Datasets:

anumafzal94

/

pubmed_full_finetuning

like 0

You are an expert at summarizing long articles. Proceed to summarize the following text: when it comes to drug therapy , intensivists have plenty of decision making every day including drug selection , dosing , administration , and monitoring strategies to optimize effective pharmacotherapy . even though the patient receives appropriate drug , a suboptimal dose or overdosing may result in either therapeutic failure or drug toxicity . the concept of having a clinical pharmacist in an intensivist - led multidisciplinary team evolved in the early 1980s in usa . plenty of studies revealed critical care pharmacist involved in a multi - professional healthcare team had constructive impact on the outcome of critically ill patients . in the modern day intensive care unit ( icu ) , the skills of a clinical pharmacist are characterized as a responsible caregiver , educator , researcher , and manager . critical care pharmacist addresses adverse drug events ( ades ) caused due to drug - related problems and medication errors . many prospective , controlled trials reveal significantly lower rates of ades and lesser days of hospitalization when a clinical pharmacist is integrated into an intensive care healthcare team . a study demonstrated reduction in rate of prescribing errors and preventable ades by 66% from 10.4 to 3.5 per 1000 patient days after clinical pharmacist intervention . this study was conducted to assess the impact and effectiveness of having a clinical pharmacist in an icu . this study aims to evaluate the clinical pharmacist interventions with a focus on optimizing the quality of pharmacotherapy and patient safety . even though the contribution of critical care pharmacist to improve the quality of patient care is accepted worldwide , many icus have not recognized this important reserve . this paper may be used to educate other healthcare professionals and administrators on impact of clinical pharmacist in the care of critically ill patients . the prospective , observational study was carried out in the medical , surgical / trauma icu and a high dependency unit at a 750-bedded tertiary care hospital . the icus in the study were under the supervision of a clinical pharmacist exclusively for the critical care areas . the study was carried over a period of 1 year from january 1 , 2013 , to december 31 , 2013 . all detected drug - related problems ( drps ) and interventions were categorized based on the pharmaceutical care network europe ( pcne ) system with minor changes according to the applicability in the hospital setting . critical care clinical pharmacy services in our hospital include active participation in physician rounds and review of treatment chart for appropriate indications , drug dosing , dosage form , drug duplication , drug interactions , and drug allergies . critical care pharmacist plays an important role in identifying , reporting , investigating , and preventing all types of medication errors and adverse drug reactions ( adrs ) . other interventions include correction and clarification of physician orders , providing drug and poison information , and recommending an alternative therapy . clinical pharmacist adjusts dose of drugs in pediatric , geriatric , renal , and hepatic failure patients . pharmacist also involved in optimizing antibiotic usage based on patient characteristics , site of infection , pharmacokinetics , dose adjustment , and de - escalation . clinical pharmacist also contributes in continuing education activities through teaching programs for doctors and nurses . this increases direct patient care practice abilities , creates awareness among intensive care team , and prevents medication errors . data collection was done by the clinical pharmacist on a daily basis and discussed with the icu chief at the monthly meeting . data analysis and results were presented as percentage and numerically coded for the ease of descriptive statistics using spss software version 20.0 by spss inc . , during the study period , average monthly census of 1032 patients got treated in all three icus . a total of 986 pharmaceutical interventions due to drug - related problems were documented , of which medication errors accounted for 42.6% ( n = 420 ) followed by 152 ( 15.4% ) drug of choice problem . manifested or potential drug - drug interactions were 149 ( 15.1% ) followed by 135 ( 13.7% ) y - site drug incompatibility , 47 ( 4.8% ) drug dosing problem , 45 ( 4.6% ) drug duplication , and 38 ( 3.8% ) adrs . all the 986 drug - related problems detected by the clinical pharmacist were categorized based on the pcne classification and percentage calculated . in table 1 , 29 ( 2.9% ) of the adrs identified were mainly due to antibiotics which included hypersensitivity reactions , thrombocytopenia , and interstitial nephritis while the other drugs were responsible for electrolyte imbalance , hyperthermia , and nephrotoxicity . thirty ( 3% ) serious and 17 ( 1.7% ) significant drug - drug interactions required clinical pharmacist intervention ; for which either the offending drug was stopped , dose was reduced , or an alternative drug was prescribed . remaining 102 ( 10.4% ) serious and significant drug - drug interactions were closely monitored for any potential manifestation . a total of 135 y - site drug incompatibilities were detected , of which 8 ( 0.8% ) were visible incompatibilities [ figure 1 ] . clinical pharmacist detected drug- related problems visible y - site drug incompatibility reported in our intensive care unit between cefepime and vancomycin the next most commonly addressed problems were related to drug of choice . seventy - eight ( 8% ) observations in this group to study were due to inappropriate drug or dosage form followed by drug use without clear indication and contraindication of the drug . drug duplication ( drugs of same therapeutic group or with same active ingredient ) identified by the clinical pharmacist was common with anti - hypertensives and proton pump inhibitors . drug dosing problems were next on the list with 35 ( 3.6% ) problems due to drug dose too low or too high and 12 ( 1.2% ) problems due to shorter or longer duration of treatment . in table 1 , 42.6% drug - related problems in our study accounted for medication errors . all medication errors were categorized based on the pcne classification and were within the benchmarks . in table 2 , clinical pharmacist interventions for drug - related problems were categorized based on the pcne classification . a total of 1182 interventions were made by the clinical pharmacist for drug - related problems . most of the interventions took place at the drug level which was propositions for modification in therapy . drug dosing adjustments done by the clinical pharmacist included 140 ( 11.9% ) renal dose adjustment , 62 ( 5.2% ) hepatic dose adjustment , and 17 ( 1.4% ) pediatric dose adjustment . glycemic control in the icu was also under the supervision of the clinical pharmacist which included 104 ( 8.8% ) insulin dosing modifications . remaining interventions at drug level included 64 ( 5.4% ) drug stopped or new drug started , 34 ( 2.9% ) instruction for drug use changed , and 28 ( 2.4% ) drug changed and alternatively used . interventions at the prescriber level comprised prescriber seeking clarification or drug information which was 10.4% ( n = 120 ) , and information given to prescriber without seeking clarification was 6.3% ( n = 75 ) . about 94.8% ( n = 1121 ) was the acceptance rate for the propositions put forward to the clinician and remaining 5.2% ( n = 61 ) were rejected . clinical pharmacist interventions for drug - related problems in table 3 , a total of 577 clinical pharmacists answered drug and poison information queries were listed . majority of the drug information queries regarded drug dosing , indication , and guidelines , which was 34.1% ( n = 197 ) . poison queries included 47 ( 8.1% ) toxicokinetics , followed by management of poisoning and identification of the poison content . a critically ill patient is reviewed and treated by physicians from different specialties ; hence , polypharmacy is a very common practice in this setting . we presume that medication errors include most commonly transcribing and administration errors which occur at the level of nurses . indeed , prescribing errors and errors in drug application which occur at the level of the prescriber is often neglected . it is important to have a clinical pharmacist to review the treatment charts to rectify these issues . numerous published studies show the importance of clinical pharmacist intervention and active participation in multidisciplinary patient care rounds having significantly better patient outcome through quality patient care . interestingly , during the study period , 38 adrs were reported , and few of them were rare presentations . these results also coincided with a study by leape who concluded that the participation of clinical pharmacist in medical rounds improved adr reporting and reduced the rate of preventable ades . many studies from the critical care areas show significant evidence favoring better reporting and prevention of ades in the presence of clinical pharmacist . the acceptance of the clinical pharmacist 's interventions in our study was 94.8% which was well in accordance with other published data , where the acceptance rate ranges from 85.5% to 99% . critically ill patients are at risk of drug interactions due to the complexity in pharmacotherapy and use of different drug combinations . a study by reis evaluated the prevalence of potential drug interaction and its clinical significance in critically ill patients . the current study managed to contribute substantial information to the physicians regarding the manifested or potential drug interactions in the critical care unit . this included clinical pharmacist interventions due to drug interaction or the need for monitoring the patient . while most articles focus on drug interactions in critical care , drug incompatibility is also considered likely to harm the patients . as a result of incompatibility , the drug either loses its efficacy or precipitates . about 3.618.6% of incompatible drug combinations we have also documented 135 y - site drug incompatibilities which included eight visible incompatibilities . streamlining , dose optimization , and de - escalation of antibiotics in the presence of a clinical pharmacist are already proven and recommended to enhance antibiotic stewardship . in our study , clinical pharmacist interventions were effective in rationalizing use of antibiotics , especially in optimizing the dose . plenty of studies have proven reduced incidence of medication errors when pharmacist actively participates in multidisciplinary rounds . in this study , clinical pharmacist not only detected medication errors but also prevented and investigated all types of medication errors . a national survey by maclaren et al . from over 260 hospitals , compared clinical and outcome data with the clinical pharmacy services in the icu . they reported significant impact in terms of mortality , length of stay , and cost benefits in the presence of critical care pharmacist . parallel studies from maclaren and bond using the same data claimed statistically significant clinical and economical outcome associated with thromboembolic or infarct - related events ( tie ) in the presence of a clinical pharmacist . desirable activities of critical care pharmacist also include formulating guidelines for the critically ill patients , active participation in research , and educating the icu team . guidelines which have been developed and implemented by the clinical pharmacist in our icu includes protocols for pain , sedation , delirium , glycemic control , stress ulcer prophylaxis , deep vein thrombosis prophylaxis , y - site drug compatibility chart [ figure 2 ] , drug administration , dilution guidelines , and toxicological management protocols . once the protocols are formulated , all the members of the icu team are educated on how to use the protocol . most of these clinical pharmacist enforced protocols are nurse oriented , and hence , it becomes easy for optimizing patient care . the effectiveness of these guidelines is under the supervision of a critical care pharmacist , and it is well studied in western countries . y - site drug compatibility chart prepared for most commonly used intravenous drugs in intensive care unit though our study did not aim to show the economic benefit of clinical pharmacy services , it has definitely reduced drug costs and other treatment costs . drug cost reduction and treatment cost savings as a result of clinical pharmacist interventions have been assessed and proved in various other studies . clinical pharmacist as a part of multidisciplinary team in an icu was associated with a substantially lower rate of adverse drug event caused by medication errors , drug interactions , and drug incompatibilities . clinical pharmacists are essential to improve patient safety and outcome , reduce costs , and provide quality of care in critically ill patients .

background and objectives : a critically ill patient is treated and reviewed by physicians from different specialties ; hence , polypharmacy is a very common . this study was conducted to assess the impact and effectiveness of having a clinical pharmacist in an indian intensive care unit ( icu ) . it also evaluates the clinical pharmacist interventions with a focus on optimizing the quality of pharmacotherapy and patient safety.materials and methods : the prospective , observational study was carried out in medical and surgical / trauma icu over a period of 1 year . all detected drug - related problems and interventions were categorized based on the pharmaceutical care network europe system.results:during the study period , average monthly census of 1032 patients got treated in the icus . a total of 986 pharmaceutical interventions due to drug - related problems were documented , whereof medication errors accounted for 42.6% ( n = 420 ) , drug of choice problem 15.4% ( n = 152 ) , drug - drug interactions were 15.1% ( n = 149 ) , y - site drug incompatibility was 13.7% ( n = 135 ) , drug dosing problems were 4.8% ( n = 47 ) , drug duplications reported were 4.6% ( n = 45 ) , and adverse drug reactions documented were 3.8% ( n = 38 ) . drug dosing adjustment done by the clinical pharmacist included 140 ( 11.9% ) renal dose , 62 ( 5.2% ) hepatic dose , 17 ( 1.4% ) pediatric dose , and 104 ( 8.8% ) insulin dosing modifications . a total of 577 drug and poison information queries were answered by the clinical pharmacist.conclusion:clinical pharmacist as a part of multidisciplinary team in our study was associated with a substantially lower rate of adverse drug event caused by medication errors , drug interactions , and drug incompatibilities .

You are an expert at summarizing long articles. Proceed to summarize the following text: toxocara vitulorum is an intestinal ascarid parasite of cattle and water buffaloes ( bubalus bubalis ) . although the parasite may occur worldwide , it is of particular economic importance in tropical and subtropical regions , mainly due to lacking or inefficient control . t. vitulorum causes morbidity and mortality in calves , which typically become infected early post - partum by ingesting larvae excreted in the colostrum and milk . after a prepatent period of 3 - 4 weeks , the ingested larvae have matured to adult worms in the calf s duodenum that produce a large number of eggs , during a patent period of about 4 weeks . at the age of 8 weeks , most infected calves are able to clear the parasite due to strengthened and acquired immunity . cambodia , a southeast asian country , has a tropical climate characterized by distinct rainy and dry seasons . agriculture is the major work sector in cambodia , and within this sector , livestock is the third largest subsector , behind crop production and fisheries . cattle ( mainly bos indicus ) and water buffaloes ( bubalus bubalis ) provide draught power , manure used as fertilizer or biogas , and increasingly , animal protein and income from trade . nevertheless , the ruminant sector is characterized by smallholder farmers rearing limited numbers of animals in traditional production systems . as a result , the animals are highly susceptible to endemic diseases , including t. vitulorum and other gastrointestinal parasites , resulting in substandard agricultural output . the aim of this study was to investigate the prevalence and associated risk factors of t. vitulorum infection in buffalo and cattle calves in cambodia . the study was conducted in 3 provinces , i.e. , pursat , kampong chnnang , and kampong cham , located in central cambodia from june till october 2011 . in each province , the age of the animals was registered as either 28 days , 28 - 56 days , or > 56 days . each fecal sample was examined for the presence of eggs of t. vitulorum and strongyle eggs and eimeria spp . oocysts by the mcmaster technique with a sensitivity of 50 eggs per gram of feces ( epg ) . the consistency of the fecal sample was scored as being either normal , or soft , or watery . t. vitulorum prevalence and corresponding exact 95% confidence intervals ( ci ) were calculated for the entire sample and for the different provinces , species , age groups , fecal consistencies , and co - infection categories . additionally , the results of the t. vitulorum fecal egg counts were summarized by their arithmetic mean and sd . association of t. vitulorum prevalence with species , age group , fecal consistency , and co - infection category was assessed with a generalized linear mixed model for binary data , using adaptive gaussian quadrature with 25 quadrature points . a final multivariable model was obtained through a backwards selection procedure , at a significance level for removal of 5% . the study was conducted in 3 provinces , i.e. , pursat , kampong chnnang , and kampong cham , located in central cambodia from june till october 2011 . in each province , the age of the animals was registered as either 28 days , 28 - 56 days , or > 56 days . each fecal sample was examined for the presence of eggs of t. vitulorum and strongyle eggs and eimeria spp . oocysts by the mcmaster technique with a sensitivity of 50 eggs per gram of feces ( epg ) . the consistency of the fecal sample was scored as being either normal , or soft , or watery . t. vitulorum prevalence and corresponding exact 95% confidence intervals ( ci ) were calculated for the entire sample and for the different provinces , species , age groups , fecal consistencies , and co - infection categories . additionally , the results of the t. vitulorum fecal egg counts were summarized by their arithmetic mean and sd . association of t. vitulorum prevalence with species , age group , fecal consistency , and co - infection category was assessed with a generalized linear mixed model for binary data , using adaptive gaussian quadrature with 25 quadrature points . a final multivariable model was obtained through a backwards selection procedure , at a significance level for removal of 5% . a total of 517 animals were subjected in this study . of these , 64 were found to excrete t. vitulorum eggs in their feces ( 12.4% ; 95% exact ci : 9.7 - 15.5 ) . the mean fecal egg count was 2,798 epg ( sd=16,351 ; range=0 - 224,400 ) . table 1 shows descriptive statistics by the province , species , age group , fecal consistency , and co - infection category . the final multivariable generalized linear mixed model showed a higher odds of t. vitulorum infection for buffalo versus cattle , for animals aged 4 - 8 weeks versus younger and older ones , and for animals with strongyle infection ( table 2 ) . to our knowledge , this is the first report on t. vitulorum infections in buffalo and cattle calves from cambodia . compared to those countries , the prevalence observed in our study is relatively low ( 12.4% ) . in thailand , srikitjakarn et al . found a t. vitulorum prevalence of 58% in calves during their first 3 months of life . more recently , holland et al . observed a prevalence of 8% in vietnamese calves aged 1 - 2 months , and rast et al . found a prevalence of 22.6% in buffalo and cattle calves aged <3 months in northern lao pdr . in our study , the main risk factors for t. vitulorum infection appeared to be host species and , not surprisingly , age . the apparent association with strongyle prevalence might be explained as an artefact due to the collinearity between strongyle infection and age ( results not shown ) . indeed , strongyle infections tend to be more common in older animals . roberts reported clinical signs in toxocariasis , especially in buffalo calves . they included , poor hair coat , eczema , stools resembling white scour and having a foul smell , inappetency with intermittent colic and bloat . more recent literature reports that calves with toxocariasis could have either pale colored or black diarrhea , or could be asymptomatic . in our study further studies are needed to determine the contribution of t. vitulorum towards the overall clinical impact of disorders in calves of less than 3 months . in conclusion , t. vitulorum is important in cambodia , especially in buffalo cattle and animals between 4 - 8 weeks of age . farmers should be aware of the potential impact of this parasite , and treat their animals appropriately . anthelmintic treatment with either pyrantel or benzimidazoles at the age of 2 - 3 weeks has proved to be very effective in eliminating t. vitulorum both in cattle and buffalo calves in cambodia ( data not shown ) and should be recommended to livestock owners in order to prevent potential pathologies caused by this parasite .

the prevalence and associated risk factors of toxocara vitulorum infection in buffalo and cattle calves was studied in 3 provinces in central cambodia . fecal samples were collected from 517 calves between the age of 1 - 15 weeks and processed for nematode egg counts by a modified mcmaster method . a total of 64 calves were found to excrete t. vitulorum eggs in their feces ( 12.4% ; 95% exact ci : 9.7 - 15.5 ) . the mean fecal egg count was 2,798 epg ( sd=16,351 ; range=0 - 224,400 ) . a multivariable generalized linear mixed model showed higher odds of t. vitulorum infection for buffalo versus cattle , for animals aged 4 - 8 weeks versus younger and older ones , and for animals with strongyle infection . there was no association with fecal consistency . farmers should be aware of the potential impact of t. vitulorum , and treat their calves at the age of 2 - 3 weeks with anthelmintics such as benzimidazoles or pyrantel .

You are an expert at summarizing long articles. Proceed to summarize the following text: the incidence of malignant tumours , particularly epithelial , increases with age , and consequently most cases are observed between 50 and 60 years of age . however , some solid tumours are likely to appear in the reproductive age , and thus it is possible that they will occur during pregnancy . the coexistence of cancer and pregnancy can delay making a diagnosis , especially for those with breast cancer . it is more difficult to assess the effect of pregnancy on prognosis in malignant tumours malignant tumours in pregnant women are very rare , but they are a serious problem women are increasingly postponing the decision about motherhood ( the age of primapara in europe increased in the last decade by two years on average ) , so we should expect a growing number of such cases during pregnancy . diagnostic and therapeutic procedures should be carried out carefully , taking into account the risk factors associated with both woman and foetus . the optimal management should include the proper assessment of oncological and obstetric risk , clear decision - making process both for the patient and for the child , the appropriate treatment , and careful observation after its completion , based on close interdisciplinary collaboration between an oncologist , obstetrician , and neonatologist . the treatment of gynaecologic cancers complicating pregnancy entails the need to consider the maintenance of pregnancy but also the potential loss of the ability to reproduce as a result of the conducted therapy . the retrospective data took into account both invasive and pre - invasive cancers , and in other cases also cancers diagnosed after birth . undoubtedly , it is the most common cancer in pregnancy among all gynaecological malignant growths [ 35 ] . pregnancy does not have a negative impact on prognosis and the therapeutic outcomes are the same as in non - pregnant women [ 3 , 5 ] . screening for cervical cancer is an important part of prenatal care . many guidelines recommend performing the papanicolaou ( pap ) test in all women at the moment of diagnosing pregnancy , although its interpretation during pregnancy can be difficult due to frequent erosions , inflammations , and the presence of decidual cells , which might be confused with atypia ( the so - called arias - stella reaction ) . generally , the test has the same importance as in patients who are not pregnant . after finding the abnormal result of the pap test the changes of low degree regress in about 60% cases and remain unchanged in about 30% . the progression to more advanced changes ( cin3 ) is rare and occurs in a maximum of 6% of patients . in disorders of high degree , such as cin3 if there is no evidence of invasion , no treatment should be implemented during pregnancy and the entire therapy can be postponed until after the birth . in patients with no invasive changes , monitoring is recommended using colposcopy performed in each trimester with repeated biopsy in cases suspected of progression [ 3 , 5 ] . the indications for conisation in pregnancy are more limited , due to the risk of severe complications of surgery such as bleeding ( including death ) in up to 15% of patients , miscarriage , premature labour , or premature rupture of membranes . this risk increases with the advancement of gestation , thus if there is a suspicion of micro - invasive or invasive changes , conisation or excision of the changes using a large diathermy loop should be carried out in early pregnancy . the choice of therapeutic method depends on the dimensions of the cervix , the preferences of the gynaecologist , and the expected progression of pathology . the choice of treatment must always be discussed with the patient and should be consistent with the patient 's beliefs . the management in the case of invasive cervical cancer depends on : 1 ) the size of tumour , 2 ) the state of the lymph nodes , 3 ) the stage of pregnancy , and 4 ) the histological subtype . the basic histological subtypes , i.e. squamous cell carcinoma , adenocarcinoma , and glandular - squamous carcinoma , have similar prognosis and should be similarly treated , as opposed to the more rare and poor prognosis type , i.e. small cell carcinoma . in the latter case it is necessary if possible to terminate pregnancy and the patient should be immediately subjected to the optimal therapy . in the past , abortion and radical therapy of cancer was the treatment of choice in the case of cervical cancer in the first and second trimester of pregnancy . at present , the aim is to maintain pregnancy , particularly in patients with the disease at an early stage , without lymph node involvement . staging , including the status of regional lymph nodes , must be properly carried out . magnetic resonance imaging ( mri ) is the best imaging technique for this purpose , which can be performed without contrast in the evaluation of cervical cancer [ 36 ] . in all the cases , the examination was conducted before conisation using the camera 1.5-t . the patients were examined in the supine position and did not receive any contrast agent . two radiologists evaluated the following : the local condition ( parametritis , uterus , bladder , and rectum ) , the visibility of changes , the size of changes , and the intensity of signal compared to the uterine and cervical muscles as well as the lymph nodes of the abdomen and pelvis . in addition , the test took into account imagining problems caused by the movements of the foetus . after determining the degree of progression , making therapeutic decisions , and implementing the treatment , the control mri examinations were repeated every four weeks until the 30 week of gestation [ 3 , 7 ] . the guidelines of the european symposium on urogenital radiology state that it is possible to provide a contrast agent ( gadolinium derivative ) in a pregnant woman , which can improve the visualisation of small lesions in mri . the most up - to - date guidelines describe the gadolinium as possible to use only if it is absolutely essential [ 6 , 7 ] . the features of cervical cancer in mri during pregnancy are similar to those found in patients who are not pregnant . however , we ought to remember that in non - pregnant women , cervical tumours are usually hyperintense compared to the muscles of the uterus , while in pregnancy the normal cervix can be hyperintense , causing the tumour to look isointense or even hypointense . in all of the described cases , mri had a significant impact on the therapeutic decisions [ 3 , 7 ] . the pet - ct examination , which is used to assess the extent of lesions in locally advanced cervical carcinoma , is contraindicated in pregnancy . this is firstly due to the exposure to a high dose of ionising radiation ( ct ) and because of the higher uptake of the radionuclide in the liver of the foetus with a longer retention than in the maternal liver ( pet ) . this was demonstrated in animal studies ( pregnant monkeys ) [ 3 , 5 , 8 ] . histopathological evaluation of the lymph nodes remains the gold standard in the assessment of regional lymph nodes . the involvement of lymph nodes affects therapeutic decisions and can change the course of pregnancy [ 3 , 4 ] . the society of american gastrointestinal and endoscopic surgeons ( sages ) has developed guidelines describing laparoscopic procedures in pregnant women . pelvic lymphadenectomy is a valid diagnostic procedure in the first and second trimester of pregnancy in patients with early cervical cancer . the rate of involved pelvic lymph nodes is comparable to that seen in non - pregnant women at the same level of progression . the histological evaluation of the lymph nodes collected from pregnant patients should be carried out by a qualified and experienced pathologist because some of the changes in the pelvic lymph nodes associated with the development of decidua can mimic metastasis to the lymph nodes , especially in squamous cell carcinomas . the immunohistochemistry test ( with the assessment of cytokeratins ) allows the disease to be distinguished from physiological changes occurring during pregnancy . sentinel node detection using radiocolloid is not recommended in pregnant women with cervical cancer , although some researchers believe that this procedure is technically feasible in this group of patients [ 3 , 4 , 9 ] . approximately 70% of cervical cancers coexisting with pregnancy are detected at stage i according to figo . at this stage , if there are no metastases to the lymph nodes , there are two possible methods of management : 1 ) close clinical observation ( in order to rule out tumour progression ) and the postponement of treatment until maturity of the foetus ; then the treatment is implemented after birth , 2 ) sparing surgical treatment of cervical tumour to preserve the uterus and pregnancy . at stage ia , the first method of treatment is associated with a very good prognosis . in this stage conisation alone the laparoscopic evaluation of the lymph node status is probably the best criterion for proceeding at stages ib1 in the case of negative lymph nodes , patients with tumours smaller than 2 cm may be subjected to careful observation and implementation of treatment after birth ; either simple trachelectomy or large conisation should be considered [ 35 ] . in locally advanced cervical cancer , a decision is taken about neoadjuvant chemotherapy or chemoradiotherapy . in pregnant women , the choice of this therapeutic method entails the need to terminate pregnancy prior to the implementation of therapy . in exceptional cases , where surgical abortion is not feasible ( e.g. due to the large mass of cervical tumour ) , radiation therapy can be started during pregnancy . neoadjuvant chemotherapy ( nact ) alone and the maintenance of pregnancy is an alternative to the combined treatment ; in such cases , surgical treatment ( or chemoradiation ) is implemented after birth . in stage ib2 and higher most women described to date have been treated with cisplatin and paclitaxel ( 175 mg / m ) . cisplatin may be administered every seven days at a dose of 2050 mg / m or every 21 days at a dose of 50100 mg / m ( usually 75 mg / m ) the second scheme is currently considered the standard for the treatment in pregnancy . there are also several reports on alternative using carboplatin ( auc 57.5 ) , which may be an option to reduce nephrotoxicity , especially in patients with a positive history of pre - eclampsia [ 3 , 5 , 6 , 9 ] . the patient should be presented with all therapeutic options , be aware of the risks , and take an active part in the final decision - making . most of the changes detected in imaging studies during pregnancy in the uterus or ovaries are benign and are usually detected at a routine ultrasound check - up during the pregnancy observation [ 3 , 5 , 6 , 10 , 11 ] . sometimes these changes manifest themselves suddenly , giving symptoms of acute abdomen in the course of ovarian torsion , rupture or intraperitoneal bleeding [ 3 , 5 ] . diagnosis and treatment of a pathological mass found in the appendages depend on the radiological image . there are different scales and ultrasound evaluation systems of pathological lesions , but it is not certain whether their value is the same as in pregnancy practice . a suspicion of malignant nature of the change is based upon : the size ( the changes measuring 5 cm and more require surgical intervention ) , morphological assessment of the tumour , and the presence of changes outside the ovary . it may be useful to use the colour - doppler imaging technique in order to obtain a picture of the blood vessels and thus improve the quality of ultrasound [ 36 , 10 ] . computed tomography of the pelvis is contraindicated because of the high levels of ionising radiation and the associated risk to the foetus . magnetic resonance imaging is preferred to accurately assess the pelvis during pregnancy [ 3 , 4 , 6 , 8 , 10 ] . in the case of ovarian cancer , however , one must remember that during pregnancy it may be ( like other tumour markers ) physiologically elevated , especially in the first trimester ( with a dozen or so per cent of pregnant women the level of ca-125 may be higher than 65 iu / ml ) . the level of ca-125 normalises during the second and third trimester , but it grows rapidly immediately after birth . therefore , the evaluation of ca-125 marker in pregnant women is not helpful in the first trimester of pregnancy , but it can be useful in the second and third trimester [ 3 , 4 , 8 ] . some authors suggest that inhibin b , amh , he4 , and ldh physiologically should not be elevated and can be used in oncologic assessment . but we should also remember that higher levels of tumour markers are associated with non - oncological obstetric complications such as miscarriage , preeclampsia , or hellp . in 1 out of 6001500 pregnancies , a pathological change in the appendages approximately 3% of these patients are diagnosed with malignant tumour of the ovary ; however , non - epithelial tumours have been most commonly observed ( embryonic and of the sex cords origin ) tumours of low - grade . the treatment depends on the size of tumour , the morphological image ( assessed using imaging testing or during surgery ) , histological subtype , progression of the disease , the course of pregnancy , and the expectations of the patient . the use of laparoscopic techniques can reduce the perioperative mortality rate , but we should remember that these procedures should be performed in compliance with all the standards designed to prevent the spread of tumour cells during surgery . the ideal procedure is to collect the specimens from the peritoneum together with the removal of the ovary and fallopian tube on the affected side with the analysis of the frozen fragments further investigation depends on the outcome [ 35 ] . ovarian tumours of low malignant potential have a very good prognosis and most patients are treated only surgically , without chemotherapy . if the surgical exploratory evaluation finds serous ovarian tumour of low malignant potential , it is necessary to resect the tumour and all grossly visible abnormal changes . if the contralateral ovary is macroscopically normal , it should be left [ 35 ] . in the absence of macroscopic peritoneal involvement , the routine assessment of progression should be carried out without lymphadenectomy ( cytology , random peritoneal specimens , resection or biopsy of the omentum , appendectomy in the case of mucous tumours ) . all changes found outside the ovary should be removed in order to assess the progression and histological subtype . another surgical evaluation should be carried out in the case of serous tumours of low malignant potential with the accompanying micropapillary tissue . this procedure may be deferred for a period of time after birth provided that the disease is diagnosed after the 2024 week of gestation . before the 20 week of pregnancy , the laparoscopic evaluation seems to be the safest option . in the case of malignant ovarian tumours , the maintenance of pregnancy and chemotherapy should always be individually discussed the final decision depends on the biological features and the stage of the disease ( histological subtype , differentiation , progression , including the involvement of the lymph nodes , tumour size , the presence of the disease in the peritoneum ) and of course , as always , the will of the patient [ 3 , 4 , 10 ] . in most patients with non - epithelial cancer ( embryonal or of the sex cords origin ) , these patients report more complaints than patients with epithelial tumours , including pain , bloating , and symptoms of acute abdomen . over 90% of patients are diagnosed at the first stage . in order to take a decision to perform the surgery maintaining fertility , a full evaluation of the progression inside the peritoneal cavity indications for adjuvant chemotherapy and the treatment regimens are similar to those in non - pregnant women bep ( bleomycin , etoposide , cisplatin ) is the program of choice [ 3 , 5 , 10 ] . epithelial ovarian cancers are rare in pregnant women and their treatment poses the most difficulties . the prognosis in these tumours is worse than in non - epithelial , in two thirds of patients there is the spread to the peritoneum and the lymph nodes and most patients require chemotherapy . standard adjuvant chemotherapy should be considered for high - grade stage i and any stage ii disease [ 3 , 5 , 6 , 9 ] . the surgical treatment is complicated because it should include the resection of appendages , peritoneal metastasis , and lymph nodes . if a decision is taken to maintain pregnancy , the preservation of the uterus with evaluation of the disease progression in the peritoneal cavity is a primary procedure that should be offered . during the initial surgical procedure , only the suspicious lymph nodes should be removed . the invasive cytoreductive surgical treatment leads to the termination of pregnancy because of the need for hysterectomy such a procedure should be proposed when the diagnosis of epithelial ovarian cancer is made at stage iii during the first or second trimester of pregnancy [ 3 , 9 ] . in some patients with peritoneal dissemination , it is possible to maintain pregnancy and use neoadjuvant chemotherapy ( carboplatin and paclitaxel ) there was no damage to the foetus if chemotherapy was administered in the second and third trimester . however , the observation of patients after the treatment described in the available reports is very short [ 3 , 4 , 6 , 810 ] . the risk of birth defects as a result of chemotherapy administered during pregnancy is high in the first trimester of pregnancy , especially between the 2 and 8 weeks of pregnancy , and therefore therapeutic abortion and the need to defer the treatment should be discussed with each patient . the cytostatic treatment of ovarian tumours in the second and third trimester of pregnancy should be in accordance with the standards applicable in non - pregnant patients , both in the case of non - epithelial and epithelial tumours . usually , the premature termination of pregnancy is not necessary if the disease is well controlled with chemotherapy . previously published reports described only single cases of birth defects and their relationship with chemotherapy is not clear [ 3 , 11 ] . most reported cases concern the safe use of bleomycin , carboplatin , taxanes , and vinca alkaloids . newborns demonstrated neutropaenia , hair loss , and impaired hearing due to the use of cisplatin within three weeks before childbirth . a case of ventriculomegaly was reported in a newborn of a mother treated with bep regimen . there are no reports on the use of topotecan in pregnant women , and data concerning gemcitabine are very scarce it is suspected of having the ability to inhibit intrauterine growth [ 3 , 11 ] . there are only a few reports of the application of this antibody during pregnancy in ophthalmic treatment without a negative impact on the course of the pregnancy and the development of the foetus . certainly , however , the systemic administration of anti - angiogenic therapy can not be recommended during pregnancy [ 3 , 4 , 8 ] . the data on this topic come from individual case reports , of which at least half were diagnosed in the course of uterine bleeding after childbirth . in other cases , the diagnosis was made while determining the cause of miscarriage . in most cases , well - differentiated cancer was observed without or with minimal invasion of the myometrium [ 5 , 8 , 11 , 12 ] . endometrial cancer diagnosed before fertilisation changes the intrauterine environment to one that makes fertilisation extremely difficult ; on the other hand , pregnancy has a protective effect on endometrial tumour growth . it is suspected that the rare phenomenon of the coexistence of pregnancy and endometrial cancer may correspond to the presence of immature endometrium , resistant to progesterone . cancer can occur focally in the immature basal cells , which do not respond to hormonal stimulation . the radical removal of reproductive organs is the standard treatment of endometrial cancer , but in the majority of patients with endometrial cancer at stage i according to figo , the long - term prognosis is successful , and after discussing with them further maternity plans , they can undergo sparing therapy ( curettage with the subsequent regular check - up with endometrial biopsy ) . this malignant tumour is very rare in premenopausal women , although the incidence of invasive squamous cell carcinoma of the vulva in women under 40 years of age is growing due to hpv and hiv infections [ 4 , 5 , 8 ] . radical vulvectomy with inguinal lymphadenectomy is the basic therapeutic option in cancer of the vulva in pregnancy . the use of blue dye is not recommended during pregnancy due to a high risk of severe allergic reactions . undergoing surgery is a relative contraindication to vaginal birth [ 4 , 5 ] . less extensive treatments are laser therapy or surgical excision of the changes like vulvar intraepithelial neoplasia ( vin ) or partial vulvectomy with the sentinel node procedure in the case of invasive cancers with clinically non - suspicious regional lymph nodes [ 5 , 9 ] . the treatment of vulvar cancer in pregnant women is not different in principle from that performed in non - pregnant women , but the advancement of pregnancy is important and should be taken into account before taking the final medical decision . in the third trimester , vascularisation of the vulva significantly increases , which also increases the operational risk ( high mortality rate ) ; therefore , if a diagnosis is made after the 36 week of pregnancy , surgery should be postponed until after the birth . if the inguinal lymph nodes are involved , the prognosis is unfavourable and immediate treatment is crucial . here vulva melanoma in pregnant women should be treated in the same way as in non - pregnant . patients with poor prognosis should be informed of the high risk of recurrence , the possibility of death and the high risk of metastasis appearance in the foetus ( 22% ) . primary carcinoma of the vagina is a rare gynaecological cancer , more often observed as secondary to the involvement of the vulva , cervix , endometrium , bladder , colon , or rectum . histologically , primary vaginal cancers are squamous cell ( up to 90% ) , adenocarcinomas ( up to 10% ) , and occasionally melanomas and sarcomas leiomyosarcoma and rhabdomyosarcoma . it is believed that intrauterine exposure to diethylstilbestrol can cause clear cell carcinoma of the vagina in young women . the coexistence of vaginal cancer and pregnancy is very rare and described in casuistic reports . the microscopic evaluation includes the assessment of smears and biopsies taken during colposcopy . in order to assess the severity of the disease in pregnant women , the following examinations can be safely performed : cystoscopy , procto - rectoscopy , abdominal ultrasound , and conventional chest x - ray with abdominal protection . because of the rarity of the disease , there are no guidelines for dealing with pregnant women . the treatment should be planned individually , depending on the progression of cancer , the stage of pregnancy , and the possibility of its maintenance . childbirth , if it occurs , should be carried out , of course , by caesarean section . it is not known whether the postponement of treatment due to pregnancy significantly changes the prognosis in patients with this diagnosis regardless of the coexistence of pregnancy , advanced disease has a decidedly poor prognosis and the five - year survival rate is low . the diagnosis of malignant tumour in pregnancy is a dramatic event that overshadows the joy of the forthcoming motherhood . usually , these women are diagnosed with genital cancer , breast cancer , lymphatic system neoplasm , or melanoma . historically , the diagnosis was associated with the need to terminate the pregnancy . today , although unskilled doctors still propose the only therapeutic option , abortion is not the only solution . thanks to the efforts of many experts , reports in recent years have been summarised and collected creating guidelines that would enable , at least in some cases , the maintenance of pregnancy and the effective treatment of cancer , especially gynaecological cancers and breast cancer . the patient should have the opportunity to decide about the fate of her pregnancy and it should not be affected by the moral beliefs of the doctor . the task of the professionals , who look after such a special patient , is to provide the woman with access to the most current and reliable knowledge in order to allow her to take a conscious decision on further management . from the moment of taking a decision to start the treatment and maintain pregnancy , the patient must be provided with the multidisciplinary care of highly qualified doctors cooperating with each other , who know and understand the complexity of coexistence of cancer and pregnancy [ 3 , 4 , 6 , 9 , 1113 ] . thanks to the publications in recent years , summarised in this paper , it is possible to avoid making hasty , tragic decisions enabling pregnant women affected by cancer to fight not only for their own health , but also for the birth of a healthy child .

the coexistence of malignant tumour and pregnancy is a state of simultaneous occurrence of two completely contradictory philosophical and biological phenomena the development of a new life and a life - threatening terminal illness . finally , a physician in fact the whole team of doctors is facing the fight for two lives : of the mother and her unborn child.the incidence of malignant disease in pregnancy is 0.05 to 0.1% . this condition is a major challenge for physicians because there are no randomised studies that could be the basis to choose the therapeutic methods the medical knowledge merely comes from case reports , registries , and observational studies.the following cancers most often coexist with pregnancy : gynaecological neoplasm ( especially cervical and ovarian cancer ) , breast cancer , lymphatic system neoplasm , and melanoma.formerly , the diagnosis was clearly the necessity of abortion . today although unskilled doctors still propose the only therapeutic option termination of pregnancy is not the only solution.the past few years have seen the updating of reports and guidelines for the management of pregnant women with cancer . this paper is a review and summary of the information from these publications .

You are an expert at summarizing long articles. Proceed to summarize the following text: hemophilia a ( ha ) results from the partial or complete deficiency of functional factor viii ( fviii ) protein caused by a wide range of heterogeneous mutations in the factor 8 ( f8 ) gene . being an x - linked recessive disorder , females are generally not affected , although they can be carriers of this disorder . a classical female hemophilia is possible only when a carrier female marries a hemophilic male , of which there are only few reports in the literature.[24 ] few other reports of homozygous female ha are mainly due to de novo mutations in one or both the x chromosomes . blood was collected by peripheral venous puncture at a 1:10 volume ratio in 3.8% trisodium citrate . activated partial thromboplastin time ( aptt ) factor viii activity ( fviii : c ) of each sample was determined by one - stage aptt - based assay in a semiautomated coagulometer ( diagnostica stago , asnieres , france ) . plasma von willebrand factor antigen level ( vwf : ag ) was measured by enzyme - linked immunosorbent assay ( diagnostica stago ) . multiplex polymerase chain reactions spanning all the 26 exons were carried out and conformation - sensitive gel electrophoresis ( csge ) was used to screen the mutations . amplicons were run on a 12.5% gel ( acrylamide : 1 , 4-bis acroylyl piperazine 99:1 ) incorporating mild denaturants ( 10% ) ethylene glycol , 15% formamide and electrophoresed overnight at 80v dna sequencing was performed on both strands using the big dye terminator cycle sequencing v1.1 ready reaction kit and an automated abi dna sequencer ( applied biosystems , carlsbad , california . we report a case of homozygous female ha with moderate fviii deficiency ( moderate fviii deficiency 5.5% fviii : c , vwf : ag 120% ) , born of a 1 consanguineous marriage . she presented to our center with severe bleeding diathesis following delivery of her first child and a history of prolonged bleed from cuts and injuries . the mother ( a carrier of ha ) of the proband was married to a hemophilic who died of excessive bleeding in a road accident and was undiagnosed but his two brothers were diagnosed with moderate deficiency of ha ( f viii : c 4.8% and 5.7% ) . her two brothers were affected and the sister was found to be a carrier of ha . pedigree of an extensive family with classical female hemophilia a sequencing of this exon revealed a missense mutation corresponding to c.1315g > a , which results in the amino acid substitution corresponding to p.gly420ser that fits well with the clinical manifestation of the patient [ figure 2 ] . the mother was shown to be a heterozygous carrier of the mutation , while the two affected brothers , uncles and nephews also showed the same mutation . they were found to be cross - reacting material ( crm ) negative [ table 1 ] . a missense mutation c.1315g > a ( p.gly420ser ) in moderate hemophilia a genotypic phenotypic correlation it was inferred that the father of this index case was also affected and carried the same mutation as that of the index case . the mutation has earlier been reported to be associated with moderate and severe ha , causing polarity change in the protein coil thus influencing the secondary structure of the protein . female carriers of ha normally do not exhibit a moderate to severe phenotypic expression of the disease . however , a number of other pathophysiological mechanisms may account for the phenotypic expression of very low fviii : c levels in females . these include ( i ) skewed inactivation of the x chromosome leading to predominant expression of the mutated allele as a result of a preferential inactivation of the x chromosome with the wild - type f8 gene , ( ii ) turner syndrome , ( iii ) translocation or ( iv ) males with a female phenotype due to mutation in the sex - determining region y ( sry ) gene on the y chromosome , i.e. swyer syndrome combined with a mutation in the f8 gene . in the present report , we have presented homozygosity of the f8 gene mutation resulting in clinical manifestation of ha in a female . in india , as consanguineous marriages are very common in certain communities ( up to 30% ) , the likelihood of encountering female hemophilia is higher , although this is the first case of ha encountered out of 1600 hemophilia families registered in our comprehensive haemophilia care center . genetic diagnosis in such cases is not necessary as all the male children will be affected and daughters are obligatory carriers .

background : hemophilia a ( ha ) , being an x - linked recessive disorder , females are rarely affected , although they can be carriers.aims:to study the mutation in f8 gene in an extended family with a homozygous female ha.materials and methods : all the seven affected members ( six males and one female ) were initially screened by conformation sensitive gel electrophoresis ( csge ) and direct dna sequencing.results:a homozygous missense mutation c.1315g > a ( p.gly420ser ) was identified in exon 9 of f8 gene in homozygous state in the affected female born of 1 consanguinous marriage and in all the affected male members of the family . her factor viii levels was found to be 5.5% , vwf : ag 120%.conclusion : in india , as consanguineous marriages are very common in certain communities ( up to 30% ) , the likelihood of encountering female hemophilia is higher , although this is the first case of ha out of 1600 hemophilia families registered in our comprehensive haemophilia care center . genetic diagnosis in such cases is not necessary as all the male children will be affected and daughters obligatory carriers .

You are an expert at summarizing long articles. Proceed to summarize the following text: malignant central nervous system ( cns ) germ cell tumors ( gcts ) are uncommon , accounting for less than 1% of primary brain tumors , and occur predominantly during childhood . the incidence of cns gcts has been reported to exhibit a marked association with race , appearing to be more common in asian countries than in the west [ 1 - 13 ] . however , the majority of previous reports were based on single institution experiences rather than the general population . recently , a population - based comparison study between japan and the united states found no significant difference in the incidence of malignant cns gcts between these two countries . in contrast , the central brian tumor registry of the united states ( cbtrus ) report published in 2014 stated that asians / pacific islanders ( age - standardized rate [ asr ] , 0.19 ) were associated with a higher incidence rate of cns gcts than caucasian ( asr , 0.10 ) and african - american ( asr , 0.07 ) individuals in the united states . thus , the existence of racial differences in the incidence of cns gct remains unclear . the aim of this study was to determine the korean nationwide incidence and survival rate for primary malignant cns gcts . using the korea central cancer registry ( kccr ) database , we reported the precise cns gct incidence by age , sex , histological type , and topography in korea , as well as the survival rate during 2005 - 2012 . in 1999 , the kccr expanded cancer registration to cover the entire population under the population - based regional cancer registry program . national cancer incidence reports for diseases diagnosed since 1999 began to be published in 2005 , and the incidence data for 2012 was 97.7% complete . as gcts are often malignant , we included only malignant gcts diagnosed between 2005 and 2012 in this study . we were able to collect more reliable and accurate data describing cns tumors because , from 2005 onward , information regarding malignant whole - brain and cns tumors was registered separately from that of benign and borderline tumors . for survival analysis , we included gcts registered between 2005 and 2010 , and followed these cases until december 31 , 2013 . gcts were identified using the international classification of diseases for oncology ( third edition ) , and were selected using the primary sites c70.0-c72.9 and c75.1-c75.3 . tumors were classified into two groups : pineal ( c75.3 ) and nonpineal ( c70.0-c72.9 and c75.1-c75.2 ) . tumors were grouped by histology codes into germinoma ( 9060 , 9061 , 9064 , and 9065 ) , nongerminomatous gct ( 9070 , 9071 , 9081 , 9085 , and 9100 ) , and teratoma ( 9080 , 9082 , and 9084 ) . the national cancer center institutional review board approved this study ( ncc2015 - 0223 ) . crude rates were calculated by dividing the total number of cases in a given time period by the entire population , and were expressed per 100,000 persons . the male - to - female ( m : f ) incidence rate ratios ( irrs ) were calculated by dividing the age - adjusted incidence rates of male participants by those of female participants . for survival analysis , we used only data for patients with tumors that were diagnosed between 2005 and 2010 , and excluded cases that could not be followed because of mismatched personal identification numbers and cases in which gcts were not the primary tumors . the overall 1- to 5-year survival rates of gct patients , as well as survival by sex , age group , primary site , and histological type were calculated using the life - table method . 9.2 ( sas institute inc . , cary , nc ) and stata 11.0 ( statacorp lp , college station , tx ) in 1999 , the kccr expanded cancer registration to cover the entire population under the population - based regional cancer registry program . national cancer incidence reports for diseases diagnosed since 1999 began to be published in 2005 , and the incidence data for 2012 was 97.7% complete . as gcts are often malignant , we included only malignant gcts diagnosed between 2005 and 2012 in this study . we were able to collect more reliable and accurate data describing cns tumors because , from 2005 onward , information regarding malignant whole - brain and cns tumors was registered separately from that of benign and borderline tumors . for survival analysis , we included gcts registered between 2005 and 2010 , and followed these cases until december 31 , 2013 . gcts were identified using the international classification of diseases for oncology ( third edition ) , and were selected using the primary sites c70.0-c72.9 and c75.1-c75.3 . tumors were classified into two groups : pineal ( c75.3 ) and nonpineal ( c70.0-c72.9 and c75.1-c75.2 ) . tumors were grouped by histology codes into germinoma ( 9060 , 9061 , 9064 , and 9065 ) , nongerminomatous gct ( 9070 , 9071 , 9081 , 9085 , and 9100 ) , and teratoma ( 9080 , 9082 , and 9084 ) . the national cancer center institutional review board approved this study ( ncc2015 - 0223 ) . crude rates were calculated by dividing the total number of cases in a given time period by the entire population , and were expressed per 100,000 persons . the male - to - female ( m : f ) incidence rate ratios ( irrs ) were calculated by dividing the age - adjusted incidence rates of male participants by those of female participants . for survival analysis , we used only data for patients with tumors that were diagnosed between 2005 and 2010 , and excluded cases that could not be followed because of mismatched personal identification numbers and cases in which gcts were not the primary tumors . the overall 1- to 5-year survival rates of gct patients , as well as survival by sex , age group , primary site , and histological type were calculated using the life - table method . 9.2 ( sas institute inc . , cary , nc ) and stata 11.0 ( statacorp lp , college station , tx ) . the kccr database included 654 cases of primary malignant gcts of the brain and cns diagnosed between 2005 and 2012 . the annual average number of registered cases was 81.8 , and the overall asr for cns gct was 0.179 per 100,000 people ( annual percent change , 0.71% ; p=0.732 ) ( table 1 ) . the incidence of all malignant gcts was significantly higher in male participants ( 0.263 per 100,000 people ; 95% confidence interval [ ci ] , 0.240 to 0.286 ) than female participants ( 0.089 per 100,000 people ; 95% ci , 0.075 to 0.104 ) . when ranked according to age , the majority of malignant tumors were reported in the young adult ( 15 - 29 years , 47.1% ) and pediatric ( 0 - 14 years , 45.3% ) age groups . the pediatric group had the highest incidence rate ( 0.434 per 100,000 people ) , followed by the young adult group ( 0.365 ) and the adults aged 30 years and over group ( 0.021 ) . approximately 65.4% of gcts were located outside the pineal region , while the rest were located in the pineal region . the majority ( 76.0% ) of tumors however , when stratified by site , the m : f irr for pineal region tumors was 13.62:1 compared to an irr of 1.87:1 for tumors located in a nonpineal region ( table 3 ) . among the patients with gct , 46 patients eventually died during the follow - up period . the 5-year observed survival rate was high for all gcts , at 91.2% ( table 4 ) . these rates showed no statistically significant differences between male and female participants ( male participants , 90.9% ; female participants , 92.3% ; p=0.658 ) ( fig . 1a ) , age groups ( 0 - 14 years , 90.7% ; 15 - 29 years , 91.8% ; 30 years and over , 90.6% ; p=0.912 ) ( fig . 1b ) , or primary sites ( pineal , 91.5% ; nonpineal , 91.1% ; p=0.843 ) ( fig . however , there was a significant difference according to histological type ( germinoma , 95.3% ; nongerminomatous gct , 77.6% ; teratoma , 76.5% ; p < 0.001 ) ( fig . the kccr database included 654 cases of primary malignant gcts of the brain and cns diagnosed between 2005 and 2012 . the annual average number of registered cases was 81.8 , and the overall asr for cns gct was 0.179 per 100,000 people ( annual percent change , 0.71% ; p=0.732 ) ( table 1 ) . the incidence of all malignant gcts was significantly higher in male participants ( 0.263 per 100,000 people ; 95% confidence interval [ ci ] , 0.240 to 0.286 ) than female participants ( 0.089 per 100,000 people ; 95% ci , 0.075 to 0.104 ) . when ranked according to age , the majority of malignant tumors were reported in the young adult ( 15 - 29 years , 47.1% ) and pediatric ( 0 - 14 years , 45.3% ) age groups . the pediatric group had the highest incidence rate ( 0.434 per 100,000 people ) , followed by the young adult group ( 0.365 ) and the adults aged 30 years and over group ( 0.021 ) . approximately 65.4% of gcts were located outside the pineal region , while the rest were located in the pineal region . the majority ( 76.0% ) of tumors however , when stratified by site , the m : f irr for pineal region tumors was 13.62:1 compared to an irr of 1.87:1 for tumors located in a nonpineal region ( table 3 ) . among the patients with gct , 46 patients eventually died during the follow - up period . the 5-year observed survival rate was high for all gcts , at 91.2% ( table 4 ) . these rates showed no statistically significant differences between male and female participants ( male participants , 90.9% ; female participants , 92.3% ; p=0.658 ) ( fig . 1a ) , age groups ( 0 - 14 years , 90.7% ; 15 - 29 years , 91.8% ; 30 years and over , 90.6% ; p=0.912 ) ( fig . 1b ) , or primary sites ( pineal , 91.5% ; nonpineal , 91.1% ; p=0.843 ) ( fig . however , there was a significant difference according to histological type ( germinoma , 95.3% ; nongerminomatous gct , 77.6% ; teratoma , 76.5% ; p < 0.001 ) ( fig . the incidence of cns gcts is known to be higher in asia , japan , and korea than in other areas of the world . in particular , cns gcts account for relatively high proportions of pediatric brain tumors in east asia , 7.8% in japan , 14.0% in taiwan , 7.9% in china , and 9.5% in korea , whereas their frequencies in north america and europe are less than 3% . according to the cbtrus report , the overall incidence of malignant cns gcts between 2007 and 2011 was 0.07 per 100,000 in the united states , with the asian / pacific islander group associated with a higher cns gct incidence rate ( 0.19 per 100,000 ) than caucasian and african - american participants . in children , the incidences of cns gct , including benign tumors , were 0.21 per 100,000 in total and 0.21 , 0.14 , and 0.51 per 100,000 in caucasian , african - american , and asian/ pacific islander populations , respectively . goodwin et al . also described differences in the incidence of pediatric gcts according to race ( caucasian , 1.29 per 100,000 ; african - american , 0.33 per 100,000 ; and asian , 2.6 per 100,000 ) . moreover , the childhood incidence of primary cns gcts in a regional survey in kumamoto prefecture in southern japan was found to be 0.45 per 100,000 . these data suggest that an asian genetic background is strongly associated with the development of cns gct . however , a recent study demonstrated that the incidence of cns gct in japan was not significantly higher than that in the united states . mccarthy et al . estimated the incidence of malignant cns gcts diagnosed during 2004 - 2006 in 14 population - based registries representing 31.8% of the total population of japan and analyzed the surveillance epidemiology and end results program database for 17 population - based cancer registries covering 26% of the population of the united states . unexpectedly , they found the incidence of malignant cns gcts in japan ( 0.096 per 100,000 ) to be similar to that in the united states ( 0.075 per 100,000 ) , and showed the same sex - based patterns by location . the incidence of cns gcts in japan was low compared to those reported in previous studies . these results prompted us to investigate the actual nationwide population - based incidence of cns gcts in korea . between 2005 and 2012 , 654 cases of newly diagnosed primary malignant cns gcts were registered in the kccr . the incidence of cns gcts in korea was more than two times higher than that in japan and the united states . furthermore , the incidence of pediatric cns gcts in korea ( 0.434 per 100,000 ) was similar to the incidence of cns gcts in kumamoto prefecture ( 0.45 per 100,000 ) . kumamoto and korea may also share a similar genetic background because of their geographical proximity . the survival rate of pure germinoma is known to be very high , with the 10-year overall survival rate attaining 90% . for nongerminomatous gct , the 10-year overall survival rates were reported to be 30%-80% ; however , cns gcts showed better prognosis among pediatric patients . matsutani et al . reported that the 10-year survival rates for pure germinoma and mature teratoma were both over 90% . even though we did not report 10-year survival rates because of our short follow - up period , the survival outcomes observed in this study suggest that cns gcts are curable . the 5-year observed survival rate for all patients with cns gcts was 91.2% , with no differences observed according to sex , age group , or primary tumor site . however , patients with germinoma showed a greater 5-year survival rate ( 95.3% ) than those with nongerminomatous gcts ( 77.6% ) and malignant teratomas ( 76.5% ) . specifically , the kccr does not record cancer risk factors or specific treatment - related factors , making it difficult to determine specific prognostic factors for cns gct . nevertheless , the kccr data encompasses over 97% of the population of korea , and includes up - to - date information with longer follow - up periods than the data sources used in previous studies . in conclusion , our nationwide population - based study revealed that the incidence of cns gcts in korea is significantly higher than the reported incidence for the overall population of the united states , but is comparable to the rate reported for americans of asian / pacific islander backgrounds .

purposemalignant central nervous system ( cns ) germ cell tumors ( gcts ) , although rare , are thought to occur more frequently among asians . however , a recent population - based study revealed no differences in gct incidence between asians and caucasians . therefore , this study was conducted to determine the incidence and survival rates of cns gcts using the national cancer incidence database , and to compare these rates to those in the united states and japan.materials and methodswe extracted cns gct patients diagnosed between 2005 and 2012 from the korea central cancer registry database . age - standardized rates ( asrs ) , annual percentage change , and the male - female incidence rate ratios ( irrs ) were calculated . to estimate the survival rate , we used data for patients diagnosed between 2005 and 2010 and followed their cases until december 31 , 2013.resultsthe asr for cns gct between 2005 and 2012 was 0.179 per 100,000 ( 95% confidence interval , 0.166 to 0.193 ) , with an overall male - to - female ( m : f ) irr of 2.95:1 . however , when stratified by site , the m : f irr was 13.62:1 for tumors of the pineal region and 1.87:1 for those located in nonpineal regions . the most frequent histologic type was germinoma ( 76.0% ) , and the most frequent location was the suprasellar region ( 48.5% ) . the 5-year survival rate of germinoma patients was 95.3%.conclusionthe incidence rate of cns gcts in korea during 2005 - 2012 was 0.179 per 100,000 , which was similar to that of the asian / pacific islander subpopulation in the united states . moreover , the cns gct survival rate in korea was similar to rates in japan and the united states .

