type appears to dominate the beta2 rhythm in vitro [18]. Our reduced model of the single IB cell consists of four compartments: an axon, soma, apical dendrite, and basal dendrite. Each compartment contains the intrinsic membrane spiking currents: a NaF current, a KDR current, and a leak current. In addition, we include in the axon a muscarinic receptor suppressed potassium current (M-current [52], [53]), and in the dendrites we include a h-current, a M-current, and a high-threshold noninactivating calcium current (CaH current). The maximum conductance of the h-current in the apical dendrites exceeds that in the basal dendrites (to crudely mimic the increase in h-current observed with distance from the soma in apical dendrites [24], [25]). Both dendritic compartments also receive inhibitory synaptic input—the basal dendrite from a Poisson source of IPSPs and the apical dendrite from the superficial layer, as we describe below. We connect the dendritic and axonal compartments to the soma through electrotonic coupling. The coupling conductances between the axon and soma were identical for both compartments. We set the coupling conductance from the dendrites to soma to exceed the coupling conductance from the soma to dendrites (so that the soma voltage has a weaker effect on the dendritic compartment' s dynamics [46], [54].) Each compartment receives a tonic drive, and the axon and dendrites receive weak stochastic inputs (normal distribution, ±0. 1 mV fluctuations). To establish a population model of the deep layer activity we create twenty replications of the IB cell. Each member of the IB cell population consists of the same (four) compartments and currents described above. We make all parameters the same in each cell, except for the depolarizing currents to each compartment. We vary these inputs from cell to cell to establish heterogeneous bursting activity in the cell population; the interburst frequency of the twenty IB cells ranges from 20 Hz to 30 Hz. In the model, consisting of only twenty IB cells, we cannot represent a sparsely connected axon plexus which involves a large number of cells [15]. Therefore, we simply connect the IB cell population with all-to-all axonal gap junctions. From the superficial to deep layer we include a synapse from a single LTS interneuron to a unique apical dendrite of an IB cell (we note that the axons of superficial LTS interneurons extend up to layer I—a lamina rich in LV pyramidal cell apical dendrites [22].) Explicitly, if we number the population of LTS interneurons and IB cell apical dendrites 1 through 20, then LTS interneuron 1 forms a synapse on IB cell 1, LTS interneuron 2 forms a synapse on IB cell 2, and so on. The rise time and decay time of these synapses are 0. 5 ms and 20 ms, respectively [15]. From the deep to superficial layer, we include synapses from each IB cell axon to all basket cells and LTS interneurons [55], [56]. For the basket cell postsynaptic target, the rise and decay times are 0. 25 ms and 1. 0 ms, respectively, and for the LTS interneuron postsynaptic target the rise and decay times are 2. 5 ms and 50 ms, respectively. We note that the differences in the synaptic rise times may result from differences in axonal conduction times or dendritic delays (resulting perhaps from differences in dendritic morphologies or differences in locations of synaptic contacts [27], [57].) We do not include ascending synapses from deep layer IB cells to superficial pyramidal cells because anatomical studies indicate few synapses between these populations within a cortical column [15], [56], [58]. In addition to these three types of permanent synapses, we include a fourth potentiating synapse: a slow (NMDA) excitatory synapse extending from each IB cell axon to all IB cell basal dendrites [26], [27]. The rise and decay times for this synapse are 0. 5 ms and 100 ms, respectively. We employ the latter synapse to generate the beta1 rhythm, as we show in the Results section. We use the Interactive Data Language (IDL) to compute numerical solutions to the model equations. We implement a second-order difference method with a time step of 0. 01 ms, and follow the Euler-Maruyama algorithm to include stochastic inputs. Readers may obtain the simulation code by contacting the authors. To analyze the simulation results we compute two measures: the power spectrum and the cross-correlation. We briefly describe each measure here (detailed discussions of these measure may be found in the literature, for example [59]). To compute a power spectrum, we first compute ten realizations of the model, each with a different set of random tonic input currents to the cells and compartments, and each lasting 500 ms. Then for each realization we compute the population average voltage of the cell type of interest by summing the voltages of all (twenty) cells and dividing by the total number of cells. We then compute the power spectra of the population average voltages, and average these spectra across the ten realizations. To compute the cross-correlation between the spike times of the RS cells and IB cell axons, we first simulate the model to create 1 s of data. We then locate the spike times and create new “binary” time series for each (of the twenty) RS cell and IB cell axon. We make the binary times series 0 everywhere except at the spike times where we set the time series to 1. We then compute the cross-correlation between the binary time series of each IB cell axon and the corresponding RS cell. By corresponding, we mean the RS cell in the unique triad whose LTS interneuron forms a synapse on a particular IB cell dendrite. We compute the cross-correlation in this way to avoid the effects of correlations in the subthreshold membrane potentials (e. g., correlations in hyperpolarizations of two cells.) We compute these cross-correlations for all twenty pairs of IB and RS cells, and average the results over the twenty cell pairs.

Title: Rhythm Generation through Period Concatenation in Rat Somatosensory Cortex Summary: Since the late 19th century, rhythmic electrical activity has been observed in the mammalian brain. Although subject to intense scrutiny, only a handful of these rhythms are understood in terms of the biophysical elements that produce the oscillations. Even less understood are the mechanisms that underlie interactions between rhythms; how do rhythms of different frequencies coexist and affect one another in the dynamic environment of the brain? In this article, we consider a recent proposal for a novel mechanism of cortical rhythm generation: period concatenation, in which the periods of faster rhythms sum to produce a slower oscillation. To model this phenomenon, we implement simple-yet biophysical-computational models of the individual neurons that produce the brain' s voltage activity. We utilize established models for the faster rhythms, and unite these in a particular way to generate a slower oscillation. Through the combined approach of experimental recordings (from thin sections of rat cortex) and mathematical modeling, we identify the cell types, synaptic connections, and ionic currents involved in rhythm generation through period concatenation. In this way the brain may generate new activity through the combination of preexisting elements.

lay_plos

en

Summarize: PRIORITY CLAIM This application is based on provisional patent application U.S. Ser. No. 61/728,879, filed Nov. 21, 2012; U.S. Ser. No. 61/821,833, filed May 10, 2013; and U.S. Ser. No. 61/843,481, filed Jul. 8, 2013, the disclosures of which are incorporated herein by reference and priority to which each application is claimed. BACKGROUND OF THE INVENTION The primary treatment for Gastroenteropancreatic Neuroendocrine tumors (GEP-NETS), such as carcinoid tumors, is surgery with curative intent. However, in many patients this is often impossible and alternatives such as external beam radiation or chemotherapy are sub-optimal because these well-differentiated tumors are relatively unresponsive. Most of these tumors express somatostatin receptors, especially sub-type 2, in high abundance, which very rapidly bind and internalize targeted peptides. Other cancers, such as ovarian cancer, also exhibit somatostatin receptors. Somatostatin analogues, such as lanreotide and octreotide, as well as octreotate, have been tested as a means to deliver a radioisotope to the cancerous tissue. Generally, the somatostatin peptide analogues are coupled with a complexing agent such as DOTA (1,4,7,10-tetra-azacyclododecane-N,N′,N″,N′″-tetraacetic acid). Other complexing moieties are disclosed for example in PCT/EP01/08824. Both Yttrium-90 and Lutetium-177 have been used to deliver a tumoricidal radiation dose. Lutetium is a medium energy beta emitter with a maximum tissue penetration of 1.6 mm and a physical half life of 6.7 days. It also emits medium and low energy gamma radiation. But the gamma radiation provides very poor resolution for imaging purposes. Gallium-68 is a positron emitter and has been used for imaging, but has limited therapeutic benefit. However, none of these radioisotopes are optimal from a therapeutic perspective. Depending on the delivery system and mode of elimination from the body, some beta emitters can adversely affect the kidneys and other organs, and some alpha emitters create systemic problems such as gastrointestinal and pulmonary adverse events. Further, many alpha emitters cannot be imaged. SUMMARY OF THE INVENTION The present invention is premised on the realization that tumors with somatostatin receptors can be effectively imaged and treated with tin-117m labeled somatostatin receptor binding compounds, including somatostatin analogues (agonists) as well as somatostatin antagonists. In particular, such tumors can be treated with tin-117m labeled octreotate(tyr 3 ), such as tin-117m bonded to DOTA-TATE. Further, a lysine modified octreotate(tyr 3 ) referred to as nonatate can also be used. The invention further includes methods of bonding the tin-117m to the octreotate or modified octreotate which can be directly applied to other somatostatin receptor binding compounds. The present invention is further premised on the realization that tumors with somatostatin binding sites can be effectively imaged and treated with tin-117m labeled somatostatin antagonists such as BASS, which has the following general formula, Ac-4-NO 2 -Phe-c(D-Cys-Tyr-D-Trp-Lys-Thr-Cys)-D-NH 2, as well as J11. In particular, such tumors can be treated with tin-117m labeled BASS or J11, and, in particular, tin-117m bonded to DOTA-BASS or DOTA-J11. The objects and advantages of the present invention will be further appreciated in light of the following detailed description. BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a drawing of DOTA-3 octreotate(tyr 3 ) or DOTATATE; FIG. 2 is a schematic depiction of a first reaction scheme; FIG. 3 is a schematic depiction of a second reaction scheme; FIG. 4 is a schematic depiction of a third reaction scheme; and FIG. 5 is a schematic depiction of a fourth reaction scheme. DETAILED DESCRIPTION According to the present invention, tin-117m held by a binding moiety is attached to a somatostatin receptor binding compound such as a somatostatin analogue agonists or antagonist. In turn, these compounds effectively treat tumors having somatostatin receptors. Tin-117m is a radioisotope which emits strong conversion electrons which travel about 290 microns in tissue. Thus, it has a very defined effective distance. Tin-117m can be prepared in an accelerator such as a cyclotron by transmutation of antimony into no-carrier-added tin-117m by high energy proton induced nuclear reactions. No-carrier-added tin-117m can also be obtained by exposing cadmium 116 to an alpha particle beam as described in U.S. Pat. No. 8,257,681, the disclosure of which is incorporated herein by reference. This permits formation of high specific activity tin-117m preferably having 100 to 1000 or more curies per gram. Binding moieties such as DOTA are commercially available, as are somatostatin analogue peptides such as octreotate(tyr 3 ). These are further disclosed in EP 0714911 and GB-A-2,225,579. Further, somatostatin antagonists such as BASS and J11 are known. For use in the present invention, any somatostatin analogue or direct antagonist can be used. Known analogues include lanreotide, octreotide and octreotate, as well as nonatate. Examples 1 and 2 disclose the preparation of octreotate and nonatate for use in the present invention. Example 1 Preparation of Protected Octreotate Protected octreotate was prepared by Solid Phase Peptide Synthesis using standard reagents. The structure of the product was: H2N-dPhe-Cys-Tyr(tBu)-dTrp(Boc)-Lys(Boc)-Thr(tBu)-Cys-Thr(tBu)-COOH with a disulfide bridge between the two Cys. The purity was &gt;95%. This was confirmed by HPLC. The molecular weight was calculated to be 1416.4 Daltons. MS confirmed this with an ion mass of 1417 m/z. Example 2 Preparation of Protected Nonatate Protected octreotate was prepared by Solid Phase Peptide Synthesis using standard reagents. The structure of the product was: Boc-Lys(ε-NH2)-dPhe-Cys-Tyr(tBu)-dTrp(Boc)-Lys(Boc)-Thr(tBu)-Cys-Thr(tBu)-COOH with a disulfide bridge between the two Cys. The purity was &gt;95%. This was confirmed by HPLC. The molecular weight was calculated to be 1645 Daltons. MS confirmed this with an ion mass of 1645 m/z. The somatostatin analogue is bound to the tin-117m using a stable chelating or binding molecule such as DOTA. The DOTA reacts with the terminal amino acid on the peptide. Although as disclosed hereinafter, any method can be used to bind the DOTA to the somatostatin analogue. As shown in FIG. 2, Tin-117m in the +2 state can be reacted with DOTA-3 octreotate(tyr 3 ). DOTA-3 is DOTA with 3 available carboxylic acid groups. The reaction is simply conducted by mixing the DOTA-TATE shown in FIG. 1 with the tin-117m in the +2 state at room temperature to about 90° C. at pH about 5. The tin +2 chelates to the DOTA-3. The tin +2 oxidizes to tin +4 over time or the process can be accelerated by bubbling oxygen through the solution. The tin-117m will thereby remain chelated to the DOTA-3. This may be purified with HPLC to extract the tin-117m DOTA-TATE. This is further shown in the following two examples. Example 3 Preparation of Sn-DOTA-TATE (Non-Radioactive) A 0.1 M solution of HCl was prepared by diluting 1.25 mL of 4 M HCl to 50 mL using deionized water. Into this was dissolved 9.48 mg of commercially available stannous chloride (SnCl2, 189.6 mg/mmole) to produce a 0.001 M solution of Sn(II). Into a plastic microcentrifuge tube was placed 28 μL of the 0.001 M Sn(II) solution. To this was added 200 μL of commercially available DOTA-TATE solution (Bachem). The pH was adjusted to 6 by the gradual addition of a pH 7 sodium bicarbonate solution. The reaction was allowed to proceed for 1 hour at room temperature and then placed in a refrigerator. HPLC-MS was used to track the reaction from 1 hour through 48 hours. The chromatographic retention times were as expected. The loss of the DOTA-TATE mass at 1435 m/z and the growth of the product peak Sn-DOTA-TATE mass at 1550 m/z was confirmed. The Sn(II) oxidized to Sn(IV) to form a final product of Sn(IV)-DOTA-TATE Example 4 Preparation of 117mSn-DOTA-TATE Radioactive 117mSn(II) was reacted with commercial DOTA-TATE under the same conditions as in Example 3. The product 117m Sn-DOTA-TATE was confirmed using HPLC-UV. The Sn(II) oxidized to 117m Sn(IV) to form a final product of Sn(IV)-DOTA-TATE. DOTA-TATE can also be formed by the method outlined in FIG. 3. This reaction utilizes aminobenzyl DOTA-4 to bind tin +4 to the octreotate(tyr 3 ). The DOTA-4 has all four carboxylic acid groups available to bind to tin. As shown in the chart, Method 2, tin-117m in the +4 state is reacted with aminobenzyl DOTA at elevated temperatures, about 140° C., for 15 minutes to bind the tin to the DOTA-4. This can be conducted in a microwave. The mixture is then purified using HPLC and the tin-117m aminobenzyl DOTA is reacted with thiophosgene to convert the amine to a thiocyanate. The octreotate(tyr 3 ) is modified by adding an amine group to position 1 of the octreotate. This compound is mixed with the tin-117m-isothiocyanotobenzyl DOTA and the pH adjusted to about 9. The mixture is heated at 35-40° C. for 1-2 hours to form tin-117m-benzyl-NCSN-DOTA-TATE. This can then be purified further with HPLC. This is further elaborated in the following two examples. Example 5 Preparation of 117mSn-IBD A solution of commercially available aminobenzyl-DOTA (ABD, 100 μL, 20 mg/mL, Macrocyclics) was combined with solid 117m SnCl 4 in a glass vial (Biotage, 2-5 mL) containing a magnetic stir bar. The volume was increased to 2 mL by the addition of water. The vial was sealed, stirred for 30 min at room temperature and was then heated to 140° C. for 15 min in a Biotage Initiator Microwave Synthesizer. After cooling, the 117m Sn-ABD complex was purified using prep-HPLC (Altima C18, 0.05% TFA gradient to acetonitrile). The product peak was collected and concentrated by heating under a stream of N 2 to 0.5 mL. The 117mSn-ABD was converted to 117m Sn-IBD by the addition of 0.2 μL thiophosgene to form the isothiscyanate product. Excess thiophosgene was removed by extracting with diethyl ether (4×2 mL). Completion of reaction was confirmed using HPLC-UV/Rad. Example 6 Preparation of 117mSn-IBD Octreotate Into a plastic microcentrifuge tube was placed 1 mg of the protected octretotate from Example 1. This was dissolved in acetonitrile (100 μL). The pH was adjusted to about 9 using triethylamine. To this was added 117m Sn-IBD from Example 5. (5 molar excess). The reaction mixture was heated to 35° C. for 2 hours. The reaction mixture was removed from the heat and thiohenol (20 μL) was added. HPLC-UV-RAD-MS was used to confirm successful reaction product (mass 1966 m/z and expected chromatographic retention time). Octreotate(tyr 3 ) can also be modified by adding lysine at position 1 of the octreotate(tyr 3 ) to produce a 9-peptide amino acid chain with the lysine at position 1. This is referred to as nonatate. The lysine has a free amine group, which can be reacted according to the previous method. According to the reaction scheme shown in FIG. 4, the lysine bonds to DOTA, forming DOTA-3 bonded to the peptide. Tin (II)-117m is reacted with the DOTA-3 at lower temperatures and is subsequently oxidized to tin (IV). Alternately, thiophosgene modified amino benzyl DOTA tin (IV)-117m with the nitrogen of the lysine at position 1 of the nonatate. In this reaction, shown in FIG. 5, the lysine of the original octreotate is protected or blocked prior to the DOTA reaction. This is further elaborated in the following example. Example 7 Preparation of 117mSn-IBD Nonatate Into a plastic microcentrifuge tube was placed 1 mg of the protected nonatate from Example 2. This was dissolved in acetonitrile (100 μL). The pH was adjusted to about 9 using triethylamine. To this was added 117m Sn-IBD from Example 5. (5 molar excess) and thiophenol (20 μL). The reaction mixture was heated to 35° C. for 2 hours. The reaction mixture was removed from the heat. HPLC-UV-RAD-MS was used to confirm reaction product. According to one method, tin-117m in the +2 state can be reacted to a DOTA-3 BASS or DOTA-3 J11. “DOTA-3” represents DOTA with 3 available carboxylic acid groups. The reaction is simply conducted by mixing the DOTA-BASS or DOTA-J11 with the tin-117m in the +2 state at room temperature to about 90° C. The tin +2 chelates to the DOTA-3. The tin +2 is oxidized by oxygen in the solution to tin +4 over time or the process can be accelerated by bubbling oxygen through the solution. It will remain chelated to the DOTA-3. This can then purified with HPLC to extract the [tin-117m]-DOTA-BASS or [tin-117m]-DOTA-J11. Alternatively, aminobenzyl DOTA-4 can be used to bind tin +4 to the BASS or J11. The DOTA-4 has all four carboxylic acid groups available to bind to tin. Tin-117m in the +4 state is reacted with aminobenzyl DOTA at elevated temperatures, about 140° C., for 15 minutes to bind the tin to the DOTA-4. This can be conducted in a microwave. The mixture is then purified using HPLC and the tin-117m aminobenzyl DOTA is reacted with thiophosgene to convert the amine to a thiocyanate. The BASS and J11 are modified by adding an amine group. This compound is simply mixed with the [tin-117m]-cyanothiobenzyl DOTA to form [tin-117m]-DOTA-benzyl-HNCSNH (isothiocyanato)-BASS or [tin-117m]-DOTA-benzyl-HNCSNH(isothiocyanato)-J11. This can then be purified further with HPLC. The tin conjugated somatostatin receptor binding compound formed as previously described is then used as a treatment for Gastroenteropancreatic Neuroendocrine tumors (GEP-NETS), as well as other cancers which are characterized by the presence of somatostatin receptors, including ovarian cancer. The amount of the tin-117m conjugated somatostatin receptor binding compound will depend on the intended radiation dosage. The actual dosage will depend on the particular cancer being treated, as well as the individual. Generally, the radiation dosage administered will be from about 0.5 to 200 millicuries, or 0.5 to 100 millicuries, or 0.5 to about 32 millicuries, or 0.5 to 20 millicuries, or 0.5 to 15 millicuries, or 0.5 to 12 millicuries, or 0.5 to 5 millicuries. Within these ranges, one can effectively destroy cancer cells and shrink or destroy tumors while minimizing necrosis of non-cancer cells. Dosages within these ranges have a hormesis effect where only the cancer cells are destroyed and surrounding cells are actually enhanced, possibly through the stimulation of the immune system. At the lower dosages, 0.5 to 5 millicuries, the tin-117m somatostatin receptor binding compound operates through apoptosis; in other words, accelerating apoptosis of existing apoptotic cells while leaving healthy cells relatively undamaged. At higher (around 100 mCi) dosages the tin-117m can cause necrosis of cells within 290 microns of the tin atom. Accordingly, depending on the desired effect, one can destroy primarily only apoptotic cells or destroy all cells within 290 microns of the tin-117m. The tin-117m bound to the somatostatin receptor binding compound is preferably administered intravenously. This can be injected intravenously over a period of 20 minutes or more in a 100 ml physiological saline solution. In order to reduce radiation exposures to kidneys, positively charged amino acids can be administered before and during administration of the radioisotope, followed with repeated administrations on subsequent post therapy days. Once administered, the tin-117m will effectively cause apoptosis or necrosis of the cancerous tissue. As it has an effective range of 290 microns, adjacent non-cancerous tissue should not be negatively impacted. As the tin-117m has a half life of 14 days, this will provide effective therapy for up to about 4 weeks. This treatment can be repeated as necessary, and can be used in conjunction with other chemotherapeutic agents. Further, as the tin-117m is also a gamma emitter, localization of the tin-117m can be easily detected, allowing one to determine the locus of tumors. This has been a description of the present invention along with the preferred method of practicing the present invention.

Summary: Tin-117m somatoostatin analogs or antagonist are used to treat tumors and symptoms associated with these tumors which express somatostatin receptors, such as gastroenteropancreatic neuroendocrine tumors. The tin-117m somatostatin receptor binding compounds can be administered at a dosage which is effectively apoptotic and not necrotic. Also, if desired, it can be administered at a dose that is necrotic and/or induces necrosis, but only to cells within 290 microns of the tin-117m atom. A novel somatostatin analog is also disclosed, as well as novel methods to produce the tin labeled analogs and antagonists.

big_patent

en

Summarize: L'Isis K ha rivendicato il duplice attacco kamikaze all'aeroporto di Kabul avvenuto nella giornata di ieri 26 agosto. La costola afghana di Daesh nemica dei talebani ha causato almeno 90 vittime secondo quanto riportato dalla Cnn: tra queste più di 70 civili afghani e 13 Marines. Altre 150 persone sono rimaste invece ferite nel duplice attentato. Anche il presidente americano Joe Biden ha attribuito la strage all'Isis Khorasan, giurando vendetta nonostante il ritiro delle truppe confermato per il 31 agosto (anche se, di fatto, le evacuazioni dovrebbero continuare anche dopo quella data). L'Isis-K (o Iskp) è un gruppo terroristico che fa capo alla provincia di Khorasan. Da alcuni giorni si attribuiva a questo ramo dei fondamentalisti l'intenzione di compiere un attentato suicida. Il gruppo terroristico che raccoglie miliziani afghani dell'Isis e i "delusi" da al-Qaeda reputa i talebani "infedeli", in quanto troppo indulgenti nelle trattative con gli occidentali. In particolare, puntano il dito contro l'accordo di Doha del 2020 stipulato con gli Stati Uniti di Donald Trump. Il 29 febbraio 2020 l'ex presidente ha stabilito la fine del conflitto armato in Afghanistan iniziato nel 2001 disponendo il totale ritiro delle forze armate americane dal Paese. Obiettivo di questi fondamentalisti sono gli occidentali, gli afghani che hanno collaborato con la comunità internazionali e gli stessi talebani, considerati musulmani infedeli che "trattano con gli americani". Il gruppo terroristico è guidato da Shahab al-Mujari da circa un anno e mezzo. Si tratta di un ex militante di al-Qaeda che ha permesso all'Isis-K di rappresentare nuovamente una minaccia per i talebani ormai al potere. L'organizzazione nasce nel 2015, quando alcuni qaedisti pakistani e militanti afghani dell'Isis si incontrano per dare naturalmente vita a un nuovo ramo terroristico di "delusi" dai gruppi correnti. I miliziani sostenevano di non ritrovarsi più nelle azioni dei loro comandanti, ritenuti troppo inclini alle trattative con gli americani. I loro primi attentati risalgono al 2015: il gruppo inizia a rivendicarne la paternità presentandosi come "Provincia del Khorasan dello Stato Islamico". Il Khorasan sarebbe storicamente il nome con il quale si fa riferimento ai territori uniti sotto un antico califfato che includeva parti dell'Afghanistan, Tagikistan, Uzbekistan, Turkmenistan e Pakistan. L'Isis-K ha trovato un terreno fertile per prendere forza nella regione Waziristan (nascondiglio di Osama Bin Laden), abbandonata alle scorribande dei criminali. A consolidare definitivamente il nuovo gruppo fu la rottura dell'alleanza tra qaedisti e Isis in Siria: la guerra jihadista per il controllo del territorio in Afghanistan ha condotto talebani e califfato allo scontro armato. Lì dove le due parti combattevano l'una contro l'altra, i "delusi" fondavano un nuovo gruppo che si proponeva di sconfiggere la "corruzione" all'interno dei movimenti fondamentalisti. Dal 2018 in poi, l'Isis-K si è rintanato in piccole aree dove sopravviveva grazie al controllo di alcune miniere. Qui si è ingrandito e ulteriormente organizzato, raccogliendo militari pashtun pakistani, disertori afghani, estremisti uzbeki e altri reduci dello Stato islamico siro-iracheno. Nel 2019, il gruppo ha tentato di entrare nel business del narcotraffico, lì dove i Talebani sono ampiamente presenti in Afghanistan. Per questo motivo il nuovo governo si contrappone violentemente ai fondamentalisti del Khorasan, sostenendo di volerli tenere "lontani dalle zone sotto il loro controllo". L'Isis pakistana è riuscita a riprendere possesso di diversi territori, estendendosi anche in Nangarhar, Kunar, Nuristan, Badakhshan. Secondo l'Onu sono 2.500 circa i miliziani arruolati dall'Isis-K. Si tratta di una "brigata mista" del terrore che raccoglie i reietti dei diversi gruppi di fondamentalisti. Preoccupa in particolare la capacità di attrarre i talebani più estremisti di al-Qaeda, contrari agli accordi di pace, e i combattenti che fuggivano dalla Siria. La volontà dell'Emirato afghano di mostrare (solo in apparenza) un volto più democratico all'occidente sta provocando una nuova ondata di defezioni tra i talebani più vicini ad al-Qaeda.

Summary: Chi sono gli attentatori dell'Isis-K, il gruppo terroristico che odia i talebani. Il ramo afghano dello Stato Islamico ha rivendicato il duplice attacco kamikaze avvenuto ieri nei pressi dell'aeroporto di Kabul. Il gruppo di "fondamentalisti reietti" delusi per "l'indulgenza dei loro comandanti" raccoglie estremisti dall'Afghanistan, Tagikistan, Uzbekistan, Turkmenistan e Pakistan.

fanpage

it

Summarize: BACKGROUND OF THE INVENTION This invention relates to new and useful improvements to field cultivators. Conventional cultivators utilize spring or hydraulically loaded mountings so that if one cultivator blade strikes an obstruction such as a rock or the like, during operation, it trips rearwardly to clear the obstruction whereupon the springs or hydraulic assemblies, return this particular cultivator blade to its original position. Unfortunately such devices are difficult to control insofar as the pitch and depth of the cultivator sweeps are concerned. This is particularly so when ground of varying densities is being cultivated. SUMMARY OF THE INVENTION The present invention overcomes these disadvantages by interconnecting a plurality of front and rear cultivator shank assemblies together in such a way that if one strikes an obstruction, it moves rearwardly to clear same and at the same time moves the remainder of the set of cultivator assemblies forwardly so that they absorb the movement of the tripping cultivator assembly. When the obstacle is passed, the engagement of the remaining cultivator assemblies with the ground, forces them to the original position which at the same time, due to the interconnecting linkage returns the original one to the preset condition. The linkage system, eliminates the use of springs but provides trip action of the shanks to clear rocks and other hard objects. One aspect of the invention is therefore to provide a cultivator of the character herewithin described comprising in combination a frame, ground engaging wheels mounted on said frame to support same, a plurality of sets of cultivator shank assemblies pivotally mounted by one end thereof to said frame adjacent the front and rear thereof, a cultivator tool on the lower ends of said shank assemblies, and linkage means interconnecting the shank assemblies of each set together whereby if at least one of said shank assemblies moves rearwardly relative to said frame, the other shank assemblies of the same set move forwardly, the total distance moved forwardly of said other shank assemblies of said set being substantially equal to the distance moved rearwardly by said one shank assembly of said set. Another object of the invention is to provide a device of the character herewithin described which can be utilized with a fixed frame, or alternatively, can be extended in width by connecting various solid frame sections together, adding extension kits bolted to either end of the solid frames or, if desired, adding fold-up wing sections which can be attached to either end of the solid frame. A yet further object of the invention is to provide a device of the character herewithin described, which can, if desired, be pulled from one end for transport purposes thus enabling a relatively wide machine to be transported readily and easily. A still further object of the invention is to provide a device of the character herewithin described which may include means to adjust, within limits, the tilt to the sweeps attached to the shanks. A still further object of the invention is to provide a device of the character herewithin described which is simple in construction, economical in manufacture and otherwise well suited to the purpose for which it is designed. With the foregoing objects in view, and other such objects and advantages as will become apparent to those skilled in the art to which this invention relates as this specification proceeds, my invention consists essentially in the arrangement and construction of parts all as hereinafter more particularly described, reference being had to the accompanying drawings in which: DESCRIPTION OF THE DRAWINGS FIG. 1 is a top plan view of part of the cultivator. FIG. 2 is a fragmentary plan view of the interconnected linkage per se. FIG. 3 is a side elevation of FIG. 1. FIG. 4 is a fragmentary partially sectioned view of one of the hinge connections to the frame. FIG. 5 is a view at right angles to FIG. 4. FIG. 6 is a fragmentary isometric view of part of the frame showing one set of shank assemblies. In the drawings like characters of reference indicate corresponding parts in the different figures. DETAILED DESCRIPTION Proceeding therefore to describe the invention in detail, reference character 10 illustrates a substantially rectangular frame including front longitudinal chassis members 11, rear longitudinal chassis members 12 and cross chassis members 13. Although only one such section is shown, nevertheless it will be appreciated that this section can be of varying widths and can, if desired, be bolted to adjacent similar sections if desired. Also, folding wings sections can be provided but as such wing sections are conventional, it is not believed necessary to describe same further. A rock shaft 14 is mounted for rotation to the chassis adjacent the front side 11 thereof and ground engaging wheels 15, mounted upon axle struts 16, are supported upon the rock shaft and support the frame above the ground as clearly shown in FIG. 3. A fluid operator 17 is mounted on the frame cross member 13 and is operatively connected to a link 18 which in turn connects to the rock shaft 14 so that extension and retraction of the fluid operator 17, lowers or raises the frame 10 relative to the wheels 15 thus controlling the depth of penetration of the shank assemblies in the usual manner. A forwardly extending hitch 19 is pivotally connected to the front member 11 of the chassis by means of pivot pins 20 and the hitch 19 extends to a source of power in the form of a tractor (not illustrated) in the usual way. Sets of cultivator assemblies are provided and are mounted in the frame, one such set being indicated collectively by reference character 21. Each set may consist of four or more individual cultivator assemblies collectively designated 22 interconnected together by linkage as will hereinafter be described. Each cultivator assembly includes a cultivator shank 23 having a cultivating tool such as a blade 24 mounted upon the lower end thereof. Alternatively, the cultivator shank may take the form of a spring shank with a ripper shank tool on the lower end thereof (not illustrated). Each shank 23 is secured by the upper end thereof to one end 25 of a crank arm collectively designated 26 pivoted intermediate the ends thereof between a pair of lugs 27 extending downwardly from the longitudinal frame members 11 or 12, reference character 28 illustrating the pivotal connection of the crank arms to the lugs 27. A rear connector 29 taking the form of a plate, is provided with pivot pins 30 extending from each end thereof which in turn engage spherical bearings 31 secured to the other legs or arms 32 of the crank arm 26 of an adjacent pair of cultivator assemblies. A front connector 33 connects adjacent pairs of front cultivator assemblies together. The front cultivator assemblies also include crank arms 26 mounted between lugs 27 similar to the mounting of the rear assemblies. The front connector includes a flat bar 34 with an offset portion 35 at one end thereof carrying a pivot pin 30A. A corresponding pivot pin 30A is secured to and extends from the other end 36 of the flat bar or plate 34 as clearly shown in FIG. 2 and these pivot pins 30A engage these spherical bearings 31 of adjacent front cultivator assemblies. A rocking link 37 is pivoted intermediate the ends thereof to a fixed support 38 extending below the front chassis member 11 and the front connector 33 is pivoted intermediate the ends thereof to one end of this rocking link 37 by means of a pivot pin 39 engaging through said one end and a lug 40 extending from one side of the plate 34. A connector link 41 is provided with lengthwise adjustment 42 within the length thereof and is pivotally connected by the rear end 43 thereof to intermediate the ends of the rear connector link 29 by means of pivot pin 44. The front 45 of the adjustable connector link 41 is pivotally connected to the other end 46 of the rocking link 37 and in this connection a plurality of apertures are formed in the end 46 anyone of which may be used to connect the adjustable connector link 41 by means of a pivot pin connection 47. In operation, the set of shank assemblies are connected together and the cultivating tools 24 are let into the ground by raising the wheels 15 by means of the fluid operator 17 thus enabling the weight of the frame to force the tools into the ground the desired amount. The implement is then moved forwardly by the associated tractor (not illustrated) and the sweeps or cultivating tools begin to cut through the ground at a depth desired and preset by the operator. If one of the cultivating tools engages an obstruction such as a rock or root, resistance is met thus causing it to pivot rearwardly around the pivot 28 until it has been raised high enough to clear the obstruction. Assuming that one of the front cultivator assemblies engages an obstruction, then rearward movement of this particular cultivator assembly will cause the other front cultivator assembly to move forwardly due to the pivotal action of the front connector 33. At the same time the connection of this front connector 33 with the rocking link 37, will cause the rocking link to pivot around its pivot point thus moving the adjustable connector link 41 forwardly together with the two cultivator assemblies operatively connected thereto at the rear. In an instance in which four shank assemblies 23 are connected together as in FIG. 2, the various linkage and angles are such that the sum of the movement of the other front cultivator assembly and the two rear cultivator assemblies is substantially equal to the distance moved by the front cultivator assembly striking the obstruction. This means that the movement is relatively slight and does not particularly interfere with the attitude of the cultivating tools 24. As soon as the obstruction is passed, the engagement of the three cultivator tools with the ground, forces them to move back to the original position and the linkage connection between the cultivator assemblies forces the other cultivator assembly back to its original position also. In other words the other cultivator assemblies attached to the one striking the obstruction, absorbs the movement of the one cultivator assembly which trips rearwardly to clear the obstruction. The interconnecting linkage eliminates the necessity for springs and hydraulic cylinders and the like and creates very little disturbance in the cultivating action. The lengthwise adjustment of the adjustable connecting link 41 together with the positioning of the front end thereof in one of the plurality of apertures in the rocking link 37, give the necessary adjustments depending upon circumstances and conditions. For example if a rod weeder (not illustrated) is attached behind rear shanks as is common practise, then this can be compensated for by the necessary adjustment at point 47. The difference in leverage determined by the adjustment in the outward end of the rocking link 27, where it connects to the adjustable connector link 41, at point 47, is also used to balance the difference in pressure normally found between the front and rear shanks. Also changing this length of the link 41 gives the desired tilt to the sweeps on the shanks. If two cultivator assemblies strike an object and move rearwardly together, the other two will also move forwardly always sharing the load and going back to equilibrium after the object has been passed. Although four shanks have been described and illustrated, other forms of interconnection may be made as illustrated in the left and righthand sides of FIG. 1. On the lefthand side of FIG. 1, five shank assemblies are shown connected together, two at the front and three at the rear. In this connection, the rear end 42 of the ajustable connector link 41 is connected to a balance bar 48 by means of pivot pin 49 and this balance bar is in turn connected to the rear connectors 50 by means of link 51 and pivot points 52 and 53. On the righthand side of FIG. 1, five shank assemblies are shown with two at the rear and three at the front. Under these conditions, the rear end of the adjustable connector 42 is pivotally connected to a balance bar 48A by means of pivot 54 with a link 51 extending to the rear connector 50 as clearly shown. A further connector link 55 is pivotally connected to the other end of the balance bar 48A and extends forwardly to a rocking link 37A which in turn is connected to the fifth cultivator assembly as clearly illustrated. If it is desired to transport the cultivator endwise, transport wheel assemblies 56 may be secured to the chassis upon either side thereof and an end hitch (not illustrated) is provided in the usual manner. However this does not affect the operation of the cultivator in the field in which the interconnected set of cultivator assemblies enables the load of an obstruction to be shared among a plurality of shank assemblies. Since various modifications can be made in my invention as hereinabove described, and many apparently widely different embodiments of same made within the spirit and scope of the claims without departing from such spirit and scope, it is intended that all matter contained in the accompanying specification shall be interpreted as illustrative only and not in limiting sense.

Summary: Four or more cultivator arms or shanks are pivoted to the front and rear of a main frame and are interconnected by linkage so that if a cultivator blade on one arm strikes an obstruction, then it moves rearwardly to clear same and at the same time the others that are interconnected, move forwardly by a lesser amount thus absorbing the movement of the cultivator blade striking the obstruction. When the obstruction is passed, the engagement of the remaining blades with the ground, returns them to the original position thus returning the tripped blade to the original position.

big_patent

en

Summarize: BACKGROUND OF THE INVENTION This invention relates to a flavouring product based on ground and roasted oilseeds and to a process for the production of this starting material. There are various known processes for the production of pastes based on ground oilseeds, such as almonds or hazelnuts for example, which are intended for use in the preparation of confectionery products. Thus, French Patent No. 1 318 539 (H. Schoppe &amp; Schultz) describes a process in which a paste based on walnuts, almonds, hazelnuts or the like, more particularly grilled and/or ungrilled, sugar and water is prepared and then dried in a drying tower to form a powder which may be incorporated, for example, in a whipped cream, in double creams or in praline-containing mixtures. Similarly, PCT application No. WO 86/03945 (Franz Haas Waffelmaschinen Industriegesellschaft m.b.H) describes a process in which walnuts, almonds, hazelnuts or the like are compressed so that they are all of the same thickness, subsequently roasted together in the presence of a flavour support, such as a sugar, so that they have a uniform degree of roasting and are then converted into a paste for the preparation of creams. SUMMARY OF THE INVENTION The problem addressed by the present invention was to provide a flavouring product based on roasted and ground oilseeds of which the flavour note and intensity could be adjusted in a precise and easy manner. To this end, the flavouring product according to the invention comprises a mixture of heat-treated and ground oilseeds, herein after referred to as roasted and ground oil-seeds A and toasted and ground oilseeds B, and as shown below, A and B need not be different. Similarly, in the process according to the invention from the production of a flavouring product, a quantity of oilseeds A are roasted, and a quantity of oilseeds B are toasted, and the roasted oilseeds A and the toasted oilseeds B are ground and are then mixed. It has been found that it is thus possible easily, precisely and reproducibly to adjust the flavour note and intensity, more particularly the note and intensity characteristic of a roasted seed flavour which a product of this type can have. DETAILED DESCRIPTION OF THE INVENTION According to the invention, the above-mentioned oilseeds A and B may be, for example, hazelnuts, almonds, pistachio nuts, peanuts and/or pine seeds and even walnuts, para nuts and/or cashew nuts. The roasted oilseeds A and the toasted oilseeds B may advantageously be characterized by their colour, the roasted seeds having a darker colour, for example brown, than the toasted seeds which have a lighter colour, for example beige. This colour may be defined by its components L, a and b which may be determined in known manner, for example with a suitable commercially available colorimeter or chromameter. Thus, in one preferred embodiment of the flavouring product and the process according to the invention where the oilseeds A and B are hazelnuts, the roasted hazelnuts A preferably have colour components L of 20 to 30, a of 0.5 to 4 and b of 0.5 to 6 while the toasted hazelnuts B preferably have colour components L of 40 to 60, a of 5 to 12 and b of 20 to 30. The oilseeds A are preferably roasted for 1 to 20 minutes at 220° to 320° C. and the oilseeds B are toasted for 1 to 40 minutes at 140° to 180° C. This roasting step and/or this toasting step may be carried out, for example, in a roaster having a surface heated by gas, electricity or steam, or in an infrared oven, a microwave oven or a hot-air oven. The roasted oil-seeds and the toasted oilseeds may then be ground, for example, in a hammer mill, a cutter mill, a stone mill, a ball mill and/or in a cylinder refiner, depending on the desired degree of fineness. In a preferred embodiment, the oilseeds are first ground to 0.5-2 mm grains and the grains obtained are then ground to 20-40μ particles. The roasted and ground hazelnuts A and the toasted and ground hazelnuts B may be mixed in a ratio by weight of from 20:80 to 80:20. The flavouring product according to the invention is preferably intended for the preparation of a confectionery paste or cream to which it enables a flavour of predetermined intensity having a note characteristic of roasted seeds, more particularly roasted hazelnuts, to be imparted with remarkable reproducibility. EXAMPLES The product and the process according to the invention are illustrated by the following Examples in which percentages are by weight. EXAMPLE I A) A gas roaster heated to a temperature of from 240° to 250° C. is charged with 35.5 kg natural Piedmont hazelnuts 13 to 15 mm in diameter. The nuts are thus roasted for 6.5 minutes. The nuts are then brushed clean, coarsely ground in a cutter mill and then finely ground in a stone mill. B) A steam roaster heated to a temperature of from 145° to 155° C. is charged with 100 kg natural Piedmont hazelnuts 13 to 15 mm in diameter. The hazelnuts are thus toasted for 8.5 minutes. They are then brushed clean, coarsely ground in a cutter mill and then finely ground in a stone mill. Eight samples of the roasted and ground hazelnuts A and eight samples of the toasted and ground hazelnuts B are taken. The components L, a, b of the colour of each of these samples is then determined with a MINOLTA chromameter equipped with a CR-310 measuring probe. For each determination, the sample is placed in a receptacle closed by a plate of glass. The receptacle is then placed under an incident light beam corresponding to the light of day. The light reflected by the sample is detected through three colour filters. The instrument displays the mean value of three successive measurements performed automatically (three flashes). The result is expressed in components L, a, b. The results are set out in Tables A and B below. TABLE A______________________________________ ROASTED HAZELNUTSSample No. L a b______________________________________1 22.34 2.21 2.622 24.90 1.65 3.263 22.14 2.27 2.534 22.24 2.28 2.665 22.30 2.20 2.706 24.97 1.90 3.317 24.82 1.53 3.108 24.67 1.69 3.16AVERAGE 23.55 1.97 2.92Standard deviation 1.30 0.29 0.30______________________________________ TABLE B______________________________________ TOASTED HAZELNUTSSample No. L a b______________________________________1 49.74 8.20 25.832 48.84 8.36 26.173 49.82 8.12 26.134 50.31 8.22 26.425 48.06 8.74 26.026 49.90 8.00 26.527 49.07 8.38 26.318 48.25 8.44 26.00AVERAGE 49.25 8.31 26.18Standard deviation 0.77 0.21 0.22______________________________________ EXAMPLE II Three flavouring products are prepared by mixing the roasted and ground hazelnuts A of Example I and the toasted and ground hazelnuts B of Example I in three different ratios by weight, namely: i) 50:50 ii) 60:40 iii) 70:30. Mixture i) is distinguished by its fineness. Mixture ii) has a cleaner flavour note of roasted hazelnut. Mixture iii) has an intense flavour characteristic of roasted hazelnut. Accordingly, it is possible by varying the ratio by weight between the roasted nuts A and the toasted nuts B to adjust the fineness, the characteristic note or the intensity of the roasted hazelnut flavour. The various nuances are reflected in the respective organoleptic qualities of three hazelnut pastes prepared from each of the mixtures i), ii) and iii), each paste being prepared by passing one part by weight mixture and two parts by weight sugar through a cylinder refiner and adding 25% vegetable fats.