You are an expert at summarizing long articles. Proceed to summarize the following text: heatstroke is characterized by hyperpyrexia , multiorgan damage and dysfunction , and predominant central nervous system dysfunction ( such as delirium , convulsion , or coma ) [ 13 ] . the full spectrum of the signs and symptoms occurring during heatstroke in humans can be mimicked by the rodent heatstroke model . when mice were subjected to acute heat stress , the stress response indicators such as mortality , hypothermia , and multiple organ apoptosis , were observed [ 5 , 6 ] . other line of evidence has accumulated to show that testosterone increases the susceptibility toward a wide variety of infectious diseases including human sepsis , shock , and severe injury . in addition , depletion of testosterone by castration prior to soft - tissue trauma results in better maintained immune and myocardial function in male mice [ 10 , 11 ] . flutamide , an androgen receptor antagonist , has been shown to restore the depressed cell - mediated immunity , and cardiac and hepatic function following soft - tissue trauma and hemorrhagic shock . it has also been promoted that testosterone plays a role in the regulation of heat balance in male rats . this raises the possibility that testosterone depletion by castration may protect male mice from heatstroke - induced multiple organ damage and lethality . to deal with the hypothesis , the effects of surgical castration with or without testosterone replacement on the heatstroke - induced thermoregulatory deficits ( in particular , the hypothalamic neuronal damage and apoptosis and hypothermia ) , multiple organs dysfunction or damage and lethality were assessed in mice [ 5 , 6 ] . all the experiments were carried out in accordance with the ethical guidelines laid down by the committee for the purpose of control and supervision of experiments on animals , chi mei medical center ( tainan , taiwan ) . icr inbred male mice , 8 weeks old , were given food and water ad libitum and acclimatized to room temperature at 24c , relative humidity ( rh ) of 50 8% , and a 12 h dark / light cycle for 1 week before the start of the experiment at least . animals were exposed to heat stress treatment ( 41.2c , rh-5055% , 1 h ) in an environment - controlled chamber . the time at which mice were removed from the environmental chamber was called 0 hour . the heat - stressed mice were returned to the normal room temperature ( 25c ) after the end of the heat exposure . mice that survived on day 4 of heat treatment were considered survivors , and the data were used for analysis of the results . core temperatures were measured every 5 minutes with a copper constantan thermocouple inserted into the rectum and connected to a thermometer ( hr1300 , yokogawa , tokyo , japan ) . heatstroke resembles sepsis in many aspects [ 15 , 16 ] . like many sepsis studies , we use death as an endpoint in conscious mice in this study fourteen days before the experiment , briefly , after the initiation of general anesthesia with ketamine and xylazine ( 8.7 and 1.3 mg/100 g bw , i m ) and application of 75% alcohol to disinfect the scrotum , a small midline incision was made and the testes were exteriorized . the spermatic vessels were tied with 4.0 silk sutures , and the testes were removed . the incision was then closed with 4.0 silk sutures . in sham - operated mice , the skin of the scrotum was incised to draw out and back the testes and closed with sutures only . an interval of 14 days after castration was chosen for subcutaneously implanting testosterone or heat stress experiments because previous studies have demonstrated the absence of any detectable plasma testosterone levels at this interval . for testosterone replacement study , the castrated groups were subcutaneously implanted with testosterone 2 weeks after the castration . briefly , after the initiation of general anesthesia with ketamine and xylazine ( 8.7 and 1.3 mg/100 g bw , i m ) , a small incision was made in the skin of the back , a pellet of testosterone ( 0.5 mg / pellet , 21-day release ; innovative research ) was subcutaneously implanted . for the other sham - implanted animals , the skin of the back was incised and then closed with 3.0 silk suture only . four major groups of animals were designated for the experiment . in the normothermic control ( nc ) groups , the animals were exposed to room temperature ( 26c ) throughout the entire experiments . the sham - operated heatstroke ( soh ) mice , the castrated , vehicle - treated heatstroke ( cvh ) mice , and the castrated , testosterone - treated heatstroke ( cth ) mice were treated with heat regimen of 41.2c for 1 h. before the start of experiments , their core temperature was within the normal body temperature range of 37.0 ~ 37.6 . peripheral blood samples were harvested from urethane - anesthetized mice ( 1.4 g / kg bw , ip ) by heart puncture via a syringe containing 3.8% sodium citrate ( 9 : 1 vol / vol ) . plasma concentration of testosterone was measured by enzyme immunoassay ( eia ) as described in the instructions provided by manufacturer 's kits ( cayman chemical usa , catalog no.582701 ) , which presents 6 pg / ml of sensitivity , and 100% of specificity . the heat - treated mice were sacrificed at heat off 2.5 h under the heat stress model . perfusion and prefixed procedure with the pbs and 10% formaldehyde were performed after the general anesthesia with urethane ( 1.4 g / kg bw , ip ) . the brain , liver , spleen , and kidney were excised and postfixed in a solution containing 30% sucrose and 10% formaldehyde for at least 24 hours . after fixation , the organs were embedded separately in tissue tek oct embedding medium ( miles ) . snap frozen samples were cryostat sectioned ( 8 m thick ) and placed on slides coated with poly - l - lysine for tunel assays . tunel staining was done using a bd apoalert dna fragmentation assay kit ( bd biosciences - clontech ) , according to detailed protocol provided by manufacture . in brief , tissue slides were pretreated with 20 g / ml proteinase k solution for 5 minutes and were incubated with the reaction mixture containing terminal deoxynucleotidyl transferase ( tdt ) and fluorescein - conjugated deoxyuridine triphosphate ( dutp ) for 1 hour at 37c . afterwards , sections were washed with pbs , their nuclei were costained with 4,6-diamidino-2-phenylindole ( dapi ) using dapi - containing vectashieldr mounting medium ( vector laboratories , burlingame , ca ) , and subsequently analyzed using olympus e800 fluorescent microscope equipped with olympus coolpix 995 digital camera ( both from olympus , japan ) . apoptosis induction efficacy was calculated as percentage of fluorescein - positive to dapi - stained nuclei . at the end of experiment , the brain was removed , fixed in 10% neutral buffered formalin , and embedded in paraffin blocks . serial ( 5 m ) sections through the hypothalamus were stained with hematoxylin and eosin for microscopic evaluation . the extent of hypothalamic neuronal damage was scored on a scale of 03 , modified from the grading system of pulsinelli et al . , in which 0 is normal 1 indicates that approximately 30% of the neurons were damaged , 2 indicates that approximately 60% of the neurons were damaged , and 3 indicates that approximately 100% of the neurons are damaged . degenerative damage was considered to have occurred in any neurons showing pyknosis of the nucleus and cell shrinkage . all values , except those on table 3 , are expressed as the mean sem and were analyzed by one - way analysis of variance followed by the fisher 's least significance test as a post hoc test for multiple comparisons among means . for the data in table 3 , the wilcoxon tests convert the scores or values of a variable to ranks , require calculation of the sum of the ranks , and provide critical values for the sum necessary to test the null hypothesis at a given level of significance . these data are presented as the median , followed by first and third quartiles . wbh treatment was used to induce heatstroke and thermoregulatory deficit ( e.g. , hypothermia ) in mice as described in section 2 . both figures 1 and 2 indicate that 1 h of wbh resulted in 33% mortality and hypothermia ( ~27c core temperature ) monitored at 4 h of wbh in soh mice . however , in cvh mice , the values of both percentage of survival and core temperature were significantly reached to new levels of 87% and 34.5c , respectively . when the cth groups were exposed to the same heat treatment , the values of both percentage of survival and core temperature table 1 summarizes the plasma levels of testosterone for different groups of mice monitored at 4 h of wbh in soh , cvh , and cth groups or the equivalent time in nc group . as compared to those of nc or soh groups , the cvh mice displayed significantly lower levels of plasma testosterone ( 4 2 pg / ml versus 403 91 or 525 115 pg / ml ) . however , cth mice showed significantly higher levels of plasma testosterone ( 260 24 pg / ml versus 4 2 pg / ml ) as compared to those of cvh ( table 1 ) . as summarized in table 2 , the numbers of tunel - positive cells in the hypothalamus evaluated at 2.5 h postwbh were 0 , 344 107 , 70 17 , and 312 95 per hypothalamic section , respectively , for nc ( n = 7 ) , soh mice ( n = 7 ) , cvh ( n = 7 ) , and cth ( n = 7 ) . photomicrographs of tunel - positive cells in the hypothalamus of an nc , a soh mouse , a cvh mouse , and a cth mouse were shown in figures 3(a)to 3(d ) . as compared to those of nc group , soh mice had higher numbers of tunel - positive cells in their hypothalami ( figure 3(b ) ) . the heat - induced increased numbers of hypothalamic tunel - positive cells could be significantly reduced by castration ( figure 3(c ) ) . however , the beneficial effects of castration were significantly reversed by testosterone replacement ( figure 3(d ) ) . table 3 summarizes the effects of heat exposure on the neuronal damage scores of the hypothalamus from nc mice , soh mice , cvh mice , or cth mice . the scores for hypothalamic neuronal damage in soh mice significantly ( p < .05 ) exceeded those of the respective nc mice . however , the hypothalamic neuronal damage scores in cvh mice were significantly ( p < .05 ) lower than those of soh mice . furthermore , it was found that the hypothalamic neuronal damage score in cth mice were significantly ( p < .05 ) higher than those of cvh mice . two and half hours after termination of heat stress , soh mice exhibited cell shrinkage and pyknosis of the nucleus in the hypothalamus ( figure 4(b ) ) . the heatstroke - induced neuronal damage in the hypothalamus was markedly less in cvh mice ( figure 4(c ) ) or cth mice ( figure 4(d ) ) . both tunel and he stainings revealed that apoptosis , cell shrinkage and pyknosis that occurred in the hypothalamus of a soh ( figure 5(b ) ) mouse could be reduced by castration as shown in a cvh mouse ( figure 5(c ) ) , which could be reversed by testosterone replacement in a cth mouse ( figure 5(d ) ) . tunel assays of splenocytes , hepatocytes , and kidney cells were done 2.5 h after the termination of heat stress for different groups of mice . the numbers of tunel - positive cells of spleen , and kidney from svh mice were significantly higher than those of nc mice ( table 2 ) . as compared to soh mice , cvh mice had significantly lower numbers of tunel - positive cells in multiple organs ( table 2 ) . in addition , the cth mice showed significantly higher numbers of tunel - positive in all these 3 organs as compared to those of cvh mice . photomicrographs showing examples of tunel - positive cells of spleen and kidney for different groups of mice were depicted in both figures 6 and 7 , respectively . it has been demonstrated that plasma levels of estradiol are related to heat tolerance in anesthetized rats . for example , the heat tolerance of estrus female rats was superior to the heat tolerance of ovariectomized or leuprolide - treated female rats . induction of high levels of plasma estradiol caused by intravenous delivery of a high dose ( 1 ml / kg ) of premarin in estrus female , ovariectomized , or leuprolide - treated female rats conferred protection after heatstroke occurrence , as reflected by prolonged survival time . evidence has also been provided to suggest that premarin can act via estrogen receptors to rescue the unanesthetized , unrestrained mice from heatstroke - induced lethality . in the present study , we have further evidence to promote that testosterone depletion by castration is able to protect the unanesthetized , unrestrained mice from heatstroke - induced lethality . it appears that low testosterone and/or high estradiol are able to protect mice from heatstroke - induced lethality . the contention is consistent with several clinical and experimental studies which demonstrate that gender dimorphism in immune and organ responsiveness and in the susceptibility and morbidity from shock , trauma , and sepsis . in view of these findings , clinically relevant therapeutic strategies should be performed using estrogen or premarin , and/or the androgen receptor antagonist , flutamide in heatstroke victims since heatstroke resembles sepsis in many aspects [ 15 , 16 ] . testosterone produced by leydig cells of the testes is the major androgen in the circulation of men and adult males of most mammalian species . androgen may proceed to amplify the action of testosterone through its conversion to dihydroxatone or its aromatization to estradiol . this raises the possibility that the increased levels of both dihydrosterone and estradiol may be induced following castration - induced testosterone depletion in the current model . however , our findings reveal that castration does not affect the plasma levels of both dihydrosterone and estradiol in our mice and indicate that low testosterone , rather than high estradiol , is the main cause for the beneficial effect of castration in preventing heat - induced lethality ( the data are not shown here ) . our previous results have shown that mice display increased production of cellular ischemia ( e.g. , glutamate and lactate - to - pyruvate ratio ) and injury ( e.g. , glycerol ) markers in the hypothalamus following heatstroke . the current findings further show that both apoptosis ( as indicated by tunel staining ) and neuronal damage ( as indicated by both cell shrinkage and pyknosis by h and e staining ) in the hypothalamus occur during heatstroke . apparently , the hypothermia that occurred after heatstroke in mice [ 5 , 6 ] may have resulted from neuronal apoptosis and degeneration in the hypothalamus . the heat - induced thermoregulatory deficits as well as neuronal degeneration and apoptosis in the hypothalamus can be significantly prevented by testosterone depletion caused by surgical castration ( as shown in the present results ) . furthermore , the beneficial effects of testosterone in preventing neuronal damage and apoptosis in the hypothalamus and thermoregulatory deficit ( e.g. , hypothermia occurs during room temperature exposure ) can be reversed after testosterone replacement . in addition to ischemic damage to the hypothalamus , severe heat causes apoptosis of spleen and renal cells , which can be ameliorated by testosterone depletion . as mentioned in the introduction section , multiorgan dysfunctions ensued from severe heatstroke include cardiac depression , cerebral ischemia and neuronal damage , systemic inflammation , hepatic and renal failure , systemic inflammation , and hypercoagulable state . the increased proinflammatory cytokine release by kupffer cells normally observed in intact inflammatory male mice following trauma - hemorrhage can be prevented by castration [ 12 , 21 , 22 ] . castration of male rats 2 weeks prior to the onset of trauma - hemorrhage prevented the depression of myocardial function . flutamide ( an androgen receptor antagonist ) has also been shown to prevent the depression of cardiovascular responses following trauma and severe blood loss in male rats . in addition , evidence has accumulated to indicate that testosterone is able to enhance both platelet aggregation [ 23 , 24 ] and vasoconstriction [ 25 , 26 ] . these observations prompted us to think that testosterone depletion may improve heat tolerance during heatstroke by reducing multiple organ dysfunction . in summary , the current results demonstrate that testosterone depletion by castration may rescue mice from heat - induced multiple organ damage and lethality . in order to transfer those effects into clinical usage , studies mimicking castration by the use of an androgen receptor antagonist such as flutamide should be conducted following the onset of heatstroke in future studies .

when the vehicle - treated , sham - operated mice underwent heat stress , the fraction survival and core temperature at + 4 h of body heating were found to be 5 of 15 and 34.4c 0.3c , respectively . castration 2 weeks before the start of heat stress decreased the plasma levels of testosterone almost to zero , protected the mice from heat - induced death ( fraction survival , 13/15 ) and reduced the hypothermia ( core temperature , 37.3c ) . the beneficial effects of castration in ameliorating lethality and hypothermia can be significantly reduced by testosterone replacement . heat - induced apoptosis , as indicated by terminal deoxynucleotidyl- transferase- mediatedudp - biotin nick end - labeling staining , were significantly prevented by castration . in addition , heat - induced neuronal damage , as indicated by cell shrinkage and pyknosis of nucleus , to the hypothalamus was also castration - prevented . again , the beneficial effects of castration in reducing neuronal damage to the hypothalamus as well as apoptosis in multiple organs during heatstroke , were significantly reversed by testosterone replacement . the data indicate that testosterone depletion by castration may protect mice from heatstroke - induced multiple organ damage and lethality .

You are an expert at summarizing long articles. Proceed to summarize the following text: motor and cognitive impairments in stroke patients dramatically reduce their independence in activities of daily living ( adl ) . in particular , the physical symptoms of stroke have a greater effect on the patients independence than the cognitive component1 . therefore , understanding the relationship between motor function and adl is important to design efficient rehabilitation programs aimed at improving adl performance . this ability to perform adl is influenced by motor functions of the upper and lower limbs2 , 3 and the trunk4,5,6 . likhi et al.7 reported that adl performance in stroke patients correlated more closely with the impairment level of the trunk than that of the upper limb , whereas lower limb impairment showed no correlation with adl . however , fong et al.8 reported that lower limb impairment correlated more closely with adl than upper limb impairment . in contrast , ezure et al.9 reported that the upper limb , lower limb , and trunk functions were significantly correlated with adl . multiple linear regression analysis revealed that trunk function exhibited a stronger relationship with adl than the affected side function . therefore , the impact of limb and trunk function impairment on adl in stroke patients remains highly controversial . this is consistent with the well - known strong association between motor functions of the affected upper and lower limbs . for instance , a correlation analysis between the affected upper limb function and adl must be conducted in the absence of the effect of the affected lower limb function on adl . to the best of our knowledge , no study has conducted partial correlation analyses between limb or trunk function impairment and adl in stroke patients . therefore , the present study aimed to investigate the independent influence of the affected upper and lower limb , trunk , and unaffected side function on adl using partial correlation analysis . the study cohort included 77 stroke patients ( 53 males and 24 females ) who were admitted to the northern fukushima medical center between october 2010 and november 2013 . they fulfilled the following inclusion criteria : first stroke ; unilateral supratentorial hemispheric lesion ; absence of marked cognitive deterioration [ 5 cognitive items of the functional independence measure ( fim)11 , described below ] ; and unilateral spatial neglect based on the stroke impairment assessment set12 ( sias ; described below ) . the mean patient age was 68.5 years , and the mean time from stroke onset was 84.8 days . subject characteristics are listed in table 1table 1.stroke-related characteristics of study subjectsmeansdrangeage , years68.512.73693time post - stroke , days84.837.437236males , % 69.2right - sided hemiparesis , % 48.8affected upper limb function ( 010)6.43.0010affected lower limb function ( 015)11.73.8115trunk function ( 06)5.31.006unaffected side function ( 06)5.30.926barthel index ( 0100)86.817.75100motor item of fim ( 1391)73.316.02291fim : functional independence measure . the study protocol was approved by the institutional ethics review board of northern fukushima medical center ( fukushima , japan ) . fim : functional independence measure we compiled data on motor function , trunk function , and unaffected side function from the sias , barthel index ( bi)13 , and fim evaluations . the sias test ( 05 ) items evaluate motor function of the affected limb ( knee - mouth , finger function , hip flexion , knee extension , and foot - pat tests ) , the trunk ( abdominal muscle strength and verticality ) , and the unaffected side ( strength of knee extension and grip strength ) . details on the method , reliability , and validity of sias have been reported elsewhere12 , 14,15,16 . in addition , the independence index of adl was determined using the bi and motor items of the fim scoring system . in the present study , the affected upper limb function was calculated from the total score of the knee - mouth and finger function tests . lower limb function was calculated from the total score of the hip flexion , knee extension , and foot - pat tests . furthermore , trunk function was calculated from the total score of the abdominal muscle strength and verticality tests , and the unaffected side function was calculated from the total score of grip strength and knee extension strength tests . we used simple correlation and partial correlation analyses to remove the effect of age and other motor function parameters ( affected upper limb , lower limb , trunk , and unaffected side function ) , and estimated the independent effect of the affected upper limb , lower limb , trunk , and unaffected side functions on bi or fim . all correlations were investigated using spearman s rank correlation analysis with spss version 22.0 for windows ; p values < 0.05 were considered statistically significant . it was observed that half of the patients ( 48.8% ) had right - sided hemiparesis , with mild to moderate impairment of the upper and lower limbs . simple and partial correlation analyses were conducted between the parameters of motor function ( affected upper limb , lower limb , trunk , and unaffected side function ) and adl ( bi or fim scores ) ( table 2table 2.simple and partial correlation analyses between motor functions and indexes of activities of daily living ( fim and bi ) in stroke patientssimple correlation ( n=77)partial correlation ( n=77)fimbifimbiaffected upper limb function0.31**0.34**0.020.07affected lower limb function0.51**0.51**0.48**0.42**trunk function0.37**0.33**0.150.13unaffected side function0.38**0.34**0.32**0.27*values are spearman s rank coefficients ; * * p0.01 . fim : functional independence measure ; bi : barthel index ) . moreover , simple correlation analyses revealed significant positive correlations for all comparisons . partial correlation analyses generated remarkably different data when the effect of age and other body part functions on adl were excluded . significant positive correlations were found between the affected lower limb or unaffected side function and bi or fim . in contrast , there was no significant correlation between the affected upper limb or trunk function and bi or fim . this discrepancy is explained by the strong functional interactions between the affected upper limb and lower limb functions and between the trunk and unaffected side functions ( table 3table 3.simple correlation analyses between motor functions in stroke patientsaffected u / l functionaffected l / l functiontrunk functionunaffected side functionaffected u / l function0.68**0.010.08affected l / l function0.68**0.140.03trunk function0.010.140.39**unaffected side function0.080.030.39**values are spearman s rank coefficients ; * * p0.01 . fim : functional independence measure ; bi : barthel index ; u / l : upper limb ; l / l : lower limb ) . fim : functional independence measure ; bi : barthel index values are spearman s rank coefficients ; * * p0.01 . fim : functional independence measure ; bi : barthel index ; u / l : upper limb ; l / the present study provides insightful information on the relationship between motor function and adl in stroke patients . the ongoing debate on motor functions affecting adl was resolved by designing partial correlation analysis protocols considering the possible interactions between body parts . simple correlation analysis suggested that the affected upper limb , lower limb , unaffected limbs , and trunk influence adl performance . in contrast , partial correlation analysis , excluding age and the influence of other body parts , revealed the absence of correlation between the affected upper limb or trunk function and adl in stroke patients . this discrepancy was explained by the strong interactions between the affected upper and lower limb functions and between trunk and unaffected side functions . this new information on motion dynamics in stroke patients should lead to the development of more efficient rehabilitation programs . this study demonstrates that adl performance in stroke subjects is hindered more by the affected lower limb than by the unaffected side . previous studies reported that balance2 , gait17 , 18 , and stair19 performance are affected by lower limb function . thrane et al.20 reported that the affected lower limb function is associated with self - care dependency . further , the present study also indicates that the affected lower limb function plays an important role in adl . we established a considerable relationship between the unaffected side function and adl , based on the strength of the quadriceps muscle of the lower limb and the grip strength . it has been reported that the strength of quadriceps muscle influences sit - to - stand21 and transfer22 activities in stroke subjects . colebatch et al.24 indicated that the strength of muscles ipsilateral to the lesion was reduced in hemiplegic patients compared with healthy subjects . therefore , rehabilitation programs aiming to improve adl should target the muscle strength on the unaffected side . the lack of correlation between the affected upper limb function and adl may be explained by the fact that most activities can be performed with the unaffected upper limb . further , previous studies mentioned that the upper limb function is required to reach a certain threshold before performance actually starts to increase25 , and improvement in the functional limitations of the upper limb does not necessarily lead to a full recovery of adl function26 . therefore , there may be a non - linear relationship between the affected upper limb function and adl . thrane et al.20 reported no significant relationship between the affected upper limb impairments and adl using lower limb function as covariate , as in our study . thus , the impact of upper limb function impairments on everyday activities may be lower than expected27 . the close relationship between trunk function and adl has been reported by previous studies4,5,6,7 , 9 . however , to the best of our knowledge , this is the first study to identify the independent effect of trunk function on adl using partial correlation analysis . in addition , our results suggest that the impact of trunk function on adl is lower than expected . however , the average score of trunk function in our patients was very high , suggesting that a relationship between trunk function and adl could have been missed due to the ceiling effect . therefore , this result should be carefully interpreted . first , simple and partial correlation analyses can only detect linear relationships between two variables . . the correlations between each motor function and adl may differ depending on the adl independence level .

[ purpose ] this study aimed to clarify the independent impact of the affected upper and lower limb , trunk , and unaffected side motor functions on activities of daily living in stroke patients using partial correlation analysis . [ subjects and methods ] this retrospective study included 77 stroke patients . motor functions were assessed using the stroke impairment assessment set , and the activities of daily living performance was assessed using the barthel index or functional independence measure . further , simple and partial correlation analyses were conducted between each motor function and activities of daily living parameter . [ results ] simple correlation analysis identified significant positive correlations for each pair . in contrast , partial correlation analysis only identified significant positive correlations between the affected lower limb or unaffected side functions and the barthel index or functional independence measure . this discrepancy between the two tests was explained by the significant interaction between the affected upper and lower limb functions and between the trunk and unaffected side functions . [ conclusion ] the present study identified the affected lower limb and unaffected side motor functions as the major determinants of activities of daily living performance in stroke patients . these findings suggest that rehabilitation programs can be improved by targeting these areas .

You are an expert at summarizing long articles. Proceed to summarize the following text: many children 's intakes of nonmilk extrinsic sugars ( nmess ) and saturated fatty acids ( sfa ) fail to meet dietary targets for these nutrients . diets high in nmes and sfa are likely to contribute to the continued high prevalence of obesity and overweight amongst children . the scottish government has taken several steps to try to improve children 's diets , including interventions in the school setting . the schools ( health promotion and nutrition ) scotland act , passed in 2007 , sets out nutritional standards for school meals and prohibits the sale of foods high in sugar in primary and secondary schools ( e.g. , confectionery and sweetened soft drinks ) and limits the sale of foods high in fat ( e.g. , fried foods and most snacks ) . once the act was implemented across all schools in scotland , attention turned to some of the other factors which could be influencing school - aged children 's diets . one suggestion was to address children 's purchasing of food and drinks high in fat and/or sugar in outlets found in the vicinity of schools . such outlets are referred to in scotland 's obesity route map action plan as being beyond the school gate . evidence suggests that the presence and geographical density of food outlets ( this includes restaurants and stores ) influences the diet of local people , including children and adolescents , thereby contributing to the so - called obesogenic environment [ 4 , 5 ] , though whether that influence is positive or negative , in terms of impacting on rates of obesity and diet quality , is uncertain [ 6 , 7 ] . it is clear , however , that the local food environment is associated with socioeconomic inequalities in diet , obesity , and health , though the evidence is mixed regarding an association between deprivation and the prevalence of fast food outlets [ 8 , 9 ] . there is little evidence in scotland of the extent to which children access food and drink in outlets beyond the school gate , though one study involving older children ( aged 1416 years ) at three schools in scotland reported that over half of young people left the school grounds every day to purchase food and that factors associated with personal liberty ( e.g. , being treated as an adult at local stores and a desire to make a personal choice about where to eat ) influenced decisions to purchase food beyond the school gate . another study found that some children wanted to escape the school environment at lunchtime . in england , an in - depth study of two secondary schools found that food bought in shops close to schools contributed 23% to children 's energy intakes , a quarter of which came from total sugars ( 15% from nmes ) . of the children given permission by schools to leave the grounds at lunchtime , at least 97% purchased food outside school . many schools in the uk do not allow children to leave the school grounds during the school day , particularly younger children , which could act as a barrier to purchases beyond the school gate , at least for those who obey the rules . however , many secondary school canteens are not big enough to seat all their students and canteens are often reported by young people to be noisy , unpleasant , and offering a poor choice of food [ 79 ] ; therefore , such factors can act as pushes for children to seek food and drink elsewhere , regardless of the rules about leaving the school grounds . children can also purchase food and drink on the way to or from school ( and during break times and free periods ) ; therefore , lunchtime is not the only opportunity for purchases to be made . as there are reported to be an average of 24 food outlets around secondary schools in one large city in scotland , there is certainly opportunity for local outlets to attract young consumers with price promotions and a fast service , both of which are thought to be important factors within the local food environment . the limited evidence from within the uk and scotland more specifically and the recent policy spotlight on food and drink purchasing beyond the school gate informed the decision to develop a new survey module on food purchasing behaviour , as part of the 2010 survey of diet among children in scotland . this was the first attempt to obtain data from a representative sample of children in scotland about their food and drink purchasing habits beyond the school gate and was therefore an important first step towards considering whether such purchases influence dietary intakes of nmes and sfa . the overall aim of the food purchasing module ( fpm ) was to assess the food and drink purchasing habits outside of school on school days among primary ( aged 811 years ) and secondary ( aged 1116 years ) school children living in scotland . the specific objectives were the following.to assess the opportunities for children to purchase food and drink outside of school.to estimate the proportion of children purchasing food and drink outside of school.to identify the types of foods and drinks children are purchasing outside of school . to explore some of the factors that influence whether children go outside of school to purchase food or drink.the aim of this paper is to describe the development of the food purchasing module ( fpm ) . to assess the opportunities for children to purchase food and drink outside of school . to estimate the proportion of children purchasing food and drink outside of school . to identify the types of foods and drinks children are purchasing outside of school . to explore some of the factors that influence the fpm was designed to be administered as part of the 2010 survey of diet among children in scotland . the dietary survey aimed to monitor dietary trends of children in scotland and was similar to the design of the earlier 2006 survey of sugar intake among children in scotland , which entailed parents and children completing a food frequency questionnaire ( ffq ) before taking part in a face - to - face computer assisted personal interview ( capi ) with an interviewer . several decisions had to be made about the design of the new fpm , including whether to include all school - aged children in the sample , how to deliver the fpm to children alongside the dietary survey , which time points around the school day to ask children about , and how best to design questions which would address the study 's objectives . whilst the main dietary survey included children aged 316 years , the fpm was concerned with food and drink purchased by children for themselves during the school day ; therefore , children aged 3 - 4 years were automatically excluded as they had not yet reached school age . it was felt that most children aged 57 years would be unlikely to purchase food for themselves therefore they were also excluded . it was considered that some children may not wish to discuss their food and drink purchasing behaviours in front of their parents ; therefore , some questions were designed to be delivered through a self - completion paper questionnaire ( scq ) and other less sensitive questions would be delivered through the capi of the main dietary survey . the capi was designed so that parents of primary school children ( aged 811 years ) would answer the questions , with some input from the child , whilst secondary school children aged 1116 years would complete the capi themselves with input from their parent(s ) as needed . the authors considered that children are likely to display different behaviours with regard to food and drinks purchased at different points during the school day ; therefore , questions were designed to assess purchasing behaviour at four time points : ( i ) on the way to school , ( ii ) at break time and during free periods , ( iii ) lunchtime , and ( iv ) after leaving school . whilst the rules about secondary school children leaving school during break and lunchtime are variable across schools in scotland , it was felt that very few primary school children would be allowed to leave school during break or lunchtime ; therefore , children aged 811 years were asked questions about food purchasing on the way to / from school only . the survey concentrated on all 4 time points for secondary school children aged 1116 years . in order to address the fpm objectives , it was important to consider and define what constituted opportunities for purchasing food and drink on the way to / from school and it was agreed that this meant the child walking or cycling past places selling food or drinks . it was felt that going past places selling food or drinks in a car , bus , taxi , or other vehicles did not represent an opportunity for children to purchase anything , without requesting the adult driving the vehicle to stop . at break time / free periods and lunchtime , the opportunity to purchase food or drinks was defined as the child being able to get to places outside of school that sell food or drinks . opportunities to purchase were based on parents ' and children 's perceptions of the type of places they considered accessible and whether they perceived that these outlets sell food or drinks . the fpm made it clear that we were interested in food and drinks children purchased themselves ; this was designed to exclude purchases made for them by adults or other children . it is worth noting that the fpm was concerned with the purchasing of food and drinks ; therefore , this might not relate to consumption as we can not determine if the food and drinks purchased were actually consumed . when deciding which factors to explore in relation to reasons for children purchasing food and drinks outside of school , we drew on the authors ' expertise and other relevant research and literature [ 1012 , 14 ] . the factors asked about in relation to buying food / drink on the way to / from school included purchasing food because of hunger / thirst , copying friends , not having anything to eat / drink from / at home , and wanting food / drink to eat later . in relation to leaving school at break / free periods or lunchtime questions were asked about wanting a break from school , preferring the food sold outside school , and exercising choice about where to purchase food . questions were also asked about why children did not leave school at break and lunchtime including , not having enough money , having nowhere to go , not being hungry / thirsty , taking food / drink to school from home , not having time to purchase anything , and preferring to purchase food / drink at school . whilst the questions exploring the reasons for purchasing / not purchasing food and drinks are not exhaustive , they provide baseline information from a representative sample for the first time and can be developed further in future surveys . the main study received ethics approval from the nat cen social research ethics committee ; the cognitive testing phase received ethics approval from the university of aberdeen 's college ethics review board . as this was a new survey module , cognitive testing was carried out to check if children understood the wording and routing of the questions and could navigate the self - completion questionnaire . seventeen interviews were conducted with primary and secondary school children , and five interviews were conducted with parents who had primary school - aged children . during the cognitive interviews , children and parents were asked to describe what they were thinking as they tried to navigate the scq or answer the capi questions . observations were recorded about the way each child or parent worked their way through the module questions ( e.g. , whether they read the instructions for each section ) . children completed the scq without help from the interviewer , to replicate the main stage of the survey , and , similarly , the capi was administered exactly as it would be administered in the main phase of the survey . the interviewer also probed participants about their understanding of some of the terms used in the questions , to determine if children and parents understood them in the way intended . the cognitive interviews highlighted that primary and secondary school children found navigating their way through the scq problematic and that primary school children struggled to complete the scq . however , there were few problems with the interview - based ( capi ) questions as they were originally designed . nearly all the primary school children had problems navigating through the scq and could not follow the routing of the questions ( e.g. , being asked to go to question 6 if they gave a negative response to an earlier question ) ; this caused the majority of their problems with the scq . some of the youngest children were not able to read words in some of the questions or did not know what the words meant . some did not understand the instructions at the start of the questionnaire while others did not read the instructions at all . questions asking about the type of food or drinks purchased outside of school created a lot of confusion among the primary school children as they were unsure what food this related to in their day . children 's interpretation of some of the terms used to describe foods was probed and in general their understanding was good . the term packets of snacks ( which referred to savoury snacks ) was interpreted by most children to mean sweet snacks . most children were familiar with the terms diet and non - diet drinks but the majority of secondary school children did not read the instructions at the start of the questionnaire and went straight to the first question . most of them had some problems navigating through the questionnaire following the routing of the questions . most of them did not read or follow the go to instructions . all secondary school children appeared comfortable completing this type of self - completion questionnaire , perhaps because they are regularly asked to complete this style of questionnaire at school . children in this age group understood the meaning of the food and drinks as intended . as with the primary school children though , packets of snacks tended to be interpreted as sweet foods . it was apparent that examples were required to illustrate some of the types of foods . following the cognitive interviewing , some changes were made to the wording of the questions , but the main changes were made to the delivery of the fpm . it was decided that the problems that primary school children had completing the scq meant it would work better if all questions were incorporated into the computer - assisted personal interview ( capi ) . some routing problems were also observed with the secondary school children , mainly due to children not reading or not following the instructions . to try and limit this problem , some of the questions were incorporated into the capi which meant the interviewer could then score out some questions in the scq , based on the capi answers given , to prevent children mistakenly answering some questions in the scq . for example , if children said they never bought food at lunchtime , the interviewer could score out the questions relating to purchases made at lunchtime in the scq . the routing instructions that remained in the scq were highlighted more clearly in the final version of the questionnaire . the questions included in the final capi and scq are outlined in table 1 for younger and older children . the main dietary survey aimed to achieve a representative sample of 1500 children aged 316 years . it was designed to be representative of children living in scotland in terms of sex , ethnicity , urban - rural distribution , and age distribution . in the main dietary survey , 1906 further details about sampling are available in the published reports [ 13 , 16 ] . fieldwork for the fpm was conducted between june and november 2010 . when interviews were conducted during the school holidays , parents and children all eligible primary school children from the dietary survey completed the fpm ( n = 564 ) . of the eligible secondary school children ( n = 653 ) , 615 ( 94% ) completed the scq questionnaire . there were no significant differences in response rates to the scq by sex or levels of socioeconomic deprivation . despite making changes based on the findings from the cognitive testing phase , there were several errors in the scq data because of navigation and routing problems . when such errors occurred , children were excluded from the analysis as it was impossible to know which responses were correct . for example , if a respondent answered that they did not purchase food or drinks on the way home from school but then answered the questions about the type of food and drinks purchased at that time point , they were deemed as not purchasing food and drinks on the way home from school and were excluded from the analysis of food and drink purchasing at this time point . decisions about such navigation and routing errors had implications for the numbers available for the subsequent analysis , as indicated by figure 1 . this is the first time a survey has been developed on food purchasing behaviour beyond the school gate using a nationally representative sample of children in scotland . the results from this survey provide an overview of the food and drink purchasing habits of school children in scotland and an insight into the issue of school children purchasing food and drinks high in fat and/or sugar on the way to and from school and in the vicinity of the school grounds at break times and lunchtime . designing a module on a new topic presents several challenges . as the overall prevalence of food and drink purchasing outside of school was unknown at the time the study was designed , it was not possible to estimate in advance what size of sample would be required to provide sufficient numbers of children making purchases who could be asked detailed follow - up questions . as a consequence , a limitation of the results from the new module was the available sample size for exploring differences between subgroups ( e.g. , by age or deprivation quintile ) and for exploring the influences on children 's purchasing behaviour . the fpm data can now provide an estimate of the sample size required to ask more detailed follow - up questions and make comparisons between subgroups in future surveys . importantly , developing the fpm and reporting on the process of this development provides much needed information about children as survey respondents . it is crucial that children are given the opportunity to report on their own lives as information provided by proxy , from their parents , for example , does not usually result in data that is as accurate . the combined use of the capi and scq data collection methods for secondary school children sometimes led to inconsistencies between the answers given in each mode , which meant that not all of the data could be used in the analysis . some of these inconsistencies may have resulted from children choosing not to accurately disclose their purchasing habits in the presence of a parent or guardian during the capi ; only 46% of secondary school children reported in the scq that they sometimes or always told their parents what foods or drinks they purchased at lunchtime , perhaps indicating that a significant proportion did not routinely discuss their food choices with parents and therefore might not be comfortable in doing so . inconsistencies between the capi and scq may also have stemmed from a social desirability effect ( e.g. , wanting to answer all the questions to please the interviewer or their parents ) as well as some children getting confused by the scq routing instructions . the decision about which questions to include in the capi was largely driven by a judgment about which were the least potentially sensitive topics . in many cases , it was also driven by the complex routing of questions ; capi methods are preferable to self - completion methods in such cases , as routing errors are eliminated in capi as the computer programme automatically routes respondents to the next appropriate question , based on their previous responses . complex questions can be difficult to answer for any respondent , not just children , and it was appropriate to ask children themselves about their own purchasing behaviours , rather than their parents , although this was not achieved to the same extent with regard to primary school children who were not given the option of a scq following the lessons learnt during the cognitive testing phase . given that interviewers asked the parents or guardians of children under 12 questions in the capi , rather than asking the child directly , this may have also influenced the accuracy of the data collected . despite these limitations , the survey provides timely and unique information about this important topic and has generated some useful methodological insights for future studies . for example , a computer - assisted self - completion interview ( casi ) in which the children read questions on screen and input their own answers ( as opposed to the capi which is interviewer administered ) would be an alternative to the paper - based self - completion questionnaire and would help avoid future errors due to confusion with routing and overcome the issue of answering sensitive questions in front of parents or guardians . casi methods were not appropriate for this study because it would have added to the interview length ( the paper - based scq was completed by the children while the adult continued with the capi ) . whilst casi methods are ideal for older children , an audio - casi could also be developed for use with younger children or those with literacy problems . this would involve children listening to questions via headphones ( rather than reading text on screen ) and inputting their answers directly onto a computer or tablet . the survey format provided an appropriate method for exploring this topic , but a number of questions were raised which warrant further investigation . using qualitative methodologies to explore food and drink purchasing beyond the school gate would facilitate an in depth understanding of some of the factors influencing children 's purchasing behaviour . such an approach would help uncover and explain the complexity of children 's food and drink purchasing practices including exploring possible contradictions in their behaviour . the reasons children gave for leaving the school grounds at lunchtime and for purchasing / not purchasing food and drink were based on the list of reasons developed by the research team , which drew on their expertise and also on the relevant literature in this area . qualitative work would allow children to voice their own reasons for purchasing food and drinks . the fpm module recorded the types of outlet which were most often used by children during the school day , but the survey could not explore in - depth why some outlets were used and not others , despite opportunities to purchase at a range of outlets . qualitative research would help answer these questions and facilitate further exploration of the way that food and drink purchasing beyond the school gate might be contributing to children 's intakes of nmes and sfas . assessing the availability and purchasing of energy dense foods by children from outlets in the vicinity of schools , termed beyond the school gate , is an important policy goal in scotland and has relevance to other countries where obesity is a problem . a number of methodological issues were raised during the development of the survey module , including that younger children experience problems using a self - completion questionnaire and that older children do not always successfully navigate a scq . the need to respect children 's rights not to disclose their food and drink purchasing habits in front of parents is an important consideration and should inform the way that future surveys are developed . the fpm can be developed further , alongside qualitative research to look in more depth at the issues covered by the survey .

many children eat a diet which supplies a higher than recommended amount of nonmilk extrinsic sugars and saturated fatty acids . the school setting is often targeted for nutrition intervention as many children consume food at school . in scotland , attempts have been made to improve the nutritional content of food in schools and attention has now turned to food and drink available beyond the school gate . this paper describes the development of a module on food and drink purchasing behaviour . the food purchasing module was designed to collect data , for the first time , from a representative sample of children aged 816 years about food and drinks purchased on the way to / from school , during break time / free periods , and at lunchtime , from outlets around schools . cognitive testing of the module highlighted that younger children find self - completion questionnaires problematic . older children have fewer problems with self - completion questionnaires but many do not follow question routing , which has implications for the delivery of future surveys . development of this survey module adds much needed evidence about effectively involving children in surveys . further research exploring food and drinks purchased beyond the school gate is needed to continue to improve the nutritional quality of children 's diets .

You are an expert at summarizing long articles. Proceed to summarize the following text: a 4yearold , female spayed beagle was referred for a history of gait abnormalities ( present since birth ) , intermittent urinary incontinence , and generalized seizures which were present since 2 years of age and had been treated by administration of phenobarbital . the dog appeared to walk on the digits ( tiptoes ) with all 4 limbs in rigid extension during ambulation ( fig 1a ) . physical examination revealed a broad skull with wideset eyes ( fig 1a ) , characteristic ridge within the ear cartilage ( fig 1b ) , brachydactyly of the outer toes , pronounced skeletal muscle definition , mild bilateral carpal valgus deformity , decreased to absent range of motion in joints of all 4 limbs , and a grade ii / vi intermittent left basilar systolic murmur . no other abnormalities apart from the gait and tail abnormalities were detected on neurologic examination , although flexor withdrawal reflexes were difficult to evaluate due to decreased range of motion . image of case 1 illustrating the tiptoe posture and characteristic facial features ( a ) , and folded ear ( b ) . cbc revealed panleukopenia ( 2.99 10/l , reference range 617 10/l ) , mature neutropenia ( 2.24 10/l , reference range 312 10/l ) , lymphopenia ( 0.54 10/l , reference range 15 10/l ) , and eosinopenia ( 0.03 10/l , reference range 0.11.25 10/l ) . a repeat cbc performed 2 weeks later and after gradual discontinuation of phenobarbital revealed resolution of the pancytopenia . the thoracic radiographs revealed a vertebral heart score of 12.25 ( reference range 8.710.7)1 with no cardiopulmonary changes noted . the ecg revealed a sinus arrhythmia with a mean electrical axis of + 30 and one of the criteria for left ventricular enlargement ( r > 1.0 in lead i ) . the echocardiogram revealed turbulent flow across both the left and right ventricular outflow tracts , but no valvular changes , wall thickening , or chamber dilatation were identified . csf analysis showed that nucleated cell counts and protein concentration were within reference range , with vacuolated mononuclear cells suggestive of lipid / myelin phagocytosis . electromyography ( emg ) of the palmar and plantar interossei , flexor carpi ulnaris , extensor carpi radialis , biceps , triceps , supraspinatus , infraspinatus , lateral gastrocnemius , medial gastrocnemius , cranial tibialis , biceps femoris , vastus lateralis , semimembranosus , semitendinosus , and tail muscles revealed mildly increased insertional activity in several muscle groups ( palmar and plantar interossei , flexor carpi ulnaris , semimembranosus , semitendinosus , and tail ) , but no spontaneous activity was identified . due to the sporadic nature of the findings and lack of consistent nerve distribution patterns , the increased insertional activity was most likely not clinically relevant . biopsies were obtained from the cranial tibial muscle and either flashfrozen in isopentane precooled in liquid nitrogen or fixed in 10% neutralbuffered formalin and paraffinembedded . no abnormalities were identified that would suggest a congenital myopathy or muscular dystrophy . compared to an agematched control , no expansion of endomysial or perimysial connective tissues was found , and localization of these proteins was appropriate , based on cryosections incubated with monoclonal or polyclonal antibodies against collagen vi and laminin 2 ( gifts from eva engvall ) ; and fibrillin1 ( polyclonal antibody 9543 ) , fibrillin2 ( polygonal antibody 868 ) , and fibrillin3 ( monoclonal antibody 689 , gifts from lynn sakai ) . stainings also included antibodies against dystrophin ( dys1 ) , utrophin ( ncldrp2 ) , and developmental myosin heavy chain ( dmhc ) ( all from novocastra laboratories ; leica biosystems inc , buffalo grove , il ) , and sarcoglycan ( gift from eva engvall ) . results of tests for organic acid and amino acid analysis ( biochemical genetics laboratory , university of california san diego , lajolla , ca ) , carbohydrate screening , and a mucopolysaccharide spot test ( penngen laboratory , university of pennsylvania , philadelphia , pa ) in urine were negative . an 11weekold , male beagle puppy was referred for difficulty righting and stiff gait . the pup was among a litter of 6 , 2 of which died at 1 day of age . of the remaining 4 puppies ( 2 males and 2 females ) , this was the only affected puppy . the breeders did not notice any abnormalities until the puppy was 9 weeks of age , at which time he began having trouble righting himself and appeared stiff . the stiffness was progressive with concurrent development of characteristic facial features , including broad skull and wideset eyes . the disposition of the affected pup was purportedly very placid compared to unaffected littermates . on physical examination , the puppy had thick skin , a broad muzzle , and wideset eyes diagnostic examinations included electrophysiologic evaluation ( emg , mncv of the tibial nerve , repetitive nerve stimulation , and brainstem auditoryevoked potentials ( baep ) ) , all of which were within reference ranges . on postmortem examination of case 2 , lesions were consistent with widespread accumulation of collagen . skin was diffusely thickened with extensive fibrosis of the hypodermis and adhesion to underlying layers . collagen and connective tissue surrounding kidney , adrenal glands , lymph node capsule , small intestine , esophagus , testes , trachea , pinnae , stomach , urinary bladder , heart , and dura was dense . staining with picrosirius red showed birefringent red / green fibers characteristic of collagen in vessel walls and interstitium of organs . the epimysium surrounding some entire muscles was excessive and comprised of dense collagen ( not shown ) , and in some cases , it was restrictive ; however , perimysial and endomysial connective tissue between muscle fascicles and individual myofibers , respectively , appeared normal ( fig 2 ) . muscle bundles contained almost no fat ( appropriate for age ) , and the epimysial connective tissue was a dense seam of tissue containing blood vessels . ligaments and , to a lesser extent , tendons diffusely contained an increase in tenocyte nuclei , and there were small foci of mineralized mucinous matrix ( sections with ligamentum nuchae were especially affected ) . nerve fibers in the sciatic nerve were surrounded by visible , but not excessive , endoneurium . several focal areas of replacement of cortical bone with fibrous tissue were present in the digit ( p2 ) , rib , and ulna . a region of the central cartilage of the pinnae was thickened in a vertical line ( similar to fig 1b ) . abnormalities were not detected in other organs , including the brain and peripheral pulmonary airways . immunofluorescence staining of muscle cryosections from a beagle dog with musladinlueke syndrome ( case 2 ) and agematched but not breedmatched control muscle . staining was performed for localization of laminin 2 , the rod domain of dystrophin , utrophin , sarcoglycan , collagen vi , fibrillins , and developmental myosin heavy chain . the endomysial ( surrounding individual muscle fibers ) and perimysial connective tissue layers ( surrounding muscle fascicles ) did not differ from control muscle . regenerating fibers were not observed with the antibody against developmental myosin heavy chain . in the figure , fibrillin 9543 binds to fibrillin 1 , fibrillin 868 binds to fibrillin 2 , and fibrillin 689 binds to fibrillins 1 , 2 , and 3 . both cases were homozygous for a founder mutation in the adamtsl2 gene on cfa 9 , indicative of musladinlueke syndrome , as previously reported.2 further characterization of fibroblasts was performed to evaluate the functional effects of musladinlueke syndrome on tissues . skin samples were minced and plated , allowing cells to adhere to tissue culture plates ( mls 1 , 2 ; control 1 , 2 ) , or tissue was further enzymatically dissociated ( controls 3 , 4 , 5 ) using 0.1% collagenase ( cls4 , worthington biochemical corporation ) and 0.05% elastase ( worthington biochemical corporation ) . as mls fibroblasts grew slower than fibroblasts from control dogs , they were plated at higher density to ensure that control and mls fibroblasts reached confluency at the same time . after reaching confluency , cells were cultured for another 2 days in 10% fbs to allow matrix synthesis and were incubated for 2 days in serumfree media . subsequently , their conditioned medium was used to assess tgf secretion , and cellular smoothmuscle actin ( sma ) expression was assessed by immunofluorescence . the total tgf in medium was measured by elisa ( promega ) in triplicate , and the tgf reading was conducted immediately after obtaining primary cell lines . high tgf levels were detected in media from the mls fibroblasts ( case 2 ) , whereas no free tgf was detected in the wildtype sample ( control dog 1 ( ctl1 ) ) ( fig 3a ) . dermal fibroblasts from case 2 and from 4 control adult dogs of unknown genetic background ( ctl1 , ctl3 , ctl4 , ctl5 ) were stained with antialpha sma antibody ( clone 1a4 , sigma 2547 ; diluted 1/400 ) and analyzed by flow cytometry . fibroblasts from case 1 and control dog 2 ( ctl2 ) were not included in the flow cytometry analysis due to a lack of sufficient cells . whereas fibroblasts from 3 of the control dogs ( ctl1 , ctl3 , ctl5 ) expressed only low levels of sma , and fibroblasts from control dog 4 showed both low and high expressing populations , mls fibroblasts ( case 2 ) showed uniformly high sma expression approaching that of smoothmuscle cells ( smc ) ( fig 3b ) . sma expression was also assessed by immunofluorescence staining3 and confirmed high sma expression in mls fibroblasts ( case 2 ) ( fig 3c ) . in addition , by immunofluorescence , mls fibroblasts from case 1 were also found to express high levels of sma ( fig 3d ) . to test contractility , 3 10 skin fibroblasts from case 2 and 5 control dogs ( ctl1 through ctl5 ) were seeded into collagen gels , and each sample was assayed in triplicate for the extent of contraction , as previously described.3 mls fibroblasts showed significantly enhanced contractility ( fig 4a , b ) . to assess whether there was a correlation between sma expression and contractility , wholemount sma staining of contracted collagen gels was performed , which also showed strong sma staining in the mls cells ( fig 4c ) . skin fibroblasts from mls dogs ( mls 1 , case 1 ; mls 2 , case 2 ) exhibit characteristics of myofibroblasts . mls fibroblasts secrete high levels of tgf ( a ) and express the myofibroblast marker smoothmuscle actin determined by ( b ) flow cytometry and ( c , d ) immunofluorescence ( sma , green nuclei ; dapi , blue nuclei ) . mls cells contract collagen gels more efficiently than fibroblasts from control dogs ( mls 2 , case 2 ) . shown are representative images of gels after contraction ( a ) , and the percentage of the original surface area after contraction ( mean sem of 3 independent experiments ) ( b ) . the significance of the difference between the mls and control samples was determined with a student 's ttest ( tails 2 , type 1 ) , and the p values were found to be < .05 ( * ) , < .01 ( * * ) and < .0003 ( * * * ) . the difference between mls and ctl 4 was not significant . sma fluorescence of cells in contracted collagen gels ( nuclei are stained blue using dapi ) shows comparable cell density but stronger sma staining and extended morphology of mls cells ( c ) . a variety of mutations affecting different regions of the adamtsl2 gene ( including the p.r221c substitution identified in mls ) in humans leads to a severe connective tissue disorder , autosomalrecessive geleophysic dysplasia ( gd ) type 1.4 , 5 adamtsl2 interacts with the microfibrilforming extracellular matrix ( ecm ) glycoproteins fibrillin1 and fibrillin2 , as well as with latent tgf binding protein 1 ( ltbp1).4 , 6 , 7 dominant gd is caused by mutations affecting fbn1,6 and a fibrillin1 defect in mice ( tight skin ( tsk ) ) also results in severe fibrosis.2 , 8 tight skin , however , has not been observed in adamtsl2/ mice , which die at birth with severe bronchial occlusion . this and additional differences among gd , mls , and mouse adamtsl2 knockouts are discussed.7 , 9 , 10 because of the established role of fibrillin microfibrils and ltbp1 in sequestering and maintaining the latency of tgfs , it is thought that the ecm defects arising from the absence of adamtsl2 lead to tgf dysregulation . excess tgf activity is thought to lead to fibroblastmyofibroblast transition.10 , 11 a potential link to altered tgf signaling is also strengthened by finding ltbp3 mutations in gd.12 gd type 1 is a progressive disorder in which affected individuals have a short stature , brachydactyly , thick skin , restricted joint mobility , and a happy face due to characteristic facial features.5 , 13 , 14 , 15 , 16 the name geleophysic dysplasia comes from the greek words geleos , meaning other findings in individuals with gd can include hepatomegaly , tracheal stenosis , pseudomuscular hypertrophy ( due to excessive collagen ) , and cardiac disease characterized by thickening of mitral , pulmonary , and aortic valves.5 , 13 , 14 , 15 , 16 the cardiac and tracheal abnormalities of gd lead to death in 33% of affected individuals before the age of 5.14 the beagles described in this report exhibited a similar array of features ( table 1 ) , including brachydactyly of the outer digits , broad facial features including wideset eyes , a characteristic ear fold , fibrosis of the joints , and a pleasant disposition . some owners report that the skin is tight , which was not apparent in these cases . cardiac disease has been inconsistently reported in association with mls.17 seizures have also been reported in other affected beagles with this disease , which is consistent with case 1 , but no underlying etiology has been identified in the literature.2 , 17 in contrast to humans with gd in which the disease progresses rapidly , beagles with mls appear to stabilize at about 1 year of age and have a normal life span unless other congenital defects are present.17 clinical features of adamtsl2 mutations reported in dogs , humans , and mice mice with adamtsl2 deletion die shortly after birth . the anomalies were not seen in newborn mutant mice , but may possibly appear with maturity . conditional deletion of adamtsl2 in limbs leads to shorter limb bones and brachydactyly ( hubmacher d , apte , s.s . , unpublished data ) . of interest , the endomysial and perimysial connective tissue layers of muscle appeared to be preserved , whereas the epimysial layer surrounding the entire muscle was thickened . it is not clear whether collagen types differ between different connective tissue layers in muscle . although a duplicate screen of collagen vi , fibrillins , and laminin2 was not performed on skin as they were on muscle , extensive fibrosis ( ie , accumulation of collagen ) was documented on routine postmortem examination in case 2.2 in the adamtsl2 knockout mouse , the bronchial epithelial cells appear to be most severely affected , with muscle generally preserved or only mildly affected.7 this species difference could arise from the inability of affected mice to survive past birth , which could mask a progressive muscle or skin disorder , or to differences in the fibrillin repertoire of these species , because humans and dogs have 3 fibrillins , but mice only have 2 fibrillins.18 adamtsl2 is thought to selectively influence assembly of fibrillin1 , and fibrillin2 , or both through direct binding , and analysis of adamtsl2/ mice demonstrated an excess of fibrillin2 microfibrils in the bronchii.7 , 10 the variable phenotypic manifestation in different tissues could also depend on different fibrillin1/fibrillin2 ratios in specific tissues , and the degree to which other adamts proteins may be able to compensate,6 , 10 which then determine the effect of the adamtsl2 mutation.7 in this context , little is presently known about adamts proteins and fibrillins in canine tissues and during canine development . investigating this could be a complex undertaking , because in mice , for example , adamtsl2 mrna shows a dynamic expression pattern and was detected in developing skeletal muscle , as well as liver , bronchial and arterial smooth muscle , skin , nucleus pulposus of the intervertebral disk , perichondrium , pancreas , and spinal cord.7 , 19 analysis of dermal fibroblasts from mls dogs was necessarily limited and should be considered preliminary because of the lack of sufficient number of cells and of strain and appropriate agematched controls . nevertheless , the findings are consistent with previous work demonstrating the increase in soluble tgf and strongly suggesting myofibroblastic transition of the mls fibroblasts , represented by strong sma expression , and enhanced contractility within collagen gels.4 , 20 in summary , the present study expands on the clinical understanding of mls , provides additional tissue analysis , and limited cell analysis which supports a potential profibrotic effect of the mls mutation and a physiological antifibrotic role for adamtsl2 in some tissues such as muscle and skin . the clinical work was performed at the purdue university veterinary teaching hospital and the university of missouri veterinary medical teaching hospital . laboratory studies were performed at the cleveland clinic lerner research institute and the comparative neuromuscular laboratory , school of medicine , university of california san diego . the work was supported in part by nih awards ar53890 ( to sa ) and t32hl00791408 to hb ( training program in vascular biology and pathology , principal investigator , edward plow ) . a synopsis of the clinical findings in the dogs described in this study was previously published in a manuscript identifying the genetic basis of musladinlueke syndrome ( bader et al . this manuscript here presents a complete clinical description of the cases as well as previously unpublished laboratory research using tissue and cells from the cases .

musladinlueke syndrome ( mls ) , previously termed chinese beagle syndrome , is an autosomalrecessive connective tissue disorder characterized by extensive fibrosis of the skin and joints that was first identified in beagles in the 1970s . recent research identified a founder mutation ( c.660c > t ; p.r221c ) in the adamtsl2 gene in beagles with mls . here , we report the detailed clinical phenotype and laboratory findings in 2 beagles affected with mls . we discuss these findings in relation to the human disorder geleophysic dysplasia ( gd ) , which also arises from recessive adamtsl2 mutations , and recent findings in adamtsl2deficient mice .

You are an expert at summarizing long articles. Proceed to summarize the following text: consistent with the iom aim to improve health care effectiveness , an explicit goal of the pcmh is the attainment of optimal , patient - centered outcomes.2 the development of clinical outcomes measures relevant to primary care practice has been the focus of numerous recent efforts aimed at practice certification , public reporting , and pay for performance programs.4,5 over time , the reliability and precision of measures has improved , for example , by replacing single evidence - based process measures with measures of adherence to guidelines that incorporate multiple processes , e.g. , from proportion of 2-year - olds with an mmr vaccine to proportion of 5-year - olds with all recommended immunizations . nonetheless , clinical performance metrics for primary care remain limited in scope compared to , for example , the set of 146 quality of care indicators used by the national health service of the uk.6 the pcmh was built on a foundation of research on the effectiveness of primary care ; a comprehensive set of outcome measures would ideally include a variety of types of health conditions , including mental health conditions , and measurement of patient - experienced health improvement and outcomes.7 there are several challenges to measuring pcmh effectiveness . coordinated implementation of clinical information technology in us medical practices could substantially improve data collection for outcomes studies . in addition , some practice - level measures , such as cervical cancer screening and use of asthma controller medications , can be collected through paid claims and supplemented with laboratory or pharmacy data . the use of these data would be facilitated by the development of large multipayer administrative databases that aggregate data across public and private payers.8 the national quality forum is developing a set of national voluntary consensus standards for ambulatory care using clinically enriched administrative data.9 another challenge is that some outcomes , such as mortality rates or new events such as stroke or renal failure , may be too far removed temporally from the primary care process for them to be attributed to a particular practice . this can be addressed by measuring intermediate outcomes , such as blood pressure control , or evidence - based processes such as treatment intensification for high - risk patients in poor control of cvd risk - factors.10 a fourth challenge , the lack of power in individual practice panels to detect differences in major primary care sensitive health system events such as hospitalizations , emergency department visits , or re - hospitalization for patients recently discharged , can be met by examining these outcomes at the level of health system or community . patient - centeredness is a cornerstone of the pcmh.1 an explicit goal is to assure that patients get the indicated care when and where they need and want it in a culturally and linguistically appropriate manner.2 additional emphasis is placed on the robust partnership between physicians , patients , and the patient s family , with active participation by patients and families in health care decision - making and quality improvement activities within the practice.2 expanded access provides patients with alternate means of interacting with the medical practice , such as by phone , e - mail , or through interactive websites.2 measuring patient - centeredness as a pcmh outcome requires patient surveys that directly assess the extent to which patients needs , wants , and desires are met , their concerns are addressed , and they feel adequately engaged and able to provide input into both their personal health care decisions and the practice organization . the quality of the patient - physician relationship , particularly patient - physician trust , is an important part of the patient experience.1113 although the consumer assessment of healthcare providers and systems ( cahps ) clinician and group survey is a standardized survey that has been widely adopted to measure patient experience , it does not capture adequately all aspects of patient - centeredness . other measurement tools include the ambulatory care experiences survey ( aces ) , the primary care assessment survey ( pcas ) , ambulatory health literary , the patient assessment of chronic illness care ( pacic ) , the patient assessment of culturally competent care , and the patient outcomes survey.1418 a recent systematic review discusses the large number of patient experience measures used in europe.19 further work is needed to understand how well these existing tools can be adapted to measure patient - centeredness in the context of the pcmh and the optimal way to administer such surveys on a recurring basis . there are questions of when people should be surveyed ( at a fixed point in time or after a visit ) , who should be surveyed ( all patients , heavy users , ages ) , who should administer the survey ( the physician practice or an external source ) , and how many are needed . implementation of the pcmh , by focusing on increasing quality , coordination , and integration of care in addition to enhanced access , should result in fewer waits and delays , improving the timeliness of care in accordance with the iom aims . in recent years innovative scheduling systems such as advanced access have led to the development of practice - level metrics of timeliness , including demand and capacity , panel size , third next available appointment , future open capacity , and continuity of care.20,21 other measures may be equally important , including time to phone triage ( time left on hold and time until called back ) and cycle times ( time from showing up to leaving the office visit ) . as patient care interactions shift to interactive websites and e - mail , measures of time to response for these types of interactions are also needed . waits and delays in receipt of indicated care could also be measured , for example , time to receipt of colon cancer screening after patient s 50th birthday , time to patient receipt of test results , and time to medication adjustment ( e.g. , for patients with hyperlipidemia ) . although some of these measures might be available using claims databases , most would require new data collection from practices or patients.22 to the extent that the pcmh is able to meet its goals of integrating and coordinating care with specialists and other aspects of the health care system , other wait times should also decrease . declines might be seen , for example , in time to follow - up after emergency department visit or hospitalization , time to receipt of discharge summary by the primary care physician , time to physical therapy appointment , social services evaluation , or home health visit . there are several well - established hospital initiatives to decrease wait times and delays for receipt of interventions that could substantially alter the course of illness ( e.g. , door - to - balloon time for heart attack patients requiring angioplasty ) . in the outpatient arena such measures do not exist and would be much more complicated to measure . for example , time to first antibiotic dose after a positive chest x - ray for community - acquired pneumonia includes the time for a radiologist ( who is often located at an independent facility ) , to track down the appropriate provider with the x - ray results , the time for the provider to notify the patient of the results and prescribe the antibiotic , the time for the pharmacist to fill the prescription , and the time for the patient to receive the medication . while these measurements might be possible in a large integrated health system , measurement in the more fragmented setting of small community - based primary care practices and independent laboratories and radiology practices is much more challenging . the pcmh model requires increased investment in primary care practices through payment reforms.2 meanwhile , long - term cost savings may accrue to the health care system ( not necessarily the primary care practice ) through , for example , decreased redundancies , decreased overuse of inappropriate services , decreased medical errors , decreased ed visits and hospitalizations , decreased rehospitalizations for patients recently discharged , prevention of costly complications , and appropriate use of palliative care at the end of life . a broader range of other potential efficiencies should also be considered . if team - based care is expanded , an appropriate shift in certain tasks from physicians to other team members or automated systems may result . if access is enhanced by phone and e - mail , in - person visits for routine questions might decrease . as wait times in the medical practice decline , patients should miss less time from work or school . as patients with chronic and complex conditions develop continuous relationships with personal physicians , the relative proportion of contacts with the personal physician should rise and the number of redundant tests should decline . as care becomes more coordinated and integrated , wait times for specialty consultation should decrease and the proportion of patient contacts during which the patient s medical records are unavailable to the treating provider should decline . provided a recent thorough review of available measures of health care efficiency.23 they argue that although health care efficiency is of considerable interest to payers and purchasers in particular , the concept has not been well - defined and that , in contrast to most quality measures , there is little convergence around a consensus set of efficiency measures . existing measures have been subjected to few rigorous evaluations to evaluate reliability , validity , and sensitivity to methods used . almost all of the purported efficiency measures reviewed would be classified as cost of care measures , not true efficiency measures.23 to evaluate the pcmh , it will be important to include both cost and non - cost measures of efficiency and to include the perspective of the patient as well as the providers . health care safety has been identified as one of the most urgent of the six aims in the iom framework and is a core principle of the pcmh.2 to date , measures of safety in ambulatory care have been limited to prescribing errors and medication safety , two areas where the pmch could be expected to have an impact.24,25 beyond this , the iom has described the knowledge of the kind and magnitude of errors and the development of safety systems in ambulatory care settings , as rudimentary.26 much work remains to be done to develop safety measures for ambulatory care and , further , to determine the potential impact of the pcmh on safety.27 disparities in health and health care are well - documented.28 as the pcmh model is more widely adopted , it will be important to consider its potential impact on health care equity . to the extent possible , data on personal characteristics , such as gender , race , ethnicity , and socioeconomic status , should be collected to allow for stratified analysis on all of the other outcome measures so that disparities can be measured and documented over time . although it is critical to measure the impact of the pcmh at the level of the practice , for several reasons it is also important to measure the impact on the population level as the pcmh moves beyond demonstration projects to be more widely adopted . first , some outcomes are difficult to assess at the level of the practice due to insufficient sample size or challenges attributing an outcome to a single practice when a patient may see multiple providers.2931 other outcomes ( e.g. , reductions in sexually transmitted diseases ) are simply easier to measure at the population level because of available public health data . as the pcmh becomes the standard model of primary care in a community , there may be changes in practice patterns across the continuum of care that can only be assessed by measurement at the community level ( e.g. , reduction in risk behaviors or increase in the proportion of the population with an identified primary care provider ) . finally , the pcmh model explicitly calls for providers to work together in the community context and across individual practice boundaries . for example , appropriately arranging care with other qualified professionals and coordinating and integrating care across all elements of the complex health care system and the patient s community.2 population effects can be assessed at the level of the community , state , region , or country . logically , it makes sense to focus on the community , as that is where one would expect to first see the effects of the pcmh on population health . also , studying the population impact of the pcmh at the community level offers the best opportunity for understanding the processes by which the pcmh can impact population health . for example , community level outcomes can be correlated with the degree of adoption of the model within the community both longitudinally within the same community and cross - sectionally among communities . community level impacts are also meaningful to employers who draw their workforce from the community . traditional boundaries such as the metropolitan statistical area may be too large for assessing the impact of the pcmh on communities and do not include rural communities . political boundaries such as towns , cities or counties may not correspond to actual communities as defined by use of primary care . hospital service areas may be an appropriate definition of a community in areas where most primary care patients use a single hospital . another approach to identifying geographically defined communities is through the use of claims data to define an area within which most people obtain most of their primary care.32 a second challenge is to measure the extent of adoption of the pcmh within a community and track it over time . counting the proportion of primary care practices in a community that meet an agreed - upon definition of a pcmh would provide a simple but incomplete measure . because the pcmh is multifaceted , it would be more informative to measure the degree to which practices , and practice networks , adopt key components of the pcmh and to aggregate these measures over the community they serve . this approach would also allow for the study of the adoption threshold at which pcmh has measurable community level impacts . a third fundamental challenge is choosing community - based measures that are therefore likely to be sensitive to adoption of the pcmh . a substantial body of literature exists demonstrating a link between the level of primary care in an area and a variety of health outcomes including lower rates of cause - specific and total adult mortality,3335 infant mortality , low birth weight,36 lower health care costs,37 better self - reported health,38 and reduced health disparities.39,40 it is hoped that the generalized adoption of the pcmh model , by improving the quality of community primary care , will improve many of the same outcomes . three broad categories of community level outcomes that could be affected by dissemination of the pcmh model are : ( 1 ) enhanced preventive services leading to improved vaccination and screening , risk factor reduction , and disease prevention ; ( 2 ) better management of chronic diseases leading to lower rates of emergency visits and hospitalizations and less lost productivity due to fewer sick days ; ( 3 ) improved structures and processes resulting in increased access , efficiency , and equitability . examples of outcomes in each of these three broad areas are provided in table 2 . table 2framework and examples of available community - based measures relevant to assessing the impact of the pcmhgeneral areaspecific areaexamples of population measures potentially sensitive to the adoption of the pcmhsources of data or survey instrumentshealth promotion and disease preventionvaccination and screeningvaccination rates at time of entry into kindergarten;state and county health departments ; chis , cms , nispercent of adults > 65 vaccinated for pneumococcus;mammograms;pap smearsrisk behaviors and risk factorstobacco use;brfss ; chis , nhis ; yrbssalcohol and drug abuse;risky sexual behaviors;obesity;hypertensionpreventable conditionsincident of sexually transmitted infections ( stis);state and county public health departments ; nvssincidence of teenage pregnancies;violence related mortality;low birth weight neonates and infant mortalitychronic disease managementavoidable complicationsemergency visits and hospitalizations for primary care sensitive ( pcs ) conditions ( e.g. , diabetes , chronic lung disease and congestive heart failure);hcup , nhdsearly readmissions for pcs conditionsmortalitymortality from tobacco related diseases;nvssmortality post - strokeefficiency and accesscommunicationuse and sharing of electronic medical records by practices , hospitals and pharmaciesnone foundcoordination and continuity of care% of visits with pcp;cms , cts / cqi% of specialist visits preceded by a pcp visit;% of all visits to same pcp;% of patients discharge from hospitalization for pcs seen by pcp within 2 weekscostslost work days;cms ; cns ; cts / cqi , hcup , meps , marketscanprocedures;avoidable emergency visits and hospitalizationsaccess% with identified pcp;chis , cns , cts / cqi% with a primary care visit in past 12 months;number of prenatal visitsequitysurveys which collect data on race , ethnicity , language , income and/or educationbrfss , hcup , nduh , nis , nvss , yrbssacronyms for measures ( sources):brfss = behavioral risk factor surveillance system ( nchs , cdc)chis = california health interview survey ( state of california)cms = center for medicare and medicaid services administrative data ( hhs)cts / cqi = community tracking study household survey/ community quality indexhcup= healthcare cost and utilization project ( ahrq)meps = medical expenditure panel survey ( ahrq)nhis = national health interview survey ( cdc)nhds = national hospital discharge survey ( cdc)nis = national immunization survey ( nchs , cdc)nvss = national vital statistics system ( nchs , cdc)nsduh = national survey on drug use and health ( samhsa)yrbss = youth risk behavior surveillance system ( cdc)acronyms of sources : ahrq = agency for healthcare research and qualitycdc = center for disease controlhhs = us department of health and human servicesnchs = national center for health statisticssamhsa = substance abuse and mental health services administration framework and examples of available community - based measures relevant to assessing the impact of the pcmh acronyms for measures ( sources ) : brfss = behavioral risk factor surveillance system ( nchs , cdc ) chis = california health interview survey ( state of california ) cms = center for medicare and medicaid services administrative data ( hhs ) cts / cqi = community tracking study household survey/ community quality index hcup= healthcare cost and utilization project ( ahrq ) meps = medical expenditure panel survey ( ahrq ) nhis = national health interview survey ( cdc ) nhds = national hospital discharge survey ( cdc ) nis = national immunization survey ( nchs , cdc ) nvss = national vital statistics system ( nchs , cdc ) nsduh = national survey on drug use and health ( samhsa ) yrbss = youth risk behavior surveillance system ( cdc ) ahrq = agency for healthcare research and quality cdc = center for disease control hhs = us department of health and human services nchs = national center for health statistics samhsa = substance abuse and mental health services administration while this section has focused on the geographically defined ( population - based ) community , it should be acknowledged that measuring outcomes in large integrated health systems such as kaiser permanente41 or geisinger health system,42 and in accountable care organizations,43 may provide some of the same benefits as community level measures for assessing pcmh - related outcomes . while most practice - level measures can be applied to networks and health systems , additional measures related to integration , communication and shared information systems are inherently more important for networks and systems than for discrete practices . community for which outcomes related to the pcmh can potentially be measured via claims , employment data , and employee surveys . traditional boundaries such as the metropolitan statistical area may be too large for assessing the impact of the pcmh on communities and do not include rural communities . political boundaries such as towns , cities or counties may not correspond to actual communities as defined by use of primary care . hospital service areas may be an appropriate definition of a community in areas where most primary care patients use a single hospital . another approach to identifying geographically defined communities is through the use of claims data to define an area within which most people obtain most of their primary care.32 a second challenge is to measure the extent of adoption of the pcmh within a community and track it over time . counting the proportion of primary care practices in a community that meet an agreed - upon definition of a pcmh would provide a simple but incomplete measure . because the pcmh is multifaceted , it would be more informative to measure the degree to which practices , and practice networks , adopt key components of the pcmh and to aggregate these measures over the community they serve . this approach would also allow for the study of the adoption threshold at which pcmh has measurable community level impacts . a third fundamental challenge is choosing community - based measures that are therefore likely to be sensitive to adoption of the pcmh . a substantial body of literature exists demonstrating a link between the level of primary care in an area and a variety of health outcomes including lower rates of cause - specific and total adult mortality,3335 infant mortality , low birth weight,36 lower health care costs,37 better self - reported health,38 and reduced health disparities.39,40 it is hoped that the generalized adoption of the pcmh model , by improving the quality of community primary care , will improve many of the same outcomes . three broad categories of community level outcomes that could be affected by dissemination of the pcmh model are : ( 1 ) enhanced preventive services leading to improved vaccination and screening , risk factor reduction , and disease prevention ; ( 2 ) better management of chronic diseases leading to lower rates of emergency visits and hospitalizations and less lost productivity due to fewer sick days ; ( 3 ) improved structures and processes resulting in increased access , efficiency , and equitability . examples of outcomes in each of these three broad areas are provided in table 2 . table 2framework and examples of available community - based measures relevant to assessing the impact of the pcmhgeneral areaspecific areaexamples of population measures potentially sensitive to the adoption of the pcmhsources of data or survey instrumentshealth promotion and disease preventionvaccination and screeningvaccination rates at time of entry into kindergarten;state and county health departments ; chis , cms , nispercent of adults > 65 vaccinated for pneumococcus;mammograms;pap smearsrisk behaviors and risk factorstobacco use;brfss ; chis , nhis ; yrbssalcohol and drug abuse;risky sexual behaviors;obesity;hypertensionpreventable conditionsincident of sexually transmitted infections ( stis);state and county public health departments ; nvssincidence of teenage pregnancies;violence related mortality;low birth weight neonates and infant mortalitychronic disease managementavoidable complicationsemergency visits and hospitalizations for primary care sensitive ( pcs ) conditions ( e.g. , diabetes , chronic lung disease and congestive heart failure);hcup , nhdsearly readmissions for pcs conditionsmortalitymortality from tobacco related diseases;nvssmortality post - strokeefficiency and accesscommunicationuse and sharing of electronic medical records by practices , hospitals and pharmaciesnone foundcoordination and continuity of care% of visits with pcp;cms , cts / cqi% of specialist visits preceded by a pcp visit;% of all visits to same pcp;% of patients discharge from hospitalization for pcs seen by pcp within 2 weekscostslost work days;cms ; cns ; cts / cqi , hcup , meps , marketscanprocedures;avoidable emergency visits and hospitalizationsaccess% with identified pcp;chis , cns , cts / cqi% with a primary care visit in past 12 months;number of prenatal visitsequitysurveys which collect data on race , ethnicity , language , income and/or educationbrfss , hcup , nduh , nis , nvss , yrbssacronyms for measures ( sources):brfss = behavioral risk factor surveillance system ( nchs , cdc)chis = california health interview survey ( state of california)cms = center for medicare and medicaid services administrative data ( hhs)cts / cqi = community tracking study household survey/ community quality indexhcup= healthcare cost and utilization project ( ahrq)meps = medical expenditure panel survey ( ahrq)nhis = national health interview survey ( cdc)nhds = national hospital discharge survey ( cdc)nis = national immunization survey ( nchs , cdc)nvss = national vital statistics system ( nchs , cdc)nsduh = national survey on drug use and health ( samhsa)yrbss = youth risk behavior surveillance system ( cdc)acronyms of sources : ahrq = agency for healthcare research and qualitycdc = center for disease controlhhs = us department of health and human servicesnchs = national center for health statisticssamhsa = substance abuse and mental health services administration framework and examples of available community - based measures relevant to assessing the impact of the pcmh acronyms for measures ( sources ) : brfss = behavioral risk factor surveillance system ( nchs , cdc ) chis = california health interview survey ( state of california ) cms = center for medicare and medicaid services administrative data ( hhs ) cts / cqi = community tracking study household survey/ community quality index hcup= healthcare cost and utilization project ( ahrq ) meps = medical expenditure panel survey ( ahrq ) nhis = national health interview survey ( cdc ) nhds = national hospital discharge survey ( cdc ) nis = national immunization survey ( nchs , cdc ) nvss = national vital statistics system ( nchs , cdc ) nsduh = national survey on drug use and health ( samhsa ) yrbss = youth risk behavior surveillance system ( cdc ) ahrq = agency for healthcare research and quality cdc = center for disease control hhs = us department of health and human services nchs = national center for health statistics samhsa = substance abuse and mental health services administration while this section has focused on the geographically defined ( population - based ) community , it should be acknowledged that measuring outcomes in large integrated health systems such as kaiser permanente41 or geisinger health system,42 and in accountable care organizations,43 may provide some of the same benefits as community level measures for assessing pcmh - related outcomes . while most practice - level measures can be applied to networks and health systems , additional measures related to integration , communication and shared information systems are inherently more important for networks and systems than for discrete practices . employee groups of large employers are another type of non - population - based community for which outcomes related to the pcmh can potentially be measured via claims , employment data , and employee surveys . whenever implementing change , one must consider unintended consequences.4446 short - term unintended consequences may result from changing care processes and business models . these unintended consequences are important in light of early research demonstrating that practice transformation to the pcmh model may take several years.47 long - term unintended consequences of the pcmh may reflect problems with the pcmh model itself . for example , increased reliance on technologies to improve efficiency might ultimately result in less human interaction and lower patient satisfaction . increased attention on chronic care management might divert resources from delivering high quality care for acute illness . in an attempt to deliver all recommended preventive services to all patients to meet outcomes goals incentives to reduce overuse might result in withholding diagnostic procedures and treatments when they are indicated . because only a small proportion of activities can be measured , there is a danger that unmeasured activities will be neglected to the detriment of patients . in addition , several studies looking at unintended consequences of quality improvement efforts demonstrate a negative impact on disparities.48 one important unintended consequence to consider is overuse , or the provision of services to those not likely to benefit . this is especially important for a patient with multiple co - morbidities or near the end of life.49 the ncqa s back pain recognition program addresses overuse by recognizing use of best practices for the management of uncomplicated low back pain.50 the national priorities partnership , a collaborative of 28 major national organizations representing a broad range of stakeholders , has identified overuse as one of six national priorities and has identified several primary care - related areas of concentration , including inappropriate antibiotic use , routine use of laboratory panels ( e.g. , sma 20 ) , and routine preoperative chest x - rays.51 in addition to these potential unintended consequences , transformation of the delivery system to the pcmh model could result in increased stress and decreased work satisfaction for providers as roles change , new technologies are implemented , new workflow patterns are established , and new patient - provider relationships are formed . this could have a critical impact on the already limited supply of adult primary care physicians . the potential negative impacts of measurement and reporting burdens shouldered by practices must also be considered . the patient - centered medical home has gained considerable traction in the us and is an important component of federal health reform efforts . this paper presents an overview of issues important to the development of a long - term policy - relevant research agenda on pcmh outcomes . in addition to this discussion , we have included a set of exemplar research questions for a policy - relevant research agenda in this area ( see table 3 ) . table 3developing a long - term policy - relevant research agenda for pcmh outcomes : exemplar research questionsidentifying a core set of measures of pcmh outcomes what are the best measures of clinical effectiveness that are sensitive to the pcmh model ; measurable at the level of the practice or community ; and feasible to collect? which clinical processes are most closely related to health outcomes and therefore should be measured to determine effectiveness? what are the evidence - based measures of patient safety in the ambulatory care setting that are sensitive to the pcmh model? what are the best measures of patient - centeredness , above and beyond patient satisfaction or experience? what are the best measures of timeliness that can be measured at the level of the practice and community ? how is timeliness linked to health outcomes , patient experience , and efficiency? how is efficiency best defined and measured with regard to the pcmh? what is the best set of measures to determine that health care delivered under the pcmh model is equitable that is it does not differ in quality based on personal characteristics such as gender , ethnicity , geographic location , and socioeconomic status? what are other measures that should be considered in evaluating the outcomes of the pcmh that go beyond the iom framework , for example , measures of workforce supply or provider satisfaction? what is the impact of non visit - based care on the six iom aims? what are the best measures of unintended consequences of the pmch model that would allow for early recognition of problems with model specifications? how large a set of core outcome measures can reasonably be collected and which measures should be included as high - value , core measures? how does choice of pcmh outcomes measures depend on the perspective of purchasers , payers , communities , providers , or patients?identifying the level at which to measure how can the patients of a medical practice be identified for the purposes of measuring pcmh outcomes? to what extent do individual physicians need to be linked to particular practices for the purposes of measuring practice - level outcomes ? how can this best be accomplished? how can a population - based community be defined for the purposes of measuring pcmh outcomes? which outcomes measures are best assessed at the level of the practice and which are best measured at the level of the community? how can the extent of adoption of the pcmh model within a community be measured? what is the level of adoption of the pcmh model that is necessary to produce changes in community health outcomes?additional questions when measuring its relationship to health care outcomes , to what extent does the pcmh model function as an integrated whole , rather than simply as a collection of components such as team - based care , advanced access scheduling , and chronic disease registries? in what ways can evaluation efforts be affected by gaming of performance measures by practices and providers? what is the best method for case - mix adjustment and how is patient preference included in outcomes calculations? what are the sample size challenges faced when trying to measure practice - level pcmh outcomes in very small physician practices ? how are these challenges best addressed? how can appropriateness best be defined and measured to detect overuse of inappropriate or unnecessary interventions , as well as underuse of necessary treatments? do the outcomes measurement issues and priorities differ among the major categories of physician practices ( e.g. , large integrated delivery systems , solo physician practices , fqhcs ) or within different types of communities ( for example , chronically underserved communities)? how do concepts such as integration , continuity , patient - physician relationship , comprehensiveness , patient trust , and care transitions within and between care settings relate to the measurement of pcmh outcomes? what is the role of specialist and hospital practices in ensuring positive patient outcomes from the pcmh ( e.g. , timely communication , etc.) who will be responsible for collecting data , evaluating impacts , and tracking changes over time at the level of the practice and the community? what will be the intended or unintended connection between outcomes measurement and other efforts such as practice accreditation or certification , public reporting , and/or pay for performance ? to what extent can these ongoing measurement activities be harnessed to yield outcomes for evaluating the impact of the pcmh? what uses of outcome measures will be most effective in promoting high performing medical homes ( e.g. , practitioner feedback , public reporting , pay for performance ) ? developing a long - term policy - relevant research agenda for pcmh outcomes : exemplar research questions although the pcmh model should not be expected to solve every problem in the health care system , developing a research agenda for measuring outcomes of delivery system innovations such as the pcmh should be considered in the context of the larger effort to improve the us health care system , with the ultimate goal to improve population health . the commonwealth fund has convened the evaluators of current pcmh demonstration projects to define best measures for use in those projects ; additional leadership will be needed to determine the best set of pcmh outcomes indicators over the longer term . much can be learned from leaders in the field of ambulatory care measurement and reporting , including organizations such as the agency for healthcare research and quality , the commonwealth fund , the robert wood johnson foundation , the national quality forum , and the national priorities partnership . large organized health systems that have demonstrated leadership in both the implementation of the pcmh model and measurement of outcomes include , for example , the veterans administration , kaiser permanente , and geisinger health system . state agencies , health plans , and purchaser coalitions all have vested interests in the outcomes of the pcmh and have experience to offer in measuring these outcomes , as do practicing physicians and patients . multistakeholder involvement will be essential in developing a long - term policy - relevant research agenda for outcomes of the pcmh .

backgroundthe patient - centered medical home ( pcmh ) is a widely endorsed model of delivery system reform that emphasizes primary care . pilot demonstration projects are underway in many states , sponsored by medicare , medicaid , major health plans and multi - payer coalitions.methodsin this paper we consider the development of a long - term policy - relevant research agenda on outcomes of the pcmh . we provide an overview of potential measures of pcmh impact , identify measurement challenges and recommend areas for further study . although the pcmh should not be expected to solve every problem in the health care system , developing a research agenda for measuring outcomes of delivery system innovations such as the pcmh should be considered in the context of the larger effort to improve the us health care system , with the ultimate goal to improve population health.resultsas a framework for our discussion , we have chosen the institute of medicine s six specific aims for 21st century health care : ( 1 ) safe , ( 2 ) effective , ( 3 ) patient - centered , ( 4 ) timely , ( 5 ) efficient and ( 6 ) equitable . in addition , we include potential areas of pcmh outcomes that do not easily fall under this framework and consider unintended consequences.conclusionmulti-stakeholder involvement will be essential in developing a long - term policy - relevant research agenda for outcomes of the pcmh .

You are an expert at summarizing long articles. Proceed to summarize the following text: dry eye ( de ) syndrome is associated with ocular discomfort , tear film instability ( ie , decreased tear film break - up time [ tfbut ] ) , increased corneal and conjunctival staining , and conjunctival goblet cell loss.1 estimates of de prevalence range from approximately 7% to 34% depending on the diagnosis criteria and population studied;2 symptoms of de vary from patient to patient and are not always associated with clinical signs.3 de stems from a disruption of the tear film caused by deficient aqueous , lipid , and/or mucin layers , either individually or in combination.4,5 other sources may include epitheliopathy , lid abnormalities , or autoimmune disease , and risk factors include female sex , increasing age , and smoking.2,4 meibomian gland dysfunction is the most common cause of evaporative de and frequently occurs with aqueous - deficient de.6,7 with decreased numbers of meibomian glands or decreased lipid excretion from existing glands , the lipid component that stabilizes the tear film becomes deficient , and tear film instability and evaporation increase.6 decreased tfbut , dehydration , exposure of ocular tissues such as the corneal epithelium , and inflammation can result in epithelial damage.8,9 de is typically managed through the use of artificial tears to supplement or restore the natural tear film . saline ( sal ) eye drops are commonly used to manage de by increasing aqueous volume , which improves corneal hydration , but sal does not replace the lipid component of the precorneal tear film or enhance tfbut.10 systane balance ( sysb ) ocular emulsion ( alcon laboratories , inc . , fort worth , tx , usa ) is a gellable lubricant eye drop containing microemulsions of oils ( the lipitech system ) intended to restore lipid , aqueous , and mucin tear components to enhance tear film stability.9 sysb contains propylene glycol 0.6% , hydroxypropyl - guar , borate , sorbitol , dimyristoylphosphatidylglycerol ( a polar phospholipid surfactant ) , and mineral oil . in a recent study of patients with de associated with meibomian gland dysfunction , sysb was shown to produce significant improvements in de symptoms , assessed using the impact of dry eye on everyday life questionnaire.11 after 4 weeks of treatment , most patients reported that they agreed or strongly agreed that sysb successfully treated their de symptoms ( 64% ) and that their de symptoms were much better with sysb compared with their habitual treatment ( 66%).11 the manner in which sysb improves symptoms of de remains to be fully determined . the purpose of this study was to evaluate the ability of sysb administered four times per day for 4 weeks to increase noninvasive tear film break - up time ( nitfbut ) over baseline compared with sal placebo control in patients with lipid - deficient de . eligible patients were aged 18 years with best - corrected visual acuity ( bcva ) 0.6 logmar in both eyes at screening and no use of topical ocular drops within approximately 24 hours before screening . patients were required to meet all the following criteria for de at screening : answered at least some of the time to the previously published symptom eligibility question how often have your eyes felt dry enough to want to use eye drops ( artificial tears),12 focusing on the past 24 hours ; nitfbut 7 seconds in one or both eyes ; meibomian gland expression of grade 1 or higher in both eyes ; and evidence of missing meibomian glands in both eyes . key exclusion criteria included intolerance or hypersensitivity to any component of study treatments , ocular or intraocular surgery or serious ocular trauma 6 months before enrollment , current punctal occlusion of any type , use of concomitant topical ocular medications , use of systemic medications that may contribute to de ( unless on a stable regimen for 30 days before screening and throughout the study ) , ocular or systemic infections or conditions ( eg , epithelial herpes simplex keratitis ; vaccinia , varicella , or mycobacterial infection ; fungal disease ; iritis ) that preclude safe administration of study treatment , use of contact lenses within 1 week before screening and throughout the study period , and participation in an investigational drug or device study 30 days before screening . this was a randomized , two - arm , parallel - group , controlled , investigator - masked comparison of sysb and the placebo control sal conducted at a single site in argentina from september to october 2012 ( clinicaltrials.gov identifier , nct01718028 ) . the study period consisted of three scheduled visits : a screening / baseline at days 0 and 2 and follow - up visits conducted after 2 and 4 weeks of treatment . at the conclusion of the screening / baseline assessments , patients were assigned a subject number in numerical sequence and were randomized 1:1 to receive either sysb or sal ( 0.9% nacl ; larmabak ; grupo de empresas farmacuticas sidus , buenos aires , argentina ) . patients were instructed to instill the study treatment topically in both eyes four times per day corresponding to morning , early afternoon , evening , and bedtime for 4 weeks . compliance with the assigned study treatment was assessed based on patient feedback and by counting the remaining eye drops in the product bottle . this study was performed in compliance with the ethical principles of the declaration of helsinki and good clinical practice . the protocol was approved by the applicable independent ethics committees or institutional review boards , and all patients provided written informed consent before participating in the study . the primary efficacy endpoint was mean nitfbut change from baseline ( day 0 ) at week 4 . secondary efficacy endpoints were nitfbut by visit , nitfbut change from baseline at week 2 , and percent nitfbut change from baseline after 2 and 4 weeks . exploratory efficacy endpoints included meibomian gland expression and meibography ( ie , evaluation of total and partial missing meibomian glands ) , conjunctival and corneal staining , and goblet cell density classification . meibomian gland evaluation and ocular surface staining were assessed for mean scores and percent change from baseline after 2 and 4 weeks ; goblet cell density was assessed for change from baseline in classification ( ie , improved , maintained , or worse ) after 2 and 4 weeks of treatment . nitfbut was assessed using a cold - light illumination interferometer ( tearscope , keeler ltd . , the interferometer was attached to the slit lamp to allow recording of the tear film in real time . one reading was performed per patient , between 60 and 120 minutes after instillation of the assigned study treatment . patients were instructed to blink naturally for 10 seconds and then to stare straight ahead without blinking . glands were expressed from the temporal to the nasal aspect using a cotton - tipped applicator . expressed meibum was classified based on color and viscosity as follows : normal , clear oil ( grade 0 ) ; opaque , diffusely turbid meibum with normal viscosity ( grade 1 ) ; opaque meibum with increased viscosity ( grade 2 ) ; or inspissated meibum or no excreted material ( grade 3 ) . meibography of the lower eyelid was evaluated by slit - lamp examination aided by a clinical transilluminator ( welch allyn inc . missing partial or whole meibomian glands in nasal , central , and temporal regions were counted by the examiner . surface staining of five corneal regions and six conjunctival regions was observed by slit - lamp examination after instillation of 5 l of 2% preservative - free fluorescein or lissamine green , respectively . surface staining was scored as 0 ( normal , no staining ) , 1 ( mild , superficial stippling or macropunctate staining ) , 2 ( moderate , macropunctate staining with some coalescent areas ) , or 3 ( severe , numerous coalescent macropunctate areas or patches ) . scores were summed to yield total corneal and total conjunctival staining scores for each eye . goblet cell density was evaluated using impression cytology and nelson s classification system.13 after instillation of tetracaine topical anesthetic , polyvinylidene fluoride filters ( 22 m pore ) were applied to the inferior tarsal and bulbar conjunctiva for ~10 seconds and processed using standard methods . periodic acid - schiff reagent positive areas were averaged across 15 random fields , and results were classified as 0 ( normal ) , i ( low number of goblet cells ) , ii ( absence of goblet cells ) , or iii ( absence of goblet cells plus squamous metaplasia ) . patient - reported and investigator - solicited adverse events ( aes ) , bcva , and ocular signs were evaluated as safety endpoints . bcva was assessed using an early treatment diabetic retinopathy study chart at a distance of 10 ft , and results were calculated as logmar scores . conditions and illnesses evaluated were signs of active inflammation or significant structural change or discharge ( eyelids and conjunctiva ) ; active inflammation or active structural change , including focal scarring and fine deposition ( cornea ) ; active inflammation ( iris and anterior chamber ) ; and level of lens opacity , pseudophakia , or aphakia ( lens , with an emphasis on the visual axis ) . efficacy endpoints were analyzed in the intent - to - treat population . nitfbut differences between groups were analyzed in the worse eye using mann whitney tests and t - tests , with a significance level of 5% . the worse eye was defined as the eye with lower nitfbut score at baseline ; if nitfbut was equal in both eyes at baseline , the right eye was used . between - group differences in ocular staining were analyzed using t - tests ; goblet cell density and meibomian gland expression were analyzed with tests ; and meibography data were analyzed using mann whitney tests or t - tests . aes were summarized descriptively , bcva was analyzed with mann whitney tests , and ocular signs were analyzed using fisher exact tests . the sample size was based on results of an exploratory study of patients with meibomian gland dysfunction . the mean nitfbut was 5.2 seconds , and the maximum standard deviation ( sd ) was 2.88 seconds . a power calculation based on the assumption of a common sd of 2.88 seconds determined that a sample size of 50 patients would provide 90% power to detect a superiority margin of 2.7 seconds using a two - sided significance level of p<0.05 . eligible patients were aged 18 years with best - corrected visual acuity ( bcva ) 0.6 logmar in both eyes at screening and no use of topical ocular drops within approximately 24 hours before screening . patients were required to meet all the following criteria for de at screening : answered at least some of the time to the previously published symptom eligibility question how often have your eyes felt dry enough to want to use eye drops ( artificial tears),12 focusing on the past 24 hours ; nitfbut 7 seconds in one or both eyes ; meibomian gland expression of grade 1 or higher in both eyes ; and evidence of missing meibomian glands in both eyes . key exclusion criteria included intolerance or hypersensitivity to any component of study treatments , ocular or intraocular surgery or serious ocular trauma 6 months before enrollment , current punctal occlusion of any type , use of concomitant topical ocular medications , use of systemic medications that may contribute to de ( unless on a stable regimen for 30 days before screening and throughout the study ) , ocular or systemic infections or conditions ( eg , epithelial herpes simplex keratitis ; vaccinia , varicella , or mycobacterial infection ; fungal disease ; iritis ) that preclude safe administration of study treatment , use of contact lenses within 1 week before screening and throughout the study period , and participation in an investigational drug or device study 30 days before screening . this was a randomized , two - arm , parallel - group , controlled , investigator - masked comparison of sysb and the placebo control sal conducted at a single site in argentina from september to october 2012 ( clinicaltrials.gov identifier , nct01718028 ) . the study period consisted of three scheduled visits : a screening / baseline at days 0 and 2 and follow - up visits conducted after 2 and 4 weeks of treatment . at the conclusion of the screening / baseline assessments , patients were assigned a subject number in numerical sequence and were randomized 1:1 to receive either sysb or sal ( 0.9% nacl ; larmabak ; grupo de empresas farmacuticas sidus , buenos aires , argentina ) . patients were instructed to instill the study treatment topically in both eyes four times per day corresponding to morning , early afternoon , evening , and bedtime for 4 weeks . compliance with the assigned study treatment was assessed based on patient feedback and by counting the remaining eye drops in the product bottle . this study was performed in compliance with the ethical principles of the declaration of helsinki and good clinical practice . the protocol was approved by the applicable independent ethics committees or institutional review boards , and all patients provided written informed consent before participating in the study . the primary efficacy endpoint was mean nitfbut change from baseline ( day 0 ) at week 4 . secondary efficacy endpoints were nitfbut by visit , nitfbut change from baseline at week 2 , and percent nitfbut change from baseline after 2 and 4 weeks . exploratory efficacy endpoints included meibomian gland expression and meibography ( ie , evaluation of total and partial missing meibomian glands ) , conjunctival and corneal staining , and goblet cell density classification . meibomian gland evaluation and ocular surface staining were assessed for mean scores and percent change from baseline after 2 and 4 weeks ; goblet cell density was assessed for change from baseline in classification ( ie , improved , maintained , or worse ) after 2 and 4 weeks of treatment . nitfbut was assessed using a cold - light illumination interferometer ( tearscope , keeler ltd . , the interferometer was attached to the slit lamp to allow recording of the tear film in real time . one reading was performed per patient , between 60 and 120 minutes after instillation of the assigned study treatment . patients were instructed to blink naturally for 10 seconds and then to stare straight ahead without blinking . glands were expressed from the temporal to the nasal aspect using a cotton - tipped applicator . expressed meibum was classified based on color and viscosity as follows : normal , clear oil ( grade 0 ) ; opaque , diffusely turbid meibum with normal viscosity ( grade 1 ) ; opaque meibum with increased viscosity ( grade 2 ) ; or inspissated meibum or no excreted material ( grade 3 ) . meibography of the lower eyelid was evaluated by slit - lamp examination aided by a clinical transilluminator ( welch allyn inc . missing partial or whole meibomian glands in nasal , central , and temporal regions were counted by the examiner . surface staining of five corneal regions and six conjunctival regions was observed by slit - lamp examination after instillation of 5 l of 2% preservative - free fluorescein or lissamine green , respectively . surface staining was scored as 0 ( normal , no staining ) , 1 ( mild , superficial stippling or macropunctate staining ) , 2 ( moderate , macropunctate staining with some coalescent areas ) , or 3 ( severe , numerous coalescent macropunctate areas or patches ) . scores were summed to yield total corneal and total conjunctival staining scores for each eye . goblet cell density was evaluated using impression cytology and nelson s classification system.13 after instillation of tetracaine topical anesthetic , polyvinylidene fluoride filters ( 22 m pore ) were applied to the inferior tarsal and bulbar conjunctiva for ~10 seconds and processed using standard methods . periodic acid - schiff reagent positive areas were averaged across 15 random fields , and results were classified as 0 ( normal ) , i ( low number of goblet cells ) , ii ( absence of goblet cells ) , or iii ( absence of goblet cells plus squamous metaplasia ) . patient - reported and investigator - solicited adverse events ( aes ) , bcva , and ocular signs were evaluated as safety endpoints . bcva was assessed using an early treatment diabetic retinopathy study chart at a distance of 10 ft , and results were calculated as logmar scores . conditions and illnesses evaluated were signs of active inflammation or significant structural change or discharge ( eyelids and conjunctiva ) ; active inflammation or active structural change , including focal scarring and fine deposition ( cornea ) ; active inflammation ( iris and anterior chamber ) ; and level of lens opacity , pseudophakia , or aphakia ( lens , with an emphasis on the visual axis ) . efficacy endpoints were analyzed in the intent - to - treat population . nitfbut differences between groups were analyzed in the worse eye using mann whitney tests and t - tests , with a significance level of 5% . the worse eye was defined as the eye with lower nitfbut score at baseline ; if nitfbut was equal in both eyes at baseline , the right eye was used . between - group differences in ocular staining were analyzed using t - tests ; goblet cell density and meibomian gland expression were analyzed with tests ; and meibography data were analyzed using mann whitney tests or t - tests . aes were summarized descriptively , bcva was analyzed with mann whitney tests , and ocular signs were analyzed using fisher exact tests . the sample size was based on results of an exploratory study of patients with meibomian gland dysfunction . the mean nitfbut was 5.2 seconds , and the maximum standard deviation ( sd ) was 2.88 seconds . a power calculation based on the assumption of a common sd of 2.88 seconds determined that a sample size of 50 patients would provide 90% power to detect a superiority margin of 2.7 seconds using a two - sided significance level of p<0.05 . two patients in the sal placebo control group withdrew consent before receiving treatment ; 49 patients received treatment and completed the study ( sysb , n=25 ; sal , n=24 ) . most patients were women ( 67.4% , n=33/49 ) and caucasian ( 63.3% , n=31/49 ) . a total of 47 patients received treatment for 28 days and two patients received treatment for 29 days . most patients reported wanting to use eye drops because of dryness at least half of the time ( sysb , n=21/25 [ 84.0% ] ; sal , n=14/24 [ 58.3% ] ) . no enrolled patients had a diagnosis of a systemic condition associated with de ( eg , sjgren s syndrome ) . one patient in the sysb group had an anxiety disorder , and one patient in the sal group had both hypertension and a lipid metabolism and deposit disorder . patient demographics and baseline de characteristics for the intent - to - treat population are presented in table 1 . after 4 weeks of treatment , nitfbut was increased from baseline by 2.830.74 seconds ( range , 1.704.60 seconds ) with sysb and by 0.660.55 seconds ( range , 0.002.00 seconds ) with sal ( between - group difference , 2.17 seconds [ 95% confidence interval ( ci ) , 1.792.54 ] , p<0.001 ; figure 1 ) . at baseline , mean sd nitfbut in the sysb and sal groups was 4.600.69 seconds and 4.930.80 seconds , respectively . at week 4 , the mean sd nitfbut was significantly greater with sysb ( 7.430.51 seconds ) compared with sal ( 5.590.66 seconds , p<0.001 ) . percent change from baseline was significantly greater with sysb compared with sal at week 2 ( 45.0% vs 14.4% , respectively ) and week 4 ( 65.0% vs 15.1% , respectively ; p<0.001 for both ) . at baseline , the mean total corneal and conjunctival staining was greater in the sysb group compared with the sal group ( table 1 ) . at the 4-week follow - up visit , the reduction in total ocular staining score from baseline ( mean [ percent ] ) was significantly greater with sysb than with sal for both cornea ( sysb , 1.16 [ 80.0% ] ; sal , 0.13 [ 10.4% ] ; p<0.001 ; figure 3a ) and conjunctiva ( sysb , 7.52 [ 98.2% ] ; sal , 1.83 [ 35.8% ] ; p<0.001 ; figure 3b ) . mean treatment difference in corneal staining for sysb vs sal after 4 weeks of treatment was 1.04 ( 95% ci , 1.43 to 0.64 ) ; mean treatment difference in conjunctival staining for sysb vs sal was 5.69 ( 95% ci , 7.44 to 3.93 ) . total staining scores were also significantly improved with sysb compared with sal at week 2 for cornea ( sysb , 0.76 [ 54.7% ] ; sal , 0.08 [ 8.3% ] ) and conjunctiva ( sysb , 5.36 [ 71.9% ] ; sal , 1.00 [ 21.3% ] ) ; group differences were statistically significant ( p0.001 for both cornea and conjunctiva ) . impression cytology at baseline revealed that most patients had reduced numbers or absence of goblet cells ( sysb , n=22/25 [ 88.0% ] ; sal , n=21/24 [ 87.5% ] ; table 1 ) . conjunctival goblet cell density was improved after 4 weeks of treatment in 84.0% of patients ( n=21/25 ) receiving sysb compared with 33.3% of patients ( n=8/24 ) receiving sal ( figure 4 ) . compared with baseline classifications , goblet cell density classification at both weeks 2 and 4 worsened in 4.2% and 12.5% of patients receiving sal , respectively , and in no patients receiving sysb . in the sysb treatment group , impression cytology findings were maintained or improved in all patients at both follow - up visits compared with baseline . at baseline , expressed meibum was classified as grade 2 ( opaque meibum with increased viscosity ) in 60% of patients in the sysb group ( n=15/25 ) and 50% of patients in the sal group ( n=12/24 ) ; meibomian gland expression classified as grade 3 ( inspissated meibum or no excreted material ) was evident in one patient in the sysb group ( table 1 ) . from baseline to week 4 , the percentage of patients with meibomian gland expression classified as grade 2 or 3 decreased from 64.0% to 28.0% in the sysb treatment group and from 50.0% to 45.8% in the sal placebo control group ( figure 5 ) . the percentage of patients with grade 0 or grade 1 expression at week 4 was 72.0% with sysb and 54.2% with sal . overall , after 4 weeks of treatment with sysb , the number of patients with grade 0 or grade 1 meibomian gland expression doubled ; meibomian gland expression was largely unchanged from baseline with sal . at week 2 no aes were reported for either the sysb treatment group or the sal placebo control group in this study . bcva of the worse eye remained stable from baseline through the 4 weeks of treatment . active inflammation , structural change , and discharge decreased markedly from baseline with both sysb and sal ; no other changes in ocular signs were observed . there were no significant differences in eyelid / conjunctiva assessment between treatment groups at any assessment . two patients in the sal placebo control group withdrew consent before receiving treatment ; 49 patients received treatment and completed the study ( sysb , n=25 ; sal , n=24 ) . most patients were women ( 67.4% , n=33/49 ) and caucasian ( 63.3% , n=31/49 ) . a total of 47 patients received treatment for 28 days and two patients received treatment for 29 days . most patients reported wanting to use eye drops because of dryness at least half of the time ( sysb , n=21/25 [ 84.0% ] ; sal , n=14/24 [ 58.3% ] ) . no enrolled patients had a diagnosis of a systemic condition associated with de ( eg , sjgren s syndrome ) . one patient in the sysb group had an anxiety disorder , and one patient in the sal group had both hypertension and a lipid metabolism and deposit disorder . patient demographics and baseline de characteristics for the intent - to - treat population are presented in table 1 . after 4 weeks of treatment , nitfbut was increased from baseline by 2.830.74 seconds ( range , 1.704.60 seconds ) with sysb and by 0.660.55 seconds ( range , 0.002.00 seconds ) with sal ( between - group difference , 2.17 seconds [ 95% confidence interval ( ci ) , 1.792.54 ] , p<0.001 ; figure 1 ) . at baseline , mean sd nitfbut in the sysb and sal groups was 4.600.69 seconds and 4.930.80 seconds , respectively . at week 4 , the mean sd nitfbut was significantly greater with sysb ( 7.430.51 seconds ) compared with sal ( 5.590.66 seconds , p<0.001 ) . percent change from baseline was significantly greater with sysb compared with sal at week 2 ( 45.0% vs 14.4% , respectively ) and week 4 ( 65.0% vs 15.1% , respectively ; p<0.001 for both ) . at baseline , the mean total corneal and conjunctival staining was greater in the sysb group compared with the sal group ( table 1 ) . at the 4-week follow - up visit , the reduction in total ocular staining score from baseline ( mean [ percent ] ) was significantly greater with sysb than with sal for both cornea ( sysb , 1.16 [ 80.0% ] ; sal , 0.13 [ 10.4% ] ; p<0.001 ; figure 3a ) and conjunctiva ( sysb , 7.52 [ 98.2% ] ; sal , 1.83 [ 35.8% ] ; p<0.001 ; figure 3b ) . mean treatment difference in corneal staining for sysb vs sal after 4 weeks of treatment was 1.04 ( 95% ci , 1.43 to 0.64 ) ; mean treatment difference in conjunctival staining for sysb vs sal was 5.69 ( 95% ci , 7.44 to 3.93 ) . total staining scores were also significantly improved with sysb compared with sal at week 2 for cornea ( sysb , 0.76 [ 54.7% ] ; sal , 0.08 [ 8.3% ] ) and conjunctiva ( sysb , 5.36 [ 71.9% ] ; sal , 1.00 [ 21.3% ] ) ; group differences were statistically significant ( p0.001 for both cornea and conjunctiva ) . impression cytology at baseline revealed that most patients had reduced numbers or absence of goblet cells ( sysb , n=22/25 [ 88.0% ] ; sal , n=21/24 [ 87.5% ] ; table 1 ) . conjunctival goblet cell density was improved after 4 weeks of treatment in 84.0% of patients ( n=21/25 ) receiving sysb compared with 33.3% of patients ( n=8/24 ) receiving sal ( figure 4 ) . compared with baseline classifications , goblet cell density classification at both weeks 2 and 4 worsened in 4.2% and 12.5% of patients receiving sal , respectively , and in no patients receiving sysb . in the sysb treatment group , impression cytology findings were maintained or improved in all patients at both follow - up visits compared with baseline . at baseline , expressed meibum was classified as grade 2 ( opaque meibum with increased viscosity ) in 60% of patients in the sysb group ( n=15/25 ) and 50% of patients in the sal group ( n=12/24 ) ; meibomian gland expression classified as grade 3 ( inspissated meibum or no excreted material ) was evident in one patient in the sysb group ( table 1 ) . from baseline to week 4 , the percentage of patients with meibomian gland expression classified as grade 2 or 3 decreased from 64.0% to 28.0% in the sysb treatment group and from 50.0% to 45.8% in the sal placebo control group ( figure 5 ) . the percentage of patients with grade 0 or grade 1 expression at week 4 was 72.0% with sysb and 54.2% with sal . overall , after 4 weeks of treatment with sysb , the number of patients with grade 0 or grade 1 meibomian gland expression doubled ; meibomian gland expression was largely unchanged from baseline with sal . at week 2 no aes were reported for either the sysb treatment group or the sal placebo control group in this study . bcva of the worse eye remained stable from baseline through the 4 weeks of treatment . active inflammation , structural change , and discharge decreased markedly from baseline with both sysb and sal ; no other changes in ocular signs were observed . there were no significant differences in eyelid / conjunctiva assessment between treatment groups at any assessment . discomfort , tear film instability , and ocular surface damage are characteristic signs and symptoms of de . reduced meibomian gland secretion , caused by decreased number or function of glands , is associated with evaporative de.6 artificial tears are commonly used to manage de symptoms by restoring the natural tear film . a frequently used artificial tear , sal , replaces the aqueous component of the tear film lost to evaporation but does not restore the lipid component of the tear film that minimizes evaporation and promotes stability.10,14 sysb , formulated to restore aqueous , lipid , and mucin components of the precorneal tear film , may bind to desiccated or damaged epithelial cells and improve tear film lipid layer thickness.9,15 the goal of this study was to assess the effectiveness of sysb to increase nitfbut compared with sal in patients with lipid - deficient de . at baseline , patients in both groups had signs of mild to moderate de . after 4 weeks of treatment , nitfbut increased by 65.0% ( nearly 3 seconds ) in the sysb treatment group compared with 15.1% ( < 1 second ) in the sal group ; nitfbut improvement was significantly greater with sysb compared with sal . improvements in corneal and conjunctival staining scores were also significantly greater with sysb , and a greater percentage of patients in the sysb group showed increased goblet cell density compared with the sal group . both study treatments were well tolerated by patients ; no aes were reported during the study period . bcva remained stable in both groups , and ocular signs ( conjunctiva / eyelid ) improved from baseline with sysb and sal . the improvement in nitfbut with sysb may be attributable to the demonstrated ability of sysb to promote tear film stability and protect the ocular surface.9 the results of the current study also indicated that sysb may help to manage de by improving characteristics of de beyond tear film instability , such as by reducing meibomian gland dysfunction , increasing mucin production , and promoting regeneration of the damaged ocular surface epithelium . the results of the current study are similar to those of another open - label , multicenter study in patients with de associated with meibomian gland dysfunction who switched to sysb from various other therapies.11 after 4 weeks of sysb treatment , tfbut , meibomian expression , and corneal staining were significantly improved . blurred vision was the most common ae ( reported by 6% of patients ) . at week 4 , nearly 80% of patients reported satisfaction with sysb , and > 60% preferred sysb to their previous treatment . these improvements in de signs and symptoms occurred with an average of < 2 sysb doses per day . in the current study , corneal staining decreased by nearly 100% after 4 weeks of sysb administered four times daily compared with a previously noted decrease of approximately 25% after 4 weeks of sysb administered approximately twice daily ; the magnitude of nitfbut increase from baseline in the current study was also larger than the previously reported increased tfbut with sysb.11 a potential limitation to this study was the relatively small study population ( n=2425 per group ) and the use of sal as a placebo control . comparison of sysb with sal enabled comparison of study outcomes after treatment with a formulation that replaces only the aqueous component of the tear film vs a formulation that also restores the lipid and mucin components . future studies comparing the efficacy of sysb vs other lipid - containing artificial tears are needed . additionally , treatment compliance was assessed by patients self - reports and by counting the number of instillations remaining in the treatment bottles . this approach did not allow monitoring of frequency or time of instillation , and potential differences in compliance between sysb and sal groups may have influenced study results . previous work demonstrated that sysb markedly improved both objective signs of de and patient - reported de symptoms,11 and a significant relationship between tfbut ( a de sign ) and ocular surface disease index scores of ocular discomfort ( a de symptom ) has been reported.16 although patient - reported symptoms of de were not assessed in the current study , objective signs of de , including nitfbut and ocular surface staining , were markedly improved with sysb . in summary , sysb restored long - term tear film stabilization and reduced ocular surface staining in patients with lipid - deficient de . after 4 weeks of treatment with sysb , nitfbut increases from baseline and improvements in corneal and conjunctival staining scores goblet cell density was improved in a greater percentage of patients who received sysb compared with those who received sal , and at the week 4 visit , meibomian gland expression was improved in the sysb group compared with the sal group .

purposeto evaluate the ability of systane balance ( sysb ) administered four times per day for 4 weeks to increase noninvasive tear film break - up time ( nitfbut ) over baseline compared with a saline ( sal ) control in patients with lipid - deficient dry eye ( de).patients and methodspatients aged 18 years with de and evidence of meibomian gland dysfunction ( ie , abnormal gland expression and missing meibomian glands ) were included in this randomized , parallel - group , controlled , investigator - masked comparison study . patients were randomized to sysb or sal four times daily for 4 weeks . the primary efficacy variable was mean change in nitfbut from baseline at week 4 . ocular surface staining , goblet cell density , and meibomian gland expression were also assessed . safety assessments included adverse events ( aes ) , best - corrected visual acuity , and ocular signs.resultsa total of 49 patients received study treatments ( sysb , n=25 ; sal , n=24 ) . most patients were women ( 67.4% ) and caucasian ( 63.3% ) ; mean standard deviation ( sd ) age was 4419 years . de characteristics at baseline were similar between groups . after 4 weeks of treatment , the mean sd nitfbut increase from baseline was significantly greater with sysb ( 2.830.74 seconds ) compared with sal ( 0.660.55 seconds ; p<0.001 , t - test ) . improvements in conjunctival and corneal staining , percentage of patients with increased goblet cell density , and meibomian gland expression were also observed with 4 weeks of sysb over sal . no aes were reported for either treatment group ; best - corrected visual acuity and ocular signs remained stable or improved compared with baseline.conclusionsysb restored tear film stability , improved ocular surface healing , and improved meibomian gland functionality after 4 weeks of use in patients with lipid - deficient de . no aes were reported with either sysb or sal .

You are an expert at summarizing long articles. Proceed to summarize the following text: hepatocellular carcinoma ( hcc ) is one of the major health problems worldwide , ranking as the third leading cause of cancer - related mortality in the world , and the second in china . the annual incidence of hcc in hepatitis b cirrhotic patients can run as high as 35% , and one - third will develop hcc in their lifetime . for patients with hepatitis b virus - related hcc ( hbv - related hcc ) , early - stage tumors and preserved hepatic function , liver resection , and liver transplantation offer the best therapeutic choice . the palliative treatment modalities include transarterial chemoembolization ( tace ) and targeted systemic chemotherapy with sorafenib . unfortunately , despite the continuing efforts for the curative treatment hcc with surgical resection , the rate of tumor recurrence after hepatectomy remains high ( > 70% at 5 years ) , which still limits survival of the patients . several factors are reported to be associated with an increased risk of hcc recurrence after surgical resection , including tumor characteristics such as multiplicity , size , and portal invasion , afp level , pivka - ii level , and hepatic functional parameters such as albumin level , pt , and child - pugh class [ 4 , 5 ] . recently , accumulating evidence has shown that a high serum hepatitis b viral ( hbv ) dna level is another risk factor for de novo hcc development in hbv carriers irrespective of hepatitis activity [ 6 , 7 ] . additionally , some investigators have shown the viral replicative status of subjects as a predictor of postoperative recurrence of hcc [ 8 , 9 ] . therefore , it was very significant and interesting to investigate of the molecular mechanism of the direct carcinogenic effect of hbv , and it may help us to clarify additional therapeutic targets for hcc prevention . however , in previous studies , the relation between hbv load and the recurrence of hcc after resection may be confounded by other major risk factors for recurrence , such as macroscopic vascular invasion or noncurative resection . in this paper we review the incidence of hbv - related hcc and its impact on the prevention of recurrence with antivirus therapy . individuals with chronic hepatitis b ( chb ) infection have a risk of developing hcc , that is , 100-fold greater than the persons who are not infected . most carriers of chb , including asians , africans , and a proportion of persons in mediterranean countries , acquire the infection at birth or within the first 1 to 2 years after birth . once chronic infection is established , complete eradication of the virus is still not possible , and these patients are facing the risk of hcc development . previous longitudinal studies have shown that genotype b patients have an earlier and more frequent hepatitis b e antigen ( hbeag ) seroconversion than genotype c patients , [ 12 , 13 ] indicating that genotype c patients may have more severe liver disease than genotype b patients . in addition , genotype c hbv was associated with increased viral load , and associations of hbv genotype and viral load with hcc risk were additive . this suggests that viral load and genotype determination may be important factors to consider regarding screening program for the detection of hcc and treatment indication . in patients with chb , screening for hcc is necessary even after clearance of serum hepatitis b surface antigen ( hbsag ) and hbv dna and remission of hepatitis , especially in those with a high antihepatitis b core antibody ( anti - hbc ) titer [ 14 , 15 ] because the oncogenic potential due to occult hbv infection or the integration of hbv dna is considered to continue . the earlier the seroconversion of hbeag , the better the clinical outcome of hbv carriers . a single randomized study from china comparing surveillance and nonsurveillance in hbv patients using periodic serum afp and abdominal ultrasound at 6-month intervals demonstrated the benefit of surveillance in terms of reduced mortality . with afp assays and the development of modern imaging systems , such as ultrasonography ( us ) , computed tomography ( ct ) , and magnetic resonance imaging ( mri ) , more and more hepatitis b - related hccs can be detected and diagnosed and hepatectomy early . however , the prognosis of hcc remains unsatisfactory , even after curative resection , yet with recurrence of hbv - related hcc is extremely high , which is also the main cause of death , in addition to concomitant hepatic decompensation . it has shown that with the successful implementation of hcc surveillance and curative treatment , more patients could avoid the risk of early recurrence and thus survive longer . it is well known that there are two distinct types of hcc recurrence : tumors grown from dissemination of the primary tumor and de novo tumors arising from the field effect in diseased liver [ 19 , 20 ] . however , the mechanism for recurrent carcinogenesis associated with hbv in the remaining liver in patients who have undergone curative resection remains unclear . over the past years , studies have suggested that high viral load is via direct and indirect ways which are thought to be involved for recurrence . it is possible that sustained viremia and subsequent active viral replication may contribute to the carcinogenic process . active replication of hbv may initiate malignant transformation through a direct carcinogenic mechanism by increasing the probability of viral dna insertion in or near proto - oncogenes , tumor - suppressor genes , or regulatory elements of cellular dna [ 22 , 23 ] . the integration of viral dna may increase the production of transactivator protein hepatitis b x antigen , which may promote the neoplasia of hepatocytes , as well as , bind to the p53 tumor - suppressor gene and disrupt its functions [ 24 , 25 ] . indirectly , continuing hbv replication can also induce chronic liver fibrosis and inflammation and mediate alteration in transforming growth factor - beta1 ( tgf-1 ) and alpha - m production , thereby leading to carcinogenesis [ 26 , 27 ] . imamura proposed a convenient framework to clinically differentiate each type of recurrence as early or late this framework has made it possible to assess risk factors for each type of recurrence . for one thing , early recurrence , which appears within 2 years after surgery , is associated with tumor - related factors including the presence of vascular invasion and additional tumor sites besides the primary lesion ( satellite lesion ) , which is consistent with the notion that this type of recurrence is tumor dissemination as a consequence of malignant characteristic of the primary tumor . for another , late recurrence , which appears more than 2 years after surgery , is considered to be associated with the severity of hepatic inflammation and liver damage closely linked to the field effect . discrimination of these types of recurrence is clinically important because the biological basis producing each recurrence is different , and the following therapeutic intervention should be considered accordingly . recently , kim et al . reported that persistent viremia is associated with disease - free survival after 12 months of surgery , suggesting its association with late recurrence . and wu et al . also evaluated clinical variables together with hbv - related factors including viral load , genotype , and recurrent mutations , for their prognostic implication with respect to early and late recurrence in 193 hbv - related hcc patients . during the median followup of 5 years it was found that tumor - related factors : microvascular invasion , positive cut margin , and high serum afp level were associated with the risk of early recurrence , whereas liver inflammation / damage - related factors : histological inflammation and icg-15 retention rate were independently associated with the risk of late recurrence . interestingly , the high hbv viral load was found to be associated with the risk of late , but not early recurrence , probably because the high hbv dna level is the most functional measure reflecting the exposure to the direct carcinogenic effect of hbv . as above mentioned , for patients with chb , serum hbv dna levels have emerged as the key risk factor for the development of hcc . this may argue for an earlier antiviral intervention , before the development of cirrhosis , to prevent hcc development , and even more , as adjuvant therapy after the resection hcc for the patients with a high hbv dna level to prevent late recurrence . but only a few recent studies have evaluated hbv replication status as a predictor of hcc recurrence [ 8 , 32 ] , and the interpretation of their results was complicated by the use of antiviral therapy . notably , several studies found a significant association between high hbv load and increased risk of hcc and liver cirrhosis [ 6 , 33 ] . elevations in serum hbv dna level are not only a major risk factor for hcc recurrence , but also the risk factor most amenable to modification . several large cohort studies from china , taiwan , and senegal reported that high serum hbv dna levels at the time of enrollment were associated with an increased risk of cirrhosis and hcc . therefore , it was suggested that serum hbv dna level , and not only liver disease activity , might be used as an indication for antiviral therapy . in a large prospective study of 3653 hbv carriers in taiwan , chen and colleagues the incidence of hcc correlated with serum hbv dna level at entry in a dose - response relationship . the authors concluded that high serum hbv dna levels ( > 10 copies / ml ) were a strong predictor of hcc independent of hbeag , alt , and the presence of cirrhosis . moreover , a subanalysis showed that spontaneous decline of viremia levels from levels higher than 10copies / ml to levels below 10 copies / ml was associated with a reduced risk of hcc development by comparison with patients who maintained high viremia levels . thus , the authors emphasize that effective control of hbv replication with antiviral therapy may lower the risk of hcc . antiviral treatment may render patients with hbv - related hcc better able to tolerate hcc treatments and may improve prognosis . however , the efficacy of antiviral therapy on hbv viral status and underlying liver function in patients is still unclear . many questions remain to be answered in terms of clinical management of chb to improve the prevention of hcc late recurrence : ( 1 ) can the correlations between high viral load and hcc recurrence risk be generalized to all hbv carriers whatever their hbeag status , alanine aminotransferase ( alt ) levels , and stage of chb ? and ( 2 ) the major clinical question is whether antiviral therapy can prevent hcc late recurrence . lin conducted a study in order to evaluate the effectiveness of ifn- with 16 hbv patients after medical ablation therapy for primary tumors . they found that hcc recurred in four of four ( 100% ) untreated patients and in four of 12 ( 33.3% ) ifn- treated patients ( p = .0384 ) . they concluded that ifn- therapy may reduce hcc recurrence after medical ablation for primary hcc although the sample size was too small to reach a firm conclusion . the asian cirrhosis lamivudine multicenter randomized controlled trial ( rct ) study showed that lamivudine can reduce disease progression in hbv - related cirrhosis , including an approximately 50% decrease in hcc incidence . such efficacy was achieved despite the emergence of drug resistance in approximately 50% of cases . in a small study , hung has reported 72 patients who underwent hcc resection and found that patients with viral load of more than 2000 iu / ml had a significantly higher risk of hcc recurrence after resection , with viral load being the most important correctable risk factor for hcc recurrence ( odds ratio 22.3 , 95% ci 3.3151 , p = .001 ) . however , only 10 patients were treated with lamivudine , and none of these patients had hcc recurrence compared to those without antiviral therapy , but this finding could be due to the small sample size . recently , a nonrandomized comparative study for postoperative antiviral treatment was conducted on patients who underwent curative hepatectomy for advanced hcc . patients in the treatment group ( n = 43 ) received lamivudine with or without adefovir dipivoxil , while the control group ( n = 36 ) received no antiviral treatment . the treatment group had a significantly higher hbeag seroconversion rate ( 57.2% versus 5.6% ; p < .05 ) . and hbv dna suppression rates at 12 and 24 months were 87.2% and 98.0% , respectively , in the treatment group , compared with 2.8% and 3.6% , respectively , in the control group ( p < .05 ) . the data of this study has shown the efficacy of postoperative antiviral therapy in suppressing viral replication . thus , to improve the liver function , antiviral therapy should be initiated in patients with detectable serum hbv dna level after resection . further rcts with larger numbers of patients and longer follow - up periods are urgently necessary to clarify whether the efficacy of antiviral therapy on hbv load for hbv - related hccs ' patients who underwent hepatectomy . recent reports found that an effective preoperative anti - hbv therapy could contribute to improve liver function . thia reported the incidence of postoperative hbv and exacerbation of chronic hepatitis b ( echb ) , that transient elevation of serum alt in the first week after resection occurred in 92% of cases and resolved by the second week . the serum activities of ast and alt were significantly higher in the patients with a high viral load than in those with a low viral load ( p = .0005 and p = .0089 , resp . ) . notably , the ast and alt activities were significantly higher in the patients with a high viral load , and the percentage of patients with moderately or severe active hepatitis was significantly higher in the patients with a high viral load . / l versus 226.1 60.5 mg / l ( p = .859 ) , albumin/ globulin ratio was 1.4 0.2 versus 1.3 0.2 ( p = .129 ) , and -globulin on protein electrophoresis was 20.0 4.3 versus 20.6 4.4 , in the treatment and the control groups respectively ( p = .540 ) . there were no significant differences between the two groups , and at the sixth postoperative month of followup , prealbumin was 201.3 52.4 mg / l versus 224.3 85.8 mg / l ( p = .148 ) , and albumin / globulin ratio was 1.3 0.3 versus 1.2 0.3 ( p = .114 ) . by analysis , there was no correlation between prealbumin and logarithmic difference in hbv dna level ( p = .688 ) , and between albumin / globulin ratio and logarithmic difference in hbv dna level ( p = .130 ) . however , the treatment group had a significantly greater increase in residual liver volume per unit surface area following hepatectomy ( 78.0 40.1 cm / m versus 35.8 56.0 cm / m ) at the sixth postoperative month . these results indicated that remnant liver functions in the nucleotide analog group were maintained better than those in the control group . remnant liver function is an important factor in selecting further treatment for hcc recurrence and is a prognostic factor for the survival rate . therefore , patients treated by nucleotide analogs have more aggressive therapies for hcc recurrence , resulting in improving the cumulative survival rate . as we all known , prolonged suppression of hbv replication with nucleoside or nucleotide analogs may reduce the risk of hbv - related hcc development . it aslo may prevent postsugery hcc recurrence . in a cohort study design , kim et al . 157 patients were included , among them 89 were non - viremic and 68 were viremic . the 5-year cumulative recurrence rate was 73% for viremic group compared to the non - viremic group by 55% ( p = .043 ) . however , in the previous study we found there was no significant difference in recurrence rate after surgery in the two groups ( 76.7% versus 91.7% ; p = .077 ) , after a median follow - up of 12 months . the median time to recurrence in the treatment and control groups were 7.0 and 6.0 months , respectively ( p = .072 ) . indeed , kuzuya et al . study has also reported that the cumulative recurrence rates of hcc after initial and curative treatment for hcc did not decrease by the administration of nucleotide analog . consequently , to confirm the efficacy of nucleotide analogs against the recurrence of hcc , further studies with a larger number of patients and longer follow - up period are needed to address this question . up till now , there have been very few studies that have documented whether antiviral therapy is beneficial to the survival after treatment for hcc . in theory , modulation in liver function may not only affect survival directly but also indirectly by influencing the patient 's tolerance to various treatments for recurrence . miao reported in a meta - analysis study that , postoperative antiviral therapy as a whole has been shown to reduce hcc recurrence at year 1 , 2 , 3 , and 5 . several small sample size of rct and nrcts have evaluated the efficacy and outcome of antiviral therapies in patients with hbv - related hcc after curative treatment , however , clinically meaningful differences are less . in the kuzuya et al . study , no significant differences regarding the recurrence rates of hcc was found ( p = .622 ) . the cumulative hcc recurrence rates at 1 , 2 , and 3 years in the lamivudine group were 13.5% , 35.1% , and 35.1% , respectively , while those in the control group were 13.4% , 39.2% and 53.2% , respectively . all 16 patients in the lamivudine group still alive during their follow - up period , but six of 33 patients died in the control group . there were no significant differences with regard to survival rate between the two groups ; however , the survival rates in the lamivudine group tended to be higher than those in the control group ( p = .063 ) . in the rct of liaw et al . study , continuous treatment with lamivudine has been shown to delay clinical progression in patients with chb and advanced fibrosis or cirrhosis by significantly reducing the incidence of hepatic decompensation and the risk of hcc . hcc occurred in 3.9% in the lamivudine group and 7.4% in the placebo group ( hazard ratio , 0.49 ; p = .047 ) . the previous study also found that after a median follow - up of 12 months , 41 patients of the treatment group and 36 patients of the control group had died . the 1- and 2-year overall survival rates were 41.9% and 7.0% , respectively , for the treatment group , and 33.3% and 0% , respectively , for the control group . the 1- and 2-year disease - free survival rates were 23.3% and 2.3% , respectively , for the treatment group , and 8.3% and 0% , respectively , for the control group . the date did not show a significant effect of postoperative antiviral therapy on hcc recurrence , but it showed a significant benefit in overall survival . although nucleoside analogs did not reduce short - term recurrence rate or progression of disease , they promoted postoperative viral clearance , increased residual liver volume , and enhanced hepatocyte regeneration in hcc patients associated with active hepatitis b , which significantly enhanced the tolerance to subsequent therapy . as a result , the overall survival was improved for those patients with postoperative antiviral therapy . we putative that if compared with other adjuvant therapies , antiviral therapy may serve as a cost - effective and favorable alternative to improve the prognosis of patients , and long - term prospective studies of antiviral therapy in chronic hbv carriers may aslo be required . the first treatment that had some success against chb was interferon alpha ( ifn- ) . meta - analyses have shown that ifn - a has a beneficial effect on hbeag loss and sustained reduction in serum hbv dna levels [ 41 , 42 ] . the antiproliferative effects of ifn include retardation of g1/s phase transition and inhibition of cell proliferation without apoptosis , and also induction of antiproliferative signaling through the jak / stat pathway . however , it is not clear whether it has potential effect on hcc prevention . only one rct and several case - control or cohort studies have shown its benefits for preventing hcc , particularly in cirrhotic patients who responded to therapy . in patients with decompensated cirrhosis , standard or pegylated inf- is usually contraindicated or causes profound intolerance , but it is still one of the choices for the operative candidates . during the last decade long - term lamivudine treatment can prevent complications of hbv - related liver disease as long as viral suppresion is maintained . it is considered to slow the progression of severe liver disease to cirrhosis as well as to hcc [ 38 , 45 ] . however , the overwhelming majority of patients relapsed after treatment cessation . it could form ( as will other nucleosides with even lower rates of resistance ) the backbone of maintenance combination therapies . the major disadvantage of lamivudine treatment is the high rate of resistance observed in both hbeag and anti - hbe - positive hcc patients . the resistance usually emerges after the first 6 months with cumulative rates of 1525% by 12 months and 6065% by 4 years of therapy . adefovir dipivoxil and entecavir have been shown to be safe and effective for the treatment of patients with chb that does not respond to lamivudine [ 47 , 48 ] . it is effective against both wild - type and lamivudine - resistant hbv strains . in the pivotal anti - hbe positive adefovir study , 185 patients were randomised to placebo or adefovir 10 mg daily for 48 weeks . at 48 weeks , the adefovir - treated group had significant improvement when compared with placebo improvement in liver histology ( 64% versus 33% ) , reductions in hbv dna ( 3.91 versus 1.35 log copies / ml ) , normalisation of alt ( 72% versus 29% ) , an undetectable hbv dna ( < 400 copies / ml ) , and hbeag seroconversion ( 12% versus 6% ) . data from a recent study of 125 patients undergoing long - term adefovir treatment indicated that 0% of patients had resistance in year 1 , 11% in year 3 , and 28% in year 5 . interestingly , all patients who developed adefovir resistance were not receiving lamivudine and adefovir combination therapy , but adefovir monotherapy . moreover , based on in vitro studies and limited clinical data , lamivudine has been shown to be effective in patients with adefovir - resistant hbv [ 51 , 52 ] . for these reasons above , we deduce that lamivudine and adefovir combination therapy may be better than adefovir monotherapy . because of the suboptimal profile of both lamivudine and adefovir monotherapy for patients with hbv - decompensated cirrhosis , a first - line combined indefinite use of lamivudine and adefovir is recommended in several guidelines , despite the lack of data on efficacy and safety for such a strategy . tenofovir is the latest antiviral medicine and has similar safety profile as adefovir in the phase iii trials . the goal of antiviral therapy for chb is to prevent the development of cirrhosis and hcc . to date , several guidelines for the treatment of chb patients are presented . however , there are no uniform guidelines globally for the usage of antivirals in the treatment chb , let alone antivirals on hbv - related hcc at present . currently the definite indications for the treatment of chb are serum hbv dna levels greater than 10 copies / ml and alt levels more than 2 uln [ 54 , 55 ] . according to the american association for the study of liver diseases and asian pacific association for the study of the liver guidelines , biopsy - confirmed liver disease is a key requisite for initiating treatment in patients older than 40 years of age with serum alt levels between 1 and 2 uln . if cirrhosis is present , an hbv dna level greater than 10 copies / ml is the sole criterion for treatment . treatment end points , including reduction of hbv dna levels to less than 10 copies / ml , alt normalization , hbeag loss , hbsag loss , and improvement in liver histology , are used to determine treatment success . these guidelines may apply to patients who acquire the hbv infection during adolescence or adulthood but are less suitable for most hbv carriers , who are infected in early life . in light of the reports , the liver - related mortality and complications were greater in patients with alt levels between 0.5 and 1 uln than in those with alt levels less than 0.5 uln [ 56 , 57 ] , and the revision of the uln for patients with chb is recommended by some guidelines [ 11 , 55 , 58 ] . therefore , hbeag seroconversion may not be an adequate end point for these patients ; the ideal treatment end points are permanent suppression of hbv dna to levels undetectable by polymerase chain reaction and reduction of alt levels to less than 0.5 uln . in the current treatment guidelines , treatment is based on hbv replication status and stage of liver disease , modulated by the age of the patient , hbeag status , and patient preference . however , results of experimental studies suggest that early treatment intervention is necessary to prevent liver cell damage and decrease viral genome integration . another important finding from recent studies is that viral genome integration persists despite antiviral induced viral suppression and cccdna clearance . this was shown to be associated with the expansion of cellular clones not expressing viral antigens . therefore , screening of hcc remains mandatory even in patients with sustained viral suppression induced by antiviral therapy to detect hcc for which curative treatments can be proposed . late recurrence mostly corresponds to de novo carcinogenesis associated with hbv viremia as well as the field effect in hbv - related hcc . this may support prioritized use of anti - hbv treatment as adjuvant therapy after the resection or ablation of hcc for the patients with a high hbv dna level to prevent late recurrence , given that the incidence rate of recurrence is higher than that of the initial hcc development . furthermore , investigation of the molecular mechanism of the direct carcinogenic effect of hbv may help clarify additional therapeutic targets in terms of hcc prevention . currently , available evidence , mostly obtained from pcr - based assays with limited scale , has identified a handful of the genomic integrations potentially affecting the function of genes , for example , cyclin a and telomerase reverse transcriptase , in a sporadic manner [ 61 , 62 ] . recently , emerging genomics technology like high - throughput sequencing [ 63 , 64 ] may provide a more comprehensive view of the critical recurrent oncogenic integration events . combination of the new sequencing assay with chromatin immunoprecipitation ( chip - seq ) , may help to identify oncogenic transactivation by hbv proteins to obtain complementary information of the direct carcinogenic effect caused by hbv . although an antineoplasm effect is not expected by nucleoside analogues , the incidence rate of hcc would decrease due to a cessation of hepatitis . future rcts with larger sample size , longer followup , and regular hbv dna monitoring will be needed to substantiate the beneficial effects of antiviral therapies which where performed in the light of the recently updated hbv treatment guidelines , on the prognosis of hcc and hcc recurrence . of course , they are focusing on the need to lower the threshold of commencing antiviral treatment based on hbv - related hcc .

hepatocellular carcinoma ( hcc ) is a highly prevalent and lethal cancer worldwide ; despite the curative treatment for hcc , the rate of tumor recurrence after hepatectomy remains high . tumor recurrence can occur early ( < 2 years ) or late ( > 2 years ) as metastases or de novo tumors . several tumor factors were associated with hcc recurrence ; high hepatitis b virus ( hbv ) load is the major risk factor for late recurrence of hcc after resection . preoperative antiviral therapy improves liver function , and postoperative reduce hcc recurrence . in this paper , we focus on antiviral treatment to improve the liver function , prevent recurrence , and lengthen the overall survival for hbv - related hcc .