Summary: A flavorant product is prepared by heat-treating a first quantity of oilseeds for from 1 minute to 20 minutes at a temperature of from 220° C. to 320° C. and heat-treating a second quantity of oilseeds for from 1 minute to 40 minutes at a temperature of from 140° C. to 180° C. and then grinding and mixing the first and second heat-treated oilseeds.

big_patent

en

Summarize: A friend of Texas Ebola patient, Thomas Duncan, who saw the sick man the day he was taken into hospital apparently 'vomiting wildly' has described his family's ordeal in isolation. And, shockingly, three days after CDC officials visited him in the family's apartment, 43-year-old Aaron Yah revealed he had not received an order to remain indoors or any advice on how to cope. Speaking exclusively to MailOnline, Mr Yah said: 'The CDC came on Tuesday, the day it was confirmed Thomas had Ebola. They told me that the children should not go to school until 17 October. Scroll down for video. Sick with worry: Aaron Yah and his family are being monitored by the CDC after visiting Ebola victim Thomas Dunn on Sunday - the day he was taken to hospital and put in isolation. Fears: Mr Yah said: 'I am concerned. I am worried. All we can do is pray. I can say it is not fair. But what is not fair happens' 'But it was not really confirmed to me that I should stay indoors. I don't know. Can you tell me?' While Mr Yah said he does not know - and has not been told what to do - it was revealed on Thursday that Thomas Duncan's family have been ordered to stay indoors after violating officials request to do so. Mr Yah, originally from Liberia, has lived in America for many years, he said. He lives with fiancée Youngor, 35, and their four children three boys ages 2, 4 and 11 and a six-year-old daughter. He has been visited by CDC officials daily since confirmation of Mr Duncan's infection. He said: 'They take our temperature and blood pressure but I don’t know what is going on. They do not tell us what to do for food. Maybe someone will bring us food. Or can I use my card to get some if I sanitize it. I know Ebola is in the blood and body fluids.' As well as being confused and frightened for his family, Mr Yah said he did not know what was being done for Mr Duncan. He said: 'They say the ZMapp is finished. So what will happen? Will he remain in hospital without medication for the rest of his life?' Mr Yah only actually met Mr Duncan for the first time when the Ebola victim arrived in America last month. He appeared fit and healthy, he recalled. The men came to know each other through Youngor's family – Mr Duncan stayed with Youngor's mother in Liberia and Mr Duncan's grandmother has provided care for their three youngest children at the now quarantined Ivy Apartments. Isolated: Mr Yah said that while his children have been told not to go to school under October 17, he has not been told by the CDC to stay indoors and was critical of the confusing advice they have given him and his family. Horror: Mr Yah last saw Thomas Duncan, above, on Sunday. He was lying in bed having been up all night with diarrhea. Mr Yah asked him how he was and Duncan replied: 'I'm not okay' The entire family has been exposed. Mr Duncan revealed: 'The last time I saw Thomas was Sunday, the day he went to hospital. I had seen him after he went to hospital the first time and he was looking fine, he had been just fine. 'But that day I passed by on Sunday he was lying down on the bed in the room and I asked him how he was. He said, "I'm not okay." 'He said he had been having diarrhea all night. Later they came and took him to the hospital.' Reuters reported that he was seen vomiting wildly as he was strapped to a gurney and taken away. Ebola is only contagious when someone is showing symptoms which can be vague initially – fever, flu-like aches and abdominal pain progressing to vomiting and diarrhea. It spreads through close contact with a patient’s body fluids such as blood, sweat, feces, urine, saliva or semen. These fluids must make contact with a cut or scrape, or someone touching their nose, mouth or eyes with contaminated hands or beng splashed providing an entry point for the Ebola. Mr Yah revealed that he learned of Mr Duncan's diagnosis the very day he was supposed to go back to work at the Meadows Nursing home where he works as a nursing assistant. 'As a matter of fact I was on the phone to them talking about my shift when CDC called,' he said. Since that visit life has stalled for the family who are left in isolation and uncertainty. Antibacterial hand wash and wipes sit by the front door of the family's apartment. Mr Yah and Youngor repeatedly reapply both to their children's hands and toys. He said: 'It is hard. The children are very bored being indoors and all that we watch on TV is the news.' In the startling absence of any concrete information the family are left to watch rolling news for updates and to pray. Orders: While the family of Duncan (seen here picking up a food package) have been told to stay indoors specifically by a judge - Mr Yah's family have not and are left wondering what they should do. They have connected with a pastor in Liberia who learned of their plight through family members. Mr Yah said: 'We pray every day, every day.' Guided through psalms and prayers by Pastor Samuel who preached via speakerphone Mr Yah read aloud to his fiancée and children. The passages were filled with images of death, perseverance and suffering. 'By the sweat of your blood you will eat bread or food until you return to the ground since form it you were taken... from dust you come and to dust you will return.' And 'Dogs have surrounded me: a band of evil men has encircled me. They have pierced my hands and my feet.' And 'Yay though I walk through the Valley of death I will fear no evil…' Between each passage Pastor Samuel sought to comfort the family in these images of ancient suffering. Later the family prayed aloud, Youngor crying out with her hands raised: 'We present our family oh Father. Ebola does not belong here. Ebola does now belong in this home. 'We ask that you destroy Ebola. We ask for our children Oh God. We ask for America.' A tear streaked down her face as she said: 'Father there is nowhere for us to go. Take Ebola, we send it back to you oh God. Destroy it in the name of Lord Jesus.' But as well as their pleas to God, Mr Yah had demands of the CDC and FDA. Grim: A burial team loads the corpse of an Ebola victim in Monrovia, Liberia - where Duncan travelled from. Precautions: Authorities have stressed that Ebola is not infectious until a person shows symptoms. But that's not stopped concern over the freedom of movement of those who have come in contact with Duncan. He said: 'What is the CDC and the FDA really doing? What are they trying to do? What is the effort – not just here in America, this is not just here. It's worldwide. What are they doing?' As for his own family he admitted: 'I am concerned. I am worried. All we can do is pray. I can say it is not fair. But what is not fair happens. 'I know that some people can contact it and not get it. We just pray that everybody will be on that safe side.'

Summary: Aaron Yah, 43, from Dallas, last saw Ebola victim Duncan on Sunday - the day he was taken to hospital. Yah and his family are now being monitored by CDC officials - but Yah, a nursing assistant, is worried that he has not been told to stay inside. He is staying home and his children - who often went to the apartment where Duncan was staying - have been told to stay off school until Oct 17. Yah said: 'Maybe someone will bring us food. Or can I use my card to get some if I sanitize it'

cnn_dailymail

en

Summarize: A sanitation worker in an Atlanta suburb is behind bars for getting to work too early.Kevin McGill was sentenced to 30 days in jail for violating a Sandy Springs ordinance that says workers can only haul trash between the hours of 7am and 7pm.McGill was cited for picking up the trash just after 5am one morning.He says he could not believe when the prosecutor asked the judge for the maximum punishment."I was stunned. I didn't know what to think. I was shocked," he said.The prosecutor, Bill Riley, makes no apologies for locking sanitation workers up."Fines don't seem to work," Riley said.He says they are a nuisance to sleeping residents.McGill had only been on the job for three months.Now he has to spend the next 14 weekends in jail, while he works during the week... after 7am. Written By Will Hager Posted: 03/04/2015, 03:47pm A Sandy Springs sanitation worker said he was taken to jail for picking up trash too early in the morning, a violation of the Georgia city’s ordinance. Kevin McGill will spend the next 14 weekends in jail because he picked up trash minutes after 5 a.m. one morning—an offense worthy of automatic jail time, according to the city solicitor. Sanitation worker sent to jail for 30 days picking up trash too early in the morning: http://t.co/QTmkzLAgl0 pic.twitter.com/iCl3XOaJER — WSB-TV (@wsbtv) March 4, 2015 Chief prosecutor Bill Riley said picking up waste too early in the morning has been a recurring problem no matter what approach is taken to limit the issue. He asked the judge to sentence McGill to 30 days in jail. Riley told WSB-TV he’s exhausted all other options. “Fines don’t seem to work,” Riley said. “The only thing that seems to stop the activity is actually going to jail.” Riley says 911 lights up when trash haulers come before 7 a.m. McGill, who didn’t have an attorney with him when he was sentenced, is serving his time on the weekend. His new attorney wonders why he’s being punished. “Give him a warning,” attorney Kimberly Bandoh said. “I mean he’s the employee. He’s not the employer. Sentencing him to jail is doing what?” McGill opted to serve his time on the weekends, spreading the sentence out over more than three months. McGill said he just wants to get back with his wife, two sons and four dogs. [UPDATE] — Sandy Springs reverses decision, suspends jail time for Kevin McGill

Summary: Most of us have at some point been woken before dawn by the incessant beeping and slamming sounds of the garbage truck just outside the window. But one Atlanta suburb has a city ordinance that actually prohibits trash collection prior to 7am. As a result, Kevin McGill, who's spent just three months on the job in Sandy Springs, Ga., will spend 30 days in jail for violating the ordinance and picking up trash a few minutes after 5am recently, reports ABC 7. Chief prosecutor Bill Riley, who pushed for jail time, says early trash pickups are a recurring noise nuisance that routinely inspire 911 calls, reports the Atlanta Sun Times. "Fines don't seem to work," he said. "The only thing that seems to stop the activity is actually going to jail." McGill has opted to serve his time spread out over 14 consecutive weekends so that he can continue working and still come home to his wife, two sons, and four dogs. It remains unclear why he was on the job so early.

multi_news

en

Summarize: By. Ashley Collman. PUBLISHED:. 01:06 EST, 13 October 2013. |. UPDATED:. 01:10 EST, 13 October 2013. Two couples perished Thursday flying from their homes in South Florida to Virginia to attend a wedding. The victims have been identified as Theodore Bradshaw, 61, and Mary Anne Bradshaw, 48 of Cooper City, Florida and Charles Rodd, 64, and Diane Rodd, 58, of Boynton Beach, Florida. Mr Bradshaw was piloting the twin-propeller Cessna 340 when it took off Thursday morning from the Fort Lauderdale Executive Airport. Lost: Charles and Diane Rodd were two of the passengers on a private flight that crashed in Virginia's Great Dismal Swamp on Thursday. What went wrong? The Cessna 340 plane was being piloted by 61-year-old Theodore Bradshaw who Virginia State Police say had 30 years of flying experience. The crash is still under investigation. The group was due to arrive at the Hampton Roads Executive Airport around noon, but the airport lost communication with the airplane about twenty miles away - on the Virginia side of the Great Dismal Swamp. On Friday, the plane crash site was discovered by crews using a privately-owned helicopter. Since the crash site is in such a remote and swampy area, crews had to work on Saturday clearing a path to the scene for vehicles. Teams hope to recover the bodies of the pilot and three passengers on Sunday. Crash: Two couples died Thursday after their private plane crashed over the Great Dismal Swamp in Virginia. Above, investigators set up a base near the scene. Hard to reach: Since the plane crashed in a remote area of the Great Dismal Swamp, a path had to be cleared with a bulldozer. Crews hope to recover all four bodies on Sunday. Authorities are still investigating what caused the crash. According to the Virignia State Police, Mr Bradshaw had 30 years of piloting experience. He was a retired firefighter with Sunrise Fire-Rescue. The group was flying to Virignia to attend the wedding of his nephew. Apparently the two women on board were sisters. According to passenger Charles Rodd's ex-wife Marie Rodd - he was a Vietnam veteran who served two tours of duty and earned two Purple Hearts. 'He was very patriotic. He was a wonderful husband, a wonderful father,' she told the Sun-Sentinel. 'He was a very nice friend.' Mr Rodd also recently had lung cancer, but it had gone into remission. Remembered: Charles Rodd's ex-wife remembered him as a very patriotic man who served two tours in Vietnam and earned two Purple Hearts. Sources say that the two women on board were sisters and that the two couples were flying to Virginia to attend the pilot's nephew's wedding. Above, Charles and Diane Rodd. Corinne Stephenson was Charles and Diane Rodd's next-door neighbors. She said they were 'wonderful neighbors' considerate enough to send her a get-well card during a recent hospital stay. They were in the middle of a home renovation when the crash happened. 'They planned to stay there the rest of their lives.' The crash is currently under investigation by the Virginia State Police, the Federal Aviation Administration and the National Transportation Safety Board

Summary: Theodore Bradshaw, 61, Mary Anne Bradshaw, 48, Charles Rodd, 64, and Diane Rodd, 58, were flying from Fort Lauderdale, Florida to Chesapeake, Virginia Thursday when they crashed in the Great Dismal Swamp. The two couples were on their way to a wedding. The Cessna was being piloted by Theodore Bradshaw, who police say had 30 years flying experience. Authorities are still investigating the cause of the crash. Teams worked Saturday to clear a road to the crash site and hope to recover all four bodies on Sunday.

cnn_dailymail

en

Summarize: Lovers write their names on a padlock, attach it to a bridge and throw keys in the river in romantic act inspired by novel On top of its usual problems of rising flood waters, sinking palazzi, tourist congestion and corrosive pigeon droppings, Venice faces a new challenge that city officials are struggling to unpick. Inspired by a bestselling romantic novel, young lovers are rushing to attach padlocks to the city's historic Rialto bridge, risking damage to the stonework and requiring policemen with bolt cutters to remove them. The craze, inspired by I Want You, the 2006 novel by Federico Moccia, involves couples writing their names on the padlock, swearing eternal love and throwing the keys into the canal. Stefania Battaggia, the head of Venice's Office for Urban Quality, said the trend was pushing the city's reputation for romance too far. "It's against the law and the rust from the locks risks damaging the stone," she said. "We have found 50 of them on metal stanchions but have yet to nab anyone while they are in the act." Battaggia said that young couples had first shown a preference for Venice's wooden Ponte del Accademia, where up to 300 padlocks are now fixed, despite a clean up with boltcutters in February. But the 16th century Rialto, with its arches and central portico, was a more sensitive target, she said. "It's urgent we act because the problem is spreading to the Rialto, the symbol of the city." Moccia's fictional padlocking took place at Rome's Milvian bridge, which was known as a lovers' hangout in Roman times and where Constantine won a decisive battle in 312 before becoming undisputed Roman emperor. After the novel's success, lampposts on the bridge were strung with so many padlocks they threatened to collapse, prompting Rome's mayor to order special railings to be erected for the locks. Today, the area has been transformed from a quiet neighbourhood into a late-night drinking spot and vendors line up on the bridge to sell padlocks and pens. The padlocking phenomenon also spread to Turin, Naples, Palermo and Florence, where police stripped 5,000 locks from the Ponte Vecchio and the mayor threatened a €43 fine for offenders. In Verona, locks have been attached to the house from where the real life Juliet supposedly called out to Romeo. "This phenomenon amuses me, I have never regretted it," said Moccia on Tuesday. "Kids do want they want and this could not be controlled." Outside Italy, the practice has popped up in Paris, Madrid, Lithuania, Hungary, South Korea and even on the Great Wall of China, Italian newspaper La Repubblica stated on Tuesday. But the desecration of the Rialto was the last straw for La Repubblica, which denounced the padlocks in a furious front page editorial, calling for €3,000 fines and up to a year in jail for offenders who are caught in the act. "The padlockers are neither poets, sculptors or artists but vandals and hooligans and the locks are ruining marble, iron and stone," it stated, adding that the padlocks were a new and "vulgar" symbol of Italian love. Moccia defended the trend and said that the padlocks were in fact a sign that Italian teenagers were learning good manners. "This phenomenon started thanks to a desire to leave walls clean," he told La Repubblica. "It is better to have padlocks here than graffiti defacing our walls." The Brooklyn Bridge isn’t feeling the love. The gym locker-sized padlocks that lovestruck visitors attach to the iconic span as a symbol of undying affection is causing damage to the bridge, city officials claim. The Transportation Dept., which monitors New York City’s bridges, is calling for a lockdown on the romantic “love lock” ritual, claiming maintenance crews removed a whopping 5,600 of the latches from the 5,989-foot span since July. As long as this bridge is standing, our love will be too. But the new bid to shut down the ritual wasn’t discouraging smitten tourists from expressing their love Tuesday with colorful clasps, which don names of lovers and the date. “It’s a sign of our love,” said Krissie Walder, 31, before she clipped a heart-shaped lock to the 131-year-old bridge. “As long as this bridge is standing, our love will be too.” The romantic “love lock” ritual is also creating a safety hazard for motorists driving below the pedestrian path across the famed East River, officials said. (Natalie Musumeci/New York Daily News) The German tourist and her sweetheart Dirk Schneider, 33, crossed the bridge Tuesday, two days after getting engaged at DUMBO’s River Cafe during their first trip to New York. “It’s the same in Munich,” said Walder of a similar love lockdown. “The government says they don’t want it.” Sweethearts Krissie Walder and Dirk Schneider from Germany clipped a heart-shaped lock with their names engraved on it to the 131-year-old bridge on Tuesday after getting engaged two days before. (Natalie Musumeci/New York Daily News) On Tuesday, during their third visit to the Big Apple, English couple Richard Sargent, 40, and Adrian Rogers, 47, attached a lock inscribed with their names to the landmark. The couple clipped a lock two years ago to Paris’ famed Passerelle Léopold-Sédar-Senghor “Bridge of Love,” where thousands are affixed to the railing of the footbridge. Most of the locks say the names of lovers and the date. (Natalie Musumeci/New York Daily News) Hundreds of "love locks" adorn the Brooklyn Bridge. (Natalie Musumeci/New York Daily News) The city wants tourists and New Yorkers to stop clipping locks to the Brooklyn Bridge. (Natalie Musumeci/New York Daily News) “We put one there and now we decided to put one on the Brooklyn Bridge,” said Sargent, who said he believes cars and graffiti are more harmful to the span than the few hundred locks. “We wanted to leave something of us behind.” The emblematic custom was birthed in Italy decades ago and spread to Paris. It became noticeable on the Brooklyn span in 2010 and has since become a popular tourist attraction. But Transportation Dept. spokeswoman Nicole Garcia said the number of locks on the bridge has increased in recent weeks, causing the cost of removal efforts to rise as well. She also claims the ritual creates safety hazards for motorists driving below the pedestiran path, although she could not point to a recent incident or elaborate. “When a minor component such as a hand railing is impacted by the number or weight of the locks, these custom elements of this national landmark must be removed and a replacement must be newly fabricated, further increasing costs,” said Garcia. [email protected]

Summary: Campaigners against "love locks" might now be tempted to say "I told you so" to those who called them unromantic fools: An iconic Paris bridge was evacuated after the weight of padlocks left by couples collapsed a metal grill. Nobody was injured by the collapse on the Pont des Arts bridge, which was closed for several hours, but city officials say they will step up efforts to find an alternative for couples who want to prove their love by attaching locks to bridges and throwing the keys in the river, Reuters reports. The trend-which was inspired by a romantic novel in Italy in 2006 and has spread worldwide, the Guardian finds-has left bridges in many cities groaning under the weight of padlocks and authorities are starting to clamp down. In New York City, the transportation department has called for an end to the practice, saying maintenance crews removed some 5,600 padlocks from the Brooklyn Bridge in less than a year and the locks are threatening to damage the 131-year-old landmark, the New York Daily News reports.

multi_news

en

Summarize: MTV to 'Jersey Shore' Cast: Arrivederci For Good! MTV to 'Jersey Shore' Cast: Arrivederci For Good! Sources connected with " Jersey Shore " confirm with TMZ... MTV will say goodbye for good to the current cast when they wrap Season 5.Although some big wigs on the show denied it last week, we're told MTV wants a fresh cast of characters after they wrap Season 5 -- which begins shooting in New Jersey Monday.Here's the thing. MTV gets the best of both worlds. They can keep the "Jersey Shore" machine going by growing a new crop of much cheaper stars. And, as for the break-outs in the original cast -- includingand Pauly D... the network has already signed them to spinoffs. Vinny Leaves 'Jersey Shore' House -- FOR GOOD Vinny Leaves 'Jersey Shore' House -- FOR GOOD has bailed on the "" house and the show once again -- but this time, we're told it's for good.Sources directly connected to the cast tell TMZ... Vinny bolted from the house late last night after getting into an argument with another cast member. We're told Vinny was feeling "burned out" and went back home to Staten Island. We have confirmed that he is at his house in Staten Island right now.Vinny threatened to leave a few days ago, after he complained of "being homesick." We're told the cast was able to talk him into coming back, but that didn't last long.Sources connected with the show say Vinny has been a pain in the ass and no one will be getting on their knees, begging him to come back.TMZ spoke with executive producer Sally Ann Salsano, who tells us, "We do not comment on the production of the show."

Summary: A furious Vinny "Sea Biscuit" Guadagnino stormed out of the Jersey Shore crew's current house, jumped into a cab, and headed home-for good, reports TMZ. The big breakup occurred after Vinny had a major fight with another cast mate, sources say. He's holed up in his Staten Island home and feeling "burned out," said a pal. Vinny has been such a pain lately that no one cares to expend the effort to entice him back, sources add. MTV is rumored to be hunting for a new Jersey Shore cast for Season 6 to inject some variety into the relentless party reality show.

multi_news

en

Summarize: State/Province: AK - Alaska AL - Alabama AR - Arkansas AZ - Arizona CA - California CO - Colorado CT - Connecticut DC - District of Columbia DE - Delaware FL - Florida GA - Georgia HI - Hawaii IA - Iowa ID - Idaho IL - Illinois IN - Indiana KS - Kansas KY - Kentucky LA - Louisiana MA - Massachusetts MD - Maryland ME - Maine MI - Michigan MN - Minnesota MO - Missouri MS - Mississippi MT - Montana NC - North Carolina ND - North Dakota NE - Nebraska NH - New Hampshire NJ - New Jersey NM - New Mexico NV - Nevada NY - New York OH - Ohio OK - Oklahoma OR - Oregon PA - Pennsylvania RI - Rhode Island SC - South Carolina SD - South Dakota TN - Tennessee TX - Texas UT - Utah VA - Virginia VT - Vermont WA - Washington WI - Wisconsin WV - West Virginia WY - Wyoming AS - American Samoa FM - Federated States of Micronesia GU - Guam MH - Marshall Islands MP - Northern Mariana Islands PR - Puerto Rico PW - Palau VI - Virgin Islands AA - Armed Forces Americas AE - Armed Forces AP - Armed Forces Pacific AB - Alberta BC - British Columbia MB - Manitoba NB - New Brunswick NL - Newfoundland and Labrador NS - Nova Scotia NT - Northwest Territories NU - Nunavut ON - Ontario PE - Prince Edward Island QC - Quebec SK - Saskatchewan YT - Yukon None Required Gwyneth Paltrow The Chicken Made Me Do It!! Fails at Being Poor Gwyneth Paltrow -- The Chicken Made Me Do It!! Fails at Being Poor Last week, chef (and great man) Mario Batali challenged me to raise awareness and money for the Food Bank For New York City by trying to live on $29 dollars for the week (what low income families on SNAP are trying to survive on). Dubious that I could complete the week, I donated to the Food Bank at the outset, and all of us at the goop office began the challenge. Our basket looked like this: It cost $24.40 (plus a little olive oil and salt)—things like avocados and limes are cheap in Southern California. As I suspected, we only made it through about four days, when I personally broke and had some chicken and fresh vegetables (and in full transparency, half a bag of black licorice). My perspective has been forever altered by how difficult it was to eat wholesome, nutritious food on that budget, even for just a few days—a challenge that 47 million Americans face every day, week, and year. A few takeaways from the week were that vegetarian staples liked dried beans and rice go a long way—and we were able to come up with a few recipes on a super tight budget. After trying to complete this challenge (I would give myself a C-), I am even more outraged that there is still not equal pay in the workplace. Sorry to go on a tangent, but many hardworking mothers are being asked to do the impossible: Feed their families on a budget which can only support food businesses that provide low-quality food. The food system in our beautiful country needs to be subjected to a heavy revision—it is a cyclical problem, with repercussions that we all feel. I’m not suggesting everyone eat organic food from some high horse in the sky. I’m saying everyone should be able to afford fresh, real food. And if women were paid an equal wage, families might have more of a choice in the grocery aisles, not to mention in the rest of their lives. According to White House statistics, “Full-time women workers earnings are only about 77 percent of their male counterparts earnings. The pay gap is even greater for African-American and Latina women, with African-American women earning 64 cents and Latina women earning 56 cents for every dollar earned by a Caucasian man.” This isn’t just unacceptable, this is reprehensible, and it is incumbent on all of us (hats off to Patricia Arquette) to do something about it. And that means making it an issue that we all talk about. (Think you might not be receiving equal pay for equal work? Here are some resources for addressing it.) The Clinton Foundation’s No Ceilings initiative is fighting for equality on a global level, while Moms Rising is another great organization that focuses on family issues, like equal pay, maternity and paternity leave, and affordable childcare. They are currently rallying awareness and action around the Paycheck Fairness Act, something we all need to get behind. And please don’t forget the organization that kicked this whole thing off: The Food Bank For New York City, which provides more than 63 million free meals per year to New Yorkers in need. According to their site, “approximately 1.4 million people—mainly women, children, seniors, the working poor and people with disabilities—rely on soup kitchens and food pantries” throughout the five boroughs. Please donate here. I know hunger doesn’t always touch us all directly—but it does touch us all indirectly. After this week, I am even more grateful that I am able to provide high-quality food for my kids. Let’s all do what we can to make this a basic human right and not a privilege. love, gp Gwyneth Paltrow has found herself under scrutiny once again; this time for eating too much! After finishing up her seven-day food stamp challenge – in which she spent only $29 on groceries – the Goop mogul celebrated with a big old pig-out meal. While any gal is entitled to a celebratory eat session, Paltrow lent herself to criticism after posting a picture of her food stamp groceries a little too soon before her extravagant meal. PHOTOS: The Top 30 Secrets & Scandals Gwyneth Paltrow Doesn’t Want You To Know About This is what $29 gets you at the grocery store—what families on SNAP (i.e. food stamps) have to live on for a week. pic.twitter.com/OZMPA3nxij — Gwyneth Paltrow (@GwynethPaltrow) April 9, 2015 She ended the New York Food Bank Challenge at Los Angeles hotspot restaurant Animal, where she apparently indulged in a lavish dinner. “It was a prefixed menu, and the tickets were $80,” a source told E! of the dinner, a promotional event for friend Jon Favreau‘s new film, Chef. “Some of the items on the menu were various types of barbeque, potato salad and beans.” #ElJefe A photo posted by Alex Hardy (@alexhardy32) on Apr 15, 2015 at 12:45am PDT PHOTOS: Gwyneth Paltrow’s Top 25 Most Outrageous & Out-Of-Touch Quotes After fans began to criticize the actress for her food faux pas, her publicist quickly came to her defense: “She finished the challenge last week when Mario [Batali] challenged her on 3 April. She didn’t get to post the photos of the groceries until the 9 April,” they explained. “The point of the challenge is to show just how impossible it is to live on 29 dollars a week which is why most families run out of money 2/3 into the week at least.” Do you think Gwyneth should’ve posted her food stamp challenge a little sooner? Let us know in the comments below!

Summary: Gwyneth Paltrow's much-maligned attempt at the food stamp challenge was supposed to last a week, but she cheated after four days, she admits in a post published yesterday on Goop. Her self-given final grade: C-. She notes that she was "dubious" from the outset that she'd be able to make it the entire week, and so donated to the Food Bank For New York City right away. She then pivots to income inequality, writing that after attempting the challenge, "I am even more outraged that there is still not equal pay in the workplace. Sorry to go on a tangent, but many hardworking mothers are being asked to do the impossible: Feed their families on a budget which can only support food businesses that provide low-quality food." "Everyone should be able to afford fresh, real food," she continues. "And if women were paid an equal wage, families might have more of a choice in the grocery aisles, not to mention in the rest of their lives." As for what she ate after she "broke down": chicken, fresh veggies, and half a bag of black licorice. The challenge ended sometime last week, Paltrow's rep told TMZ. The Goop post contains three recipes whipped up as part of the challenge. Among them: "Brown Rice, Kale and Roasted Sweet Potato Sauté with Poached Eggs."

multi_news

en

Summarize: By. Daily Mail Reporter. Paging doctor lead-foot. A prominent Boston surgeon with a well-documented need for speed was arrested over the weekend after police caught him driving his luxury sedan at nearly 120 miles per hour. Dr. Adel Malek, a 48-year-old Harvard University graduate and chief of neurovascular surgery at Tufts Medical Center, was clocked doing 118 mph in his 2011 Audi A8 by a police aircraft on Sunday while cruising down a New Hampshire highway. The posted speed limit on Interstate 89 - where Malek was stopped - is 65 mph. Lead foot: Dr. Adel Malek's driving record is nine pages long and his license has been suspended three times. This is far from the first time the doctor has been stopped for speeding - in fact, his driver's license has been suspended multiple times after accumulating dozens of speeding tickets. According to the Massachusetts Department of Transportation, Malek's driving record is nine pages long - and that only includes violations he acquired in the Bay State. 'It shows a history of speeding violations dating back to the 1980s. The. driver has been suspended three times for accumulating multiple. violations over a set period of time, a 60-day suspension in 2009 for. seven surchargeable events, a 60-day suspension in 2008 for seven. surchargeable events, and a 30-day suspension in 1995 for five. surchargeable events,' MassDOT spokeswoman Sara Lavoie tells the Boston Herald. Busted: Malek was clocked doing 118 mph on a New Hampshire highway on Sunday. 'Before. reinstating each time he had to complete a driver retraining course and. pay a reinstatement fee.' Malek graduated from Harvard Medical School in 1994. He completed his residency at Brigham and Women's Hospital. Unlike his driving record, Malek has an unblemished medical disciplinary record and has won awards for his research on aneurisms. In 2012, U.S. News and World Report named Malek as one of the best doctors in the U.S. Fancy: The Audi A8 can cost anywhere from $75,000 to $135,000 and can have up to 500 horsepower. Malek's work has been published in several medical journals, including the Journal of the American Medical Association. The doctor was charged with reckless driving, but was released on bail shortly after

Summary: Dr. Adel Malek is the chief of neurovascular surgery at Tufts Medical Center in Boston. Malek was busted on Sunday doing 118 mph in a 65 mph zone. His Massachusetts driving record is nine pages long. Malek's license has been suspended three times for speeding. In 2012, U.S. News and World Report named Malek one of the best doctors in the U.S.