You are an expert at summarizing long articles. Proceed to summarize the following text: takayasu arteritis is an inflammatory arteritis involving the large arteries.1 ocular manifestations are not uncommon in takayasu arteritis.2 occlusive arteritis of the aortic arch branches results in ischemic ocular manifestations , whilst involvement of the renal artery or supra - renal aorta causes eye manifestations , due to severe and uncontrolled hypertension . takayasu retinopathy had been classified into four stages by uyama and asayma.3 stage 1 takayasu retinopathy is characterized by distension of veins , stage 2 by micro - aneurysm formation , stage 3 by the formation of arterio - venous anastomoses and stage 4 by the presence of ocular complications like cataract , rubeosis iridis , retinal ischemia , neovascularization and vitreous hemorrhage . other ischemic manifestations like anterior ischemic optic neuropathy,4,5 central retinal artery occlusion6 and ocular ischemic syndrome have been described infrequently.7,8 we describe two hypoperfusive and two hypertensive manifestations in patients with takayasu arteritis , diagnosed by the american college of rheumatology classification.9 each patient had a peripheral angiogram to delineate the type of takayasu arteritis.10 in type i takayasu arteritis , the inflammatory process is localized to the arch of the aorta and its branches . in type ii disease the lesions involve both the ascending aorta , aortic arch and its branches ( type ii a ) or in addition the thoracic descending aorta ( type ii b ) . in type iii disease , the thoracic descending aorta is involved along with the abdominal aorta and/or renal arteries . abdominal aorta involvement or renal artery involvement is classified as type iv disease , whilst type v takayasu arteritis involves the entire aorta and its branches.10 a 25-year - old female with type i takayasu arteritis , presented with gradual progressive painless visual loss in the left eye of 1-year duration . her best corrected visual acuity was 6/12 in the right eye and 6/60 in the left eye . anterior segment of the left eye showed relative afferent pupillary defect , flare and cells ( 1 + ) and iris neovascularisation . fundus examination of the left eye revealed disc pallor , arteriolar attenuation without neovascularisation or retinal hemorrhages . fundus angiogram was normal in the right eye ( figure 1b ) except for an increased arterio - venous time . the left eye fundus fluorescein angiogram in the venous phase showed multiple microaneurysms and areas of capillary non - perfusion and arteriolar attenuation consistent with ocular ischemic syndrome ( figure 1a ) . the reason for the reduced visual acuity in the right eye could not be readily explained . the increased arterio - venous time could represent very early ocular ischemic syndrome in the right eye also , albeit no other changes were evident on the fundus examination and in the angiogram . the normal intraocular pressure despite closed angles could represent hypoperfusion of the ciliary body and reduced aqueous secretion . a 29 year - old female presented with a history of painless visual loss in the left eye of 3 years duration . she had right - sided hemiparesis , secondary to a cerebrovascular accident involving the left middle cerebral artery territory , just before she started developing decreased vision . her best corrected visual acuity was 6/6 in the right eye and hand movements in the left eye . anterior segment was normal in the right eye while the left eye revealed 15 degree exotropia , relative afferent pupillary defect and an early posterior sub - capsular cataract . a dilated fundus examination showed hypertensive retinopathy in the right eye and optic atrophy in the left eye . humphrey s field analyzer showed right homonymous hemianopia secondary to the cerebrovascular accident that the patient had a few years ago . fundus fluorescein angiogram showed normal perfusion to the right eye and disc hypo - fluorescence due to loss of capillary perfusion in the left eye . the venous phase of the fundus angiogram of the left eye is depicted in figure 2 . although the right subclavian artery was involved , circulation to the right eye was not compromised . however the left eye circulation was compromised sufficiently to cause an anterior ischemic optic neuropathy . the angioplasty and stenting of the subclavian and carotid arteries relieved the obstruction in the subclavian arteries and preserved circulation in the right eye even after 3 years following revascularization . the left eye visual acuity , as expected , remained unchanged despite angioplasty and stenting of the left subclavian and carotid arteries . a 13 year - old girl presented with dizziness and seizures for 3 months and decreased vision of both eyes of 1-month duration . her best corrected visual acuity was 2/60 in the right eye and 5/60 in the left eye . dilated fundus examination revealed bilateral exudative retinal detachment ( figure 3 ) involving the macula . systemic examination showed systolic blood pressure difference of 20 mm between the upper limbs ( 170/100 mmhg [ right ] and 150/100 mmhg [ left ] ) . she subsequently underwent angioplasty with stenting of both renal arteries and infra - renal aorta as well as angioplasty of both subclavian arteries . three months later , her blood pressure was under control and the best corrected visual acuity was 6/18 in both the eyes with total resolution of the retinal detachment . a 28 year - old male , diagnosed with type v takayasu arteritis , presented with gradual decrease in vision in both eyes for 2 months . a magnetic resonance imaging ( mri ) scan at that time did not reveal any intracranial pathology to account for the papilledema . a peripheral angiogram revealed bilateral renal artery stenosis and abdominal aortic aneurysm . his blood pressure control , effected by anti - hypertensive drugs and renal artery stenting , led to resolution of papilledema and maintenance of visual acuity . a 25-year - old female with type i takayasu arteritis , presented with gradual progressive painless visual loss in the left eye of 1-year duration . her best corrected visual acuity was 6/12 in the right eye and 6/60 in the left eye . anterior segment of the left eye showed relative afferent pupillary defect , flare and cells ( 1 + ) and iris neovascularisation . fundus examination of the left eye revealed disc pallor , arteriolar attenuation without neovascularisation or retinal hemorrhages . fundus angiogram was normal in the right eye ( figure 1b ) except for an increased arterio - venous time . the left eye fundus fluorescein angiogram in the venous phase showed multiple microaneurysms and areas of capillary non - perfusion and arteriolar attenuation consistent with ocular ischemic syndrome ( figure 1a ) . the reason for the reduced visual acuity in the right eye could not be readily explained . the increased arterio - venous time could represent very early ocular ischemic syndrome in the right eye also , albeit no other changes were evident on the fundus examination and in the angiogram . the normal intraocular pressure despite closed angles could represent hypoperfusion of the ciliary body and reduced aqueous secretion . a 29 year - old female presented with a history of painless visual loss in the left eye of 3 years duration . she had right - sided hemiparesis , secondary to a cerebrovascular accident involving the left middle cerebral artery territory , just before she started developing decreased vision . her best corrected visual acuity was 6/6 in the right eye and hand movements in the left eye . anterior segment was normal in the right eye while the left eye revealed 15 degree exotropia , relative afferent pupillary defect and an early posterior sub - capsular cataract . a dilated fundus examination showed hypertensive retinopathy in the right eye and optic atrophy in the left eye . humphrey s field analyzer showed right homonymous hemianopia secondary to the cerebrovascular accident that the patient had a few years ago . fundus fluorescein angiogram showed normal perfusion to the right eye and disc hypo - fluorescence due to loss of capillary perfusion in the left eye . the venous phase of the fundus angiogram of the left eye is depicted in figure 2 . although the right subclavian artery was involved , circulation to the right eye was not compromised . however the left eye circulation was compromised sufficiently to cause an anterior ischemic optic neuropathy . the angioplasty and stenting of the subclavian and carotid arteries relieved the obstruction in the subclavian arteries and preserved circulation in the right eye even after 3 years following revascularization . the left eye visual acuity , as expected , remained unchanged despite angioplasty and stenting of the left subclavian and carotid arteries . a 13 year - old girl presented with dizziness and seizures for 3 months and decreased vision of both eyes of 1-month duration . her best corrected visual acuity was 2/60 in the right eye and 5/60 in the left eye . dilated fundus examination revealed bilateral exudative retinal detachment ( figure 3 ) involving the macula . systemic examination showed systolic blood pressure difference of 20 mm between the upper limbs ( 170/100 mmhg [ right ] and 150/100 mmhg [ left ] ) . she subsequently underwent angioplasty with stenting of both renal arteries and infra - renal aorta as well as angioplasty of both subclavian arteries . three months later , her blood pressure was under control and the best corrected visual acuity was 6/18 in both the eyes with total resolution of the retinal detachment . a 28 year - old male , diagnosed with type v takayasu arteritis , presented with gradual decrease in vision in both eyes for 2 months . a magnetic resonance imaging ( mri ) scan at that time did not reveal any intracranial pathology to account for the papilledema . his blood pressure control , effected by anti - hypertensive drugs and renal artery stenting , led to resolution of papilledema and maintenance of visual acuity . takayasu s arteritis is an inflammatory vascular disease of the young and involves primarily the large arteries . classically takayasu arteritis involves the aorta and its major branches , namely subclavian , renal or carotid arteries and is occasionally called the pulseless disease , as there is difficulty in detecting peripheral pulses due to vascular narrowing.1 the disease affects more females than males and usually begins in the second or third decade of life . the estimated incidence of takayasu arteritis is 2.6 cases per million persons per year , and most new patients are women of reproductive age , with an asian or hispanic ethnic background.4 there have been very few reports of ocular ischemic syndrome7,8 and anterior ischemic optic neuropathy4,5 occurring in association with takayasu arteritis . these four unique ocular manifestations of takayasu arteritis were seen in a single center over a 1-year period . this may be attributed to the fact that our institution is a referral center for ophthalmology , interventional cardiology and rheumatology . takayasu arteritis occurs due to an autoimmune process that results in a chronic granulomatous inflammation.1 this causes attenuation and obliteration of the branches of the aorta with or without thrombosis leading to cerebral and ocular ischemia.2 the ischemic retinal changes in takayasu arteritis depend on which portions of the carotid arteries become occluded , the rate of development and duration of ocular vascular insufficiency , and the effectiveness of collateral blood supply to the eye.2 the asymmetry of ocular manifestations in cases 1 and 2 , despite bilateral involvement of the major branches of the aorta , is thus not surprising . occlusion of the branches of the aortic arch resulted in anterior ischemic optic neuropathy and ocular ischemic syndrome in the patients described in this report . stenosis of the descending aorta and its branches can cause severe hypertension due to renal artery involvement . two of our patients manifested consequences of severe hypertension related to renal artery involvement in takayasu arteritis , proven by angiography . the presence of bilateral papilledema without other changes of hypertensive retinopathy in case 4 was unusual . however no other intracranial cause of papilledema was evident on a mri scan of the brain . bilateral optic disc swelling has been reported in a child with severe hypertension due to pheochromocytoma without any other evidence of grade 4 hypertensive retinopathy.11 in the absence of other causes of papilledema and the resolution of the papilledema with control of hypertension , the papilledema was attributed to severe hypertension . these cases highlight the fact that patients with takayasu arteritis can present with either hypoperfusive ocular manifestations or hypertensive ocular manifestations and that these manifestations could lead to significant visual loss . given that a majority of these patients are young ( all patients in our series were less than 30 years of age ) , the consequence of a sight threatening ocular complication / manifestation of takayasu arteritis can be devastating . whilst some of these ocular manifestations may be acute in onset , like the acute visual loss in our patient with anterior ischemic optic neuropathy , others can be sub - acute as in the patient who had hypertensive retinopathy due to uncontrolled hypertension as a result of renal artery involvement by the arteritis . in other patients , the ocular symptoms may be more gradual and chronic , paralleling the gradual ischemia that develops due to progressive vascular occlusion of the arteries as evidenced in our patient with ocular ischemic syndrome . whilst acute sight loss , like in anterior ischemic optic neuropathy , may not be amenable to therapy that could restore sight ( despite restoration of blood flow ) , other sub - acute or chronic ocular manifestations are eminently treatable . medical treatment in the form of disease modifying drugs such as steroids and immunosuppressants alter the course of the disease whilst adequate anti - hypertensive therapy prevents the consequences of severe hypertension . circulation to ischemic areas can be either restored or improved by angioplasty and stenting of occluded arteries .

takayasu arteritis is a relatively rare inflammatory arteritis that can be associated with ocular manifestations . we report four patients with proven takayasu arteritis ; two patients manifested hypoperfusive ocular manifestations of ocular ischemic syndrome and anterior ischemic optic neuropathy whilst two others had exudative retinal detachment and papilledema as a result of severe hypertension . the ischemic ocular manifestations were a result of hypoperfusion of the ocular structures due to occlusive arteritis of the aortic arch and its branches . the exudative retinal detachment and papilledema were manifestations of severe hypertension due to renal arterial involvement . patients with takayasu arteritis should be referred for ophthalmic assessment and screening for hypoperfusive and hypertensive manifestations .

You are an expert at summarizing long articles. Proceed to summarize the following text: perforation of the small intestine is not a particularly common entity ; however , a pediatric case involving typhoid and adult cases involving trauma and iatrogenic perforations have been reported in the literature . in cases of perforative peritonitis , there are several treatment options . when contamination in the abdominal cavity is mild and localized , clinicians often prefer primary closure or resection with anastomosis ; however , when contamination is severe and the intestine is damaged , enterostomy is often preferred . here , we present a case of perforation of the small intestine with gross contamination successfully treated with t - tube enterostomy . an 86-year - old woman who had undergone appendiceal cancer surgery before 2 years presented to our institution with acute onset abdominal pain lasting for several hours with no related episode of abdominal trauma . abdominal computed tomography showed free peritoneal air and fluid in the broad area of the abdominal cavity . the scan also showed that the bowel was diffusely dilated and had an edematous wall , and many diverticula along the descending and sigmoid colon . emergency laparotomy revealed gross contamination and dirty ascites , including intestinal contents spread over the entire abdominal cavity . 1a ) , apparently a result of increased intraluminal pressure from a bowel obstruction . intestine - to - intestine or intestine - to - abdominal wall adhesions were corrected . however , primary closure or anastomosis should be avoided because of edema and damage to the intestine . instead of constructing an enterostomy , a 7-mm rubber t - tube ( willy rusch gmbh , germany ) was inserted into the lumina through the perforation , and the tube was secured at the entry hole ( perforation ) with several stitches around the perforation ( fig . the t - tube was brought out through the abdominal wall at an appropriate site to avoid kinking of the tube . the intestine was firmly sutured to the abdominal wall with several stitches to prevent leakage ( fig . 1c ) . figure 1:(a ) perforation on the edematous and damaged small intestine wall . ( b ) a rubber t - tube was inserted through the perforation and tightened in place with several stitches . ( c ) the t - tube was brought out through the abdominal wall , and the bowel was sutured to the abdominal wall at the exit site . ( b ) a rubber t - tube was inserted through the perforation and tightened in place with several stitches . ( c ) the t - tube was brought out through the abdominal wall , and the bowel was sutured to the abdominal wall at the exit site . the patient remained in the icu for 7 days due to sepsis caused by perforative peritonitis . the t - tube was kept open to decompress the intestine . on the 13th postoperative day , we used contrast medium to confirm that there was no dilatation or obstruction of the intestine , and no leakage into the abdominal cavity . she required dysphagia rehabilitation after surgery and , although oral intake was initially insufficient , enteral nutrition through t - tube precluded any need for parenteral nutrition during the rehabilitation period . by the 34th postoperative day , in cases of small intestine perforation with gross contamination , an enterostomy is usually constructed , but several authors have reported the success of t - tubes , although predominately in small children . reported that they performed t - tube ileostomy in five cases of intestinal perforation in extremely low - birthweight neonates , and that all the patients survived without severe complications . pandey et al . also reported the usefulness of t - tubes in children with typhoid ileal perforation . to date , however , t - tube enterostomy for intestinal perforation in adult patients has not been reported . . the patient may be able to avoid anastomotic leakage as a complication of primary closure or bowel resection with primary anastomosis , especially when extensive bowel damage exists , as in the case reported here . second , since enterostomy output is usually liquid and high in volume , it can cause fluid and electrolyte imbalances . this can cause severe stress for the patients already in critical condition with sepsis caused by perforative peritonitis . in contrast , the daily amount of discharge in our patient never exceeded 85 ml . a third advantage is that enteral feeding can be performed through the t - tube . finally , a t - tube can be easily removed from the body without anesthesia at bedside , and the fistula usually closes spontaneously . miller et al . reported a colostomy closure - related morbidity rate of 20% . a t - tube enterostomy can be an effective alternative to a standard enterostomy in selected cases ; however , there are limitations . first , when the adhesion around the perforated intestine is too extensive to free the intestine from the surrounding organs , t - tube enterostomy should be avoided . a key component of this procedure is to tighten the t - tube at the entry hole and firmly fix the tube at the perforation site to the abdominal wall to prevent intestinal contents from leaking into the abdominal cavity . second , although t - tube drainage for duodenal perforation and esophageal perforation has been reported , t - tube drainage would be insufficient in cases of colon perforation because of the solid content . finally , when the perforation occurs near the terminal ileum , enteral feeding from the t - tube is largely useless . in conclusion , in selected cases of perforation of the small intestine , t - tube enterostomy can be an effective treatment . the procedure s advantages include no anastomotic leakage , easier management of fluid and electrolyte levels , postoperative enteral feeding from the tube , shorter operative time and no need for a second operation to close the stoma .

in cases of small bowel perforation with gross contamination , enterostomy has traditionally been the treatment of choice . an 86-year - old woman was diagnosed with perforative peritonitis . emergency laparotomy revealed a small bowel perforation with gross contamination , and a t - tube enterostomy was performed . the t - tube was used for intestinal decompression for the first few days and was then accompanied by enteral feeding . when oral intake was sufficient , the t - tube was removed . the abdominal wall s fistula healed within 2 days of removal . except for wound infection , the patient developed no postoperative complications . under specific circumstances , a t - tube enterostomy can be an effective alternative for a traditional enterostomy . its advantages include less or no anastomotic leakage , easier management of fluid and electrolyte levels , postoperative enteral feeding from the tube , a shorter operative time and no need for a second operation to close the stoma .

You are an expert at summarizing long articles. Proceed to summarize the following text: one of the main challenges for contemporary neuroscience has been to uncover the neural correlates of social cognition . research in this area has been dominated by two main theories : the theory theory and the simulation theory . according to the theory theory , social cognition depends on a theory of minda psychological theory about how beliefs , desires , and intentions are interrelated and inform actions ( fodor , 1992 ; gopnik and meltzoff , 1997 ; carruthers , 2009 ) . simulation theory claims that social cognition involves putting ourselves in the shoes of others by simulating the mental states we would have in their situation ( goldman , 2006 ; hurley , 2008 ; gallese and sinigaglia , 2011 ) . despite the fact that they are often portrayed as rivals , most versions of the theory theory and the simulation theory share an important assumption . they take it for granted that social understanding ( usually ) involves mindreading , i.e. , the capacity to attribute mental states such as beliefs , desires , and intentions to others in order to predict or explain their behavior ( nichols and stich , 2003 ; apperly , 2011 ) . mindreading does not require us to interact with other people : we may simply speculate about their mental states while standing at the margins of the situation . as a result , proponents of the theory theory and the simulation theory have primarily investigated the neural correlates of social cognition by means of a third - person ( 3p ) approach in which participating subjects are not actively engaging with other agents but merely observe them . most studies on the neural correlates of theory of mind , for example , require subjects to make inferences about how the protagonist of a story would behave or feel ( for review , see : mar , 2011 ) . these experiments are usually devoid of any interaction between the subjects and the protagonist whose mental states they are supposed to read . this lack of interaction is also characteristic of neuroimaging research conducted in the simulation theory framework . studies of the mirror neuron system ( mns ) , for instance , typically involve a condition in which subjects observe another agent who performs an action , and a condition in which they perform the same action themselves . however , there is no interaction between the subjects and the agent in either condition . these interaction theorists , as we will label them , argue that the theory theory and the simulation theory are fundamentally flawed because they fail to recognize the importance of our dynamic interactions with others . what is needed , according to them , is an interactive turn in social cognition research ( de jaegher et al . , 2010 ) . some interaction theorists suggest that a 2p approach will shed new light on the neural mechanisms that underlie social cognition ( schilbach et al . others claim that a 2p approach does justice to the phenomenology of our everyday encounters with others ( ratcliffe , 2007 ; gallagher and zahavi , 2008 ) . then there are those who think that a 2p approach to social cognition will allow us to solve the problem of other minds , i.e. , the problem of how we can access the mind of others ( gallagher , 2004 ; reddy , 2008 ) . besides these different motivations for advocating a 2p approach to social cognition , interaction theorists also have different conceptions of what such an approach precisely entails , and how it should be spelled out in contrast to the 3p approach endorsed by the theory theory and the simulation theory . the first aim of the present article is to critically analyze the 2p challenge to social neuroscience , and assess the various ways in which interaction theorists have articulated the distinction between 2p versus 3p modes of social cognition . in section against the idea of an observational stance , we argue that interaction theorists are right to oppose the idea of an observational stance . drawing a parallel with recent criticism on the two - systems model of visual perception , we will show that there actually is no such thing as passive observation every perceiver , no matter how detached , is actively involved in what she perceives . although we take this to be a strong argument for interaction theory , it also shows that we can not use the difference between active engagement and passive observation to ground a strong distinction between 2p and 3p modes of social cognition . in section social interaction versus social cognition , we discuss another way of explicating this distinction . some interaction theorists not only make a case for the intertwinement of perception and action , but also claim that this may be constitutive of social cognition . according to them , there are situations in which social cognition is nothing over and above social interaction . however , we argue not only that social cognition often does entail more than social interaction , but also that the proposed contrast between social interaction and social cognition does not provide a good basis for the distinction between 2p versus 3p modes of social cognition . the second aim of the article is to put forward an alternative conceptualization of the distinction between 2p versus 3p modes of social cognition one that gives pride of place to the notion of reciprocity . in section reconceptualizing 2p interaction , we argue that what distinguishes 2p from 3p modes of social cognition is not their interactive or non - cognitive nature , but rather the fact that they involve reciprocal interaction . on our view , 2p modes of social cognition may and often do recruit capacities that interaction theorists take to be characteristic of 3p modes of social cognition as long as the demand for reciprocity is met . finally , in section the real challenge to social neuroscience , we briefly compare our proposal to frith and frith 's ( 2011 ) signaling model of social cognition , and discuss its implications for neuroscientific experiments on social cognition . interaction theorists often criticize the 3p stance toward others that is presupposed by the theory theory and the simulation theory for being a specialized and relatively rare mode of social cognition one that is characterized by a lack of actual interaction and a reliance on passive observation . they argue that , in everyday life , we find ourselves constantly engaged in dynamic interactions with others : we buy a ticket at the counter of the station , travel by train with our fellow passengers , have a coffee with our colleagues and discuss new plans in a meeting . these 2p modes of social cognition do not require us to adopt an observational stance . in what follows pure observational stance by drawing a parallel with recent criticism on the two - systems model of visual perception . according to the two - systems model , dating back to the early work of leslie ungerleider and popularized by milner and goodale , this influential model distinguishes a ventral processing stream dedicated to vision - for - perception from a dorsal stream that is involved in vision - for - action ( milner and goodale , 2008 ) . the ventral processing pathway projects from early visual areas to the inferior temporal lobe , while the dorsal processing pathway projects to the parietal lobe . neuropsychological support for this distinction is provided by patients with visual form agnosia , such as patient df , who was unable to report the orientation of a bar that he was able to grasp in a correct way ( goodale et al . , 1991 ) . by contrast , patients with optic ataxia show preserved object recognition abilities , while having difficulties with directing actions toward these same objects . other evidence for a dissociation between the dorsal and ventral visual stream has been obtained by studies on visual illusions , showing for instance that grasping kinematics in the ebbinghaus illusion are insensitive to the illusory percept accompanying the mere perception of the stimulus ( smeets and brenner , 2006 ) . the two - systems model has been further corroborated by neuroimaging studies showing that visual information is processed differently depending on whether the information is used for subsequent action or perception ( e.g. , valyear et al . , 2006 ) . however , the two - systems model has not gone unchallenged . first , within the neuroscience community an ongoing debate concerns the interpretation of the evidence in favor of the two streams hypothesis ( for recent discussion , see : schenk and mcintosh , 2010 ) . for instance , several studies have shown that grasping and pointing movements are affected by visual illusions as well ( see for instance : skewes et al . , 2011 ) . in addition , in a recent paper it has been shown that patient df 's differential performance on the action and perception task can largely be accounted for by the effects of haptic feedback ( i.e. , only after grasping she gets feedback about the correctness of the movement ; schenk , 2012 ) . at a neural level there is strong evidence for reciprocal interactions between dorsal and ventral stream areas at several levels in the processing hierarchy ( himmelbach and karnath , 2005 ; pisella et al . , 2006 ) . for example , it has been shown that the ability to consciously see an object and identify its gestalt depends on both ventral and dorsal processing streams ( huberle and karnath , 2011 ) . finally , the errors displayed by patients with optic ataxia or visual form agnosia can not always easily be interpreted as evidence in favor of damage to one specific visual stream . for instance , patient df , with supposed damage to ventral stream areas showed action planning deficits as well , such as a failure to anticipate the fingertip forces required for object grasping or displaying action semantic errors such as grasping objects in a functionally incorrect way ( carey et al . , 1996 ) . these considerations have led to a revision of the original two - systems model , such that the distinction between dorsal and ventral processing streams should be considered as reflecting a relative rather than an absolute functional specialization ( schenk and mcintosh , 2010 ) . in recent philosophical debates , proponents of the sensorimotor approach to visual cognition , for example , have argued that the strict distinction between vision - for - perception and vision - for - action is misguided , because there is no such thing as pure vision - for - perception ( o'regan and noe , 2001 ; no , 2004 ) . they argue that the problems with the two - systems model described above testify to the fact that perception involves the employment of sensorimotor skills , and can not be fully separated from action . whenever we see a tomato , for example , our eyes only take into the fovea the plane orthogonal to the vector of the eyes ' focus . however , our sensorimotor capacities let us perceive the tomato as a three - dimensional solid object one that can be grasped , and which appearance changes as we move around it . on the view advocated by the sensorimotor approach , the visual system has evolved in order to enable us to act in the surrounding world ( wheeler , 2006 ) . as a result , the way in which we perceive the world depends on our bodily capabilities . the idea that perception and action are intimately linked is not new and dates back to the ideomotor principle put forward by william james , who noted that every representation of a movement awakens in some degree the actual movement which is its object more recently this principle has seen renewed interest in the so - called theory of event coding , according to which perception and action share a common representational format ( hommel et al . , 2001 ) . support for this idea is found in behavioral experiments for instance , in which it is shown that the presentation of an action effect ( e.g. , a sound ) results in the reactivation of the motor program associated with achieving the action effect ( e.g. , making a button press ; e.g. , hommel , 1996 ) . these findings reflect that based on training we have acquired strong associations between specific actions and their resultant effects . the ideomotor principle accounts for a wide range of behaviors in which perception and action are tightly linked , such as imitation , observational learning and joint action . in the case of imitation , for instance , observing a specific movement , such as lifting a finger , activates in the observer the corresponding motor program required for achieving the effect and thereby facilitates imitative behavior ( e.g. , brass et al . , 2000 ) . at a neural level , this perception - action coupling is likely mediated by visuomotor neurons in premotor and parietal areas ( koski et al . , 2002 ; kilner et al . , 2004 ; newman - norlund et al . , 2007 ) a complementary line of evidence for the idea that perception is directly coupled to action can be found in the selection - for - action principle , according to which the sole purpose of the perceptual system is to gather information for interaction with the environment ( allport , 1987 ) . it has been found for instance , that one 's action intention determines the way in which sensory information is processed already at an early stage in the visual system , as reflected in a modulation of early visual evoked potentials when one intends to grasp compared to point toward a target ( van elk et al . , 2010 ) . together these studies highlight the close link of perception and action , and suggest that any attempt to demarcate perception- from action - related processes in a principled way is arbitrary . the criticism of the two - systems model of visual perception can be extended to the debate on social cognition to illustrate that there is no such thing as a pure observational stance toward others . 2008 ) have shown that when we see a smiling face we automatically tend to mimic this smile , at least in terms of specific muscle activation . enactive element through which we engage with and respond to stimuli instead of a mere passive perception of face - based cues . another illustration is provided by the mns studies : if one takes a closer look at the neural processes involved in cases where subjects passively observe another agent 's action from a 3p point of view , one notices that there is only a short amount of time ( 30100 ms ) between the activation of the visual cortex and the activation of the pre - motor cortex ( gallagher , 2007 ) . although this casts doubt on the possibility to draw a strict demarcation line between action and perception , it does not imply that we can not differentiate between observation and action conditions . the mns studies , for example , show that during the observation of another agent 's action , our motor system becomes active as if we were executing the action ourselves ( gallese , 2001 ) . some argue that in the case of action observation the actual execution of the action is inhibited ( schutz - bosbach et al . , 2009 ) . others claim that the absence of an efference copy of the motor command signals that the event is externally generated ( wolpert et al . , 1995 ) . however , what is agreed upon is that we can sensibly distinguish between observation and action conditions . interactivists often claim that 2p interactions rather than 3p observations are the backbone of social cognition . more in particular , they argue that 2p modes of social cognition are primary to 3p modes of social cognition , not only in the sense that ( 1 ) they involve capabilities that come earlier in development and are likely to be partially innate , but also in the sense that ( 2 ) they remain the default way how we understand others ( gallagher , 2001 , 2011 ) . the first claim about the developmental primacy of 2p modes of social cognition might look problematic in the light of recent studies on implicit false belief understanding in early infancy . spontaneous - response false belief tests , in which infants ' understanding of false belief is inferred from the behavior they spontaneously produce ( e.g. , anticipatory looking , longer looking times ) , seem to indicate that infants at a very young age are already able to adopt a 3p observational stance toward other agents in order to anticipate their behavior ( see baillargeon et al . however , even without taking into account these findings , proponents of the theory theory and the simulation theory could maintain that the claim about developmental primacy is compatible with the idea that social development basically comes down to a transition from 2p to 3p modes of social cognition . as currie ( 2008 , p. 212 ) sees it , for instance , the abilities for 2p modes of social cognition underpin early intersubjective understanding , and make way for the development of later theorizing or simulation [ i.e. , 3p modes of social cognition ] they argue that 2p interaction does not make way for purportedly more sophisticated mindreading processes , but instead continues to characterize our everyday encounters even as adults . if we look at the phenomenological evidence and pay attention to our everyday experience , so the argument goes , we will find that 2p interactions rather than 3p observations are pervasive in our social life ( see , e.g. , ratcliffe , 2007 ; gallagher and zahavi , 2008 ) . as we have argued elsewhere ( de bruin et al . , 2011 ; de bruin and kstner , 2012 ) , the claim that 2p interactions remain the default way how we understand others is problematic insofar it depends on an appeal to phenomenology . the question which mode of social cognition is characteristic of our everyday encounters with others is an empirical one , and can not be decided on the basis of a overgaard and michael ( under review ) rightly criticize the idea of having a single everyday stance toward other people : in the course of any one day , we not only interact with others in various ways , but we also , and not infrequently , simply observe people . ultimately , the question about the dominance of 2p versus 3p modes of social cognition might simply boil down to a question about the commonality of a certain type of personality , for instance , extrovert ( as in interacting ) versus introvert ( as in observing ) ( mccrae and costa , 1987 ) . claims about the developmental primacy and phenomenological pervasiveness of 2p versus 3p modes of social cognition also face a more general worry . if interaction theorists spell out the difference between 2p and 3p modes of social cognition in terms of active engagement versus passive observation , then it becomes unclear how to draw a line between 2p and 3p modes of social cognition . for , as we have argued in the previous section , the distinction between active engagement and passive observation appears to be gradual rather than absolute . and this , in turn , undermines the claims about the developmental primacy and phenomenological pervasiveness of 2p interactions . some interaction theorists , however , spell out the difference between 2p and 3p modes of social cognition in a different way . they claim that 2p modes of social cognition are direct in the sense that they do not require cognitive processes to mediate between our perception of others and our actions toward them . action loops that define the various things that i am doing with or in response to others . gallagher proposes a rich notion of enactive perception , which is meant to obviate the kind of cognitive processes postulated by the theory theory and the simulation theory . he argues that in seeing the actions and expressive movements of the other person in the context of the surrounding world , one already sees their meaning ; no inference to a hidden set of mental states ( beliefs , desires , etc . ) ( 2010 ) explain in more detail how social cognition can be equivalent to social interaction . in contrast to an enabling condition , according to which the ability must have been acquired at some point in development , a constitutive condition requires that the ability is exercised at the very moment we are trying to make sense of others . ( 2010 ) argue that , in some cases , 2p interactions can be a constitutive and not merely an enabling condition for social cognition . rather , we would like to point out that interaction theorists still have to account for those cases in which social cognition clearly is something over and above social interaction . take interaction theory 's criticism of the 3p paradigm employed by the theory of mind approach and the simulation theory , for example . as overgaard and michael ( under review ) argue , if interaction theorists agree that this paradigm puts subjects in the role of detached spectators rather than interacting agents and their complaint shows that they do agree with this then the results of these experiments clearly show that social cognition is possible without social interaction . or consider empirical studies of cases in which social interaction is completely lacking but a capacity for social cognition remains . patients suffering from a total locked - in - syndrome ( bauer et al . , 1979 ) , for example , are no longer able to engage in real - time interaction with others , but they are still able to understand them to some degree ( laureys et al . , 2005 ) . we can find similar dissociations between enabling and constitutive conditions in other domains as well . for example , the development of a body image , i.e. , a ( cognitive ) system of perceptions , attitudes , and beliefs pertaining to oneself ( cash and brown , 1987 ; powers et al . , 1987 ; gardner and moncrieff , 1988 ) , depends on a body schema a system of sensorimotor capacities that functions without reflective or perceptual monitoring in an immediate and close to automatic fashion ( gallagher , 2005 ) . although a body schema is an enabling condition for a body image , it is not constitutive condition . patients with deafferentation , such as ian waterman ( cole , 1995 ; gallagher and cole , 1995 ) , suffer from certain impairments in their body schema ( loss of tactile and proprioceptive input ) , but their body image remains intact and even allows them to compensate their disabilities to some extent . another interesting dissociation between enabling and constitutive conditions has been found in relation to the use of linguistic concepts . whereas there is a clear correlation between action verbs like kick , pick and lick and pre - motor cortex activation ( pulvermller and fadiga , 2010 ) , this is not the case for abstract verbs such as think ( rueschemeyer et al . , in other words , although understanding action verbs may be a necessary step for understanding more abstract psychological verbs , it is certainly not a constitutive condition . what these examples show is that it is not hard to come up with cases in which social cognition is something over and above social interaction . the question is to what extent interaction theorists are able to account for these often more advanced forms of social cognition . according to de jaegher and froese ( 2009 , p. 439 ) , the biggest challenge for interaction theorists is to show how an explanatory framework that accounts for basic biological processes [ i.e. , enactivism ] can be systematically extended to incorporate the highest reaches of human cognition . this is what they call the cognitive gap . a more important question for our purpose here , however , is whether the proposed contrast between social interaction and social cognition provides us with a good basis for the distinction between 2p versus 3p modes of social cognition . for most interaction theorists , the main target in the debate on social cognition has been the so - called sandwich model of the mind , which regards perception as input from the world to the mind , action as output from the mind to the world , and cognition as sandwiched in between ( hurley , 2008 , p. 2 ) . according to the sandwich model , cognition is required in order to translate visual input into motor output , since there is no direct interaction between perception and action . because of their commitment to this model , many proponents of the theory theory and the simulation theory have simply assumed that our social engagements require us to engage in a cognitive process of mental state attribution ( by means of either theory or simulation or both ) . on the one hand , we agree with interaction theorists that the sandwich model should not be presupposed as a general model underlying all forms of social cognition ( as mindreaders tend to do ) . at the same time , however , from this it does not automatically follow that one has to reject the cognitive capacities that are thought to be representative of the sandwich model . some of these capacities might actually play an important role in 2p modes of social cognition as well . in the next section , we will substantiate this idea by proposing an alternative conceptualization of the distinction between 2p and 3p modes of social cognition . we propose that what distinguishes 2p from 3p modes of social cognition is their reciprocal nature . that is , 2p modes of social cognition feature agents who coordinate their actions with one another what is sometimes called ( fuchs and de jaegher , 2009 ; de jaegher et al . , 2010 ) . importantly , we take the capacity for reciprocal interaction to be an ontogenetic achievement and not something that human beings are simply born with . following sebanz et al . first of all , reciprocal interaction depends on the ability to share representations of objects and events with others . visual habituation studies indicate that 5-month - old infants already respond selectively to the goals of another agent rather than the physical details of their actions ( woodward , 1998 , 2005 ) . however , it is not until 912 months of age that they begin to engage in shared attention , and their interactions with others begin to have a reference to the things that surround them ( hobson , 2002 ; tomasello et al . , 2005 ) . shared attention creates a perceptual common ground this allows infants to direct another agent 's attention to outside objects in which they are interested in themselves . the pointing gesture , for example , enables them to declare their interest in specific objects in their surroundings ( phillips et al . , 2002 ; woodward and guajardo , 2002 ; sodian and thoermer , 2004 ) . more importantly , however , shared attention also allows infants to coordinate their actions with those of another agent . meltzoff ( 1995 ) showed that 18-month - olds are capable of completing an unfinished action of another agent , such as pulling apart miniature dumbbells . although shared attention provides interacting agents with a focal point of interest , it is grounded in a more basic system for sharing representations : the mns . the mns matches action observation and action production ( rizzolati and craighero , 2004 ; rizzolatti and sinigaglia , 2010 ) , and facilitates a common coding of perception and action ( see section against the idea of an observational stance ) . mns activation has been investigated in early infancy as well ( kanakogi and itakura , 2010 ) , and research on infant imitation has been cited as evidence for the fact that the mns is an innate mechanism ( e.g. , iacoboni et al . , 1999 ; decety et al . , 2002 ; grezes et al . what is important is that the mns facilitates action anticipation , which is considered a second prerequisite for coordinating one 's actions with those of another agent according to sebanz et al . ( 2006 ) , for example , showed that 12-month - old infants are capable of anticipating an agent 's action toward an object ( picking up and placing it in a container ) by making eye movements ahead of the moving hand . the experimenters argued that these findings provide direct support for the idea that action anticipation depends on a mns which is triggered by the infant 's perception of another agent 's goal - directed behavior . more direct support for the involvement of the mns in action prediction was obtained in a study by meyer et al . ( 2011 ) , which showed a stronger anticipatory motor - related brain response when 3-year old children observed the action of a partner they were actively interacting with compared to the action of an outsider . we can elucidate the role of the mns in action anticipation by mapping the neural circuit of the mns onto an inverse - forward model ( iacoboni , 2003 , 2005 ) . the superior temporal sulcus ( sts ) is responsible for the visual representation of an observed action . an inverse model then feeds this visual representation into the fronto - parietal mns and converts it into a motor plan . in a next step , this motor plan is sent back from the fronto - parietal mirror neuron to the sts and converted into a predicted visual representation ( a sensory outcome of action ) by means of a forward model . this two - step process explains how infants ( and adults , see flanagan and johansson , 2003 ; ambrosini et al . , 2011 ) are able to track another agent 's goal - directed behavior toward objects with predictive eye - movements . the mns might also play a role in the initiation and execution of complementary actions . 2007 ) found that mirror neuron areas ( right inferior frontal gyrus and bilateral inferior parietal lobes ) are more active when observers are simultaneously preparing a complementary action than when they are preparing an imitative action . ( 2006 ) point out , the ability to prepare complementary actions can not be fully explained in terms of shared representations . motor resonance might enable action anticipation , but this ( 1 ) crucially depends on action perception and ( 2 ) does not explain how we become capable of choosing an appropriate complementary action at an appropriate time . in order to address the first point , sebanz et al . ( 2006 ) appeal to studies on shared task representations , in which two agents have to covertly represent each other 's task requirements without observing each other 's action . for instance , in a study by ramnani and miall ( 2004 ) , participants acquired stimulus response mappings , and were then presented with stimuli indicating whether they should respond , a co - actor in another room should respond , or a computer should respond . although the other 's actions could not be observed , participants anticipated the co - actor 's actions . this was associated with activity in motor areas , including ventral premotor cortex , as well as areas typically involved in mindreading . according to sebanz ( 2006 ) , these results suggest that the mechanisms underlying mental state attribution might be triggered by shared task representations ( cf . sebanz and frith , 2004 ) . in order to deal with the second point , sebanz et al . ( 2006 ) postulate a third prerequisite for action coordination : the ability to integrate the predicted effects of own and others ' actions . they discuss this ability in relation to a number of studies that show how individuals incorporate others ' action capabilities into their own action planning ( richardson et al . , 2007 ) , and how temporal feedback about another agent 's action is used in anticipatory action control ( knoblich and jordan , 2003 ; jordan and knoblich , 2004 ) . ( 2006 ) pay relatively little attention to what we take to be another crucial prerequisite for reciprocal interaction : perspective taking . in order to engage in reciprocal interaction , elsewhere , we have proposed a developmental model in which we distinguish three modes of perspective taking ( de bruin and newen , 2012 ) : motor perspective taking , which allows infants to understand another agent on the basis of her movements ( e.g. , woodward , 1998 , 2003 , 2005).visual perspective taking , which allows infants to understand another agent on the basis of what she ( visually ) perceives ( e.g. , onishi and baillargeon , 2005 ; southgate et al . , 2007).cognitive perspective taking , which allows children to understand another agent on the basis of propositional attitudes such as beliefs and desires ( e.g. , wimmer and perner , 1983 ; baron - cohen et al . motor perspective taking , which allows infants to understand another agent on the basis of her movements ( e.g. , woodward , 1998 , 2003 , 2005 ) . visual perspective taking , which allows infants to understand another agent on the basis of what she ( visually ) perceives ( e.g. , onishi and baillargeon , 2005 ; southgate et al . , 2007 ) . cognitive perspective taking , which allows children to understand another agent on the basis of propositional attitudes such as beliefs and desires ( e.g. , wimmer and perner , 1983 ; baron - cohen et al . , 1985 ; rakoczy et al . , 2007 ) . the development of perspective taking is important insofar as reciprocal interaction requires that agents are on the same level . for example , classic versions of the false belief test show that children under 4 years of age fail to verbally predict the behavior of another agent on the basis of her false belief ( cognitive perspective taking ) . of course as gallagher ( 2005 ) has pointed out , for example , although these children fail to predict the behavior of the agent they observe , they have no difficulty understanding the experimenter . but it does show that they are not yet able to reciprocally interact with other agents in terms of their ( false ) beliefs at least not on a verbal level . more advanced modes of perspective taking allow children to engage in more advanced modes of social interaction . importantly , the various capacities described above can be recruited in 2p as well as 3p modes of social cognition . they are not to be classified as 2p or 3p because of their interactive or perceptual nature , or because they do or do not involve cognitive processing . what counts instead is whether they are recruited for reciprocal ( 2p ) or non - reciprocal ( 3p ) interaction . on our view , therefore , 2p modes of social cognition may involve a lot of observation and only a minimal amount of action ( see , for example , schilbach et al . , 2p modes of social cognition may involve cognitive processes such as mental state attribution . imagine that i am playing an online chess - game with a friend who lives in the us . i 'm staring at my computer screen and from time to time i click on my left mouse button . there is a lot of mindreading going on : i am trying to find out what my friend 's next move will be , and whether i can capture his queen in the next turn . this scenario qualifies as a 2p mode of social cognition even though it involves a lot of mindreading and only a minimal amount of bodily movement because there is reciprocal interaction between us . i am practically dragging him forward , but he is too drunk to realize this . i am not thinking about whether he believes he is drunk , or whether he still desires beer ; all my attention is focused on preventing him from stumbling . on our view , this scenario should not be classified as a 2p mode of social cognition . despite the fact that it features a very active agent who is not engaged in mindreading , these examples show that capacities that are usually associated with ( non - reciprocal ) 3p modes of social cognition , such as perspective taking , actually play a crucial role in ( reciprocal ) 2p modes of social cognition as well . developmental studies show that this is not only true for adult human beings , but also for infants . ( 2009 ) , for example , provides an excellent illustration of how infants manage to engage in reciprocal interaction with an experimenter by taking into account his visual perspective . in the experiment , infants watched as a toy was transferred from box a to box b while an experimenter either witnessed the transfer of the toy ( true belief condition ) or not ( false belief condition ) . then the experimenter attempted unsuccessfully to open box a the empty box . in the true belief condition , infants could follow their natural tendency to help the experimenter by opening box a for him . in the false belief condition , if infants understood the experimenter 's false belief , they had to understand that he wanted the toy he thought was in there . in this case they should not simply help him to open box a , but rather go to box b and retrieve the toy for him . the results indicated that , by 18 months of age , infants were able to actively assist the experimenter in his search for the toy . what this shows is that perspective taking is not limited to non - reciprocal 3p modes of social cognition , but instead plays a constitutive role in 2p modes of social cognition as well . according to our reconceptualization , 2p modes of social cognition can but do not necessarily have to be cooperative in nature . furthermore , 2p modes of social cognition are not only about understanding other agents but also about misunderstanding them . as de jaegher ( 2009 ) suggests misunderstandings are the pivots around which the really interesting stuff of social understanding revolves . in these instances where coordination is lost , we have the potential to gain a lot of understanding ( p. 540 ) . so far we argued against two ways in which the distinction between 2p versus 3p modes of social cognition can be articulated : as active engagement versus passive observation , and as social interaction versus social cognition . instead , we have proposed an alternative conceptualization of this distinction one that gives pride of place to the notion of reciprocity . accordingly , capacities that interaction theorists take to be characteristic of 3p modes of social cognition play an important role in 2p modes of social cognition as well . however , this does not mean that we take mindreading to be a necessary ingredient of 2p modes of social cognition . consider the signaling model of social cognition recently put forward by frith and frith ( 2011 ) . frith and frith point out that the perception of biological movements elicits activity in the sts , especially the posterior part ( allison et al . , 2000 ) , and suggest that this is likely to be a very basic and universal brain mechanism . ostensive signaling , by contrast , is done deliberately ( e.g. , by making eye contact or calling someone by name ) . this type of signaling is needed for closing the loop in 2p modes of social cognition , where both sender and receiver need mutual knowledge that signals are being exchanged deliberately . furthermore , frith and frith propose that a critical role in establishing mutual knowledge between sender and receiver is played by anterior rostral medial prefrontal cortex ( mpf ) or armpfc ( see also amodio and frith , 2006 ) . and because activity in the armpfc is elicited by mentalizing tasks , they argue that mindreading is very important for closing the loop between minds . we would like to propose that what is required for closing the loop is reciprocal interaction rather than mutual knowledge . it is less problematic than the requirement of mutual knowledge because , in order for knowledge between agents to be mutual , each agent has to know what the other agent knows and also know that the other agent knows that the first agent knows etc . this leads to an infinite regress ( lewis , 1969 ; clark and marshall , 1981 ; sperber and wilson , 1995 ) . it is less demanding because it does not necessarily involve mindreading ( since mindreading is only necessary as long as we assume that mutual knowledge is required to close the gap ) . our discussion of the various forms of perspective taking ( see reconceptualizing 2p interaction section ) showed that there is more than one way to close the loop between minds . for example , visual perspective taking closes the loop insofar it enables agents to represent whether a given object is seen by another agent without requiring them to attribute mental states to others ( hutto , 2011 ) . cognitive perspective taking , by contrast , enables agents to represent another agent 's belief about a given state of affairs . what are the implications of our view for neuroscientific research on social cognition ? first , our reconceptualization of 2p interaction is meant to encourage researchers to take into account both observational and enactive conditions when studying the neural correlates of reciprocal interaction . for example , it would be interesting to contrast observational 2p conditions in which subjects are following the gaze of a virtual avatar ( schilbach et al . , 2010 ) with more enactive 2p conditions in which subjects are throwing a ball with a virtual avatar ( david et al . , 2006 ) . this would make clear to what extent these conditions recruit common resources or are neurally differentiated . second , our proposal invites a closer look at the role of cognitive processing in reciprocal interaction . so far , a lot of research in social neuroscience has focused on non - reciprocal modes of social cognition , in which subjects have to attribute mental states to another agent . we know that mental state attribution in such conditions is associated with a theory of mind network , consisting of the mpf , the temporoparietal junction ( tpj ) , the sts and the temporal poles ( frith and frith , 2003 ; amodio and frith , 2006 ) . however , what we also want to know is to what extent this network is recruited during reciprocal interactions , in which subjects have to attribute mental states to each other . the new field of neuro - economics , for example , uses paradigms from game theory and behavioral economics to study the neural correlates of social interactions and preferences , e.g. , for fairness , cooperation and trust ( e.g. , singer , 2012 ) . most studies in this field involve reciprocal interactions in which subjects attribute mental states to each other , for instance when playing some version of the prisoner 's dilemma game . it would be interesting to see if these reciprocal interactions share common ( neural ) resources with the non - reciprocal modes of social cognition mentioned above . most mns studies still employ non - reciprocal paradigms , in which subjects either observe another agent 's action or perform the same action themselves . the real challenge to social neuroscience would be to transform both theory of mind and mns studies into full - blown dynamical studies involving reciprocal 2p interactions . for example , one could take a classic version of the false belief test , in which infants have to attribute false belief to another agent , as a starting point , and add reciprocal elements like gaze interaction between the infant and the agent in a stepwise manner . such an experiment might also put the findings on false belief understanding in a new perspective . in this article we have argued for an understanding of 2p modes of social cognition in terms of reciprocity . what distinguishes 2p from 3p modes of social cognition is not the amount of action involved or the absence of cognitive processing , but rather the fact that they involve reciprocal interaction . in the end , this is what the interactive turn in social cognition research should be about . the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest . the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .

over the last couple of decades , most neuroscientific research on social cognition has been dominated by a third - person paradigm in which participating subjects are not actively engaging with other agents but merely observe them . recently this paradigm has been challenged by researchers who promote a second - person approach to social cognition , and emphasize the importance of dynamic , real - time interactions with others . the present article 's contribution to this debate is twofold . first , we critically analyze the second - person challenge to social neuroscience , and assess the various ways in which the distinction between second- versus third - person modes of social cognition has been articulated . second , we put forward an alternative conceptualization of this distinction one that gives pride of place to the notion of reciprocity . we discuss the implications of our proposal for neuroscientific studies on social cognition .

You are an expert at summarizing long articles. Proceed to summarize the following text: nail fragility , nail thickening and onycholysis may considerably reduce ability to manipulate small objects and can be a serious handicap , for example , to jewelers , musicians or illusionists . we report the case of mario , an eccentric 23-year - old man , a card illusionist who had alopecia areata ( aa ) universalis for the last 15 years . he had accepted his hair loss and was not seeking treatment for it . in january 2007 , he consulted us because he developed severe abnormalities of all his fingernails . at clinical examination , the fingernails were yellow gray colored and showed severe onycholysis , involving the whole nail plate and nail bed hyperkeratosis [ figure 1 ] . the patient asked for treatment as the nail changes did not permit him to continue his work as card illusionist . he was treated with intramuscolar triamcinolone acetonide 0.5 mg / kg / month , for 3 months [ figure 2 ] . severe onycholysis with distal to proximal detachment of the nail plate , nail bed hyperkeratosis regression of the nail changes after systemic triamcinolone acetonide for 3 months aa most commonly affects the scalp but it may involve beard , eyelashes , eyebrows , pubic , axillary , body hair . in patients with aa , nail abnormalities were found in 10 - 66% of the patients . hence , nail changes due to nail matrix inflammation are common and usually not severe ; geometric pitting affects up to 34% of patients , others alterations include trachyonychia , punctate leukonychia , mottled lunulae and onychomadesis . the nails are useful tools in many occupations and their cosmetic appearance is important in all occupations where personal contact occurs . in mario 's case the nail abnormalities were severe and affected the nail bed with symptoms that are not typical of nail aa . systemic steroids were very effective and treatment was justified by the important impact of the nail changes on the patient 's job .

in patients with alopecia areata ( aa ) , nail abnormalities due to nail matrix inflammation are common and usually not severe . we report the case of a 23-year - old man with aa universalis , who developed severe abnormalities of all his fingernails . systemic steroids improved the onycholysis that had an important impact on the patient 's job , as he was a card illusionist .