cnn_dailymail

en

Summarize: A study from the Centers for Disease Control and Prevention says one in 10 deaths among working-age adults is attributable to excessive alcohol use. (Photo: iStockphoto) One in 10 deaths among working-age adults between 2006 and 2010 were attributable to excessive drinking, researchers from the Centers for Disease Control and Prevention report. A study published in Preventing Chronic Disease found that excessive alcohol use — which includes binge drinking, heavy weekly alcohol consumption and drinking while underage or pregnant — was responsible for an average 88,000 deaths per year between 2006 and 2010. The lives of those who died were shortened by about 30 years. About 70% of those deaths were working-age adults between the ages of 20 to 64, said Mandy Stahre, epidemiologist at the Washington State Department of Health and author of the study. "We're talking about a large economic impact, people who are contributing to society," Stahre said. "They're in the prime of their lives, whether they're building up careers or midcareer. A lot of attention we tend to focus on is maybe college drinking or just drunk driving. This really talked about the broadness of the problem." The study was conducted using the CDC's Alcohol-Related Disease Impact tool, which estimates total alcohol-attributable deaths across the United States and in individual states. This study marks the first release of a nationwide report on the number of alcohol-related deaths, but Stahre said they had been collecting information since 2001. The tool gathers mortality statistics from local and state governments, and used scientific methods developed by a group of experts on alcohol and public health to determine the number of deaths linked to alcohol use. There has been a small rise in deaths since 2001, but nothing statistically significant, Stahre said. The 2010 figures represent the last year that data is available, but Stahre hopes the CDC will continue releasing reports every five years to monitor the mortality rates. Stahre also hopes the reports will push state governments to enact more policies concerning alcohol regulation and spread awareness of the potentially fatal consequences of excessive drinking. William Kerr, a scientist with the Alcohol Research Group, a national research organization, agrees that the current government policies in place could be strengthened toward alcohol regulation. "It's important to think about what might be done to reduce this (death) toll, and think about government policies that might reduce availability and increase the price of alcohol that is known to impact drinking in general and binge drinking," Kerr said. The Distilled Spirits Council, however, took issue with recommendations it says the CDC has made for increased alcohol taxes, and limiting hours for alcohol sales and the density of retail alcohol outlets. "Repeatedly, studies have shown that alcohol abusers are affected little by price," said Lisa Hawkins, the council's vice president, in a statement. It's the moderate alcohol consumers who are most affected by price, she said. The CDC tool estimates the number of the alcohol-related deaths that were caused by long-term health effects such as liver disease and heart disease, as well as short-period effects such as violence, alcohol poisoning, car crashes and drowning. Stahre said binge drinking (four or more drinks per occasion for women, five or more for men) played a large role in many of these short-term health effects and even some long-term effects. Traci Toomey, an epidemiologist and professor at the University of Minnesota who specializes in alcohol prevention, agreed that binge drinkers may pose a bigger problem to society than some may think. "Oftentimes when we talk about alcohol-related problems, people assume it's about alcoholism and they're the ones causing all the problems, when in fact any of us can drink alcohol in excess," Toomey said. "So because people occasionally binge drink and there are many more of them (than alcoholics), those non-addicted binge drinkers account for more problems in our society." This can result in an increase in binge drinking-related accidents on holidays such as July 4th, Stahre said, when people tend to drink heavily, adding risk to activities like boating and swimming. About 1.7 million people died from short-term causes such as crashes or accidents, compared to approximately 800,000 who died from long-term health causes like cancer or strokes, according to the study. "Alcohol is a common, socially accepted drug in our society, and it's widely legally available and glorified to a great extent, so that certainly creates a culture where binge drinking is common and accepted in many settings," said Toben Nelson, an epidemiologist and University of Minnesota professor. Read or Share this story: http://usat.ly/1mxyhmA All other clinicians completing this activity will be issued a certificate of participation. To participate in this journal CME activity: (1) review the learning objectives and author disclosures; (2) study the education content; (3) take the post-test with a 75% minimum passing score and complete the evaluation at www.medscape.org/journal/pcd; (4) view/print certificate. This activity has been planned and implemented in accordance with the Essential Areas and policies of the Accreditation Council for Continuing Medical Education through the joint providership of Medscape, LLC and Preventing Chronic Disease. Medscape, LLC is accredited by the ACCME to provide continuing medical education for physicians. PEER REVIEWED Abstract Introduction Excessive alcohol consumption is a leading cause of premature mortality in the United States. The objectives of this study were to update national estimates of alcohol-attributable deaths (AAD) and years of potential life lost (YPLL) in the United States, calculate age-adjusted rates of AAD and YPLL in states, assess the contribution of AAD and YPLL to total deaths and YPLL among working-age adults, and estimate the number of deaths and YPLL among those younger than 21 years. Methods We used the Centers for Disease Control and Prevention’s Alcohol-Related Disease Impact application for 2006–2010 to estimate total AAD and YPLL across 54 conditions for the United States, by sex and age. AAD and YPLL rates and the proportion of total deaths that were attributable to excessive alcohol consumption among working-age adults (20-64 y) were calculated for the United States and for individual states. Results From 2006 through 2010, an annual average of 87,798 (27.9/100,000 population) AAD and 2.5 million (831.6/100,000) YPLL occurred in the United States. Age-adjusted state AAD rates ranged from 51.2/100,000 in New Mexico to 19.1/100,000 in New Jersey. Among working-age adults, 9.8% of all deaths in the United States during this period were attributable to excessive drinking, and 69% of all AAD involved working-age adults. Conclusions Excessive drinking accounted for 1 in 10 deaths among working-age adults in the United States. AAD rates vary across states, but excessive drinking remains a leading cause of premature mortality nationwide. Strategies recommended by the Community Preventive Services Task Force can help reduce excessive drinking and harms related to it. Top of Page Introduction Excessive alcohol use is the fourth leading preventable cause of death in the United States (1) and costs $223.5 billion, or about $1.90 per drink, in 2006 (2). Excessive alcohol consumption includes binge drinking (ie, ≥5 drinks on an occasion for men; ≥4 drinks on an occasion for women), heavy weekly alcohol consumption (ie, ≥15 drinks/week for men; ≥8 drinks/week for women), and any drinking by pregnant women or those younger than 21 years (2). Binge drinking, the most common form of excessive alcohol consumption, usually results in acute intoxication and is responsible for over half of deaths and three-quarters of the economic costs of excessive drinking. Excessive drinking is also responsible for many other health and social problems (3,4). In 2004, the Centers for Disease Control and Prevention (CDC) released an online version of the Alcohol-Related Disease Impact (ARDI) application to allow state public health agencies and other users to assess deaths and years of potential life lost (YPLL) attributable to excessive drinking. By using ARDI, CDC estimated approximately 75,000 deaths and 2.3 million YPLL were due to excessive drinking in the United States in 2001 (5). However, since that time, no comprehensive analysis has been conducted of US deaths and YPLL from excessive alcohol consumption. Furthermore, the ARDI application does not provide rates for death and YPLL from excessive drinking. The assessment of these rates is important because the total number of alcohol-attributable deaths (AAD) and YPLL are known to vary substantially across states (6), as does the prevalence and intensity of binge drinking (3). Finally, the contribution of excessive drinking to deaths among working-age adults (20–64 y) and those younger than 21 years is not well understood, even though excessive drinking is known to be a major cause of premature mortality, resulting in an average of 30 years of life lost per AAD (5). The objectives of this study were to update previous national estimates of AAD and YPLL in the United States, calculate age-adjusted rates of AAD and YPLL in states, assess the contribution of AAD and YPLL to total deaths and YPLL among working-age adults, and estimate the number of deaths and YPLL that specifically involved those younger than 21 years. Top of Page Methods We estimated average annual deaths and YPLL from 2006 through 2010 that were attributable to excessive drinking by using the CDC’s ARDI online application (6). The methods used in ARDI were developed by a scientific workgroup that comprised experts in alcohol and public health. The details of these methods have been discussed elsewhere (5). Briefly, ARDI estimates AAD by multiplying the number of age- and sex-specific deaths from 54 alcohol-related causes, identified by the underlying cause of death reported on death certificates, by the alcohol-attributable fractions (AAF) for that cause of death. The majority of AAF for chronic conditions are calculated by ARDI on the basis of relative risk estimates from meta-analyses and the prevalence of alcohol use at specified risk levels (7,8). Self-reported alcohol use from the Behavioral Risk Factor Surveillance System (BRFSS) (9) was used to capture drinking at levels specified by the meta-analyses, which use slightly higher cut-points for risky drinking than those more commonly used in the United States. For the majority of acute conditions (ie, injuries), ARDI includes a direct estimate of the AAF. AAF for these conditions is based on studies assessing the proportion of deaths from a particular condition that occurred at or above a blood alcohol level of 0.10 g/dL (10). In addition, certain conditions (eg, alcoholic cirrhosis of the liver) are by definition 100% alcohol-attributable and therefore did not need to be estimated. To calculate YPLL attributable to excessive alcohol consumption, the age- and sex-specific AAD estimates for each cause were multiplied by the corresponding estimate of life expectancy based on the age and sex of the decedent. For causes of death that were considered chronic (eg, cancer, liver disease, cardiovascular disease), AAD and YPLL were estimated for decedents aged 20 years or older; for the majority of acute conditions, they were estimated for decedents aged 15 years or older. However, ARDI also estimates AAD and YPLL for chronic conditions for persons younger than 20 years who died from conditions attributable to drinking during pregnancy (eg, fetal alcohol spectrum disorders) and for acute conditions for persons younger than 15 years who died from motor-vehicle traffic crashes or child maltreatment. ARDI provides reports of AAD and YPLL by sex, age group, and state, and for those under age 21 years. AAD and YPLL due to excessive alcohol use, including those among decedents under age 21 years, were obtained directly from the ARDI application. Average annual national and state rates for AAD and YPLL per 100,000 population from 2006 through 2010 were calculated by dividing the average annual AAD and YPLL estimates from ARDI for 2006 through 2010 by the average annual population estimates from the US Census for 2006–2010, and then multiplying by 100,000. The rates were then age-adjusted to the 2000 US population (11). The proportion of total average annual deaths and YPLL among working-age adults that were alcohol-attributable was calculated by dividing the average annual AAD and YPLL estimates for adults aged 20 to 64 years from 2006 through 2010 from ARDI by the total average annual deaths and YPLL for all causes for adults aged 20 to 64 years from vital statistics, and then multiplying by 100. Top of Page Results An average of 87,798 AAD and 2,560,290 YPLL occurred in the United States annually from 2006 through 2010 (Table 1). Overall, 44% of the AAD and 33% of the YPLL were due to chronic conditions, and 56% of the AAD and 67% of the YPLL were caused by acute conditions. Most AAD (71%) and YPLL (72%) involved males. The most common cause of chronic AAD was alcoholic liver disease, while the most common cause of acute AAD was motor-vehicle traffic crashes. A total annual average of 4,358 AAD (5%) and 249,727 YPLL (10%) involved those under age 21 years from 2006 through 2010 (data not shown). Similar to the findings for adults, about 78% of the AAD and 76% of the YPLL in those younger than 21 involved males. However, in contrast to the findings for adults, all of the top 3 causes of death for those under age 21 years —specifically, motor-vehicle traffic crashes, homicide, and suicide —were acute conditions. In fact, motor-vehicle traffic crashes alone accounted for 36% of the total AAD for those under age 21 years. The average annual age-adjusted AAD rate for the United States from 2006 through 2010 was 27.9 deaths per 100,000 population, with a range of 51.2 deaths per 100,000 (New Mexico) to 19.1 deaths per 100,000 (New Jersey) (Table 2). Twenty-six states and the District of Columbia (DC) had higher average annual age-adjusted AAD rates than the national rate, and 2 states (New Mexico and Alaska) reported average annual age-adjusted AAD rates above 40 deaths per 100,000 population. The average annual age-adjusted YPLL rate for the United States from 2006 through 2010 was 831.6 per 100,000 population, with a range of 1,570 YPLL per 100,000 (New Mexico) to 570 YPLL per 100,000 (Hawaii) (Table 3). The average annual age-adjusted YPLL rates in 23 states and the District of Columbia were higher than the national rate, and 12 states and DC reported over 1,000 YPLL per 100,000 population. Average annual AAD were responsible for an average of 9.8% of total deaths (Table 2) and an average of 11.5% of YPLL among working-age adults (20–64 y) (Table 3) from 2006 through 2010.The average proportion of total deaths among working-age adults that were alcohol-attributable ranged from 16.4% in New Mexico to 7.5% in Maryland; the average proportion of total YPLL that were alcohol-attributable ranged from 18.5% in New Mexico to 9.1% in Maryland. From 2006 through 2010 more than two-thirds (69%) of all average annual AAD (Table 2) and 82% of average annual YPLL (Table 3) involved working-age adults (20–64 y). The proportion of average annual AAD in states that involved working-age adults ranged from 83% in Alaska to 56% in Vermont, and the proportion of average annual YPLL attributable to alcohol that involved working-age adults ranged from 88% in Alaska to 77% in Nebraska and Vermont. Top of Page Discussion From 2006 through 2010, excessive alcohol consumption accounted for nearly 1 in 10 deaths and over 1 in 10 years of potential life lost among working-age adults in the United States. Furthermore, an average of 2 out of 3 AAD and 8 out of 10 alcohol-attributable YPLL involved working-age adults. Although AAD rates varied by state, the national annual average AAD rate of 27.9 deaths per 100,000 population was higher than the average annual death rate for 10 of the 15 leading causes of deaths from 2006 through 2010 (12). The majority of the average annual AAD involved males (71%); over half of AAD and two-thirds of YPLL resulted from acute causes of death, all of which were by definition attributable to binge drinking. About 5% of all average annual AAD and 10% of average annual YPLL involved those under age 21 years, most of which were due to acute conditions. The average annual estimates of AAD and YPLL for the United States from 2006 through 2010 are similar to the 2001 estimates (5) and emphasize the substantial and ongoing public health impact of excessive drinking in the United States. The differences in age-adjusted AAD and YPLL rates in states probably reflect differences in the prevalence of excessive drinking, particularly binge drinking, which is affected by state and local laws governing the price, availability, and marketing of alcoholic beverages (13). The differences in AAD and YPLL rates in states probably also reflect other factors, including access to medical care and vehicle miles traveled, which could affect the risk of death from alcohol-related conditions (13,14). The higher rates of AAD and YPLL among men than women probably also reflects the higher prevalence, frequency, and intensity of binge drinking, the most common pattern of excessive alcohol consumption, among men (15). The substantial contribution of excessive alcohol consumption to total deaths and premature mortality among working-age adults (20–64 y) in the United States, as well as the large proportion of these deaths (69%) and YPLL (82%) that involved working-age adults, is consistent with studies assessing the contribution of harmful alcohol consumption to the global burden of disease (16) and also reflects the substantial effect that excessive alcohol consumption has across the lifespan. The concentration of AAD and YPLL among working-age adults is also a major factor contributing to alcohol-attributable productivity losses from premature mortality, which, together with reduced earnings by excessive drinkers, was responsible for 72% of the estimated $223.5 billion in economic costs from excessive alcohol consumption in 2006 (2). The findings in this report are subject to several limitations. First, data on alcohol consumption used to calculate indirect estimates of AAF are based on self-reports and may underestimate the true prevalence of excessive alcohol consumption because of underreporting by survey respondents and sampling noncoverage (17). A recent study that used BRFSS data found that self-reports identify only 22% to 32% of presumed alcohol consumption in states on the basis of alcohol sales (18). Second, risk estimates used in ARDI were calculated by using average daily alcohol consumption levels that begin at levels greater than those typically used to define excessive drinking in the United States. Third, deaths among former drinkers, who might have discontinued their drinking because of alcohol-related health problems, are not included in the calculation of AAF, even though some of these deaths might have been alcohol-attributable. Fourth, ARDI does not include estimates of AAD for several causes (eg, tuberculosis, pneumonia, hepatitis C) for which alcohol is believed to be an important risk factor, but for which suitable pooled risk estimates were not available. Fifth, ARDI exclusively uses the underlying cause of death from vital statistics data to identify alcohol-related causes and does not consider contributing causes of death that might be alcohol-related. Finally, age-specific estimates of AAF were only available for motor-vehicle traffic deaths, even though alcohol involvement varies by age, particularly for acute causes of death. While our results do show the substantial burden of alcohol-related consequences, many of the limitations cited could result in a substantial underestimate of the true contribution of excessive alcohol consumption to total deaths and YPLL in the United States. This analysis illustrates the magnitude and variability of the health consequences of excessive alcohol consumption in the United States, and the substantial contribution of excessive drinking to premature mortality among working-age adults. More widespread implementation of interventions recommended by the Community Preventive Services Task Force (19), including increasing alcohol prices by raising alcohol taxes, enforcing commercial host (dram shop) liability, and regulating alcohol outlet density, could reduce excessive alcohol consumption and the health and economic costs related to it. Top of Page Acknowledgments This article is dedicated to Ron Davis, MD, MA, for his visionary leadership and commitment to the prevention of excessive alcohol use. We thank Henry Wechsler, PhD, retired, Harvard School of Public Health, Harvard University. The development of the ARDI application was supported by generous grants (nos. 044149 and 059738) from the Robert Wood Johnson Foundation to the CDC Foundation. Top of Page Author Information Corresponding Author: Mandy Stahre, PhD, MPH, Epidemic Intelligence Service Officer, Washington State Department of Health, Olympia, WA 98504. Telephone: 360 236-4247. Email: [email protected]. Author Affiliations: Jim Roeber, New Mexico Department of Health, Santa Fe, New Mexico; Dafna Kanny, Robert D. Brewer, Xingyou Zhang, Centers for Disease Control and Prevention, Atlanta, Georgia. Top of Page References Mokdad AH, Marks JS, Stroup DF, Gerberding JL. Actual causes of death in the United States, 2000. [Published erratum in: JAMA 2005;293(3):293-4, 298]. JAMA 2004;291(10):1238–45. CrossRef PubMed Bouchery EE, Harwood H, Sacks JJ, Simon CJ, Brewer RD. Economic costs of excessive alcohol consumption in the US, 2006. [Published erratum in: Am J Prev Med 2013;44(3):198]. Am J Prev Med 2011;41(5):516–24. CrossRef PubMed Centers for Disease Control and Prevention. Vital signs: binge drinking prevalence, frequency, and intensity among adults — United States, 2010. MMWR Morb Mortal Wkly Rep 2012;61(1):14–9. PubMed National Institutes of Health. 10th Special Report to the US Congress on Alcohol and Health. Rockville (MD): US Department of Health and Human Services, National Institute on Alcohol Abuse and Alcoholism; 2000. Centers for Disease Control and Prevention. Alcohol-attributable deaths and years of potential life lost — United States, 2001. MMWR Morb Mortal Wkly Rep 2004;53(37):866–70. PubMed Centers for Disease Control and Prevention. Alcohol Related Disease Impact (ARDI) application, 2013. http://www.cdc.gov/ARDI. Accessed April 3, 2013. English DR, Holman CDJ, Milne E, Winter MG, Hulse GK, Codde JP, et al. The quantification of drug caused morbidity and mortality in Australia. 1995 edition. Canberra (AU): Commonwealth Department of Human Services and Health; 1995. Corrao G, Bargnardi V, Zambon A, Arico S. Exploring the dose-response relationship between alcohol consumption and the risk of several alcohol-related conditions: a meta-analysis. Addiction 1999;94(10):1551–73. CrossRef PubMed Centers for Disease Control and Prevention. Behavioral Risk Factor Surveillance System. http://www.cdc.gov/brfss. Accessed April 1, 2013. Smith GS, Branas CS, Miller TR. Fatal nontraffic injuries involving alcohol: a meta-analysis. Ann Emerg Med 1999;33(6):659–68. PubMed Klein RJ, Schoenborn CA. Age adjustment using the 2000 projected US population. Statistical Notes. No. 20. Hyattsville (MD): National Center for Health Statistics; 2001. Murphy SL, Xu JQ, Kochanek KD. Deaths: final data for 2010. National Vital Statistics Reports; Vol 61 no 4. Hyattsville (MD): National Center for Health Statistics; 2013. Naimi TS, Blanchette J, Nelson TF, Nguyen T, Oussayef N, Heeren TC, et al. A new scale of the US alcohol policy environment and its relationship to binge drinking. Am J Prev Med 2014;46(1):10–6. CrossRef PubMed Branas CC, MacKenzie EJ, Williams JC, Schwab CW, Teter HM, Flanigan MC, et al. Access to trauma centers in the United States. JAMA 2005;293(21):2626–33. CrossRef PubMed Kanny D, Liu Y, Brewer RD, Lu H. Binge drinking — United States, 2011. MMWR Surveill Summ 2013;62(Suppl 3):77–80. PubMed Rehm J, Mathers C, Popova S, Thavorncharoensap M, Teerawattananon Y, Patra J. Global burden of disease and injury and economic cost attributable to alcohol use and alcohol-use disorders. Lancet 2009;373(9682):2223–33. CrossRef PubMed Stockwell T, Donath S, Cooper-Stanbury M, Chikritzhs TN, Catalano P, Mateo C. Under-reporting of alcohol consumption in household surveys: a comparison of quantity-frequency, graduate-frequency and recent recall. Addiction 2004;99(8):1024–33. CrossRef PubMed Nelson DE, Naimi TS, Brewer RD, Roeber JUS. State alcohol sales compared to survey data, 1993–2006. Addiction 2010;105(9):1589–96. CrossRef PubMed Community Preventive Services Task Force. Preventing excessive alcohol consumption. In: The guide to community preventive services. New York, NY: Oxford University Press; 2005. http://www.thecommunityguide.org/alcohol/index.html. Accessed April 3, 2014. Top of Page Tables Table 1. Average Annual Number of Deaths and Years of Potential Life Lost (YPLL) Attributable to the Harmful Effects of Excessive Alcohol Use, by Cause and Sex, United States, 2006–2010 Cause Deaths YPLL Male, n (%) Female, n (%) Total Male, n (%) Female, n (%) Total Chronic causes Acute pancreatitis 411(57) 313 (43) 724 8,459 (62) 5,263 (38) 13,722 Alcohol abuse 1,587 (78) 435 (22) 2,022 39,949 (76) 12,842 (24) 52,791 Alcohol cardiomyopathy 441 (86) 73 (14) 514 10,357 (84) 1,909 (16) 12,266 Alcohol dependence syndrome 2,892 (78) 836 (22) 3,728 72,208 (75) 24,099 (25) 96,307 Alcohol polyneuropathy 7 (100) 0 7 117 (100) 0 117 Alcohol-induced chronic pancreatitis 59 (72) 23 (28) 82 1,546 (70) 673 (30) 2,219 Alcoholic gastritis 23 (79) 6 (21) 29 586 (75) 191 (25) 777 Alcoholic liver disease 10,403 (72) 3,961 (28) 14,364 251,921 (69) 114,347 (31) 366,268 Alcoholic myopathy 1 (100) 0 1 23 (100) 0 23 Alcoholic psychosis 502 (77) 151 (23) 653 10,511 (76) 3,294 (24) 13,805 Breast cancer (female only) NA 391 (100) 391 NA 7,429 (100) 7,429 Cholelithiases 0 0 0 0 0 0 Chronic hepatitis 1 (100) < 1 1 20 (71) 8 (29) 28 Chronic pancreatitis 139 (55) 116 (45) 255 2,940 (56) 2,297 (44) 5,237 Degeneration of nervous system due to alcohol 104 (83) 22 (17) 126 1,804 (79) 477 (21) 2,281 Epilepsy 108 (53) 95 (47) 203 3,170 (55) 2,612 (45) 5,783 Esophageal cancer 437 (89) 55 (11) 492 6,957 (89) 848 (11) 7,805 Esophageal varices 47 (72) 18 (28) 65 1,032 (72) 397 (28) 1,430 Fetal alcohol syndrome 3 (75) 1 (25) 4 163 (68) 78 (32) 241 Fetus and newborn affected by maternal use of alcohol 1 (50) 1 (50) 2 75 (48) 80 (52) 155 Gastro-esophageal hemorrhage 19 (61) 12 (39) 31 332 (66) 173 (34) 505 Hypertension 874 (55) 729 (45) 1,603 13,684 (61) 8,737 (39) 22,421 Ischemic heart disease 516 (70) 223 (30) 738 6,745 (73) 2,434 (27) 9,178 Laryngeal cancer 198 (86) 33 (14) 231 3,126 (84) 581 (16) 3,707 Liver cancer 752 (75) 245 (25) 997 13,033 (77) 3,893 (23) 16,926 Liver cirrhosis, unspecified 4,592 (59) 3,255 (41) 7,847 93,308 (59) 64,114 (41) 157,422 Low birth weight, prematurity, intrauterine growth restriction death 106 (64) 60 (36) 165 7,915 (62) 4,790 (38) 12,705 Oropharyngeal cancer 309 (85) 56 (15) 365 5,401 (86) 912 (14) 6,313 Portal hypertension 24 (63) 14 (37) 38 511 (66) 261 (34) 772 Prostate cancer 202 (100) NA 202 1,985 (100) NA 1,985 Psoriasis <1 <1 <1 2 (67) 1 (33) 3 Spontaneous abortion NA <1 <1 NA 10 (100) 10 Stroke, hemorrhagic 1,357 (83) 286 (17) 1,643 21,292 (83) 4,389 (17) 25,681 Stroke, ischemic 329 (74) 118 (26) 447 3,812 (76) 1,227 (24) 5,039 Superventricular cardiac dysrhythymia 122 (43) 160 (57) 282 1,065 (44) 1,356 (56) 2,421 Subtotal 26,564 (69) 11,689 (31) 38,253 584,050 (68) 269,722 (32) 853,771 Acute causes Air–space transport 81 (84) 15 (16) 96 2,408 (81) 569 (19) 2,977 Alcohol poisoning 1,264 (77) 383 (23) 1,647 42,299 (75) 13,833 (25) 56,132 Aspiration 125 (57) 94 (43) 220 2,431 (59) 1,701 (41) 4,132 Child maltreatment 98 (59) 70 (42) 167 6,947 (57) 5,345 (43) 12,292 Drowning 770 (80) 193 (20) 963 27,802 (82) 6,194 (18) 33,997 Excessive blood alcohol level 0 0 0 0 0 0 Fall injuries 3,853 (51) 3,688 (49) 7,541 53,443 (58) 39,015 (42) 92,458 Fire injuries 645 (59) 444 (41) 1,089 15,914 (59) 11,014 (41) 26,928 Firearm injuries 86 (88) 12 (12) 98 3,337 (87) 481 (13) 3,817 Homicide 6,221 (80) 1,535 (20) 7,756 274,753 (81) 64,612 (19) 339,364 Hypothermia 177 (67) 88 (33) 265 4,114 (72) 1,585 (28) 5,699 Motor-vehicle nontraffic crashes 171 (78) 49 (22) 220 5,345 (77) 1,554 (23) 6,899 Motor-vehicle traffic crashes 9,764 (78) 2,696 (22) 12,460 398,376 (77) 121,314 (23) 519,690 Occupational and machine injuries 126 (94) 8 (6) 134 3,359 (94) 201 (6) 3,560 Other road vehicle crashes 146 (79) 38 (21) 184 4,857 (78) 1,363 (22) 6,220 Poisoning (not alcohol) 5,457 (65) 2,947 (35) 8,404 203,635 (65) 111,371 (35) 315,007 Suicide 6,460 (79) 1,719 (21) 8,179 210,811 (77) 62,395 (23) 273,206 Suicide by and exposure to alcohol 28 (67) 14 (33) 42 842 (62) 524 (38) 1,366 Water transport 69 (87) 10 (13) 79 2,349 (85) 427 (15) 2,776 Subtotal 35,540 (72) 14,004 (28) 49,544 1,263,023 (74) 443,497 (26) 1,706,519 Total 62,104 (71) 25,693 (29) 87,798 1,847,072 (72) 713,218 (28) 2,560,290 Table 2. Average Annual Number of Deaths and Alcohol-Attributable Deaths (AAD), and Percentage of Deaths Among All Ages and Among Persons Aged 20–64 years, by State, United States, 2006–2010. State All Ages 20–64 years Total Deaths Total AAD Age-Adjusted AAD Rate per 100,000 Total Alcohol-Attributable Deaths, % Total Deaths Total AAD Total Alcohol-Attributable Deaths, % United States, total 2,445,322 87,798 27.9 3.6 620,259 60,617 9.8 Alabama 47,377 1,511 31.0 3.2 13,688 1,119 8.2 Alaska 3,531 275 41.1 7.8 1,443 229 15.9 Arizona 46,023 2,362 37.2 5.1 12,178 1,626 13.4 Arkansas 28,600 920 31.0 3.2 7,874 650 8.3 California 234,436 10,572 29.1 4.5 60,612 7,476 12.3 Colorado 30,684 1,628 33.2 5.3 8,429 1,200 14.2 Connecticut 28,794 836 22.1 2.9 5,904 544 9.2 Delaware 7,477 248 26.8 3.3 1,958 172 8.8 District of Columbia 5,035 210 34.7 4.2 1,732 155 9.0 Florida 170,507 6,643 32.6 3.9 40,970 4,493 11.0 Georgia 69,347 2,555 27.6 3.7 21,580 1,854 8.6 Hawaii 9,591 304 20.8 3.2 2,355 191 8.1 Idaho 10,985 437 28.9 4.0 2,578 291 11.3 Illinois 101,218 3,042 23.4 3.0 24,479 2,067 8.4 Indiana 55,816 1,646 25.1 2.9 14,102 1,168 8.3 Iowa 27,682 775 23.8 2.8 5,322 459 8.6 Kansas 24,508 762 26.6 3.1 5,453 518 9.5 Kentucky 40,976 1,351 30.5 3.3 11,518 994 8.6 Louisiana 40,433 1,475 32.8 3.6 12,495 1,103 8.8 Maine 12,534 372 24.8 3.0 2,722 241 8.9 Maryland 43,677 1,318 22.6 3.0 11,928 899 7.5 Massachusetts 52,954 1,525 21.8 2.9 10,920 1,022 9.4 Michigan 87,136 2,945 28.1 3.4 21,977 2,020 9.2 Minnesota 37,897 1,257 23.3 3.3 7,896 778 9.9 Mississippi 28,603 1,025 34.8 3.6 8,711 755 8.7 Missouri 54,990 1,866 30.3 3.4 13,661 1,256 9.2 Montana 8,713 390 37.7 4.5 2,090 275 13.2 Nebraska 15,121 422 22.7 2.8 3,040 261 8.6 Nevada 19,147 943 34.9 4.9 5,979 694 11.6 New Hampshire 10,186 341 23.8 3.3 2,289 222 9.7 New Jersey 69,557 1,754 19.1 2.5 15,543 1,206 7.8 New Mexico 15,670 1,042 51.2 6.6 4,619 758 16.4 New York 147,610 4,011 19.6 2.7 33,826 2,659 7.9 North Carolina 76,780 2,761 28.9 3.6 20,949 1,947 9.3 North Dakota 5,832 179 26.2 3.1 1,123 115 10.2 Ohio 107,798 3,288 26.9 3.1 25,994 2,179 8.4 Oklahoma 36,120 1,350 35.9 3.7 9,974 1,000 10.0 Oregon 31,655 1,302 32.1 4.1 7,456 863 11.6 Pennsylvania 125,482 3,510 25.8 2.8 26,807 2,290 8.5 Rhode Island 9,625 292 25.3 3.0 1,948 188 9.7 South Carolina 40,107 1,534 32.6 3.8 11,995 1,133 9.4 South Dakota 7,003 249 30.0 3.6 1,431 158 11.0 Tennessee 58,120 2,064 31.8 3.6 16,891 1,511 8.9 Texas 162,469 6,514 27.9 4.0 47,458 4,660 9.8 Utah 14,171 529 22.9 3.7 3,751 393 10.5 Vermont 5,170 183 26.5 3.5 1,125 103 9.2 Virginia 58,536 1,865 23.1 3.2 15,193 1,292 8.5 Washington 47,696 1,981 29.2 4.2 11,702 1,301 11.1 West Virginia 21,195 660 33.1 3.1 5,540 468 8.4 Wisconsin 46,442 1,706 28.5 3.7 9,866 1,027 10.4 Wyoming 4,305 210 37.5 4.9 1,188 159 13.4 Table 3. Average Annual Number of Years of Potential Life Lost (YPLL), Total YPLL, and Percentage of YPLL Among All Ages and Among Persons Aged 20 to 64 Years, by State, United States, 2006–2010 State All Ages 20–64 years Total YPLL Total Alcohol-Attributable YPLL Age-Adjusted YPLL Rate per 100,000 Total Alcohol-Attributable YPLL, % Total YPLL Total Alcohol-Attributable YPLL Total Alcohol-Attributable YPLL, % United States, total 38,281,133 2,560,290 831.6 6.7 18,380,927 2,106,126 11.5 Alabama 797,361 48,424 1030.1 6.1 408,573 40,535 9.9 Alaska 75,697 9,131 1299.6 12.1 45,281 8,042 17.8 Arizona 757,615 68,826 1111.8 9.1 368,170 56,603 15.4 Arkansas 469,241 28,226 991.3 6.0 234,355 23,211 9.9 California 3,704,628 304,472 822.0 8.2 1,806,358 251,821 13.9 Colorado 506,006 47,269 942.8 9.3 254,887 40,451 15.9 Connecticut 398,287 23,149 646.4 5.8 173,316 18,988 11.0 Delaware 119,510 7,453 840.5 6.2 58,397 6,079 10.4 District of Columbia 93,741 6,725 1083.9 7.2 52,568 5,426 10.3 Florida 2,580,471 187,068 999.6 7.2 1,217,429 154,447 12.7 Georgia 1,227,003 79,183 829.1 6.5 645,519 65,864 10.2 Hawaii 145,318 7,915 569.7 5.4 68,676 6,335 9.2 Idaho 171,134 12,311 819.7 7.2 76,901 9,873 12.8 Illinois 1,557,893 91,615 711.8 5.9 723,596 73,823 10.2 Indiana 879,690 50,042 780.9 5.7 416,119 41,253 9.9 Iowa 375,846 19,885 654.8 5.3 153,969 15,498 10.1 Kansas 364,862 22,131 792.1 6.1 161,373 18,091 11.2 Kentucky 672,103 41,780 969.0 6.2 341,312 35,393 10.4 Louisiana 715,228 49,719 1116.6 7.0 379,576 41,270 10.9 Maine 176,731 9,929 723.2 5.6 77,630 8,064 10.4 Maryland 713,579 40,075 694.8 5.6 357,601 32,410 9.1 Massachusetts 728,381 41,501 616.0 5.7 318,262 34,389 10.8 Michigan 1,343,335 84,215 838.0 6.3 644,275 68,738 10.7 Minnesota 537,350 32,829 616.2 6.1 231,357 26,237 11.3 Mississippi 504,546 32,916 1134.4 6.5 261,516 27,550 10.5 Missouri 856,379 55,681 941.2 6.5 405,162 44,787 11.1 Montana 133,084 11,331 1163.5 8.5 62,408 9,471 15.2 Nebraska 214,124 11,682 651.0 5.5 88,984 9,037 10.2 Nevada 334,423 27,923 1034.9 8.3 177,069 23,441 13.2 New Hampshire 145,490 8,789 637.1 6.0 66,054 7,260 11.0 New Jersey 1,005,669 50,856 575.8 5.1 457,224 42,068 9.2 New Mexico 268,778 31,129 1570.1 11.6 142,364 26,281 18.5 New York 2,162,819 111,986 564.5 5.2 985,558 90,878 9.2 North Carolina 1,259,703 83,125 886.8 6.6 619,963 68,842 11.1 North Dakota 81,298 5,132 785.5 6.3 33,320 4,061 12.2 Ohio 1,632,999 91,851 789.8 5.6 757,943 74,828 9.9 Oklahoma 595,524 41,460 1134.1 7.0 295,639 34,833 11.8 Oregon 462,860 33,933 868.3 7.3 215,541 27,934 13.0 Pennsylvania 1,789,327 100,106 794.0 5.6 785,357 81,180 10.3 Rhode Island 131,293 7,538 687.4 5.7 56,371 6,178 11.0 South Carolina 680,320 47,267 1037.5 6.9 353,461 39,646 11.2 South Dakota 101,838 7,023 889.3 6.9 42,598 5,519 13.0 Tennessee 972,290 63,058 999.8 6.5 500,315 52,831 10.6 Texas 2,799,886 199,618 823.6 7.1 1,429,308 165,170 11.6 Utah 245,204 16,800 673.9 6.9 119,423 14,075 11.8 Vermont 72,760 4,335 664.6 6.0 32,292 3,317 10.3 Virginia 931,966 55,232 687.3 5.9 447,064 45,349 10.1 Washington 719,348 53,050 784.1 7.4 342,548 43,400 12.7 West Virginia 330,370 19,464 1056.6 5.9 162,457 16,477 10.1 Wisconsin 665,699 44,249 769.0 6.6 289,133 34,776 12.0 Wyoming 72,123 6,480 1183.3 9.0 36,352 5,563 15.3 Top of Page Post-Test Information To obtain credit, you should first read the journal article. After reading the article, you should be able to answer the following, related, multiple-choice questions. To complete the questions (with a minimum 75% passing score) and earn continuing medical education (CME) credit, please go to http://www.medscape.org/journal/pcd. Credit cannot be obtained for tests completed on paper, although you may use the worksheet below to keep a record of your answers. You must be a registered user on Medscape.org. If you are not registered on Medscape.org, please click on the "Register" link on the right hand side of the website to register. Only one answer is correct for each question. Once you successfully answer all post-test questions you will be able to view and/or print your certificate. For questions regarding the content of this activity, contact the accredited provider, [email protected]. For technical assistance, contact [email protected]. American Medical Association’s Physician’s Recognition Award (AMA PRA) credits are accepted in the US as evidence of participation in CME activities. For further information on this award, please refer to http://www.ama-assn.org/ama/pub/about-ama/awards/ama-physicians-recognition-award.page. The AMA has determined that physicians not licensed in the US who participate in this CME activity are eligible for AMA PRA Category 1 Credits™. Through agreements that the AMA has made with agencies in some countries, AMA PRA credit may be acceptable as evidence of participation in CME activities. If you are not licensed in the US, please complete the questions online, print the AMA PRA CME credit certificate and present it to your national medical association for review. Post-Test Questions Article Title: Contribution of Excessive Alcohol Consumption to Deaths and Years of Potential Life Lost in the United States CME Questions You are seeing a 30-year-old woman who reports a history of binge drinking several times per month as well as past heavy drinking. You express your concern over her drinking, but you are unsure which problem drinking pattern is most harmful. Overall, which of the following forms of problem drinking account for the highest proportion of deaths from excessive alcohol use? Heavy weekly alcohol consumption Cumulative heavy drinking during a period of at least 5 years Binge drinking Drinking during pregnancy What should you consider regarding the epidemiology of alcohol-attributable deaths and years of potential life lost in the current study by Stahre and colleagues? The gross numbers of alcohol-attributable deaths and years of potential life lost failed to decrease since the last measurement in 2001 Approximately 30% of alcohol-attributable deaths occurred among individuals younger than 21 years Alcohol-attributable deaths and years of potential life lost affected men and women equally Older adults (>65 years) accounted for most cases of alcohol-attributable deaths and years of potential life lost Which of the following states had the highest rates of alcohol-attributable deaths and years of potential life lost in the current study by Stahre and colleagues? Delaware New York New Mexico Alabama According to the current study by Stahre and colleagues, what percentage of all deaths was caused by excessive alcohol use between 2006 and 2010? 0.4% 2% 3% 10% Evaluation 1. The activity supported the learning objectives. Strongly Disagree Strongly Agree 1 2 3 4 5 2. The material was organized clearly for learning to occur. Strongly Disagree Strongly Agree 1 2 3 4 5 3. The content learned from this activity will impact my practice. Strongly Disagree Strongly Agree 1 2 3 4 5 4. The activity was presented objectively and free of commercial bias. Strongly Disagree Strongly Agree 1 2 3 4 5 Top of Page The opinions expressed by authors contributing to this journal do not necessarily reflect the opinions of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. UGLY TRUTH Ten percent of Americans will die due to alcohol abuse this year, adding up to millions of years of lost life. If people moderated their alcohol intake and avoided excessive drinking, it would prevent 10 percent of the deaths that occur in this country every year in people between the ages of 20-64. Tallying up all the potential years of life lost annually due to alcohol-related deaths, the total reaches 2.5 million years. Those are the results of a new study released today by the Centers for Disease Control (CDC). The authors collected data related to 54 different causes of death that could be attributed to alcohol, both chronic and acute. For some of these conditions, like motor vehicle collisions due to intoxication, or cirrhosis of the liver, mortality could be attributed entirely to the effect of alcohol. For other conditions, such as high blood pressure or breast cancer, the deaths related to alcohol were calculated using risk estimates for developing the different diseases based on varying levels of intake. The study, published in the journal Preventing Chronic Disease, defined excessive alcohol intake as either binge drinking—five or more drinks on a single occasion for men, four or more for women—or heavy weekly consumption—15 or more weekly drinks for men, eight for women. Since much of the data collected relied on self-reporting by individuals, which can low-ball the amount actually consumed when compared to alcohol sales in various areas, it may be that alcohol plays an even greater role in preventable death than even this new study shows. All told, alcohol-related deaths comprise about 10 percent of the total deaths in the United States per year among working-age people. Those who die prematurely are overwhelmingly—71 percent—male, and over half die as the direct result of binge drinking. Though still lagging behind tobacco use, poor nutrition, and sedentary lifestyle on the list of preventable causes of death in our country, excessive drinking leads to the cumulative loss of millions of years of potential human life. These numbers are stark and sobering—in many cases, one hopes literally so. It’s one thing to have an intellectual understanding of the health risks associated with imbibing too much. But seeing the thousands of deaths per year of liver disease, cancer, and trauma that could have been prevented makes clear how serious the problem of alcohol abuse is from a public health perspective, to say nothing of the individual tragedies each death represents. As a pediatrician, my eye searched for data that relates to the lives of children. I made grim note of the hundreds of deaths each year that are due to alcohol-related child abuse, and that the top three causes of alcohol-related deaths for those under 21 are motor vehicle accidents, homicide, and suicide—with the first way out in front at 36 percent. Even though the focus of the study is on preventable deaths among people defined as working age, it’s a harrowing reminder that excessive alcohol consumption isn’t a problem limited to that age group. Unlike tobacco use, the number one cause of preventable death and a terrible habit with nothing to recommend it, moderate alcohol consumption is safe and may actually confer some benefits. Drinking is, for many people, an enjoyable part of social gatherings and a complement to meals. For that small number of my patients who are of legal drinking age, I tell them to keep consumption limited, but I don’t advise total abstinence. (I have many patients who disclose that they drink despite not having turned 21, in which case I do advise abstinence.) Drinking is not, in and of itself, something that must be strictly avoided.

Summary: One out of every 10 deaths among working-age adults can be blamed on booze, the CDC reports. Researchers behind a new study in the journal Preventing Chronic Disease came up with the stat after crunching the numbers on deaths of people ages 20 to 64 from 2006 through 2010. The figure includes both direct causes-car crashes, alcohol poisoning, drunken violence-as well as longer-term health problems linked to excessive drinking, reports USA Today. Binge drinking, defined as four drinks at one sitting for women and five for men, played a particularly big role in the deaths. All those lives cut short translates into 2.5 million lost years annually, reports the Daily Beast. The vast majority of those who die prematurely are men, at 71%. "We're talking about a large economic impact, people who are contributing to society," says the author of the CDC study. "A lot of attention we tend to focus on is maybe college drinking or just drunk driving. This really talked about the broadness of the problem."

multi_news

en

Write a title and summarize: Plant nucleotide-binding leucine-rich repeat (NB-LRR) disease resistance (R) proteins recognize specific “avirulent” pathogen effectors and activate immune responses. NB-LRR proteins structurally and functionally resemble mammalian Nod-like receptors (NLRs). How NB-LRR and NLR proteins activate defense is poorly understood. The divergently transcribed Arabidopsis R genes, RPS4 (resistance to Pseudomonas syringae 4) and RRS1 (resistance to Ralstonia solanacearum 1), function together to confer recognition of Pseudomonas AvrRps4 and Ralstonia PopP2. RRS1 is the only known recessive NB-LRR R gene and encodes a WRKY DNA binding domain, prompting suggestions that it acts downstream of RPS4 for transcriptional activation of defense genes. We define here the early RRS1-dependent transcriptional changes upon delivery of PopP2 via Pseudomonas type III secretion. The Arabidopsis slh1 (sensitive to low humidity 1) mutant encodes an RRS1 allele (RRS1SLH1) with a single amino acid (leucine) insertion in the WRKY DNA-binding domain. Its poor growth due to constitutive defense activation is rescued at higher temperature. Transcription profiling data indicate that RRS1SLH1-mediated defense activation overlaps substantially with AvrRps4- and PopP2-regulated responses. To better understand the genetic basis of RPS4/RRS1-dependent immunity, we performed a genetic screen to identify suppressor of slh1 immunity (sushi) mutants. We show that many sushi mutants carry mutations in RPS4, suggesting that RPS4 acts downstream or in a complex with RRS1. Interestingly, several mutations were identified in a domain C-terminal to the RPS4 LRR domain. Using an Agrobacterium-mediated transient assay system, we demonstrate that the P-loop motif of RPS4 but not of RRS1SLH1 is required for RRS1SLH1 function. We also recapitulate the dominant suppression of RRS1SLH1 defense activation by wild type RRS1 and show this suppression requires an intact RRS1 P-loop. These analyses of RRS1SLH1 shed new light on mechanisms by which NB-LRR protein pairs activate defense signaling, or are held inactive in the absence of a pathogen effector. Plant innate immunity relies on two layers of pathogen detection. Cell surface-localized pattern recognition receptors detect pathogen-associated molecular patterns (PAMPs) of invading microorganisms and activate PAMP-triggered immunity (PTI) [1]. Successful pathogens must circumvent PTI to colonize plants, and many bacterial pathogens use type III secretion (T3S) to deliver effectors that suppress PTI into plant cells [1]. Effectors can be detected directly or indirectly by plant disease resistance (R) proteins, which then activate effector-triggered immunity (ETI) generally together with a hypersensitive response (HR) of the infected tissue [2]. Most intracellular R proteins are modular, with an amino-terminal coiled coil (CC) or Toll/interleukin-1 receptor/R protein (TIR) domain, a nucleotide binding (NB) domain and a leucine-rich repeat (LRR) domain [3]. Some NB-LRR proteins also carry an additional carboxyl-terminal extension, the function of which is unknown [3]. In addition, NB-LRR protein function generally requires an intact P-loop motif (GxxxxGKT/S) in the NB domain, presumably for ATP binding and energy-dependent conformational changes [3], [4]. Plant NB-LRR proteins and mammalian Nod-like receptors (NLRs) exhibit both structural and functional similarities [5]. Signaling following TIR-NB-LRR protein activation requires other key regulators such as Enhanced Disease Susceptibility 1 (EDS1), the EDS1-related proteins PAD4 and SAG101, and biosynthesis of the plant hormone salicylic acid (SA) for full immunity [6]. EDS1 was recently reported to interact with several NB-LRR proteins [7], [8]. Mis-regulation of R protein accumulation, localization or activation can cause constitutive defense responses, which are usually deleterious or lethal. For instance, the dwarf suppressor of npr1-1, constitutive 1 (snc1) mutant carries a point mutation between NB and LRR domains of the TIR-NB-LRR protein SNC1, which results in constitutive defense signaling [9], [10]. Suppression of the stunted snc1 phenotype in mos (modifier of snc1) mutants allowed the identification of several genes required for nuclear defense signaling [11]–[14]. Although most R proteins function to recognize a corresponding avirulent effector (Avr), some NB-LRR proteins appear to act downstream of R protein activation. The tobacco and tomato CC-NB-LRR proteins, “N-required gene 1” (NRG1), and “NB-LRR protein required for HR-associated cell death 1” (NRC1), are required for TIR-NB-LRR protein N-mediated resistance to tobacco mosaic virus and receptor-like protein Cf-4-mediated resistance to tomato leaf mold pathogen, respectively [15], [16]. Arabidopsis CC-NB-LRR Activated Disease Resistance 1 (ADR1) family proteins are required for SA-dependent ETI [17]. The Arabidopsis accession Col-0 downy mildew resistance locus RPP2 comprises two distinct closely linked NB-LRR genes RPP2A and RPP2B, both of which are required for resistance [18]. The rice Pia locus for blast (Magnaporthe) resistance comprises two divergently transcribed CC-NB-LRR genes, RGA4 and RGA5, again both required for resistance [19]. In mammals, the NLR NAIP2 confers specific recognition of PrgJ, whereas NLRs NAIP5 and NAIP6 confer responses to flagellin. However, the NLR NLRC4 is required for defense responses to both PrgJ and flagellin [20], [21]. NLRC4 association with either NAIP2 or NAIP5/6, upon provision of PrgJ or flagellin respectively, is required for defense activation [20], [21]. The T3S effectors AvrRps4 and PopP2 from Pseudomonas syringae and Ralstonia solanacearum respectively, are recognized by paired TIR-NB-LRR proteins RPS4 (resistance to P. syringae 4) and RRS1-R (resistance to R. solanacearum 1), and activate ETI in Arabidopsis [22]–[24]. RRS1-R alleles, found in accessions Ws-2, No-0 and Nd-1, confer recognition of PopP2; the RRS1-S allele of Col-0 does not recognize PopP2, but does recognize AvrRps4 [22]–[24]. Lack of AvrRps4 recognition in accession RLD is due to non-synonymous mutations in RPS4, and RRS1-S in Col-0 is truncated compared to RRS1-R because of an early stop codon [24]–[26]. RPS4 and RRS1-R genetically function together, as plants lacking RPS4, RRS1-R or both show similar enhanced susceptibility to bacterial strains expressing AvrRps4 or PopP2 [25], [26]. RRS1 (also annotated as WRKY52) is an atypical NB-LRR protein that also carries a C-terminal WRKY DNA-binding domain [22]. In this study, we delivered PopP2 using Pseudomonas T3S by fusing it with the N-terminal region of AvrRps4 (AvrRps4N). Pseudomonas-delivered AvrRps4N: PopP2 triggers RPS4- and RRS1-dependent HR and immunity in resistant Arabidopsis genotypes when tagged with a nuclear localization signal (NLS) but not when tagged with a nuclear exclusion signal (NES). We show that the delivery of PopP2, or an inactive PopP2C321A variant, from a Pseudomonas fluorescens strain (Pf0-1) that lacks other effectors [27], results in the induction of ETI-specific genes that overlaps substantially with previously reported AvrRps4-regulated genes [28], [29]. The presence of a single amino acid (Leu) insertion in the WRKY domain of RRS1-R (RRS1SLH1 hereafter) causes the recessive lethal phenotype of the sensitive to low humidity 1 (slh1) mutant in No-0 [30]. RRS1SLH1-induced lethality is associated with enhanced defense gene expression and high SA accumulation. Similarly to other mutants displaying spontaneous cell death, slh1 mutant growth can be restored to wild type phenotype at 28°C [30]–[32]. In contrast to snc1, the slh1 mutant allele is recessive and heterozygotes show no constitutive defense activation [30]. RRS1 is also recessive and an RRS1-R/RRS1-S heterozygote is unable to recognize PopP2 [22], [23]. Here, we used the conditional RRS1SLH1-mediated lethal phenotype to gain insights into RPS4/RRS1 gene pair function. Transcriptional profiling of the slh1 mutant shows that genes induced during RRS1SLH1-mediated defense activation in the absence of Avr overlap with those induced by AvrRps4- or PopP2-triggered immunity. Genetic screening for mutations that suppress slh1-triggered aberrant immunity reveals the critical role of RPS4 in RRS1SLH1-mediated activation of defense signaling. Transient expression of RPS4 and RRS1SLH1 in tobacco results in HR in the absence of AvrRps4 or PopP2, which can be suppressed by co-expression of wild type RRS1-R, consistent with the recessive nature of RRS1SLH1. Our study sheds new light on how paired R proteins work cooperatively and illustrates the similarities between auto-active and Avr-dependent defense signaling. To compare AvrRps4- or PopP2-triggered HR and immunity, we established the delivery of PopP2 via the Pseudomonas T3S. We engineered pEDV6, a Gateway-compatible version of pEDV3 [33], to carry full-length or N-terminally truncated PopP2 variants (Figures 1A and S1A–B). pEDV6 enables expression of a translational fusion between the N-terminal part of AvrRps4 (137 first amino acids; hereafter, AvrRps4N) and an effector of interest. We used a non-pathogenic Pseudomonas fluorescens Pf0-1 engineered to carry a functional T3S system (hereafter, Pf0-1 (T3S) ) in HR assays because unlike Pseudomonas syringae pv. tomato (Pto) DC3000, Pf0-1 (T3S) does not elicit non-specific tissue collapse. When delivered from Pf0-1 (T3S) or Pto DC3000, PopP21–488 (full-length) or PopP2149–488 triggered HR and immunity in Arabidopsis accession Ws-2, whereas the PopP2 variants that were further truncated did not (Figure S1C–D). Interestingly, the N-terminal 148 amino acids of PopP2 that include a nuclear localization signal (NLS) are dispensable in our assay. Based on this finding, we used the PopP2149–488 (hereafter, PopP2) variant for the rest of our experiments. To verify that Pseudomonas-delivered PopP2 confers genotype-specific avirulence, we investigated the responses of Arabidopsis natural variants to PopP2. When delivered from Pf0-1 (T3S), PopP2 and AvrRps4 triggered HR in accessions Nd-0 and Ws-2 whereas Col-0 and RLD showed no symptoms at 24 hours post-infection (hpi) (Figure 1B). Col-0 RRS1-S confers HR-deficient disease resistance to Pst DC3000 delivered AvrRps4 but not to PopP2 [22], [34]. In addition, transgenic expression of Ws-2 RRS1-R in Col-0 confers strong HR in response to Pseudomonas-delivered AvrRps4 [35]. HopA1 was used as an additional control; it triggers HR in Nd-0, Ws-2 and RLD, but not in Col-0, as expected. Next, we tested if Pf0-1 (T3S) -delivered PopP2 triggers RPS4- and RRS1-dependent HR in Arabidopsis. Pf0-1 (T3S) -delivered PopP2 triggered strong HR in wild type Ws-2 whereas Ws-2 rrs1-1, rps4-21, rrs1-1/rps4-21 or eds1-1 mutants did not show any response (Figure 1C). In contrast, Pf0-1 (T3S) -delivered AvrRps4 triggered weak but robust HR even in the absence of RPS4 or RRS1 in Ws-2 (Figure 1C). When delivered from Pto DC3000, AvrRps4 triggered immunity in wild type Ws-2, rrs1-1, rps4-21 or rrs1-1/rps4-21 mutants because AvrRps4 recognition leads to RPS4/RRS1-dependent and -independent immunity (Figure 1D) [26]. To test if Pseudomonas-delivered PopP2 can trigger RPS4/RRS1-dependent immunity in Arabidopsis, we engineered a virulent Pto DC3000 to deliver PopP2. Pto DC3000 (PopP2) showed reduced virulence in wild type Ws-2 but not in rrs1-1, rps4-21 or rrs1-1/rps4-21 mutants compared to Pto DC3000 (pEDV5) indicating that Pseudomonas-delivered PopP2 triggers only RPS4/RRS1-dependent immunity (Figure 1D), consistent with previously reported Ralstonia-delivery assay results [26]. By contrast, HopA1-triggered immunity was not affected in rrs1-1, rps4-21 or rrs1-1/rps4-21 mutants compared with wild type Ws-2 (Figure 1D). All tested Pto DC3000 strains showed unrestricted growth in the eds1-1 mutant compared to other genotypes. Taken together, these data indicate that AvrRps4N-mediated delivery of PopP2 from Pseudomonas can trigger RPS4/RRS1-dependent HR and immunity in Arabidopsis. We further tested if Pseudomonas-delivered PopP2 recognition requires a specific subcellular localization, as reported for AvrRps4 [8]. We engineered a PopP2149–488 variant lacking the native NLS, to carry a NLS or a nuclear export signal (NES) tag at the C-terminus. The avirulence activity of these PopP2 variants was tested in two resistant transgenic Arabidopsis lines, RLD (RPS4Ler) and Col-0 (RRS1Ws-2). Pf0-1 (T3S) -delivered PopP2NES, failed to trigger HR in both transgenic lines and in wild type Ws-2, despite being expressed during plant infection, indicating that nuclear localization of PopP2 is required to trigger RPS4/RRS1-dependent HR (Figure S2A, S2E and S3). The PopP2NES variant induced a response comparable to PopP2C321A, an enzymatically inactive variant that does not trigger RPS4/RRS1-R-dependent immunity [36] in wild type Ws-2 when HR-inducing activity was quantified by ion leakage measurements (Figure S2B). We could also show that PopP2NES, in contrast to PopP2NLS, could not restrict the virulence of bacteria when delivered from Pto DC3000, nor trigger expression of defense genes when delivered from Pf0-1 (T3S) (Figures S2C and S2D). As these data suggest that PopP2 triggers HR and immunity in the nucleus, we independently assessed previously reported AvrRps4 variants [8]. Unexpectedly, both AvrRps4NLS and AvrRps4NES variants triggered HR and elevated ion leakage in the Ws-2 accession when delivered from Pf0-1 (T3S) (Figure S2B and S2E). RRS1 is a TIR-NB-LRR protein with a WRKY DNA binding domain, which belongs to Group III of the WRKY superfamily [37]. RRS1SLH1, which carries a leucine insertion near the WRKY motif, shows strongly reduced DNA binding by its WRKY domain [30]. This reduced DNA binding correlates with auto-immunity of the slh1 mutant, suggesting a critical role of RRS1 in transcriptional regulation of defense genes. Delivery of PopP2 from Pseudomonas via T3S, combined with the RPS4/RRS1-R dependence of this PopP2-triggered HR, enables direct assessment of RRS1-R-dependent transcriptional regulation. To identify PopP2-triggered and RPS4/RRS1-dependent early transcriptional responses, genome-wide expression profiling was carried out using EXPRSS, an Illumina sequencing based method [38]. Wild type Ws-2 and rrs1-1 plants were infiltrated with Pf0-1 (T3S) delivering PopP2WT or PopP2C321A. The infiltrated leaf tissues were collected at 2,4, 6 and 8 hpi for total RNA extraction, as onset of HR began at 8 hours after bacterial infiltration in an incompatible interaction (PopP2WT/Ws-2). For differential expression analysis, PopP2WT-infiltrated Ws-2 samples were compared either to PopP2C321A mutant on Ws-2 or PopP2WT on rrs1-1. Essentially complete overlap was observed between the differentially regulated genes in the two comparisons (Figure 2A), consistent with our results showing that Pf0-1 (T3S) -delivered PopP2 triggers RRS1- and acetyltransferase activity-dependent immunity (Figures 1 and S2). In total, 719 genes were differentially expressed in an RRS1- and acetyltransferase activity-dependent manner in at least one of the time points surveyed (Table S1). Gene ontology enrichment analysis using ATCOECIS [39] showed that most of the up-regulated genes are involved in defense, while most of the down-regulated genes are involved in photosynthesis and enriched in chloroplast-localized genes (Table S2). Interestingly, the majority of genes differentially expressed at 4 and 6 hpi were up-regulated, while many down-regulated genes were observed at 8 hpi (Figure 2A). The early (4 and 6 hpi) up-regulated genes, such as SID2, FMO1, NudT7, PBS3 and PAD4, have previously been implicated in plant defense (Table S3). Further analysis of mean expression of genes induced at 4 and 6 hpi (Table S3) showed that there was greater gene induction in Ws-2 infiltrated with PopP2WT (∼20–100 fold) than in Ws-2 infiltrated with PopP2C321A or in rrs1-1 infiltrated with PopP2WT (∼2–10 fold). For simplicity, we interpret genes induced by PopP2C321A as induced by the repertoire of PAMPs in Pf0 (thus, PTI-induced), and by PopP2WT as PTI+ETI-induced. To validate our transcriptional expression profiling results, we performed quantitative RT-PCR (qRT-PCR) verification of EDS5, NudT6, WRKY18 and WRKY40 with the cDNA used for Illumina libraries. Expression of EDS5 and NudT6 but not WRKY18 and WRKY40 was specifically regulated by ETI in our expression profiling data. In qRT-PCR experiments, PopP2 but not PopP2C321A variant delivered from Pf0-1 (T3S) induced EDS5 and NudT6 in an RRS1-dependent manner, while expression of WRKY18 and WRKY40 was induced in the absence of ETI (Figure S4). AvrRps4- and PopP2-dependent transcriptional changes in resistant plants have been investigated previously [28], [29], [40]. We compared these available micro-array and RNA-seq data with our results. To minimize the effects of experimental and technical differences from the AvrRps4/Ws-2 data [28], genes altered in expression at 6 hpi due to mock treatment were subtracted from the comparison; similarly, only the GMI1000/GMI1000ΔPopP2-infected Nd-1 data were used from the Hu et al. [40] study. For comparative analysis the differential expression from PTI, PTI+ETI and ETI responses were combined for data presented in this study (Table S1) and the data from Howard et al. [29]. A summary of these comparisons is presented in Figure S5 and details of genes from comparative datasets are presented in Table S4. Transcriptional changes upon AvrRps4 infection on Col-0 and Ws-2 [28], [29] considerably overlapped with PopP2-regulated genes identified both in our study and the GMI1000/GMI1000ΔPopP2 study [40] (Figure S5). The majority of early PTI+ETI-induced genes detected in our study were also found to be AvrRps4-responsive [28], [29] (Figure S5 and Table S4). We next tested the expression of four PopP2-responsive genes PBS3, SARD1, FMO1 and PR1 by qRT-PCR in Ws-2, rps4-21 and eds1-1. At 8 hpi, Pf0-1 (T3S) -delivered AvrRps4WT, HopA1 or PopP2WT triggered similar levels of induction of the four genes in Ws-2 (Figure 2B). Induction of all four genes was strictly dependent on EDS1 and abolished when non-functional variants of the effectors (AvrRps4KRVY-AAAA, AvrRps4E187A and PopP2C321A) were delivered. PTI+ETI-induction of all four genes in response to PopP2 was reduced to PTI-induced levels in both rps4-21 and in rrs1-1 mutants, confirming RPS4/RRS1-R-dependence of PopP2-induced transcriptional changes. AvrRps4-triggered induction of all four genes was reduced but not abolished in the rps4-21 mutant, likely due to RPS4-independent recognition of AvrRps4 in Ws-2 [26], [41]. These expression profiling data thus reveal the genes specifically regulated at very early stages of PopP2-triggered, RPS4/RRS1-dependent immunity in Arabidopsis. Moreover, these ETI transcriptional changes are very similar after AvrRps4 or PopP2 recognition. To compare slh1 aberrant defense responses to effector-triggered RPS4/RRS1-mediated immunity, we conducted transcription profiling of the slh1 mutant over a time course after shifting plants from 28°C to 19°C, using Illumina tag sequencing [38]. A total of 1821 genes showed temperature-dependent differential expression in RRS1SLH1 after 24 hours (h) compared to wild type No-0 (Figure 3A). We confirmed the temperature-dependent regulation of 3 genes with differential induction in slh1 by qRT-PCR. PR1, PBS3 and CBP60g transcript accumulation was induced in slh1 plants between 9 and 24 h after the shift from 28°C to 19°C whereas it was unaltered in temperature-shifted No-0 plants (Figure 3B). We compared the slh1/No-0 temperature-shift transcriptional dataset to the PopP2/RRS1-time course dataset by analyzing the pairwise overlap of genes differentially expressed in both experiments (Figure 4). Each time course response was categorized according to the mode of elicitation as PTI, ETI, temperature shift, auto-immunity, or corresponding combinations (e. g. PTI+ETI). We found that most (∼83%) of the PopP2/RRS1 ETI genes were differentially expressed in slh1 auto-immune and temperature shift responses, while up to 54% of ETI genes were also differentially expressed in the auto-immune response but not by temperature shift (Figure 4, black box). Similarly, more than 55% of auto-immune genes were also differentially expressed in PTI and PTI+ETI (Figure 4, dotted block box). Most ETI genes were also differentially expressed in PTI+ETI (more than 85%) and in PTI (up to 70%). However, less than 10% of the PTI genes were differentially expressed during ETI (Figure 4, blue box). This strongly suggests that many ETI responses involve potentiation of a subset of PTI responses, with few genes solely regulated by effector recognition. The ETI-specific genes that are regulated in PopP2 acetyltransferase activity- and RRS1-dependent manner include nucleotide/ATP-binding protein encoding genes such as NB-LRRs (Table S1). Similarly, we found that most temperature shift-regulated genes (up to 83%) (Table S5) were also differentially expressed by PTI or PTI+ETI, but only 25% were specifically affected by ETI, and less than 5% of the PTI-responsive genes were differentially expressed by temperature shift (Figure 4, green box). Up to 50% of PTI or PTI+ETI genes were also differentially expressed by temperature shift and auto-immune response, while about 25% of PTI or PTI+ETI genes were differentially expressed by auto-immune response (Figure 4, green box). These results indicate that PTI broadly activates genes responsive to heat, auto immunity and ETI. These analyses indicate that slh1 auto-immunity overlaps strongly with PopP2- and RPS4/RRS1-R-dependent ETI. Thus, RRS1SLH1-induced transcriptional reprogramming results in similar gene expression changes to those observed in AvrRps4- or PopP2-triggered immunity, indicating that the slh1 lethal phenotype mimics RPS4/RRS1-dependent ETI at the transcriptional level. Lethality of slh1 at 21°C is correlated with constitutive activation of defense responses including high expression of Pathogenesis Related (PR) genes and SA accumulation [30]. We hypothesized that mutations that affect RRS1SLH1-mediated signaling components or RRS1SLH1 expression would suppress slh1 lethality. To identify genetic components required for RRS1SLH1-dependent immunity, we conducted a suppressor screen. slh1 seeds were incubated with ethyl methanesulfonate (EMS), ∼7,000 M1 plants were grown at 28°C and M2 seeds were harvested. By screening ∼500,000 M2 mutant plants at 21°C, we identified 83 families with a suppressor of slh1 immunity (sushi) mutant phenotype. Among them, 69 and 14 could rescue the slh1 lethal phenotype to a wild type-like and an improved morphology, respectively. We further analyzed the progeny of 7 selected fully rescued sushi mutants for morphological development and defense marker gene expression in the M3 generation (Figure 5). Growth of sushi mutants at 21°C was similar to wild type No-0, whereas slh1 plants did not develop beyond the first true leaf stage (Figure 5A). PR1, PBS3 and FMO1 expression was elevated in slh1 mutants grown constantly at 21°C or 24 h after shift from 28°C to 21°C, but not in fully rescued sushi mutants (Figures 5B and S6). To exclude any contamination with wild type seeds, we confirmed the presence of the slh1 mutation in 72 of the 83 M3 individual sushi mutants identified using a cleaved amplified polymorphic sequences (CAPS) marker [30]. Next, we carried out Sanger sequencing of RRS1 and RPS4 coding regions in these mutants. As expected from the complete suppression of the slh1 phenotype, we identified 6 sushi intragenic suppressor mutants that carry an early stop codon in RRS1SLH1 and 8 other non-synonymous mutations (Table S6). Surprisingly, non-synonymous mutations were also identified throughout the RPS4 coding region in 34 rescued sushi mutants (Table S6). Most of the altered amino acid residues have not previously been shown to be required for RPS4 function [24]. However, sushi52 and sushi22 harbour non-synonymous mutations at positions R28 and E88 that are important for RPS4TIR+80-triggered HR in tobacco [42], further verifying the crucial role of the RPS4 TIR domain function in RRS1SLH1-mediated defense activation. It was previously reported that mutations in SID2/ICS1/EDS16 or SID1/EDS5 result in suppression of the RRS1SLH1 mutant phenotype [30]. We sequenced the coding region of these genes in the non-RRS1, non-RPS4 mutants, and found one sushi mutant that carried a mutation in SID2/ICS1/EDS16 (sushi70, Table S6), and no mutants that carry mutations in SID1/EDS5. Similarly to Arabidopsis accession Col-0, wild type No-0 carries two copies of EDS1. Therefore, EDS1 coding sequence was not verified in the sushi lines. The 23 remaining unassigned SUSHI mutations are now subjected to further analysis to identify new signaling components of RRS1SLH1-mediated immunity. Homo- or hemizygous, but not heterozygous, No-0 plants carrying RRS1SLH1 display a stunted phenotype at 21°C due to elevated immunity [30]. To verify that RPS4 is required for RRS1SLH1 function, we crossed 7 sushi lines carrying mutations in RPS4 (sushi17,64,24,12,41,58 and 32) to rrs1-1 and rrs1-1 rps4-21 knockout mutants [26]. The resulting F1 individuals from both crosses were hemizygous RRS1SLH1/rrs1 for RRS1 locus (Figure S7) and either RPS4sushi/RPS4WT or RPS4sushi/rps4 at the RPS4 locus. As expected, the F1 plants derived from a cross between the sushi and rrs1-1 were stunted and showed elevated PR1 expression level (Figure 6A–C). These phenotypes were both completely suppressed in the F1 plants derived from a cross between sushi mutants in RPS4 and rrs1-1 rps4-21 double mutant. This result confirms that RPS4 is required for RRS1SLH1-mediated activation of immunity. To further verify the functional requirement for RPS4 in RRS1SLH1-mediated immunity, we recapitulated RRS1SLH1-mediated defense activation in Nicotiana tabacum. As shown recently [39], Agrobacterium-mediated transient co-transformation (hereafter, agroinfiltration) of RPS4-HA, RRS1-His-Flag and wild type AvrRps4-GFP or PopP2-GFP induced strong HR within 3 dpi (Figure S8A). The specificity of recognition was further verified by comparing functionally characterized mutant variants of AvrRps4 or PopP2 to wild type. As expected, AvrRps4E187A, AvrRps4KRVY-AAAA and PopP2C321A variants did not induce RPS4/RRS1-dependent HR in tobacco (Figure S8A). We have also verified that AvrRps4 and PopP2 recognition in tobacco activate defense genes orthologous to those that are regulated by RRS1 in Arabidopsis. The transcripts of the defense genes NtWRKY51 and NtNudT7 were highly up regulated when PopP2-GFP was co-expressed with RPS4-HA and RRS1-His-Flag in tobacco (Figure S8B). Agroinfiltration of GFP or PopP2C321A-GFP with RPS4-HA and RRS1-His-Flag induced significantly lower accumulation of defense gene transcripts compared to wild type PopP2 (Figure S8B). Taken together, these results further demonstrate that our transient agroinfiltration assay can also be used to investigate RPS4/RRS1 regulated immunity. Agroinfiltration of epitope-tagged RRS1SLH1-His-Flag and RPS4WT-HA triggered HR in tobacco leaf cells, whereas RRS1SLH1 co-expressed with GFP or RPS4K242A (P-loop mutant) did not (Figures 6D and 8B). Consistent with our Arabidopsis genetic data (Figure 6B), agroinfiltration of RRS1SLH1 with each RPS4SUSHI variant did not trigger HR in tobacco (Figure 6D). Protein accumulation of the 7 tested RPS4SUSHI variants was comparable to that of RPS4WT, indicating that the lack of HR was not due to low protein expression levels (Figure S9). Moreover, as expected from our genetic analysis, RPS4SUSHI variants did not have a dominant negative effect on RPS4WT function, when both were co-expressed with RRS1SLH1 (Figure S10). We then tested whether SUSHI mutant alleles of RPS4 confer RRS1-dependent recognition of AvrRps4 or PopP2. Agroinfiltration of RRS1WT, RPS4WT and either AvrRps4 or PopP2, triggered RPS4 P-loop-dependent HR in infiltrated tobacco leaf sectors [43] (Figure 6D). Importantly, agroinfiltration of the 7 RPS4SUSHI variants did not confer responsiveness to AvrRps4 or PopP2 (Figure 6D). Taken together, these data show that RPS4 is required for RRS1SLH1-mediated and Avr-triggered/RRS1-dependent defense signaling activation. Recently, we showed the physical interaction of RRS1 and RPS4 [43]. We hypothesized that RPS4SUSHI variants may have lost their ability to interact with RRS1SLH1. However, RPS4SUSHI-HA variants and RPS4WT-HA were co-immunoprecipitated by RRS1SLH1-Flag or RRS1WT-Flag (Figure S9A-B). This result suggests that RPS4-RRS1 interaction is insufficient for signaling activation. We identified six additional sushi mutants that carry mutations in the TIR domain of RPS4, the structure of which is known [43]. The stunted growth and elevated defense transcript accumulation of slh1 at 21°C were considerably suppressed in sushi52 (R28H), 14 (A38V), 22 (E88K), 71 (L101F), 89 (P105L) and 29 (G120R) (Figure S11). The RPS4 TIR domain structure suggests that side-chains from R28 and A38 are surface exposed, while the side-chains of the other mutated residues are buried (Figure 7A). RPS4TIR expression is sufficient to trigger HR in tobacco after agroinfiltration (Figure 7B) [42]. Therefore we introduced these six SUSHI mutations into an RPS4TIR construct (amino acids 1 to 250) to test their individual effect on RPS4 TIR domain signaling. Strikingly, all six mutations suppressed this response, suggesting that each of these residues is important for RPS4 TIR domain defense activation either through interaction with downstream partners or by maintaining the correct signalling-competent structural conformation, as the protein stability/accumulation was not significantly altered when expressed as GFP fusions in tobacco (Figure S12D). Intriguingly, when SUSHI mutations were tested in the RPS4 full-length context by co-expression in tobacco with RRS1 and the effectors, A38V and L101F did not suppress RRS1SLH1- nor AvrRps4- and PopP2-triggered HR (Figure 7C). This discrepancy was not due to inconsistent level of protein accumulation (Figure S12E) but might illustrate a limitation of the transient expression system in tobacco, or subtle differences between defense activation by RPS4TIR, and by the activated RPS4/RRS1 complex. As nuclear localization of RPS4 is necessary for AvrRps4-triggered immunity [41], we investigated the role of RPS4 nuclear localization in RRS1SLH1-mediated cell death. Co-expression of RRS1SLH1 with RPS4WT or RPS4NLS induced HR (Figure 8A). However, RPS4NES did not induce HR when co-expressed with RRS1SLH1, indicating the importance of RPS4 nuclear localization for RRS1SLH1 function, consistent with a previous report [41]. Nucleotide binding to the invariant Lys residue of the P-loop motif in the NB domain of R proteins is critical for conformational change and immunity activation [4], [44], [45]. Agroinfiltration of RPS4WT, but not the P-loop mutant RPS4K242A, triggered HR when co-expressed with RRS1SLH1 (Figure 8B). However, RPS4K242A does interact with RRS1SLH1 and RRS1WT (Figure S9C). Therefore, a functional RPS4 P-loop motif is required for activation of RRS1SLH1-induced defense but is not an absolute requirement for RPS4-RRS1 interaction. Surprisingly, introduction of the P-loop mutation (K185A) in the RRS1SLH1 protein sequence did not affect HR-inducing activity when co-expressed with RPS4WT (Figure 8B). Thus, P-loop motif-dependent conformational change may not be required for defense activation by RRS1SLH1, consistent with the functionality of an RRS1 P-loop mutant in AvrRps4 or PopP2 recognition [43]. Structural analysis of RPS4 and RRS1 TIR domains revealed an “SH motif” in regions that mediate heterodimerization between RPS4 (S33 and H34) and RRS1 (S25 and H26) [43]. Moreover, RPS4 or RRS1 variants carrying a mutated SH motif (SH-AA) cannot recognize AvrRps4 or PopP2 in tobacco agroinfiltration [43]. To investigate if TIR-TIR domain heterodimerization is also required for RRS1SLH1 function, SH-AA mutations were introduced in RPS4WT and RRS1SLH1 variants. Agroinfiltration of RRS1SLH1 and RPS4SH-AA, or RRS1SLH1/SH-AA and RPS4WT did not induce HR in tobacco suggesting that TIR-TIR domain heterodimerization between RRS1 and RPS4 is required for RRS1SLH1-dependent defense activation (Figure 8B). However, in the context of the full-length proteins the RRS1SLH1/SH-AA variant could still interact with RPS4WT (Figure S9C). RRS1SLH1-dependent lethality is recessive [30]. In agreement, agroinfiltration of RRS1WT but not of GFP interfered with HR induced by co-expression of RRS1SLH1 and RPS4WT in tobacco (Figure 8C–D). Interestingly, the RRS1K185A variant did not interfere with RRS1SLH1-induced HR whereas the RRS1SH-AA variant did (Figure 8C), indicating that nucleotide-binding function but not RPS4/RRS1 TIR-TIR domain interaction is required for RRS1-mediated interference with RRS1SLH1-induced HR. These agroinfiltration data are consistent with our transcriptomic and genetic analyses and demonstrate the striking similarity of RRS1SLH1 and Avr-triggered/RRS1-dependent defense activation. As RRS1SLH1/RPS4-dependent constitutive HR is prevented by co-expression of RRS1WT, we tested if RRS1SLH1 interferes with RRS1WT recognition of AvrRps4 or PopP2. Interestingly, in the presence of both RRS1 variants and RPS4, AvrRps4- or PopP2-triggered HR is still observed suggesting that RRS1SLH1 did not completely abolish RRS1WT function (Figure 8D). However, AvrRps4-triggered HR was attenuated considerably compared to PopP2-triggered HR under the same conditions (Figure 8D). Although both AvrRps4 and PopP2 are recognized by RPS4 and RRS1, a thorough comparison of immune responses, particularly of early transcriptional changes, has been difficult due to the distinct infection modes of the bacterial pathogens from which AvrRps4 (Pseudomonas syringae) and PopP2 (Ralstonia solanacearum) originate. Root infection of Arabidopsis plants with R. solanacearum causes wilting within 2 weeks, whereas Pseudomonas-delivered AvrRps4 triggers HR in Arabidopsis Ws-2 leaf cells within 24 hours. PopP2 delivery from Pf0-1 (T3S) allowed us to compare the transcriptional reprogramming caused by recognition of AvrRps4 or PopP2 at the earliest stages and has resulted in the identification of a set of similarly regulated ETI-specific genes. It is interesting that the NLS is dispensable for the avirulence activity of PopP2 in our assays. It was shown that removal of the N-terminal NLS renders localization of PopP2 and co-expressed RRS1-S/R variants nuclear-cytoplasmic [46]. However, the significance of this PopP2 NLS-dependent relocalization of RRS1 is not known, as there have been no studies showing ETI phenotypes triggered by PopP2 lacking the NLS. As shown in Figure S2, a PopP2 variant lacking an N-terminal NLS shows similar levels of avirulence compared to wild type. Thus, PopP2 NLS-dependent relocalization of RRS1 may not be significant in PopP2-triggered immunity. Alternatively, the portion of RRS1 that is localized in the nucleus with the NLS lacking PopP2 might be sufficient to activate ETI. It is intriguing to find that AvrRps4NES and AvrRps4NLS are comparable in their ability to elicit HR in Arabidopsis Ws-2 (Figure S2E). AvrRps4NES triggers a slightly lower ion leakage level than AvrRps4NLS (Figure S2C). We conclude that regardless of AvrRps4 contribution to defense activation in the cytoplasm, its major role is in the nucleus via interactions with the RPS4/RRS1 complex. Pseudomonas T3S delivery of PopP2 provides a useful tool to investigate RPS4/RRS1-dependent transcriptional regulation at an early stage of ETI. In addition, by comparing non-functional variants of AvrRps4 and PopP2 to wild type proteins, we could identify the genes whose transcriptional changes were specific to Avr function. As Pf0-1 (T3S) carries a mutated HopA1 gene which is unable to trigger RPS6-dependent immunity in Arabidopsis, the gene expression change in rrs1-1 infiltrated with PopP2WT or in Ws-2 infiltrated with PopP2C321A can be considered as PTI resulting from perception of the Pf0-1 PAMP repertoire. We thus report defense gene expression changes as PTI vs. PTI+ETI (Table S3). Gene ontology enrichment has shown that the majority of early up-regulated genes are involved in plant defense. Comparative analysis with previously published microarray data shows that many PopP2-triggered early gene expression changes overlap substantially with AvrRps4-triggered transcriptional regulation [28], [29]. It is interesting to note that PopP2-regulated genes also overlap substantially with previously reported PopP2-induced genes at a later stage of infection when delivered from R. solanacearum [40]. Our discovery of early responding genes will allow us to test if they are directly regulated by RPS4/RRS1. It has been recently shown that WRKY18 and WRKY40 positively contribute towards AvrRps4-triggered immunity [47]. Consistent with this, WRKY18 and WRKY40 were highly induced at 3 and 6 hpi by AvrRps4 (Table S4). However, our experimental design enabled us to show that both WRKY18 and WRKY40 are primarily induced due to PTI (Figure S4). PTI+ETI and PTI induction of WRKY40 expression are indistinguishable. There is slightly higher PTI+ETI-induced expression of WRKY18 in response to PopP2WT in Ws-2 at later time points (6 and 8 hpi) compared to PTI elicited by PopP2C321A in Ws-2 or PopP2WT in rrs1-1 (Figure S4), but this could be due to elevated SA levels that we presume are responsible for strong PR1 induction at 8 hpi. It is interesting to note that AvrRps4-induced regulation of ETI genes only partially requires RPS4. This is consistent with AvrRps4 recognition being conferred by both RPS4/RRS1-dependent and -independent mechanisms. Identification of an R gene (s) that confer RPS4/RRS1-independent immunity will enable comparative analysis of how AvrRps4-induced ETI genes are transcriptionally regulated by different R genes. It was remarkable to observe that AvrRps4, PopP2 and HopA1 induced common genes at early stage of defense activation, suggesting a possible EDS1-dependent conserved gene activation mechanism in ETI. Several auto-active alleles of NB-LRR genes have been found [9], [10], [30], [48], [49], though unlike the recessive slh1, all others are dominant or semi-dominant. Plants carrying an auto-active R gene typically show temperature-dependent lethality and enhanced resistance to virulent pathogens [30]–[32]. However, in many cases the overlap between elevated disease resistance that is conferred by an auto-active R gene allele and by Avr-triggered immunity is poorly defined. Unlike most other auto-active R gene alleles, RRS1SLH1 carries a single amino acid insertion in the WRKY-DNA binding domain that reduces its DNA-binding affinity [30]. To address the role of RRS1 in transcriptional activation or repression, we tested whether RRS1SLH1-induced transcription changes overlap with AvrRps4- or PopP2-triggered transcription changes. Based on previously reported expression profiling data and the present study, we propose that the genes whose transcripts were differentially regulated by RRS1SLH1, and by AvrRps4 and PopP2 are directly regulated by RRS1 upon Avr detection. As exons 6 and 7 of RRS1SLH1 show reduced binding to a W-box in vitro, RRS1 may act as a transcriptional repressor of plant immunity, or at least as a repressor of RPS4 function, and this repression may be relieved upon Avr perception [30]. However, RRS1 could act both as repressor and activator of defense gene transcription, as has been found for other plant transcription factors [50]. Loss of RRS1-DNA binding may be part of the activation of defense transcription, but paradoxically, rrs1 knockout lines do not show enhanced immunity. Identification of RPS4 mutant alleles among the SUSHI mutations was unexpected, as we had anticipated that RRS1 might act downstream of RPS4 to regulate defense gene transcription directly. Notably, it would have been difficult to recover recombinants between RRS1SLH1 and an adjacent mutant allele of RPS4, so without a genetic screen, this discovery might not have been made. Based on the genetic requirement of RPS4 for RRS1SLH1-induced defense gene transcription, we now hypothesize that RPS4 is required to form a functional immune receptor complex with RRS1. This hypothesis is further supported by the fact that RPS4 and RRS1 interact with each other, in part but not solely by forming a TIR-TIR domain heterodimer [43]. In addition, the requirement of a functional P-loop motif for RPS4 but not for RRS1 function suggests that RPS4 contributes to defense activation by providing ATP-dependent conversion of a repressive immune receptor complex to an activated state. PopP2 interacts with RRS1 [46], as does AvrRps4 [43]. We hypothesize that RPS4 activates defense upon recognition of perturbations in RRS1 by effectors, and that RRS1SLH1 mimics the results of effector action upon RRS1. Can this be reconciled with the observation that a 35S: RPS4 constitutive defense phenotype partially requires RRS1 [51]? Conceivably, RRS1 might also play a chaperone-like role in facilitating conversion of RPS4 from an inactive to an active form, and RRS1SLH1 has enhanced activity in facilitating this conversion. The TIR domain of RPS4 induces cell death when transiently overexpressed in tobacco. Several amino acid residues were shown to be required for RPS4 TIR domain auto-activity [42]. Among the 33 single amino acid polymorphisms of RPS4 that we identified in sushi mutants, two residues, R28 and E88, were previously implicated as being required for RPS4 TIR domain-induced auto-activity in tobacco. R28H and E88K mutations are unlikely to alter the overall structure of RPS4 TIR domain, judging from the crystal structure of RPS4/RRS1 TIR domain heterodimer [43]. A study on RPS4 natural variants identified Y950 as an important residue for function as a susceptible RLD allele of RPS4 carries a Y950H mutation, and a Y950H substitution in the functional Ler allele of RPS4 abolishes its AvrRps4-recognition capability [24]. Interestingly, we identified several mutations (S914F, G952E and G997E) in this C-terminal domain (CTD) of RPS4. Although the function of the RPS4 CTD remains unclear, it appears to be important for immune signaling. Conceivably, the sushi-mutated residues found in the TIR domain (R28, E88, P105L and G120R) and in the CTD (S914F, G952E, and G997E) are involved in the interaction with RRS1 or other yet unknown partner (s). AvrRps4 and PopP2 interact directly with RRS1 [43], [46]. Conceivably, after interaction of AvrRps4 or PopP2 with RRS1, dissociation of the activated RPS4/RRS1 immune complex from target DNA induces RPS4 P-loop-dependent de-repression/activation of defense gene transcription, perhaps via WRKY18 and WRKY40 [47]. There may be multiple WRKY transcription factors that can replace the transcriptional repression function of RRS1, but not its Avr-recognition function. However, the Ws-2 RRS1SLH1 allele may make additional contributions to assembling a defense-activating complex beyond vacating W-boxes. An intriguing feature of RRS1 is that it is the only known recessive NB-LRR-encoding R gene. Consistent with this observation, the slh1 mutation is also recessive. We were able to recapitulate this feature by transiently co-expressing RRS1 with RPS4 and RRS1SLH1 and suppressing RPS4/RRS1SLH1-triggered HR. This suppression is abolished if the RRS1-R carries a mutation in its P-loop motif. Intriguingly, this result suggests that the RRS1-R P-loop is not required for RPS4-dependent HR activation, but potentiates assembly of an inactive, poised complex. Thus, we suggest that the recessive nature of RRS1 in the Col-0 (S) /Nd-0 (R) or Col-0 (S) /Ws-2 (R) cross is the result of the Col-0 allele encoding a protein that can interfere in trans with PopP2 responsiveness and thus acts as a “poison subunit”. There are nine TIR-NB-LRR gene pairs reported in the Arabidopsis Col-0 genome [26]. It is important to better understand how paired R proteins have evolved and recognize effectors. It is interesting to note that all three TIR-NB-LRR-WRKY encoding genes (At5g45260, At5g45050 and At4g12020) found in Arabidopsis are paired with TIR-NB-LRR genes [26]. This suggests that at least some other paired R proteins may function cooperatively in the nucleus by directly regulating transcriptional processes. In conclusion, the deployment of a Pseudomonas T3S delivery of PopP2 allowed a detailed comparison of AvrRps4- and PopP2-triggered RPS4- and RRS1-dependent transcriptional regulation. We found that an auto-active allele of the TIR-NB-LRR-WRKY protein RRS1, RRS1SLH1, induces immune responses comparable to Avr-triggered immunity. The suppressor of slh1 immunity screening enabled us to uncover the critical role of RPS4 in RRS1SLH1-mediated defense activation. Furthermore, we defined additional properties of RPS4 and RRS1 that are essential for function, and these results significantly enhance our understanding of NB-LRR protein function in plants. Arabidopsis plants were grown in short day conditions (10 h light/14 h dark) at 21°C or 28°C. Nicotiana benthamiana and Nicotiana tabacum ‘Petit Gerard’ plants were grown in long day conditions (16 h light/8 h dark) at 24°C. No-0 and slh1 are described in [30]; Ws rrs1-1 and Ws rrs1-1 rps4-21 are described in [26]. To create pEDV6 (gateway destination variant of pEDV3), the nucleotide sequence encoding the HA epitope tag was inserted at SalI site of pEDV3 [33] that resulted in AvrRps4N (1-137aa): HA: ClaI: BamHI (pEDV5). Subsequently, pEDV5 was digested with ClaI and BamHI, treated with T4 DNA-polymerase to generate blunt ends and ligated with EcoRV digested Gateway reading frame cassette B (RFB) (Invitrogen) to create pEDV6. Construction of pBBR1MCS-5: avrRps4 was described previously [35]. The NES- or NLS-tagged avrRps4 variants were kindly provided by Jane Parker laboratory and the cloning procedure was described previously [8]. To generate pEDV6: popP2 variants, full-length or truncated popP2 fragments were amplified from Ralstonia solanacearum genomic DNA by polymerase chain reaction and cloned in the Gateway entry vector, pCR8 (Invitrogen). Introduction of popP2 fragments in pEDV6 was performed according to manufacturer' s instructions by using LR recombinase II (Invitrogen). The pBin19: RPS4: HA construct was described previously [52]. To obtain C-terminally GFP tagged AvrRps4 or PopP2 variants, avrRps4 or popP2 coding regions were PCR amplified and cloned at ClaI and BamHI sites of EpiGreenB5: GFP. Construction of 35S: RRS1: His-Flag is described in [43]. Wild type and mutant variants of AvrRps4 and PopP2 were PCR amplified from previously reported plasmid constructs [35], [53]. The resulting PCR fragments were cloned in pCR8 (Invitrogen) and correct sequences were confirmed. These pCR8 constructs were used for LR reaction with the Gateway destination vector pK7FWG2 (35S promoter and C-GFP) to generate C-terminally GFP-tagged AvrRps4 and PopP2 variants. Wild type and SH-AA mutant variants of RPS4-HA and RRS1-His-Flag are described in [43]. Introduction of SLH1 and SUSHI mutations in RRS1 and RPS4, respectively, was achieved by using Quikchange II XL site-directed mutagenesis kit (Agilent). The C-terminally GFP-tagged RPS4 constructs were generated by inserting ClaI/BamHI digested RPS4 in EpiGreenB5-GFP-WT/NES/NLS. Escherichia coli DH5α was used for maintaining plasmid constructs and bacterial conjugation. For hypersensitive response assay and in planta bacterial growth assay, Pseudomonas fluorescens Pf0-1 (T3S) and Pseudomonas syringae pv. tomato (Pto) DC3000 strains were used, respectively. To introduce various constructs carrying avrRps4, popP2 or hopA1 in Pf0-1 (T3S) and Pto DC3000, standard triparental mating method was used by using E. coli HB101 (pRK2013) as a helper strain as previously described [33]. For transformation of Agrobacterium tumefaciens strain AGL1, standard electroporation method was used. For hypersensitive response assay, freshly grown Pf0-1 (T3S) strains on King' s B agar plates containing appropriate antibiotics were harvested in 10 mM MgCl2. The final concentration of bacterial suspensions was adjusted to A600 = 0. 2. Leaves of five week-old Arabidopsis plants were hand-infiltrated by using 1 mL needless syringes and kept 20–24 h further for symptom development. For ion leakage assays, leaf discs were sampled at 0. 5 hpi, floated on water for 30 minutes (with gentle shaking at room temperature) and transferred to fresh water (1 hpi sample). Ion leakage was measured at 24 hpi using a conductivity meter. For in planta bacterial growth assays, Pto DC3000 strains were grown and harvested as for Pf0-1 (T3S). Leaves of five week-old Arabidopsis plants were hand-infiltrated with bacterial suspensions (A600 = 0. 001) by using 1 mL needless syringes and kept 3–4 days further before sampling. Infected leaf samples were ground in 10 mM MgCl2, serially diluted, spotted on L agar plates containing appropriate antibiotics and kept at 28°C for 2 days before counting colonies to estimate bacterial population in infected leaves. Agrobacterium tumefaciens AGL1 strains carrying the different constructs were grown in liquid L-medium supplemented with adequate antibiotics for 24 h. Cells were harvested by centrifugation and re-suspended at OD600 0. 5 in infiltration medium (10 mM MgCl2,10 mM MES pH 5. 6). For co-expression, bacterial suspensions were mixed in 1∶1 ratio before infiltration with needleless syringes in 5 week-old N. benthamiana or N. tabacum leaves. Tobacco hypersensitive response was generally observed and photographed 2 to 3 days after infiltration. EXPRSS tag-seq cDNA library construction and data analysis was carried out as described previously [38]. The sequence data presented in this publication have been deposited in NCBI' s Gene Expression Omnibus [54] and are accessible through GEO Series accession number GSE48247 and GSE51116. Tag to gene associations were carried out using uniquely mapped reads, with the considerations described previously [38]. Bowtie v0. 12. 8 [55] was used to map short reads to TAIR10 genome and Novoalign v2. 08. 03 (http: //www. novocraft. com/) was used to align remaining reads to TAIR10 cDNA sequences. Differential gene expression analysis was performed using the R statistical language (v2. 11. 1) with the Bioconductor package [56], edgeR v1. 6. 15 [57] with the exact negative binomial test using tagwise dispersion and selected genes with false discovery rate (FDR) <0. 01. From RNA-seq data for avrRps4 on Col-0 [29], uniquely mapped read counts to genes were used for reanalysis using edgeR and selected gene with FDR <0. 05. Microarray data files from Pto DC3000 (AvrRps4) infiltration (Array Express E-MEXP-546, [28]) and Interaction of Arabidopsis thaliana and Ralstonia solanacearum (NASCARRAYS-447, [40]) were used. Data analysis was performed using the R statistical language as described previously [38], [58]. Differentially expressed genes were identified using the rank products method with FDR <0. 05 [59]. As Pto DC3000 (AvrRps4) data has only one replicate, differential expression analysis was carried out with untreated and MgCl2 infiltrated 3 hpi samples as controls and compared against 3 and 6 hpi of avrRps4 and 6 hpi of MgCl2. For GMI1000/GMI1000ΔPopP2 data, only Nd-1 samples were used. Total RNAs were extracted from 4 to 5 week-old Arabidopsis plants using the TRI reagent (Invitrogen) according to the manufacturer' s instructions. First-strand cDNA was synthesized from 5 µg RNA using SuperScriptII Reverse Transcriptase (Invitrogen) and an oligo (dT) primer, according to the manufacturer' s instructions. cDNA was amplified in triplicate by quantitative PCR using SYBR Green JumpStart Taq ReadyMix (Sigma) and the CFX96 Thermal Cycler (Bio-Rad). The relative expression values were determined using the comparative Ct method and Ef1α (At5g60390) as reference. Primers used for quantitative PCR are described in Table S7. The presence of the slh1 mutation in sushi M3 generation and F1 individuals resulting from the genetic cross with rrs1-1 or rrs1-1 rps4-21 was assessed using the CAPS marker described in [30]. For sequencing of candidate genes on sushi mutants genomic DNA, 10,6, 4 and 4 couples of primers respectively were used to amplify regions of RRS1, RPS4, EDS16 and EDS5 coding sequence (see Table S7). PCR products were purified on Sepharose and sequences were analyzed using the Vector NTI assembly software (Invitrogen). Protein samples were prepared from N. benthamiana 48 h after Agrobacterium-mediated transformation. One infiltrated leaf was harvested and ground in liquid nitrogen. Total proteins were extracted in GTEN buffer (10% glycerol, 100 mM Tris-HCl pH 7. 5,1 mM EDTA, 150 mM NaCl) supplemented extemporaneously with 5 mM DTT, 1% (vol/vol) plant protease inhibitor cocktail (Sigma) and 0. 2% (vol/vol) Nonidet P-40. Lysates were centrifuged for 15 min at 5,000 g at 4°C and aliquots of filtered supernatants were used as input samples. Immunoprecipitations were conducted on 1. 5 mL of filtered extract incubated for 2 h at 4°C under gentle agitation in presence of 20 µL anti-FLAG M2 or EZview anti-HA affinity gel (Sigma). Antibodies-coupled agarose beads were collected and washed three times in GTEN buffer, re-suspended in SDS-loading buffer and denatured 10 min at 96°C. Proteins were separated by SDS-PAGE and analyzed by immunoblotting using anti-FLAG M2-HRP, anti-GFP-HRP or anti-HA-HRP conjugated antibodies (Sigma, Santa Cruz and Roche respectively).