You are an expert at summarizing long articles. Proceed to summarize the following text: a properly performed lymphadenectomy helps detect occult nodal metastases in 25% of the patients undergoing rc . currently , extended radical lymphadenectomy is strongly recommended for all patients undergoing rc for the treatment of bladder cancer , because of more accurate staging and improved postoperative survival . moreover , recent reports have shown that the resection of a large number of lns is associated with a survival advantage among patients with ln - positive disease . however , morbidity increases if large numbers of lns are resected . most bladder cancer patients who are required to undergo rc are evaluated before the procedure by cystoscopy and computed tomography . establishing a correlation between tumor location and the direction of ln metastatic spread is useful knowledge for surgeons performing rc with lymphadenectomy . the aim of this study was to determine the number and location of the tumors in the bladder and to determine the correlation between these factors and ln metastasis . we retrospectively reviewed the records of patients who underwent surgery for bladder cancer ( pathological n1 or higher ) at ilsan hospital ( department of urology , national health insurance corporation ilsan hospital , goyang , korea ) between 1 january 2000 and 31 august 2010 . to ensure consistency , the same investigator reviewed all of the charts to extract data on demographics , admission and operation , and pathological conditions . a total of 78 cases of patients who had undergone rc with extended lymphadenectomy were identified from the database . we excluded 42 patients without ln metastasis or any other organ metastasis ( m1 ) . the location of the cancer within the bladder was classified as right or left ( defined by a vertical line between the ureteral orifices ) , front or posterior ( defined by a horizontal cross line between the ureteral orifices ) , or whole ( defined as the presence of an invading mass in more than two zones ) bladder . additionally , the ln metastasis pattern was classified as right , left , or bilateral in reference to the aorta . statistical analyses were performed by using spss ver . 12.0 ( spss inc . , chicago , il , usa ) . continuous variables were expressed as medians ( ranges ) and were compared by using an independent t - test . correlations between the location of the bladder tumor and the site of ln metastasis were determined by using the chi - square test . survival was compared by using the log - rank test and kaplan - meier analysis . we retrospectively reviewed the records of patients who underwent surgery for bladder cancer ( pathological n1 or higher ) at ilsan hospital ( department of urology , national health insurance corporation ilsan hospital , goyang , korea ) between 1 january 2000 and 31 august 2010 . to ensure consistency , the same investigator reviewed all of the charts to extract data on demographics , admission and operation , and pathological conditions . a total of 78 cases of patients who had undergone rc with extended lymphadenectomy were identified from the database . we excluded 42 patients without ln metastasis or any other organ metastasis ( m1 ) . the location of the cancer within the bladder was classified as right or left ( defined by a vertical line between the ureteral orifices ) , front or posterior ( defined by a horizontal cross line between the ureteral orifices ) , or whole ( defined as the presence of an invading mass in more than two zones ) bladder . additionally , the ln metastasis pattern was classified as right , left , or bilateral in reference to the aorta . statistical analyses were performed by using spss ver . 12.0 ( spss inc . , chicago , il , usa ) . continuous variables were expressed as medians ( ranges ) and were compared by using an independent t - test . correlations between the location of the bladder tumor and the site of ln metastasis were determined by using the chi - square test . survival was compared by using the log - rank test and kaplan - meier analysis . the patients included 30 men and 6 women with an average age of 66 years ( range , 48 to 79 years ) . there were 3 ( 8.3% ) , 15 ( 41.7% ) , 11 ( 30.6% ) , and 7 ( 19.4% ) pathologic pt1 , pt2 , pt3 , and pt4 cases , respectively . the mean number of resected lns was 10.4 ( range , 4 to 29 ) , and the mean number of pathologically positive lns was 1.8 ( range , 1 to 11 ) . as shown in table 1 , we observed 28 and 8 patients with pathologic pn1 and pn2 , respectively . we observed 16 patients ( 44.4% ) with bladder cancer on the right side ( group 1 ) , 16 patients ( 44.4% ) with bladder cancer on the left side ( group 2 ) , 2 patients ( 5.6% ) with posterior bladder cancer ( group 3 ) , and 2 patients ( 5.6% ) with whole bladder cancer ( group 4 ) . in group 1 , 14 patients ( 87.5% ) had right - sided ipsilateral positive lns , and 2 patients ( 12.5% ) had left - sided contralateral positive lns ( 12.5% ) . in group 2 , 4 patients ( 25% ) had right - sided contralateral positive lns , and 12 patients ( 75% ) had left - sided ipsilateral positive lns . in group 3 , two patients ( 100% ) had right - sided posterior positive lns . in group 4 , two patients ( 100% ) had positive lns on both sides ( table 2 ) . we found a significant correlation between the location of the tumor and the site of ln metastasis ( chi - square test , p<0.001 ) . ipsilateral metastasis was found in 26 cases , contralateral metastasis in 6 cases , and no ln metastasis in 42 cases . kaplan - meier survival analysis showed that the 5 year median survival rate of patients with ipsilateral metastasis was 37% , with contralateral metastasis was 18% , and without ln metastasis was 61% ( p<0.001 ) ( fig . , the presence of ipsilateral or contralateral metastasis predicts poor survival in patients with bladder cancer . most bladder cancer patients experience lymphatic metastasis in the course of disease progression . nonetheless , many studies have shown that patients with ln - positive disease can achieve long - term survival by extended radical lymphadenectomies despite initial poor prognosis . those same studies have shown that a positive ln status is found in 23% of all bladder cancer patients . furthermore , data from those analyses highlight that patients with ln - positive disease have a mean 5 year recurrence - free survival rate of 30% ( range , 20.9 to 35% ) . the relationship between the location of the primary tumor and the direction of metastatic spread has not been fully investigated . interestingly , however , a recent study has suggested a close correlation between the histologic characteristics of the primary tumor and the metastatic pattern . to the best of our knowledge , this was the first study to analyze the correlation between tumor location in the bladder and pattern of ln metastasis relative to survival rates . the 5 year survival rate of the ipsilateral ln - positive group was 37% , whereas that of the contralateral ln - positive group was 18% . this result indicates that patients with contralateral ln metastasis might have a poorer prognosis than those with ipsilateral ln metastasis . of the 32 patients with a lateralized bladder tumor , 6 ( 19% ) had lns in the contralateral side . these data suggest that bilateral nodal dissection in patients with invasive bladder cancer does not necessarily occur . in fact , invasive bladder cancer usually spreads around the circumference of the bladder in a large percentage of cases . on the other hand , wishnow et al . analyzed patients in whom the primary bladder tumor was localized clearly to one side of the bladder , and they observed unsuspected metastasis only in patients with ipsilateral ln cancer . on the basis of these findings , we advocate a restricted pelvic lymphadenectomy for patients in whom gross examination shows no evidence of nodal metastasis during rc . in our study , we found a significant correlation between the location of the bladder tumor and ln positivity . however , we are reluctant to not infer that there is no evidence of nodal metastasis on the contralateral side in patients with bladder cancer . in fact , our data indicate that lymphadenectomies must be performed bilaterally , even if the primary cancer is limited to the right or left hemisphere of the bladder wall , because even contralateral nodal metastases may eventually occur . the risk of contralateral metastases is only slightly lower than that of ipsilateral metastases . in agreement with our claim , previous retrospective studies have shown a survival benefit for patients undergoing bilateral extended radical lymphadenectomies [ 6 - 8 ] . notwithstanding the possible advantages , all of the participating urological surgeons unanimously agreed that an extended radical lymphadenectomy takes up to 60 minutes longer than does a lymphadenectomy that cranially ends at the level of the iliac arteries and therefore , knowledge of the exact location of the tumor would be useful for surgeons performing rcs and lymphadenectomies . although the group with ln metastasis on the contralateral side had a poorer prognosis than did those with ln metastasis on the ipsilateral side , tumor grade was also a valid prognostic factor . when the latter is taken into account , the distance of the ln from the tumor itself may not be an independent prognostic factor . the current study had some limitations : the surgeon may have been biased toward the presence of ipsilateral ln metastases , the sample population was small , a single operator was not used , and a single chemotherapy protocol was not performed . the site of ln metastasis was significantly correlated with the location of the bladder tumor . moreover , survival was significantly affected in patients with ipsilateral and contralateral ln - positive bladder cancer .

purposeresection of a large number of lymph nodes ( lns ) increases survival in patients with ln - positive disease ; however , morbidity also increases . here , we investigated the correlation between tumor location and ln metastasis in bladder cancer.materials and methodsthirty - six patients with pathological n1 or higher bladder cancer , who underwent radical cystectomy with extended lymphadenectomy , were reviewed retrospectively . the tumor location was classified as right , left , front , posterior , or whole bladder . the ln metastasis pattern was classified as right , left , or bilateral . the correlation between tumor location and ln metastasis was determined by chi - square test . survival rates were compared by kaplan - meier analysis.resultsthe numbers of patients with a tumor on the right ( group 1 ) , left ( group 2 ) , posterior ( group 3 ) , or whole ( group 4 ) bladder were 16 ( 44.4% ) , 16 ( 44.4% ) , 2 ( 5.6% ) , and 2 ( 5.6% ) , respectively . in group 1 , 14 patients ( 87.5% ) had right - sided ipsilateral lns , and 2 patients ( 12.5% ) had left - sided contralateral lns . in group 2 , 4 patients ( 25% ) had right - sided contralateral lns , and 12 patients ( 75% ) had left - sided ipsilateral lns . in group 3 , both patients ( 100% ) had right - sided posterior lns . in group 4 , both patients ( 100% ) had positive lns on both sides . tumor location and ln metastasis were significantly correlated ( p<0.05 ) . moreover , the survival rate was significantly higher in patients with no ln metastasis than in patients with ipsilateral or contralateral ln - positive bladder cancer.conclusionsthe location of the bladder tumor and direction of metastatic spread were significantly correlated . mandatory bilateral lymphadenectomy during radical cystectomy should be questioned .

You are an expert at summarizing long articles. Proceed to summarize the following text: short bowel syndrome ( sbs ) is the most common cause of protracted intestinal failure . even though the causes of sbs are diverse , the management has identical pillars : parenteral nutrition ( pn ) and early enteral nutrition ( en ) . prognosis is associated with age - adjusted small bowel length , the presence of the ileocaecal valve ( icv ) and colon , the advent of pn complications , and the capacity of the remaining intestine to adapt . several hormonal and surgical methods to improve bowel adaptation have been reported [ 38 ] , but en remains an important and controllable factor . direct trophic effect of nutrients and stimulation of gastrointestinal secretions and hormonal factors enhances intestinal adaptation [ 3 , 6 , 8 ] . we present 4 cases of ultrashort bowel syndrome ( < 40 cm residual small bowel ) ( table 1 ) rapidly weaned of pn after introduction of an elemental formula ( neocate , nutricia , strombeek - bever , belgium ) . table 2 illustrates the composition of neocate compared to other elemental formulas available in other countries and to the semi - elementary formula used in 2/4 patients . all patients received a ppi ( omeprazole ) as additional medication as part of the sbs treatment . the diagnosis of congenital short bowel in patient 1 was made by explorative laparotomy at the age of 3 months . he had no treitz angle , a small bowel of 50 cm , and a colon of 30 cm length . en with semi - elemental formula was started following the en scheme used in our department as illustrated in table 3 . a third of his calories was tolerated by continuous en through a gastrostomy ( 43 kcal / kg / d ) , and home pn was organised for the remaining caloric requirements ( 86 kcal / kg / d ) . the advancement of en was limited by recurrent profuse diarrhoea , and at 3 years of age , neocate was introduced . he was started at 1/3 of his daily requirements ( total cals : 130 kcal / kg / d ) on continuous enteral infusion and upgraded following table 2 . after initial pn weaning , the patient needed another 5 days of tpn during an episode of d - lactate acidosis with severe dehydration . he was started on probiotics ( vsl3 : 450 bilion lactic acid bacteria per package in defined ratios of bifidobacterium breve , bifidobactium longum , bifidobacterium infantis , lactobacillus acidophilus , lactobacillus plantarum , lactobacillus paracasei , lactobacillus bulgarius , streptococcus thermophilus by vsl pharmaceuticals , inc . ) and remains well since . although rast testing remained negative , serum albumin dropped , and the patient stopped growing for 12 months ( 25th percentile to 10th percentile ) . he remains on step 4 of the weaning scheme ( table 2 ) receiving 46% of his calories by nocturnal feeds ( 1500 ml neocate 20% + 20 g protifar = 1527 kcal/58.5 g ew/69.2 g v/168 g kh ) , and reintroduction of cow 's milk and soy protein is planned . his motor development is normal , and his growth parameters ( height and weight ) follow the 10th percentile . patient 2 was born at 25 weeks gestation , with a birth weight of 700 g and suffered severe enterocolitis at day 27 . a second look operation revealed 32 cm of small bowel remaining to re - establish continuity . several attempts to start and increase en with semi - elemental formula ( alfare , nestle , brussels , belgium ) failed . continuous enteral feeding with neocate was started successfully in combination with pn and oral stimulation ( table 2 , step 1 ) . at the age of 5 months the patient reached step 2 ( table 2 ) when she left the hospital at 8 months of age ( total calories 128.4 cal / kg / day ) . she obtained complete oral gastrointestinal autonomy at the age of 1 year and has successfully been switched to semi - elemental formula ( nutramigen , mead johnson , braine - l'alleud , belgium and frisomel ; friesland coberco dairy foods , meppel , the netherlands ) . her growth is normal ( weight 10th percentile , height 10th25th percentile ) , and her vitamin status and electrolytes are checked regularly and are within the normal range without supplements . patient 3 , born at 33 weeks , 1700 g , had dark gastric aspirates five days after birth . a large bowel resection left 12 cm of jejunum and 8 cm of ileum with an intact colon and a preserved icv . en with neocate was started 14 days after surgery following table 2 . at the age of 2 months , the patient tolerated full en on neocate 20% ( step 2 , table 2 ) . a gastrostomy was placed , and pn was discontinued . at discharge , he was on daytime boluses and night - time continuous feeding ( step 3a table 2 ) which were adapted weekly following tolerance ( total calories 142 cal / kg / day , 10% po , 90% ps ) . he achieved oral autonomy ( step 4 table 2 ) at 6 months , and solids were introduced . his oral caloric intake from neocate remained 93 cal / kg / day . by that time , the patient caught up in length and weight , reaching normal growth percentiles ( 3rd percentile ) for his age . in patient 4 , born at term , the amniotic fluid was meconium stained , the abdomen was dilated , and vital signs were compromised . extensive resection was needed , leaving 5 cm of duodenum , 4 cm of terminal ileum , the icv , and the colon . postoperatively tpn was initiated . on day 12 , continuous enteral feeding with neocate following table 2 was started . when she was discharged home at the age of 3 months , the gastrostomy had been removed due to peritonitis , and she was fed by small oral boluses of neocate 20% ( 6 20 ml ) and nightly pn ( 130 kcal / kg / d , 36% po and 64% pn ) . although she made good progress with oral neocate , growth deviation from the 50th to the 25th percentile indicated the need for extra support and nocturnal feeding through a gastrostomy at 11 months . the patient maintained her growth with oral intake and supplemental enteral feeding ( total 121.5 kcal / kg / d , 73.5% po and 26.5% ps ) ( step 4 table 2 ) . frequent liquid stools without reducing substances were debilitating and persisted despite trials of cotrimoxazole , cholestyramin , and probiotics . she eats a varied diet during the day and has nightly enteral supplements with neocate ( total 121.5 kcal / kg / d , 48% po and 52% ps , 4.9 g prot cow 's milk and soy are excluded from her diet because of clinical intolerance and elevated rast tests . she was toilet trained at 30 months and has normal motor development and growth ( weight 50th percentile , height 25th percentile ) . sbs is defined as malabsorption and failure to thrive following extensive resection of the small bowel . surgical classification of sbs is based on the residual length of the small intestine measured peroperatively along the antimesenteric border . although residual length is an important element , it is not the only prognostic factor . the adaptive capacity of the remaining gut is a major component for obtaining enteral autonomy . enteral autonomy and pn weaning while maintaining adequate growth are the principal endpoints in this group of patients . continuous enteral feeding is the starting method of choice as it enhances intestinal absorption and improves tolerance . concentration of the continuous feed is progressively increased until total caloric requirements are tolerated . only then , pn is discontinued , and bolus feeding initiated . enteral tolerance is monitored by intake , growth , stool frequency , stool consistency , reducing substances , and biochemistry . three of the 4 infants reported have an ultrashort gut ( < 40 cm ) , and one has a congenital short bowel of 50 cm , in which function is known to be altered . all patients needed parenteral nutrition , but enteral autonomy was obtained and maintained relatively rapidly ( < 13 months ) after introduction of neocate ( table 1 ) . georgeson and breaux retrospectively described a group of 52 sbs patients receiving an elemental diet . pn weaning was obtained in 12/21 , and the mean weaning period was 24.1 months . not all patients could be weaned off pn , but the majority of this group had no icv ( 17/21 ) . more recently , goulet et al . reported 78 sbs patients , receiving initially a hydrolyzed diet , followed up for 15 years . ultrashort bowel , < 40 cm , was seen in 21/78 patients . in 9 patients ( 42.8% ) pn weaning failed , and in the 12 patients remaining ( 57.2% ) , enteral or parenteral support was necessary after initial pn weaning . the weaning period in georgeson 's study was considerably shorter with an elemental diet compared with goulets ' group , receiving a semi - elemental diet ( 24.1 versus 47.4 months ) . semi - elemental or elemental formulas are most frequently started [ 1 , 6 ] . where some studies suggest that a more complex diet with long chain fat ( lcf ) and complex carbohydrates enhances adaptation [ 1315 ] , others support the important influence of an elemental diet on the weaning of pn and enteral tolerance . the first 2 patients described in our series failed to thrive on a hydrolyzed formula as did 4 patients reported by bines et al . . although the ratio is different , both hydrolyzed and elemental formulas contain lcf and complex carbohydrates . therefore , another contributing factor needs to be considered : the elimination of a certain allergen or the presence of a yet unidentified stimulating substance . many children acquire sbs at a very young age ; it makes them naturally prone for cow 's milk intolerance ( cmi ) . in infants generally , cmi is considered to be 2%-3% below the age of 2 years , but there is no exact data about the incidence of cmi and food allergy in sbs patients , except for small case series [ 16 , 17 ] . an alteration in gut permeability , often present in sbs patients , can be a predisposing factor . first of all , the administration of tpn without enteral support increases intestinal permeability , whereas the administration of even small amounts of en can reverse this process . bacterial overgrowth on the other hand , a common complication of sbs , influences gut permeability through local gut inflammation . we think that the combination of these factors might make sbs patients more prone for cmi . in 2 of our patients ( patient 1 and 4 ) , even the late introduction of cow 's milk protein failed . this is an additional argument for the contribution of cmi to their initial feeding intolerance and explains the success of neocate in these patients . only 1 study compared intestinal permeability in sbs patients in a crossover study with hydrolized and whole protein formula . ten patients were included when 30% of enteral nutrition was tolerated , and no difference in intestinal permeability was found . although measurement of intestinal permeability in this patient group while investigating tolerance to different formulas is of interest , no comment was made about pn weaning , 30% of enteral nutrition had to be tolerated before inclusion , the study period was rather short ( 60 days ) , and no washout period in between formulas was considered . because of a parental choice , none of the patients received breast milk . cmi develops less frequently in breastfed babies , and breast milk has the additional trophic effect of probiotics and growth factors on the intestinal mucosa , beneficial to sbs patients [ 8 , 18 ] . unfortunately we realise that , even after reporting these 4 cases , the published data about the relationship between residual bowel length , bowel adaptation , formula , cmi , and pn weaning remain scarce . in all our patients icv and colon were preserved , which increases the chance of definite pn weaning [ 1 , 2 , 6 ] . evidence from randomised controlled trials ( rcts ) on this subject is lacking . because of limited patient numbers , large rcts are difficult to perform in a single centre and a multicentre approach is necessary . measurement of intestinal permeability , growth , allergic parameters , and pn duration should be included . if breast milk is not an option , we would recommend an amino - acid based formula as the initial enteral feeding for sbs infants . it may lead to reduction in pn duration , cost , and complications and benefit the patients ' quality of life . despite all , it remains important as a doctor to focus on the outcome for the patient and to continue investigating if the initial treatment fails .

clinical management of short bowel syndrome remains a multistage process . although pn is crucial , early introduction of enteral feeding is mandatory . we describe retrospectively 4 patients with an ultrashort bowel who could be weaned off pn on very short terms after introduction of an amino - acid - based formula ( neocate ) . patient 1 had congenital short bowel with 50 cm small bowel and 30 cm colon . he had persistent diarrhoea on a semielementary formula . when neocate was introduced he could be weaned from pn within 6 months . patient 2 needed multiple surgical interventions because of nec at d 27 . he maintained 40 cm small bowel and an intact colon and remained pn dependent on semielemental formula . after introducing neocate , pn could be weaned within 3 months . in the next 2 patients , neocate was introduced as initial enteral feeding after bowel resection following antenatal midgut volvulus . patient 3 had 20 cm small bowel and an intact colon . pn was weaned after 2 months . patient 4 had 9 cm small bowel and an intact colon . pn was weaned after 13 months . in all patients ileocaecal valve ( icv ) was preserved . no consensus is reached on the type of formula to use for short bowel syndrome . compared to recent data in the literature , the weaning period in these 4 patients was significantly shortened on an aminoacid based formula . the reason for this may lie in the antiallergic properties of this formula . we recommend the use of an amino - acid - based formula to induce earlier weaning of pn .

You are an expert at summarizing long articles. Proceed to summarize the following text: several dermatological conditions are severe enough to merit inpatient admission for proper investigation and management . the relative frequency of different diseases requiring inpatient care may vary in different geographic regions . dermatology is primarily an outpatient - oriented specialty , most of the skin diseases being associated with variable morbidity but low mortality . however , there are several dermatological disorders which are severe enough to mandate inpatient admission . seriously ill patients may need regular clinical and laboratory monitoring , parenteral therapies , advanced nursing care and multispecialty referral for their condition which is only possible in an inpatient setting . absence of domestic pressures and opportunities for the patients for gaining skills needed to manage their condition themselves in future are additional advantages . there is evidence for significant improvement in measures of quality of life , depression , and anxiety following hospitalization for skin disease . till date , most of the studies concerning dermatology inpatient admissions hail from the western world , where psoriasis , bullous disorders , chronic ulcers , and dermatitis constitute about 70% of the inpatients . in comparison , immunobullous disorders , infections , and drug reactions are the most common causes of inpatient admissions in this part of the globe . we undertook this study to ascertain the characteristics of indoor admissions and the patterns of disease and their outcome at a tertiary care center in eastern india . dearth of studies addressing inpatient dermatology in india has prompted us to embark on this work . we conducted a retrospective analysis of admissions and discharge records of all patients admitted during 20112014 . the data obtained were analyzed statistically focusing mainly on the demographic profile of patients , clinical diagnosis , type of complications , referrals made to other departments , duration of hospital stay , mortality , and final condition of patient at the time of discharge . a total of 375 patients were admitted under our departmental care from 2011 to 2014 . the major reasons for admission were severe disease with potential mortality , lack of response to outpatient management , and need for nursing care . in our study , the mean age was calculated to be 45.5 2 years , ranging from 6 to 90 years . diagnoses were assigned to one of the following ten categories : immunobullous disorders , psoriasis , erythroderma , infections , cutaneous adverse drug reactions , eczema / dermatitis , vasculitis , connective tissue disorders , malignancies , and miscellaneous dermatoses . immunobullous disorders ( 91 cases , 24.27% ) comprised the most frequent cause of admission followed by various causes of erythroderma ( 80 cases , 21.33% ) and different infective disorders ( 73 cases , 19.47% ) . pemphigus vulgaris , bullous pemphigoid , and pemphigus foliaceus were the most common immunobullous disorders ( in order ) . leprosy ( 43 patients ) comprised 59% of the infectious disease group followed by postkala azar dermal leishmaniasis ( pkdl ) ( 27 patients , 37% ) . remainder of the infectious diseases group consisted of 2 patients of severe cellulitis and one patient of rhinoscleroma . almost all leprosy patients ( 40 ) were admitted for reactions ( type 2 > type 1 ) . pkdl patients were admitted for detailed evaluation and administration of liposomal amphotericin b. the mean duration of stays for leprosy and pkdl patients were 21.3 days and 22.4 days , respectively . all the clinical diagnostic groups along with percentage of patients affected are tabulated [ table 1 ] . clinical diagnoses with percentage of patients affected ( n=375 ) about 25.5% of our patients developed at least one complication during their hospital stay , while 133 ( 35.46% ) patients had to be referred to other departments for their optimum management [ table 2 ] . percentage of patients requiring referral to other departments ( n=133 ) the final outcome following hospital stay was satisfactory ; majority of the patients improved , and they have been advised regular follow - up at our outpatient department ( 312 , 83.2% ) ; 19 ( 5.07% ) patients left against medical advice , 8 ( 2.13% ) patients had to be transferred out to icu and other departments for effective management . despite our best efforts , 29 ( 7.46% ) patients died . the cause of death and the final diagnoses of deceased patients are shown in table 3 . mean length of stay , referral and mortality rates of different diagnostic categories the duration of hospital stay ranged from 1 day to 164 days ; the mean duration being 22.16 15.73 days . the duration of stay along with the referral and mortality rates of patients belonging to different diagnostic categories has been tabulated [ table 4 ] . cause of death and final clinical diagnosis at the time of death ( n=29 ) in our study , male patients ( 62.2% ) outnumbered female patients ( 37.5% ) . the mean age was calculated to be 45.5 2 years , ranging from 6 to 90 years . diagnoses were assigned to one of the following ten categories : immunobullous disorders , psoriasis , erythroderma , infections , cutaneous adverse drug reactions , eczema / dermatitis , vasculitis , connective tissue disorders , malignancies , and miscellaneous dermatoses . immunobullous disorders ( 91 cases , 24.27% ) comprised the most frequent cause of admission followed by various causes of erythroderma ( 80 cases , 21.33% ) and different infective disorders ( 73 cases , 19.47% ) . pemphigus vulgaris , bullous pemphigoid , and pemphigus foliaceus were the most common immunobullous disorders ( in order ) . leprosy ( 43 patients ) comprised 59% of the infectious disease group followed by postkala azar dermal leishmaniasis ( pkdl ) ( 27 patients , 37% ) . remainder of the infectious diseases group consisted of 2 patients of severe cellulitis and one patient of rhinoscleroma . almost all leprosy patients ( 40 ) were admitted for reactions ( type 2 > type 1 ) . pkdl patients were admitted for detailed evaluation and administration of liposomal amphotericin b. the mean duration of stays for leprosy and pkdl patients were 21.3 days and 22.4 days , respectively . all the clinical diagnostic groups along with percentage of patients affected are tabulated [ table 1 ] . clinical diagnoses with percentage of patients affected ( n=375 ) about 25.5% of our patients developed at least one complication during their hospital stay , while 133 ( 35.46% ) patients had to be referred to other departments for their optimum management [ table 2 ] . percentage of patients requiring referral to other departments ( n=133 ) the final outcome following hospital stay was satisfactory ; majority of the patients improved , and they have been advised regular follow - up at our outpatient department ( 312 , 83.2% ) ; 19 ( 5.07% ) patients left against medical advice , 8 ( 2.13% ) patients had to be transferred out to icu and other departments for effective management . despite our best efforts , 29 ( 7.46% ) patients died . the cause of death and the final diagnoses of deceased patients are shown in table 3 . mean length of stay , referral and mortality rates of different diagnostic categories the duration of hospital stay ranged from 1 day to 164 days ; the mean duration being 22.16 15.73 days . the duration of stay along with the referral and mortality rates of patients belonging to different diagnostic categories has been tabulated [ table 4 ] . in our study , male patients ( 62.2% ) outnumbered female patients ( 37.5% ) . the mean age was calculated to be 45.5 2 years , ranging from 6 to 90 years . diagnoses were assigned to one of the following ten categories : immunobullous disorders , psoriasis , erythroderma , infections , cutaneous adverse drug reactions , eczema / dermatitis , vasculitis , connective tissue disorders , malignancies , and miscellaneous dermatoses . immunobullous disorders ( 91 cases , 24.27% ) comprised the most frequent cause of admission followed by various causes of erythroderma ( 80 cases , 21.33% ) and different infective disorders ( 73 cases , 19.47% ) . pemphigus vulgaris , bullous pemphigoid , and pemphigus foliaceus were the most common immunobullous disorders ( in order ) . leprosy ( 43 patients ) comprised 59% of the infectious disease group followed by postkala azar dermal leishmaniasis ( pkdl ) ( 27 patients , 37% ) . remainder of the infectious diseases group consisted of 2 patients of severe cellulitis and one patient of rhinoscleroma . almost all leprosy patients ( 40 ) were admitted for reactions ( type 2 > type 1 ) . pkdl patients were admitted for detailed evaluation and administration of liposomal amphotericin b. the mean duration of stays for leprosy and pkdl patients were 21.3 days and 22.4 days , respectively . all the clinical diagnostic groups along with percentage of patients affected are tabulated [ table 1 ] . about 25.5% of our patients developed at least one complication during their hospital stay , while 133 ( 35.46% ) patients had to be referred to other departments for their optimum management [ table 2 ] . the final outcome following hospital stay was satisfactory ; majority of the patients improved , and they have been advised regular follow - up at our outpatient department ( 312 , 83.2% ) ; 19 ( 5.07% ) patients left against medical advice , 8 ( 2.13% ) patients had to be transferred out to icu and other departments for effective management . despite our best efforts , 29 ( 7.46% ) patients died . the cause of death and the final diagnoses of deceased patients are shown in table 3 . the duration of hospital stay ranged from 1 day to 164 days ; the mean duration being 22.16 15.73 days . the duration of stay along with the referral and mortality rates of patients belonging to different diagnostic categories has been tabulated [ table 4 ] . cause of death and final clinical diagnosis at the time of death ( n=29 ) we analyzed the records of 375 patients , spanning over 4 years ( 20112014 ) . the majority ( 62% ) of our patients were males , who were mostly in their fifth decade . similar male preponderance was noted in an australian study , while a nepalese study showed female preponderance . the mean age of our patients ( 45.5 ) was similar to the findings reported from iran ( 44 years ) , whereas it was higher when compared to the findings of studies from nepal ( 35.5 years ) and south africa ( 34.1 years ) . where as a higher mean age of about 53 years , was reported from greater manchester , uk . the most common cause of admission in our study was immunobullous disorders ( 91 patients , 24.27% ) , followed by various causes of erythroderma ( 80 patients . pemphigus vulgaris was the most common immune - bullous disorder , accounting for almost 46% of the cases of this group . immunobullous disorders was also the most common cause of admission in iran and fourth most common cause in the usa ; however , it was pretty uncommon in a spanish hospital . infections were the third most common cause of admission in our series ( 19.47% ) . leprosy , mainly reactional forms , was the most frequent infective disorder , followed by pkdl . infective conditions were the most frequent cause of indoor admission in pakistan , while those accounted for 15.9% of admissions in brazil ; 8.3% of admissions in nepal , and 3.74% in iran . cutaneous adverse drug reactions ( stevens johnson syndrome - toxic epidermal necrolysis [ ten ] , drug hypersensitivity syndrome , exanthematous reaction ) accounted for 10.67% of admission in our study whereas it was most important cause of admission at nepal ( 21.6% ) . while psoriasis , dermatitis , skin cancers , and leg ulcers comprised the most common causes of admission in western countries , these conditions accounted for lesser number of admissions in our study . about 25.5% of our patients developed some form of complications during their hospital stay , while 35.6% of our patients had to be referred to at least one specialist department for management of their disease complications and comorbidities . this rate of referral is much lower than that reported by an australian study ( 92% ) . most referrals were made to the department of internal medicine ( 48.87% ) followed by the department of ophthalmology ( 20.30% ) [ table 2 ] . the mean duration of hospital stays for our patients ranged from 1 to 164 days ( mean 22.16 15.7 ) . about 107 patients ( 28.55% ) stayed for < 2 weeks , while 92 patients ( 24.5% ) had to stay for more than a month . the mean duration of hospital stay was much higher when compared to the inpatients of brazil ( 13 days ) , australia ( 10 days ) , and the usa . the longer duration of stay for our patients is mainly explained by the most frequent reasons of admission : immunobullous diseases and erythroderma , conditions requiring a relatively long duration of treatment for induction of remission or significant improvement . overall , the outcome of admitted patients was satisfactory , the mortality rate being 7.73% ( 29 patients ) [ table 4 ] . an indian study specifically looking into the mortality in dermatology inpatients had recorded a mortality rate of 3.8% . the death rate among our patients was highest among patients with immunobullous disorders ( 58.62% ) followed by drug reactions and different forms of erythroderma ( 17.24% each ) . the most common cause of death was found to be septicemia ( 44.83% ) followed by cardiorespiratory complications ( 41.38% ) and renal impairment ( 13.79% ) . advanced stage of disease at the time of admission and multiple comorbidities probably accounted for this high mortality rate in these patients . most ( 83.2% ) patients benefitted from inpatient care and they were advised regular outpatient follow - up , while 8 ( 2.13% ) patients had to be transferred to other departments for their co - morbidities . patients with several dermatological conditions require inpatient admission for severity of their disease and comorbidities . the conditions requiring admission vary from one geographic region to another . since many of the diseases are chronic in nature , they may require prolonged hospital stay . immunobullous disorders , erythroderma , and infections were the most frequent conditions requiring inpatient care in our patients . about one - third of the patients needed referral to other departments . while there were some mortalities , the majority of the patients significantly benefitted from indoor treatment . immunobullous disorders , erythroderma , and infections were the most frequent conditions requiring inpatient care in our patients . while there were some mortalities , the majority of the patients significantly benefitted from indoor treatment . immunobullous disorders , erythroderma , and infections were the most frequent conditions requiring inpatient care in our patients . while there were some mortalities , the majority of the patients significantly benefitted from indoor treatment .

introduction : dermatology is primarily a non - acute , outpatient - centered clinical specialty , but substantial number of patients need indoor admission for adequate management . over the years , the need for inpatient facilities in dermatology has grown manifold ; however , these facilities are available only in some tertiary centers.aims and objectives : to analyze the characteristics of the diseases and outcomes of patients admitted in the dermatology inpatient department of a tertiary care facility in eastern india.materials and methods : we undertook a retrospective analysis of the admission and discharge records of all patients , collected from the medical records department , admitted to our indoor facility from 2011 to 2014 . the data thus obtained was statistically analyzed with special emphasis on the patient 's demographic profile , clinical diagnosis , final outcome , and duration of stay.results and analysis : a total of 375 patients were admitted to our indoor facility during the period . males outnumbered females , with the median age in the 5th decade . immunobullous disorders ( 91 patients , 24.27% ) were the most frequent reason for admissions , followed by various causes of erythroderma ( 80 patients , 21.33% ) and infective disorders ( 73 patients , 19.47% ) . other notable causes included cutaneous adverse drug reactions , psoriasis , vasculitis , and connective tissue diseases . the mean duration of hospital stay was 22.215.7 days ; ranging from 1 to 164 days . majority of patients ( 312 , 83.2% ) improved after hospitalization ; while 29 ( 7.73% ) patients died from their illness . about 133 patients ( 35.64% ) required referral services during their stay , while 8 patients ( 2.13% ) were transferred to other departments for suitable management.conclusion:many dermatoses require inpatient care for their optimum management . dermatology inpatient services should be expanded in india to cater for the large number of cases with potentially highly severe dermatoses .

You are an expert at summarizing long articles. Proceed to summarize the following text: cardiovascular diseases and related disorders are a major cause of mortality both in men and women all over the world . they are commonly characterized by high levels of total cholesterol , triglycerides , and low - density lipoprotein cholesterol in the serum . increased total cholesterol and more significantly ldl cholesterol in the serum have been implicated in the etiology of cardiovascular diseases and are seen as primary risk factors . also , high level of lipids in the blood has been associated with hypertension and lipid peroxidation . orthodox medicine , though , is generally preferred and acceptable , traditional medicine is still very much relied on all over the world [ 4 , 5 ] . this is common in the developing countries where the cost of orthodox medicine is astronomical and unaffordable to a large size of the populace . according to world health organization , about 80% of folks in developing countries depend mainly on traditional medicine for their primary health care , and about 85% of such traditional medicine involves the use of plant extracts . some commonly consumed herbs have been reported to promote reduction in blood lipids [ 810 ] . p. thonningii is an under - explored leguminous plant that belongs to the family , leguminosae - caesalpiniodae . the tree is perennial in nature , and the petals varies from white to pink in colour and are produced between november and april . silva and colleagues reported that in many african countries various parts of p. thoninngii ( organs : root , bark , seed , and fruit ) are used for various medicinal purposes . for instance , the plant is used to treat wounds , ulcers , gastric / heart pain , gingivitis , and as an antipyretic . in tanzania and zimbabwe , a cough remedy is prepared from the root bark ; this fraction exhibits significant anti - inflammatory / analgesic activity . certain compounds isolated from its leaves have been reported to elicit anti - inflammatory and antibacterial activities . generally , plants reported to exhibit lipid lowering activity are rich in flavonoids and tannins which play significant role in the mobilization and metabolism of lipids . preliminary phytochemical studies on piliostigma thonningii reveals high levels of flavonoids , tannins , and alkaloids . the plant is also reported to contain nutritionally important vitamins ( such as c , e , and beta - carotene ) and minerals ( such as calcium , magnesium , zinc , and potassium ) all of which contriuibute to its high - antioxidant properties ) . against high incidence of cardiovascular diseases , there is paucity of information on scientifically verified plants with antilipidaemic and anticholesterolaemic properties . in light of the chemical constituents of p. thonningii , this study was designed to evaluate the effect of its aqueous leaf extract on the blood lipid profile in rats . fresh piliostigma thonningii leaves were harvested as one batch in the month of june 2010 at abeokuta , ogun state , nigeria . the botanical identification was confirmed at the herbarium of the department of botany , university of ibadan . the leaves were freed of extraneous materials , air - dried , and ground into a uniform powdery form using a milling machine . the powdered leaf was macerated and extracted in 2.5 l distilled water at room temperature for 48 hrs , with occasional shaking . the filtrate obtained was concentrated under reduced pressure at 60 1c in a rotary evaporator . they were purchased from the institute for advance medical research and training ( imrat ) , at the university college hospital ( uch ) , ibadan . the animals were handled humanely , kept in a plastic suspended cage placed in a well - ventilated and hygienic rat house under suitable conditions of temperature and humidity . they were provided rat pellets and served water ad libitum and subjected to natural photoperiod of 12 hrs light and 12 hrs dark cycle . the rats attained a body weight range of 200220 g before they were used for this study . the animals were randomly assigned into three ( 3 ) groups , a , b , and c with each group containing ten animals ( n = 10 ) . group b were treated orally with 0.2 g / kg bwt of p. thonningii extract daily for 14 days . group c were treated orally with 0.4 g / kg bwt of the extract daily for 14 days . all animals were given access to normal laboratory chow and water ad libitum during the study . at the onset of the study , blood samples were collected separately from each rat in all the groups via the retro orbital sinus of the eye by ocular puncture into nongheparinized bottles . after 14 days , the animals ( treated and nontreated ) were fasted overnight , blood samples were again collected and the animals were then sacrificed by cervical dislocation . the blood samples collected before and after treatment were left to clot and sera were obtained by centrifugation at 3000 g for 10 min . the sera obtained above were used for the biochemical analyses of total cholesterol , triglycerides , low - density lipoprotein ( ldl ) cholesterol , and high - density lipoprotein ( hdl ) cholesterol . total cholesterol and triglycerides were determined by the methods of braun and stein and myers , respectively . the method of hiller was used to estimate hdl cholesterol . the ldl - hdl ratio for each group was estimated mathematically results are presented as mean s.d ( standard deviation of the mean ) and n represents the number of rats used for each experiment . comparisons were done between groups and between the basal and final concentrations in each by use of one - way analysis of variance ( anova ) followed by post hoc tests ( leastsquare deviation ) . the determined concentrations of total cholesterol , triglycerides , low - density lipoprotein ( ldl ) cholesterol , and high - density lipoprotein ( hdl ) cholesterol in both nontreated and treated rats at 0 hr ( basal concentration ) and after 14 days are presented in tables 1 , 2 , and 3 , respectively . in order to establish a definite and significant effect of p. thonningii leaf extract on the serum lipids of rats in this study , it was necessary to observe how the levels of these lipids varied in rats which were not treated with the extract within the period of the study . the results in table 1 showed that there were no significant differences in the concentrations of total cholesterol , triglycerides , ldl cholesterol and hdl cholesterol at zero hour and after 14 days in rats which were not treated with piliostigma thonningii leaf extract . this implied that there was no significant difference between the initial levels of total cholesterol , triglycerides , ldl cholesterol , and hdl cholesterol , and the final concentrations after 14 days in the nontreated rats ( table 1 ) . this observation is very important as it substantiates any effects of the plant extract on the treated rats . there was significant ( p < 0.05 ) decrease in total cholesterol ( by 18.6% ) , triglyceride ( by 20.46% ) and ldl cholesterol ( by 20.42% ) in groups treated with 0.2 g / kg of piliostigma thonningii leaf extract ( table 2 ) . 0.4 g / kg of the extract did not elicit a higher effect on the lipid profile of rats . on the contrary , a relative lower reduction in total cholesterol ( by 15.18% ) triglyceride ( by 19.04% ) , and ldl cholesterol ( by 15.96% ) was observed in rats treated with 0.4 g / kg of the extract ( table 3 ) . both doses of the extract elicited a nonsignificant increase in high - density lipoprotein cholesterol in rats . this observation is based on the comparative measures of the basal ( 0 hr ) and final concentrations ( after 14 days ) of the assessed indices in the treated groups . lipids are generally characterized by insolubility in aqueous or polar solvents but highly soluble nonpolar or organic solvents . hence , lipids are normally combined with specific proteins to form structures called lipoproteins which possess substantial degree of hydrophilicity . low density lipoproteins , high - density lipoproteins , and chylomicrons which are basically composed of triglycerides are integral parts of the serum lipoproteins . except for the hdl cholesterol , high level of all lipids in the blood is arguably a high risk factor in the onset of cardiovascular disorders . high serum concentrations of triglycerides and ldls have been reported to cause atherosclerosis and coronary heart diseases . cholesterol is the principal sterol in animal tissues and occurs mainly in the cell membrane due to its amphipatic nature . it is also found in the adrenal gland , liver , brain , and nervous system . the molecule is synthesized basically from acetyl coa in the liver from where it is distributed through the blood to extrahepatic tissues where it is utilized for the synthesis of bile acids and steroid hormones as well as regulation of membrane fluidity . however , high level of cholesterol in the blood has adverse effects on human health . it is reportedly a major cause of cardiovascular derangements such as atherosclerosis , myocardial infarction and coronary heart diseases . in this study , piliostigma thonningii leaf extract at the administered doses ( 0.2 and 0.4 g / kg bwt ) has been observed to cause significant reduction in the serum levels of total cholesterol , triglycerides , and ldl cholesterol in rats . there is a possibility that the the extract possess the ability to facilitate the transport of cholesterol and triglycerides from the blood into tissues . this may have probably occurred through the induction or suppression of certain enzymes critical to the metabolism of these lipids . 2006 in which commiphora africanana extract showed antilipidaemic and anticholesterolaemic activities in rats . also , the phytochemicals present in medicinal plants are basically responsible for the definite pharmacological effects they exert on the human body . flavonoids , alkaloids , cardiac glycosides , and tannins have been reported to play very important roles in lipidmetabolism and protective functions against the incidence of lipid peroxidation and cardiovascular diseases . piliostigma thonningii is rich in flavonoids , tannins and alkaloids , and antioxidant molecules ( such as c , e , and beta - carotene ) . these molecules are likely responsible for the hypolipidaemic activities elicited by the plant in this study . morever , the ldl / hdl ratio is often used as an index for cardiovascular disorders , and in this study the ldl / hdl ratio in all the treated groups was less than 0.9 compared to a figure of 1.0 recorded in the control group . the overall data obtained in this study suggest that piliostigma thonningii leaves may protect against accumulation of cholesterol and triglycerides in the blood . this may be useful in the treatment or management of atherosclerosis and coronary heart disorders . however , it is strongly recommended that the use of the plant extract should be within the limits that are nontoxic to body cells and tissues , preferably between 200250 mg / kg of body weight .

cardiovascular complications and associated conditions remain a major cause of death , globally . piliostigma thonningii has been used for different and several medicinal purposes . on this background , the effect of aqueous leaf extract of the plant on the lipid profile of physiologically normal rats was examined . graded doses of the extract , 0.0 , 0.2 , and 0.4 g / kg of body weight ( bwt ) were orally administered to rats for a period of 14 days . the effect of the extract was assessed on the basis of comparative determinations of the evaluated indices in treated rats vis - - vis the nontreated group as well as in respect to the differences between the basal and final concentrations of the indices in each group . the extract , especially at 0.2 g per kg body weight caused a significant decrease in the total cholesterol , triglycerides , and low - density lipoprotein ( ldl ) cholesterol in the treated rats when compared to the control group and basal concentrations . though , the level of high - density lipoprotein ( hdl ) cholesterol increased in the treated rats , the increase was not significant when compared to the basal concentration . the ldl / hdl ratio in all the experimental groups was less than 0.9 . the results obtained in this study suggest that p. thonningii aqueous leaf extract likely contains antilipidaemic and anticholesterolaemic substance(s ) , which may be useful in the prophylactic and curative management of lipid peroxidation , high blood pressure , and cardiovascular disorders .

You are an expert at summarizing long articles. Proceed to summarize the following text: the magnitudes of these conditions include increased risk for cardiovascular diseases , diabetes , and many other diseases . the recent assessments specify that around 1.46 billion people globally are overweight and 502 million of them are obese ( 1 ) . obesity is strongly associated with significantly higher all - cause mortality during adulthood due to its association with various complex diseases ( 2 ) . genome - wide scans for obesity genes have repetitively detected linkage with a locus on chromo - some 10p11.22 - 23 ( 3 ) . the previous studies showed that glutamate decarboxylase 2 ( gad2 ) located on chromosome 10 , has been linked to obesity ( 3 , 4 ) . the first candidate gene for obesity identified through the genome wide approach was gad2 ( 5 ) . it encodes the glutamic acid decarboxylase enzyme gad65 connected to obesity via the hypothalamic regulation of food intake . gad2 regulates the formation of the - amino - butyric acid ( gaba ) from the glutamic acid . gaba functions together with neuropeptide y in the paraventricular nucleus to stimulate food intake . in pancreatic islets , gaba modulates hormone secretion by pancreatic islets ( 6 ) . family - based genetic analyses showed association of obesity with other snp , + 61450c > a ( rs992990 ) , which located in the gad2 gene . 243a > g polymorphism ( rs2236418 ) located in the promoter region of the gad2 gene , has been associated with morbid obesity in various studies ( 5 , 7 ) . the gad2 gene polymorphisms were associated with childhood obesity , birth weight and binge eating ( 7 ) . the g allele of 243a > g polymorphism was modestly associated with lower body mass index ( bmi ) and lower fasting glucose concentrations ( 8 ) . in addition , other studies involving europian and american population showed no association with obesity ( 3 , 9 , 10 ) . now , obesity and obesity associated phenotypes becomes very common and both environmental as well as genetic factors significantly contribute toward susceptibility of obesity . as the association studies are influenced by populations and ethnicities , we ascertained the role of these snps in genetic susceptibility to obesity and obesity associated phenotypes in our north indian population . the population studied included 642 apparently healthy individuals ( 347 men , 295 women ) ranging in age from 19 to 60 yr . the samples were collected randomly from the outpatients department of king george s medical university , lucknow and from the general population of lucknow ( north india ) . 309 obese ( bmi > 30 k.g / m and 333 non obese ( bmi 30 k.g / m individual were participated in the study , selected based on the strict inclusion criteria . in all subjects body height , body weight , waist circumferences and hip circumferences were measured for calculation of bmi and waist to hip ratio ( whr ) . the subjects were free from serious and/or chronic illnesses , especially diabetes mellitus , coronary artery disease and pregnant women were excluded . all individuals were of north indian origin and the population was homogeneous with regard to ethnic background ( 11 ) . subjects were classified as type 2 diabetes patients if they were on hypoglycemic medications or when their fasting glucose concentrations exceeded 126 mg / dl . prior informed written consent was taken from each participant and the identity of all participants was kept confidential . all protocols and the study were carried out with the approval of local ethics committee ( irb number- xxxiv ecm / p6 ) at king george s medical university lucknow . at baseline all study participants were subjected to a thorough screening program that included assessment of a detailed personal and family history , physical examination , determination of anthropometric indices and measurement of various biochemical parameters were done . the body fat analyzer ( tbf310 , japan ) was used for assessing the bmi , % body fat , fat mass ( fm ) , fat free mass ( ffm ) and total body water ( tbw ) . venous blood was collected after an overnight fast , and was centrifuged within 2 h after collection . plasma samples were immediately separated and stored in aliquots at 80 c until they were analyzed . commercial enzymatic tests were used for determining fasting glucose , lipid profile while low density lipoprotein ( ldl ) cholesterol was calculated by the formula of friedewald . fasting insulin level was determined by enzyme - linked immunosorbent assay ria ( linco research ) . the degree of insulin sensitivity / resistance was calculated according to the homeostasis model assessment ( homa ) which is a good index for assessing insulin sensitivity / resistance . a description of each method was given by us elsewhere ( 12 ) . gad2 snps were genotyped by pcr - based restriction fragment length polymorphism analysis or by tetra amplification refractory mutation system pcr ( 9 ) . the amount of isolated dna was of good quality ( absorbance 260 nm/280 nm ratio > 1.75 ) . one sample with known genotype and a reagent blank were included after every 20 samples in the pcr . a 50 base - pair marker was included during electrophoresis . twenty percent of samples from patients and controls , including samples of each genotype were re - genotyped by other laboratory personnel . the independent segregation of alleles was tested for the hardy - weinberg equilibrium ( hwe ) , comparing the observed genotype frequencies with those expected ( x test ) . genotype and allele distribution was compared between obese and non - obese subjects using x test . haplotype analysis was done by snp analyzer version 1.2 by expectation maximization algorithm ( 13 ) . most frequent homozygous genotype in the control group was used as reference for association analysis . the hypothesis of different genetic models ( additive model , co - dominant model , dominant model , recessive model , over dominant model , and multiplicative model ) used in the study is described in table 1 . the differences among the three groups were assessed by one - way anova for continuous variables and variables are given as the mean sd . the population studied included 642 apparently healthy individuals ( 347 men , 295 women ) ranging in age from 19 to 60 yr . the samples were collected randomly from the outpatients department of king george s medical university , lucknow and from the general population of lucknow ( north india ) . 309 obese ( bmi > 30 k.g / m and 333 non obese ( bmi 30 k.g / m individual were participated in the study , selected based on the strict inclusion criteria . in all subjects body height , body weight , waist circumferences and hip circumferences were measured for calculation of bmi and waist to hip ratio ( whr ) . the subjects were free from serious and/or chronic illnesses , especially diabetes mellitus , coronary artery disease and pregnant women were excluded . all individuals were of north indian origin and the population was homogeneous with regard to ethnic background ( 11 ) . subjects were classified as type 2 diabetes patients if they were on hypoglycemic medications or when their fasting glucose concentrations exceeded 126 mg / dl . prior informed written consent was taken from each participant and the identity of all participants was kept confidential . all protocols and the study were carried out with the approval of local ethics committee ( irb number- xxxiv ecm / p6 ) at king george s medical university lucknow . at baseline all study participants were subjected to a thorough screening program that included assessment of a detailed personal and family history , physical examination , determination of anthropometric indices and measurement of various biochemical parameters were done . the body fat analyzer ( bioelectrical impedance was obtained using a device , tanita tbf310 , japan ) was used for assessing the bmi , % body fat , fat mass ( fm ) , fat free mass ( ffm ) and total body water ( tbw ) . venous blood was collected after an overnight fast , and was centrifuged within 2 h after collection . plasma samples were immediately separated and stored in aliquots at 80 c until they were analyzed . commercial enzymatic tests were used for determining fasting glucose , lipid profile while low density lipoprotein ( ldl ) cholesterol was calculated by the formula of friedewald . fasting insulin level was determined by enzyme - linked immunosorbent assay ria ( linco research ) . the degree of insulin sensitivity / resistance was calculated according to the homeostasis model assessment ( homa ) which is a good index for assessing insulin sensitivity / resistance . a description of each method was given by us elsewhere ( 12 ) . gad2 snps were genotyped by pcr - based restriction fragment length polymorphism analysis or by tetra amplification refractory mutation system pcr ( 9 ) . the amount of isolated dna was of good quality ( absorbance 260 nm/280 nm ratio > 1.75 ) . one sample with known genotype and a reagent blank were included after every 20 samples in the pcr . a 50 base - pair marker was included during electrophoresis . twenty percent of samples from patients and controls , including samples of each genotype were re - genotyped by other laboratory personnel . the independent segregation of alleles was tested for the hardy - weinberg equilibrium ( hwe ) , comparing the observed genotype frequencies with those expected ( x test ) . genotype and allele distribution was compared between obese and non - obese subjects using x test . haplotype analysis was done by snp analyzer version 1.2 by expectation maximization algorithm ( 13 ) . most frequent homozygous genotype in the control group was used as reference for association analysis . the hypothesis of different genetic models ( additive model , co - dominant model , dominant model , recessive model , over dominant model , and multiplicative model ) used in the study is described in table 1 . the differences among the three groups were assessed by one - way anova for continuous variables and variables are given as the mean sd . clinical characteristics of the obese ( bmi30 ) and non - obese ( bmi<30 ) participants of the present study are shown in table 2 . systolic blood pressure , diastolic blood pressure , fm ( fat mass ) , % body fat , whr , insulin , homa - ir , and lipid profile were significantly different between obese and non - obese subjects . demographic characteristic of the study subjects values are expressed in meansd ; the bold values represent statistically significant values less than 0.05 . the gad2 gene polymorphisms ( rs2236418 and rs992990 ) were genotyped in all the subjects . there was no significant deviation from the hardy - weinberg equilibrium among the subjects with respect to both the snps ( p<0.05 ) . the distributions of allele and genotype and haplotype frequencies along with their odds ratios among obese and non - obese subjects are presented in table 3 . overall 243 a > g polymorphism shows significantly higher minor allele and genotype frequencies in obese cases , when compared with non - obese subjects ( odd ratio ( or ) , 4.01 ; 95% confidence interval ( ci ) , 1.91 8.42 ; p=<0.001 ) . the genotype and allele frequencies of snp + 61450 c > a was not different in obese subjects compared with non - obese subjects and showed no association with obesity . distribution of gad2 gene among non - obese ( n=333 ) and obese subjects ( n=309 ) the bold values represent statistically significant values < 0.05 . a positive significant association has also been observed in the additive , dominant and recessive model for snp ( rs2236418 : or 1.52 ; p=0.016 ; or 1.75 ; p=0.001 , or 3.47 ; p=0.001 ) , respectively , while no significant association has been seen in over dominant genetic model . however , no association has been seen in any genetic model for the snp rs992990 . the haplotype consisting of wild type alleles of two - studied variable ( a c ) were represented more often in the non - obese group ( 61.0% ) than in the obese group ( 49.8% ) . the frequency of combined haplotypes cg+ag was observed significantly higher in obese than non - obese ( or 1.94 , p=0.001 ) , table 4 . haplotype frequency of gene variants and its association with risk of obesity the bold values represent statistically significant values < 0.05 ; the bold values represent statistically significant values less than 0.05 . gad-2 rs2236418 showed association with different obesity associated phenotypes like weight , percentage body fat , fm , fasting blood glucose , and insulin ( table 5 ) . the gad-2 rs992990 polymorphism also showed association with weight , percentage body fat , fm and insulin ( table 6 ) . association of gad2 243 a > g , ( rs2236418 ) genotypes with obesity related phenotypes data represents mean and its 95% confidence interval from anova ; p values were derived from multiple linear regression analysis using the best genetic model ; the bold values represent statistically significant values less than 0.05 . association of gad2 + 61450 c > a , ( rs992990 ) genotypes with obesity related phenotypes data represents mean and its 95% confidence interval from anova ; * p values were derived from multiple linear regression analysis using the best genetic model ; the bold values represent statistically significant values less than 0.05 . the gad2 gene polymorphisms ( rs2236418 and rs992990 ) were genotyped in all the subjects . there was no significant deviation from the hardy - weinberg equilibrium among the subjects with respect to both the snps ( p<0.05 ) . the distributions of allele and genotype and haplotype frequencies along with their odds ratios among obese and non - obese subjects are presented in table 3 . overall 243 a > g polymorphism shows significantly higher minor allele and genotype frequencies in obese cases , when compared with non - obese subjects ( odd ratio ( or ) , 4.01 ; 95% confidence interval ( ci ) , 1.91 8.42 ; p=<0.001 ) . the genotype and allele frequencies of snp + 61450 c > a was not different in obese subjects compared with non - obese subjects and showed no association with obesity . distribution of gad2 gene among non - obese ( n=333 ) and obese subjects ( n=309 ) the bold values represent statistically significant values < 0.05 . a positive significant association has also been observed in the additive , dominant and recessive model for snp ( rs2236418 : or 1.52 ; p=0.016 ; or 1.75 ; p=0.001 , or 3.47 ; p=0.001 ) , respectively , while no significant association has been seen in over dominant genetic model . however , no association has been seen in any genetic model for the snp rs992990 . the haplotype consisting of wild type alleles of two - studied variable ( a c ) were represented more often in the non - obese group ( 61.0% ) than in the obese group ( 49.8% ) . the frequency of combined haplotypes cg+ag was observed significantly higher in obese than non - obese ( or 1.94 , p=0.001 ) , table 4 . haplotype frequency of gene variants and its association with risk of obesity the bold values represent statistically significant values < 0.05 ; the bold values represent statistically significant values less than 0.05 . gad-2 rs2236418 showed association with different obesity associated phenotypes like weight , percentage body fat , fm , fasting blood glucose , and insulin ( table 5 ) . the gad-2 rs992990 polymorphism also showed association with weight , percentage body fat , fm and insulin ( table 6 ) . association of gad2 243 a > g , ( rs2236418 ) genotypes with obesity related phenotypes data represents mean and its 95% confidence interval from anova ; p values were derived from multiple linear regression analysis using the best genetic model ; the bold values represent statistically significant values less than 0.05 . association of gad2 + 61450 c > a , ( rs992990 ) genotypes with obesity related phenotypes data represents mean and its 95% confidence interval from anova ; * p values were derived from multiple linear regression analysis using the best genetic model ; the bold values represent statistically significant values less than 0.05 . in the present study , we found association of snps in gad2 ( genotype , allele and haplotype ) with the predisposition to human obesity and its association with insulin secretion . we observed significant association of gad-2 243 a > g polymorphism at genotype and allele level with risk of obesity while gad-2 + 61450 c > a polymorphism do not associated with obesity . the variant genotypes of 243 a > g and + 61450 c > a polymorphism also associated with weight , % body fat and fat mass in obese and non - obese subjects both ( table 5 & 6 ) . haplotypes were estimated from 243 a > g and + 61450 c > a for each subject and tested for differences between the obese and non - obese subjects by logistic regression . there were two common haplotypes : ca , and aa , with the remaining haplotypes being combined into a single haplotype ( cg+ag ) . the combined haplotype showed significant association with obesity in the present study ( p value = 0.001 , table 4 ) . table 7 shows the list of various studies on the gad-2 polymorphisms related to obesity . the ( 243 ) a > g polymorphism of the gad2 gene showed a strong association with obesity ( 5 ) , while other studies report the contradictory results showing no association with obesity ( 3 , 9 , 10 ) . the contribution of gad2 promoter snp 243 a < g to the genetic risk for childhood obesity and with lower bmi , fasting glucose concentrations were observed ( 8 ) . in addition , investigations into the functional consequences of the ( 243 ) ag snp in the promoter region of the gad2 gene have reported contradictory results ( 5 , 9 ) . association of gad2 243 a > g , ( rs2236418 ) , + 61450 c > a ( rs992990 ) gene polymorphisms with obesity in previous studies + 61450 c > a polymorphism was not associated with obesity , so we did ( 9 ) . the gad-2 + 61450 c > a polymorphism did not show association with obesity in utah population ( 10 ) . however , a family - based genetic study , reported significant association of + 61450 c > a polymorphism with obesity ( 5 ) . gad2 encodes the 65-kda isoform of the enzyme glutamate decarboxylase , which enhance catalyses of the production of c - aminobutyric acid ( gaba ) from glutamic acid that interact with neuropeptide y in neurons of the hypothalamic arcuate nucleus to stimulate food intake ( 14 ) . these acute neuropeptide y neurons also slow down the similarities and opposite effects of neighbouring pro - opiomelanocortin / cocaine- and amphetamine - regulated transcript neurons via gaba - ergic collateral inputs ( 15 ) . food in - take suppressed after the administration of the antisense gad-65 and gad-67 oligonucleotides by inhibiting the gaba synthesis in the ventromedial hypothalamus ( 16 ) . in addition , gad2 gene polymorphisms showed significant association with the insulin level in obese and non - obese subjects . gaba pool in the hypothalamus may enhance by an increased activity of the gad2 gene and improved orexigenic effect of gaba resulting in changed feeding behaviour . ( 17 ) observed the effect of varying doses of muscimol ( gaba agonist ) on food intake . gad2 snp - related increase of the gaba pool in pancreatic islets also contributes in food intake ( 18 ) . heritability of obesity with improved body weight and fat deposition showed in transgenic mice with increased expression of gaba transporter ( 19 ) . gaba - containing micro vesicles are released by ca2 - dependent exocytosis and may have an autocrine / paracrine function within the islet ( 20 ) . gaba released from the b cell inhibits insulin exocytosis by activation of gaba - b receptors ( g protein - coupled receptors ) ( 21 ) . the significant association between gad2 promoter snp ( snp+83897 t > a ) and lower level of insulin in non - obese subjects were observed while no association was reported in obese subjects ( 5 ) . the association of variant allele of 243 a < g snp with 6-fold increased gad2 gene promoter activity ( 5 ) . increased gaba level in the central nervous system encouraged enhanced food intake and obesity ( 17 , 19 ) . in the present study we found the association between variant genotype of 243a > g and + 61450 c > a and lower fasting insulin levels and homa - ir indexes which suggest the deleterious effect of gad2 snps on insulin secretion . an increase of the gaba pool in pancreatic b cells mediated by gad65 higher enzymatic activity may be responsible for above explained association ( 22 ) . 243 a > g snp and + 61450 c > a snp of the gad2gene in linkage disequilibrium , variant allele , genotype of 243 a > g snp and combined haplotypes of 243 a > g snp and + 61450 c > a snp ( cg+ag ) showed the strongest association with obesity . the ( 243a > g ) snp increased transcriptional activity and promoter activity by which gaba production stimulated , may possibly have effect on feeding and insulin ( 5 ) . lack of data , in particular , lifestyle factors such as education , occupation , per capita income , population social background , and daily activity patterns , in the present analysis are an important limitation of this study . an additional limitation of the study is multiple comparisons ; however , the majority of literature to date would indicate that the gad-2 gene variant is associated with measures of insulin secretion . other influencing factors small sample size of the study which may reduce the capability to identify certain associations . lastly , as our study nature is cross - sectional , so we are limited to identifying associations only and longitudinal studies required to identify and understand more clearly the role of gad-2 gene . however , this study also has a number of significant advantages : the present sample was collected from an ethnically and socioeconomically homogeneous population , with phenotype measurements not modified by medication . we reported that 243 a > g snp , and the combined haplotypes of gad-2 gene significantly associated with obesity in north indian population , while + 61450 c > a snp did not show association . however , an association between variant genotype of 243 a > g , + 61450 c > a snp with body weight and insulin level were observed . it is evident that gad2 variants have a detectable influence on obesity and obesity related pheno - type like insulin secretion in a diverse range of populations . future studies of the association of these snps with obesity and obesity related abnormalities may more rigorously prove the suggested statistical association . ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and/or falsification , double publication and/or submission , redundancy , etc . ) have been completely observed by the authors .

background : obesity associated with type 2 diabetes , and hypertension increased mortality and morbidity . glutamate decarboxylase 2 ( gad2 ) gene is associated with obesity and it regulate food intake and insulin level . we investigated the association of gad-2gene 243a > g ( rs2236418 ) and + 61450c > a ( rs992990 ) polymorphisms with obesity and related phenotypes.methods:insulin , glucose and lipid levels were estimated using standard protocols . all subjects were genotyped ( pcr - rflp ) method.results:the 243a > g polymorphism of the gad-2 gene was significantly associated with higher risk of obesity ( p<0.05).conclusion : gad-2 gene polymorphisms influence obesity and related phenotype in complex manner , probably by regulating the food intake , insulin and body weight .