Title: The Nuclear Immune Receptor RPS4 Is Required for RRS1SLH1-Dependent Constitutive Defense Activation in Arabidopsis thaliana Summary: How plant NB-LRR resistance proteins and the related mammalian Nod-like receptors (NLRs) activate defense is poorly understood. Plant and animal immune receptors can function in pairs. Two Arabidopsis nuclear immune receptors, RPS4 and RRS1, confer recognition of the unrelated bacterial effectors, AvrRps4 and PopP2, and activate defense. Using delivery of PopP2 into Arabidopsis leaf cells via Pseudomonas type III secretion, we define early transcriptional changes upon RPS4/RRS1-dependent PopP2 recognition. We show an auto-active allele of RRS1, RRS1SLH1, triggers transcriptional reprogramming of defense genes that are also reprogrammed by AvrRps4 or PopP2 in an RPS4/RRS1-dependent manner. To discover genetic requirements for RRS1SLH1 auto-activation, we conducted a suppressor screen. Many suppressor of slh1 immunity (sushi) mutants that are impaired in RRS1SLH1-mediated auto-activation carry loss-of-function mutations in RPS4. This suggests that RPS4 functions as a signaling component together with or downstream of RRS1-activated immunity, in contrast to earlier hypotheses, significantly advancing our understanding of how immune receptors activate defense in plants.

lay_plos

en

Write a title and summarize: Filamentous fungi that thrive on plant biomass are the major producers of hydrolytic enzymes used to decompose lignocellulose for biofuel production. Although induction of cellulases is regulated at the transcriptional level, how filamentous fungi sense and signal carbon-limited conditions to coordinate cell metabolism and regulate cellulolytic enzyme production is not well characterized. By screening a transcription factor deletion set in the filamentous fungus Neurospora crassa for mutants unable to grow on cellulosic materials, we identified a role for the transcription factor, VIB1, as essential for cellulose utilization. VIB1 does not directly regulate hydrolytic enzyme gene expression or function in cellulosic inducer signaling/processing, but affects the expression level of an essential regulator of hydrolytic enzyme genes, CLR2. Transcriptional profiling of a Δvib-1 mutant suggests that it has an improper expression of genes functioning in metabolism and energy and a deregulation of carbon catabolite repression (CCR). By characterizing new genes, we demonstrate that the transcription factor, COL26, is critical for intracellular glucose sensing/metabolism and plays a role in CCR by negatively regulating cre-1 expression. Deletion of the major player in CCR, cre-1, or a deletion of col-26, did not rescue the growth of Δvib-1 on cellulose. However, the synergistic effect of the Δcre-1; Δcol-26 mutations circumvented the requirement of VIB1 for cellulase gene expression, enzyme secretion and cellulose deconstruction. Our findings support a function of VIB1 in repressing both glucose signaling and CCR under carbon-limited conditions, thus enabling a proper cellular response for plant biomass deconstruction and utilization. Bioconversion of lignocellulosic biomass to simple sugars holds great promise in next-generation biofuel production and relies on a complex repertoire of proteins for enzymatic deconstruction of plant cell walls [1]. Many filamentous fungi have evolved to utilize cellulosic materials and are capable of producing a wide spectrum of enzymes, but only a few species have been harnessed for industrial usage [2]. Further improvement in fungal cellulolytic enzyme production is desired to make biofuel production cost-competitive, but this relies on a better understanding of the molecular basis of networks involved in carbon sensing and regulatory aspects associated with induction of gene expression of hydrolytic enzymes [3]. Cellulolytic enzyme production and secretion is a unique attribute of filamentous fungi, and efforts to identify important factors in enzyme production led to the discovery of a number of transcriptional activators and repressors. For example, the transcription factor XlnR/XYR1 positively regulates expression of cellulase and hemicellulase genes in Aspergillus niger and Trichoderma reesei, respectively [4]–[7]. In Neurospora crassa, the transcription factors CLR1 and CLR2 are essential for growth on cellulose and are required for expression of a ∼212 gene regulon that is induced in response to cellodextrins, such as cellobiose [8], [9] (Figure 1). In Aspergillus nidulans and A. oryzae, a clr-2 homolog, called clrB/manR, respectively, is also essential for cellulase gene expression and activity [8], [10], [11]. Additional transcriptional regulators that promote expression of some genes encoding hydrolytic enzymes have also been identified, including mcmA in A. nidulans [12], clbR in A. aculeatus [13], and aceII and bglR in T. reesei [14], [15]. In addition to induction, cellulase gene expression is also subject to carbon catabolite repression (CCR), which functions when a favorable carbon source, such as glucose, is present [3], [16], [17]. The most well-characterized transcription factor involved in CCR in filamentous fungi is CreA/CRE1. Deletion of creA/cre-1 alleviates some aspects of CCR for cellulolytic enzyme expression in Aspergilli [18]–[22], T. reesei [23]–[25], Penicillium decumbens [2] and N. crassa [26], [27]. In A. nidulans, repression by CreA occurs both by binding to promoters of hemicellulase genes as well as repressing expression of transcriptional activators [28]. Other factors including creB/cre2, creC, creD, lim1, and aceI were also reported to promote CCR in different fungal species via unknown mechanisms [29]–[37]. The strength of CCR is tuned by glucose sensing and signaling, although crosstalk between these two regulatory systems is not well understood. In N. crassa, RCO3, a predicted sugar transporter was proposed to function as a glucose sensor [38], [39]. In A. nidulans, phosphorylation of glucose triggers CreA repression [29], [40]. In Magnaporthe oryzae, trehalose-6-phosphate synthase (Tps1) promotes glucose metabolism and CCR through inhibition of Nmr (nitrogen metabolite repression) proteins (Nmr1, Nmr2, Nmr3) [41]. Downstream, a multidrug and toxin extrusion pump, Mdt1, promotes citrate efflux to relieve CCR. To what extent these mechanisms are shared among cellulolytic fungi and whether they all converge to regulate CreA/CRE1-mediated CCR is currently unclear. N. crassa is an early colonizer of burnt vegetation [42], [43], grows robustly on plant biomass and secretes a broad spectrum of enzymes to degrade plant cell walls [44], [45]. By screening the N. crassa near-full genome deletion strain set [46] for growth on Avicel (crystalline cellulose), we identified a transcription factor, vib-1, that is essential for cellulose utilization. VIB1 (vegetative incompatibility blocked) is a p53-like transcription factor that is conserved among filamentous ascomycete fungi. Characterized as a mediator of nonself recognition and cell death in N. crassa [47], [48], VIB1 is also required for extracellular protease secretion in response to both carbon and nitrogen starvation [48]. Here, we demonstrated that vib-1 functions upstream of cellulolytic gene induction and its absence leads to a weak induction of clr-2 and cellulase genes but increased expression of genes predicted to function in CCR. Functional analysis of one such predicted transcription factor gene, col-26, an N. crassa bglR homolog, showed that COL26 regulates glucose sensing/metabolism and which is separate from CRE1-mediated CCR. Deletion of both col-26 and cre-1 leads to a synergistic effect in rescuing Δvib-1 utilization of cellulose and cellulolytic activity. Our data support a function for VIB1 in repression of glucose signaling and CCR and which is critical for fungal utilization of plant biomass. Screening of a transcription factor deletion set of N. crassa strains [46] for ability to deconstruct crystalline cellulose showed that a strain carrying a deletion of the vib-1 gene (FGSC11309) failed to grow on Avicel (Figure 2A). Since functional vib-1 is required for extracellular protease secretion in response to carbon and nitrogen starvation in N. crassa [48], [49], we hypothesized that the Δvib-1 mutant might be unable to respond to complex extracellular carbon sources. In support of this hypothesis, the Δvib-1 mutant also exhibited slow growth on xylan. Growth defects were accompanied by barely detectable extracellular enzyme activity towards crystalline cellulose and low extracellular xylanase activity (Figure 2B and S1A). In contrast, the Δvib-1 mutant accumulated a similar amount of mycelial biomass as the WT strain when inoculated into minimal media containing simple sugars (sucrose, cellobiose or xylose) (Figure S1B). The introduction of an ectopic copy of vib-1 (Pvib-1) completely restored the growth defects on Avicel of the Δvib-1 mutant, as well as the secretome and cellulolytic enzyme activity of culture supernatants (Figure 2B). To test the hypothesis that the role of VIB1 in cellulose utilization is conserved in other filamentous fungi, especially in fungi used in industrial production of cellulolytic enzymes, we carried out complementation tests using the vib-1 ortholog from T. reesei (EGR52133; Trvib1); TrVIB1 and N. crassa VIB1 share 49% amino acid identity. Constitutive expression of Trvib1 in a N. crassa Δvib-1 mutant fully restored the growth and cellulolytic enzyme activity (Figure 2B). The Trvib1 strain also recapitulated most of the secretome of N. crassa WT and Pvib-1 strains on Avicel (Figure 2C). These results suggest that vib-1 is functionally conserved for the utilization of cellulose in filamentous ascomycete fungi. The Δvib-1 mutant shows an inappropriate temporal and spatial conidiation pattern. These phenotypes are correlated with differential localization of VIB1-GFP in vegetative hyphae versus conidiophores [48]. As conidiation is regulated by glucose limitation [50], we assessed whether differential localization of VIB1 was also associated with cellulose utilization. We examined a strain in which we replaced the resident vib-1 gene with a functional vib-1-gfp construct. Nuclear localization of VIB1-GFP was observed in hyphae and localization was independent of carbon source, either following a shift to Avicel for 2 hrs (Figure S1C) or after prolonged growth. Previous comparative RNA-seq analysis of WT revealed that 212 genes are significantly differentially expressed under cellulose conditions, a gene set referred to as the “Avicel regulon” [8]. To determine whether the defect in cellulase secretion and activity in the Δvib-1 mutant was due to failure to induce cellulase gene expression versus a defect in cellulase secretion, we assessed genome wide expression differences via RNA-seq between the WT and Δvib-1 strains following a shift for 4 hrs from sucrose medium to either carbon-free or Avicel medium. Of the 212 genes in the Avicel regulon, 91 genes were expressed at a significantly lower level in the Δvib-1 mutant versus WT under Avicel conditions (cutoff: Padj <0. 05 and fold change >2; Table S1). This gene set includes the essential cellulase transcription factor gene, clr-2 and 43 carbohydrate-active enzymes (CAZy) from 27 different families (Carbohydrate Active Enzymes database: http: //www. cazy. org/) [51]. CLR1 and CLR2 are strictly required for full expression of 140 genes within the Avicel regulon [8], [10]; 62 of these genes were identified in the 91-gene set that showed low expression in the Δvib-1 mutant. Although expression of clr-1 was not significantly different from WT in the Δvib-1 mutant, the expression of clr-2 was significantly reduced (FPKM: 107±43 in WT; 66±27 in Δvib-1 for clr-1 versus 171±10 in WT; 39±14 in Δvib-1 for clr-2) (Table S1). Importantly, constitutive expression of clr-2 (Pc clr-2) in minimal medium without cellulosic inducers recapitulates the response of N. crassa to crystalline cellulose, including the secretion of active cellulolytic enzymes [10]. The reduced transcription of clr-2 in the Δvib-1 mutant (Table S1) suggested that constitutive expression of clr-2 might suppress the cellulose utilization defect in the Δvib-1 mutant. To test this hypothesis, we constructed a Pc clr-2; Δvib-1 strain and evaluated its ability to secrete cellulases and utilize Avicel in comparison to the Pc clr-2, the Δvib-1 and WT strains. In support of our hypothesis, the Pc clr-2; Δvib-1 strain showed restoration of protein secretion and cellulolytic activity to near WT levels (Figure 3A). Although the clr-2 expression levels in the Pc clr-2 strain were at a similar level to a WT strain after a 4 hr shift to Avicel (Figure S4), the Pc clr-2; Δvib-1 mutant showed a ∼3. 5 fold increase in clr-2 expression level under the same conditions. To evaluate the functions of VIB1 versus CLR2 in regulating the 91 genes in the Avicel-regulon, we generated RNA-seq data from the Pc clr-2; Δvib-1 mutant that was shifted for 4 hrs from sucrose medium to carbon-free medium and compared it to previously obtained data for Pc clr-2 [10]. Analysis of genes encoding different CAZy family proteins revealed a similar pattern of expression between the Pc clr-2 and the Pc clr-2; Δvib-1 strains (Figure 3B), consistent with our hypothesis that VIB1 functions upstream of clr-2 in response to cellulose. To differentiate whether any Avicel-regulon genes that showed decreased expression levels in Δvib-1 mutant were due to the vib-1 deletion rather than a low level of clr-2 expression, we performed hierarchical clustering of expression patterns of the Avicel-regulon genes across 6 RNA-seq experiments (WT and Δvib-1 shifted to no carbon or Avicel and the Pc clr-2 and the Pc clr-2; Δvib-1 strains shifted to no carbon); 4 major expression groups were identified (Figure 3C and Table S1). Two groups (group 1 and 3) were CLR2-regulon genes that were vib-1 independent. Group 1 consisted of 54 genes whose expression was fully induced by constitutive expression of clr-2 regardless of the presence or absence of vib-1, including 33 of the 43 CAZy proteins (Table S1). Group 3 consisted of 8 genes whose expression was partially induced by clr-2, but still in a vib-1-independent manner. The fourth group of genes included 14 vib-1 modulated genes. These genes were partially induced in Δvib-1 on Avicel, but remained repressed in both the Pc clr-2 and the Pc clr-2; Δvib-1 strains under no carbon conditions (Table S1). Expression of these genes is likely induced by the cellulolytic cascade pathways upstream of CLR2 or other components present in commercial Avicel preparations, such as a low concentration of hemicellulose [9]. The second group consisted of 15 genes that were induced by constitutive clr-2 expression under no carbon conditions but in vib-1-dependent manner. This gene set included a pectate lyase (NCU06326), a BNR/Asp-box repeat protein predicted to have exo-α-L-1,5-arabinanase activity (NCU09924), a β−xylosidase (NCU09923/gh3-7), an extracellular β−1,4-D-glucosidase (NCU04952/gh3-4), a β−1,3-glucosidase (NCU09904), a starch binding domain-containing protein (NCU08746), a LysM domain-containing protein (NCU05319), a putative methyltransferase (NCU05501), and 6 hypothetical proteins. Six genes in this set encode proteins predicted to enter the secretory pathway (Table S1). Our epistasis experiments indicated that vib-1 functions upstream of clr-2, suggesting that VIB1 could be involved in signal molecule processing that leads to CLR1 activation and thus clr-2 expression (Figure 1). In N. crassa, a strain carrying deletions of genes encoding two extracellular β-glucosidases and an intracellular β-glucosidase (Δ3βG), recapitulates the cellulolytic response when the Δ3βG strain is exposed to cellobiose [9]. These data indicate that cellobiose (or a derivative) functions as a cellulose signal that results in the induction of cellulolytic genes and subsequent secretion of cellulase enzymes. This cellobiose-induced cellulase gene expression and secretion is dependent upon functional clr-2 gene, as the Δ3βG; Δclr-2 mutant is unable to produce cellulolytic enzymes in response to Avicel or cellobiose (unpublished data). We therefore asked if VIB1 plays a role in induction via signal processing. To test this hypothesis, we created a Δ3βG; Δvib-1 quadruple mutant and asked whether the Δ3βG; Δvib-1 mutant could induce cellulase gene expression in response to cellobiose. Following a switch from sucrose to either no carbon, or 0. 2% cellobiose, or 2% Avicel for 4 hrs, the induction of two major cellulase genes, cbh-1/NCU07340 and gh5-1/NCU00762 were significantly induced in the Δ3βG; Δvib-1 and the Δ3βG strains, but not in the Δvib-1 strain (p<0. 05) (Figure 4A). The restoration of cellulase gene expression in the Δ3βG; Δvib-1 strain when exposed to cellobiose was accompanied by enzyme production and activity. Similar to the Δ3βG mutant, the Δ3βG; Δvib-1 strain accumulated biomass more slowly on cellobiose than WT or the Δvib-1 mutant due to the slow conversion of cellobiose to glucose (0. 51±0. 11 g/L and 0. 63±0. 0 g/L for the Δ3βG and the Δ3βG; Δvib-1 strains, respectively, versus 3. 83±0. 19 g/L and 3. 62±0. 11 g/L for WT and Δvib-1, respectively). However, despite less biomass accumulation, both the Δ3βG and the Δ3βG; Δvib-1 strains showed significantly more enzyme activity than WT and the Δvib-1 strains on 2% cellobiose (Figure 4B). When grown on medium containing 2% Avicel as a sole carbon source, the Δ3βG; Δvib-1 strain showed significantly higher enzyme activity than Δvib-1 (Figure S2). These expression and activity data indicate VIB1 does not play a role in signal processing or signal transduction mechanisms that lead to activation of CLR1 and transcription of the cellulase activator, CLR2. In addition to induction, cellulolytic enzyme production requires proper nutrient sensing and relief from carbon catabolite repression (CCR) (reviewed in [17], [52]). We therefore hypothesized that the Δvib-1 mutant might be defective in either nutrient sensing and/or relieving CCR in response to Avicel. To test this hypothesis, we first compared RNA-seq data of the Δvib-1 mutant when shifted from sucrose to carbon-free media versus a shift from sucrose to Avicel media. This comparison revealed 770 differentially expressed genes (cutoff: Padj<0. 01 and fold change >2) (Table S2). We then compared how these genes were expressed in WT under no carbon versus Avicel conditions using a previously published RNA-seq dataset [8]. Hierarchical clustering analysis of expression patterns of these 770 genes revealed three gene clusters (Figure 5) (Table S2). The first cluster contained 237 genes whose expression pattern was similar between the Δvib-1 and WT strains. This gene set was expressed at low levels under no carbon conditions but induced to higher levels upon exposure to Avicel. This group contained 51 CAZy proteins, clr-1 and clr-2, all three cellodextrin transporters (cdt-1, cdt-2, and cbt-1) [44], [53], [54] and 102 hypothetical proteins. This gene set overlapped the WT Avicel-regulon for 143 genes, suggesting that cellulosic induction still occurred in the Δvib-1 mutant albeit at a low level. The second cluster consisted of 173 genes whose expression pattern was also similar between WT and the Δvib-1 strain. However, in contrast to the first gene set, the expression level of these 173 genes was higher under carbon-free conditions. This set included 7 CAZy proteins, three conidiation-specific proteins (NCU08769/con-6, NCU07325/con-10, NCU09235/con-8), a high affinity glucose transporter/NCU08152, and 103 hypothetical proteins. Genes in this cluster may encode proteins that function in a general response to carbon starvation. The third cluster consisted of 360 genes whose expression pattern between no carbon and Avicel conditions was different in the Δvib-1 mutant as compared to the WT strain. This gene set showed consistently higher expression in the Δvib-1 mutant on Avicel medium as compared to carbon-free medium (Figure 5). Only 7 genes encoding CAZy proteins were in this set and 169 genes were annotated as hypothetical. An enrichment in the categories of metabolism and energy, particularly, degradation of glycine (p = 2. 37e-03), nitrogen, sulfur and selenium metabolism (p = 8. 00e-03), purine nucleotide/nucleoside/nucleobase catabolism (p = 2. 49e-05), isoprenoid metabolism (p = 8. 63e-04), respiration (p = 3. 34e-04), metal binding (p = 6. 18e-04), and mitochondrial transport (p = 2. 94e-03) was observed. These data suggested that the Δvib-1 mutant was improperly responding to carbon-limited conditions as compared to a WT strain. Within the gene set that showed increased expression level in the Δvib-1 mutant on Avicel were genes involved in CCR. This gene set included cre-1/NCU08807, creD/NCU03887, creB/NCU08378 and bglR/NCU07788 (Table S2). Although the role of cre-1 in CCR and cellulose utilization is established in N. crassa [26], [27], the function of the creB and creD homologs in cellulolytic enzyme production were uncharacterized. In N. crassa, NCU07788/BglR was previously characterized in a transcription factor deletion screen and was named col-26 for its colonial phenotype on minimal sucrose medium [46]. To determine whether homologs of the CCR genes that showed increased expression in the Δvib-1 mutant play a role in cellulose deconstruction, we first measured protein concentration and cellulase enzyme activity in supernatants from the Δcol-26, ΔNCU08378/creB, and ΔNCU03887/creD mutants grown on Avicel for 7 days: none of the mutants showed significantly different cellulase activity than WT (Figure S3). To test if these genes are involved in CCR, we evaluated resistance of WT and the mutants to 2-deoxy-glucose (2-DG). The compound 2-DG is an analogue of glucose that cannot be metabolized and is often used to select for, or evaluate, impairment of CCR and glucose repression in filamentous fungi [39], [55]–[57]. In strains with functional CCR, 2-DG is phosphorylated, thus activating CCR, resulting in the inability of the strain to grow on alternative carbon sources; strains with impaired CCR are insensitive to 2-DG exposure. When 2% cellobiose and 0. 2% 2-DG were used as carbon sources, only the Δcre-1 and the Δcol-26 mutants showed 2-DG resistance, which was more obvious when Avicel instead of cellobiose was used as a carbon source (Figure 6A). These data implicated COL26 in CCR in N. crassa. To confirm the role of COL26 in CCR, we tested CCR functionality using allyl alcohol (AA). As reported for M. oryzae [41], when CCR is impaired, alcohol dehydrogenase is expressed and will convert AA into toxic acrylaldehyde. Thus, strains with impaired CCR exhibit AA sensitivity, while strains with functional CCR are insensitive. As predicted, the Δcre-1 mutant was sensitive to AA, but the Δcol-26 mutant, similar to WT, was insensitive (Figure 6B). These data indicated that CCR was still functional in the Δcol-26 mutant. To reconcile the different results for the Δcol-26 mutant with respect to CCR, we analyzed growth of the Δcre-1 and the Δcol-26 mutants on different simple carbon sources. When grown on MM media with 2% glucose, fructose, sucrose, or cellobiose as the sole carbon source, the Δcre-1 mutant accumulated a similar amount of biomass to the WT strain (Figure 7A). However, the Δcol-26 mutant exhibited a severe growth defect on glucose, fructose and sucrose, consistent with its colonial designation [46], but only a moderate growth defect on cellobiose (Figure 7A). The fact that the Δcol-26 mutant grew much better on cellobiose as compared to glucose, fructose, and sucrose and was insensitive to 2-DG suggested that the Δcol-26 mutant might have defects in sugar transport and/or metabolism. To test this hypothesis, we measured glucose uptake rates in WT, the Δcre-1, and the Δcol-26 mutants. Within the first 5 minutes, extracellular glucose was reduced to a similar level in all strains (Figure 7B), suggesting similar glucose transporting capacity. However, over the remaining 55 minutes, glucose uptake rates decreased dramatically in the Δcol-26 mutant (Figure 7B). These data indicate that the Δcol-26 mutant has defects in glucose sensing/metabolism, rather than in glucose transport. Our data supported a role for CRE1 in CCR and a role for COL26 in the regulation of glucose utilization. We therefore tested sensitivity of the Δcre-1; Δvib-1 and the Δcol-26; Δvib-1 mutants to AA. The Δcre-1; Δvib-1 and the Δcre-1 mutants were both sensitive to AA (Figure 6B), indicating the Δcre-1 mutation is epistatic for CCR to Δvib-1, while the Δcol-26; Δvib-1 mutant was insensitive to AA, consistent with the active CCR phenotype of the col-26 and the Δvib-1 mutants. However, although CCR was impaired in the Δcre-1; Δvib-1 mutant, the double mutant was still unable to produce cellulolytic enzymes and grow on Avicel (Figure 8A). Similar to the Δcol-26 mutant, the Δcol-26; Δvib-1 mutant also showed defects in glucose consumption (Figure 7B). Although the Δcol-26; Δvib-1 mutant was unable to utilize Avicel, it showed slightly higher enzyme levels than that of the Δvib-1 mutant (Figure 8A). We therefore hypothesized that simultaneously preventing CRE1-mediated CCR and reducing glucose sensing/metabolism via inactivation of col-26 would restore cellulase gene expression and enzyme activity in a Δvib-1 mutant. As predicted, a Δcre-1; Δcol-26; Δvib-1 triple mutant utilized Avicel, produced significant cellulase activity and displayed a secretome similar to WT after 5 days of growth on Avicel (Figure 8A and S5). RT-PCR experiments from the Δcre-1; Δcol-26; Δvib-1 Avicel cultures showed that expression levels of clr-2 and cbh-1 were restored in the triple mutant (Figure 8B). Although simultaneous deletion of cre-1 and col-26 restored utilization of cellulose in the Δvib-1 mutant, a significant lag in growth and enzyme activity in the triple mutant was observed as compared to the WT, Δcre-1, or Δcol-26 mutants (Figure 8C). To assess whether the Δcre-1; Δcol-26; Δvib-1 mutant was also delayed in transcriptional response upon exposure to cellulose, we measured expression levels of clr-2, cbh-1, cre-1, vib-1 and col-26 in the Δvib-1, Δcol-26, Δcre-1, Δcre-1; Δvib-1, Δcol-26; Δvib-1, and Δcre-1; Δcol-26; Δvib-1 mutants as compared to the WT strain at 4 hrs and 24 hrs after cultures were shifted to Avicel conditions. Consistent with the enzyme activity assay and growth phenotype (Figure 8C), induction of clr-2 and cbh-1 was delayed in the Δcre-1; Δcol-26; Δvib-1 mutant (Figure 9). However, in the Δcol-26 mutant at the 4 hr time point, expression levels of cre-1 were significantly higher than in the Δvib-1 mutant, with the Δcol-26; Δvib-1 mutant showing an additive phenotype of significantly increased cre-1 expression levels. At the 24 hr time point, expression levels of cre-1 were only maintained in the Δvib-1 and Δcol-26; Δvib-1 mutants, but not in the Δcol-26 mutant. These data suggest that COL26 may function to repress cre-1 transcription to promote relief of CCR during the initial response to cellulolytic induction. Surprisingly, although the Δcre-1; Δvib-1 mutant was unable to utilize cellulose, induction of both clr-2 and cbh-1 were near WT levels at the 4 hr time point, unlike the Δvib-1 mutant (Figure 9A). However, at the 24 hr time point, expression levels of clr-2 were low and cbh-1 was undetectable in Δcre-1; Δvib-1 mutant (Figure 9B). These data suggest that although the Δcre-1; Δvib-1 can respond to cellulolytic induction by increasing clr-2 and thus cbh-1 expression levels, induction signaling cannot be maintained, perhaps due to repression by COL26 or by other factors present/absent in a Δvib-1 mutant background. The fact that the Δcre-1; Δcol-26; Δvib-1 mutant does not show WT restoration of initial cellulolytic induction (Figure 8C; Figure 9A) supports the hypothesis that additional unknown factors remain to be identified that play a role in nutrient sensing/signaling and the regulation of cellulose utilization in N. crassa. In this study, we showed that a Δvib-1 mutant displayed severe growth defects on cellulose, which was correlated with a lack of cellulolytic enzyme activity. By using RNA-seq data, we showed that expression of the Avicel regulon was significantly decreased in the Δvib-1 mutant, a phenotype that was rescued by constitutive expression of clr-2. Induction of clr-2 is dependent upon a signal cascade from cellobiose or derivative and functional CLR1 (Figure 1) [8]. Here we showed that VIB1 is not involved in inducer signal processing or perception because the Δ3βG; Δvib-1 mutant produced cellulolytic enzymes in response to cellobiose. These data indicated that VIB1 functions upstream of regulators that mediate inducer-dependent signal transduction and cellulase gene expression and activity. Our transcriptional profiling revealed that, under Avicel conditions, a deletion of vib-1 led to an increase in transcription of genes in metabolism and energy as well as genes reported to mediate CCR. These results suggested that cellulolytic induction was mis-regulated in the Δvib-1 mutant. In the presence of glucose, N. crassa adjusts its metabolism for a high rate of glycolysis and directs carbon flux to respiration and fermentation for biosynthesis and energy production [58], while genes involved in utilization of alternative carbon sources are repressed in a CRE1-dependent manner [26], [27]. When lignocellulose is the only carbon source, CCR is relieved to allow the synthesis of “scouting” enzymes that liberate inducer molecules, such as cellobiose [9], [44], [59]. In S. cerevisiae, glucose is sensed through a multifaceted mechanism including direct detection of glucose by glucose receptors/transporters on the plasma membrane and by the sensing of glucose-6-P and other metabolites by metabolic enzymes. The glucose signals are transmitted to CCR mainly through the Snf1 complex and the Mig1 (CreA/Cre1 homolog) transcriptional repressor complex [60], [61]. In A. nidulans, mutations in two hexose kinase genes (hxkA/glkA4) results in inappropriate de-repression of genes under glucose growth conditions, although to a lesser extent than a creA mutant strain [29]. Here we show that simply eliminating CRE1-mediated CCR did not rescue the growth defect of Δvib-1 mutant on Avicel, but that a deletion of col-26 was also required. The Δcol-26 mutant exhibited a growth defect on glucose, fructose and sucrose, which was not associated with a deficiency in glucose transport (Figure 7B). In T. reesei, a strain carrying a mutation in bglR shows reduced expression of β-glucosidase genes, suggesting the BglR plays a positive role in CCR by increasing glucose release from cellobiose [15]. However, our analyses of cellulolytic activity of secreted enzymes in the Δcol-26 mutant showed no difference in glucose versus cellobiose release (Figure 8A), a result that is in contrast to the strongly reduced glucose release from culture supernatants in the Δ3βG mutant (which lacks extracellular β-glucosidase activity) (Figure S2). Although we have not determined how glucose metabolism is changed in the Δcol-26 mutant, the resistance of Δcol-26 to 2-DG inhibition suggests a defect in glucose sensing/metabolism; CRE1-mediated CCR was still functional (as shown by insensitivity to AA). The fact that a deletion of col-26 and cre-1 restored growth of Δvib-1 on Avicel suggests a synergistic effect between glucose sensing/metabolism mediated by COL26 and CRE1-regulated CCR in repressing cellulolytic induction (Figure 10). However, other unknown factors in addition to CRE1 and COL26 play a role in the Δvib-1 mutant, because the Δcre-1; Δcol-26; Δvib-1 mutant showed a significant lag in gene induction and enzyme secretion under cellulolytic conditions (Figure 8C). Future experiments to identify additional mutations that fully suppress the Δvib-1 cellulolytic phenotype and the identification of direct targets of VIB1 will be most informative for further dissection of glucose sensing and CCR in filamentous fungi. Our data supports the model that the regulatory function of VIB1 on CRE1-mediated CCR and COL26-mediated glucose sensing/metabolism functions during different stages of the cellulolytic response (Figure 10). At induction stage, both VIB1 and COL26 negatively regulate CRE1-mediated CCR (Figure 9), thus allowing a relief of CCR and efficient induction of cellulolytic genes in response to cellulose. During the utilization phase, glucose is released from cellulose, and glucose sensing/signaling via COL26 may repress cellulolytic responses, with VIB1 functioning to dampen this inhibition. As many cellulolytic genes are subject to carbon catabolite repression and a requirement for CLR2 for induction, the cellular response to plant biomass may depend on the relative strength of these two antagonizing forces (Figure 10). Mechanistically, how VIB1 exerts its function on glucose sensing/metabolism via COL26 and CCR via CRE1 remain to be elucidated. In the hyper-secreting T. reesei strain, RUT-C30, disruption of phosphoglucose isomerase gene (pgi1) blocks formation of fructose-6-P from glucose-6-P and increased cellulase production on glucose. This increase relies on a genetic interaction between the Δpgi1 mutation and the cre1-1-1 mutation in the RUT-C30 background [62]. Interestingly, both the hyper-secreting T. reesei RUT-C30 and PC-3-7 strains have mutations in cre1 and bglR/col-26 [15], [63], [64], but whether a synergy exists between Δcre1 and ΔbglR in T. reesei, as in N. crassa, and its relationship to T. reesei vib1 is unclear. Many cellulolytic enzyme hyper-producers such as T. reesei RUT-C30 and PC-3-7, and P. decumbens JU-A10-T show relief from CCR, but contain a large number of mutations in additional genes that contribute to the hyper-production phenotype [2], [15], [63]–[65]. Identifying and characterizing possible synergistic effects of the different mutations on hyper-production of lignocellulose enzymes, as shown in this study, will be a challenge. The function of VIB1 in regulating glucose sensing/metabolism and CCR plays a role in the utilization of other complex substrates. VIB1 is required for extracellular protease production in response to carbon and nitrogen starvation, a function shared by its homolog in A. nidulans, xprG [66]–[70]. The Δvib-1 mutant also exhibits inappropriate temporal and spatial conidiation and has defects in protoperithecia formation [48], [70], two developmental events that are regulated by nitrogen and glucose limitation and signaling [71]. A shotgun proteomic analysis of culture supernatant of the Pvib-1 strains under carbon source depletion showed a higher amount of intracellular proteins relative to WT (Table S3). These data are in consistent with a role of VIB1 in promoting cell death [47], [48], [72], and in autolysis in A. nidulans [73], perhaps via perturbed nutritional signaling. Autolysis is frequently observed in submerged batch cultures in industrial bioprocessing, and promotes cryptic growth for survival and protein production under nutrient-depleted conditions [74]. Further manipulations of vib-1 and its homologs in filamentous fungi may yield economic benefits via the regulation of autolysis under industrial settings. In summary, our data show that VIB1 is an essential regulator for cellulase production under inductive conditions and identifies COL26 as an important player in glucose sensing/metabolism. As VIB1 mediates metabolic changes as well as programmed death, two properties shared by mammalian tumor suppressor p53 [75], [76], the molecular mechanism in linking the two could be conserved, and further investigation of vib-1 function and its homologs in filamentous fungi may also shed light on cancer research. FGSC 2489 was used as the WT reference strain and background for mutant strains [46]. FGSC 11308 (Δvib-1; mat a), FGSC 11309 (Δvib-1; mat A), FGSC 11030 (Δcol-26; mat a), FGSC 11031 (Δcol-26; mat A) were obtained from the Fungal Genetics Stock Center (http: //www. fgsc. net/) [50]. The vib-1 mis-expression strain Pvib-1 (Pvib-1; Δvib-1) was constructed by transforming FGSC 11308 with a DNA fragment containing the promoter of the clock controlled gene 1 (ccg-1) and the open reading frame and 3′ untranslated region (UTR) of vib-1 and homologous and flanking regions from the coding sequence of the his-3 gene. Transformants were selected for histidine prototrophy [77] and backcrossed to FGSC 2489 to obtain a his-3: : pccg-1-vib-1; Δvib-1 homokaryotic strain. The Tr vib1 mis-expression strain PTr-vib1 (PTr vib1; Δvib-1) was created in the same way except that the open reading frame and 3′UTR of Tr vib1 was used. The Pc clr-2, the Δcre-1, the Δ3βG and the Δ3βG Δcre-1 strains were from previous studies [9], [10], [26]. The Pc clr-2; Δvib-1 strain, the Δ3βG; Δvib-1 strain, the Δcol-26; Δvib-1 strain, the Δcre-1; Δcol-26 strain, and the Δcre-1; Δcol-26; Δvib-1 strain were created through crosses. N. crassa cultures were grown on Vogel' s minimal medium (VMM) [78]. Unless noted, 2% (w/v) sucrose was used as a carbon source. Strains were pre-grown on 3 mL VMM slants at 30°C in dark for 24 hrs, then at 25°C in constant light for 4–10 days to stimulate conidia production. For flask cultures, conidia were inoculated into 100 mL of liquid media at 106 conidia/mL and grown at 25°C in constant light and shaking (200 rpm). To test 2-DG and allyl alcohol sensitivity, 3 mL of liquid media containing either 0. 2% (w/v) 2-DG (Sigma Aldrich, MO) or 100 mM allyl alcohol were inoculated with 106 conidia/mL and grown in 24-well plates at 25°C in constant light and shaking (200 rpm). For crosses, one parental strain was grown on synthetic crossing medium [79] as the female for 2 weeks at room temperature for protoperithecial development. The other parental strain was used as the male to fertilize the protoperithecia. Crosses were kept for 3 weeks at room temperature. Ascospores were collected and activated as described [80], plated on 1% VMM, and incubated at room temperature for 18 hrs. Germinated ascospores were selected and transferred to selective slants for further screen and confirmation. Cultures were grown on sucrose for 16 hrs, centrifuged at 2000 g for 10 min and washed in VMM or MM without a carbon source, followed by 4 hrs growth in 100 mL VMM or MM with 2% carbon source (sucrose, cellobiose, Avicel PH-101 (Sigma Aldrich, MO) ) or with no carbon source added. Mycelia were harvested by filtration and flash frozen in liquid nitrogen. RNA was extracted using the Trizol method (Invitrogen) and further purified using RNeasy kits (QIAGEN). Four ng of RNA was used as template in each quantitative RT-PCR (qRT-PCR) reaction. qRT-PCR was carried out using EXPRESS One-Step SYBR GreenER kit (Invitrogen) and Applied Biosystems Step One Plus Real Time PCR system. qRT-PCR were done in biological duplicates or triplicates with actin as the endogenous control. Relative expression levels were normalized to actin, and fold changes in RNA level were the ratios of the relative expression level on inducing conditions to no carbon conditions. Libraries were prepared according to standard protocols from Illumina Inc (San Diego, CA) and sequenced on the HiSeq 2000 platforms at QB3 Vincent J. Coates Genomics Sequencing Laboratory (CA). Sequenced reads were mapped against predicted transcripts from the N. crassa OR74A genome [81] (Neurospora crassa Sequencing Project, Broad Institute of Harvard and MIT http: //www. broadinstitute. org/) with Tophat v2. 0. 4 [82]. Transcript abundance (FPKM) was estimated with Cufflinks v2. 0. 2 mapping against reference isoforms and differential gene expression were analyzed with Cuffdiff v2. 0. 2 [83]. Biological replicates used for RNA-seq showed high reproducibility. The Pearson correlation of FPKM on log basis (p-value<2. 2e-16): rp≥0. 96 between WT (Nc) replicates, rp≥0. 91 between WT (Av) replicates, rp≥0. 99 between Δvib-1 (Nc) replicates, and rp≥0. 96 between Δvib-1 (Av) replicates. For hierarchical clustering analysis, FPKM were log transformed, normalized and centered on a per gene basis with Cluster 3. 0 [84] so that values from each gene ranged from −1 (minimum) to 1 (maximum). Average linkage clustering was performed with Euclidean distance as the similarity metric. Functional category analysis was done as described in [8]. Lists of genes were matched against the MIPS Functional Category Database [85], and significance of enrichment was calculated. For CMCase and xylanase activity assays, Azo-CM-Cellulose and Azo-xylan (Beechwood) from Megazyme (Wicklow, Ireland) were used as substrates. Protein concentration was measured with the Bradford assay (BioRad). Cellulase assays were conducted by mixing 500 µL of culture supernatant with 500 µL 0. 5% (w/v) Avicel in 100 mM sodium acetate, pH 5. 0, and incubated with shaking at 37°C for 5 hrs. Reactions were stopped by centrifugation at 2000 g for 5 min and by addition of 9 volumes of 0. 1 M NaOH to the reaction supernatants. Released glucose and cellobiose were separated on a PA-200 HPAEC column and analyzed on Dionex ICS-3000 as described in [45]. Strains were grown in 3 mL VMM with 2% cellobiose as the carbon source in the well of 24-well plates at 25°C in constant light with shaking (200 rpm) for 40 hrs to reach the same mycelial biomass, then glucose was added into each culture such that the culture was grown in MM with 1% (w/v) glucose for 1 hr. The cultures were thoroughly washed with MES buffer (10 mM 2- (N-morpholino) ethanesulfonic acid, 100 mM NaCl), and each washed culture was transferred into 4 ml of MES buffer supplemented with 10 mM glucose and grown at room temperature for 1 hr with shaking at 550 rpm. Culture supernatants were sampled at 5,20, and 60 min, and diluted in 50 volumes of 0. 1 M NaOH. Glucose levels were measured using Dionex ICS-3000 HPAEC-PA 200 and MES buffer instead of VMM was used to avoid precipitation that interferes with downstream analysis. Culture supernatants were mixed with 4× SDS loading buffer and boiled for 10 min before loading onto Criterion 4–15% Tris-HCl Precast Gel (Bio-Rad). GelCode Blue Stain Reagent (Thermo Scientific) was used for gel staining. Strains were inoculated in 2% sucrose VMM and grown at 25°C for 12 hrs in eight-chamber Lab-Tek chambered cover glass (Nalge Nunc International, Naperville, IL). Localization of VIB1-GFP was observed using a 100×1. 4 NA oil immersion objective on a Leica SD6000 spinning disk confocal with 488 nm laser and controlled by Metamorph software. Z-series stacks were collected and maximum intensity projections were created using ImageJ. For medium shift experiment, the cultures in the chamber were washed with VMM without carbon sources and VMM with 0. 5% Avicel was added, followed by immediate time-lapse recordings with an interval of 15 min. Equal volume of culture supernatants of WT and Pvib-1 strains was subjected to SDS-PAGE and secretome proteins identified as described in [86]. In-gel trypsin-digestion was performed according to manufacture protocol (Promega, Trypsin Gold). Digested peptides were separated using ProtID-Chip-43 (II) and analyzed using the Agilent 6510 Q-TOF LC/MS as in [9].

Title: VIB1, a Link between Glucose Signaling and Carbon Catabolite Repression, Is Essential for Plant Cell Wall Degradation by Neurospora crassa Summary: Many filamentous fungi that grow on plant biomass are capable of producing lignocellulase enzymes to break down plant cell walls into utilizable sugars, thus holding great potential in reducing the cost of the next-generation biofuels. Cellulase production is subject to induction by the presence of plant biomass components and to repression by the availability of easily metabolized sugars, such as glucose. Genes required for repression of cellulase gene expression when preferred carbon sources are present (carbon catabolite repression) and those that play a role in mediating glucose sensing/metabolism have been identified in filamentous fungi, but the mechanisms involved in crosstalk between repression versus induction of cellulase gene expression is poorly understood. Here, we report the identification and functional characterization of VIB1, a transcription factor essential for plant cell wall deconstruction in Neurospora crassa and COL26, a transcription factor that functions in glucose sensing/metabolism and regulation of CCR. We show that disabling CRE1 repression and modulating the glucose response by deletion of col-26 restored growth of the Δvib-1 mutant on cellulose. Our findings are particularly important in understanding the molecular basis of enzyme production that could allow a further strain improvement for plant biomass deconstruction.

lay_plos

en

Summarize: A year on from the launch of Tesco’s hugely popular Hudl tablet, the retail giant has released its next-generation model. Unveiled at an event in London, the hudl2 has an 8.3-inch screen - an increase in size from the original 7-inch model – and runs on Android KitKat 4.4.2. It will be available from Tesco stores, and online, from 9 October for £129. Unveiled at an event in London, the hudl2 (pictured) has an 8.3-inch screen - an increase in size from the original 7-inch model – and runs on Android KitKat 4.4.2. It will be available from Tesco stores, and online, from 9 October for £129. Clubcard customers can also purchase the hudl2 through Clubcard Boost – a scheme that doubles the value of Clubcard vouchers - meaning the price drops to £65. The original Hudl launched on 1 September 2013 and more than 35,000 models were sold in the first two days of release. In total, Tesco claims it has sold more than 750,000 devices in the past 12 months. The price of the original Hudl has been dropped from £129 to £99. In addition to boosting the screen size, the hudl2 has updated its cameras. The hudl2 is available in eight colours including, what the company dubbed, Jazzy Blue, Zesty Orange, Slate Black, Rocket Red, Tropical Turquoise, Dreamy White, Perky Purple and Bubblegum Pink (pictured) The original Hudl has a 3MP rear-facing camera, and 2MP camera on the front, while the hudl2 has a 5MP rear, but has dropped the front-facing device to 1.2MP. This puts the cameras on the hudl2 in direct competition with those on Google’s Nexus 7 (2013) and Apple’s iPad mini with Retina Display. The resolution of the hudl2 has been increased to 1920 x 1200, up from 1400 x 900 on the original, but the larger screen on the newer model means the pixel-per-inch (PPI) density is only marginally better; 272 compared to 237. PPI is an indicator of image sharpness, clarity and colour. Elsewhere, Tesco claims the hudl2 has an eight-hour battery life - which matches the original model - when watching videos, and 16GB of on-board memory, which can be expanded to 48GB. And inside, it is powered by an Intel Atom quad-core processor. Tesco has also partnered with The Parent Zone to develop a filter on the hudl2 meaning children and parents can use one device safely. The built-in app makes it easier for parents to set up profiles for up to seven users. Each of these can be tailored based on age and suitability, including setting a time limit to pre-determine how long a child spends using the tablet. The resolution of the hudl2's display (pictured) has been increased to 1920 x 1200, up from 1400 x 900 on the original 2013 model, but the larger screen on the newer model means the pixel-per-inch (PPI) density is marginally better; 272 compared to 237. PPI is an indicator of image sharpness, clarity and colour. The original Hudl (pictured) launched on 1 September 2013 and more than 35,000 models were sold in the first two days of release. The price of the original Hudl has been dropped from £129 to £99. In total, Tesco claims it has sold more than 750,000 devices in the past 12 months. Michael Comish, group digital officer at Tesco said: ‘We know customers want easy, accessible technology that the whole family can use whether working, shopping, gaming, learning or just taking some time out. Cutting-edge technology doesn’t have to come with a big price tag. ‘hudl2 may be affordable, but we’ve cut no corners when it comes to performance - this is our best tablet offering yet.’ The hudl2 is available in eight colours including, what the company dubbed, Jazzy Blue, Zesty Orange, Slate Black, Rocket Red, Tropical Turquoise, Dreamy White, Perky Purple and Bubblegum Pink. Each hudl2 additionally comes with £25 free blinkbox credit to spend on movies, books and music, £10 off clothing range F&F when customers spend £50, £10 off Tesco Direct when they spend £50, £15 of Tesco.com when they spend £60 and 10 free photos when they buy 50 at Tesco Photo

Summary: The hudl2 has an 8.3-inch screen and runs on Android KitKat 4.4.2. It will be available from Tesco stores, and online, from 9 October for £129. Tesco claims it has an eight-hour battery life when watching videos. Hudl2 has 16GB of on-board memory, which can be expanded to 48GB. It's increased its rear-facing camera to 5MP, but dropped the rear to 1.2MP. The original Hudl has a 7-inch screen, 3MP rear-facing and 2MP front-facing camera and is now available for £99.

cnn_dailymail

en

Summarize: David Deutchman says he has held more than a thousand babies—and counting. For the past 12 years, Deutchman has visited Children’s Healthcare of Atlanta twice a week to hold and comfort babies in the neonatal intensive care unit—earning him the nickname “ICU Grandpa” from staff and parents. Even if he gets vomited on occasionally, the 82-year-old says the experience has been nothing short of rewarding. “It is very gratifying, not just because the babies are crying and you help them to stop crying,” Deutchman, from Atlanta, Georgia, tells PEOPLE. “There are a lot of benefits to that warm connection of being held—when a baby puts their face against your heartbeat, there’s a benefit there. I came to love it, but not just because of the connection with the babies, but the whole atmosphere of the hospital.” Children's Healthcare of Atlanta Deutchman retired from international business marketing about 15 years ago and spent some of his newfound free time giving lectures at local universities. But it wasn’t enough for him, and he wound up walking into Children’s Healthcare of Atlanta to ask if they had any volunteering opportunities available. He helped for a year in the hospital’s pediatric intensive care unit, and was soon asked to help in the NICU. “Before you know it, I was holding little babies,” he says while laughing. “And 12 years have just flown by.” Deutchman, who is married and has two daughters in their 50s and two grandkids, doesn’t just help the little ones, but makes sure worried mothers have a shoulder to lean on when they need it, as well. “I talk with mothers and sometimes I hold their hand, because holding a mom’s hand is just as important as holding a baby,” he says. “There’s a lot of stress for these parents. Having somebody tell them they can go get breakfast and assure them I’ll be there with their baby, it means something to them. It’s important.” Children's Healthcare of Atlanta Deutchman makes his visits to see babies and parents on Tuesdays and Thursdays, and says that though he doesn’t know what will await him behind hospitals doors, he’ll do his best to find a way to offer compassion and warmth to those who need it. “When I drive into that parking lot every other day, I never know what I’m going to see, who I’m going to be meeting, or what challenge will be in front of me,” he says. “It keeps changing, but if there’s anything I can do to make sure people are taken care of, that’s what I’m going to do.”... put a new spin on that trend—with an inspirational twist. Has your child come a long way since your first visit to Children’s? Show us—and families who may be about to embark on similar journeys—your before-and-after photos in the comment thread below! Seen lots of now-and-then photos in your social feeds lately? Let’s CLOSE He's been a volunteer at the NICU and PICU units at Children's Healthcare of Atlanta for twelve years. Though staff and parents say he's a 'treasure', David Deutchman believes no one gets more out of it than he does. USA TODAY David Deutchman, 'ICU Grandpa', holds a premature baby at Children's Healthcare of Atlanta. (Photo: Courtesy MaryBeth Brulotte) ATLANTA — Sometimes, babies need a little extra love when their life first begins. Maybe they came a little earlier than expected, or their bones need a little extra time to heal. Whatever the case may be, "ICU Grandpa" is there to provide some much-needed TLC. David Deutchman has been a volunteer with Children’s Healthcare of Atlanta for more than 12 years. After retiring from a career in international business, he says he found himself in the NICU and PICU units of the hospital. “It’s been wonderful because it gives me something to do that has meaning to it,” Deutchman says. He doesn’t do it for the fame or recognition; only recently did the world learn his identity when a photo of him holding a preemie went viral. “We live two hours from Children’s Healthcare of Atlanta, and seeing him all snuggled up when I got there was such a blessing,” says MaryBeth Brulotte, a mother of a premature baby. “Knowing this man is so selfless and donates his time to these babies is such a blessing.” There is no way to count exactly how many babies Deutchman has held over the years, but his quality time with them surely has made an impact. “It definitely helps,” says Elizabeth Mittiga, a Children’s Healthcare of Atlanta NICU Nurse. “Just feeling that comfort, that warmth. It definitely helps them to, I think, grow faster and put more weight on.” Deutchman says although the babies seem to enjoy their time with him, he gets much more out of it than they do. He says it’s something a few of his friends don’t understand. “They just don’t get it. The kind of reward you can get from holding a baby like this.” 'ICU Grandpa' sings 'You Are My Sunshine' to a baby at Children's Healthcare of Atlanta. (Photo: Courtesy Children's Healthcare of Atlanta) Nurses say he’s a treasure. “He’s a really special person,” Mittiga says. “We’re so grateful for him to be a part of our unit and be a baby buddy.” Deutchman has two daughters in their 50s and two grandchildren, ages 19 and 21. For more heartwarming stories like this, LIKE Humankind on Facebook. Skip in Skip x Embed x Share CLOSE HUMANKIND: STORIES WORTH SHARING Preschooler races with peers thanks to unlikely friendship 1:31 The relationship between a woman who survived a horrific car crash and a preschooler with cerebral palsy leads to a breakthrough in his recovery. Humankind 1 of 25 Skip in Skip x Embed x Share CLOSE HUMANKIND: STORIES WORTH SHARING Woman sings emotional ballad to celebrate end of chemo 1:04 Jessie celebrated the end of her chemo with an emotional rendition of “Amazing Grace.” Humankind 2 of 25 Skip in Skip x Embed x Share CLOSE HUMANKIND: STORIES WORTH SHARING Pastor brings hope to Puerto Ricans 1:38 Pastor Humberto “Bert” Pizarro is delivering supplies and hope to people after Hurricane Maria ravaged Puerto Rico. Humankind 3 of 25 Skip in Skip x Embed x Share CLOSE HUMANKIND: STORIES WORTH SHARING Officer uses own money to get a car for hardworking woman 1:34 Officer Arnold set up a surprise gifting of a 2007 Ford Taurus to help out Meade who rides her bike to and from work for a total of 16 miles. Humankind 4 of 25 Skip in Skip x Embed x Share CLOSE HUMANKIND: STORIES WORTH SHARING These siblings have one incredible bond 0:31 This little sister can't wait for her big brother to get home! The minute he steps off the bus, they run to each other. 5 of 25 Skip in Skip x Embed x Share CLOSE HUMANKIND: STORIES WORTH SHARING Sister in tears after her Airman brother surprises her at graduation 1:31 Derek surprised his sister Miranda at her high school graduation. Her reaction is priceless. 6 of 25 Skip in Skip x Embed x Share CLOSE HUMANKIND: STORIES WORTH SHARING Boy is surprised with adoption in the most magical way 1:40 He thought he was there to meet his favorite Disney characters. But they were all there to deliver the most magical surprise. Humankind 7 of 25 Skip in Skip x Embed x Share CLOSE HUMANKIND: STORIES WORTH SHARING Once paralyzed, Chris Norton vows to walk his fiancee down the aisle 1:30 Chris Norton suffered a severe spinal cord injury in 2010. He inspires all of us with every step he takes. Humankind 8 of 25 Skip in Skip x Embed x Share CLOSE HUMANKIND: STORIES WORTH SHARING A man, a camera and a pink tutu fight breast cancer 1:04 Bob Carey started taking pictures to make his wife laugh during her treatment for breast cancer. Now, he's making millions more feel the same way with his photos. Wochit 9 of 25 Skip in Skip x Embed x Share CLOSE HUMANKIND: STORIES WORTH SHARING God and ink saved this man's life 1:53 Tommy Kirschbaum was locked up four times. When he started his tattoo business, Mid-West Tattooers, he found a passion and a vocation that has helped him change his life. Humankind 10 of 25 Skip in Skip x Embed x Share CLOSE HUMANKIND: STORIES WORTH SHARING Marching band shows up for epic chemo-completion celebration 1:36 Usually this band performs at high school football games. This time, their performance was outside the home of someone who deserved an entire band’s love and support. Humankind 11 of 25 Skip in Skip x Embed x Share CLOSE HUMANKIND: STORIES WORTH SHARING Father runs to keep children's memories alive 1:39 Rik Zortman never liked running but his 3 year old son Armstrong did. When he died from cancer, Zortman used GPS to track a run spelling out his son's name. He started getting more names to run and hasn't stopped since. Humankind 12 of 25 Skip in Skip x Embed x Share CLOSE HUMANKIND: STORIES WORTH SHARING The Iowa Wave through a child's eyes 2:21 For the children and families in the UI Stead Family Children's Hospital including 6-year-old Will Kohn, the end of the first quarter marks the beginning of their brief escape from the hospital walls. Humankind 13 of 25 Skip in Skip x Embed x Share CLOSE HUMANKIND: STORIES WORTH SHARING High school principal nails the step team performance 1:35 When the beat dropped, this principal stunned the entire student body in the best way. Humankind 14 of 25 Skip in Skip x Embed x Share CLOSE HUMANKIND: STORIES WORTH SHARING Paralyzed coach takes an exhilarating high dive 2:03 Diving coach Cliff Devries was diagnosed with a brain tumor two decades ago. The tumor left him paralyzed on his right side. But once a year, on his birthday, he climbs back up the diving board. Humankind 15 of 25 Skip in Skip x Embed x Share CLOSE HUMANKIND: STORIES WORTH SHARING This little girl cheering on her father just stole our hearts 1:31 Cliff's annual birthday dive was an incredible feat, but many people were also inspired by his 5-year-old daughter's sweet reaction on the sidelines. Humankind 16 of 25 Skip in Skip x Embed x Share CLOSE HUMANKIND: STORIES WORTH SHARING Stepdad blown away by stepson’s incredible surprise 2:28 Marcus has a very special relationship with his stepdad Paul. For Paul’s birthday, Marcus came up with the best way to show his gratitude. Humankind 17 of 25 Skip in Skip x Embed x Share CLOSE HUMANKIND: STORIES WORTH SHARING This sweet father-daughter dance was 20 years in the making 1:01 When Charlene Couillard renewed her wedding vows with her husband 20 years later, a special guest who missed her wedding was their to witness the vow renewal: Her father. Humankind 18 of 25 Skip in Skip x Embed x Share CLOSE HUMANKIND: STORIES WORTH SHARING Bakery's secret ingredient is uplifting people with special needs 3:31 When a family created a place for their son to learn and work, they had no idea it would turn into a community-wide treasure. Humankind 19 of 25 Skip in Skip x Embed x Share CLOSE HUMANKIND: STORIES WORTH SHARING Food truck hands out help and hope to people in need 3:00 The Salvation Army's Bed and Bread truck brings free meals to people who need it, right in the neighborhoods where they live. Humankind 20 of 25 Skip in Skip x Embed x Share CLOSE HUMANKIND: STORIES WORTH SHARING Cyclist's path to the Olympics turned into a career she never expected 1:32 Vanderbilt bio-engineer Sinead Miller finds a new passion after a serious crash. Humankind 21 of 25 Skip in Skip x Embed x Share CLOSE HUMANKIND: STORIES WORTH SHARING Preemie babies are the superheroes we need for Halloween 0:50 The Mercy NICU is helping families and their babies get in the Halloween spirit. A nurse made dozens of costumes for the 38 babies for Halloween this year. Humankind 22 of 25 Skip in Skip x Embed x Share CLOSE HUMANKIND: STORIES WORTH SHARING Groom overwhelmed at the sight of his bride 1:05 When Quintin saw his bride walking down the aisle, he was immediately overwhelmed with emotion. Humankind 23 of 25 Skip in Skip x Embed x Share CLOSE HUMANKIND: STORIES WORTH SHARING Neighbors pull together to harvest farmer's last crop 1:11 When Van Brownlee lost his life after a heart attack in May, his neighbors decided to come together and harvest the crop for his family. Humankind 24 of 25 Skip in Skip x Embed x Share CLOSE HUMANKIND: STORIES WORTH SHARING Girl showered with compliments after vulnerable moment 1:06 A Baltimore student's classmates immediately jumped in to lift her up after she admitted to having low self-esteem because of her darker complexion. Humankind 25 of 25 Last VideoNext Video Preschooler races with peers thanks to unlikely friendship Woman sings emotional ballad to celebrate end of chemo Pastor brings hope to Puerto Ricans Officer uses own money to get a car for hardworking woman These siblings have one incredible bond Sister in tears after her Airman brother surprises her at graduation Boy is surprised with adoption in the most magical way Once paralyzed, Chris Norton vows to walk his fiancee down the aisle A man, a camera and a pink tutu fight breast cancer God and ink saved this man's life Marching band shows up for epic chemo-completion celebration Father runs to keep children's memories alive The Iowa Wave through a child's eyes High school principal nails the step team performance Paralyzed coach takes an exhilarating high dive This little girl cheering on her father just stole our hearts Stepdad blown away by stepson’s incredible surprise This sweet father-daughter dance was 20 years in the making Bakery's secret ingredient is uplifting people with special needs Food truck hands out help and hope to people in need Cyclist's path to the Olympics turned into a career she never expected Preemie babies are the superheroes we need for Halloween Groom overwhelmed at the sight of his bride Neighbors pull together to harvest farmer's last crop Girl showered with compliments after vulnerable moment Read or Share this story: https://usat.ly/2wp8Nka

Summary: You'll probably wish David Deutchman were your grandpa after reading about him, but then that would mean all of the tiny babies at Children's Healthcare of Atlanta would miss out. People reports on the 82-year-old's efforts at the Georgia hospital, where for the past 12 years the "ICU Grandpa" has held and cuddled more than 1,000 infants in the neonatal intensive care unit. Deutchman comes in two times a week to help soothe and comfort babies, a role he started filling a few years after retiring as a marketing executive in 2000. A hospital Facebook post from last week explains that Deutchman spends much of his time holding babies whose parents may not be able to be with them that day because they're taking care of other children at home or have other obligations that keep them from their babies. And those parents are extremely grateful. "We live two hours from [the hospital], and seeing [our baby] all snuggled up when I got there was such a blessing," one mom says, per USA Today. Deutchman, who's married with two daughters and two grown grandkids, tells People of that "warm connection" babies feel when they're held, as well as the stress he's able to relieve in the concerned moms. "Having somebody tell them they can go get breakfast and assure them I'll be there with their baby, it means something to them," he says. He doesn't even mind the inevitable side effects. "Sometimes I get puked on, I get peed on. It's great," he says in a hospital video, per CNN.

multi_news

en

Summarize: By. Katy Winter for MailOnline. Sandra McDonald spent a lifetime searching for the mother who gave her up for adoption at only a few days old, only tragically to find that she was too late, and her mother had died in 2002. Despite this devastating news, Sandra, from Edinburgh, gained two half-sisters and an aunt through her quest to find the mother who left a hole in her childhood. ‘Even at a young age I felt there was something missing,’ Sandra explains, ‘I was only able five or six and I remember going out into the street and shouting for my real mum. Reunited: Sandra (c) with her newly found half-sisters Loraine Rennie (l) and Elizabeth Hall (r) ‘It’s like something is missing in my heart and soul. I just want a cuddle from her.’ Adopted in 1961, Sandra was the only child of her adoptive parents, Jemima and Donald. Growing up Sandra felt she was treated coldly by her adoptive parents. Despite doing anything she could to gain their acceptance, she always felt she simply didn’t belong. From a young age Sandra pined for her birth mother. As a teenager the strain on the relationship with her adoptive parents only grew and at fifteen Sandra decided that she needed to find her biological mum. ‘it was a very cold relationship, but I think as a child you try your best to think “this will help them to love me more”. You do well at school, your room is clean, you do as your told and everything but it doesn’t work like that. At age just 15 and struggling with her adoptive parents, Sandra began her search for her birth mother, knowing only that she had been in the care of a church-run mother and baby home. ‘I went to the offices and I thought because they were religious there would be some compassion there. The man was so rude it was unbelievable, saying “your mother sinned abominably and she doesn’t want to be reminded of the sins she’s committed and she has to move forward” ‘I felt so sorry for my mum. I thought if he’s like that with me what an earth has he been like with her. Id never felt anger like that in my life before- it made me more determined to find my mum.’ Unhappy with her adoptive parents, Sandra began the long search for her mother at just 15 (stock photo) At age 18 Sandra gained access to her adoption file and discovered her mother was called Mrs Elizabeth Blair, recording a maiden name of Anderson. Sandra spent years searching, contacting hundreds of women with her mother’s name but to no avail. ‘I’ve always felt there was that strong connection between us from the heart and that’s what‘s kept me going.’ When ITV’s Long Lost Family took on the search they discovered that Sandra’s mother had died in 2002. They did however discover two daughters – and Sandra’s half sisters- Elizabeth Hall and Loraine Rennie. ‘I’m glad she was happy and went on to have more children. But it’s a shock finding out my mum is dead and now I have all these siblings, having been an only child.’ The two girls had never been told about Sandra growing up and it was only after their mother’s death that the secret came out when their aunt, Ina Haque, told them. The trio et for the first time at the Wallace monument in Stirling – one of their mother’s favourite places. ‘I felt my heart flip. That is really my sisters sitting there.’ Two weeks later, Sandra traveled to Mansfield and, in an emotional meeting is reunited with her aunt. Ina Haque, who lives in Mansfield recounts the pain that her sister experienced when she gave up her daughter for adoption. ‘Me and my mother went to visit her in the home, and she came to the window and held the baby up for us to see, and her face was all red from crying. I just knew she was going through an awful, awful time,' Ina recalls. Despite not being able to meet her mother, being reunited with her aunt and half-sisters has given Sandra a sense of comfort. ‘I felt we had all just connected like a chain that had been broken and we were all back together again.’ Long Lost Families, tonight at 9pm on ITV

Summary: Sandra has been looking for her birth mother since she was 15. Unhappy with her adoptive parents, she longed to be cuddled by her mother. She spent years attempting to find her with no success. ITV's Long Lost Families found her but discovered she had died in 2002. Although devastated, Sandra discovered she had two half-sisters and aunt. 'I felt we had all just connected like a chain that had been broken,' she says.

cnn_dailymail

en

Summarize: By. Mark Nicol. PUBLISHED:. 18:03 EST, 15 February 2014. |. UPDATED:. 20:46 EST, 15 February 2014. A heroic paratrooper who lost both legs and an arm in Afghanistan has spoken for the first time about the campaign of abuse he suffered from officers after returning to Britain. Corporal Tom Neathway, 30, overcame the loss of three limbs after a bomb blast in Helmand and was able to return to work with new recruits. But he told The Mail on Sunday he left the Army with a broken heart after being ‘singled out’ and bullied by his Regimental Sergeant Major. Corporal Tom Neathway claims he was driven out of the Army by his Regimental Sergeant Major, Alistair Hutcheson, who bullied him. An Army inquiry found Regimental Sergeant Major Alistair ', left, singled out' and bullied Corporal Neathway, right, over several months in 2011 and that the harassment was 'cumulative in effect over time' Corporal Neathway lost both legs and his left arm in a bomb blast while he was serving with the 2nd Battalion, the Parachute Regiment (2 Para) in Afghanistan's Helmand province. Cpl Neathway of the 2nd Battalion, the Parachute Regiment (2 Para), broke his silence yesterday after a Government report revealed a 25 per cent rise in reported cases of Armed Forces bullying in the past year. After suffering his devastating injuries, Cpl Neathway was targeted by RSM Alistair Hutcheson, 54, while they were working at the Parachute Training Support Unit (PTSU) at RAF Brize Norton, Oxfordshire. ‘It was not the Taliban that cost me my life as a soldier, it was Hutcheson and those officers in the Army’s chain of command who ignored my mistreatment,’ said Cpl Neathway. ‘I loved my job at the PTSU helping junior Paras making their first jumps, but Hutcheson would get other members of staff to call me at all hours, demanding to know where I was and questioning me over what I was doing. ‘He also criticised me for wearing gym kit of shorts and a regimental T-shirt, which was practical given the problems I had with my artificial legs, which were continually falling off. He wanted me to wear uniform as if I was able-bodied. I looked ridiculous and would collapse in a heap. It was embarrassing. Cpl Neathway said on returning to work after overcoming his injuries, the bullying he was subjected to was 'harder to cope with than being a triple amputee' Senior officers also upheld Cpl Neathway's claims he was subjected to excessive phone calls at the RSM's behest and that he suffered unreasonable demands that he should wear uniform. ‘Hutcheson kept on at me over several months and I couldn’t take any more. The psychological impact of what he was saying was harder to cope with than being a triple amputee. So I lodged an official complaint.’ An Army inquiry found he was ‘singled out’ and ‘isolated’ by RSM Hutcheson over several months in 2011 and that the harassment was ‘cumulative in effect over time’. Senior officers also upheld Cpl Neathway’s claims he was subjected to excessive phone calls at the RSM’s behest and that he suffered unreasonable demands that he should wear uniform. In his treatment of the disabled soldier, RSM Hutcheson, also of the Parachute Regiment, was found to have failed to maintain the standards expected of his rank. Cpl Neathway’s claim that RSM Hutcheson had whispered in his ear ‘you’re not much of a paratrooper any more, are you?’ was dismissed after the Army found no supporting evidence. The RSM denied making the comment. After lodging his complaint, Cpl Neathway was forced to leave the PTSU, even though the offices had been adapted for severely wounded personnel. He returned to 2 Para’s base in Colchester, Essex, but the facilities were unsuited to a triple amputee. Cpl Neathway left the Army last year, five years after he was blown up by the Taliban. Cpl Neathway, of Crowle, Worcestershire, left the Army in 2013, five years after he was blown up by the Taliban. He says that the psychological scars of being abused also led to the breakdown of his relationship with model Rachael Patterson, who he had met at a charity event. Hutcheson has since been transferred to the Princess Royal Barracks at Deepcut, Surrey. The Mail on Sunday can also reveal that following a separate enquiry, Hutcheson was accused of displaying ‘poor judgment’ after allegedly making disparaging remarks about the mental state of a Parachute Regiment officer who had recently returned from Afghanistan. And in 1991 Hutcheson was fined £500 by the Army for physically abusing a recruit at a training depot. An MoD spokesman said: ‘The Army takes all incidents of bullying and harassment extremely seriously and all allegations are thoroughly investigated. ‘We have robust processes in place to ensure all Commanding Officers are made fully aware of their responsibility to protect others harassment and discrimination, and any suspicion of bullying is dealt with immediately.’

Summary: Corporal Tom Neathway lost both his legs and left arm in a bomb blast. He was serving in Helmand with the 2nd Battalion, the Parachute Regiment. 30-year-old overcame his injury to return to work in Colchester, Essex. But he was forced out of the Army after being'singled out' and bullied by Regimental Sergeant Major Alistair Hutcheson. Revelations come as Government report highlights 25 per cent rise in cases of bullying in the Armed Forces in the last year.

cnn_dailymail

en

Summarize: Starting in 1996, Alexa Internet has been donating their crawl data to the Internet Archive. Flowing in every day, these data are added to the Wayback Machine after an embargo period. Chick-Fil-A Will Give You Free Ice Cream if You Put Your Phone Down Some Chick-Fil-A locations across the U.S. are offering customers free ice cream in exchange for going screen-free. The company said on Tuesday that customers at more than 150 locally-owned Chick-Fil-A locations across the country can win a free Chick-Fil-A Icedream provided they can make it through their meals without looking at their phones. "Although our phones were meant to bring us closer together, they can sometimes have the opposite effect," the company said in its announcement. The promotion is the brainchild of Brad Williams, a Chick-Fil-A operator in Georgia, who has been offering dining families a square, cardboard box he calls a "cell phone coop," where they can place their phones (in silent mode) for the duration of their meals. "As we all know, technology increasingly demands more of our time and can be a big distraction, even while we’re eating," Williams said in a statement. "This got me thinking about what we could do to reduce this distraction during meals." The phone-free ice cream giveaway is not available at every Chick-Fil-A location, so the company advises potential customers to contact their local operator to inquire about availability. Known for its chicken sandwiches and other poultry products, Chick-Fil-A recently expanded into New York City with a successful midtown location that led the company to announce a second Big Apple location in the works. The restaurant chain has been facing increased competition from fast-food rivals such as McDonald's ( mcd ), which recently started testing a chicken breakfast sandwich, while growing chain Shake Shack ( shak ) is also now offering fried chicken sandwiches. All Cooped Up: How One Chick-fil-A Operator Is Redefining the Phrase This may be a scenario you’ve experienced before: you sit down for a meal with a friend, family member or colleague, but instead of spending that time talking to one another, you’re scrolling through Instagram, texting other friends and are generally disconnected from the present moment. For Brad Williams, a father of four, it’s something he’s witnessed firsthand. “I’ve seen this addiction to technology worsen at such a rapid pace in just my lifetime,” says Williams. “People have gone from having meaningful interactions with one another to constantly being on their phones and other technology.” Williams wanted to ensure his family stayed connected in this technological age, but admits, it’s difficult. His solution – a “no cell phone” rule at the dinner table. “My kids know when they sit down for a family dinner, they can’t be using their cell phones or any other technology,” says Williams, who jokingly calls them “screenagers.” “This is the way I was raised – to truly value meaningful conversation around the dinner table.” This technological distraction is more common than not. Americans now spend an average of 4.7 hours per day on their phone, according to a 2015 Informate Mobile Intelligence study. Although our phones were meant to bring us closer together, they can sometimes have the opposite effect. Williams, who is also a Chick-fil-A franchise owner in Suwanee, Ga., has witnessed this trend not only in his home, but in his restaurant dining room. “I’ve been doing this for 25 years and, over that time, I’ve seen customers at our restaurant go from spending quality time and talking with one another to being on their phones the entire meal,” says Williams. “There’s just a major disconnect.” Realizing the “no cell phone” rule worked at home, he decided to apply the same concept in his restaurant. Thus, the “Cell Phone Coop” challenge was born. Here’s how it works: The restaurant places a small, square box, (a.k.a. the Coop) on each table, with a simple challenge: enjoy a meal without the distraction of cell phones and receive a free Chick-fil-A Icedream. Guests complete the challenge successfully only if cellphones remain in the Coop untouched for their entire meal. Download Email x “The challenge has completely taken off,” says Williams. “We have families who don’t make it the first time, either because they ended up texting or something else, but then they come back in to try it again. Now we even have people asking to take the boxes home with them!” And the challenge has caught on outside his restaurant too. Throughout his small community in Suwanee, Ga., a suburb outside of Atlanta, Williams is known for the technology-free initiative. “I have to make sure I’m following the same rules,” he says. “Now I make sure I put my phone away even when I’m out having dinner on the town.” The challenge has been so well-received that Chick-fil-A restaurants across the country are requesting the Cell Phone Coops. Although this initiative isn’t available at all locations, more than 350 locally owned Chick-fil-A restaurants across the U.S. are offering guests the opportunity to take the Cell Phone Coop challenge. Download Email x “I had no idea this challenge would get so big – we didn’t even publicize it outside our restaurant,” says Williams. “I just want to see if we can play a small part in helping the families within in our community reconnect. It’s what we’re all about.” Download Email x To find out if you can be a part of the challenge, please contact your local Chick-fil-A Operator. Related Articles: Menu Hack: Double Cookie Milkshake

Summary: A Chick-fil-A operator in Georgia wants to stop families from being distracted by their phones while sharing a meal together. So he came up with the "Cell Phone Coop," a box in which family members place their (silenced) phones while they're eating in a Chick-fil-A restaurant, and he came up with a pretty good incentive to convince them to do so: free ice cream. Each member of a family that successfully completes the challenge and informs their cashier will get a free "Icedream" cone, Chick-fil-A says in a statement. "We really want our restaurant to provide a sense of community for our customers, where family and friends can come together and share quality time with one another," Georgia operator Brad Williams explains. The challenge has taken off, and more than 150 locations now offer Cell Phone Coops on their tables. The company suggests you call your local Chick-fil-A to see if it's taking part, Fortune reports.

multi_news

en

Summarize: Starting in 1996, Alexa Internet has been donating their crawl data to the Internet Archive. Flowing in every day, these data are added to the Wayback Machine after an embargo period. PITTSBURGH (KDKA) — Nine-year-old Will Maillis is not your average college kid. His father says he was speaking sentences at seven months. “I’d put him to bed, and he’d be in a crib, and I’d say go to sleep, go to sleep, and he’d say, I don’t want to.” Peter Maillis, a Greek Orthodox priest, says his son was also good with numbers, adding at a year-and a-half, multiplying at two. By five, he was counting in Chinese. “He finally gets to a hundred,” says his father, “and I said, OK, what else did you learn? He said, I learned the alphabet, and he rattled off the alphabet.” “Technically there’s no Chinese alphabet,” Will responds. “There’s a symbol for every word.” Join The Conversation On The KDKA Facebook Page Stay Up To Date, Follow KDKA On Twitter Will graduated from Penn Trafford High this year, and is taking a full schedule at CCAC. But is he overwhelmed by older students? “I’m usually at the front of the class,” he answers. “So out of sight, out of mind.” “He’s able to keep up, and he’s had A’s in the courses that he’s taken here at CCAC,” says Associate Academic Dean Tomi Waters. “So he’s more than excelling in those classes.” CMU has accepted him for next September. Will plans to be an astrophysicist. “It’s statistically impossible for there to be no life on any other planet in the universe.” he has his own universal concepts. The reason the universe is expanding is not bacause dark energy overpowers gravity, but because of gravity,” he announces. He has company. Will’s best friend will be starting a full load of classes, also at CCAC, at the ripe old age of ten.