You are an expert at summarizing long articles. Proceed to summarize the following text: a large ensemble gives high predictability of the subpolar gyre temperaturethe recently observed cooling is forecast to continueimpacts are numerous , reduced numbers of tropical storms are clearest a large ensemble gives high predictability of the subpolar gyre temperature the recently observed cooling is forecast to continue impacts are numerous , reduced numbers of tropical storms are clearest north atlantic sea surface temperatures ( ssts ) are thought to drive important multiyear weather and climate impacts including temperature and precipitation over land in europe , america , and africa [ knight et al . , 2006 ; zhang and delworth , 2006 ; sutton and hodson , 2007 ; sutton and dong , 2012 ] , the atlantic storm track position and/or strength [ wilson et al . , 2009 ; woollings et al . , 2012 ; frankignoul et al . , 2013 ] , and atlantic hurricane frequency [ goldenberg et al . , 2001 ; smith et al . , 2010 ; dunstone et al . , the subpolar gyre ( spg , defined here as 60w10w , 50n66n ) is a key part of the decadal variability of north atlantic ssts , being cool during the 1970s and 1980s and warm since the mid-1990s . this decadal variability is larger than interannual variability [ knight et al . , 2005 ] . forecasting whether the current warm conditions will continue , decline or even increase over the coming years , along with associated climate impacts , is a key aim of decadal climate predictions . 2012 ] , idealized experiments with coupled climate models [ griffies and bryan , 1997 ; pohlmann et al . , 2004 2011 ] and initialized decadal climate predictions [ pohlmann et al . , 2009 ; smith et al . , 2010 ; van oldenborgh et al . , , 2013 ; wouters et al . , 2013 ; doblas - reyes et al . , 2013 ] all highlight the north atlantic , especially the spg , as being potentially predictable on multiyear timescales . this skill is physically underpinned by potential predictability of the atlantic meridional overturning circulation ( amoc ) [ collins et al . , 2006 ; pohlmann et al . , initialization of ocean dynamics was shown to be crucial for predicting the two major changes in the spg that have occurred since 1960 , namely , a cooling during the 1960s and a warming in mid-1990s [ yeager et al . , 2012 ; robson et al . furthermore , some of the resultant climate impacts may have also been predictable in the periods following these changes , including precipitation changes in parts of north and south america , european temperatures , and atlantic hurricane frequency [ robson et al . , 2013 , 2014b ; smith et al . , 2014 ; mller et al . , given such robust evidence for skill during historical periods , we investigate actual forecasts of the spg made using three versions of the met office decadal prediction system ( depresys ) . these show a progressive cooling of the spg , together with a reduction in the amoc . below , we look at the mechanisms and impacts of this cooling and compare the predicted changes to the potential impacts of the subpolar gyre inferred from observations . the ensemble size used here is , to our knowledge , unprecedented in decadal prediction with at least 23 members , enabling robust identification of the mechanisms of spg changes . these mechanisms are very similar for three different spg events : the late 1960s , the 1990s , and the present and next few years . we also investigate the predictability of potential impacts of changes in the spg for africa , north - east brazil , the tropical atlantic , and europe . we employ three versions of the met office decadal prediction system ( depresys ; table 1 ) : depresys_cmip5 , based on hadcm3 [ smith et al . , 2007 ] , as submitted to cmip5 using anomaly initializationdepresys_ppe , also based on hadcm3 but using nine variants obtained by perturbing poorly constrained atmospheric and surface parameters in order to sample modeling uncertainty [ smith et al . , 2010]depresys2 , based on the latest hadley centre climate model , hadgem3 [ knight et al . , 2014 ] . depresys_cmip5 , based on hadcm3 [ smith et al . , 2007 ] , as submitted to cmip5 using anomaly initialization depresys_ppe , also based on hadcm3 but using nine variants obtained by perturbing poorly constrained atmospheric and surface parameters in order to sample modeling uncertainty [ smith et al . , 2010 ] depresys2 , based on the latest hadley centre climate model , hadgem3 [ knight et al . , versions of depresys used in this study , their atmosphere and ocean resolutions and ensemble sizes in all versions , initial conditions are generated by relaxing the coupled model to analyses of atmosphere ( from era40 and ecmwf operational analyses ) and ocean [ smith and murphy , 2007 ] , following the anomaly initialization approach [ smith et al . the skill of the forecasts is assessed by examining retrospective and real - time predictions from 1 november each year since 1960 made with each version of depresys . we refer to predictions that can be verified with available observations as hindcasts , and those that can not yet be verified because they extend into the future as forecasts ( table 1 ) . we also investigate parallel integrations with each version that are driven by external forcing factors ( solar radiation , greenhouse gases , and volcanic and anthropogenic aerosols ) identical to those used in depresys but are not initialized with the concurrent state of the climate . the difference between depresys and these uninitialized simulations ( hereafter referred to as uninitialized forecasts ) reveals the impact of initialization . for depresys_cmip5 and depresys2 external forcings follow the cmip5 protocol in which future forcing from volcanic eruptions and solar radiation future changes in volcanic aerosol and solar radiation are projected from the start of each prediction ( as in smith et al . for the variables considered here , the differences in skill between systems are indistinguishable . however , this is not the case for other variables [ knight et al . , we take advantage of the large ensemble size to reduce noise and present results from the grand ensemble . the grand ensemble mean is obtained by averaging the ensemble mean anomalies from the 1960 to 2009 climatology of each version ( thus , each version is given equal weight ) . a 90% probability range for verification with observations is calculated by using student 's t distribution together with the average of the three variances . we investigate the role of ocean dynamics and its predictability by assessing predictions against the ocean analysis used for initialization for temperature or density and against the average of the three assimilation integrations for heat convergence . we note that despite the lack of ocean observations over the historical period , the spg was actually relatively well observed such that the major changes are robust across different data sets [ robson et al . , 2012a ] . furthermore , the amoc in the three assimilation runs are similar ( pairwise correlations are 0.7 or higher ) and compare reasonably well with rapid observations [ hermanson et al . , the model surface temperature , mean sea level pressure , and precipitation are verified by comparison with hadcrut3 [ brohan et al . , 2006 ] , hadslp2 [ allan and ansell , 2006 ] , and gpcc [ schneider et al . , 2011 ] , respectively . the observed 5 year mean temperature averaged over the upper 500 m of the spg is shown in figure 1a ( red and blue shading ) . there is a marked cooling in the late 1960s followed by a period with below average temperatures , and a warming in the 1990s followed by a period with above average temperatures . the spg has been cooling slightly since the mid-2000s , but remains well above average . the grand ensemble 5 year hindcasts that were intialized between 1960 and 2007 ( diamonds ) show high skill in predicting the decadal variability of the observations ( pearson 's correlation r = 0.87 , p < < 0.001 with the effects of autocorrelation taken into account ) consistent with previous studies [ robson et al . the forecasts that were initialized between 2008 and 2012 ( crosses ) all show a general trend for further decreases in temperature , continuing the observed trend . the 2012 forecast spread suggests that the chance of the observed warm spg mean temperature anomaly of 20032007 ( 0.53 ) occurring again in 20132017 is less than 6% . hindcasts , uninitialized forecasts , forecasts and observational analyses or assimilations for 5 year mean ( years 15 ) anomalies of ( a ) spg temperature averaged over the upper 500 m , ( b ) ocean heat transport convergence into the spg , and ( c ) deep atlantic density index ( see text ) . also shown in figure 1c is the amoc at 45n from pohlmann et al . the 90% probability spread of the hindcasts / forecasts is indicated by the vertical lines . figure 1a uses additional trend correction following kharin et al . . to gain further confidence in this forecast previous studies showed that the 1990s spg warming was driven by increased convergence of ocean heat transport resulting from an increase in the amoc [ robson et al . , 2012b ; yeager et al . , 2012 ] , and the 1960s cooling was driven by reduced ocean heat transport convergence following a reduced amoc [ robson et al . the hindcasts show changes in ocean heat transport convergence , consistent with these earlier events . we find that changes in ocean heat transport convergence are skilfully predicted by the hindcasts ( figure 1b , diamonds ; r = 0.86 , p < < 0.001 , assessed against the convergence in the assimilation ) . the forecasts show a continued decrease in ocean heat transport convergence , consistent with a cooling spg . we further investigate the role of ocean dynamics in driving changes in ocean heat transport convergence by computing the grand ensemble assimilation heat transport convergence using climatological temperatures ( from each assimilation averaged over 19602009 ) but time varying velocities ( figure 1b , solid green line ) . this captures the decrease in the 1960s , the increase from the 1970s to the 1990s , and the recent decrease ( last few years ) , suggesting that changes in ocean velocities rather than temperatures have been the most important drivers of ocean heat convergence , and hence spg temperature , in agreement with previous studies [ robson et al . changes in meridional ocean velocities in the spg region are largely driven by changes in the west - east density gradient at around 12003000 m depth [ hodson and sutton , 2012 ; roberts et al . , 2013 ] , which impacts on the amoc return flow . as observations of the amoc are rare at these latitudes , we consider recent trends in density at these depths ( figure 2 , top ) , which can be estimated from fewer observations [ smith and murphy , 2007 ] and noting that the spg region was relatively well observed historically [ abraham et al . , 2013 ] . there has been a clear reduction in density along the western boundary , especially in the labrador sea , consistent with a weakening of the west - east density gradient and a reduction of the amoc return flow . we construct an index of the difference in density ( west minus east ) between two boxes ( see blue boxes in figure 2 , top ) weighted by their respective volumes . decadal variations of this index ( figure 1c ) agree well with the amoc at 45n in the assimilations ( green line , right hand axis ) and an estimate of the amoc at 45n from 10 recent ocean syntheses ( cyan line , pohlmann et al . , 2013 ) . this index is also skilfully predicted by the hindcasts ( r = 0.86 , p < < 0.001 ) and is forecast to decrease further out to 2017 . using the index to choose years that also show decadal trend , we investigate the deep density trend patterns during the 1960s spg cooling and the 1990s spg warming ( figures 2 , bottom left and 2 , bottom right ) . remarkably similar patterns are found , implying that similar dynamical processes appear to have been dominant in these earlier periods of change . density trend in the 12003000 m layer for ( top ) 19952013 and for two earlier periods ( bottom left ) 19531972 ( cooling period ) and ( bottom right ) 19881995 ( warming period ) . note that the uninitialized forecasts ( dashed green lines in figure 1 ) fail to capture the observed recent cooling . while they do simulate a warming of the spg between 1970 and 2005 in agreement with observations , this is likely for different reasons than in the initialized hindcasts since changes in ocean heat transport convergence and density index are opposite to those observed ( this was also found by yeager et al . ) . this highlights the need for initialized predictions . however , further work is needed to understand the role of external forcing , perhaps through indirect aerosol effects [ booth et al . , 2012 ; dunstone et al . , 2013 ] , which are not included in these models or natural forcing ( such as solar and volcanic : [ menary and scaife , 2014 ] ) . in summary , changes in spg temperature since the 1960s were likely driven by changes in ocean heat transport convergence as a result of changes in the amoc . the spg cooling during the 1960s and the warming during the 1990s along with changes in ocean dynamics . recent observations suggest that the amoc may already be declining [ smeed et al . , 2013 ; robson et al . , 2014a ] , and our forecasts show a continued cooling of the spg out to 2017 driven by reduced ocean heat transport convergence resulting from a continued reduction in the amoc . since past changes in spg temperature are thought to have driven important climate impacts , we also examine the predicted climate impacts . figure 3 shows the amplitude of variability associated with spg changes ( in sst ) diagnosed from composite differences in ( june , july , and august ) between warm and cold spg decades for surface temperature , mean sea level pressure , and precipitation . it shows that a warm spg is associated with a warm northern tropical atlantic , warm mainland us , and warm european temperatures , especially in the eastern mediterranean there is also a low pressure over western europe , which is colocated with a signal for wet summers . the rainfall pattern in the tropical regions around the atlantic indicates a northward shift of the intertropical convergence zone ( itcz ) , consistent with increased hurricane numbers . a simple forecast of impacts would be that these features of the climate , which have been observed in recent years , will become less likely to occur . ( left column ) a composite of potential spg impacts inferred from observations , ( middle column ) correlation skill for the grand ensemble of model hindcasts and ( right column ) the forecast all for boreal summer ( june august ) for 1.5 m temperature , mean sea level pressure , and precipitation ( rows ) . figure 3 ( left column ) shows half the observed composite difference between warm ( 19301940 , 19541956 , 19992005 ) and cold ( 19211923 , 19691976 , 1982 , 19851992 ) spg decades , following smith et al . . figure 3 ( middle column ) shows the correlation skill for predicting the coming 6 year mean relative to the previous 8 years ( following similar quantities investigated by robson et al . figure 3 ( right column ) shows the forecast for 20122017 relative to the previous 8 years . from top to bottom , units are k , hpa , and % change from climatology . see the appendix a for more details on the method . to investigate potential climate impacts simulated by the model , this highlights potentially important changes from recent conditions that might be masked by trends if a longer climatological period were used . this approach also effectively removes biases and noise is reduced by combining several hindcasts together . furthermore , the influence of trends on correlation skill is reduced , thereby avoiding high correlations that can arise from the trend . we use 5 years from each of two consecutive hindcasts ( making a 6 year mean , four of which overlap plus one independent year from each hindcast ) relative to the four most recent hindcasts prior to them ( making an 8 year mean ) . for example , the two hindcasts intialized in november 1968 and 1969 make a mean including the summers 19691974 and are compared to a climatology created from the hindcasts initialized in november 19601963 , which includes the summers 19611968 . to quantify skill , the correlation skill of the grand ensemble for predicting surface temperature , pressure , and rainfall is shown in figure 3 ( middle column ) . figure 3 ( right column ) shows the grand ensemble forecast using the same approach as the hindcasts . these are the two 5 year forecasts initialized in 2011 and 2012 for the period 20122017 , relative to hindcasts that started in 20032006 for the years 20042011 . this forecast consists of an ensemble of 76 members , showing future changes relative to recent ( forecast ) conditions . one of the clearest signals in this forecast is for higher pressure and decreased rainfall in the northern tropical atlantic ocean . this is consistent with the observed composites ( figure 3 , left column ) and in a region where there is some correlation skill ( figure 3 , middle column ) . previous studies suggest a link between spg temperatures and the frequency of atlantic tropical storms [ goldenberg et al . figure 4 shows the 5 year mean hurdat2 observations of tropical storms [ landsea and franklin , 2013 ] since 1960 along with the hindcasts and forecasts of storm counts from the grand ensemble . the hindcasts appear to be skilful and the recent forecasts for tropical storm counts show an overall downward trend in the coming years , consistent with expected impacts from a cooling spg . tropical storm counts for storms in the latitude band 5n25n in the atlantic that last more than 2 days . the year indicates the central year of the 5 year mean . following smith et al . , model storms are tracked in daily field of sea level pressure and standardized to have the same mean and variance as the observations . the 50% probability spread of the hindcasts / forecasts is indicated by the vertical lines . other expected impacts of a cooling spg are not clear in the forecast . for example , warmer summers are predicted in the mediterranean , which is contrary to our expectation for a cooling of the spg . the itcz does not show a clear shift in the forecast , although there are some indications of reduced rainfall in the western sahel and increased rainfall in north - east brazil . the probability of wet summers in western europe is expected to decrease as the spg cools [ dong et al . , the precipitation forecast also shows a small region with significantly lower precipitation over the british isles and ireland . however , the ensemble shows no skill in predicting rainfall for this region and although the pressure forecast map shows coincident high pressure , it is in a region with large variability and is not significant . we have investigated the decadal predictability of the north atlantic subpolar gyre ( spg ) and associated physical mechanisms and climate impacts using three versions of the met office decadal prediction system ( depresys ) resulting in a uncommonly large ensemble . upper 500 m temperature in the spg was found to be highly predictable and driven by predictable changes in ocean heat transport convergence related to changes in the atlantic meridional overturning circulation ( amoc ) in our models . we present forecasts from depresys predicting a continued decrease in spg temperature , driven by a weakening amoc leading to decreased heat transport convergence into the spg . this suggests that ocean dynamics not captured in our uninitialized forecasts may have a significant influence on the evolution of the north atlantic over the coming years . the forecast signals presented here therefore arise from a combination of climate change and internal variability and/or forced changes not captured by our models ( but introduced through initialization ) and show the benefits of initialization in decadal climate predictions . observations and previous studies suggest that the recent warm spg has increased the likelihood of several climate impacts including increased hurricane numbers , wet european summers , increased sahel rainfall , reduced summer rainfall over the amazon and south - west usa , and warm summer temperatures over much of the usa and europe . our forecast is for a cooling of the spg but not a complete reversal to cold conditions . as such , we expect climate impacts related to a warm spg to persist but become less likely . indeed , our forecast does indicate a reduction in atlantic tropical storms , consistent with higher pressure and lower rainfall in the northern tropical atlantic . there is also a decrease in summer rainfall in western europe with a coincident high - pressure signal but the signals are weak , and the historical skill of the forecast system is too low to provide confidence in these signals . the predicted cooling of the spg highlighted is potentially a significant event , and further studies with other models are encouraged to provide more confidence in associated climate impacts . north atlantic sea surface temperatures ( ssts ) are thought to drive important multiyear weather and climate impacts including temperature and precipitation over land in europe , america , and africa [ knight et al . , 2006 ; zhang and delworth , 2006 ; sutton and hodson , 2007 ; sutton and dong , 2012 ] , the atlantic storm track position and/or strength [ wilson et al . , 2009 ; 2013 ] , and atlantic hurricane frequency [ goldenberg et al . , 2001 ; smith et al . , 2010 ; dunstone et al . , the subpolar gyre ( spg , defined here as 60w10w , 50n66n ) is a key part of the decadal variability of north atlantic ssts , being cool during the 1970s and 1980s and warm since the mid-1990s . forecasting whether the current warm conditions will continue , decline or even increase over the coming years , along with associated climate impacts , is a key aim of decadal climate predictions . 2012 ] , idealized experiments with coupled climate models [ griffies and bryan , 1997 ; pohlmann et al . , 2004 ; hermanson and sutton , 2010 ; dunstone et al . , , 2009 ; smith et al . , 2010 ; van oldenborgh et al . , chikamoto et al . , 2012 ; hazeleger et al . , 2013 ; wouters et al . 2013 ] all highlight the north atlantic , especially the spg , as being potentially predictable on multiyear timescales . this skill is physically underpinned by potential predictability of the atlantic meridional overturning circulation ( amoc ) [ collins et al . , 2006 ; pohlmann et al . , initialization of ocean dynamics was shown to be crucial for predicting the two major changes in the spg that have occurred since 1960 , namely , a cooling during the 1960s and a warming in mid-1990s [ yeager et al . , 2012 ; robson et al . , 2013 , 2014b ] . furthermore , some of the resultant climate impacts may have also been predictable in the periods following these changes , including precipitation changes in parts of north and south america , european temperatures , and atlantic hurricane frequency [ robson et al . , 2013 , 2014b ; , 2014 ; mller et al . , 2014 ] . given such robust evidence for skill during historical periods , we investigate actual forecasts of the spg made using three versions of the met office decadal prediction system ( depresys ) . these show a progressive cooling of the spg , together with a reduction in the amoc . below , we look at the mechanisms and impacts of this cooling and compare the predicted changes to the potential impacts of the subpolar gyre inferred from observations . the ensemble size used here is , to our knowledge , unprecedented in decadal prediction with at least 23 members , enabling robust identification of the mechanisms of spg changes . these mechanisms are very similar for three different spg events : the late 1960s , the 1990s , and the present and next few years . we also investigate the predictability of potential impacts of changes in the spg for africa , north - east brazil , the tropical atlantic , and europe . we employ three versions of the met office decadal prediction system ( depresys ; table 1 ) : depresys_cmip5 , based on hadcm3 [ smith et al . , 2007 ] , as submitted to cmip5 using anomaly initializationdepresys_ppe , also based on hadcm3 but using nine variants obtained by perturbing poorly constrained atmospheric and surface parameters in order to sample modeling uncertainty [ smith et al . , 2010]depresys2 , based on the latest hadley centre climate model , hadgem3 [ knight et al . , depresys_cmip5 , based on hadcm3 [ smith et al . , 2007 ] , as submitted to cmip5 using anomaly initialization depresys_ppe , also based on hadcm3 but using nine variants obtained by perturbing poorly constrained atmospheric and surface parameters in order to sample modeling uncertainty [ smith et al . , 2010 ] depresys2 , based on the latest hadley centre climate model , hadgem3 [ knight et al . , versions of depresys used in this study , their atmosphere and ocean resolutions and ensemble sizes in all versions , initial conditions are generated by relaxing the coupled model to analyses of atmosphere ( from era40 and ecmwf operational analyses ) and ocean [ smith and murphy , 2007 ] , following the anomaly initialization approach [ smith et al . the skill of the forecasts is assessed by examining retrospective and real - time predictions from 1 november each year since 1960 made with each version of depresys . we refer to predictions that can be verified with available observations as hindcasts , and those that can not yet be verified because they extend into the future as forecasts ( table 1 ) . we also investigate parallel integrations with each version that are driven by external forcing factors ( solar radiation , greenhouse gases , and volcanic and anthropogenic aerosols ) identical to those used in depresys but are not initialized with the concurrent state of the climate . the difference between depresys and these uninitialized simulations ( hereafter referred to as uninitialized forecasts ) reveals the impact of initialization . for depresys_cmip5 and depresys2 external forcings follow the cmip5 protocol in which future forcing from volcanic eruptions and solar radiation future changes in volcanic aerosol and solar radiation are projected from the start of each prediction ( as in smith et al . the results shown below are evident in each version of depresys . for the variables considered here , the differences in skill between systems are indistinguishable . however , this is not the case for other variables [ knight et al . , we take advantage of the large ensemble size to reduce noise and present results from the grand ensemble . the grand ensemble mean is obtained by averaging the ensemble mean anomalies from the 1960 to 2009 climatology of each version ( thus , each version is given equal weight ) . a 90% probability range for verification with observations is calculated by using student 's t distribution together with the average of the three variances . we investigate the role of ocean dynamics and its predictability by assessing predictions against the ocean analysis used for initialization for temperature or density and against the average of the three assimilation integrations for heat convergence . we note that despite the lack of ocean observations over the historical period , the spg was actually relatively well observed such that the major changes are robust across different data sets [ robson et al . , furthermore , the amoc in the three assimilation runs are similar ( pairwise correlations are 0.7 or higher ) and compare reasonably well with rapid observations [ hermanson et al . , the model surface temperature , mean sea level pressure , and precipitation are verified by comparison with hadcrut3 [ brohan et al . , 2006 ] , hadslp2 [ allan and ansell , 2006 ] , and gpcc [ schneider et al . , 2011 ] , respectively . the observed 5 year mean temperature averaged over the upper 500 m of the spg is shown in figure 1a ( red and blue shading ) . there is a marked cooling in the late 1960s followed by a period with below average temperatures , and a warming in the 1990s followed by a period with above average temperatures . the spg has been cooling slightly since the mid-2000s , but remains well above average . the grand ensemble 5 year hindcasts that were intialized between 1960 and 2007 ( diamonds ) show high skill in predicting the decadal variability of the observations ( pearson 's correlation r = 0.87 , p < < 0.001 with the effects of autocorrelation taken into account ) consistent with previous studies [ robson et al . the forecasts that were initialized between 2008 and 2012 ( crosses ) all show a general trend for further decreases in temperature , continuing the observed trend . the 2012 forecast spread suggests that the chance of the observed warm spg mean temperature anomaly of 20032007 ( 0.53 ) occurring again in 20132017 is less than 6% . hindcasts , uninitialized forecasts , forecasts and observational analyses or assimilations for 5 year mean ( years 15 ) anomalies of ( a ) spg temperature averaged over the upper 500 m , ( b ) ocean heat transport convergence into the spg , and ( c ) deep atlantic density index ( see text ) . also shown in figure 1c is the amoc at 45n from pohlmann et al . the 90% probability spread of the hindcasts / forecasts is indicated by the vertical lines . to gain further confidence in this forecast we examine the physical mechanisms that control spg temperatures . previous studies showed that the 1990s spg warming was driven by increased convergence of ocean heat transport resulting from an increase in the amoc [ robson et al . , 2012b ; yeager et al . , 2012 ] , and the 1960s cooling was driven by reduced ocean heat transport convergence following a reduced amoc [ robson et al . , the hindcasts show changes in ocean heat transport convergence , consistent with these earlier events . we find that changes in ocean heat transport convergence are skilfully predicted by the hindcasts ( figure 1b , diamonds ; r = 0.86 , p < < 0.001 , assessed against the convergence in the assimilation ) . the forecasts show a continued decrease in ocean heat transport convergence , consistent with a cooling spg . we further investigate the role of ocean dynamics in driving changes in ocean heat transport convergence by computing the grand ensemble assimilation heat transport convergence using climatological temperatures ( from each assimilation averaged over 19602009 ) but time varying velocities ( figure 1b , solid green line ) . this captures the decrease in the 1960s , the increase from the 1970s to the 1990s , and the recent decrease ( last few years ) , suggesting that changes in ocean velocities rather than temperatures have been the most important drivers of ocean heat convergence , and hence spg temperature , in agreement with previous studies [ robson et al . changes in meridional ocean velocities in the spg region are largely driven by changes in the west - east density gradient at around 12003000 m depth [ hodson and sutton , 2012 ; roberts et al . , 2013 ] , which impacts on the amoc return flow . as observations of the amoc are rare at these latitudes , we consider recent trends in density at these depths ( figure 2 , top ) , which can be estimated from fewer observations [ smith and murphy , 2007 ] and noting that the spg region was relatively well observed historically [ abraham et al . there has been a clear reduction in density along the western boundary , especially in the labrador sea , consistent with a weakening of the west - east density gradient and a reduction of the amoc return flow . we construct an index of the difference in density ( west minus east ) between two boxes ( see blue boxes in figure 2 , top ) weighted by their respective volumes . decadal variations of this index ( figure 1c ) agree well with the amoc at 45n in the assimilations ( green line , right hand axis ) and an estimate of the amoc at 45n from 10 recent ocean syntheses ( cyan line , pohlmann et al . , 2013 ) . this index is also skilfully predicted by the hindcasts ( r = 0.86 , p < < 0.001 ) and is forecast to decrease further out to 2017 . using the index to choose years that also show decadal trend , we investigate the deep density trend patterns during the 1960s spg cooling and the 1990s spg warming ( figures 2 , bottom left and 2 , bottom right ) . remarkably similar patterns are found , implying that similar dynamical processes appear to have been dominant in these earlier periods of change . density trend in the 12003000 m layer for ( top ) 19952013 and for two earlier periods ( bottom left ) 19531972 ( cooling period ) and ( bottom right ) 19881995 ( warming period ) . note that the uninitialized forecasts ( dashed green lines in figure 1 ) fail to capture the observed recent cooling . while they do simulate a warming of the spg between 1970 and 2005 in agreement with observations , this is likely for different reasons than in the initialized hindcasts since changes in ocean heat transport convergence and density index are opposite to those observed ( this was also found by yeager et al . ) . however , further work is needed to understand the role of external forcing , perhaps through indirect aerosol effects [ booth et al . , 2012 ; dunstone et al . , 2013 ] , which are not included in these models or natural forcing ( such as solar and volcanic : [ menary and scaife , 2014 ] ) . in summary , changes in spg temperature since the 1960s were likely driven by changes in ocean heat transport convergence as a result of changes in the amoc . initialized predictions using depresys capture both the spg cooling during the 1960s and the warming during the 1990s along with changes in ocean dynamics . recent observations suggest that the amoc may already be declining [ smeed et al . , 2013 ; robson et al . , 2014a ] , and our forecasts show a continued cooling of the spg out to 2017 driven by reduced ocean heat transport convergence resulting from a continued reduction in the amoc . since past changes in spg temperature are thought to have driven important climate impacts , we also examine the predicted climate impacts . figure 3 shows the amplitude of variability associated with spg changes ( in sst ) diagnosed from composite differences in ( june , july , and august ) between warm and cold spg decades for surface temperature , mean sea level pressure , and precipitation . it shows that a warm spg is associated with a warm northern tropical atlantic , warm mainland us , and warm european temperatures , especially in the eastern mediterranean there is also a low pressure over western europe , which is colocated with a signal for wet summers . the rainfall pattern in the tropical regions around the atlantic indicates a northward shift of the intertropical convergence zone ( itcz ) , consistent with increased hurricane numbers . a simple forecast of impacts would be that these features of the climate , which have been observed in recent years , will become less likely to occur . ( left column ) a composite of potential spg impacts inferred from observations , ( middle column ) correlation skill for the grand ensemble of model hindcasts and ( right column ) the forecast all for boreal summer ( june august ) for 1.5 m temperature , mean sea level pressure , and precipitation ( rows ) . figure 3 ( left column ) shows half the observed composite difference between warm ( 19301940 , 19541956 , 19992005 ) and cold ( 19211923 , 19691976 , 1982 , 19851992 ) spg decades , following smith et al . . figure 3 ( middle column ) shows the correlation skill for predicting the coming 6 year mean relative to the previous 8 years ( following similar quantities investigated by robson et al . [ 2013 , 2014b ] ; see text for further explanation ) . figure 3 ( right column ) shows the forecast for 20122017 relative to the previous 8 years . from top to bottom , units are k , hpa , and % change from climatology . see the appendix a for more details on the method . to investigate potential climate impacts simulated by the model , we take a similar approach to robson et al . [ 2013 , 2014b ] and compute multiyear differences between forecasts and recent hindcasts . this highlights potentially important changes from recent conditions that might be masked by trends if a longer climatological period were used . this approach also effectively removes biases and noise is reduced by combining several hindcasts together . furthermore , the influence of trends on correlation skill is reduced , thereby avoiding high correlations that can arise from the trend . we use 5 years from each of two consecutive hindcasts ( making a 6 year mean , four of which overlap plus one independent year from each hindcast ) relative to the four most recent hindcasts prior to them ( making an 8 year mean ) . for example , the two hindcasts intialized in november 1968 and 1969 make a mean including the summers 19691974 and are compared to a climatology created from the hindcasts initialized in november 19601963 , which includes the summers 19611968 . to quantify skill , the correlation skill of the grand ensemble for predicting surface temperature , pressure , and rainfall is shown in figure 3 ( middle column ) . figure 3 ( right column ) shows the grand ensemble forecast using the same approach as the hindcasts . these are the two 5 year forecasts initialized in 2011 and 2012 for the period 20122017 , relative to hindcasts that started in 20032006 for the years 20042011 . this forecast consists of an ensemble of 76 members , showing future changes relative to recent ( forecast ) conditions . one of the clearest signals in this forecast is for higher pressure and decreased rainfall in the northern tropical atlantic ocean . this is consistent with the observed composites ( figure 3 , left column ) and in a region where there is some correlation skill ( figure 3 , middle column ) . previous studies suggest a link between spg temperatures and the frequency of atlantic tropical storms [ goldenberg et al . , 2001 ; smith et al . , 2010 , 2014 ; figure 4 shows the 5 year mean hurdat2 observations of tropical storms [ landsea and franklin , 2013 ] since 1960 along with the hindcasts and forecasts of storm counts from the grand ensemble . the hindcasts appear to be skilful and the recent forecasts for tropical storm counts show an overall downward trend in the coming years , consistent with expected impacts from a cooling spg . tropical storm counts for storms in the latitude band 5n25n in the atlantic that last more than 2 days . the year indicates the central year of the 5 year mean . following smith et al . , model storms are tracked in daily field of sea level pressure and standardized to have the same mean and variance as the observations . the 50% probability spread of the hindcasts / forecasts is indicated by the vertical lines . other expected impacts of a cooling spg are not clear in the forecast . for example , warmer summers are predicted in the mediterranean , which is contrary to our expectation for a cooling of the spg . the itcz does not show a clear shift in the forecast , although there are some indications of reduced rainfall in the western sahel and increased rainfall in north - east brazil . the probability of wet summers in western europe is expected to decrease as the spg cools [ dong et al . , the precipitation forecast also shows a small region with significantly lower precipitation over the british isles and ireland . however , the ensemble shows no skill in predicting rainfall for this region and although the pressure forecast map shows coincident high pressure , it is in a region with large variability and is not significant . we have investigated the decadal predictability of the north atlantic subpolar gyre ( spg ) and associated physical mechanisms and climate impacts using three versions of the met office decadal prediction system ( depresys ) resulting in a uncommonly large ensemble . upper 500 m temperature in the spg was found to be highly predictable and driven by predictable changes in ocean heat transport convergence related to changes in the atlantic meridional overturning circulation ( amoc ) in our models . we present forecasts from depresys predicting a continued decrease in spg temperature , driven by a weakening amoc leading to decreased heat transport convergence into the spg . the amoc is expected to decrease with climate change [ meehl et al . , 2007 ] , leading to relative cooling in the spg . this suggests that ocean dynamics not captured in our uninitialized forecasts may have a significant influence on the evolution of the north atlantic over the coming years . the forecast signals presented here therefore arise from a combination of climate change and internal variability and/or forced changes not captured by our models ( but introduced through initialization ) and show the benefits of initialization in decadal climate predictions . observations and previous studies suggest that the recent warm spg has increased the likelihood of several climate impacts including increased hurricane numbers , wet european summers , increased sahel rainfall , reduced summer rainfall over the amazon and south - west usa , and warm summer temperatures over much of the usa and europe . our forecast is for a cooling of the spg but not a complete reversal to cold conditions . as such , we expect climate impacts related to a warm spg to persist but become less likely . indeed , our forecast does indicate a reduction in atlantic tropical storms , consistent with higher pressure and lower rainfall in the northern tropical atlantic . there is also a decrease in summer rainfall in western europe with a coincident high - pressure signal but the signals are weak , and the historical skill of the forecast system is too low to provide confidence in these signals . the predicted cooling of the spg highlighted is potentially a significant event , and further studies with other models are encouraged to provide more confidence in associated climate impacts .

decadal variability in the north atlantic and its subpolar gyre ( spg ) has been shown to be predictable in climate models initialized with the concurrent ocean state . numerous impacts over ocean and land have also been identified . here we use three versions of the met office decadal prediction system to provide a multimodel ensemble forecast of the spg and related impacts . the recent cooling trend in the spg is predicted to continue in the next 5 years due to a decrease in the spg heat convergence related to a slowdown of the atlantic meridional overturning circulation . we present evidence that the ensemble forecast is able to skilfully predict these quantities over recent decades . we also investigate the ability of the forecast to predict impacts on surface temperature , pressure , precipitation , and atlantic tropical storms and compare the forecast to recent boreal summer climate .

You are an expert at summarizing long articles. Proceed to summarize the following text: despite major advances , making an accurate diagnosis of consciousness in patients with chronic disorders of consciousness ( doc ) remains challenging ( gantner et al . , 2012 ) . the expanding nosology makes the process even more complex , as the differences between states tend to become smaller and smaller ( bodart et al . , 2013 , the coma recovery scale - revised ( crs - r ( giacino et al . , 2004 ) ) is the gold standard behavioural scale to make the diagnosis of unresponsive wakefulness syndrome ( uws recovery of arousal but limited reflexes - only behaviour ) , minimally conscious state ( mcs ) minus and plus ( recovery of inconsistent but definite signs of consciousness such as visual pursuit , object localization or manipulation , congruent emotional responses mcs - or command - following and language function mcs+ ) , and emergence from the mcs ( emcs recovery of functional communication or use of objects ) ( seel et al . , 2010 ) . however , due to sensorimotor impairment , fluctuation of vigilance , pain , unnoticeable motor activity , apraxia , and aphasia issues , some patients might have covert consciousness not accessible through behavioural evaluation ( gosseries et al . , 2014 , schiff and fins , 2016 ) . several patients , otherwise considered unconscious , showed signs of command - following with functional magnetic resonance imaging ( fmri , e.g. bardin et al . , 2011 , bardin et al . , 2012 , monti et al . , 2010 , owen et al . , 2006 ) and electroencephalography ( eeg ) active paradigms ( e.g. cruse et al . , 2011 , goldfine et al . , 2011 ) considering these patients unconscious seems inadequate , and the diagnosis of non - behavioural mcs ( mcs * ) was proposed as a better way to describe their state ( gosseries et al . , 2014 ) , while other authors preferred the term cognitive motor dissociation ( schiff and fins , 2016 ) . cerebral f - fluorodeoxyglucose positron emitted tomography ( fdg pet ) evaluates patterns of metabolic activity of the brain . it is a well - established technique to study consciousness ( laureys et al . , 2004 ) , and it was recently validated to distinguish between uws and mcs patients ( stender et al . , 2016 , stender et al . , 2014 ) . pet could also detect metabolic activity compatible with mcs in 29% of the uws patients ; 69% of these recovered signs of consciousness at 12 months of follow - up , suggesting that fdg pet might be a reliable and sensitive tool to detect unresponsive patients with a covert capacity for consciousness ( mcs * ) . using transcranial magnetic stimulation ( tms ) coupled with eeg it is possible to study cortico - cortical interactions on a millisecond time - scale ( ilmoniemi et al . cortical eeg responses to tms differs greatly in healthy subjects between conscious ( i.e. , normal wakefulness , rapid eye movements sleep ( massimini et al . , 2010 ) , ketamine anaesthesia ( sarasso et al . , 2015 ) ) and unconscious states ( i.e. , non - rapid eye movements sleep early in the night ( massimini et al . , 2005 ) , propofol , xenon ( sarasso et al . , 2015 ) , and midazolam anaesthesia ( ferrarelli et al . , 2010 ) ) , and uws patients ( rosanova et al . , 2012 ) . on these premises , 2013 ) implemented an algorithm , the perturbational complexity index ( pci ) , to assess the ability of functionally specialized modules of the thalamocortical system to interact rapidly and effectively thus producing complex patterns of activity . the distributions of this index in unconscious and conscious conditions do not overlap , ranging from 0 to 0.31 and from 0.44 to 0.7 , respectively , suggesting an optimal cut - off of 0.31 ( casali et al . , 2013 ) to distinguish between the two states . recently , we validated this threshold with a perfect sensitivity and specificity on a larger benchmark population . we then demonstrated its ability to distinguish between uws and mcs patients with a very high sensitivity and specificity , and detected multiple uws patients with high complexity , whom exact state of consciousness remained to be specified ( casarotto et al . , 2016 ) . studying the relationship between the cerebral metabolic activity ( as assessed by fdg pet ) and the complexity of neuronal interactions ( as assessed by tms eeg and pci ) could shed light on the neurophysiology of consciousness . eeg being a recently validated technique , a cross - validation with established techniques such as fdg - pet is necessary . we expect to see a low pci in uws patients with a severely impaired brain metabolism , and a high pci in those who have fdg pet results compatible with mcs . mismatches between pci and fdg pet results could also provide significant information about the complementarity of both techniques . the combined metabolic and electrophysiological study of unresponsive patients with high complexity , such as those identified in casarotto et al . we recruited 24 adult patients ( 13 male , 12 traumatic brain injuries , time since injury 52.5 weeks ( 51371 ) , age 35 12 years ) . all had acquired brain injuries leading to a coma then to a prolonged state of impaired consciousness , except for two of them , who suffered from a lis . the lis and emcs patients were included as positive controls for this study . patients were excluded if they had significant neurological , neurosurgical or psychiatric disorders prior to the brain insult that lead to doc , if they had any contraindication to tms eeg or mri ( electronic implanted devices , active epilepsy , external ventricular drain ) , and if they were not medically stable . patients were seen at least 5 weeks after the brain injury , to limit the impact of spontaneous recovery during the study . we did not set an upper limit for the time since injury , to better reflect the clinical diversity of these patients . the ethics committee of the medical school of the university of liege approved the study , and we received informed consent from the two lis patients , and from the legal surrogate of all non - communicating patients . ( 2016 ) , and the fdg - pet of ten patients were reported in stender et al . the crs - r ( giacino et al . , 2004 ) is a behavioural scale consisting of 23 items separated in six subscales , assessing the visual , auditory , motor , and oromotor / verbal functions , communication , and arousal . each subscale includes items of increasing complexity , of which some are considered signs of consciousness ( mcs ) . functional communication and functional use of object are the diagnostic criteria for emcs if present at least twice in a row ( giacino et al . , 2002 ) . accredited experts administered the crs - r a minimum of three times to each patient ( except in lis ) , and at least the day of tms eeg and the day of fdg - pet . eeg data were acquired and analysed similarly to our previous tms eeg studies ( casali et al . , 2013 , rosanova et al . , 2012 ) , using tms stimulator , neuronavigation , and eeg amplifier from nexstim plc . , the patients ' 3d t1 was loaded into the neuronavigation system , and stimulation targets ( left and right medial part of the superior frontal and parietal gyri ) were identified , as well as any structural lesion that needed to be avoided . a 60 channels eeg cap was installed , along with electrooculogram , reference , and ground electrodes , and connected to a tms compatible sample - and - hold amplifier . the target areas were stimulated 400 times with an interstimulus delay of 2000 ms , with a jitter of 300 ms , using a figure - of - eight coil driven by a mobile stimulator unit , and with an intensity at the cortical level of around 120 v / m . this could be adjusted , between 100 and 150 v / m , to obtain a sufficient signal to noise ratio with minimal artefacts . the shape and complexity of tms evoked potentials do not vary with limited changes of intensity ( casarotto et al . , 2010 ) . patients were kept awake for the whole stimulation sessions , using arousal protocol if required ( giacino et al . , 2004 ) . data were then pre - processed with in house scripts in matlab ( matworks , natick , ma ) . eeg sources were computed using weighted minimal norm constraint and pci was calculated as in casali et al . patients were classified as unconscious or conscious , if their best pci was below or over 0.31 , respectively ( casali et al . , 2013 ) . data were acquired and analysed similarly to our previous fdg pet studies ( e.g. , see stender et al . , 2014 ) . before and after injection of 150300 mbq of fdg , patients were kept awake in the dark for 30 min and were then scanned for 12 min on a philips gemini tf pet - ct scanner . some patients required light sedation , during the scanning only , in order to prevent excessive movements . as this sedation was performed after the glucose uptake had happened , it did not have any influence on the metabolic results obtained . to detect brain areas exhibiting a significantly preserved or decreased metabolism in each patient , we used spm 8 ( www.fil.ion.ucl.ac.uk/spm ) and a contrast consisting of 39 age - matched healthy controls ' fdg - pet . the pet - based diagnosis was visually made by experts , and was classified as compatible with unconsciousness ( when the statistical tool did not detect a single voxel of preserved metabolism in the whole associative fronto - parietal network bilaterally ) or as compatible with consciousness ( when at least some significantly preserved metabolic activity could be detected in the fronto - parietal network ) ( laureys et al . , 1999 , we used a significance threshold of p < 0.05 uncorrected in all contrast for single subject analyses , as in our previous studies ( stender et al . , 2014 ) . tms eeg and fdg - pet were performed 5 days apart : fdg pet first then tms eeg . all the investigators ( ob , og , sw , at , and ja ) knew the results of behavioural evaluations , but tms eeg investigators ( ob , og ) were blinded to the results of fdg pet ( sw , at ) , and vice - versa . we recruited 24 adult patients ( 13 male , 12 traumatic brain injuries , time since injury 52.5 weeks ( 51371 ) , age 35 12 years ) . all had acquired brain injuries leading to a coma then to a prolonged state of impaired consciousness , except for two of them , who suffered from a lis . the lis and emcs patients were included as positive controls for this study . patients were excluded if they had significant neurological , neurosurgical or psychiatric disorders prior to the brain insult that lead to doc , if they had any contraindication to tms eeg or mri ( electronic implanted devices , active epilepsy , external ventricular drain ) , and if they were not medically stable . patients were seen at least 5 weeks after the brain injury , to limit the impact of spontaneous recovery during the study . we did not set an upper limit for the time since injury , to better reflect the clinical diversity of these patients . the ethics committee of the medical school of the university of liege approved the study , and we received informed consent from the two lis patients , and from the legal surrogate of all non - communicating patients . ( 2016 ) , and the fdg - pet of ten patients were reported in stender et al . the crs - r ( giacino et al . , 2004 ) is a behavioural scale consisting of 23 items separated in six subscales , assessing the visual , auditory , motor , and oromotor / verbal functions , communication , and arousal . each subscale includes items of increasing complexity , of which some are considered signs of consciousness ( mcs ) . functional communication and functional use of object are the diagnostic criteria for emcs if present at least twice in a row ( giacino et al . , 2002 ) . accredited experts administered the crs - r a minimum of three times to each patient ( except in lis ) , and at least the day of tms eeg and the day of fdg - pet . tms eeg data were acquired and analysed similarly to our previous tms eeg studies ( casali et al . , 2013 , rosanova et al . , 2012 ) , using tms stimulator , neuronavigation , and eeg amplifier from nexstim plc . , the patients ' 3d t1 was loaded into the neuronavigation system , and stimulation targets ( left and right medial part of the superior frontal and parietal gyri ) were identified , as well as any structural lesion that needed to be avoided . a 60 channels eeg cap was installed , along with electrooculogram , reference , and ground electrodes , and connected to a tms compatible sample - and - hold amplifier . the target areas were stimulated 400 times with an interstimulus delay of 2000 ms , with a jitter of 300 ms , using a figure - of - eight coil driven by a mobile stimulator unit , and with an intensity at the cortical level of around 120 v / m . this could be adjusted , between 100 and 150 v / m , to obtain a sufficient signal to noise ratio with minimal artefacts . the shape and complexity of tms evoked potentials do not vary with limited changes of intensity ( casarotto et al . , 2010 ) . patients were kept awake for the whole stimulation sessions , using arousal protocol if required ( giacino et al . , 2004 ) . data were then pre - processed with in house scripts in matlab ( matworks , natick , ma ) . eeg sources were computed using weighted minimal norm constraint and pci was calculated as in casali et al . patients were classified as unconscious or conscious , if their best pci was below or over 0.31 , respectively ( casali et al . , 2013 ) . data were acquired and analysed similarly to our previous fdg pet studies ( e.g. , see stender et al . , 2014 ) . before and after injection of 150300 mbq of fdg , patients were kept awake in the dark for 30 min and were then scanned for 12 min on a philips gemini tf pet - ct scanner . some patients required light sedation , during the scanning only , in order to prevent excessive movements . as this sedation was performed after the glucose uptake had happened , it did not have any influence on the metabolic results obtained . to detect brain areas exhibiting a significantly preserved or decreased metabolism in each patient , we used spm 8 ( www.fil.ion.ucl.ac.uk/spm ) and a contrast consisting of 39 age - matched healthy controls ' fdg - pet . the pet - based diagnosis was visually made by experts , and was classified as compatible with unconsciousness ( when the statistical tool did not detect a single voxel of preserved metabolism in the whole associative fronto - parietal network bilaterally ) or as compatible with consciousness ( when at least some significantly preserved metabolic activity could be detected in the fronto - parietal network ) ( laureys et al . , 1999 , nakayama et al . , 2006 , thibaut et al . , 2012 ) . we used a significance threshold of p < 0.05 uncorrected in all contrast for single subject analyses , as in our previous studies ( stender et al . , 2014 ) . tms eeg and fdg - pet were performed 5 days apart : fdg pet first then tms eeg . all the investigators ( ob , og , sw , at , and ja ) knew the results of behavioural evaluations , but tms eeg investigators ( ob , og ) were blinded to the results of fdg pet ( sw , at ) , and vice - versa . table 2 illustrates the behavioural , metabolic , and electrophysiological results , as well as the outcome of the 24 patients . pet and tms eeg classified patients as conscious or unconscious with no mismatch , except for two patients detailed below , regardless of their behavioural diagnosis . lis , two emcs ) according to behavioural evaluations ( best crs - r score of 22 or 23 ) , and served as positive controls for this study . their fdg pet showed a hypometabolism limited to the cerebellum ( four cases ) , brainstem ( two ) , and motor areas ( two ) . one showed more extensive hypometabolism of the left posterior parieto - occipital areas including v1 and wernicke area , as well as the thalami . as expected , all four had best pci above 0.31 , hence above the distribution of unconscious subjects . ten patients were mcs ( seven mcs+ and three mcs ) according to the crs - r ( best total score ranging from 7 to 17 ) . all had a relative preservation of cerebral metabolism of the internal or external fronto - parietal network found by the pet . four patients were behaviourally unambiguously unconscious , with a diagnosis of uws ( best crs - r of 6 or 7 ) . maximal pci values ranged from 0 to 0.27 , and were in the distribution of unconsciousness . these four patients have concordant behavioural , metabolic and electrophysiological findings , and had non - traumatic brain injuries . an additional four unambiguously behaviourally uws patients ( three with traumatic and one with non - traumatic brain injuries , best crs - r ranging from 5 to 7 ) had at least partial preservation of the left ( two cases ) , right ( one case ) or bilateral ( one case ) temporo - parietal metabolism , compatible with the diagnosis of mcs . notably , one of them showed preserved activation of the supplementary motor area during an active fmri evaluation ( monti et al . , 2010 ) 1 ) , while the other three did not underwent this exam because they had to be sedated to avoid movement artefacts . three of them had their brain injury less than one year ago , while the fourth suffered from it nearly four years before the study . typical behavioural , metabolic , and electrophysiological results of one uws , one mcs * , one mcs , and one lis patient are illustrated in fig . the pci were all below 0.31 , hence in the distribution of unconsciousness , despite stimulations over the right hemisphere . after a follow - up of five years , this patient has not improved and is still uws . the other patient had a behavioural diagnosis of mcs- ( best crs - r of 10 ) , as visual pursuit was detected once during evaluations , the day of fdg pet . the latter was compatible with this diagnosis , showing a relative preservation of cerebral metabolism including the anterior cingulate gyrus , the precuneus , and the left frontal area . however , the day of tms eeg , this patient had a behavioural diagnosis of uws ( crs - r of 4 ) , and pci could be computed only on the right premotor area ( two areas were excluded due to the presence of a cerebrospinal fluid shunt , and one had low signal - to - noise ratio as it was close to structural lesions on the mri ) . the tms evoked potentials and fdg pet results of these patients are illustrated in fig . one year after the evaluation , five patients had died , 15 remained stable , three were lost to follow up , and only one had improve from mcs * to mcs ( table 2 ) . out of our 24 patients , 22 have congruent fdg pet and pci results . the association of these two techniques shows the most concordance when compared to the combination of crs - r with any or both of fdg pet and pci ( table 3 ) . in four cases in which the patients could communicate ( emcs and lis ) , both the fdg pet and tms eeg results were compatible with the presence of consciousness : fdg - pet showed preserved metabolism in the fronto - parietal network , while tms similarly , the fdg pet and the pci were compatible with the presence of consciousness in ten mcs patients . finally , in four patients that were unambiguously uws after repeated behavioural assessment , both the metabolic and electrophysiological results were in favour of the absence of consciousness . in these cases , pci was always below 0.31 in patients whose fdg pet could not identify preserved metabolism in the fronto - parietal network , suggesting that preserved metabolic rates are a minimal prerequisite for cortical circuits to engage in complex dynamics . notably , four patients with otherwise unambiguous clinical diagnosis of uws had preserved metabolic patterns and pci levels typical of conscious conditions , suggesting that these patients were probably mcs*. thus , preserved fdg pet not only has prognostic value ( stender et al . , 2014 ) , but may index an actual , albeit covert , capacity for consciousness . a hypothesis further supported by the willful modulation of brain activity in our fmri paradigm in one of these patients ( fig . this also demonstrates that uws patients with a high pci do not reflect a lack of specificity of tms eeg , but really seem to be a specific population , with its own metabolic and electrophysiological characteristics . mcs * are likely to also share their own prognosis , given the results of previous studies showing they were more prone to recover behavioural signs of consciousness ( stender et al . , 2014 ) and as the only patient in this cohort that recovered signs of consciousness was mcs * ( table 2 ) . adding the fact that pci has very high sensitivity and specificity in healthy controls ( casarotto et al . , 2016 ) , we can safely support the hypothesis that both tms eeg and fdg pet are able to detect non - behavioural signs of consciousness . in two patients , fdg this is not surprising since these two techniques clearly index different aspects of neuronal functioning at distinct spatial and temporal scales . pet evaluates the metabolic activity in terms of patterns of preserved and impaired glucose uptake over many minutes , allows inferring on the level of neuronal activity across distributed cortical areas . on the other hand , pci evaluates the electrophysiological complexity of cortico - cortical neuronal interactions over milliseconds , allowing computing effective connectivity between cortical areas , and fluctuates on a minute - by - minute base according to the subject 's current state ( massimini et al . , 2005 ) . the two patients with incongruent results had preserved metabolic activity , while their pci values were in the range of unconsciousness . the first patient was behaviourally unambiguously uws , showed a conservation of the whole right hemisphere metabolism , whereas pci computed across several sites at optimal intensity were always in the distribution range of unconsciousness . a parsimonious explanation of this result is that preserved metabolic rates may be necessary but not sufficient to recover complex interactions among cortical areas and consciousness . hence , neurons that are still active may not be able to engage in complex network dynamics due to an insufficient level of connectivity or functional imbalances , such as sleep - like neuronal bistability induced by increased potassium conductance or by an altered excitation / inhibition balance ( massimini et al . , 2012 ) . the second patient only showed visual pursuit on one occasion , the day of the fdg pet . the day of tms eeg , and the rest of the week , this patient was behaviourally uws and showed no signs of consciousness . in this case pci could be computed from only one session and was low . assuming that this patient was conscious , the discrepancy between fdg pet may be explained by the inability of tms to effectively stimulate the cortex , or by a drop in the level of vigilance during the pci measurement . apart from fluctuation of consciousness levels , aetiology and comorbidities may be the source of divergent results . patients with anoxic brain injuries may exhibit low cortical excitability , hindering the emergence of complex eeg potentials ( gosseries et al . , 2015 ) . stimulating over brain lesions should be avoided , but in traumatic brain injuries , they may be so widespread that gathering artefact - free signal in tms antiepileptic drugs also lower cortical excitability , and this should be taken into account while performing tms diabetes , if treated with insulin , and any serious infection may artificially decrease the measure of brain metabolism in fdg pet , and these conditions should be looked for before the acquisition . overall , these results , by showing a substantial concordance between fdg pet and tms - eeg results , provides a first cross - validation of two different techniques in assessing doc patients and suggest that their complementarities could be exploited in the clinical setting in a two - step procedure ( fig . 4 ) . in this scenario , patients diagnosed as uws with repeated crs - r should first be screened with fdg pet , as it is easier to perform , well - standardized , and might be more sensitive than tms eeg . in patients showing preserved fronto - parietal metabolic activity , tms eeg could be performed , to assess the ability of cortical neurons to interact effectively and engage in complex pattern of distributed activity , which provides a more specific index of a capacity for consciousness . the use of these costly techniques should be limited to the patients for whom an accurate diagnostic might influence important clinical decisions , such as end - of - life issues . moreover , we think that patients with traumatic , or at least non - anoxic , brain injuries might benefit more from these additional assessments , as they are more likely to exhibit non - behavioural signs of consciousness ( e.g. cruse et al . , 2011 , monti et al . , 2010 , stender et al . , 2014 although both fdg pet and tms eeg are not readily available in the clinical setting and require specific expertise , their joint application may increase the sensitivity and specificity of our diagnostic process of doc patients and provide relevant physiopathological insight . indeed , early identification of mcs * could lead to the planning of new assessments and increased attention toward the identification of the emergence of subtle signs of consciousness , and could change the rehabilitation program these patients undergo . nevertheless , one of our mcs * patient could be identified several years after the brain injury , and could also benefit from this more accurate diagnosis . moreover , the joint assessment of metabolic activity and electrophysiological complexity of cortical circuits may help guiding pharmaceutical or electrophysiological trials of consciousness promoting agents , such as amantadine ( giacino et al . , 2012 ) , zolpidem ( whyte and myers , 2009 ) , transcranial direct current stimulation ( thibaut et al . , 2014 ) or deep brain stimulation ( schiff et al . , 2007 ) for the first time , metabolic and complexity measures of the brain are studied in the same challenging population of patients with disorders of consciousness . our results offer a cross validation of these two techniques , despite their very different characteristics and own specificities . this allows us to suggest the use of both fdg - pet and tms - eeg to improve our diagnostic accuracy in the clinical setting . moreover , we demonstrated that they could both detect non - behavioural minimally conscious patients , and that uws patients showing high level of complexity in tms this also has an important potential clinical impact , as these patients seem to have a better prognosis than patients with unresponsive wakefulness syndrome and thus require increased attention toward potential appearance of subtle signs of consciousness , and more efforts in rehabilitation centre to allow these signs to emerge . ob is a research fellow , og a post - doctoral fellow and sl a research director at the national fund for scientific research ( fnrs ) . this research was supported by the belgian national fund for scientific research ( fnrs ) , human brain project ( eu - h2020-fetflagship - hbp - sga1-ga720270 ) , luminous project ( eu - h2020-fetopen - ga686764 ) , the belgian american education foundation , the wallonie - bruxelles international , the european commission , the fonds lon fredericq , the james s. mcdonnell foundation , the mind science foundation , the french speaking community concerted research action ( arc-06/11 - 340 ) , and the university and university hospital of lige .

backgroundmaking an accurate diagnosis in patients with disorders of consciousness remains challenging . 18f - fluorodeoxyglucose ( fdg)pet has been validated as a diagnostic tool in this population , and allows identifying unresponsive patients with a capacity for consciousness . in parallel , the perturbational complexity index ( pci ) , a new measure based on the analysis of the electroencephalographic response to transcranial magnetic stimulation , has also been suggested as a tool to distinguish between unconscious and conscious states . the aim of the study was to cross - validate fdg pet and pci , and to identify signs of consciousness in otherwise unresponsive patients.methodswe jointly applied the coma recovery scale - revised , fdg pet and pci to assess 24 patients with non - acute disorders of consciousness or locked - in syndrome ( 13 male ; 1954 years old ; 12 traumatic ; 9 unresponsive wakefulness syndrome , 11 minimally conscious state ; 2 emergence from the minimally conscious state , and 2 locked - in syndrome).resultsfdg pet and pci provided congruent results in 22 patients , regardless of their behavioural diagnosis . notably , fdg pet and pci revealed preserved metabolic rates and high complexity levels in four patients who were behaviourally unresponsive.conclusionwe propose that jointly measuring the metabolic activity and the electrophysiological complexity of cortical circuits is a useful complement to the diagnosis and stratification of patients with disorders of consciousness .

You are an expert at summarizing long articles. Proceed to summarize the following text: topiramate is one of the newer antiepileptic drugs and is also approved for migraine prophylaxis . there is little information concerning topiramate use in breast - feeding women , but case reports indicate that it is transferred into human milk and that milk concentrations may equal those in maternal plasma , , , . we report a case of long - lasting diarrhea in a breast - fed infant exposed to topiramate . a patient with epilepsy , aged 31 , had been treated with topiramate 100 mg / day for several years . the treatment was continued unchanged throughout her pregnancy with good therapeutic effect . a healthy girl with a birth weight of 2735 g the topiramate treatment was continued while breast - feeding . in order to reduce infant exposure to topiramate , the baby initially thrived and had a normal development . at 40 days of age and body weight of 4735 g , she became ill , with 810 watery , foamy stools a day . her weight gain rate eventually declined , and she was referred to the hospital outpatient clinic . relevant differential diagnoses such as infection or somatic cause of the diarrhea were excluded , but she still suffered from diarrhea . after 18 days of frequent , watery stools , the general practitioner suspected a causal relationship with topiramate , and breast - feeding was suspended . within 2 days , the frequency was reduced to 23 stools a day , and the mother observed more solid feces , with smell and color returning to normal . while breast - feeding was suspended , the mother used a breast pump and stored the milk in a freezer ( 20 c ) . she gave her consent to have the milk analyzed for topiramate , and the milk was sent for analysis after a storage time of 4.5 months . a sample was analyzed for topiramate by fluorescence polarization immunoassay based on the competitive binding principle ( innofluor topiramate assay system , seradyn , indianapolis , in , u.s.a . ) . the assay system was used on a tdx analyzer ( abbott , abbott park , il , u.s.a . ) . precision studies have shown a coefficient of variation ( cv ) of < 5% . mol / l in the mother 's milk , corresponding to 5.3 g / ml . the plasma concentration in the child was not measured . breast - feeding is generally recommended , even if the mother is using antiepileptic drugs , but adverse effects in the child may necessitate reduction or withdrawal of breast - feeding . little is known regarding the use of topiramate in breast - feeding women and the risk of adverse effects in their children . while there are no systematic studies of topiramate excretion in human milk , some study results indicate a considerable transfer . the product information does not state explicitly that topiramate is contraindicated during breast - feeding but advises that a risk / benefit assessment should be made before deciding whether to stop breast - feeding or to withdraw topiramate . a literature search in medline ovid , embase , handbooks , and databases on drugs and lactation provided little additional information . published case reports of topiramate use while breast - feeding , , , include a total of only eight patients . a general finding is transfer into breast milk and milk / plasma ratios of 0.61.1 . concentrations of topiramate in the breast milk of three patients were 1.63.6 , 6.9 , and 13.7 mol / l ( 0.5 , 2.3 , and 4.7 g / ml ) , respectively , after daily doses of 150 or 200 mg , measured 1497 days after delivery . the weight - adjusted relative dose to the infant was estimated at 323% of the maternal dose . two of the mothers were using carbamazepine , a substance known to induce the metabolism of topiramate . another case report found a topiramate concentration of 3.1 g / ml ( 9.1 mol / l ) after a daily dose of 150 mg in one patient 12 days after delivery . we have not found any studies investigating stability of topiramate in breast milk , but topiramate in human plasma stored for a period of 1 month at 80 c has shown that the drug is stable . topiramate is not metabolized to any great extent unless the patient is using concomitant cyp enzyme inducers . the child 's plasma concentration will depend on the amount of drug in the milk , the amount absorbed from the intestine of the child , and the child 's ability to eliminate the compound . in five of six mother / infant pairs , plasma levels of topiramate in the infants were 1020% of the maternal plasma levels and in one case could not be detected , . in the case reported here , a milk concentration of 5.3 g / ml ( 15.7 mol / l ) and an estimated daily intake of 450 ml of mother 's milk in an infant weighing 4735 g would result in a daily dose of 0.5-mg / kg topiramate . the mother 's body weight was 70 kg , and the relative infant dose was estimated at 0.35 . the infant described here may have ingested a topiramate dose of 35% of the mother 's weight - adjusted dose . withdrawal of breast milk was associated with rapid clinical improvement of the child 's condition , supporting the theory of an adverse drug reaction . diarrhea is a well - known and very common adverse reaction to topiramate , and the infant 's condition improved upon withdrawal of topiramate . the diarrhea was assessed as a probable adverse reaction to topiramate in the breast milk . other case reports describing topiramate use in breast - feeding women do not describe side effects in the children . to our knowledge , this is the first report of probable topiramate - induced diarrhea in a breast - fed infant . infant diarrhea increases the risk of electrolyte disturbances , and topiramate in the breast milk may be a hitherto unknown risk factor . the case has been reported to the national health authorities in norway , registered as number no - nomaadvre - reliss-2008 - 5232 . the authors have received no funding to write the manuscript and have no conflicts of interest .

an infant developed a severe condition of recurrent and persistent watery diarrhea at 40 days of age . the child had been partially breast - fed , and the mother used topiramate for epilepsy . hospital examination excluded a viral or bacterial infection and failed to identify any other potential cause . after two weeks , topiramate exposure was suspected to be the cause , and breast - feeding was suspended . the diarrhea ceased within 2 days . analysis of the breast milk showed a topiramate concentration of 15.7 mol / l ( 5.3 g / ml ) . there is little information on the use of topiramate in breast - feeding women . the potential effects on the children are not known . topiramate passes into breast milk , and the concentration may equal the therapeutic plasma concentration . in this case , the infant may have ingested up to 40% of the mother 's weight - adjusted dose . diarrhea is a well - known adverse reaction to topiramate and has the potential to cause serious electrolyte disturbances in neonates and infants . the condition improved rapidly after suspension of breast - feeding . topiramate in breast milk may reach levels that cause adverse effects in infants . based on the adverse reaction profile of topiramate and the milk concentration , the diarrhea was assessed as a probable adverse drug reaction in the infant .

You are an expert at summarizing long articles. Proceed to summarize the following text: longipalpis sandflies were allowed to feed on 2 hounds naturally infected with l. infantum , strain mcan / us/2001/foxymo1 or a closely related strain . during 20072011 , the hounds had been tested for infection with leishmania spp . by elisa , pcr , and dual path platform test ( chembio diagnostic systems , inc . medford , ny , usa ( table 1 ) . l. infantum development in these sandflies was assessed by dissecting flies starting at 72 hours after feeding and every other day thereafter . migration and attachment of parasites to the stomodeal valve of the sandfly and formation of a gel - like plug were evident at 10 days after feeding ( figure 1 ) , indicating successful parasite development . * serologic results determined by immunofluorescence antibody testing : < 64 indicates negative ( ) . pcr results : indicates no amplification ; borderline indicates amplification on 1 of 3 tests ; positive ( + ) indicates amplification on 2 of 3 or 3 of 3 tests . development of l. infantum ( mcan / us/2001/ foxymo1 ) in laboratory - reared lutzomyia longipalpis sandflies led to stomodeal valve blockage 1013 days after infection . a ) dissected gut of infected sandfly , showing stomodeal valve ( cardia ) obstructed by leishmania parasites ( dashed box ) . b ) parasites obstructing stomodeal valve and parasite - secreted plug ( dashed box ) . original magnification 40 . c ) parasite plug dissected from the stomodeal valve , showing metacyclic promastigote parasites attached to plug ( arrow ) , as well as free - swimming parasites ( arrowheads ) . next , to determine sandfly capacity to transmit the us strain of l. infantum to a susceptible vertebrate host , we allowed l. infantum naive and l. infantum infected sandflies to feed on 7 l. infantum naive hamsters for 13 days . for confirmation of l. infantum infection , we dissected the alimentary tract of sandflies that fed on the hamsters ( table 2 ) . a total of 30 sandflies were used for feeding on hamsters ; 11 flies fed and were subjected to leishmania detection by pcr , which confirmed leishmania positivity for 5 sandflies . hamster l. infantum dna was detected in hamster blood by quantitative pcr ( qpcr ) and was present in hamster nos . 1 ( at 2 mo ) , 2 ( at 3 mo ) , 5 ( at 4 mo ) , and 6 ( at 4 mo ) with cycle thresholds of 43.88 , 28.27 , 34.38 , and 45 respectively . 5 , a cutaneous lesion consistent with leishmania infection persisted for 1 month . tissue from this lesion was harvested to assay for leishmania infection . bacteria found in the tissue probably represented secondary infection , a common sequela of canine vl . no l. infantum parasites were observed on slides stained with hematoxylin and eosin , periodic acid schiff , or giemsa , and lesion tissue was negative for l. infantum by qpcr ( data not shown ) . qpcr was performed to quantify parasite load within common leishmania - infected organs from all hamsters . the mean quantities of leishmania dna amplified from spleen , bone marrow , and lymph node from hamsters on which leishmania - infected sandflies had fed were 12- , 22- , and 11-fold greater than that from hamsters on which leishmania - naive sandflies had fed ( figure 2 ) . according to extrapolation from a pcr standard curve similar to one previously used ( 5 ) , the highest parasite load was in bone marrow , which contained an average of 1,238 ( 282 ) parasites / mg tissue . leishmania spp.specific quantitative pcr was performed , and parasite load was calculated from a standard curve . statistical significance was determined by 1-way analysis of variance with bonferroni posttest between 6 naive and 15 infected groups , by tissue type . in the united states , parasites from vl - symptomatic , naturally infected hunting hounds remain highly infectious to leishmania - competent lu . parasites that had fed on l. infantum infected hounds were able to develop fully within sandflies and to be subsequently transmitted to and disseminated within hamsters . longipalpis sandflies to acquire l. infantum from naturally infected dogs has been compared in leishmaniasis - endemic brazil ( 13 ) . although lower infection rates were observed in lu . longipalpis ( 36% ) sandflies , the intensity of infection ( 200500 promastigotes / fly ) was higher in lu . shannoni sandflies are commonly found within the united states and also in areas where l. infantum infected hounds were reported ( 4 ) . these data demonstrate the risk for vectorborne transmission of zoonotic vl from these dogs in the united states . despite our use of an l. infantum strain that is primarily , if not solely , transmitted via vertical transmission between dogs in the united states , we were able to measure substantial parasite loads in sandflies that fed on these dogs and in the bone marrow , spleen , and peripheral lymph nodes of hamsters on which infected sandflies had fed ( figures 1 , 2 ) . parasite dna was not amplified in the liver , possibly because of lower parasite loads in the liver during later infection , as demonstrated in experimental vl infections of mice ( 14 ) . therefore , the us strain of l. infantum that is circulating in north american hunting hounds has not lost virulence factors that facilitate adherence to sandfly gut and facilitate transmission , and subsequent dissemination , in a secondary host . this study focused on the possibility that domestic hounds serve as reservoir hosts for l. infantum within the united states ; however , other potential l. infantum reservoirs include coyotes , foxes , and opossums . when leishmaniasis was found to be reemerging among hounds in the united states in 2000 , a total of 291 wild canids were trapped and tested ( 15 ) . no serologic evidence of infection was found , but these studies were limited to the southeastern united states ; further study is needed to rule out the possibility that enzootic cycles of transmission do not exist within wild canids . the range covered by lu . shannoni sandflies overlaps that of reservoir species including coyotes , foxes , and hunting hounds . occurrence of leishmania vectors in areas of naturally infected hounds indicates a coalescence of components for establishment of a sylvatic and/or domestic cycle of l. infantum . diagnostic testing and preventive measures should be considered for dog breeds known to harbor l. infantum . in the united states , l. infantum is circulating among dogs . despite the fact that vertical transmission maintains vl within the hound population ( 5 ) , l. infantum was able to fully develop in sandflies and be further transmitted to a susceptible vertebrate host . l. infantum strain mcan / us/2001/foxymo1 , similar to the common european zymodeme mon-1 , circulating dog - to - dog in north america maintained all necessary requirements for complete development within sandflies . shannoni , and l. infantumi ) in hounds may put companion dogs and humans at risk and could pose an emerging risk for l. infantum triggered clinical disease in at - risk populations in north america . technical appendix . photograph and histologic images of lesion on hamster on which leishmania infantum infected sandflies fed .

leishmaniasis is a zoonotic disease caused by predominantly vectorborne leishmania spp . in the united states , canine visceral leishmaniasis is common among hounds , and l. infantum vertical transmission among hounds has been confirmed . we found that l. infantum from hounds remains infective in sandflies , underscoring the risk for human exposure by vectorborne transmission .

You are an expert at summarizing long articles. Proceed to summarize the following text: transplants of the retina are among the new strategies being used in the treatment of genetic and degenerative macular diseases . moreover , literature dated from 2004 to 2011 was comprehensively examined via medline and pubmed searches for the following terms : auto- , homo- , heterologous transplantation , retina , stem cells , cultivated cells . tissue and cell therapy of retinal diseases are reviewed , including full - thickness retina / retinal pigment epithelium ( rpe)/choroid graft ; full and partial thickness rpe / choroid complex grafts ; rpe / bruch membrane complex graft ; and rpe , iris pigment epithelium and stem cell grafts . recommendations for transplants , as well as the benefits and weaknesses of specific techniques in retina transplants , are discussed . auto- and allogenic transplants of a full or partial thickness retina / rpe / bruch membrane / choroid complex represent an alternative treatment offered to patients with some macular diseases . stem cell transplantation to reconstruct and regenerate the macula requires further biomolecular and animal research studies . genetic and degenerative retinal diseases currently present scientific and ophthalmological challenges . in the united states , approximately 6 million people have retinal diseases , in particular from retinopathies such as age - related macular degeneration ( amd ) , diabetic retinopathy and retinitis pigmentosa [ 13 ] . amd accounts for 75% of cases of legal blindness in people over the age of 50 years in all industrialized countries . photodynamic therapy or intravitreal anti - vascular endothelial growth factor ( vegf ) injections represent the first line of wet amd treatment , but are of limited efficacy [ 48 ] . implantation of electronic chips to stimulate the brain , as well as transplantation of donor tissue and cells , are new therapeutic strategies currently being explored to reconstruct the photoreceptor / retinal pigment epithelium ( rpe ) complex and to restore central vision in different retinopathies [ 1114 ] . an animal model of retinal degeneration demonstrated the importance of the survival and integration of transplanted tissues . an evolutionary phenomenon that prevents immunogenic inflammation , macular destruction and blindness [ 12,13,1618 ] . blood - tissue barriers that limit the ingress of blood - borne immunogenic factors ; immunosuppressive properties of pigment epithelial cells ; and the expression of cd95 ligand on ocular parenchymal cells , which triggers the apoptosis of effector t cells , all contribute to the immune tolerance of the eye . human rpe cells have the particular ability to suppress t - cell activity by direct contact ( toll - like receptors serve as the first line of defense [ 17,9,10 ] ) and via secretion into the aqueous humor and vitreous body of soluble immunomodulatory / suppressive factors , such as cytotoxic t lymphocyte - associated antigen-2 programmed cell death 1 ligand , thrombospondin-1 and transforming growth factor [ 19,2125 ] . these overlapping mechanisms enable acceptance of foreign tissue grafts for extended intervals unlike conventional body sites that summarily reject such grafts and delay symptoms of retinal rejection ( ie , shrinkage , architecture loss and glial transformation accompanied by low - grade inflammation ) . full - thickness retina / rpe / choroid complex allogenic grafts were performed to treat patients with retinitis pigmentosa and geographic atrophy in dry amd . during a 5-year study , graft samples were harvested from the enucleated eyes of human embryos after abortion in the 10 to 15 week of pregnancy . it was then placed in a special applicator ( allowing gentle lifting and correct direction of the tissue ) and grafted under the central retina by means of an upper nasal retinotomy . the procedure was finalized with the use of a laser around the retinotomy and performance of a perfluorocarbon - oil exchange . after the retina transplantation , synaptic junction stimulation at the host / donor interface was required , which was performed in this group of patients by showing them various colorful moving images on video . seventy percent of the patients ( n=10 ) showed improved visual acuity scores 6 months after the transplantation . the nutritious effect of the graft on the photoreceptors or the stimulation of mller cells , leading to new synaptic junctions in the host / donor interface , may have contributed to better visual acuity . the new immunization was not found in human leukocyte antigens ; embryonic tissues were less immunogenic and the blood - brain barrier stopped the infiltration of the graft s antigens . five years after surgery , no graft rejection symptoms , such as macular edema or encapsulation , were found clinically or by optical coherence tomography . however , in the graft area , pigment loss occurred in 80% of patients after 36 months , which was not interpreted as rejection because of the improvement in visual acuity . the investigators also suggested that the improvement could result not only from the graft , but also from the lensectomy and vitrectomy , which had been performed before transplantation during the same procedure . the administration of neutrofins ( an indirect result ) rather than the replacement of the degenerated tissue could also have contributed to the good results . it is doubtful , however , whether this type of graft would be commonly accepted ( because of ethical and religious dilemmas ) . autotransplantation ( autotranslocation ) of rpe / choroid complex graft is called a full - thickness autologous patch or a patch graft ( pg ) . such grafts were performed in patients with wet amd ( choroidal neovascularization in amd [ cnv / amd ] ) [ 3135 ] , rpe rip and dry amd ( geographic atrophy in amd ) . a pg consists of the rpe , bruch membrane , and choriocapillaris , as well as medium and large choroidal vessel translocation . the differences between pg methods depend on the manner in which the neovascular tissue is removed and the graft is prepared , as well as on the tissue translocation technique used ( see below ) . one method involved the removal of cnv by means of perimacular retinotomy and harvesting of the graft from the superior temporal equatorial retina . it was first encircled with continuous laser impacts and then excised as deep as the sclera with vertical scissors . the retina was peeled from the sheet and pg was implanted under the fovea through a central retinotomy . the procedure was finalized by applying the laser around the retinotomy and performing a perfluorocarbon - oil exchange . one study compared the results of this pg technique with those of full macular translocation ( fmt ) surgery ( 360 ) . the results after 1 year were comparable , but after 4 years the results of fmt surpassed those of pg ( the deterioration of visual acuity from 0.87 to 1.38 logmar in pg and from 0.9 to 0.69 logmar in fmt ; more extensive rpe damage and inferior fixation occurred in the pg group ) . three reasons for the inferior results in the pg group have been suggested : ( 1 ) iatrogenic detachment of the retina caused by the fluid in fmt does not damage the natural , strong adhesion of the photoreceptors and rpe to the extent that peeling does ; ( 2 ) in pg , the tissue is harvested from the equatorial retina and rpe , which is less specific and less sensitive than paramacular rpe , on which the retina is placed and rotated by 45 in fmt ; and ( 3 ) the perfusion disorder can last for several days after pg and the translocation of the full choroid section does not prevent ischemia and does not contribute to the metabolic balance of the retina . in another study the investigators compared results of autologous rpe / choroid pg with an rpe cell - suspension graft . three or more lines in best corrected visual acuity at 24 months follow - up was found in 28.5% of patients in the rpe patch group and in 14.2% of patients in the rpe cell - suspension group ; a loss of 3 or more lines occurred in 14.2% in each group ( n=7 in each group ) . examination by fluorescein and indocyanine green angiography showed revascularization of all pgs and normal choroidal vasculature in the area of rpe atrophy in all patients of the rpe cell - suspension group . however , part of the successfully transplanted patch grafts showed intrastructural changes on spectral - domain optical coherence tomography ( ie , irregularities in the cell layers ; scarring or gliosis and an absence of photoreceptors and outer nuclear layer ) . this may explain the limited visual gain of rpe pgs , which should theoretically be a better option than rpe suspension grafts ( loose , unevenly distributed rpe cells without their own basal lamina are worse support for photoreceptors than a functional monolayer in sheet grafts ) . in another method for pg surgery , a temporal 180 retinotomy was performed and the mobilized retina placed on the nasal area . the vast retinal area bared in this way enabled less extensive cnv removal . with special scissors , the graft was excised from the central circumference of the fundus in the superior temporal quadrant and was not encircled by the laser . in cases of hemorrhage , the nutrient vessel supporting the graft was coagulated with diathermia and/or the intraocular pressure was raised . moreover , perfluorocarbon injected into the intrinsic surface reversed the retina and stabilized the graft . the procedure was finalized by applying a laser along the retinotomy and by performing a perfluorocarbon - oil exchange . between 4 and 20 months after surgery , visual acuity improved in 60% of eyes , stabilized in 30% and deteriorated in 10% ( n=13 ) . this allows for delicate cnv excision and maximum preservation of residual , healthy rpe and subretinal vessels ; in addition , it enables and accelerates revascularization of the graft . folding and stretching of the tissue during implantation was not required ( it took place in the graft through paramacular retinotomy ) . the laser was not used prior to tissue resection to avoid the shrinkage and infolding of the graft s edges . it is vital for the graft to be large enough to entirely cover the area of the recipient s damaged rpe and choroid . the tissue junction contributes to the nutrient bridge vessel at the host / donor interface and to early graft revascularization . in indocyanine green angiography , the graft s nutrient vessels did not run radially , but in parallel as ladder rungs . pvr occurs in 2050% of patients after a 360 retinotomy and in 31% of patients after paramacular retinotomy ; a large incision area and good perfusion of the central retina lead to pvr . lack of pvr in the above - mentioned group is ascribed to limited ( 180 ) retinotomy in the poorly vascularized circumferential area of the retina and routine performance of phacoemulsification with intraocular lens implantation . the right access allows for maximum excision of the vitreous base , which prevents shrinkage and pvr . in some patients , extensive tissue thickness makes penetration of nutrients and reperfusion difficult , thereby leading to graft fibrosis beginning just 3060 days after autotranslocation . animal research has shown that a partial graft , with no medium and large choroid vessels , is easily integrated with the recipient s bed . in 63% of the animals , the partial graft was found to be viable ( ie , revascularization and monolayered rpe cells were present ) . autologous rpe / bruch membrane complex grafts were performed in patients with hemorrhagic cnv in wet amd . a temporal 180 retinotomy was performed with cnv removal on the external side of the retina and laser around the retinotomy with a perfluorocarbon - oil exchange . the 4 mm graft was excised with a microvitreoretinal knife on the cauterized area from the central circumference in the superior temporal quadrant . the rpe / bruch membrane complex was separated from the choroid vessels with a special s - shaped spatula and scissors . patients showed improved early treatment of diabetic retinopathy study visual acuity scores that averaged 28.6 to 47.7 after surgery , central fixation occurred in 30% of eyes , and the appropriate graft morphology without depigmentation was found in 82% of eyes ( n=21 ) . visual acuity scores were reported to be comparable to the results of full - thickness grafts . however , the thinness of the partial graft , without the retina and the choroids , is perceived as an advantage in this graft it easily settles after perfluorocarbon , does not require curling , enables penetration of nutrients from the choroid to the retina , and its edges do not tend to curl , which prevents the formation of subretinal membranes . according to various authors [ 4144 ] , the reported long - term results of rpe / bruch membrane pgs are not satisfactory because the achieved overall visual gain is about 1 line of best corrected visual acuity , and proliferative vitreoretinopathy complications occur in up to 45% of eyes . full or partial tissue transplantation is one of the current strategies for macular pathology treatment , but most grafts fail to integrate into the recipient s bed , lose their architecture and do not function [ 4547 ] . moreover , allotransplants of fetal or postmortem tissue lead to rejection and the need to apply immunosuppressants and , at the same time , they raise moral and ethical concerns . autologous rpe cell grafts were performed in patients during the surgical removal of cnv in exudative amd ( cnv / amd ) or cnv in retinal angiomatous proliferations ( cnv / rap ) and can be a therapeutic option for anti - vegf non - responders or where anti - vegf fails to improve visual acuity ( rpe tear , massive subretinal hemorrhage ) . after pars plana vitrectomy , nasally from the optic nerve , flat detachment of the retina was created and rpe cells were mobilized in the iatrogenic bubble by means of fluid injection . the cells were aspirated , removed by centrifugation and then counted and prepared for injection of suspension . the cnv was removed by a second paramacular retinotomy , and the suspension of rpe cells was injected under the fovea . the procedure was finalized by applying a laser to the retinotomy and performing a perfluorocarbon - oil exchange . in a 1-year follow - up period , visual acuity improved or stabilization occurred in 80% of patients with wet amd and in 68% of patients with rap . however , the long - term results of autologous rpe cells grafts are not promising . the technique is not viable because the grafts do not contribute to functional monolayer formation and the scattered cells atrophy . unevenly distributed , multilayered rpe cells without their own basal lamina and extracellular matrix are unable to grow well on an aged or diseased host s bruch membrane , which is a crucial factor in the survival of transplanted rpe cells , their adherence and differentiation , and their ability to phagocytose photoreceptor outer segments [ 5052 ] . the fovea requires much more stimuli than just new rpe cells in order to function properly . a biostable synthetic membrane ( ie , expanded polytetrafluoroethylene ( eptfe ) polymer modified by ammonia gas - plasma treatment ) was tested experimentally as a bruch membrane prosthesis a scaffold for rpe cell growth and differentiation . defluorination of the fluoropolymer increases surface hydrophilicity , incorporates surface polar groups and facilitates cell attachment . arpe-19 cells ( a non - immortalized human rpe cell line that mimics the human situation ) , seeded on a modified eptfe scaffold at a density of 1500 cells / mm and cultured in the presence of retinoic acid ( to promote rpe differentiation ) , formed a differentiated and functional monolayer capable of phagocytosing photoreceptor outer segments . the scaffold serves as a carrier substrate , protected from the hostile influences of an aged and diseased bruch membrane ; facilitates cell interaction and flow of nutrients ( vitamin a , glucose , fatty acid ) ; and represents a possible treatment to repair retinal degeneration and restore vision in affected patients . according to krishna et al . , the biostable , biocompatible eptfe membrane provides stable replacement of the natural bruch membrane and long - term support for transplanted rpe cells . the membrane seems to be a better option than a synthetic biodegradable membrane or tissue - based material [ 50,5357 ] . despite advances in microfabrication technology , the functional results of various rpe cell transplantation techniques in humans are worse than anti - vegf treatment and are associated with a high rate of serious complications ( eg , massive hemorrhage , pvr ) . autotransplantation of iris pigment epithelium ( ipe ) cells is not performed in humans because of the potential for significant damage to the iris . non - modified ipe allotransplantation is also not performed in humans , because it does not significantly improve visual acuity . however , ipe cells have become a focus of interest because in vivo they have been shown to express mrna for proteins involved in the metabolism of retinol . they also phagocytize the external segments of photoreceptors and accumulate lipofuscin ; thus , they significantly impact visual acuity . subretinal human ipe xenotransplantation was performed in rats ( the royal college of surgeons ) with iatrogenic macular dystrophy ( genetically engineered gene change for the photoreceptors of tyrozine kinosis , leading to inhibition of phagocytosis of the external segments of photoreceptors through rpe and lipofuscin accumulation , as well as to subsequent atrophy of photoreceptors ) . a human iris ( from a cadaver ) the human ipe cell xenotransplant was shown in vivo to protect photoreceptors without any significant adverse effects ; it also produced protective neurotrophic growth agents and stimulated the regeneration of photoreceptors . in future , ipe cells may turn out to be useful for transferring genetic information to photoreceptors and rpe . specific retinal cells , similar to other neurons , have limited capability for proliferating and regenerating spontaneously . stem cells , as well as engineered retina ( ie , retinal aggregates that are laboratory - generated from tissue - specific progenitor stem cells [ pscs ] ) , are new therapeutic strategies for the replacement of degenerative photoreceptors and rpe cells in patients [ 45,57,6179 ] . the multipotent stem cells differentiate into multiple , specific cell types of 1 lineage ( meso- or endo- or exo - dermy ) , known as pscs . multipotent stem cells can be harvested from different tissues , such as embryo , neuron , bone marrow , and eye ( including the ciliary body , iris , and retina ) . retinal pscs , formed from exodermy , have the ability to differentiate into photoreceptors , rpe , mller glial cells and bipolar cells in a favorable environment that includes growth factors and/or chemical modulators . at present , research on retinal pscs has been conducted in vitro and with animals [ 45,60,78,8284 ] , and the source of optimum retinal pscs has not yet been determined . embryonic human stem cells can differentiate into retinal neurons that are similar to adult retinal stem cells , but this manner of obtaining adult stem cells in humans has raised serious moral and ethical concerns and dilemmas . neural stem cells differentiate to photoreceptors and glia in rats , but when implanted into an animal retina , often become immature and fail to express rhodopsin . a human neural progenitor xenograft was performed in 21-day - old rats with iatrogenic macular degeneration and pigment dystrophy . adult human stem cells found in the retina , mller cells or rpe are considered to be the optimum source of retinal pscs [ 45,6165 ] . the concept of grafting both 3-dimensional ( 3d ) cultures and differentiated retinal pscs seems to be promising . 3d cultures are much better suited than monolayer cultures because the graft involves the 3d structure of the recipient s bed . cultured aggregates of retinal progenitors appear on approximately the 10th day of culturing . as a result of cellular bioengineering , the cultured 3d structured cells were differentiated in such a way as to create several cell lines specific for the particular tissue . photoreceptor differentiation was performed by upregulation of rhodopsin and aanat enzyme ( implicated in melatonin synthesis ) . this differentiation was confirmed by reverse transcription - polymerase chain reaction in reference to the following factors : rod transcription factor nrl , nr2e3 , interstitial retinal binding protein and rhodopsin kinase . differentiation toward other cell lineages was demonstrated by the presence of tyrosine hydroxylase in amacrine and ganglion cells , as well as by the presence of calbindin and gnb3 in cone cells . the resulting 3d cultured and differentiated psc aggregates are able to blend into the degenerated bed in the recipient and are capable of producing neurotrophic factors , leading to regeneration of the photoreceptor / rpe complex and reconstruction of the subretinal environment in retinitis pigmentosa and amd in humans . the development of microfabrication technology improved the delivery aspect of 3d aggregates for transplantation in an experimental study . a novel biodegradeable , 3d thin - film cell encapsulation scaffold served as the carrier platform for aggregates . the transplantation vehicle was constructed from thin - film 22.5-d polycaprolactone ( pcl ) layers ( < 10 m ) thermally bonded to form the 3-d cell encapsulation scaffold ( < 30 m ) with varying protrusions , cavities , pores and particles . the 3d scaffold was permeable and promoted the delivery of retinal progenitor cells and their appropriate retention in subretinal space . in another study , mouse embryonic stem cells cultured with the extracellular matrix proteins added to the medium , over a period of 9 days formed 3d spherical aggregates called embryoid bodies . subsequent invagination of its apical surface formed an optic cup - like structure with a 2-walled structure consisting of retinal pigment epithelium and neural retina , with synaptic activities . the formation of the optic cup occurred in a self - directed way ( was not caused by a lens or surface ectodermal tissues ) . according to several studies , self - formation of fully stratified 3d neural retina tissue from stem cells opens up a new strategy for the transplantation of the artificial retinal tissue sheets , rather than simple cell grafting . this optic - cup structure can be further induced to form an entire eye structure ( lens , iris , cornea , and sclera ) , and can serve as the cell - culture models for drug screening and characterization of the disease phenotype . such models may be obtained with retinal pscs , which derived from the persons with some specific mutant genotypes associated with the diseases , such as macular degeneration or retinitis pigmentosa . natural retinal barriers inhibitory extracellular matrix and cell adhesion molecules ( cd44 , neurocan ) , as well as the outer limiting membrane ( olm ) that form a natural barrier between the subretinal space and the outer nuclear layer , weaken cellular host - donor integration . degradation of these molecules and transient chemical disruption of the olm facilitates host - donor integration in animals . the combined transplantation of retinal pscs with biodegradable microspheres of poly lactic - co - glycolic acid , which deliver active matrix metalloproteinase 2 , stimulated the removal of the matrix inhibitory barrier and enhanced cellular host - donor integration in mice . targeted disruption of olm junctional proteins , crumbs homologue 1(crb1 ) and zona occludens ( zo-1 ) , as well as intravitreal injection of the glial toxin dl - alpha - aminoadipic acid 72 h prior to transplantation , induced transient chemical disruption of the olm ( maximal at 72 h , recovered by 2 weeks ) and led to a significant increase in the number of transplanted photoreceptor precursors integrated within the outer nuclear layer in degenerated mouse retinas . this study showed that targeted disruption of an undesirable physical barrier in the retina may be an effective and practical strategy for retinal repair . the usefulness of research on stem cells has also been confirmed by autologous non - myeloablative hematopoietic stem cell transplantation ( hsct ) . hsct was shown to be effective in the therapy of autoimmune - related retinopathy and optic neuropathy syndrome ( arron ) that was resistant to conventional therapies ( prednisone , methotrexate , cyclophosphamide , plasmapheresis , intravenous immunoglobulin ) . after hsct , the clinical manifestations ( visual acuity , visual field , electroretinography , and antibody activity against pig retina and pig optic nerve ) of arron appeared to stabilize . the techniques presented for auto- or allogenic retina transplants , both full and partial , represent the currently available surgical alternatives in the treatment of neovascular and atrophic macular diseases . however , retina transplant requires complicated vitreoretinal surgery and in some cases might be followed by delayed reperfusion of the graft . the difficulty of retina transplantation lies in the highly specific nature of the complex and demanding neuronal tissue . stem cell transplantation in retinal diseases is of increasing importance , but further laboratory tests in genetic engineering and animal testing are required to find an optimal source of pscs for rpe cells and photoreceptors . stem cell transplantation also raises new ethical dilemmas that require further consideration .

summarybackgroundtransplants of the retina are among the new strategies being used in the treatment of genetic and degenerative macular diseases . moreover , various cell cultures are being tested to treat retinal disorders.material/methodsliterature dated from 2004 to 2011 was comprehensively examined via medline and pubmed searches for the following terms : auto- , homo- , heterologous transplantation , retina , stem cells , cultivated cells.resultstissue and cell therapy of retinal diseases are reviewed , including full - thickness retina / retinal pigment epithelium ( rpe)/choroid graft ; full and partial thickness rpe / choroid complex grafts ; rpe / bruch membrane complex graft ; and rpe , iris pigment epithelium and stem cell grafts . recommendations for transplants , as well as the benefits and weaknesses of specific techniques in retina transplants , are discussed.conclusionsauto- and allogenic transplants of a full or partial thickness retina / rpe / bruch membrane / choroid complex represent an alternative treatment offered to patients with some macular diseases . stem cell transplantation to reconstruct and regenerate the macula requires further biomolecular and animal research studies .

You are an expert at summarizing long articles. Proceed to summarize the following text: benign prostatic hyperplasia ( bph ) is one of the most frequently occurring urologic diseases in men older than 50 . the bladder outlet obstruction causes a variety of urinary symptoms including nocturia , incomplete voiding , urgency , and hesitancy and comes to the fore as a significant health problem interrupting the quality of life of men over middle age . the prevalence rate of bph increases with age ; bph occurs in 40% to 70% of men aged 60 to 70 years . the current korean population is aging very rapidly compared with other countries ; with this , interest in health after middle age is increasing throughout society . however , owing to a lack of recognition about bph , the time until visiting the hospital is often delayed , and this tendency is truer in rural areas than in urban areas . in this situation , it is necessary to understand the prevalence rate of bph , but few systematic epidemiologic investigations have been carried out about bph in korea . also , there are limitations in the epidemiologic research conducted so far because the previous data were not collected by use of standardized diagnostic criteria or a specific clinical definition . therefore , in this study , the prevalence rate of bph was estimated among males living in the rural korean area of yangpyeong country . this study was conducted to investigate the prevalence rate of bph and its related factors on the basis of an epidemiologic investigation among males in one rural community in korea . the department of preventive medicine and the department of urology in hanyang university guri hospital planned the cohort research by targeting yangpyeong county . the participants of this study were males aged 40 and above in yangpyeong county , gyeonggi - do . the participants were recruited over august to september 2009 , august 2010 , and august 2011 . trained investigators collected the international prostate symptom score ( ipss ) , individual medical history , and demographic information for each participant . we excluded those already diagnosed with bph who were receiving treatment and taking health food supplements . prostate disease was assessed by measuring serum prostate - specific antigen ( psa ) , a doctor 's medical examination by interview , a digital rectal examination , and prostate volume by transrectal ultrasound ( sa6000ii , medison inc . , seoul , korea ) . a total of 799 males responded to all of the survey questions and underwent examinations . among them , 668 subjects remained for study after the exclusion of 1 person who did not consent to participate in the study , 1 person who had a prostate cancer history , and 109 subjects who were missing the digital rectal examination , transrectal ultrasonography , or other epidemiologic inf ormation . among these subjects , data were analyzed from the 599 subjects finally participating in this study after the exclusion of subjects in whom a nodule was perceived or who had a serum psa score of 4.0 or higher and thus who might have prostate cancer ( fig . 1 ) the severity of luts was evaluated by the ipss and quality of life and the participants were divided into four groups by age ( 40 - 49 , 50 - 59 , 60 - 69 , and 70 years and above ) . this study was approved by the institutional review board ( irb ) of hanyang university college of medicine . the irb numbers were hyuh irb 2010-r-38 and 2011 - 07 - 005 . in this study , bph was defined as a score of 8 or higher on the ipss and a prostate volume of 25 ml or above by transrectal ultrasonography , according to the criteria of the fourth edition of the textbook of urology published by the korean urological association . the prevalence rate of bph was compared by classifying the groups by age : 40 - 49 , 50 - 59 , 60 - 69 , and 70 years and above . in addition , the prevalence rate of each luts was checked by classifying the total ipss in each group into a mild symptom group ( score of 1 - 7 ) , a moderate symptom group ( score of 8 - 19 ) , and a severe symptom group ( score of 20 - 35 ) . additionally , the analysis was conducted on the correlations between the epidemiologic factors ( age , marital status , education level , smoking status , alcohol consumption status , regular exercise , body mass index [ bmi ] ) , comorbidities ( hypertension , diabetes ) , and serum psa and bph . , cary , nc , usa ) was used for the statistical analysis ; we also used the chisquare test , independent t - test , analysis of variance , and logistic regression analysis . the results of the statistical analysis were considered to be significant when the p - value was less than 0.05 . this study was conducted to investigate the prevalence rate of bph and its related factors on the basis of an epidemiologic investigation among males in one rural community in korea . the department of preventive medicine and the department of urology in hanyang university guri hospital planned the cohort research by targeting yangpyeong county . the participants of this study were males aged 40 and above in yangpyeong county , gyeonggi - do . the participants were recruited over august to september 2009 , august 2010 , and august 2011 . trained investigators collected the international prostate symptom score ( ipss ) , individual medical history , and demographic information for each participant . we excluded those already diagnosed with bph who were receiving treatment and taking health food supplements . prostate disease was assessed by measuring serum prostate - specific antigen ( psa ) , a doctor 's medical examination by interview , a digital rectal examination , and prostate volume by transrectal ultrasound ( sa6000ii , medison inc . , seoul , korea ) . a total of 799 males responded to all of the survey questions and underwent examinations . among them , 668 subjects remained for study after the exclusion of 1 person who did not consent to participate in the study , 1 person who had a prostate cancer history , and 109 subjects who were missing the digital rectal examination , transrectal ultrasonography , or other epidemiologic inf ormation . among these subjects , data were analyzed from the 599 subjects finally participating in this study after the exclusion of subjects in whom a nodule was perceived or who had a serum psa score of 4.0 or higher and thus who might have prostate cancer ( fig . 1 ) the severity of luts was evaluated by the ipss and quality of life and the participants were divided into four groups by age ( 40 - 49 , 50 - 59 , 60 - 69 , and 70 years and above ) . this study was approved by the institutional review board ( irb ) of hanyang university college of medicine . in this study , bph was defined as a score of 8 or higher on the ipss and a prostate volume of 25 ml or above by transrectal ultrasonography , according to the criteria of the fourth edition of the textbook of urology published by the korean urological association . the prevalence rate of bph was compared by classifying the groups by age : 40 - 49 , 50 - 59 , 60 - 69 , and 70 years and above . in addition , the prevalence rate of each luts was checked by classifying the total ipss in each group into a mild symptom group ( score of 1 - 7 ) , a moderate symptom group ( score of 8 - 19 ) , and a severe symptom group ( score of 20 - 35 ) . additionally , the analysis was conducted on the correlations between the epidemiologic factors ( age , marital status , education level , smoking status , alcohol consumption status , regular exercise , body mass index [ bmi ] ) , comorbidities ( hypertension , diabetes ) , and serum psa and bph . , cary , nc , usa ) was used for the statistical analysis ; we also used the chisquare test , independent t - test , analysis of variance , and logistic regression analysis . the results of the statistical analysis were considered to be significant when the p - value was less than 0.05 . there were 45 subjects ( 7.5% ) in the aged 40 - 49 years group , 165 subjects ( 27.5% ) in the aged 50 - 59 years group , 200 subjects ( 33.4% ) in the aged 60 - 69 years group , and 189 subjects ( 31.5% ) in the aged 70 years and above group . the prostate volume of the entire group of participants was 30.2510.14 g , and the average psa level was 1.200.79 ng / ml . the ipss and the quality of life score were 5.966.72 and 2.701.04 , respectively . in the age groups , the ipss was 2.223.76 in men aged 40 - 49 years , 3.505.06 in those aged 50 - 59 , 6.756.94 in those aged 60 - 69 , and 8.167.28 in men aged 70 or more . these changes with age were statistically significant ( p<0.001 ) . also , prostate volume was 25.365.22 g in men aged 40 - 49 years , 30.299.12 g in men aged 50 - 59 years , 30.549.7 g in men aged 60 - 69 years , and 31.0711.91 g in men aged 70 years and above , and these age - related increases were statistically significant ( p=0.008 ) . a total of 120 subjects ( 20.0% ) in the entire group of participants met the standard of bph as defined in this study . when we examined the prevalence rate according to age , we found that the prevalence rate increased with age . there were 2 subjects ( 4.4% ) with bph in the and aged 40 - 49 years group , 18 subjects ( 10.9% ) in the aged 50 - 59 years group , 44 subjects ( 22% ) in the aged 60 - 69 years group , and 56 subjects ( 26.6% ) in the aged 70 years and above group , and this increase with age was statistically significant ( p<0.001 ) ( table 1 ) . a total of 120 participants ( 20% ) met the definition of bph in this study . the average age of the bph group was 68.238.52 years , the average ipss was 14.675.95 , the average prostate volume was 37.0411.71 g , and the average psa level was 1.560.88 ng / ml ( table 2 ) . in the subscores of the ipss , the score for weak urinary stream was highest ( 3.372.08 ) ; the scores for incomplete emptying ( 2.432.18 ) , hesitancy ( 2.192.15 ) , and nocturia ( 2.051.31 ) were also high . in the survey questions about quality of life , the overall inconvenience of the patients due to their current urinary symptoms was used for the score ; the scores were divided from 0 as very satisfied to 6 as very dissatisfied . the quality of life score was significantly higher in the bph group ( 3.480.93 ) than in the non - bph group ( 2.500.91 ) . in this study , we conducted a correlation analysis to determine whether epidemiologic factors ( marital status , education level , smoking status , alcohol consumption status , bmi , and regular exercise ) and comorbidities ( hypertension and diabetes ) influenced the risk of bph . the non - bph group had a higher proportion of smokers than did the bph group ( table 3 ) . the reason the epidemiologic factors including lifestyle did not show a significant correlation may be that this study was based on a cross - sectional design that did not clearly show a sequential relationship by time . in the case of the bph group , the patients ' uncomfortable urinary status could have already influenced changes in health behavior . there were 45 subjects ( 7.5% ) in the aged 40 - 49 years group , 165 subjects ( 27.5% ) in the aged 50 - 59 years group , 200 subjects ( 33.4% ) in the aged 60 - 69 years group , and 189 subjects ( 31.5% ) in the aged 70 years and above group . the prostate volume of the entire group of participants was 30.2510.14 g , and the average psa level was 1.200.79 ng / ml . the ipss and the quality of life score were 5.966.72 and 2.701.04 , respectively . in the age groups , the ipss was 2.223.76 in men aged 40 - 49 years , 3.505.06 in those aged 50 - 59 , 6.756.94 in those aged 60 - 69 , and 8.167.28 in men aged 70 or more . these changes with age were statistically significant ( p<0.001 ) . also , prostate volume was 25.365.22 g in men aged 40 - 49 years , 30.299.12 g in men aged 50 - 59 years , 30.549.7 g in men aged 60 - 69 years , and 31.0711.91 g in men aged 70 years and above , and these age - related increases were statistically significant ( p=0.008 ) . a total of 120 subjects ( 20.0% ) in the entire group of participants met the standard of bph as defined in this study . when we examined the prevalence rate according to age , we found that the prevalence rate increased with age . there were 2 subjects ( 4.4% ) with bph in the and aged 40 - 49 years group , 18 subjects ( 10.9% ) in the aged 50 - 59 years group , 44 subjects ( 22% ) in the aged 60 - 69 years group , and 56 subjects ( 26.6% ) in the aged 70 years and above group , and this increase with age was statistically significant ( p<0.001 ) ( table 1 ) . a total of 120 participants ( 20% ) met the definition of bph in this study . the average age of the bph group was 68.238.52 years , the average ipss was 14.675.95 , the average prostate volume was 37.0411.71 g , and the average psa level was 1.560.88 ng / ml ( table 2 ) . in the subscores of the ipss , the score for weak urinary stream was highest ( 3.372.08 ) ; the scores for incomplete emptying ( 2.432.18 ) , hesitancy ( 2.192.15 ) , and nocturia ( 2.051.31 ) were also high . in the survey questions about quality of life , the overall inconvenience of the patients due to their current urinary symptoms was used for the score ; the scores were divided from 0 as very satisfied to 6 as very dissatisfied . the quality of life score was significantly higher in the bph group ( 3.480.93 ) than in the non - bph group ( 2.500.91 ) . in this study , we conducted a correlation analysis to determine whether epidemiologic factors ( marital status , education level , smoking status , alcohol consumption status , bmi , and regular exercise ) and comorbidities ( hypertension and diabetes ) influenced the risk of bph . the non - bph group had a higher proportion of smokers than did the bph group ( table 3 ) . the reason the epidemiologic factors including lifestyle did not show a significant correlation may be that this study was based on a cross - sectional design that did not clearly show a sequential relationship by time . in the case of the bph group , bph generally occurs in males in their 50s ; 80% of males in their 70s suffer from the luts related to bph . because in current korean society the population is aging , the older population is rapidly increasing . additionally , the incidence of metabolic syndrome , which is a risk factor for bph , and the number of patients with obesity are also annually increasing owing to westernized eating habits . bph and luts could lead to social problems caused by the increase in annual medical expenses related to serious complications such as falls , depression , and reduced quality of life , particularly in the elderly . in this situation , it is necessary to conduct systematic epidemiologic investigations of the prevalence rate of bph in korea . to investigate the prevalence rate of bph , it is f irst necessary to clarify the diagnostic criteria of bph . although methods exists for the diagnosis of bph , including taking the patient 's medical history and recording urinary symptoms , prostate volume measurement by digital rectal examination and transrectal ultrasonography , peak urinary flow rate ( qmax ) , and residual urine measurement , accurate diagnostic criteria have not been established . currently , bph is mainly defined clinically on the basis of the ipss , prostate volume , and qmax . garraway et al . defined bph as urinary symptoms , prostate volume of 20 ml or more as measured by transrectal ultrasonography , and qmax of 15 ml / s or less . in their study , they reported that the prevalence rate of bph was 14% in males in their 40s and 40% in males in their 70s . bosch et al . defined bph as a prostate volume of 30 ml or more and ipss of 8 points or higher and reported a bph prevalence rate of 19% . in a study targeting males aged 40 years and older in spain . in studies defining bph in korea , rhew et al . defined bph as an ipss of 8 points or higher and a qmax of 10 ml / s or less . defined it as an ipss of 8 points or higher , prostate volume by digital rectal examination of 30 ml or more , and qmax of 15 ml / s or less . in studies investigating the prevalence rate in seongnam city and jeju island , bph was defined as an ipss of 8 points or higher and prostate volume measured by transrectal ultrasonography of 30 ml or more . in this study , bph diagnosis was based on the symptom score and the prostate volume , and urof lowmetry examination was excluded . reported that the bph prevalence rate defined by two variables including symptom score and prostate volume and the bph prevalence rate defined by three variables including symptom score , prostate volume , and qmax were 12% and 10% , respectively , and that there was no statistically significant difference between the two rates . second , it was thought that there could be many errors when determining bph based on 10 ml / s or less or 15 ml / s or less in epidemiologic examinations because uroflowmetry can vary depending on the amount of urination . measured prostate volume through transrectal ultrasonography by targeting 175 males whose ages were between 27 and 70 years ; the average prostate volume of adenoma prostate was significantly higher than that of nonadenoma prostate : 28.0 ml ( range , 14.5 - 62.1 ml ) vs. 23.0 ml ( range , 11.3 - 39.1 ml ) . therefore , those authors proposed criteria for bph as an ipss of 8 points or higher and a prostate volume by transrectal ultrasonography of 25 ml or more . the bph prevalence rate was 20% ( 120/599 subjects ) in the present study and lower than the rate in other reports in korea . the reason for this could be that 210 of 599 males ( 35% ) were in their 40s to 50s and were thus relatively younger than the groups in the other studies in korea . bph prevalence rates reported in korea were 40% in the urban area of seongnam and 25.5% in busan . in addition , the prevalence rates were 23.2% in the rural area of yeoncheon , gyeonggi - do , and 27.7% in the inland area of chungcheongbuk - do . first , there were variables in the epidemiologic investigation , such as the selection of the target group and regional differences in the population . the prevalence rate in seongnam was much higher than in other regions because the study was an epidemiologic investigation targeting the elderly population ( 65 years old and above ) . although lee et al . conducted an epidemiologic investigation for the first time in yeoncheon area in 1995 , they only conducted a survey of the ipss and then estimated the prevalence rate of bph . reported that the bph prevalence rate as assessed by luts , digital rectal examination , and uroflowmetry examination was 11% ; here , the question about the accuracy of measuring prostate size could be raised because the prostate volume was measured by digital rectal examination . in this study , the survey and the epidemiologic investigation were performed by interviewers who were sufficiently trained ; unlike other authors ' measurement of the prostate volume by digital rectal examination , it could be thought that the reliability would be high because the prostate volume was accurately measured by transrectal ultrasonography . epidemiologic research on bph has greatly evolved over the past several years , and many epidemiologic data have been accumulated . even though age and genetics play an important role as causes of bph , it is notable that lifestyle factors such as metabolic syndrome or cardiovascular disease , which can be corrected , have a considerable impact on the natural progression of bph . one cohort study showed that luts prevalence increased by 80% in the group diagnosed with at least three components of the metabolic syndrome compared with the group without diagnosed components of the metabolic syndrome . additionally , other studies have shown that the risk of bph and luts is significantly increased in people with heart disease . in other previous studies , a correlation was observed in which the more the amount of fat increased , the more the prostate volume increased . in several research studies , weight , bmi , and waistline all showed a significant correlation with prostate volume . in this study , there was no significant difference in bmi between the bph group and the non - bph group . the reason for this may be that the cross - sectional design of this study did not clearly show the sequential relationship of time . the study criteria were also vague because there are few studies related to bmi and prostate volume in asia , including korea . in the longitudinal study of aging cohort in baltimore , maryland ( usa ) , each 1-kg / m increase in bmi corresponded to a 0.41-ml prostate volume increase . compared with nonobese participants ( bmi<25 kg / m ) , the obese participants ( bmi35 kg / m ) showed a 3.5-time higher bph risk . in addition , whereas some studies reported that there was a reverse protective effect of smoking on bph and luts , other studies reported that the risk level increased or showed no change . therefore , it is necessary to conduct more studies on the correlation between smoking and bph . first , the subjects were not a random sample of the population because we recruited subjects through a prostate health screening campaign . second , we did not consider the difference in the population distribution by age in yangpyeong county and the study group . third , although prevalence was the number of cases of the condition at a particular point in time , the participants of this study were recruited over 3 years ( august - september 2009 , august 2010 , and august 2011 ) in an effort to collect more participants . consequently , the results of this epidemiologic research investigating the bph prevalence rate in a rural korean area showed a lower value than in other countries . one reason for this may be that the ratio of relatively younger males in their 40s to 50s was somewhat higher in this epidemiologic investigation than in other studies . second , there may have been an influence of diet , with a focus on vegetables in the rural area compared with the westernized diet of high meat consumption in urban areas . although our study did not survey the eating habits of the individuals , in a study performed to evaluate food intake of the elderly residing in different regions of korea , the intake of meats was significantly higher in urban elderly than in rural elderly . third , the different diagnostic criteria of bph applied in each study could be a cause of the differences in prevalence rates . in this study , the prevalence rate of bph was estimated by targeting males aged 40 years and older in a rural korean area . the results showed that the prevalence rate of bph in males aged 40 years and older in yangpyeong county was 20.0% . when classifying the men according to age , none of the epidemiologic factors studied including lifestyle showed a statistically significant correlation with bph , except for smoking . this study showed a lower prevalence rate of bph in a rural area than reported in other studies in korea . unlike other studies conducted in rural areas , however , the reliability of this study can be considered to be high because prostate volume was measured by use of a more objective method .

purposewe investigated the prevalence rate of benign prostatic hyperplasia ( bph ) among korean males in a rural area through a cross - sectional , community - based epidemiologic survey and analyzed the correlation with epidemiologic factors.materials and methodsa total of 779 males who lived in yangpyeong county participated in a prostate examination campaign . targeting these men , we collected the international prostate symptom score ( ipss ) , medical history , demographic information , serum prostate - specific antigen , and prostate volume as measured by transrectal ultrasonography . the data for 599 participants were analyzed , excluding 180 men who had a possibility of prostate cancer . bph was defined as an ipss of 8 points or higher and a prostate volume of 25 ml or more.resultsthe prevalence rate of bph was 20.0% . the prevalence rate increased with age . there were 2 subjects ( 4.4% ) in the age group of 40 - 49 years , 18 subjects ( 10.9% ) in the age group of 50 - 59 years , 44 subjects ( 22% ) in the age group of 60 - 69 years , and 56 subjects ( 26.6% ) in the age group of over 70 years ; this increase with age was statistically significant ( p<0.001 ) . in the bph group , the average ipss was 14.675.95 , the average prostate volume was 37.0411.71 g , and the average prostate - specific antigen value was 1.560.88 ng / ml . in the analysis of correlations between the epidemiologic factors and the risk of bph , smoking was the only statistically significant factor.conclusionsthe total prevalence rate of bph in this study was 20.0% , which was a little lower than the rate reported in other cities or rural areas .