Summary: When Peter Maillis told his 7-month-old son William to go to bed, William replied, "I don't want to," KDKA reports. It was clear from very early on that William was no ordinary child, and he recently proved that once again by becoming-at 9 years old-one of the youngest people ever to be accepted into college. According to People, William graduated from high school in May, is currently taking classes at Community College of Allegheny County, and will enroll in Carnegie Mellon University next fall. A psychologist declared William a genius at just 5 years old, the Pittsburgh Post-Gazette reports. By that time, he knew multiplication, reading, and writing (2 years old); could use sign language and read Greek (4 years old); and had learned geometry in one night (5 years old). William says being the youngest person in his college classes doesn't bother him. "I'm used to it by now," he tells People. (Even at home, William's siblings are 17 and 20 years older than he is.) And the dean at CCAC tells KDKA that William is "more than excelling," earning As in all the courses he's taken. William hopes to become an astrophysicist, and he already disagrees with Albert Einstein and Stephen Hawking when it comes to black holes. His ultimate goal? "I want to prove to everybody that God does exist," he tells People. "I tell him, 'God gave you a gift,'" Peter Maillis, a Greek Orthodox priest, says. "The worst thing would be to reject that gift and not use it for the betterment of the world."

multi_news

en

Summarize: Background The Recovery Act provided DOE with more than $41.7 billion, including $35.2 billion for projects and activities and $6.5 billion in borrowing authority. Of the $35.2 billion for projects and activities, almost half— $16.7 billion—was provided to the Office of Energy Efficiency and Renewable Energy for projects intended to improve energy efficiency, help build the domestic renewable energy industry, and help restructure the transportation industry to increase global competitiveness. This amount included about $5 billion for the Weatherization Assistance Program, about $3.2 billion for the Energy Efficiency and Conservation Block Grant program, and about $3.1 billion for the State Energy Program. The Recovery Act also provided about $6 billion to the Office of Environmental Management for environmental cleanup projects and about $2.5 billion to the Loan Guarantee Program Office to support loan guarantees for renewable energy and electric power transmission projects. As of March 10, 2011, DOE reported that it had obligated $33.1 billion (94 percent) and spent $12.5 billion (36 percent) of the $35.2 billion it received under the Recovery Act for projects and activities (see table 1). By comparison, as of December 31, 2009, the department had obligated $23.2 billion (54 percent) and spent $1.8 billion (4 percent). Nonfederal recipients of Recovery Act funds have reported on jobs funded by the Recovery Act, and this effort is a solid first step in moving toward more transparency and accountability for federal funds. Under the Recovery Act, nonfederal recipients are to report for any quarter in which they receive Recovery Act funds directly from the federal government, and are to include in those reports information concerning the jobs created or retained by their Recovery Act projects and activities. As reported by the Recovery Accountability and Transparency Board, job calculations are based on the number of hours worked in a quarter and funded under the Recovery Act—expressed in full-time equivalents (FTE). In November 2009, we reported on our review and analysis of recipient data from Recovery.gov, finding that there are reporting and quality issues with these data. It is important to recognize that the FTEs in recipient reports alone do not reflect the total employment effects of the Recovery Act. These reports solely reflect direct employment arising from the expenditure of less than one-third of Recovery Act funds. Therefore, both the data reported by recipients and other macroeconomic data and methods are necessary to gauge the overall employment effects of the stimulus. The employment effects in any state will vary with labor market stress and fiscal condition. DOE Recovery Act Spending and Jobs Funded Vary by Program DOE programs vary in the amount of Recovery Act funds they have obligated and spent and in the number of jobs funded through such spending, according to DOE and recipient reported data. Table 2 shows Recovery Act funding, obligations, and spending for the selected DOE programs. As of March 10, 2011, the percentage of Recovery Act funding spent on these selected programs ranged from a high of 67 percent for the Office of Environmental Management’s cleanup activities to a low of 5 percent for the Loan Guarantee Program Office. I will now briefly describe the status of Recovery Act spending for each of these five programs. Energy Efficiency and Conservation Block Grant Program The Recovery Act provided about $3.2 billion for DOE’s Energy Efficiency and Conservation Block Grant program (EECBG), funding the program for the first time since it was authorized, in the Energy Independence and Security Act (EISA) of 2007. The program—administered by the Office of Energy Efficiency and Renewable Energy—provides formula and competitive grants to states, territories, federally recognized Native American tribes, and local communities to develop, promote, and manage projects that improve energy efficiency and reduce energy use and fossil fuel emissions in local communities. Of the $3.2 billion provided for the EECBG program under the Recovery Act, DOE awarded about $1.94 billion as formula grants to more than 2,000 local communities–including cities, counties, and tribal communities—and about $767 million as formula grants to the states, five territories, and the District of Columbia. In addition to the approximately $2.7 billion in formula grants, DOE awarded about $453 million of the total EECBG funds through competitive grants to local communities. The Recovery Act required that DOE obligate about $2.7 billion in formula funds by September 30, 2010. DOE has obligated all EECBG funds to recipients, and recipients are beginning to obligate and spend these funds. As of December 31, 2010, recipients reported obligating approximately $1.7 billion and spending more than $655 million, approximately 24 percent of the EECBG budget. As of March 10, 2011, recipients reported spending about $860 million. As we reported in September 2010, more than 60 percent of EECBG funds had been obligated for three purposes: energy- efficient retrofits, such as replacement of heating and cooling systems; financial incentive programs, such as rebate programs to pay for energy- efficiency retrofits not already covered by existing incentives; and improvements to buildings and facilities, such as the installation of geothermal systems. Energy-efficiency improvements have varied and include projects such as occupancy sensor lighting, solar-powered trash compactors, and solar-powered parking meters. In September 2010, we noted that some EECBG recipients were experiencing challenges in reporting job-related outcome metrics. For example, in one locality, officials said that they planned to estimate the number of jobs created because they did not have hourly contracts. In another locality, officials were not aware of how to calculate FTEs per Office of Management and Budget guidance. Recipients also expressed frustration with the process for reporting metrics and the volume of contact from various DOE offices about reporting requirements or changes in reporting requirements. DOE is beginning to take steps to consolidate the amount of guidance and requirements being provided to recipients. We expect to issue a report in April 2011 with greater detail about the implementation of the EECBG program, including information on the challenges that EECBG recipients have reported encountering in using grant funds and the quality of jobs data reported by recipients. Environmental Cleanup Projects The Recovery Act provided about $6 billion for DOE to expand and accelerate its efforts to clean up numerous contaminated sites across the country, where decades of nuclear weapons research, development, and production left a legacy of dangerously radioactive, chemical, and other hazardous wastes. This funding substantially boosted the Office of Environmental Management’s annual appropriation for cleanup, which has generally been between $6 billion and $7 billion. In all, DOE selected 93 projects at 17 DOE sites in 12 states for Recovery Act funding. DOE designated the bulk of this new funding—almost 80 percent—to speed cleanup activities at four large sites: the Hanford Site in Washington State, Idaho National Laboratory, the Oak Ridge Reservation in Tennessee, and the Savannah River Site in South Carolina. DOE generally chose to use Recovery Act funds for cleanup projects that could be started and finished quickly. The majority of the projects selected also had existing contracts, which allowed the department to update and validate new cost and schedule targets within a short time frame. DOE generally funded four types of projects: (1) decontaminating or demolishing facilities, (2) removing contamination from soil and groundwater, (3) packaging and disposing of transuranic and other wastes, and (4) supporting the maintenance and treatment of liquid tank wastes. As of March 2011, DOE had obligated virtually all of the $6 billion in Recovery Act funding for cleanup activities and had spent nearly $4 billion, or about two-thirds of the funds. Spending rates varied across sites, from 50 percent of obligated funds spent at the Oak Ridge Reservation to 96 percent at the Mound Site in Ohio, a former production site for explosives and other weapons components. DOE officials said that they plan to have 95 percent of the funds spent by the end of fiscal year 2011. As of March 10, 2011, 19 projects were complete. Officials told us that some work may take until December 2012 to complete although they are taking steps to try to move up the completion date. Recovery Act-funded employment for DOE’s cleanup activities peaked in the last quarter of fiscal year 2010. DOE reported for the last quarter of fiscal year 2010 an estimated total of 10,977 FTEs funded by the Recovery Act. The jobs were concentrated at the four sites that received the bulk of the Recovery Act funding. By the following quarter, DOE reported 9,362 FTEs as being funded by the Recovery Act. Furthermore, DOE officials said that workforce reductions have been approved and announced for three sites. The Hanford Site will lose 1,600 positions, all funded by the Recovery Act. The Idaho National Laboratory will lose 600 positions, of which 400 were funded by the Recovery Act, and the Savannah River Site will lose 1,400 positions, of which 800 were funded by the Recovery Act. As a consequence of these reductions, it is likely that the reported count of FTEs will continue to decline. In July 2010, we reported that DOE has faced familiar challenges in both managing Recovery Act projects and measuring how Recovery Act funding has affected cleanup and other goals. At that time, we reported that one- third of Recovery Act funded projects did not meet cost and schedule targets. DOE officials cited some of the same reasons that have plagued DOE in the past: technical, regulatory, safety, and contracting issues. DOE has taken steps aimed at strengthening project management and oversight for Recovery Act projects, such as increasing project reporting requirements and placing tighter controls on when funds are disbursed to sites. By October 2010, both cost and schedule performance had significantly improved. Measuring the impact of Recovery Act funding has been a challenge for DOE. It has had particular difficulty providing an accurate assessment of the act’s impact on jobs, environmental risk reduction, and the life-cycle costs of its cleanup program. First, it has used different methodologies to assess and report jobs created, which provided very different and potentially misleading pictures. Second, DOE had not yet developed a clear means of measuring how cleanup work funded by the act would affect environmental risk or reduce its footprint—the land and facilities requiring DOE cleanup. Third, it is unclear to what extent Recovery Act funding will reduce the costs of cleaning up the DOE complex over the long term. DOE’s estimate of $4 billion in life-cycle cost savings resulting from Recovery Act funding was not calculated in accordance with federal guidance. Our analysis indicated that those savings could be 80 percent less than DOE estimated. Without clear and consistent measures, it will be difficult to say whether or how Recovery Act funding has affected DOE’s cleanup goals. In our July 2010 report, we recommended four actions for DOE to improve project management and reporting: (1) determine whether project management and oversight steps adopted for Recovery Act projects would benefit other cleanup projects, (2) clarify the methodology used to calculate jobs created, (3) develop clear and quantifiable measures for determining the impact of Recovery Act funding, and (4) ensure that cost savings are calculated according to federal guidance. DOE agreed with the recommendations and is taking steps to implement them. For example, some of the steps DOE implemented to improve management of Recovery Act projects are being implemented for work funded through annual appropriations. DOE also issued clarifying guidance to the sites on the methodology for reporting footprint reduction, although the extent to which this measures actual environmental risk reduction, if at all, is not clear. Finally, according to DOE officials, the department is preparing a report describing the methodologies used for cost savings achieved to date through the Recovery Act and plans to submit a report to the Office of Management and Budget and Congress by September 30, 2011. Loan Guarantee Program for Innovative Technologies Title XVII of the Energy Policy Act of 2005 established DOE’s Loan Guarantee Program (LGP) to guarantee loans for projects that (1) use new or significantly improved technologies as compared with commercial technologies already in use in the United States and (2) avoid, reduce, or sequester emissions of air pollutants or man-made greenhouse gases. In February 2009, the Recovery Act amended the LGP, authorizing DOE to also guarantee loans for some projects using commercial technologies. Projects supported by the Recovery Act must employ renewable energy systems, electric power transmission systems, or leading-edge biofuels that meet certain criteria; begin construction by the end of fiscal year 2011; and pay wages at or above market rates. The Recovery Act originally provided nearly $6 billion to cover the credit subsidy costs for projects meeting those criteria. During the 2 years since providing Recovery Act funds to cover LGP credit subsidy costs, Congress twice transferred funds from the LGP to other programs, after we expressed concerns about DOE’s administration of the program. In April and May 2009, as part of our mandate to annually review DOE’s implementation of the LGP, we provided information on the program’s status to House and Senate appropriators. Among other things, we noted that DOE had received loan guarantee applications for at least 68 projects but had committed to guarantee a loan for only 1, even though a number of the applications—including 6 that DOE deemed eligible for Recovery Act funding—had been submitted in response to a solicitation issued in 2006. In August 2009, Congress authorized the transfer of $2 billion of the nearly $6 billion to expand the “Cash for Clunkers” program, leaving about $4 billion in Recovery Act funds to pay credit subsidy costs for LGP projects. In July 2010, we reported that DOE made an additional nine conditional commitments to issue loan guarantees but had issued only one loan guarantee. We also reported that DOE lacked appropriate tools for assessing the progress of the program an treated applicants inconsistently in the application review process, favoring some applicants and disadvantaging others. In July 2010, our report’s findings were cited in the Senate report for the fiscal year 2011 Energy and Water Development appropriation, which voiced continued concerns about DOE’s ad hoc implementation of the program and slow progress in making loan guarantees. Shortly thereafter, Congress transferred an additional $1.5 billion in funds from the LGP to the Education Jobs Fund. GAO-10-627. According to our analysis of DOE data, as of March 10, 2011, DOE’s LGP had obligated only about 17 percent of the remaining $2.5 billion in Recovery Act funds. DOE stands to lose about $2 billion of the Recovery Act funds for LGP projects if it does not make final loan guarantees using those funds soon; the Recovery Act requires that borrowers begin construction of their projects by September 30, 2011. One of the purposes of the Recovery Act is to create jobs, and DOE established job creation as an agency goal when making loan guarantees. However, it is not clear to what extent the LGP projects for which DOE has used Recovery Act funds are supporting that goal. In our July 2010 report, we stated that DOE had not established measures for evaluating agency progress in achieving that goal, as called for by principles of good governance. For the fourth quarter of 2010, recipients reported funding 784 FTEs from LGP projects. DOE officials estimate that 8 projects were under way by the end of 2010. As of March 2, 2011, according to agency estimates derived from loan guarantee applications, 10,531 construction and operations positions are expected to result from the 10 projects that have received loan guarantees, and an additional 2,331 positions are expected to result from the 4 additional projects to which DOE has conditionally committed. State Energy Program The $3.1 billion that the Recovery Act appropriated to the State Energy Program (SEP) was made available to 56 recipients, including all 50 states, the District of Columbia, and U.S. territories. The SEP provides funds through formula grants to achieve national energy goals such as increasing energy efficiency and decreasing energy costs. Created in 1996, the SEP has typically received less than $50 million per year. Thus, the Recovery Act provided a substantial increase in funding for this program. As of January 31, 2011, recipients reported obligating over $2.7 billion and spending over $900 million of their available funds. As we reported in September 2010, recipients obligated their SEP funds for such items as buildings, including school and government improvements and revolving loan programs; electric power and renewable energy, including wind turbine deployment; and industry, including energy audits and water conservation. We also noted that a lack of guidance and other obstacles, such as the lack of state energy management staff, hampered states from obligating and spending funds. As of September 2010, DOE was beginning to monitor recipient spending, and recipient monitoring practices varied in scope and depth. DOE and recipients reported challenges in meeting Recovery Act outcome reporting requirements for a variety of reasons, including the need to coordinate among numerous state agencies to fulfill reporting requirements and difficulties with reporting information into DOE’s primary reporting system. Weatherization Assistance Program The Recovery Act provided $5 billion for the Weatherization Assistance Program, which DOE is distributing to each of the states, the District of Columbia, five territories, and two Indian tribes. This program, administered by DOE’s Office of Energy Efficiency and Renewable Energy, is intended to enable low-income families to reduce their utility bills by making long-term energy-efficiency improvements to their homes by, for example, installing insulation, sealing leaks, and modernizing heating and air conditioning equipment. The $5 billion in funding provided by the Recovery Act represents a significant increase for a program that has received about $225 million per year in recent years. During 2009, DOE obligated about $4.73 billion of the $5 billion in Recovery Act weatherization funding to recipients, while retaining the remaining funds to cover the department’s expenses. Initially, DOE provided each recipient with the first 10 percent of its allocated funds, which could be used for start-up activities, such as hiring and training staff, purchasing equipment, and performing energy audits of homes. Before a recipient could receive the next 40 percent of its funds, DOE required it to submit a plan for how it would use its Recovery Act weatherization funds. By the end of 2009, DOE had approved the weatherization plans of all 58 recipients and had provided all recipients with half of their funds. To release the remaining half of allocated funds, DOE requires that recipients finish weatherizing 30 percent of the homes identified in their weatherization plans. In addition, recipients must fulfill the monitoring and inspection protocols established in their weatherization plans; monitor each local agency at least once each year to determine compliance with administrative, fiscal, and state policies and guidelines; ensure that local quality controls are in place; inspect at least 5 percent of completed units during the course of the year; and submit timely and accurate progress reports and monitoring reviews to DOE so that the department can confirm acceptable performance. As of February 2011, DOE reported that it had released the remaining half of funds to the 44 recipients that had met these requirements. According to DOE, the department is providing targeted communications and training to assist the remaining 14 recipients meet the requirements to gain access to their remaining funds. DOE has indicated that recipients are to spend their Recovery Act weatherization funds by March 31, 2012. DOE officials told us that as of December 2010, about 330,304 homes had been weatherized nationwide, or about 56 percent of the approximately 590,000 homes currently planned for weatherization. All of the recipients submitted their quarterly data to FederalReporting.gov and, for the fourth quarter of 2010, reported approximately 15,391 FTEs had been funded by the Recovery Act under this program. In May 2010, we made eight recommendations for DOE to clarify its weatherization guidance and production targets. DOE generally concurred with the recommendations and has addressed them to varying extents. We will continue to monitor DOE’s progress in implementing these recommendations. We have recently begun additional work on the Weatherization Assistance Program looking at the use of Recovery Act funds and the extent to which program recipients are meeting Recovery Act and program goals, such as job creation and energy and cost savings, as well as the status of DOE’s response to our May 2010 recommendations. We expect to complete this work in fiscal year 2012. Chairman Stearns, Ranking Member DeGette, and Members of the Subcommittee, this completes my prepared statement. As noted, we are continuing to monitor DOE’s use of Recovery Act funds and implementation of programs. I would be happy to respond to any questions you may have at this time. Contact and Acknowledgments For further information regarding this testimony, please contact me at (202) 512-3841. Catherine Bombico, Swati Deo, Janet Frisch, Maria Gaona, Kim Gianopoulos, Jonathan Kucskar, David Marroni, Kristen Massey, Cynthia Norris, Emily Owens, John Scott, Benjamin Shouse, Karla Springer, Kiki Theodoropoulos, Lisa Van Arsdale, Ginny Vanderlinde, Jeremy Williams, and Arvin Wu made key contributions to this testimony. This is a work of the U.S. government and is not subject to copyright protection in the United States. The published product may be reproduced and distributed in its entirety without further permission from GAO. However, because this work may contain copyrighted images or other material, permission from the copyright holder may be necessary if you wish to reproduce this material separately.

Summary: The American Recovery and Reinvestment Act of 2009 (Recovery Act) aims to promote economic recovery, make investments, and minimize or avoid reductions in state and local government services. As of February 2011, the Congressional Budget Office estimated the act will cost $821 billion in spending and tax provisions through 2019. The Recovery Act provided the Department of Energy (DOE) more than $41.7 billion--$35.2 billion for projects and activities and $6.5 billion in borrowing authority--in areas such as energy efficiency, renewable energy, and environmental cleanup. This included about $3.2 billion for the Energy Efficiency and Conservation Block Grant program, about $3.1 billion for the State Energy Program, and about $5 billion for the Weatherization Assistance Program. The act also provided about $6 billion to DOE's Office of Environmental Management for environmental cleanup activities and about $2.5 billion to its Loan Guarantee Program Office to support such guarantees for, among other things, renewable energy projects. This testimony focuses on DOE's obligations and spending of Recovery Act funds for these programs and information reported on jobs funded as a result of this spending. This testimony is based on prior GAO work updated with data from DOE and on preliminary results from ongoing GAO work on the Energy Efficiency and Conservation Block Grant program. As of March 10, 2011, DOE reported that it had obligated $33.1 billion (94 percent) and spent $12.5 billion (36 percent) of the $35.2 billion it received under the Recovery Act for projects and activities. This is an increase from December 31, 2009, when DOE reported that it had obligated $23.2 billion and spent $1.8 billion. DOE programs vary in the amount of Recovery Act funds they have obligated and spent and in the number of jobs funded through such spending, according to DOE and recipient reported data. Specifically: (1) Energy Efficiency and Conservation Block Grant Program. DOE has obligated the full $3.2 billion of Recovery Act funding provided for the program and, as of March 2011, some grant recipients reported spending about $860 million. GAO expects to issue a report in April 2011 with information on the quality of jobs data reported by recipients. (2) Office of Environmental Management Cleanup Activities. DOE has obligated virtually all of the $6 billion in Recovery Act funding for cleanup activities and, as of March 2011, had spent about two-thirds of the funds. Recovery Act-funded employment for DOE's cleanup activities peaked in the last quarter of 2010, when DOE reported that 10,977 full-time equivalents had been funded by the act. (3) Loan Guarantee Program. As of March 2011, DOE has obligated about 17 percent of the $2.5 billion provided for Loan Guarantee Program. For the last quarter of 2010, recipients reported 784 full-time equivalents had been funded from Loan Guarantee Program projects. (4) State Energy Program. As of January 2011, grant recipients reported obligating over $2.7 billion of Recovery Act funding and spending over $900 million of the $3.1 billion appropriated to the State Energy Program. (5) Weatherization Assistance Program. As of March 2011, DOE reported that half of the $5 billion of Recovery Act funding provided for the Weatherization Assistance Program had been spent. Recipients reported that about 15,391 full-time equivalents had been funded by the Recovery Act for the fourth quarter of 2010.

gov_report

en

Summarize: Photos by Bill Dow ©2019 The Roar Foundation No images may be removed from this web site without written permission from the Roar Foundation The Roar Foundation is a 501 (c) (3) non-profit organization. Shambala is a member of the American Sanctuary Association. Art-rich websites of significance to the study of art and art history, especially those at risk of disappearance from the live web. In this May 26, 2011 photo, auction items that belonged to Michael Jackson are displayed at Julien's Auctions in Beverly Hills, Calif. Items are among the memorabilia available for auction on June 25... (Associated Press) In this May 26, 2011 photo, auction items that belonged to Michael Jackson are displayed at Julien's Auctions in Beverly Hills, Calif. Items are among the memorabilia available for auction on June 25... (Associated Press) In this May 26, 2011 photo, a worn and signed "Thriller" Jacket that belonged to Michael Jackson is displayed at Julien's Auctions in Beverly Hills, Calif. This item is among the memorabilia available... (Associated Press) In this May 26, 2011 photo, auction items that belonged to Michael Jackson are displayed at Julien's Auctions in Beverly Hills, Calif. Items are among the memorabilia available for auction on June 25... (Associated Press) Auction administrator Darren Julien says the red and black leather jacket is "the most recognized and significant piece of pop culture" to come up for sale, and he expects it to fetch at least $200,000 at the Music Icons auction on June 25 and 26 at Julien's Auctions in Beverly Hills. Jackson autographed the jacket as a gift to his longtime costume designers, Dennis Tompkins and Michael Bush. He wanted them to use the small calfskin jacket as a template for his future concert fashions. A portion of the proceeds from its sale will benefit the Shambala Preserve, where Jackson's two Bengal tigers, Thriller and Sabu, have been living since the pop star left his Neverland ranch in 2006. Other Jackson items up for sale include the wig he wore when he announced his ill-fated "This Is It" concert series in London, a fedora and spangled glove he wore on stage, his shirt from the "Scream" video and the battered mailbox from the Carolwood Drive estate where Jackson died at age 50 in 2009. The Music Icons sale also includes one of Eric Clapton's guitars, Frank Sinatra's patent leather boots and 1986 Jaguar, handwritten lyrics and a leather jacket from Johnny Cash, jackets and a guitar from Elvis Presley, a signed harmonica from Bob Dylan and nearly 600 other pieces of music memorabilia from Bruce Springsteen, Madonna, The Beatles and others. The collection will be on view free to the public from June 13 to 25 at Julien's Auctions Gallery in Beverly Hills. ___ Online: www.juliensauctions.com

Summary: You might own a cheap knockoff of Michael Jackson's iconic "Thriller" jacket, but if you've got a couple hundred thousand dollars burning a hole in your pocket, you can snag the real thing. The red and black leather jacket worn by the King of Pop in the 1983 video is expected to fetch between $200,000 and $400,000 at a Beverly Hills auction later this month, reports the AP. The jacket-worn and signed by Jackson-was a gift from the singer to his longtime costume designers. A portion of the proceeds will benefit the Shambala Preserve, where Jackson's two Bengal tigers have lived since 2006. Also for sale: the wig Jackson wore during the announcement of his "This Is It" concert series, a fedora and glove he wore onstage, the shirt he wore in the "Scream" video, and a mailbox from the estate where he died in 2009.

multi_news

en

Summarize: Syria's activists called for the largest protests since demonstrations began a month ago, and reports indicate that huge crowds took to the streets to call for President Bashar Assad's ouster. However, the government responded with a violent crackdown that left at least 75 people dead. Syria has expelled journalists and the government tightly controls access to the protests. However, dramatic videos have surfaced on Facebook and YouTube showing the horrifying violence taking place while tens of thousands continue to march. Below, find some of the videos circulating of the protests and violence that rocked Syria on Friday. Please note, some videos are extremely graphic. 1 of 8 Young Boy Shot (GRAPHIC VIDEO) This video reportedly shows Syrians fleeing violence, including an image of a young boy being suffering from a devastating head wound. Share this slide: At least 75 protesters reported killed across Syria during the "Great Friday" protests against Bashar al-Assad's rule. At least 75 people are reported to have been killed in Syria in the bloodiest day since the uprising began, as security forces use live ammunition and tear gas to quell anti-government protests across the country, according to Amnesty International, the London-based rights group. Syrian activists sent Al Jazeera a list naming 103 people from across the country who they said had been killed by security forces during the "Great Friday" protests. SANA, the official news agency, said that 10 people had died in clashes between protesters and passers-by, and that security forces had only used tear gas and water cannons. Rights groups and pro-democracy activists dispute this claim. Fifteen of the protester's deaths took place in Izraa, near the flashpoint southern town of Daraa, according to the list released by activists, while another 21 were reported to have occured in Homs. Deaths were also reported in Douma and Zamalka, near Damascus (see this video posted from an unknown source from Zamalka). Other places where protesters were killed include Homs, Syria's third largest city, Moadamia and Daraa. Demonstrators marching in peace were surprised by security forces' live ammunition, according to Hazem, a protester who spoke to Al Jazeera via phone from a Damascus suburb. "Demonstrators were going with olive branches, it was peaceful" until they were "surprised by live ammunition from some security forces in one of the flats of the street", Hazem said. The protesters took to the streets to mark what activists dubbed "Great Friday" - the biggest demonstrations against Bashar al-Assad's government to date. Map of April 22 'Great Friday' protests across Syria Al Jazeera's Rula Amin reported from Damascus, which until now had been relatively calm, that the level of tension in the city on Friday marked a new point in the uprising. "This day is turning into a very bloody day, probably the bloodiest since the protests started," she said. A heavy security presence prevented protests from taking off in Damascus. "Obviously the government want[s] to make a point, the capital is a redline and they will not allow the protests to reach the capital," she said. Several witnesses, including medical professionals, told Al Jazeera that many of the injured were either being refused access to hospitals or were too scared to seek treatment. A spokesperson for the ministry of information told Al Jazeera on Friday that security forces would fire on protesters only if they were fired upon first. State television, meanwhile, aired a talk show where speakers blamed foreign media, including Al Jazeera, Al Arabiya and BBC Arabic, for inciting the protests. Violence in Homs Speaking under condition of anonymity, a witness in Homs described how about 200 protesters, moving ahead of a 3,000-strong group, came under fire as they marched down Cairo Street, close to the Clock Square that has been the city's focus for protests. "Suddenly the security opened fire on us randomly," the activist told Al Jazeera by phone. One of those killed in the city by government officers was a 25-year-old protester named Mohammed Bassam al-Kahil, he said. Meanwhile, another witness in Hasakah, in Syria's mainly Kurdish northeast, told Al Jazeera that demonstrators gathering at a mosque after prayers were attacked by pro-government protesters. Syrian activists co-ordinating the protests against al-Assad's rule have demanded the abolition of his Baath Party's monopoly on power and the establishment of a democratic political system. In the first joint statement since protests erupted five weeks ago, the Local Co-ordination Committees, representing provinces across Syria, said "freedom and dignity slogans cannot be achieved except through peaceful democratic change". "All prisoners of conscience must be freed. The existing security apparatus has to be dismantled and replaced by one with specific jurisdiction and which operates according to law," the joint statement said. Contest of wills On the eve of the protests, witnesses said security forces were setting up checkpoints in areas surrounding Damascus, checking people's ID cards. The demonstrations are a test of whether Assad's decision to lift emergency law, imposed by his Baath Party when it took power in a coup 48 years ago, will defuse mass discontent with repression and corruption. A spokeswoman for Syria's information ministry says security forces could open fire if protesters shoot first Haitham Maleh, who heads the Syrian Human Rights Association, a civil-rights group, told Al Jazeera that the regime's reforms only went a fraction of the way towards satisfying the protesters' demands for more freedom, democracy and the legalisation of opposition parties. "The government will not do anything, I think, and the strikes will get bigger and bigger," he said. Al Jazeera's Amin said that because one of the conditions for the newly gained right to protest was to request a permit, today's protests fell outside of the changes. "There was no time for anyone to ask for permission for today," she said. Aided by his family and a pervasive security apparatus, Assad, 45, has absolute power in Syria. More than 220 protesters have been killed since pro-democracy protests erupted on March 18 in Daraa, rights campaigners say. A decree Assad signed on Thursday that lifted emergency law is seen by the opposition as little more than symbolic, since other laws still give entrenched security forces wide powers. 'Violent repression' Robert Fisk, the Middle East reporter, analyses the Syrian uprising in interview to Al Jazeera The authorities have blamed armed groups, infiltrators and Sunni Muslim armed groups for provoking violence at demonstrations by firing on civilians and security forces. Commenting on the Syrian situation, Robert Fisk, the veteran Middle East reporter for the UK's Independent newspaper, says Assad appears to be "stepping backwards". "Once you start giving these concessions, the crowds on the streets want more and it will always end at the same demand: end of the dictator," he told Al Jazeera from the Lebanese capital Beirut on Friday. With his belated concessions, Assad is "is now enduring the failures that he committed 11 years ago", Fisk said. While crowds in Damascus and Deraa are getting bigger, he said Assad will not be fleeing Syria yet. "He's in a lot of trouble and there must be a lot of talk in the presidential palace tonight," he said. Washington urged Syria to stop the violence against protesters and William Hague, the British foreign secretary, said emergency law should be "lifted in practice not just in word". Western and other Arab countries have mostly muted their criticism of the killings in Syria for fear of destabilising the country, which plays a strategic role in many of the conflicts in the Middle East. Syria is technically at war with Israel but has kept its Golan Heights front quiet since a 1974 ceasefire. Coming a day after Mr. Assad endorsed the lifting of draconian emergency rule, the killings represented another chapter in the government’s strategy of alternating promises of concessions with a grim crackdown that has left it staggering but still entrenched. “There are indications the regime is scared, and this is adding to the momentum, but this is still the beginning,” said Wissam Tarif, the executive director of Insan, a Syrian human rights group. “Definitely, we haven’t seen the millions we saw in Egypt or Tunisia. The numbers are still humble, and it’s a reality we have to acknowledge.” Photo The images of carnage marked one of the deadliest days of the so-called Arab Spring, and the coming days may be replete with its lessons. In other places in the Middle East, violence has led to funerals where many more are often killed. The government’s belated attempts at reform, meanwhile, have often simply escalated protesters’ demands. In that, the government faces perhaps its greatest challenge: to maintain its bastions of support with promises for the future and threats that its collapse means chaos, against the momentum that the vivid symbols of martyrdom have so often encouraged. “We are not scared anymore,” said Abu Nadim, a protester in Douma, a town on the outskirts of Damascus. “We are sad and we are disappointed at this regime and at the president. Protests, demonstrations and death are now part of the daily routine.” In a sharply worded statement, President Obama said the “outrageous use of violence to quell protests must come to an end now.” The statement also said President Assad was seeking Iranian help in repressing his people, but did not provide details. In the capital, a city that underlines the very authority of the Assad family’s decades of rule, hundreds gathered after Friday Prayer at the al-Hassan Mosque. Some of them chanted, “The people want the fall of the government,” a slogan made famous in both Egypt and Tunisia. But security forces quickly dispersed the protests with tear gas, witnesses said. Syria’s second-largest city, Aleppo, appeared to remain relatively quiet. Advertisement Continue reading the main story The government’s determination to keep larger cities somewhat subdued may have led to some of the highest death tolls. Protesters in some towns on Damascus’s outskirts said security forces fired at them to prevent them from marching toward the capital. And in Azra, protesters said, government forces were intent on keeping them from Dara’a, a poor town 20 miles away that helped unleash the revolt in March. A protester in Azra who gave his name as Abu Ahmad said he brought three of those killed to the mosque — one shot in the head, one in the chest and one in the back — the oldest of whom was 20 years old. Video that was posted on social networking sites showed a man carrying the bloodied corpse of a young boy, apparently shot by the police. Video Taken together, most of the victims died in protests in the towns around Damascus, where demonstrators have sought to occupy a city landmark in a replay of Cairo ’s Tahrir Square. Both sides seemed to understand the significance of the capital: Mass protests there would serve as a devastating blow to the government’s prestige. Mr. Nadim, the protester in Douma, said plainclothes security forces carrying machine guns were omnipresent in the town. He said snipers were also stationed on top of two hospital buildings. Protesters left the mosque after noon prayers, their numbers growing to 5,000, he said. They met a force of 3,000 security men, he said. “The minute they saw us they started shooting at us,” he said. Protesters retreated, then surged again. “Peaceful! Peaceful!” he said they shouted as the gunfire continued. Newsletter Sign Up Continue reading the main story Please verify you're not a robot by clicking the box. Invalid email address. Please re-enter. You must select a newsletter to subscribe to. Sign Up You will receive emails containing news content, updates and promotions from The New York Times. You may opt-out at any time. You agree to receive occasional updates and special offers for The New York Times's products and services. Thank you for subscribing. An error has occurred. Please try again later. View all New York Times newsletters. Organizers said at least some dissent was reported in every province, and the protesters’ calls were far more sweeping than in the uprising’s earliest days, when demonstrators were seeking democratic changes rather than regime change. In Baniyas, a coastal city, a banner denounced Mr. Assad and his ruling Baath Party : “No Baath, No Assad, we want to free the country.” Another banner, referring to Mr. Assad’s medical training abroad, read, “A doctor in London, a butcher in Syria.” Razan Zeitouneh, an activist with the Syrian Human Rights Information Link in Damascus, basing her account on witnesses, said 88 people had been killed — 20 in Azra; 1 in Dara’a; 22 near Homs; 39 in the suburbs of Damascus; 1 in Latakia; 3 in Hama and 2 elsewhere. Mr. Tarif’s group, Insan, said 81 people were killed. In Homs, where major protests erupted this week, activists said security forces and plainclothes police officers flooded the city, setting up checkpoints and preventing all but a few dozen people from gathering. By afternoon, one resident said the streets were deserted, the silence punctuated every 15 minutes or so by gunfire.

Summary: Most wire accounts are putting the day's death toll among protesters in Syria at about 75, making it what al-Jazeera calls the "deadliest day" yet in the nation's unrest. President Obama condemned the "outrageous use of violence" by the government of Bashar al-Assad, notes the BBC, and the AP warns that it could be even worse tomorrow-precisely because of all those funerals. The violence came a day after Assad formally lifted emergency law, a move that did little to appease protesters and followed the government's usual concession-followed-by-crackdown pattern, notes the New York Times. While today's protests were unprecedented, their momentum "seemed to fall short of the popular upheaval that revolutions in Egypt and Tunisia represented," writes the Times' Anthony Shadid. Organizers promised they were just getting started. Click to see videos of the protests at Huffington Post, but be warned that the content is rough.

multi_news

en

Summarize: Michelle Obama has hit out at movie director Michael Moore and other critics of the Oscar-nominated film 'American Sniper', saying it 'touches on the emotions and experiences' of many military families. Speaking at the launch of '6 Certified' in Washington D.C. on Friday, the U.S. First Lady said that she was aware that the film has been accused of glorifying murder and serving as war propaganda. But she said: 'The number-one movie in America right now is a complex, emotional depiction of a veteran and his family. And I had a chance to see American Sniper this week on that long flight. 'While I know there have been critics, I felt that, more often than not, this film touches on many of the emotions and experiences that I've heard firsthand from military families over these past few years.' Scroll down for video. First Lady: Michelle Obama (pictured) has hit out at movie director Michael Moore and other critics of the Oscar-nominated film 'American Sniper', saying it 'touches on the emotions' of many military families. Couple: 'American Sniper' is based on the autobiography of late Navy SEAL sniper, Chris Kyle (pictured with his wife, Taya, in April 2012). The film has been accused of glorifying murder and serving as war propaganda. Controversial: Speaking at the launch of '6 Certified' in Washington D.C. on Friday, the U.S. First Lady said that she was aware the film (featuring Bradley Cooper as Kyle, pictured) has been accused of glorifying murder. Mrs Obama was joined by Hollywood star Bradley Cooper - who portrays main character, late Navy SEAL sniper, Chris Kyle, in the film - and media heavyweights for the '6 Certified' event. The initiative will allow TV shows and films to display an onscreen badge that tells viewers the show they're watching has been certified by the group 'Got Your 6' - military slang for 'I've got your back'. To be approved, the film or show must cast a veteran, tell a veteran story, have a story written by a veteran or use veterans as resources. And it must do so 'accurately and responsibility'. During the event, the 51-year-old FLOTUS said: 'We hope our country will welcome back our veterans - not by setting them apart but by fully integrating them into the fabric of our communities.' She then spoke in defense of 'American Sniper', which has become a $264 million global box-office sensation following its cinematic release on January 16. The film has gained millions of supporters. However, it has also weathered a growing storm of criticism because of the acts of war committed by Kyle - whose autobiography the movie is based on - as well as its portrayal of Islamic people. Speaking out: Mrs Obama told attendees: 'The number-one movie in America right now is a complex, emotional depiction of a veteran and his family. And I had a chance to see American Sniper this week on that long flight' Difference in opinion: She continued: 'While I know there have been critics, I felt that, more often than not, this film touches on many of the emotions and experiences that I've heard firsthand from military families over these past few years.' Above, Mrs Obama at the event (left) and Michael Moore (right), who criticized the film. Angry: Taking to Twitter in rage, Moore seethed of 'American Sniper': 'My uncle killed by sniper in WW2. We were taught snipers were cowards. Will shoot u in the back. Snipers aren't heroes. And invaders r worse' On the same day the Clint Eastwood-directed film hit U.S. cinemas, Moore - director of Fahrenheit 9/11 - courted controversy by slamming snipers as 'cowards' who'shoot you in the back' Taking to Twitter in rage, Moore seethed: 'My uncle killed by sniper in WW2. We were taught snipers were cowards. Will shoot u in the back. Snipers aren't heroes. And invaders r worse.' Kyle, whose widow, Taya, attended the movie's premiere, was credited with saving hundreds of American lives by making 160 confirmed kills, which is the most in American military history. He claimed to have shot down 255. The film reveals not only how the sniper, who joined the SEALS in the late nineties, became so successful, but also how the trauma of fighting in Iraq never left him. Raised in rural Texas, Kyle was posted to Fallujah, west of Baghdad and a major battleground of Iraqi insurgency, in 2004, and it was during the battle for that city where he made his mark. Actor: Kyle, whose widow, Taya, attended the movie's premiere, was credited with saving hundreds of US lives by making 160 confirmed kills, the most in American military history. Above, Cooper at the '6 Certified' launch. Couple: The film reveals not only how the sniper, who joined the SEALS in the late nineties, became so successful, but also how the trauma of fighting in Iraq never left him. Above, Cooper with his on-screen wife. However, it was in 2006 in Ramadi, a city in central Iraq, that he gained his nickname as 'The Legend' from his fellow SEALs. In 2009, after four tours of Iraq, Kyle retired. He had not only shot more of the enemy than any other American sniper but had also gained a chestful of medals, including three Silver Stars for gallantry. In February 2013, the sniper was shot dead, alongside a friend, by a soldier they were trying to help who was apparently suffering from severe post-traumatic stress. Despite Moore's condemning tweet, he went on to describe Eastwood as a 'great filmmaker' on his Facebook page, saying that his movie 'Unforgiven' is his favorite Western of all time. However, he later wrote: 'But something started to go haywire with Clint in the last decade.' He then further criticized 'American Sniper' as a'mess of a film that perpetrates a 'racist sentiment to Arabs' Speakers: Sarah Schechter (left), President, Berlanti Productions, and Lori McCreary (right), Co-President, Producers Guild of America, are pictured speaking at the launch at the National Geographic Society on Friday. Following Moore's online rants, Sarah Palin was among many high-profile people to defend 'American Sniper', calling out the director for his 'disrespect' of U.S. troops. Moore won an Oscar in 2002 for his documentary Bowling For Columbine, exploring gun violence in America and the main reasons for the Columbine High School massacre. He is outspoken in his views against firearms and has previously described America's national symbol as the gun, not the bald eagle. During Friday's '6 Certified' launch, representatives from Warner Bros, National Geographic Channels and the Producers Guild of America were in attendance. Chris Marvin, managing director of 'Got Your 6 'and an ex-U.S. Army officer and Blackhawk helicopter pilot, said the campaign does not aim to show veterans in a good light - but in an honest one. 'Most Americans tell us that they only see veterans portrayed as broken or as heroes who walk on water in film and television,' he told the Associated Press via phone. 'We're missing something in the middle. Veterans are everyday people. They're your next door neighbor who helps you bring your garbage cans back when they blow away. 'They're your kids' fifth-grade math teacher. It's the person running for city council. You see them every day in your own life but you don't see them on film or television.' Launched in 2012, the 'Got Your 6' group aimed to enlist Hollywood to help discourage stereotypes and promote more accurate portrayals of the 2.6million soldiers coming home over the past decade. Surveys have found that many Americans presume veterans suffer from post-traumatic stress disorder, are homeless or are addicted to drugs or alcohol. The group has taken lessons from other successful efforts to change national viewpoints, including increasing gay rights, reducing teen pregnancies, encouraging colonoscopies, improving animal rights and reducing drunken driving. It has identified Hollywood as an engine of cultural change. Advocating 'accurate' portrayals of veterans: Courteney Monroe (left), CEO, National Geographic Channels U.S., and Bruce Cohen (right), producer of 'American Beauty' and 'Silver Linings Playbook', are seen at the event. Creator: Charlie Ebersol (pictured), President and CEO of The Company, created the '6 Certified Program' 'This is more of a challenge than anything else. We're challenging the entertainment industry — myself included - to live up to the responsibilities inherent in the powers we have and with the reach that we have,' said Charlie Ebersol, a producer and creator of the '6 Certified' program. Ebersol said films like 1987's 'Full Metal Jacket' by Stanley Kubrick and Clint Eastwood's new 'American Sniper' would likely be eligible for certification because they portray veterans accurately, even if the soldiers in those films aren't representative of the population of veterans. Mrs. Obama cited TV shows including 'Nashville' and 'Doc McStuffins' as ones that share stories of 'our veterans in new and meaningful ways.' During the high-profile event, she said telling veterans' stories honestly makes for 'tremendous TV and movies' and 'are good for business as well.' Director: Despite Moore's condemnation of 'American Sniper', he has described Clint Eastwood (pictured) as a 'great filmmaker' on his Facebook page, saying that his movie 'Unforgiven' is his favorite Western of all time. Ebersol had his own list of shows with positive veteran portrayals, including the Jay Pritchett character in 'Modern Family,' Sam Waterston's portrayal of veteran Charlie Skinner on 'The Newsroom' and Seth Rogen's guest role as a veteran on 'The Mindy Project.' In all of them, being a veteran was not their defining characteristic. 'We have a real opportunity to go way beyond the platitudes of the entertainment industry,' he said. 'We love to say, "I support the troops!" and "I've got a yellow ribbon!" but there's an actual, tangible way to make a difference. That's what the challenge is here.'

Summary: Michelle Obama spoke at launch of '6 Certified' project in Washington D.C. Said she knew 'American Sniper' has been criticized for glorifying murder. But said she felt it 'touches on emotions and experiences' of Army families. Film covers life of late Navy SEAL, Chris Kayle - played by Bradley Cooper. FLOTUS also urged Hollywood to give more accurate portrayal of veterans. Film director Michael Moore among many to condemn Clint Eastwood film. Wrote on Twitter that'snipers aren't heroes' and 'will shoot u in the back'

cnn_dailymail

en

Summarize: This application is a continuation-in-part application to patent application Ser. No. 474,967 titled &#34;Evaporative Waste Disposal Process&#34; filed on Mar. 14, 1983, now abandoned. BACKGROUND OF THE INVENTION The water toilet has been accepted and used as a standard method for disposing of human waste from private dwellings, office and industrial buildings, etc. Certainly the water toilet does the job involving messy material in a neat and clean manner and, consequently, the water toilet has become an indispensible element in the high standard of living in modern society. As the population of the human race grows out of bounds and our life style demands an ever increasing amount of water for use in households and industries, it is becoming more and more clear that water is not the boundless abundant resource that it was before, and there is little doubt that water will become an expensive commodity in the future when there is not enough of it to go around. In average households, about forty five percent of the total amount of the water used daily is wasted to flush the toilet. Firstly, it does not make sense to waste forty five percent of the water used daily by each household to flush out waste while we are talking and worrying about dwindling water resources. Secondly, it is downright unwise to mix a small amount of human waste with large amounts of clean water and then spend a large amount of resources to build a network of sewer pipes and waste treatment plants to separate the clean water from the waste. Thirdly, it is less than intelligent to dump the waste effluent into streams and rivers and, then to argue and worry about polluting natural water resources. The major portion of the water problems confronting us today can be resolved and eliminated by ridding ourselves of the habit of using the water toilet. We have been sophisticated enough to mobilize a vast amount of technology and social resources to cope with the water pollution problems created by our water toilet, yet no one has seriously questioned whether it is necessary to have these problems at all. Indeed, it is a common folly of many experts who try frantically to find an expensive solution to the problem, but fail to examine the rationality of the problem. It should be mentioned that a number of solutions have been addressed to the problem of wasting water and polluting water resources resulting from the use of water toilets. The compost toilet does not use any water. However, it lacks cleanliness and leaves messy end products of compost. It is quite doubtful that the compost toilet will ever be accepted by a civilized society used to the water toilet. The incinerating toilet of present day technology burns off the solid waste as well as the liquid waste and, consequently, does not use any water and leaves no end product. The use of the incinerating toilets in masses is unacceptable because it constitutes a fire hazard in private dwellings, is too energy-intensive and creates a serious problem of air pollution. There are recycling toilets which recycle the water or oil used to flush the toilet. These recycling toilets require an initial capital investment and operating/maintenance costs too high for average households. Furthermore, the recycling toilet does not solve the problem in essence because it leaves messy end products which have to be processed by other means. In conclusion, all of the nonconventional toilet technology available today is not good enough to replace the conventional water toilet. SUMMARY OF THE INVENTION The primary object of the present invention is to provide a toilet that uses little or no water, while still being as clean as the water toilet. Another object of the present invention is to provide a toilet that leaves no end products or an end product that is useful and easy to handle. A further object of the present invention is to provide a preseparating toilet bowl that roughly separates the liquid waste from the solid waste. Yet another object of the present invention is to provide a toilet system including a liquid waste evaporator that evaporates off the liquid waste separated from the solid waste by the preseparating toilet bowl. Yet a further object of the present invention is to provide a toilet system including a solid waste dehydrator that dries the solid waste separated from the liquid waste by the preseparating toilet bowl. Still another object of the present invention is to provide a toilet system including a solid waste incinerator that burns off the solid waste separated from the liquid waste by the preseparating toilet bowl. Still a further object of the present invention is to provide a toilet system including means for dispensing the dehydrated solid waste out of the solid waste dehydrator. These and other objects of the present invention will become clear as the description thereof proceeds. BRIEF DESCRIPTION OF FIGURES The present invention may be described with a greater clarity and specificity by referring to the following figures: FIG. 1 illustrates a schematic drawing of an embodiment of the present invention that operates without electricity. FIG. 2 illustrates a schematic drawing of another embodiment of the present invention that operates without electricity. FIG. 3 illustrates a schematic drawing of a further embodiment of the present invention that operates without electricity. FIG. 4 illustrates a schematic drawing of an embodiment of the present invention that requires a power source such as electricity. FIG. 5 illustrates a cross section of an embodiment of the preseparating toilet bowl of the present invention equipped with a solid waste dehydrator. FIG. 6 illustrates a cross section of another embodiment of the preseparating toilet bowl of the present invention equipped with a solid waste dehydrator. FIG. 7 illustrates a schematic drawing of another embodiment of the present invention that requires a power source such as electricity. FIG. 8 illustrates a cross section of an embodiment of the preseparating toilet bowl of the present invention equipped with a solid waste incinerator. FIG. 9 illustrates a cross section of another embodiment of the preseparating toilet bowl of the present invention equipped with a solid waste incinerator. FIG. 10 illustrates a schematic drawing of a further embodiment of the present invention that requires a power source such as electricity. FIG. 11 shows a process flow diagram of an embodiment of the present invention. FIG. 12 shows a process flow diagram of another embodiment of the present invention. FIG. 13 shows a process flow diagram of a further embodiment of the present invention. FIG. 14 shows a process flow diagram of yet another embodiment of the present invention. DESCRIPTION OF THE PREFERRED EMBODIMENTS In FIG. 1 there is shown a schematic drawing illustrating the arrangement of the elements and the operating principles of an embodiment of the present invention, which embodiment is suitable for installation in an area without electric power such as national parks, rest stations, etc. The principal elements comprising the evaporation toilet system shown in FIG. 1 include a preseparating toilet bowl 1, a liquid waste evaporator 2 and a solid waste dryer 3. The preseparating toilet bowl 1 includes the familar funnel-shaped bowl 4 with a seat and cover and a converging-diverging tubular shell 5 smoothly connected to the bottom 4 of the funnel-shaped toilet bowl 1. A solid waste inlet tube 6 having an inlet opening with a diameter substantially greater than the throat section diameter of the converging-diverging bottom 5 of the toilet bowl 1 is disposed within the diverging end of the toilet bowl bottom 7 in a coaxial arrangement with respect to the toilet bowl. The inlet opening diameter of the solid waste inlet tube 6 is substantially less than the inside diameter of the diverging end of the toilet bowl bottom and, consequently, an annular gap 8 is provided between the inner wall of the diverging end of the toilet bowl bottom and the inlet opening of the solid waste inlet tube. The annular gap 8 terminates to a liquid waste collector pan 9 that collects the liquid waste and empties it to the liquid waste evaporator 2. The solid waste inlet tube 6 is connected to the solid waste dryer 3 wherein an airlock valve or damper disc 10 cuts off the air movement between the solid waste dryer 3 and the toilet bowl 1. The airlock valve or damper disc 10 is mechanically linked to an activating device such as a foot pedal 11 in such a way that it automatically stops at the fully closed position after a one hundred eighty degree rotation on each activation. The solid waste dryer 3 includes a rotary divider 12 having a plurality of compartments. The partitioning walls of the rotary divider 12 includes means such as a plurality of vent holes disposed therethrough for allowing air circulation. The rotary divider 12 is mechanically linked to an activating device such as the foot pedal 11 in such a way that the rotary divider 12 advances by one compartment on each activation. The solid waste dryer 3 includes an air inlet tube 13, an air outlet tube 14 and a solid waste outlet tube 15. The rotary divider 12 lifts up and dumps out the fully or partially dried solid wastes into a solid waste storage bin 16 equipped with a sloping bottom 17 and a mesh screen 18 disposed there-above. The solid waste storage bin 16 includes an air inlet 19, an air outlet 20, a drain pipe 21 and a discharge gate 22. The liquid waste flows from the liquid waste pan 9 into the liquid waste evaporator 2 through a liquid waste pipe 23 and is dumped on the top evaporator tray 24 that is one of a plurality of the evaporator trays 25, 26, etc. substantially horizontally disposed in the liquid waste evaporator in a multilevel arrangement. The liquid waste evaporator 2 includes an air inlet 27 disposed at the lower portion thereof and an air outlet 28 disposed at the upper portion thereof. The air inlet 13 into the solid waste dryer 3 and the air inlet 27 into the liquid waste evaporator 2 may be connected to a device such as a solar collector 29 that heats the air circulated through the liquid waste evaporator 2 and the solid waste dryer 3. The air outlet 14 from the solid waste dryer 3, the air outlet 28 from the liquid waste evaporator 2 and the air outlet 20 from the solid waste storage bin 16 may include fans 30, 31 and 32, respectively, which may be wind powered fans or electric motor driven fans. Two or more air outlets may be merged to a single air duct including a single fan, which arrangement helps to reduce the number of the fans required to operate an evaporation toilet. It should be understood that the throat section of the converging-diverging tubular bottom 5 of the toilet bowl 1 provides a smooth and continuous transition from the converging section to the diverging section. The liquid waste discharged from a person sitting on the toilet bowl 1 lands on the converging wall of the toilet bowl 1 and flows down following the converging-diverging surface of the toilet bowl bottom due to the surface tension of the liquid waste, wherein the liquid waste collected in the liquid waste pan 9 flows into the liquid waste evaporator 2 through the liquid waste pipe 23 by gravity. The liquid waste dumped into the liquid waste evaporator 2 spreads on the top of one or more evaporator trays which produce the air-liquid waste interface of very large area. The air circulated through the liquid waste evaporator 2 naturally or forcibly evaporates the liquid waste into the atmosphere. The residual solid particles deposited on the evaporator trays left out by the evaporating liquid waste should be cleaned out once or twice every year. The solid waste discharged into the toilet bowl 1 from a person sitting on the toilet bowl 1 is funneled through the throat section of the converging-diverging tubular bottom 5 of the toilet bowl 1 and drops into the solid waste inlet tube 6 wherein the solid waste lands on top of the damper disc 10. When activating means such as the foot pedal 11 is pressed by the person using the toilet, the damper disc 10 rotates one hundred eighty degrees and, consequently, the solid waste is dumped into one compartment of the rotary divider 12 located directly under the damper disc 10. The air circulated through the solid waste dryer 3 dehydrates the solid wastes which are stored in the plurality of compartments included in the rotary divider in a distributed manner. The fully or partially dried solid wastes are discharged into the solid waste storage bin 22 through the solid waste outlet tube 15 by the rotating movement of rotary divider 12 that rotates intermitently in a counter clockwise direction in the specific embodiment shown in FIG. 1. The sole object of the rotary divider 12 is to spread out the solid wastes and thus to prevent the piling up of the solid waste. This is necessary to enhance the dehydration of the solid wastes. It is quite obvious that a round rotary table installed under the damper disc 10 in an off set relationship serves the same purpose as the rotary divider, wherein a stationary wiper wiping the rotary table top discharges the dried solid wastes into the solid waste storage bin. The solid waste dumped into the solid waste storage bin 16 is further dried and oxidized by the air percolated therethrough. Any excess liquid waste discharged with the solid waste is automatically drained through the drain pipe 21. The dried solid waste stored in the solid waste storage bin 16 is regularly removed through the discharge gate 22. It is advisable to coat the surfaces in contact with the solid wastes in the preseparating toilet bowl and in the solid waste dryer 3 with a lining such as the teflon coating; whereby, the evaporation toilet can be operated without requiring an excessive amount of cleaning and up-keep. It should be understood that the particular embodiment of the evaporation toilet shown in FIG. 1 is for installation in a remote area without electric power. The embodiment of the evaporation toilet utilizing electric power can be much more sophisticated than the embodiment shown in FIG. 1. In FIG. 2 there is illustrated a schematic drawing showing a preseparating toilet bowl 33 equipped with a solid waste dryer 34 of another embodiment. The preseparating toilet bowl 33 has the same elements and construction as the element 1 in FIG. 1, wherein the solid waste inlet tube 35, including a damper disc 36 is connected to the solid waste dryer 34 that includes a belt conveyer 37 which is intermittently advanced by one of two drum pulleys 38 and 39 mechanically linked to an actuator such as the food pedal 40 that also operates the damper disc 36. The belt conveyer 37 is intermittently rotated in a clockwise direction whenever the foot pedal 40 is pressed down by the user of the toilet, which action spreads the solid wastes from different users of the toilet over the length of the belt conveyer 37 and thus enhances dehydration of the solid wastes. The air circulated through the solid waste dryer enters through an air inlet 41 and leaves through an air outlet 42. The fully or partially dried solid wastes are discharged through a solid waste outlet tube 43 by gravity. A belt wiper 44 keeps the conveyor belt 37 clean. It should be understood that the solid waste dryer 34 and the conveyor belt 37 may be arranged to slope down as shown in FIG. 1 or to slope up or in a substantially horizontal position. It is not difficult to realize that the combination of the separating toilet bowl 32 and the solid waste dryer 34 can replace the corresponding combination shown in FIG. 1 and be connected to the liquid waste evaporator and the solid waste storage bin as illustrated in FIG. 1. In FIG. 3 there is shown a preseparating toilet bowl 45 having the same elements and construction as element 1 shown in FIG. 1, that is connected to a solid waste dryer 46 including a screw conveyer 47, an air inlet 48, an air outlet 49 and a solid waste outlet tube 50. The screw conveyor 47 may be operated by a foot pedal 51 that also operates the damper disc 52 or other actuator means such as electric motor. In FIG. 4 there is shown a schematic drawing illustrating another embodiment of the evaporation toilet of the present invention that is suitable for installation in private dwellings, offices and industrial buildings, etc., where electric power is available. In this embodiment, the preseparating toilet bowl 53 comprising the same elements and construction as the preseparating toilet bowl 1 of FIG. 1 is connected to the liquid waste evaporator 54 having the same elements and construction as the liquid waste evaporator 2 of FIG. 1 by the liquid waste pipe 55. The solid waste inlet tube 56 extending from the bottom of the preseparating toilet bowl 53 includes a damper disc 57 and is connected to the solid waste dryer 58 that includes a pulverizer-blower 59 driven by an electric motor 60. The solid waste dryer 58 further includes heating means 61 such as the electric heating coils or the gas heater or other heat transfer means and is insulated by the insulating material 62 to prevent heat loss during the heat drying cycle. The solid waste outlet tube 63 originating from the solid waste dryer 58 merges with the air outlet tube 64 originating from an air blower 65 that is also driven by the pulverizer-blower motor 60, wherein two merged tubes are connected to the top of the solid waste storage bin 66. The solid waste storage bin 66 includes a discharge gate 67, aerating bottom 68 and a filter 69 connected to the air outlet tube 70 that originates from the upper portion of the solid waste storage bin 66 and is connected to the bottom portion of the liquid waste evaporator 54. A heating means 71 preheating the air entering the liquid waste evaporator 54 is included to provide an additional avenue to enhance the evaporation of the liquid waste. The air outlet tube 72 originating from the upper portion of the liquid waste evaporator 54 includes a filter 73 and a blower 74 driven by an electric motor 75. The air supplied to the inlet 76 of the blower 65 and the inlet 77 of the aerating bottom 68 of the solid waste storage bin 66 may be preheated by a solar collector 78 and controlled by a three-way valve 79. When a user of the toilet activates the actuator operating the damper disc 57, which may be a foot pedal or a switch controlling an electric solenoid that operates the damper disc 57, the solid waste is dumped into the solid waste dryer and the heating means 61 becomes activated. When the solid waste dumped into the solid waste dryer is completely dehydrated by the heat supplied by the heating means 61 that is sensed by a temperature sensor or humidity sensor installed in the solid waste dryer, the electric motor 60 is turned on automatically. The pulverizer-blower 59 breaks down the dried solid wastes and blows out the broken-down solid wastes. The suction effect created by the air stream being discharged from the blower 65 helps to empty the solid waste dryer of the dried solid wastes, which is then transported pneumatically and dumped into the solid waste storage bin 66. The duration of operation of the electric motor 60 driving the pulverizer-blower 59 and the blower 65 should be preset. The solid waste stored in the solid waste storage bin 66 is further dried and oxidized by the aeration resulting from the air circulation provided by the combination of the aerating bottom 68 of the solid waste storage bin 66 and the suction blower 74, which creates air circulation through the solid waste storage bin 66 and the liquid waste evaporator 54. The air circulated through the liquid waste evaporator 54 may be heated by the solar collector 78 or by the heating means 71 disposed at the air inlet to the liquid waste evaporator 54. The liquid waste pipe 55 includes an outlet orifice 80 that limits the air flow therethrough while allowing the uninterrupted flow of the liquid waste. When the blower 74 is turned on by a person about to use the toilet, it causes a small amount of air to be sucked into the toilet that prevents odor from spreading out to the room from the toilet bowl. The duration of the operation of the blower 74 may be pretimed or controlled by a humidity sensor installed in the liquid waste evaporator 54. The three-way valve 79 is used to activate or by-pass the aeration of the solid wastes stored in the solid waste storage bin 66. In FIG. 5 there is illustrated a cross section of the combination of a preseparating toilet 81 and a solid waste dryer 82 having the same construction as that described in conjunction with FIG. 4. The combination shown in FIG. 5 includes a toilet rinsing system comprising a rinse water spray ring 83 for rinsing the toilet bowl 81 and a spray nozzle 84 for rinsing the damper disc after and/or before each use of the toilet. In FIG. 6 there is shown a cross section of the combination of a preseparating toilet bowl 85 and a solid waste dryer 86 having essentially the same construction as that shown in FIG. 5. In this embodiment, the toilet bowl rinsing spray system uses compressed air assisted water jet created by an eductor that creates water sprays energized by compressed for cleaning the toilet bowl. In the particular embodiment shown in FIG. 6, the damper disc 88 is cleaned by the compressed air discharged through the air nozzle 89. Of course, the airwater mixture spray can be used to clean the damper disc 88 by branching off the spray nozzle 89 from a downstream point of the eductor 87. In FIG. 7 there is shown a schematic drawing illustrating another embodiment of the evaporation toilet that utilizes electric power which includes essentially the same elements and arrangements as that shown in FIG. 4 with the following exception: The preseparating toilet bowl 90 includes a spray rinsing system as explained in conjunction with FIGS. 5 and 6. The solid waste outlet tube 91 originating from the solid waste dryer 92 is directly connected to the solid waste storage bin 93 without being merged with the air outlet tube of the blower 94. The air outlet tube 95 from the solid waste storage bin 93 is connected to the air inlet tube 96 of the blower 94 and the air outlet tube 97 of the blower 94 is connected to the lower portion of the liquid waste evaporator 98 wherein a part of the air discharged from the blower 94 is fed back to the solid waste dryer 92 through a valve 99. The liquid waste evaporator 98 includes a wind driven exhaust fan 100 in addition to an electric motor driven fan 101. The air supply to the aerating bottom 102 of the solid waste bin 93 is controlled by a two-way valve 103. The embodiment of the evaporation toilet illustrated in FIG. 7 may operates in two different modes. In the first mode, the pulverizer-blower 104 as well as the air blower 94 is directly driven by an electric motor 105. The pulverizer-blower 104 and the air blower 94 operate only during a cycle emptying the dried solid wastes out of the solid waste dryer 92 that is carried out by the pulverizing and blowing action created by the pulverizer-blower 104 and the suction out of the solid waste dryer 92 created by the air blower 94, in which cycle the valve 99 stays open while the valve 103 stays closed. The air circulation through the solid waste storage bin 93 and the liquid evaporator 98 is provided by the echaust fan 100 or 101. The valve 99 stays closed and the valve 103 stays open when the electric motor 105 is not in operation. In the second mode of operation, the pulverizer-blower 104 is connected to the motor 105 through a clutch, while the air blower 94 is directly connected to the motor 105. During the drying cycle of the solid waste, the clutch driving the pulverizer-blower 104 remains disconnected while the air blower 94 is turned on wherein both valves 99 and 103 stay closed. As a consequence, the air blower 94 creates a partial vacuum in the solid waste dryer 92, which, in combination with the heat supplied by the heating means 106 dehydrates the solid wastes rapidly. The check valve 107 included in the rinse water supply tube is to assist the build up of a partial vacuum in the solid waste dryer 92. When the solid waste is fully dehydrated, the clutch driving the pulverizer-blower 92 is engaged and the valve 99 is opened whereupon the dried solid wastes are pneumatically transported into the solid waste storage bin 93. In both modes of operation, the liquid waste is evaporated into the atmosphere by the air circulated throuth the liquid waste evaporator. In FIG. 8 there is illustrated a cross section of a preseparating toilet bowl 108 combined with a solid waste incinerator 109. The solid waste inlet tube 110 including an air-lock valve or damper disc 111 is connected to the incinerator chamber 109 including a plurality of flame nozzles 112, 113, etc. disposed on the cylindrical wall of the incinerating chamber 109, which also includes an exhaust tube 114 disposed through one end wall of the incinerator chamber 109. The liquid waste separated from the solid waste flows into the liquid waste evaporator connected to the liquid waste pipe 115, while the solid waste accumulated on top of the air-lock valve 111 is dumped into the solid waste incinerator chamber 109 wherein it is burned off and the ashes and gases are exhausted through the exhaust tube 114. The preseparating toilet bowl 108 includes a rinse water spray nozzle 116 installed on the bottom side of the toilet bowl cover. In FIG. 9 there is illustrated a cross section of a preseparating toilet bowl 117 coupled with a solid waste incinerator 118 that includes a plurality of electric heating coils 119. An air inlet 120 and an exhaust tube 121 are connected to two opposite end walls of the incinerating chamber 118, respectively. The incinerating chamber is insulated to prevent the heat loss to the ambient atmosphere. In FIG. 10 there is shown a schematic drawing illustrating a further embodiment of the evaporation toilet which includes essentially the same elements and arrangements as that shown in FIG. 7 with one exception being that a vacuum pump 122 equipped with a filter 123 provides an evacuated state in the solid waste dryer 124 during the heat-vacuum drying cycle of the solid waste. The inlet tube 125 of the vacuum pump 122-filter 123 branches off from the solid waste oulet tube 126 originating from the solid waste dryer 124 and terminating at the solid waste storage bin 127. The solid waste outlet tube 126 includes a flap type check valve 128 disposed at the discharge end thereof, wherein the check valve 128 prevents the back flow from the solid waste storage bin 127 to the solid waste outlet tube 126. The embodiment shown in FIG. 10 operates in the same principles as the first mode of operation of the embodiment shown in FIG. 7 with one exception being that a partial vacuum is created in the solid waste dryer 124 during the solid waste drying cycle by the vacuum pump 122. In FIG. 11 there is shown a process flow diagram illustrating an embodiment of the evaporation toilet system. A preseparating toilet bowl 129 roughly separates the liquid waste from the solid waste wherein the liquid waste is discharged into a liquid waste evaporator 130 while the solid waste is dumped into a solid waste dryer 131. The solid waste is dehydrated in the solid waste dryer by means of heating or partial evacuation or a combination thereof and pulverized dried solid wastes are pneumatically transported into a solid waste storage bin 132. The pulverizing and pneumatic transportation of the dried solid wastes is carried out by the pulverizer-blower installed in the solid waste dryer 131 and an air blower 133. The fully or partially dehydrated solid wastes stored in the solid waste storage bin 132 is further dehydrated and oxidized by aeration provided by air percolated through the solid wastes stored in the solid waste storage bin 132, which is regularly emptied. The liquid waste discharged into the liquid waste evaporator 130 is evaporated into the atmosphere wherein the evaporation process is promoted by a suction fan 134 forcibly circulating air through the liquid waste evaporator 130. The same suction fan 134 also provides air circulation through the solid waste storage bin 132. The air circulated through the liquid waste evaporator 130 as well as through the solid waste storage bin 132 may be preheated by heating means such as a solar collector 135. An air compressor 136 is employed to produce a compressed-air energized water spray that cleans the preseparating toilet bowl. The water is siphoned from a storage tank and mixed with compressed air by an eductor 138. Of course, the toilet bowl may be cleaned by a simple water spray produced by the municipal water supply under pressure. For the detail of the construction of the elements inlcuded in the evaporation toilet system shown in FIG. 11, one may refer to FIGS. 6 and 7. In FIG. 12 there is illustrated a process flow diagram of another evaporation toilet system which is essentially the same as that shown in FIG. 11 with one exception being that a vacuum pump 139 produces a vacuum in the solid waste dryer 140 that accelerates the dehydration process of the solid waste. The vacuum pump 139 may be used as the sole means for drying or in conjunction with other heating means in drying the solid waste. The dried and oxidized solid waste stored in the solid waste storage bin 141 may be bagged for removal or incinerated in an incinerator 142 that may be remotely located or permanently installed in conjunction with the solid waste storage bin 141. For the detail of the construction of the elements included in this process flow diagram, one should see FIG. 10. In FIG. 13, there is shown a process flow diagram showing essentially the same embodiment as that of FIG. 12 with one exception being that a single compressor 143 operating in conjunction with a pair of control valves 144 and 145 provides a partial vacuum in the solid waste dryer during the drying cycle and supplies compressed air to the rinsing spray system during the cleaning cycle. The air circulation through the liquid waste evaporator 147 is provided either by the wind powered exhaust fan 146 or by the air blower 148 driven by an electric motor that also drives the pulverizer-blower installed in the solid waste dryer 149 through a clutch. In FIG. 14 there is shown a process flow diagram of an evaporation-incinerating toilet system. A preseparating toilet bowl 150 that roughly separates the liquid waste and the solid waste from one another discharges the liquid waste into the liquid waste evaporator 151 and dumps the solid waste into the solid waste incinerator 152. The exhaust fan 153 circulates air preheated by a heating means such as a solar collector 154 through the liquid waste evaporator 151 and also assists to suck out ashes and gases from the solid waste incinerator 152. The valve 155 closes during the incinerating cycle. The liquid waste evaporator 151 has essentially the same construction as that shown in FIG. 4 with one exception being the sloping bottom thereof which is for collecting the ashes exhausted from the solid waste incinerator 152. The combination of the preseparating toilet bowl 150 and the solid waste incinerator 152 included in this process flow diagram is further illustrated in FIG. 8 or FIG. 9. The evaporation-incinerating toilet system shown in FIG. 14 provides an overwhelming advantage over the conventional incinerating toilet in view that the former requires much less energy and results in much less air pollution compared with the latter. It should be understood that the heat source preheating the air circulated through the liquid waste evaporator 151 may be exhaust gases from an internal combustion engine or flue gas from a furnace. While the principles of the present invention have now been made clear by the illustrative embodiments, it will be immediately obvious to those skilled in the art that many modifications of the structures, elements, arrangement, proportions and materials which are particularly adapted to a specific working environment and operating condition in the practice of the invention are possible without departing from those principles of the present invention.

Summary: This invention relates to a process for disposing of human waste wherein the liquid waste is evaporated off and the solid waste is dehydrated for easy disposal. A preseparating toilet bowl roughly separates the urinous wastes and the toilet rinse water from the fecal wastes and other solid wastes dumped into the preseparating toilet bowl. The liquid waste separated from the solid waste flows into an evaporator wherein it is evaporated into the atmosphere by means of air currents circulated through the evaporator. The solid waste drops into a dryer or incinerator wherein it is dehydrated by the heat or vacuum drying process, or a combination thereof, or incinerated by an electric heater or gas burner. The dried solid waste may be bagged and used as a fertilizer or it may be taken to a centralized incinerating plant.

big_patent

en

Summarize: By. Associated Press. Trying to appease many angry parishioners, the archbishop of Atlanta said Saturday that he will sell a luxury $2.2 million mansion built using church funds, just three months after he moved in. Archbishop Wilton Gregory announced the decision following a closed-door meeting with members of several church councils at his headquarters north of Atlanta. He publicly apologized Monday for building the Tudor-style residence and will move out in early May. 'I have decided to sell the Habersham property and invest the proceeds from that sale into the needs of the Catholic community,' Gregory told The Associated Press after the meeting. He declined to take questions. Rev. Wilton Gregory, the Archbishop of Atlanta, has apologized for building a $2.2 million mansion for himself, a decision criticized by local Catholics who cited the example of austerity set by the new pope. He will now sell the sprawling house. Controversial: The new $2.2 million mansion that is the residence of Atlanta Archbishop Wilton Gregory stands in the upscale Buckhead neighborhood in Atlanta. Gregory apologized for his spending and will now sell the house. Gregory, who has been criticized for lavish spending of church money, on April 5, 2014, said he has decided to sell the $2.2 million mansion he has been using as his official residence. Money from the sale of the Tudor-style home in an exclusive neighborhood will be used for 'the needs of the Catholic community' Sprawling: A safe room is seen in an original floor plan for the residence of Atlanta Archbishop Wilton Gregory. Interior decorating samples for the residence of Atlanta Archbishop Wilton Gregory is seen inside a conference room during an interview with Gregory on Wednesday, April 2, 2014. He has now promised to sell the house. It was not immediately clear where Gregory will live next. He will not return to his old residence, which was sold for $1.9 million to Christ the King Cathedral. The cathedral plans to expand the archbishop's former home and house its priests there. Gregory said this week that if the church sold the mansion, he would seek to live in a setting more modest than his current mansion or his previous home. A group of Catholics in Gregory's diocese had asked since January that he sell off the more than 6,000-square-foot home in keeping with the tone of austerity set by Pope Francis. Elected last year, Francis said he wants a church for the poor, drives in an economy car and lives in a guestroom instead of a Vatican palace. He has denounced the 'idolatry of money' and warned against "insidious worldliness" within the church. Laura Mullins, one of several Catholics who asked Gregory to sell, praised the archbishop for making a quick decision and ending the controversy. The mansion was made possible by a generous multimillion dollar gift to the archdiocese. 'He is the person we follow locally,' she said. 'He sets the mood. He sets the example for all of us to follow. If he is choosing to use a gift so personally, what does that tell the people sitting in the pews?' Gregory thanked parishioners for raising the issue, and he acknowledged earlier this week the importance of Francis' example. On a mission: Pope Francis has made a point of. living a more humble life than some of his predecessors, and even fired a. German Bishop called the 'Bishop of Bling' Roman Catholic Archbishop of Atlanta Wilton Gregory has apologized for building a $2.2 million mansion to use as his home, a move that made him the object of derision and complaint, and said he will sell it. 'He's called us to live more simply,' Gregory said in an interview Wednesday, prior to announcing the decision to sell the residence. 'He also has encouraged bishops to grow closer to their people, to listen to their people. And that, I take as a pretty serious admonition. I'm disappointed in myself... because in my nine years, I do believe that I've grown very close to the people of the archdiocese. And I think this decision is an aberration rather than a pattern.' Even before the new pope's election, top-ranking Catholics were selling off luxurious homes, most built decades or a century ago by their predecessors seeking to demonstrate the growing clout of the Catholic church. The downsizing by archbishops in Boston and Philadelphia was also symbolically important during a period when church officials were closing parishes, schools and paying big settlements over clergy sex abuse. A generous gift from a wealthy donor in Atlanta made the luxurious residence possible. Joseph Mitchell, the nephew of the author of Gone With The Wind, left an estate worth more than $15 million to the local church when he died in 2011. Mitchell asked in his will that the proceeds be used for 'general religious and charitable purposes'. He also requested that his parish, Christ The King Cathedral, get primary consideration. The archdiocese gave $7.5 million to the cathedral, and cathedral officials bought Gregory's old home. By moving its priests into Gregory's former residence, the cathedral can free up space on its crowded campus. After the sale, Gregory needed a new home. He demolished Mitchell's old home and replaced it with an expansive mansion. It has an upper-level safe room, an eight-burner kitchen stove, an elevator, public and private offices and two dining rooms. Architects initially planned space for a wine room and wanted an antique chandelier in the foyer, though those plans were later dropped

Summary: The 6,000-plus square foot. mansion was built in the exclusive Buckhead neighborhood using money. from an inheritance gifted to the Archdiocese. The gift came from an heir to the Gone With The Wind fortune, and had to be used for'religious or charitable purposes' Archbishop Wilton Gregory has said the home is mainly for entertaining, but he will live wherever parishioners want him to. Following major parishioner blacklash, he has promised to sell the house. Gregory also said he will live in a more modest fashion.

cnn_dailymail

en

Summarize: This collection contains web crawls performed as the post-inauguration crawl for part of the End of Term Web Archive, a collaborative project that aims to preserve the U.S. federal government web presence at each change of administration. Content includes publicly-accessible government websites hosted on.gov,.mil, and relevant non-.gov domains, as well as government social media materials. The web archiving was performed in the Winter of 2016 and Spring of 2017 to capture websites after the January 20, 2017 inauguration. For more information, see. This collection contains web crawls performed as the post-inauguration crawl for part of the End of Term Web Archive, a collaborative project that aims to preserve the U.S. federal government web presence at each change of administration. Content includes publicly-accessible government websites hosted on.gov,.mil, and relevant non-.gov domains, as well as government social media materials. The web archiving was performed in the Winter of 2016 and Spring of 2017 to capture websites after the January 20, 2017 inauguration. For more information, see. More than $1,300 in video game purchases logged on Rep. Duncan Hunter’s campaign expense report are being blamed on a billing dispute. ADVERTISEMENT Earlier this week, the Federal Election Commission sent a letter to the California Republican asking his campaign to explain the numerous payments made to an online video game distribution company, Steam Games. In the congressman's 2015 campaign report, the dozens of charges are listed as a "personal expense - to be paid back." Hunter's chief of staff, Joe Kasper, said Hunter's son mistakenly used his father's campaign credit card to make small payments to Steam Games. After realizing the mistake, Hunter tried to close the account and vowed to pay back those charges. However, dozens of additional unauthorized charges showed up in the two months after the congressman tried to close the account. Kasper said the congressman listed the items on his campaign account while he disputes the charges with his credit card company. The congressman had not planned on paying back the charges until the matter was resolved, but Kasper said the congressman might just end up reimbursing the campaign "to avoid the headache." "The idea that he was buying video games on the campaign knowing that he shouldn't and he was hoping to pull a fast one on the FEC is absurd," Kasper told The Hill. The San Diego Union-Tribune first reported the news. The FEC told Hunter's campaign to respond by next month to clear up the charges. The letter also references a $1,650 payment to "Christian Unified Schools" that is also marked as a "personal expense - to be paid back." The FEC said that the personal use of campaign funds can result in legal action. But it added, "prompt action to obtain reimbursement of the funds in question will be taken into consideration." --This report was updated at 1:54 p.m. The Federal Election Commission is questioning Rep. Duncan Hunter, R-Alpine, for his use of campaign funds to pay for video games on 68 separate occasions — something the congressman is attributing to a mistake by his son, followed by several unauthorized charges. Hunter listed the $1,302 of Steam Games expenses on his campaign finance disclosure for 2015 year-end, with the notation “personal expense — to be paid back.” The expenses run from Oct. 13 through Dec. 16, and no payback is listed during the time period of the report. Hunter’s spokesman, Joe Kasper, said the congressman’s teenage son used his father’s credit card for one game, and then several unauthorized charges resulted after the father tried to close access to the website. Kasper said that Hunter is trying to have the unauthorized charges reversed before repaying his campaign account. “There won’t be any paying anything back there, pending the outcome of the fraud investigation, depending on how long that takes,” Kasper said. Which game do you think Duncan Hunter's campaign funds paid for? Dota 2 14% (99) Counter-Strike: Global Offensive 54% (378) Team Fortress 2 13% (94) Football Manager 2016 8% (54) ARK: Survival Evolved 10% (73) 698 total votes. In a letter dated Monday, an analyst for the election commission asked Hunter’s campaign treasurer to explain the expenses, amend the filing as necessary, and seek reimbursement for the personal expenses. The commission gave Hunter until May 9 to respond. According to the House Ethics Committee website, “Campaign funds are to be used for bona fide campaign or political purposes only. Campaign funds are not to be used to enhance a member’s lifestyle, or to pay a member’s personal obligations... Members have no discretion whatsoever to convert campaign funds to personal use.” Hunter, who recently made news vaping in the House of Representatives, has defended violent video games in the aftermath of mass shootings. Hunter argued in an opinion piece in Politico that regulating video games is not the answer. “The narrative that children and young adults today stare at television and computer screens, developing lethal skills through first-person gaming experiences, disingenuously portrays video games as having a corrosive influence,” Hunter wrote. “The problem with this rationale is that it conveys an image that America’s youth are incapable of discerning right from wrong, which simply is not true.” The FEC also questioned a Sept. 21 payment of $1,650 to Christian Unified Schools of El Cajon as a personal expense to be paid back. Hunter’s spokesman said the donation — allowed under House rules — was mistakenly listed as a personal expense.

Summary: More than $1,300 in video game purchases appearing on US Rep. Duncan Hunter's 2015 campaign report prompted the FEC to send a letter to the California Republican asking for an explanation, the Hill reports. The charges made to Steam Games between Oct. 13 and Dec. 16, which bear the notation "personal expense-to be paid back," are the result of a still-unresolved billing dispute, Duncan's campaign tells the San Diego Union-Tribune. Chief of staff Joe Kasper says Hunter's teenage son accidentally used the congressman's campaign credit card to purchase a game. After that, he says, dozens of unauthorized charges were made on the card. Kasper says Hunter (who recently made headlines for vaping during a hearing) is trying to have the charges reversed before reimbursing the campaign account. The idea that Hunter was illegally buying video games with campaign funds and hoping to get away with it is "absurd," Kasper tells the Hill, adding that Hunter may go ahead and reimburse the campaign "to avoid the headache."

multi_news

en

Summarize: By. Oliver Todd. Follow @@oliver_todd. The threat of national service hanging over Chelsea winger Mohamed Salah's football career has been lifted - after the Egyptian Prime Minister personally cancelled his potential military call-up. Salah's registration to an educational programme allowed him to avoid national service and stay in England was rescinded - leaving the 22-year-old facing the very real problem of having to return home for a period of 12 months to three years. But the former Basel winger has now been given the all-clear to continue his career after high-ranking talks involving Egytian Prime Minister Ibrahim Mahlab, the football website www.kingfut.com said. VIDEO Scroll down to watch some of Salah's best goals. All clear: Mo Salah will not be required to return to Egypt for national service. Talent: Salah could potential have had to leave Chelsea within months of his £11million signing. Mahlab held a meeting with Egypt's national coach Shawky Gharib and their Minister for Higher Education - and after announcing Salah's fate he reportedly said the decision could have been 'threatening' to Egyptian football, according to kingfut.com. Neither Chelsea nor Salah received any official communications informing the player that he would have to return to Egypt although the club are believed to have spoken to their January signing about the issue. National service...of another kind: Salah celebrates a goal for Egypt during the 2012 Olympic Games. Career saver: Egyptian Prime Minister Ibrahim Mahlab personally stepped in to ensure Salah could continue playing. VIDEO Chelsea fear Salah exile. Salah will now travel along with the rest of the Chelsea squad to Austria on Monday to begin their pre season tour, without the threat of a move back to Egypt hanging over his head. The pacy winger has got off to a decent start in London since his £11million move from Basel in January, scoring in games against Arsenal and Stoke at Stamford Bridge. He also scored the equaliser in Chelsea's 3-2 friendly win against AFC Wimbledon on Saturday. Making an impact: Salah also appeared in Chelsea's other pre season game, a 5-0 win away at Wycombe. Two sides: Salah can continue his career for Chelsea, while the news also boosts his national side. Good start: The Egyptian winger reels away after scoring his first goal for the Blues against Arsenal in March

Summary: PM Ibrahim Mahlab decides Salah will not be forced into national service. Salah would have had to return home for between one and three years. Decision gives him the all-clear to continue his football career. Mahlab said the potential call-up was 'threatening' to Egyptian football. Salah and the rest of the Chelsea squad head to Austria on Monday. He scored the equaliser in Chelsea's 3-2 win over AFC Wimbledon.

cnn_dailymail

en

Summarize: By. Chris Greenwood, Crime Reporter. Victim: Chef Henry Stangroom, 21, was stabbed to death by his flatmate Andrew Morris. A brilliant financier killed his girlfriend’s brother after she dumped him and ordered him to delete a sex tape, a court was told. Andrew Morris, 30, fatally stabbed his 21-year-old flatmate Henry Stangroom after spending months in a blur of alcohol and cocaine. The victim’s sister, Michelle, had told him she would not see him again unless he returned to his £120,000-a-year job, the Old Bailey heard. The actuary had gone on sick leave for five months after suffering panic attacks during a £200million deal with finance giant Goldman Sachs. She also ordered him to destroy a sex tape they had made on his mobile phone during a visit to the flat he shared with her brother in Battersea, South West London. She was worried after a friend had been involved in a scandal involving England rugby player James Haskell, in which a couple were filmed secretly. Highly-qualified Morris, who worked as a risk assessor handling huge business deals, killed Mr Stangroom three days later. The young successful chef, who worked at the Criterion, in Piccadilly Circus, was stabbed repeatedly in the heart, lungs and head. Morris was later found in the bathroom after attempting suicide, with wounds to both wrists and a harpoon spear in his neck. He admits killing his friend, but claims he was mentally ill at the time after suffering from severe depression and the impact of his drug and alcohol abuse. Miss Stangroom had moved out of the flat she shared with Morris and her brother six weeks before the attack. Sister: Michelle Stangroom had ordered Morris to destroy a sex tape they had made on his mobile phone, the Old Bailey heard. Morris said she told him she was concerned a tape they had made could cause similar problems as it did for Mr Haskell, former captain of the England under 18s. The rugby player was suspended from Wellington College after one of his friend’s was filmed having sex with his girlfriend on a camera planted in a dormitory cupboard. ‘She asked me to dispose of similar material we had made,’ Morris told the court. It was a tape. It was made on my mobile phone. ‘She said her friend had got into hot water making a similar tape with this England rugby player.’ Later, Morris sobbed as he claimed a furious row was behind the killing. He said he stabbed Mr Stangroom while defending himself after taunting him over a fatal road tragedy some time earlier. Fear: Miss Morris was worried after a friend had been involved in a scandal involving England rugby player James Haskell, in which a couple were filmed secretly. Mr Stangroom had killed 19-year-old Jack Bland as he drove to his family home in Odiham, Hampshire, after a wedding reception. The chef assumed he had hit a deer and drove on with a smashed windscreen. He was later given a suspended sentence for dangerous driving. Morris said the victim told him he would not let him ruin his sister’s life as they argued and stalked each other around the flat. He told the jury: ‘I said it wasn’t me who ruined lives, it was him. I was referring to the accident he had. I went into the kitchen. I got hit on the back of the head.’ 'As he came towards me I put the knife up in front of me and pushed it towards him. I wanted him to stop stabbing at me' Andrew Morris. Morris then claimed the victim lashed out with a knife, inflicting a cut on his arm as he ran to the bedroom to get help. ‘It was my fault. I said some things that I shouldn’t have said. I probably said the most hurtful thing I could ever have said to him,’ Morris said. He grabbed the spear gun before the pair grappled again and Morris said he picked up a second knife to defend himself. ‘As he came towards me I put the knife up in front of me and pushed it towards him. I wanted him to stop stabbing at me,’ he said. It was then that the chef was fatally injured, said Morris, and he claims to have tried to stop the bleeding as he gave his friend mouth-to-mouth resuscitation. Morris said he intended to kill himself by slashing his wrists, but simply ended up sitting in the hot water for two hours. He then put the spear gun under his chin and used his toe to fire it. However, it did not inflict a fatal wound and he was later found by paramedics. Tragedy: The young successful chef, who worked at the Criterion, in Piccadilly Circus, was stabbed repeatedly in the heart, lungs and head. The jury has heard how Morris’ life spiralled into depression after he went on sick leave from his job in the City. The father-of-one became a recluse, spending months inside his flat drinking up to two bottles of wine a day, inhaling nitrous oxide and snorting cocaine. Morris gradually spent all his money and in the end could not afford to pay his bills and his credit was so bad he was refused a pay-day loan. He attempted suicide several times and once slashed his wrists and sat in the bath fully clothed while his brother and best friend were in the flat. In the weeks before the killing he Googled ‘murder mental illness’ and ‘sentence for murder in UK’ but told the jury they were linked to a TV show he was watching. Morris, of St Neots, Cambridgeshire, denies murder. The trial continues. Sorry we are not currently accepting comments on this article

Summary: Andrew Morris fatally stabbed his 21-year-old flatmate Henry Stangroom. Victim's sister Michelle told him she would not see him again unless he returned to his £120,000-a-year job, court told. Actuary was on sick leave after suffering panic attacks during £200m deal. She ordered him to destroy a sex tape couple had made on their phone. Three days later, Morris killed chef Mr Stangroom, Old Bailey hears.

cnn_dailymail

en