You are an expert at summarizing long articles. Proceed to summarize the following text: it is the body 's immediate and carefully orchestrated response to pathogens , noxious stimuli , or physical injury . in addition , responsiveness to plasma- and cell - derived inflammatory mediators reflects a more general role for inflammation in restoring functionality of the system to basal homeostatic set points . the process , by which acute inflammation is initiated and develops via molecular and cellular pathways , is well defined . in case the body does not succeed in eliminating or neutralizing this condition over time , a chronic inflammatory state arises and resets the body 's reference points and will become maladaptive . this implicates elevated concentrations of cytokines and chemokines including interleukin- ( il- ) 1 , il-1 , il-6 , il-8 , il-10 , il-18 , tnf- , and alarmins such as high - mobility group box 1 ( hmgb1 ) . these molecules have also been proven to be involved in the progression of chronic inflammatory disorders , infections , and fibrotic diseases as well as cancer , autoimmune , and ageing - associated disorders . it is demonstrated that il-1 and il-18 driven inflammation , through inflammasome activation , is initiated by recognition of endogenous or exogenous danger signals . il-1 , one of the main classic instigators of inflammation is , together with il-18 , released from the cell upon activation of the inflammasome . it has the ability to affect various biological properties and has several roles in the proinflammatory response , including activation of the endothelium and leukocytes . back in 1984 it was predicted that il-1 was responsible for many of the acute responses to infection and inflammation . il-18 , a member of the il-1 cytokine super family , is recognized as an important regulator of innate and acquired immune responses . its importance is derived from its prominent biological property of inducing interferon ( ifn ) . il-18 is expressed at sites of chronic inflammation , in autoimmune diseases , in a variety of cancers , and in the context of numerous infectious diseases . in addition to il1 and il18 , basic fibroblast growth factor ( bfgf ) and hmgb1 are unconventionally released under caspase-1 activated conditions following a number of posttranslational modifications . therefore , we included bfgf as well as hmgb1 to be reviewed among the factors that could possibly be released from the epithelial cells upon inflammasome activation . for hmgb1 , its earliest functions were described as a nonhistone dna - binding nuclear protein . it forms highly inflammatory complexes with single stranded ( ss ) dna , lipopolysaccharide ( lps ) , il-1 , and nucleosomes and interacts with toll - like receptor ( tlr ) 9 , tlr4 , il-1r , and tlr2 and the receptor for advanced glycation end - products ( rage ) . it has also been reported that hmgb1 can signal via the well - characterized nuclear factor-b pathway to induce a release of proinflammatory cytokines , including tnf- and il-1. bfgf , a mitogenic agent , is not directly proinflammatory but can potentiate the recruitment of immune cells to the site of inflammation . this growth factor supports the maintenance of undifferentiated cells and is involved in tissue repair , regeneration , and proliferation . it is a potent fibrogenic mediator that can be induced by a variety of molecules in different cell types such as by silica in lung epithelial cells [ 5 , 6 ] from which it is released in an inflammasome - dependent mode - of - action and potentially linked to fibroblast proliferation . activation of inflammasome - dependent mediator release is typically a very potent reaction and by virtue of the potentially destructive proinflammatory effects of uncontrolled cytokine and alarmin release their reduction and shutdown mechanisms ( e.g. , il-1 receptor antagonist ( il-1ra ) signaling ) should therefore be tightly regulated by innate sensors . to date , a number of cytosolic receptors are successful in the recognition of conserved molecular patterns termed pathogen- or danger - associated molecular patterns ( pamps or damps ) , by initiating the formation of an inflammasome . these include the nucleotide - binding oligomerization domain receptors , in short nod - like receptor ( nlr ) protein family members nlrp1 , nlrp3 , nlrp6 , nlrp7 , nlrp12 , nlrc4 , and nlrc5 as well as the non - nlr pyrin and hin200 domain - containing ( pyhin ) protein family members absent in melanoma 2 ( aim2 ) , myeloid nuclear differentiation antigen ( mnda ) , interferon inducible protein x ( ifix ) , and interferon alpha - inducible protein 16 ( ifi16 ) which are all able to oligomerize into a functional inflammasome [ 911 ] . this implies the formation of a multiprotein complex consisting otherwise also of an adaptor protein , apoptosis - like speck protein containing a card ( asc ) , and il-1 converting enzyme ( ice , caspase-1 ) , the enzyme responsible for maturation of proinflammatory cytokines . upon this assembly , caspase-1 undergoes autocatalytic activation into heterotetramers , which further enables the cleavage of its substrates pro - il-1 and pro - il-18 into mature il-1 and il-18 , and the unconventional release of bfgf and alarmins by the cell as is illustrated in figure 1 . in addition , caspase-1 is associated with the release of il-1 , although these mechanisms are poorly understood . moreover , their release may be accompanied by pyroptosis , an incompletely characterized proinflammatory mode of cell death . upon activation by a myriad of signaling pathways these inflammasome - dependent mediators are strongly expressed by monocytes , tissue macrophages , and dendritic cells but are also produced by b lymphocytes , natural killer ( nk ) cells , and epithelial cells . activated inflammasomes and subsequently activated and released cytokines and alarmins play a key and well - controlled role in innate immunity of the lung mucosa and interstitial microenvironment . as mediators of the acute phase of inflammation they are extremely important for the immune system to react to invading pathogens . it is however equally important that inflammasomes distinguish pathogenic from nonpathogenic commensals , implying that a disturbance in normal danger signaling through the inflammasome can act as a master switch between tolerance and sensitization in many actively participating tissues [ 1519 ] . the activation of inflammasomes in myeloid innate immune cells as well as their contribution to acute and chronic inflammatory diseases has been characterized profoundly over the past 12 years by in vivo and in vitro research . nevertheless , we are still far away from understanding how these molecules actually become activated , how they exert their function , and how they can be targeted in therapy . aside from the specialized cells of the immune system that evolutionary developed to protect organ systems , most foreign pathogens and noxious stimuli are also encountered by epithelial cells in a barrier lining the organs that are in most proximal contact with the exterior environment . these are the tissue specific mucosae of the skin , the lung , the gut , and the urogenital tract , as well as nonkeratinizing squamous epithelial cells of the oral mucosa . the epithelium is more and more appreciated to be less passive than what was assumed before and evidence is mounting that it participates not only in receiving and relaying inflammatory signals , but in functions as an initial sensor of danger and executor of the response as well . we therefore review here the literature on the presence and functionality of inflammasomes in epithelial cells of the various organs exposed to the exterior milieu in response to reported insults . the aim of this review is to deliver better understanding of inflammatory responses of first - line barrier epithelium in multiple organs and mucosal immunity and encourage further laboratory research to dissect out the role of epithelial inflammasomes to these processes , with more effective therapies for the numerous debilitating diseases with an acute and chronic inflammatory component as the ultimate goal . in addition to its properties as a physical barrier , the skin has many active defense mechanisms . keratinocytes can detect microbial or nonmicrobial danger signals and elicit an immune response prior to the infiltration of myeloid cells . although the action and importance of il-1 , il-18 , and hmgb1 in inflammatory skin disorders are not completely understood , dysregulation of these inflammasome - dependent molecules is an attractive concept that might play a role in many inflammatory abnormalities of the skin . in 1990 already , protein levels of immunoreactive il-1 were shown to be elevated in psoriatic lesions whereas the amount released by normal keratomes or cultured keratinocytes was undetectable . the presence of il-1 was suggested to be due to a novel mechanism of posttranslational processing in the epidermis . this mechanism was identified in 1997 as caspase-1 dependent cleavage which could be induced in human keratinocytes in response to inflammatory and immunologic stimuli . later , keratinocytes of the nondiseased skin were scarcely stained positive for nlrp1 and nlrp3 and aim2-like receptor ( alr ) inflammasomes . these expression patterns suggest that multiple inflammasomes are likely to play a role in the first line of defense against noxious molecules . with respect to different functional inflammasomes in the skin , human keratinocytes express aim2 and respond to poly(da : dt ) dsdna with il-1 secretion . recently , these findings have been supported by detection of active il-1 and cleaved caspase-1 in human papillomavirus ( hpv ) infected skin , suggesting inflammasome activation by viral dna . watanabe et al . also demonstrated that the nlrp3 inflammasome is present and can be activated in keratinocytes as in animal models of contact hypersensitivity this inflammasome was identified as a key regulator of innate immunity . keratinocytes are obviously also barrier cells against environmental pollutants such as tio2 and sio2 . it was shown that these environmental particles in the nanosize could induce cleavage of caspase-1 and secretion of il-1 . caspase-1 activity of stratum corneum and serum il-18 level were also increased in patients with netherton syndrome , a disease characterized by chronic skin inflammation . in a tetanus toxoid - dependent experimental model using cocultures of monocytes and keratinocytes , others furthermore observed high levels of il-1 when tetanus toxoid and keratinocytes were present , indicating that skin epithelial cells are able to secrete caspase-1 and a source for il-1 ( figure 2 ) . in skin injury models relevant to the development of cancer , irradiation with a physiological dose of uvb induced secretion of pro - il-1 and of mature and active il-1 and il-18 in a caspase-1 dependent fashion [ 31 , 32 ] . other studies of uvb overexposure in sunburned skin demonstrated activated inflammasomes and uv light exposure stimulated bfgf and hmgb1 release by keratinocytes as well [ 34 , 35 ] . in an allergic skin disease model , mite allergen dermatophagoides pteronyssinus 1 ( der p1 , a major allergen of house dust mite ) , is recognized as a danger signal , activated caspase-1 , and induced release of il-1 and il-18 from keratinocytes which was dependent on the cysteine protease activity . moreover , der p1 stimulated assembly of the inflammasome by recruiting asc , caspase-1 , and nlrp3 to the perinuclear region . the data reviewed in this section demonstrate that keratinocytes are a potent source of cytokines and alarmins upon contact with a broad spectrum of activators . it is clear that keratinocytes do not only have a passive role as target cells in the process of inflammation but also act as stimulators of the initiation and maintenance of local immune reactions . the oral mucosa is exposed to high density and diversity of potential microbial pathogens such as gram - positive and gram - negative bacteria as well as fungi and others and therefore has the important function of acting as a physical barrier and responding to microbial growth and invasion . the inflammasomes , as intracellular immune receptors , are thus likely to be important mediators of the inflammatory response in gingival epithelial cells . in a recent study depletion of nlrp3 by sirna abrogated the ability of atp to induce il-1 secretion in infected cells . atp is sensed by purinergic receptors such as p2x , ligand - gated ion channel 4 ( p2x4 ) . besides numerous reports on the role of p2x7 receptors in atp - mediated inflammasome activation and mature il-1 production in macrophages in vitro , recently in gingival epithelial cells that were stimulated with extracellular atp , a role for p2x7 dependent - ros production in the activation of the inflammasome was revealed ( figure 2 ) . interestingly , in addition to the nlrp3 inflammasome , a different inflammasome containing nlrc4 appeared to function in the protection against infection with candida albicans in the mucosal lining of the mouth and intestines rather than in immune cells . no further evidence can be found on how immune homeostasis via inflammasome signaling is maintained in this environment . these studies reveal the epithelial - specific roles of the nlrp3 and nlrc4 inflammasome in innate immune response of the oral mucosa . in organs where a variety of cell types come in intimate contact with commensals and potentially pathogenic microbes , such as the gut , the regulation and maintenance of normal intestinal mucosal barrier function is primordial for the host 's survival and fitness . when cellular integrity and functioning of tight junctions between adjacent epithelial cells is disrupted barrier impairment is easily provided resulting in inflammation and the induction of tissue - repair responses . the lack of control of this inflammatory condition is suggested to aggravate in the direction of detrimental chronic inflammation in the gut . inflammasome - dependent mediators such as il-1 , il-18 , and hmgb1 have been identified as potent promoters of intestinal pathology , which suggests that targeting these mediators may represent a useful therapeutic approach in inflammatory bowel disease ( ibd ) . initially , observations suggested that induction of il-1 mrna in enterocytes was causally related to the subsequent inflammatory changes seen in a model of acute experimental colitis . it was proposed that colon epithelial cells were programmed to provide a set of signals for the activation of the mucosal inflammatory response in the earliest phases after microbial invasion [ 42 , 43 ] . later , a few studies demonstrated that intestinal epithelial cells ( iec ) , continuously exposed to dietary molecules , microbial antigens , and environmental influences , played a much more active role in the host immune and inflammatory response via the secretion of a variety of cytokines limited to not only il-1 , but also il-1 and il-8 [ 4446 ] . that same year , for the first time , mouse iecs were proven to be the main producers of il-18 , formerly called interferon - gamma - inducing factor under normal physiological conditions , suggesting that its constitutive expression in iecs may have an important role in the induction of mucosal immunity . two years later , il-18 was demonstrated to be localized and increasingly expressed in intestinal mucosal cells of patients with crohn 's disease ( cd ) [ 49 , 50 ] . within this same period , posttranslational activation of il-18 by caspase-1 cleavage was identified to occur in response to viral and bacterial infections [ 51 , 52 ] . specifically , a year before inflammasomes were characterized , cleavage of il-18 in porcine intestinal mucosa by salmonella choleraesuis was demonstrated , indicating that caspase-1 activation of il-18 may be a key step in mucosal immune response to bacterial invasion . expression of il-18 in human gastric mucosal epithelial cells was also increased by helicobacter pylori infection or by lactoferrin [ 54 , 55 ] . recently , human iecs showed the ability to release il-18 upon salmonella treatment in a caspase-1 dependent fashion and release hmgb1 in their culture medium upon stimulation with lps and a mixture of tnf- , il-1 , and ifn- . microbial activity is required to be constantly monitored in the epithelial lining of the gut . it has become evident that a range of inflammasome family members within different cell types ( e.g. , epithelial and hematopoietic cells ) accomplish different , but often complementary , functions , as watchful guardians eliciting mucosal immune responses when activated . the most intensively studied inflammasomes in the gut , the nlrp1 , nlrp3 , nlrp6 , and nlrc4 inflammasomes , have been shown to regulate a number of common intestinal mucosal infections . for instance , nlrp3 and nlrc4 activation in the intestinal epithelium is essential for regulation of permeability and epithelial regeneration through sensing of commensal microbes and has been shown to protect against mucosal pathogens [ 60 , 61 ] ; however , excessive inflammasome activation within the lamina propria contributes to severe intestinal inflammation . moreover , whereas the nlrp6 inflammasome subtype regulated colonic microbial ecology and risk for colitis , it was also shown to be involved in control of epithelial self - renewal and colorectal carcinogenesis upon injury . otherwise , nlrp6 inflammasome - deficient mice have been shown to be unable to clear enteric pathogens from the mucosal surface , rendering them highly susceptible to persistent infection . additionally , recent findings suggest that both hematopoietic- and nonhematopoietic - derived nlrp12 contributed to inflammation in an experimental colitis model , but the latter dominantly contributed to tumorigenesis . herein , nlrp12 was profiled as an important add - on in the inflammasome repertoire and new player in colonic inflammation and tumorigenesis . together , these studies reveal intensive and integrated signaling from multiple inflammasomes to regulate inflammation - induced ibd and colon cancer . in addition , unpublished data report the upregulation of most inflammasome sensor subtypes ( nlrp1 , nlrp3 , nlrp12 , nlrc4 , aim2 , ifi16 , mnda , and pyhin1 ) in the colonic mucosa of active ibd patients , with the double - stranded ( ds ) dna responding pyhin inflammasome subtypes ( aim2 and ifi16 ) showing the strongest increase . these data are accompanied with enhanced levels of il-1 in primary iecs in culture following dsdna exposure . immunohistochemical data show , next to inflammatory cells , an epithelial presence of these inflammasome sensor subunits and some of their effector molecules ( casp1 and hmgb1 ) ( unpublished data ) . together , this indicates that a more profound focus on non - nlr signaling may be justified in ibd . the multiple activators of a broad spectrum of inflammasome subtypes implying caspase-1 activation and subsequent secretion of specific readouts in iecs are summarized in figure 3 . activation of intestinal inflammasomes in different lineages of cells regulates physiological reactions , and their hyperactivation or absence can lead to deleterious consequences such as inflammation or cancer progression as shown in different models . for instance , following tissue damage using the iec cytotoxic agent dextran sodium sulphate ( dss ) , the nlrp3 inflammasome assembles , leading to the production of il-18 , which is then released at the mucosal sites . defective nlrp3 inflammasome subtype activation was shown to protect against loss of epithelial integrity and mortality during dss - induced experimental colitis , suggesting that genetic and environmental factors may activate the nlrp3 inflammasome . in addition , their absence rather than their overproduction could be considered deleterious , indicating a multifaceted regulatory role of nlrp3 in intestinal inflammation . , on the other hand , demonstrated that nlrp6-deficient mice were highly susceptible to experimental colitis . further , it was shown in humans with a leaky intestinal barrier ( such as seen in ibd patients ) that tio2 microparticles were taken up by iec and could activate the inflammasome and induce il-1 and il-18 secretion in the mucosa of crohn 's disease patients , representing a possible mode of aggravation of inflammation in susceptible individuals . others have shown that 2,4,6-trinitrobenzene sulfonic acid ( tnbsa ) was unable to induce significant colitis in il-18 deficient mice and that administration of an il-18 neutralizing antibody resulted in a dramatic attenuation of mucosal inflammation . the proposed function for the nlr and non - nlr inflammasomes is to regulate secretion of il-18 that stimulates epithelial cell barrier function and regeneration , whereas , in hematopoietic cells , inflammasome activation would have a proinflammatory effect [ 63 , 71 ] . this suggests that signals produced by the iecs may play an important role in inducing the early host inflammatory response to infection and raises the possibility that interventions that directly target production of inflammatory cytokines by iecs might alter the course of disease . when comparing results of studies by different groups , one should take into consideration that many of the observed effects may be explained by defective inflammasome regulation of the composition of the microflora coupled with differences in native microflora in different facilities . targeting mediator release that is associated with mucosal inflammasome activation in the gut could lead to better understanding of which pathological aspects of inflammation and subsequent increases in permeability contribute to the development of ibd . barrier epithelia , such as the airway epithelial cells lining the respiratory tract , fulfill multiple functions essential for tissue homeostasis . they are , because of the immense surface area that is in intimate contact with the environment , a primary target of attack by microorganisms and potentially harmful factors during every single breath . a vicious cycle of exaggerated responses to chronic stimuli or aberrant responses to rather innocent agents may result in chronic inflammation with permanent structural changes in barrier properties , including smooth muscle hyperplasia , airway remodeling , and fibrosis . the importance of engagement of pattern recognition receptors ( pprs ) and their activation is demonstrated via experimental studies in knockout mice . these resulted in evidence suggesting a deleterious role for excessive production of the inflammasome - dependent proinflammatory cytokines and danger signals il-1 , il-18 , and hmgb1 and the growth factor bfgf which possess multiple pathogenic properties that could be further enhanced during episodes of disease exacerbations [ 7276 ] . because the localization and the impact of inflammasome sensor activation in airway epithelial cells associated with pulmonary inflammation have yet to be revealed , the activation of different inflammasomes in lung epithelium in response to triggers relevant to the main chronic inflammatory diseases , asthma , copd , pulmonary fibrosis , and pneumoconiosis , mainly in in vitro settings is summarized in this section . historically , with respect to evidence of inflammasome activation or mediator release from lung epithelium one has to go back more than a decade prior to the first characterization of the inflammasome . immunoreactive il-1 was shown to be released from bronchial epithelial cells exposed to toluene diisocyanate or nitrogen dioxide [ 78 , 79 ] and in tracheal biopsy material from individuals exposed to endotoxin - contaminated grain dust . a few years later , in 1996 hastie et al . showed low but significantly higher amounts ( 2-fold ) of il-1 released from bronchial epithelial cells from allergic compared to nonallergic individuals following segmental challenge with ragweed . moreover , in experiments with exposure to another allergen , der p1 , cultured human airway epithelial cells were shown to release il-1 . in 1998 , the il-1 release for the first time was linked to ice expression in alveolar epithelial cells upon respiratory syncytial virus ( rsv ) infection . interestingly this study showed that this occurred in the absence of apoptosis , which could imply that epithelial cell death occurred through what is now known as pyroptosis . different animal models of pulmonary fibrosis have been developed to investigate the pathogenic mechanism and potential therapies for idiopathic pulmonary fibrosis ( ipf ) . the most common is the bleomycin model in rodents ( mouse , rat , and hamster ) . in 2001 , caspase-1 mrna expression was shown to be elevated in mice treated with bleomycin and bronchiolar and alveolar epithelial cells , as well as myeloid cells showing increased caspase-1 immunoreactivity in both nucleus and cytoplasm . a decade later , it was suggested that inflammasome signaling in airway epithelial cells may play an important role in the pathogenesis of diseases like copd , as compounds such as lps and cpg were found to induce the releases of il-1 from human bronchial epithelial cells . next to these environmental triggers , mechanical stretch was shown that same year to induce enhanced il-1 levels in the supernatants of alveolar epithelial cells . in recent years the panel of mediators able to activate the inflammasome - dependent caspase-1 activity and il-1 release from ( primary ) lung epithelial cells has expanded rapidly to include pseudomonas aeruginosa , simvastatin , influenza a [ 19 , 87 , 88 ] , rsv , and rhinovirus . the membrane attack complex of complement , apart from its classical role of lysing cells , can also trigger a range of nonlethal effects on cells , including driving inflammation . recent findings demonstrated that sublytic attack by the membrane attack complex of complement leads to caspase-1 activation as well as il-1 secretion in primary human lung epithelial cells . a panel of inflammasome - dependent mediators was shown to be released by bronchial epithelial cells following crystalline silica exposure and tran et al . demonstrated induction of il-1 and nlrp3 protein by the proinflammatory stimulus lps and the combination of ifn- with lps in primary cell cultures of nhbe cells . hirota and his colleagues characterized airway epithelial nlrp3 inflammasome - mediated immune responses to urban particulate matter exposure and found significant increases in airway epithelial nlrp3 inflammasome - mediated production of il-1 in vitro , results that were corroborated in vivo . for interleukin-18 , a prolific cytokine involved in many immune responses already issued , literature research revealed that its immunoreactivity in airway epithelial cells was first investigated during early stages of host defense within the bronchial epithelium of biopsies obtained from control subjects and patients with sarcoidosis or asthma . later , western blot analysis showed that the 18.3 kda mature form of il-18 appeared in whole cell lysate of mycobacterium tuberculosis - stimulated alveolar type ii cells , whereas both nonstimulated and mycobacterium tuberculosis - stimulated alveolar type ii cells contained abundant 24 kda pro - il-18 . these results indicated that mycobacterium tuberculosis upregulates il-18 expression at both transcriptional and posttranscriptional levels , implying the involvement of caspase-1 enzymatic activity and therefore inflammasome activation . piper et al . furthermore found that il-18 was released from rhinovirus - infected lung epithelia . the release was not associated with cell death but was dependent on caspase-1 catalytic activity . the endogenous danger protein hmgb1 was shown to be released from a549 cells infected with virulent legionella pneumophila in association with caspase-1 activity . hmgb1 levels were furthermore found to be elevated in cell supernatant from rat alveolar type ii cell monolayers that underwent scratch wounding . moreover , mechanical stretch significantly increased hmgb1 protein expression in a549 cells . these results are important in the context of injury , since epithelial crosstalk to neighboring cells is important for normal as well aberrant repair , such as in the case of fibrosis . hmgb1 was included in the panel of inflammasome - dependent mediators that were released following crystalline silica exposure of bronchial epithelial cells . epithelial cells express and secrete not only cytokines and alarmins upon exposure to endogenous or exogenous inflammasome activators but also bfgf . the fgfs are involved in morphogenesis , wound repair , inflammation , angiogenesis , and tumour growth and invasion and require the glycosaminoglycan ( gag ) side chains of heparin sulphate proteoglycans for high affinity binding to their specific receptors . late 20th century , bronchial epithelial cells were shown to secrete bfgf which positively impacted myofibroblast proliferation in an animal model of asthma . a role for epithelial cells in the expression and release of bfgf from heparan sulphate binding sites in bronchial asthma the lung epithelium is a major source of bfgf as shown by rhinovirus - induced bfgf release in a model that mimics features of airway remodeling . we furthermore showed that crystalline silica exposure of bronchial epithelial cells caused bfgf release which was inflammasome- and particle uptake - dependent . a pivotal role of surface reactivity of crystalline silica to inflammasome activation was recently demonstrated in cultures of epithelial cells with evidence of the inhibitory capacity of the antioxidant trx to inflammasome activation . importantly , our studies showed that the panel of silica - induced nlrp3 inflammasome - dependent mediators released from airway epithelium leads to fibroblast proliferation , a characteristic of multiple lung diseases . , in which it is evidenced that multiwalled carbon nanotubes induce a nlrp3 inflammasome - dependent , but tgf- independent , profibrotic response in human bronchial epithelial cells . in contrast , there are publications that demonstrate that lung epithelial cells are not able to secrete il-1 upon exposure to different microorganisms and particulates among others [ 102 , 103 ] . this section however summarizes a vast body of evidence that lung epithelium participates in early first - line immune defenses via activation of the inflammasome . the expression of il-18 , il-1 , and bfgf as well as hmgb1 by these cells demonstrates its participation in the initial response to encounters with foreign molecules . the described mediators may play a prominent role in the cascade of subsequent steps of the immune response in an autocrine and paracrine as well as chemotactic manner . to date , only a subset of inflammasomes has been described in lung epithelial cells so far ( figure 4 ) . nlrp1 was reported to contribute to the immune response in lung epithelial cells and alveolar macrophages . nlrp3 inflammasome presence and activation in lung epithelial cells was demonstrated as well [ 92 , 93 ] . of most caspase-1 activating inflammasomes that have been studied well , nlrp12 is a unique nlr that has been shown to attenuate inflammatory pathways in biochemical assays and mediates the lymph node homing of activated skin dendritic cells in contact hypersensitivity responses . although its expression was shown in lung cells , the overall development of allergic airway disease and airway function was not significantly altered by overall nlrp12 deficiency . this suggests that nlrp12 does not play a vital role in regulating airway inflammation in this model . upon rhinovirus pathogenesis , the contribution of nlrp3 and nlrc5 inflammasomes and il-1 secretion in rhinovirus pathogenesis was investigated and revealed that both inflammasomes act in a cooperative manner during the assembly by sensing intracellular ca fluxes and triggering il-1 secretion in primary human bronchial epithelial cells . additionally , the importance of inflammasome signaling in animal models representing a cadre of lung diseases such as asthma , copd , and acute lung injury as well as fibrosis and pneumoconiosis among others has been shown by many groups [ 106114 ] and was recently reviewed by brusselle et al . . this section evidences that the surface epithelium of the conducting airways can be considered a constitutive primary participant in innate immunity with strong evidence that epithelial dysfunction is involved in the development of inflammatory disorders of the lung and could be a plausible target for therapeutic interventions . often though , as indicated in the preceding paragraph the importance of inflammasome activation in the epithelium in animal models is not primarily approached . therefore conditional knockout models or epithelial - specific transgenic animal studies will be a necessity . with respect to cells lining the urogenital tract , evidence suggests that inflammasomes , next to other pprs , have important roles in associated diseases through regulation of inflammatory and tissue - repair responses to infection and injury . first , on the subject of human kidney diseases such as wegener 's granulomatosis and in experimental models of glomerulonephritis , glomerular as well as tubular epithelial cells have been shown to synthesize and release il-1 , constitutively [ 117119 ] . in a recent study that analyzed the processing of caspase-1 , il-1 , and il-18 after unilateral ureteral obstruction ( uuo ) in mice reflecting chronic kidney disease , it was shown that nlrp3 has a biological function in both hematopoietic and renal epithelial compartments during renal injury . additionally , in models of ischemic tubular necrosis and obstruction - induced epithelial - mesenchymal transition , an important role for caspase-1 and il-18 has been demonstrated under hypoxic conditions and in the absence of vascular effects [ 120122 ] . other cells lining epithelial tracts in contact with the environment conveying inflammasomes are prostate epithelial cells expressing aim2 with increased caspase-1 activity in an experimental model of benign prostate hyperplasia ( bph ) , and human cervical epithelial cells expressing aim2 and ifi16 inflammasomes following chlamydia trachomatis and herpes simplex virus 2 , respectively [ 123125 ] . although the amount of literature on inflammasome activation in these organs is relatively scarce , other studies demonstrate a pivotal role of the presence and activation of various inflammasomes in the epithelium of urogenital organs exposed to the environment [ 126128 ] ( figure 5 ) . they are important guardians for the detection of danger signals and the consecutive initiation of an inflammatory response . as presented in this review , each organ and cell type express different sensor subtypes with discrepancy in the release of various mediators . it should be emphasized that it is very possible that manifold inflammasomes are important in multiple epithelial cell types and become activated to either overcome detrimental signaling or to cooperate in a constructive fashion combating the disease . likewise , with respect to relatively lower concentrations of cytokines released from epithelial cells versus the myeloid compartment , it could be considered that first - line barrier epithelial cells , in contact with many potential danger signals , preferably should not produce high amounts of these very potent inflammatory cytokines and alarmins as it would be harmful for the microenvironment to have a constant high - alarm situation . additionally , many more epithelial cells are present in these organs as opposed to , for instance , macrophages ; therefore activated epithelial cells may relay equally large and biologically significant immune signals that build up the important contribution in global inflammasome activation at organ level . this review demonstrates that inflammasome activation and subsequent secretion of alarming proteins is not restricted to macrophages , indicating that epithelial cells should be considered as highly important cells in innate immune signaling . in future research , epithelial - specific conditional knockout models and transgenic animal studies will be a necessary approach to determine this important contribution more profoundly .

the epithelium regulates the interaction between the noxious xenogenous , as well as the microbial environment and the immune system , not only by providing a barrier but also by expressing a number of immunoregulatory membrane receptors , and intracellular danger sensors and their downstream effectors . amongst these are a number of inflammasome sensor subtypes , which have been initially characterized in myeloid cells and described to be activated upon assembly into multiprotein complexes by microbial and environmental triggers . this review compiles a vast amount of literature that supports a pivotal role for inflammasomes in the various epithelial barriers of the human body as essential factors maintaining immune signaling and homeostasis .

You are an expert at summarizing long articles. Proceed to summarize the following text: laser in situ keratomileusis ( lasik ) is the most common and popular procedure performed for the correction of refractive errors in the last two decades . we report a case of traumatic flap displacement with flap folding which occurred 3 years after lasik was performed . previous literature suggests that vision prognosis would be closely related to proper and prompt management of traumatic flap displacement with flap folding 3 years after lasik . a 23-year - old female presented to our hospital who had undergone uneventful lasik in both eyes 3 years prior . unfortunately , she had suffered a blunt trauma in her right eye in a car accident . a late onset of corneal flap displacement was found with upper and lower portion of the flap being folded inside the corneal bed . surgical intervention for debridement with subsequent reposition of corneal flap was performed as soon as possible in the operating room . a bandage contact lens was placed , and topical antibiotic and corticosteroids were given postoperatively . two days after the operation , the displaced corneal flap was found to be well attached smoothly on the corneal bed without folds . the best - corrected visual acuity was 6/6 with refraction of 0.75 d to 1.0 d 175 in her right eye 1 month later . we reviewed a total of 19 published cases of late - onset traumatic flap dislocations or displacements after lasik with complete data from 2000 to 2014 . traumatic displacement of corneal flaps after lasik may occur after blunt injury with specific direction of force to the flap margin , especially tangential one . according to the previous literature , late - onset traumatic flap displacement may happen at any time after lasik and be caused by various types of injuries . traumatic flap displacement , which is known as one of the complications of lasik , may occur in the early or late postoperative period . the procedures of lasik , used worldwide to correct a wide range of refractive errors , include creating a corneal flap , lifting it , ablating the stromal bed by excimer laser and repositioning the corneal flap at the end . however , the wound healing between corneal flap and stromal bed should be diminished to maintain corneal transparency , which leads to weak flap adhesion . lamellar wound healing is confined to the flap margin without suture to avoid astigmatism.1 since central wound healing does not increase over time , risks of flap displacement or dislocation could be expected after face trauma . postoperative flap dislocation happens within the first 24 hours after surgery in approximately 1%2% of patients , mostly due to eye - rubbing or eyelid motion such as squeezing or blinking.2,3 in comparison to the early - onset flap dislocation , late traumatic flap dislocation arises more than 1 week after the surgery . the increasing incidence of late traumatic flap dislocation in recent years may be related to the popularity that lasik has gained in the last two decades , which is performed by using either microkeratome or femtosecond laser . here , we report a case of traumatic flap displacement after a severe car accident , in a patient who had lasik performed 3 years prior using microkeratome . we also reviewed all previous literature published on medline about late - onset flap dislocation and displacement after previous lasik that required surgical reposition . a 23-year - old female presented to our hospital who had undergone uneventful lasik in both eyes 3 years prior . the patient had suffered a blunt trauma in her right eye in a severe car accident . multiple and irregular lacerations with active bleeding in the right upper eyelid were noted in the emergency room . direct ophthalmoscope revealed a late - onset corneal flap displacement with the flap being folded in the superior and inferior portion . in addition , the bare stroma was exposed . the connection between the nasal hinge of the corneal flap and the cornea was still intact ( figure 1 ) . surface debris was thoroughly scraped by a sterile surgical sponge with continuous irrigation of bss . the margin of the corneal flap which was still in situ was then demarcated , followed by dissection of the central portion from the stromal bed . finally , the whole corneal flap was refloated by a lasik spatula . to expose the whole stromal bed , meanwhile , the superior and inferior folds of corneal flap were unfolded and flattened using a sterile surgical sponge , followed by vigorous irrigation with bss at the end . in addition , the epithelial cells and remnants adherent to the underside of the corneal flap and stromal bed were carefully removed . the corneal flap was repositioned and stretched using surgical sponges in order to avoid folds and wrinkles . at last , a bandage soft contact lens was placed on the cornea for protection ( figure 2 ) . topical antibiotic ( 0.3% ciprofloxacin ) and corticosteroids ( 1.0% prednisolone acetate ) were given postoperatively . two days after the operation , the displaced corneal flap was found to be well attached smoothly on the stromal bed without folds and wrinkles . the best - corrected visual acuity was 6/6 with refraction of 0.751.0175 in her right eye at 1 month . four months later , the uncorrected vision of her right eye was 6/6 with residual refraction of + 0.250.25d175. the corneal flap was clear and smooth in situ without epithelial ingrowth ( figure 3 ) . informed consent was obtained from the patient for publication of this case report and accompanying images . the ethics committee of did not require written informed consent be obtained from the patient because lasik remains the most common and popular procedure for the correction of the refractive errors . it has been increasingly used worldwide for nearly 20 years since it was approved by the us food and drug administration in 1998 . a new technique using femtosecond laser instead of microkeratome to make corneal flap has also been developed . although less wound healing between corneal flap and stromal bed enhances corneal interface transparency , lifetime flap adhesion weakness could lead to increased risk of late traumatic flap complications . due to our interest in the prevalence of traumatic flap displacement after lasik , we reviewed several reports published in the previous ophthalmic literature with complete data from 2000 to 2014 on cases of late - onset traumatic flap dislocations or displacements after lasik ( table 1).415 we reviewed a total of 19 cases of patients with an average age of 35 years , of whom 52.6% were male . regarding the causes of injury , over 26% of injuries were due to sport - related activities , followed by work - related accidents ( 15.7% ) , animal injuries ( 10.5% ) and failure of airbags during car accidents ( 10.5% ) . regarding the mechanisms of trauma , the cases of blunt trauma were more common than those of sharp trauma ( table 2 ) . the interval between lasik and injury episode varied from 10 days to over 14 years , while the vision after trauma varied from counting finger to 20/20 . of all these 19 cases , patients with ots grade 2 accounted for 54.55% ( table 3).16 the interim between injury and surgical intervention was a maximum of 2 days . although the uncorrected vision at last visit was generally excellent with an average of 20/25 , the patients who experienced car accidents had a relatively poor average final vision of 15/20 . the vision prognosis of sharp injury was worse than that of blunt trauma with statistical significance ( table 2 ) . besides , patients with other eye injuries such as hyphema or eyelid laceration accounted for 15.7% of all 19 cases , and had ended up with a poorer average final vision of 20/30 . furthermore , 31.6% of patients had developed complications even after surgical interventions , though they had an average final vision of 20/25 in the last visit . among them , only 15.7% had undergone further treatment and ended up with an average final vision of 20/25 . of all 19 cases , 94.74% of patients had ended up with an ots grade 1 after proper treatment ( table 3 ) . as for the flap condition after trauma ( table 4 ) , flap dislocation was revealed in 73.7% of cases , which was similar to the finding of 71.1% in xiao et al study which analyzed all the cases in the people s republic of china.17 in our review , all the cases with corneal flap dislocation had received flap replacement ( table 5 ) , while only 55.6% of cases in xiao et al study had undergone the same treatment . lack of ophthalmic doctors skilled in refractive surgery could be one possible factor.17 during flap replacement surgery , epithelial scraping had been performed to avoid epithelial ingrowth or residual debris in 63.2% of patients , which led to dissemination of lamellar keratitis at last . at the end of the surgery , up to 73.7% of patients were covered with bandage contact lens to make the folded flaps more flat and then smoothly settle on the stromal beds and remain in situ ( table 5 ) . after lasik surgery , the whole processes and exact mechanisms of wound healing at the interface of corneal flap stromal bed and around the free margins of corneal flap remain unclear . less and delayed wound healing at the stromal interface is believed to keep cornea transparent , leading to weaker adhesion in the central part compared to the surrounding epithelial rim margin , which was confirmed by the surgical experience during retreatment of lasik . schmack et al found that the wound margin of lasik flap heals by producing peripheral hypercellular fibrotic stromal scar , which is about 28.1% as strong as normal corneal stroma . in contrast , the central and paracentral hypocellular primitive stromal scar is only 2.4% as strong as normal corneal stroma , which means it is 10 times weaker then peripheral margin scar.18 kato et al studied corneal wound healing in an animal model . their work on immunohistochemical staining and electron microscopy following lasik showed that up to 9 months after the procedure , wound healing continued to be disorganized and delayed at the interface region.19 the corneal flaps have free margins about more than 270 without any sutures and anchors except the hinge area , which is attached to the corneal flap smaller than 90. any shearing forces , which are tangential to the corneal flap regardless of mechanism and direction , may induce breaking of not only the loose adhesion between corneal flap and stromal bed but also the connection between the free margins and peripheral cornea . these tangential shearing forces may drag the corneal flap away from the corresponding stromal bed and peripheral cornea , leading to the dislocation / stria / split . according to the appearance of corneal flap folding and stria , the direction of shearing forces could be speculated . the pictures of the corneal flap dislocation in our patient showed a larger upper portion of the corneal flap compared to the lower portion . furthermore , there was a part of the upper portion cornea folding between the stromal bed and cornea itself . besides , the patient had multiple lacerations over upper eyelids . these are all hints that the strong shearing forces came from up to down . femtosecond laser - assisted lasik also involves a corneal flap , which may have risks of late - onset traumatic flap dislocation if the force causing blunt trauma comes from a proper angle . however , there are no available studies comparing the late complications of these two different methods of lasik . contrary to the lasik , smile , the newest refractive surgery , involves smaller degrees of free margins and cap incision despite the same interface between the corneal cap and stromal beds . we deduced that even shearing forces can cause breaking of the loose adhesion between corneal cap and stromal bed , and the counterforce of cornea with non - free margin could resist the force , therefore preventing the corneal cap from moving . however , further studies and mechanical models are required to prove that smile might cause less complication after trauma . because the corneal flaps never heal after lasik , eye protection should be used before participating in dangerous sports such as basketball and also in work such as gardening . once traumatic accidents occur , careful and detailed examinations should be undertaken under slit lamp as soon as possible . if dislocation / stria / split of corneal flaps is identified during emergent conditions , corneal flap reposition should be considered immediately . thorough irrigation and scraping off the debris by sponges between corneal flaps and stromal beds should not be ignored . previous experiences suggest that the vision prognosis would be good if proper managements and treatments are followed .

backgroundlaser in situ keratomileusis ( lasik ) is the most common and popular procedure performed for the correction of refractive errors in the last two decades . we report a case of traumatic flap displacement with flap folding which occurred 3 years after lasik was performed . previous literature suggests that vision prognosis would be closely related to proper and prompt management of traumatic flap displacement with flap folding 3 years after lasik.case presentationa 23-year - old female presented to our hospital who had undergone uneventful lasik in both eyes 3 years prior . unfortunately , she had suffered a blunt trauma in her right eye in a car accident . a late onset of corneal flap displacement was found with upper and lower portion of the flap being folded inside the corneal bed . surgical intervention for debridement with subsequent reposition of corneal flap was performed as soon as possible in the operating room . a bandage contact lens was placed , and topical antibiotic and corticosteroids were given postoperatively . two days after the operation , the displaced corneal flap was found to be well attached smoothly on the corneal bed without folds . the best - corrected visual acuity was 6/6 with refraction of 0.75 d to 1.0 d 175 in her right eye 1 month later.literature reviewwe reviewed a total of 19 published cases of late - onset traumatic flap dislocations or displacements after lasik with complete data from 2000 to 2014.conclusiontraumatic displacement of corneal flaps after lasik may occur after blunt injury with specific direction of force to the flap margin , especially tangential one . according to the previous literature , late - onset traumatic flap displacement may happen at any time after lasik and be caused by various types of injuries . fortunately , good visual function could mostly be restored with immediate and proper management .

You are an expert at summarizing long articles. Proceed to summarize the following text: mature mirnas are short single - stranded rna molecules , approximately 1923 nucleotides in length . the mirna sequence is encoded in a stem - loop structure in the primary transcript that is cleaved in the nucleus by the ribonuclease iii enzyme drosha to form the precursor mirna ( pre - mirna ) . the pre - mirna is subsequently exported to the cytoplasm by the exportin and then is cleaved by another ribonuclease iii enzyme dicer to form mature mirna [ 13 ] . mature mirnas can regulate the expression of a large number of genes at the posttranscriptional level . mirna is partially complementary to the sequence of mirna recognition elements ( mre ) in the 3 untranslated regions ( utrs ) of target mrnas . the seed sequence with seven nucleotides in mirna determines the specificity of mrna targeting , whereas the remaining mirna sequence is supposed to stabilize the mirna - target complex . mirna can inhibit translation of target mrnas by blocking protein translation machinery or by sequestering the mrna transcript away from ribosomal interaction . mirna can also induce target mrna degradation in a similar way like rna interference [ 1 , 5 ] . mirnas have been identified in a wide range of species , and computational analysis shows that nearly 30% of protein - coding genes can be modulated by mirnas . in general , mirnas negatively regulate the expression of their targets . however , it is also reported that mir-369 - 3p can upregulate the expression of its target , tumor necrosis factor- ( tnf- ) . mirnas have been demonstrated to play important roles in many biological processes , such as cell cycle control , proliferation , apoptosis , differentiation , metabolism , hemopoiesis , and development . a rapidly growing body of evidence shows that mirnas also have comprehensive functions in tumor progression . some mirnas may function as oncogenes ( also called oncomirs ) while some mirnas are supposed to be tumor suppressors . the importance of mirnas in cancer is highlighted by the fact that half of all mirna genes are located in cancer - associated regions or fragile sites , which are frequently altered or deleted in cancer . many tumor types show unique mirna signatures ; thus , mirnas may be of use in cancer diagnosis and prognosis [ 11 , 12 ] . pituitary adenomas are usually benign intracranial neoplasms , accounting for 1015% of diagnosed brain tumors . pituitary adenomas can be derived from a single mutant cell of five differentiated cell types within pituitary gland : somatotropes , lactotropes , corticotropes , thyrotropes , and gonadotropes , which , respectively , secrete growth hormone ( gh ) , prolactin ( prl ) , adrenocorticotrophic hormone ( acth ) , thyroid - stimulating hormone ( tsh ) , and gonadotropins ( follicle - stimulating hormone ( fsh ) and luteinizing hormone ( lh ) ) . according to the hormonal activity , pituitary adenomas can be defined as functioning , causing endocrine dysfunction such as cushing 's disease in acth - secreting pituitary adenomas , acromegaly in gh - secreting pituitary adenomas , galactorrhea and amenorrhea in prl - secreting pituitary adenomas , and hyperthyroidism in tsh - secreting pituitary adenomas . on the other hand , nonfunctioning pituitary adenomas ( nfa ) do not give rise to hormone hypersecretion . pituitary adenomas might be small lesions with slow growth . however , some pituitary adenomas grow rapidly and cause tumor mass effect , the local compressive effect of large pituitary tumors on brain structures and cranial nerves . they can also invade downwards into the paranasal sinuses , laterally into the cavernous sinuses and upwards into the parenchyma of the brain . occasionally , malignant pituitary carcinomas metastasize to distant locations in the central nervous system , lymph nodes , liver , and other sites throughout the body . in recent years nevertheless , the correlation and function of mirnas and their target genes in pathogenesis of pituitary adenomas remain largely unknown . only a small number of mirnas with their target genes in pituitary adenomas have been validated so far . in this review , we summarize recent advances in the study of mirnas and their validated or potential targets in pituitary adenomas and discuss the future perspectives . aberrant expressions of mirnas have been demonstrated so far ( table 1 ) . mir-15a and mir-16 - 1 are the first two mirnas shown to have differential expression in pituitary adenomas . mir-15a and mir-16 - 1 genes are located at chromosome 13q14 , a region which is frequently deleted in pituitary tumors . previous studies have suggested that the genes in this locus may be responsible for the progression of pituitary adenoma to a more aggressive form . in 2005 , mir-15a and mir-16 - 1 were reported to have lower expression in both gh - secreting and prl - secreting pituitary adenomas than in normal tissues , and their downregulation was correlated with greater tumor volume and impaired secretion of p43 , a potent anticancer cytokine , suggesting that mir-15a and mir-16 - 1 may function as tumor suppressors and their inactivation may contribute to tumor growth in pituitary adenomas . in another study on acth - secreting pituitary tumors , mir-15a and mir-16 were also expressed at a lower level , but no association between mirnas expression and tumor size was observed in this study . this is in accordance with the result of a subsequent report which showed no correlation between downregulation of mir-15a and gh - secreting pituitary tumor size . mutations in mir-16 - 1 gene have been reported to be partially responsible for its altered expression in chronic lymphocytic leukemia ( cll ) patients . thus , it is worth exploring whether there are similar mutations in pituitary adenoma patients . family members are located at chromosomal regions that are often altered or deleted in human tumors . downregulation of let-7 has been reported in breast , lung , colon , and others cancers [ 3033 ] and let-7 is considered a tumor suppressor by targeting ras oncogene . recently , some studies revealed that high - mobility group a2 ( hmga2 ) is negatively regulated by the let-7 mirnas in vitro [ 35 , 36 ] . hmga2 plays diverse roles in many biological processes such as embryogenesis , differentiation , and neoplastic transformation . overexpression of hmga2 is a hallmark of various tumors , including pituitary adenomas , and is associated with highly malignancy [ 38 , 39 ] . the transgenic mice with overexpressed hmga2 developed pituitary adenomas , indicating that hmga2 may be involved in pituitary tumorigenesis . in 2009 , hmga2 was frequently upregulated in pituitary adenomas including prl , acth , fsh / lh , or null cell adenomas but relatively rare in gh and mixed gh / prl adenomas . hmga2 overexpression and the decrease of let-7 were significantly correlated with tumor proliferation , growth , invasion , and tumor grade , which lead to a hypothesis that let-7 may also function as a tumor suppressor in pituitary adenomas by targeting hmga2 . decreased expression of let-7a in pituitary adenomas was also reported in other studies [ 27 , 41 ] , suggesting the general downregulation of let-7 in pituitary adenomas . on the other hand , some other mirnas such as mir-98 can also regulate hmga2 expression , indicating that hmga2 may have multiple mirnas regulators . during pituitary development , let-7b / c was proposed to operate with the rna - binding protein ksrp in a negative feedback loop , in which ksrp induces the maturation of let-7b / c , and let-7b / c posttranscriptionally downregulates the expression of ksrp itself . as pituitary adenomas can be derived from differentiated cell types within pituitary gland , different subtypes of pituitary adenomas could display distinct mirna profiles , and these specific profiles might be useful to distinguish pituitary adenoma subtypes . in 2007 , the most representative ones were mir-212 , mir-026a , mir-150 , mir-152 , mir-191 , and mir-192 , which were upregulated in pituitary adenomas , while mir-024 - 1 and mir-098 were downregulated in tumor samples . twenty - nine mirnas were identified to be able to predict pituitary adenoma histotype ( acth- , gh- , prl - secreting adenomas , and nfa ) . for the limit of sample numbers , the authors only analyzed the association of deregulated mirnas and tumor diameter in the nfa group . five mirnas were upregulated ( mir-140 , mir-099a , mir-099b , mir-030b , and mir-030c ) and only one ( mir-138 - 2 ) was downregulated in macroadenomas compared to microadenomas . in 2009 , amaral et al . investigated the differential expression of some mirnas in acth - secreting pituitary tumors . in addition to the decrease of let-7a , mir-15a , and mir-16 , they also found underexpression of mir-21 , mir-141 , mir-143 , mir-145 , and mir-150 in acth - secreting pituitary adenomas compared with normal pituitary tissues . among these mirnas , mir-143 expression was decreased in human lung and colorectal cancers [ 46 , 47 ] and was reported to inhibit kras translation in colorectal cancer cell . mir-145 was downregulated in human breast , lung , and colorectal cancers [ 30 , 46 , 47 , 49 ] . mir-145 could regulate the expression of various targets in different tumors : fscn1 in esophageal squamous cell carcinoma , oct4 , egfr , and nudt1 in lung adenocarcinoma [ 51 , 52 ] , and fli1 in colon cancer . mir-150 was overexpressed in hematopoietic progenitor / stem cells and was demonstrated to target notch3 in human t - cell development in a recent study . studies were conducted with the aim of investigating the aberrant expression of mirnas in gh - secreting pituitary adenomas . in 2010 , mao et al . identified totally fifty - two mirnas to be differentially expressed in gh - secreting pituitary adenomas . mir-184 , mir-524 - 5p , mir-629 , and mir-766 were upregulated , while mir-124 , mir-222 , mir-32 , mir-744 , and mir-765 were downregulated . in 2012 , another set of mirnas were identified to be differentially expressed in gh - secreting pituitary adenomas . eighteen mirnas , including mir-34b , mir-326 , mir-432 , mir-548c-3p , mir-570 , and mir-603 , were drastically and constantly downregulated in gh adenomas , whereas only mir-320 was significantly upregulated . mir-34b and mir-548c-3p were demonstrated to regulate both hmga1 and hmga2 expression , whereas mir-326 , mir-432 , and mir-570 target hmga2 only . mir-326 and mir-603 could decrease the expression of the e2 transcription factor 1 , e2f1 . besides , mir-107 was found to be overexpressed in gh - secreting and nonfunctioning pituitary adenomas and inhibited the expression of pituitary tumor suppressor gene aryl hydrocarbon receptor - interacting protein ( aip ) . recently , palumbo et al . identified 17 mirnas which were differentially expressed in gh - secreting pituitary tumors . specifically , five mirnas ( mir-26b , mir-26a , mir-212 , mir-107 , and mir-103 ) were upregulated and twelve mirnas ( mir-125b , mir-141 , mir-144 , mir-164 , mir-145 , mir-143 , mir-15b , mir-16 , mir-186 , let-7b , let-7a3 , and mir-128 ) were downregulated . mir-26b and mir-128 controlled pituitary cell properties through regulation of their direct targets , pten , and bmi1 , respectively . mirnas are also dysregulated in nonfunctioning pituitary adenomas ( nfa ) . in 2011 , butz et al . expressions of smad3 , smad6 , smad9 , meg , and dlk1 were significantly decreased in nfa . through pathway analysis and in silico target prediction , a specific subset of mirnas was identified that may potentially downregulate tgf- signaling pathway in nfa . five mirnas predicted to target smad3 ( mir-135a , mir-140 - 5p , mir-582 - 3p , mir-582 - 5p , and mir-938 ) were overexpressed , of which mir-140 - 5p has already been validated to target smad3 directly . in addition , an inverse correlation between tumor size and the expression of eighteen mirnas was observed . six mirnas of them ( mir-450b-5p , mir-424 , mir-503 , mir-542 - 3p , mir-629 , and mir-214 ) were significantly underexpressed , while one mirna ( mir-592 ) was significantly overexpressed in nfa compared to normal pituitary tissues . in another study , mir-124a was the most upregulated mirna , and mir-31 was the most downregulated mirna in nonfunctioning pituitary adenomas . in gonadotropin - secreting pituitary adenomas , a study demonstrated that mir-10b was upregulated and mir-503 was downregulated . furthermore , the integration and coordination of hormones and pituitary cells are important for the regulatory function of pituitary tissues . gonadotropin - releasing hormone ( gnrh ) acts on pituitary gonadotropes to stimulate lh and fsh synthesis and secretion . gnrh induces expressions of mir-132 and mir-212 in lt2 pituitary gonadotrope cells to regulate cellular morphology and migration . the p250rhogap protein is a downstream target of mir132/212 and its downregulation is involved in the morphological change and migration altered by gnrh . it is well known that the dysfunction of cell cycle control is a critical step in initiation and progression of human cancers . some oncoproteins or tumor suppressors play important roles in cell cycle control by interacting with critical cell cycle regulators , such as cyclin , cyclin - dependent - kinase ( cdk ) , or cell cycle inhibitors . during tumor progression , the genes involved in cell cycle control often have aberrant expression , resulting in unlimited tumor cell growth . some reports suggested that the deregulated mirnas might also regulate cell cycle of pituitary adenomas at the post - transcriptional level ( figure 1 ) . mir-128a , mir-155 , and mir-516a-3p target 3-utr of wee1 , and exogenous overexpression of these mirnas inhibited wee1 expression . mir-128a is a brain - enriched mirna and was reported to be decreased in pituitary adenomas . its ectopic overexpression reduced neuroblastoma cell motility and invasiveness , suggesting its tumor suppressive role . mir-516a-3p was involved in glioblastoma development and was associated with progression of breast cancer . these mirnas may take part in the regulation of cell cycle in pituitary adenomas together with other related mirnas . hmga2 is associated with the e1a - regulated transcriptional repressor p120 ( e4f ) , interfering with p120 ( e4f ) binding to the cyclin a promoter . ectopic expression of hmga2 resulted in the activation of cyclin a promoter and induction of endogenous cyclin a expression . moreover , chromatin immunoprecipitation experiments showed that hmga2 was associated with cyclin a promoter only when the gene was transcriptionally activated . these data indicate cyclin a as a cellular target of hmga2 and , for the first time , lead to a mechanism of hmga2-dependent cell cycle regulation . thus , let-7 , as a regulator of hmga2 , may exert its effects in cell cycle control of pituitary adenomas by targeting hmga2 . mir-23b and mir-130b , which were reduced in gh , gonadotroph , and nfpa adenomas , overexpression of mir-23b and mir-130b arrested the cells in the g1 and g2 phase of the cell cycle . recently , a study revealed that mir-15a and mir-16 - 1 cluster could modulate prostate cancer by targeting multiple genes , including cyclin d1 . regarding the deregulation in pituitary adenomas , mir-15a and mir-16 - 1 may exert their roles as tumor suppressors by regulating cell cycle . previous study has shown that mir-126 could modulate phosphatidylinositol 3-kinase ( pi3k ) signaling by limiting the pi3k regulatory subunit beta ( p85b ) . loss of mir-126 would eliminate the check point and increase pi3k signaling , which facilitate tumor growth during colon carcinogenesis . mir-145 was downregulated in gh - secreting pituitary adenomas , which is in line with the results in 11 samples of cortitropinomas . the potential targets of mir-145 include myc , kras , fos , yes , fli , cyclin d2 , and mapk transduction proteins , indicating that mir-145 might function in cell cycle control by targeting multiple genes . mir-503 has been validated to directly target cyclin d1 and is thought to be a tumor suppressor . furthermore , an important potential target of mir-503 is the cell cycle regulator cdc25 . mir-26b and mir-128 were found to directly regulate pten and bmi1 , respectively . moreover , mir-128 regulated pten expression and akt activity in the pituitary tumor cells by interfering with the binding of bmi1 to pten promoter . since pten - akt pathway plays important roles in cell cycle control , mir-26b and mir-128 might regulate cell cycle through pten - akt pathway . moreover , mir-26a was also overexpressed in acth - secreting pituitary adenomas and plays an important role in cell cycle control by modulating protein kinase c delta . apoptosis , the process of programmed cell death , is an important barrier for tumor cells . during malignant transformation and tumor progression , tumor cells have to escape this regulated cell death to obtain an advantage in growth and expansion . at the early stage of apoptosis , cells receive death signals , and then the apoptotic trigger is controlled by pro- or antiapoptotic members of b - cell lymphoma 2 ( bcl-2 ) family and other regulatory proteins . accumulating evidence have shown that mirnas can regulate cancer cell apoptosis by targeting bcl-2 family or other apoptosis regulators ( figure 1 ) . mir-15a and mir-16 - 1 were demonstrated to induce apoptosis by targeting bcl-2 in cll . bcl-2 is a founding member of the bcl-2 family , a family of antiapoptotic proteins governing mitochondrial death signaling . bcl-2 is frequently overexpressed in many types of human cancers , including carcinomas , lymphomas , and leukemias . in cll , some other apoptosis related genes were identified to be targets of mir-15a and mir-16 - 1 cluster , such as mcl1 , which could enhance cell survival by inhibiting apoptosis . therefore , it is possible that , in pituitary adenomas , mir-15a and mir-16 - 1 influence apoptosis by targeting multiple antiapoptotic genes . besides , mir-214 and mir-629 , two mirnas overexpressed in nfa and negatively correlated with tumor size , also potentially target bcl2 . mir-21 was differentially expressed in acth - secreting pituitary adenomas compared with normal pituitary tissues . mir-21 has been identified to be upregulated in human breast , lung , colorectal and other cancers [ 30 , 46 , 49 , 75 ] . suppression of mir-21 by antisense oligonucleotides or mir-21 knockdown was associated with increased apoptotic activity and inhibition of tumor cell growth , probably by downregulating the target tumor suppressor genes . mir-21 may exert its function in apoptosis by targeting tumor suppressor pdcd4 and pten . overexpression of pdcd4 was able to result in apoptotic death , and pten can induce apoptosis through phosphoinositol-3-kinase / akt dependent and independent pathways . putative targets of mir-212 include death effector domain - containing protein ( dedd ) , a protein involved in apoptotic signaling , as well as other proteins participating in apoptosis . mir184 was markedly upregulated in gh - secreting pituitary adenomas and was correlated with tumor diameter . contrary to that , another study reported that ectopic overexpression of mir-184 resulted in increased apoptosis . study of cheng et al . suggested that the upregulated mir-150 , mir-152 , mir-191 , and mir-192 may also be involved in apoptosis . mir-26b was found to be upregulated in gh - secreting pituitary tumors and directly regulate pten . mir-200c , which has been characterized as a tumor suppressor or oncogene in different cancers , also inhibited apoptosis in pituitary adenoma cells by targeting the pten / akt signaling pathway . intriguingly , a novel marine drug , sz-685c that was isolated from the secondary metabolites of a mangrove endophytic fungus was reported to induce apoptosis of mmq pituitary tumor cells by downregulating mir-200c . tgf- has been shown to inhibit proliferation and induce apoptosis in hp75 cells , a cell line derived from a clinically nfa . thereby , the mirnas targeting tgf- signaling ( mir-135a , mir-140 - 5p , mir-582 - 3p , mir-582 - 5p , and mir-938 ) may have effects in apoptosis . however , as tgf- can also promote cancer cell invasion by inducing epithelial - mesenchymal transition ( emt ) , it is rational to conclude that mirnas targeting tgf- pathway may suppress invasion and metastasis by blocking emt , as mir-300 does in human epithelial cancer . therefore , mirnas that regulate tgf- pathway play controversial roles in tumor initiation and progression . deregulation of bmi1 has been revealed to affect apoptosis ; thus , mir-128 , which was downregulated in gh - secreting pituitary tumors , could also affect apoptosis by directly regulating bmi1 . these data together lead to the hypothesis that many mirnas may function in a network to regulate apoptosis in pituitary adenomas . although invasion and metastasis are rare in pituitary tumors , studies provide some clues of mirnas ' function in pituitary tumor invasion and metastasis ( figure 1 ) . significant correlation between hmga2 overexpression and tumor cell invasion has been detected in breast cancer and gastric cancer [ 89 , 90 ] . in oral squamous cell carcinomas , strong staining of hmga2 and loss of e - cadherin expression were observed at the invasive front of tumor . previous studies also demonstrated that tumor - specific downregulation of e - cadherin and h - cadherin was related to invasiveness of pituitary adenoma . hmga2 may be involved in tumor cell invasion due to its association with epithelial - mesenchymal transition that facilitates tumor cell invasion . since let-7 regulates hmga2 expression in pituitary adenomas , let-7 may also take a role in pituitary adenoma invasion . in amaral et al . 's study , although no association between mirnas expression and tumor size was observed , the patients with acth - secreting pituitary tumors expressing reduced mir-141 had more chance of remission after transsphenoidal surgery , suggesting that mir-141 may regulate pituitary genes involved in tumor growth and local invasion . pttg protein 1 is a target of both mir-126 and mir-381 , which were downregulated in gh - secreting pituitary adenomas . aggressive pituitary adenomas and carcinomas frequently have a deletion in regions near the rb gene [ 94 , 95 ] . in 2010 , stilling et al . more mirnas were deregulated between pituitary adenomas and normal pituitaries compared to carcinomas and normal pituitaries . in pituitary carcinomas compared to acth adenomas , mir-122 and mir-493 were upregulated , and , in all three metastatic sites of acth carcinomas , mir-122 expression was markedly increased . recently , palumbo et al . identified mir-26b to be upregulated and mir-128 to be downregulated in gh - secreting pituitary tumors . inhibition of mir-26b and overexpression of mir-128 suppressed colony formation and invasiveness of pituitary tumor cells . interestingly , the inhibition of mir-26b and overexpression of mir-128 had a synergistic effect on suppressing the tumorigenicity and invasiveness of pituitary tumors . since deregulation of pten and bmi1 correlates with the invasive and metastatic phenotype of several human cancer types [ 97 , 98 ] , it is possible that mir-26b and mir-128 regulate invasiveness of pituitary tumor cells by directly targeting pten and bmi1 , respectively . although metastatic pituitary carcinomas are rare , these data suggest that altered expression of mirnas may provide diagnostic information to distinguish pituitary adenomas and carcinomas before they metastasize . the symptoms of mass effect and hormonal hypersecretion caused by pituitary adenomas could be reversed by surgical resection or debulking of the adenoma , radiotherapy , or medical treatment . medical treatment is the primary choice for prolactinomas and the secondary option for acromegaly , cushing 's disease , gonadotropin - secreting tumours , and tsh - secreting adenomas . some studies provide evidence that mirnas were differentially expressed before and after pharmacological treatment , and the altered mirna profile could provide useful information of responsiveness of pituitary adenomas patients to pharmacological treatment ( figure 1 ) . in 2007 , a microarray was carried out to analyze the mirna profiles in pituitary adenomas and normal pituitary samples . to elucidate whether mirnas profile is altered by pharmacological treatment , differentially expressed mirnas were identified in nfa from patients with pharmacological treatment or patients without treatment . six mirnas were found to be differentially expressed : mir-29b , mir-29c , and mir-200a were upregulated , while mir-134 , mir-148 , and mir-155 were downregulated after treatment . thus , the mirna expression could differentiate treated patient samples from nontreated patient samples . in 2010 , another study aimed to identify altered expression of mirnas in gh - secreting pituitary adenomas . fifteen pituitary adenomas patients were treated with lanreotide for four months before surgery , while six patients did not receive any presurgical medical treatments . patients with > 50% reduction of gh secretion after lanreotide treatment were considered somatostatin analogs ( ssa ) responders , while patients with < 50% gh secretion were considered ssa nonresponders . thirteen mirnas were differentially expressed between gh - secreting pituitary adenomas from patients with lanreotide treatment and those without treatment . eight mirnas ( mir-183 , mir-193a-5p , mir-222 , mir-516b , mir-524 - 5p , mir-601 , and mir-629 , 99b ) were upregulated and five mirnas ( mir-124 , mir-32 , mir-574 - 5p , mir-744 , and mir-96 ) were downregulated . putative targets of these mirnas are mainly igfbp family members , igfals , scp1 , and matrix metalloproteinase-9 . accumulating evidence demonstrates that a large number of mirnas have altered expression in pituitary adenomas , and these mirnas may play important roles in tumor progression by targeting multiple genes . the molecular mechanism of the regulation of mirnas in pituitary adenomas is still a mystery . some proofs indicate that genetic or epigenetic alterations may contribute to the deregulated expression of mirnas . for example , mutations in the mir-16 - 1 gene have been reported to be partially responsible for its aberrant expression in cll patients , and expressions of mir-124 and mir-203 are decreased because of cpg methylation . some mirnas have been demonstrated to target multiple genes , indicating that they may have different roles in pituitary tumors . on the other hand , a gene involved in pituitary adenomas progression can be modulated by more than one mirna . therefore , the mirnas and their targets could regulate pituitary adenomas progression in a complex network . advances in the technology to investigate mirnas make it easier and faster to explore more exactly the roles of mirnas in pituitary adenomas . as some mirnas signatures can be used to distinguish pituitary adenomas and normal pituitaries and even subtypes of pituitary tumors , it is also possible to develop mirna based diagnosis and therapies of pituitary adenomas . the knowledge of pituitary pathogenesis is still limited . continuing study on mirnas and their targets will shed more light on mechanisms of pituitary adenomas .

micrornas ( mirnas ) are a class of recently identified noncoding rnas that regulate gene expression at posttranscriptional level . due to the large number of genes regulated by mirnas , mirnas play important roles in many cellular processes . emerging evidence indicates that mirnas are dysregulated in pituitary adenomas , a class of intracranial neoplasms which account for 1015% of diagnosed brain tumors . deregulated mirnas and their targets contribute to pituitary adenomas progression and are associated with cell cycle control , apoptosis , invasion , and pharmacological treatment of pituitary adenomas . to provide an overview of mirnas dysregulation and functions of these mirnas in pituitary adenoma progression , we summarize the deregulated mirnas and their targets to shed more light on their potential as therapeutic targets and novel biomarkers .

You are an expert at summarizing long articles. Proceed to summarize the following text: tonometry , or the measurement of intraocular pressure ( iop ) , the pressure of the fluid inside the eye , is one of the most important examination procedures in ophthalmic clinics , and iop is an important parameter in the diagnosis of glaucoma . iop varies among individuals,1 with normal iop essentially maintained by the dynamic equilibrium between aqueous humor formation and outflow , and by episcleral venous pressure.2 aqueous humor helps to maintain appropriate iop.3 the circulating aqueous humor nourishes the cornea and lens ( both structures that must be transparent and therefore devoid of blood vessels ) , as well as the trabecular meshwork.4 iop helps to maintain the proper shape of the eyeball.5 aqueous humor provides a transparent and colorless medium between the cornea and the lens and constitutes an important component of the eye s optical system.6 the aqueous humor is secreted by the nonpigmented ciliary epithelium at a flow rate of 23 l per minute.3 anterior chamber volume in humans is estimated to be ~250300 l . aqueous humor turnover is ~1% of anterior chamber volume ( ~2.5 l per minute).7 pooled data from large epidemiologic studies indicate that the mean iop is approximately 16 mmhg ; however , these pooled data have a non - gaussian distribution with a skew toward higher pressures , especially in individuals over the age of 40 . the value 22 mmhg has been used in the past to both separate normal and abnormal pressures and define which patients required ocular hypotensive therapy . this division was based largely on the erroneous assumptions that glaucomatous damage is caused exclusively by pressures that are higher than normal and that normal pressures do not cause damage.8 screening for glaucoma based solely on an iop > 21 mmhg may miss up to half of the people with glaucoma in the screened population . it is now generally agreed that , for the population as a whole , no clear line exists between safe and unsafe iop : some eyes undergo damage at an iop of 18 mmhg or less , whereas other eyes tolerate iops in the 30s . however , iop is still seen as a very important risk factor for the development of glaucomatous damage . although other risk factors affect an individual s susceptibility to glaucomatous damage , iop is the only risk factor that can be altered at this time.8 in normal individuals , iop varies by 26 mmhg over the course of a 24-hour period as aqueous humor production changes . higher iop is associated with greater fluctuation and a diurnal fluctuation > 10 mmhg is suggestive of glaucoma . many people reach their peak iop in the morning hours , but others do so in the afternoon , in the evening , or during sleep ; still others follow no reproducible pattern.8 iop is an important risk factor for the development of glaucoma as well as for the progression of an already established glaucoma.9 reduction of iop is the best , and only evidence - based , treatment modality ; pharmacologic as well as surgical interventions aimed at reducing iop may successfully slow the progression of structural damage and visual field loss in patients with glaucoma.10 therefore , iop measurement by tonometry is essential in ophthalmological assessment . however , glaucoma may continue to progress despite iop reduction to targeted levels ; this indicates that factors other than iop may play an important role in the pathogenesis of glaucoma.11 applanation tonometry is based on the imbert fick principle , which states that a perfect sphere has its internal pressure equally distributed and that the external force needed to flatten a known area of that sphere is directly proportional to the internal pressure of the sphere.12 the goldmann applanation tonometer ( gat ) is currently the most popular tonometer available . it consists of a double prism mounted on a standard slit lamp.2 the gat represents the gold standard for iop measurement and is used in all major randomized glaucoma clinical trials . with the gat , the force required to flatten , or applanate , a constant area of the cornea is measured and related to the iop using the imbert fick principle . the gat uses an applanation diameter of 3.06 mm and is performed with the patient seated at the slit lamp.13 air - puff tonometry is an applanation method using a standardized puff of air to flatten the cornea . this method has the advantage that no topical anesthetic or risk of corneal abrasion is involved.14 the system consists of a central air plenum flanked either side by a light emitter and a light detector . as the pressure of the air pulse directed to the cornea increases to deform the cornea , the corneal surface behaves like a plane mirror , reflecting light to the detector.15 corneal applanation is measured by collecting light reflected from the central cornea . a parallel beam of light is directed onto the central cornea at an angle of 30 and the reflected light is measured by a photo detector at an angle of reflection of 30. the reflected beam of light will be strongest at this angle when the cornea is flat and acting as a plane mirror , rather than as a curved mirror . the instrument records the force of air required to flatten the cornea and displays the iop that corresponds to that force . the ap tonometer must be used at a set distance from the cornea , and the instrument incorporates an optical alignment system to facilitate this.16 the puff of air can startle the patient , both with its apparent force and with its noise . an ap tonometer may be nonportable or portable,17 and because the ap tonometer is a noncontact tonometer , the risk of transmitting infectious agents from one eye to another via the tonometer tip is eliminated . however , the force of the air puff can aerosolize the tear film and may theoretically transmit viruses by an airborne route.13 the purpose of this study was to evaluate the difference , if any , between iop measurements taken by a gat and those taken by an ap tonometer , in view of what the author considers to be an increasing dependency in the medical community on the ap method of iop measurement . the study population comprised 196 eyes from 98 patients who were attending an ophthalmic outpatient clinic for various ophthalmic complaints and diseases . the patients ( 51 males , 47 females ) had an age range of 1584 years , and mean age was 55.32 14.72 years . exclusion criteria were as follows : patients who are uncooperative in the measurement of iop by either method , those with severe visual loss who are unable to maintain fixation for both methods , history of intraocular surgery , history of refractive surgery , a known case of glaucoma , or history of antiglaucoma medications . prior to the assessment of iop , to minimize the effect of astigmatism on the accurate determination of iop , subjects with astigmatism of 3 diopters or more ( as detected by autorefraction ) were excluded from the study.18 the research follows the tenets of the declaration of helsinki , and each patient gave his or her informed consent to participate in the study . iop was measured in all patients using both a gat and an ap tonometer , and the difference in readings between the two methods was calculated . the ap tonometer used was a topcon ct-80 model ( topcon corporation , tokyo , japan ) . for the assessment of iop , three readings were averaged to get the iop values for an eye ; this procedure was adopted to suit the principle of iop measurement used by the topcon ct-80 noncontact tonometer . the iop assessment with the gat was always subsequent to that with the topcon ct-80 noncontact tonometer ; this was done to prevent bias due to a reduction of measured iop caused by applanation . for the measurement by gat , the eyes were anesthetized using alcaine ( proparacaine hydrochloride ophthalmic solution ) 0.5% eye drops ( alcon laboratories , inc , fort worth , tx ) and a fluorescein strip was applied to the inferior conjunctival fornix for a few seconds . the period of contact with the applanation probe was kept under 5 seconds to minimize the iop - reducing effect of aqueous massage on repeated applanation readings . all readings of iop were taken between 8 am and 1 pm , and the same examiner took both measurements . the data collected were classified into three groups according to the iop measurements by gat and ap tonometer : group 1 , iop < 12 mmhg ; group 2 , iop 1224 mmhg ; and group 3 , iop > 24 mmhg . the difference in readings between the two devices was calculated for each patient in each group . the data were also classified according to the patients age , sex , and laterality ( right and left eyes ) . the data were analyzed using statistical software ( spss , v 17 ; ibm corporation , armonk , ny ) . the paired t - test was used and a p - value < 0.05 was considered statistically significant . the study population comprised 196 eyes from 98 patients who were attending an ophthalmic outpatient clinic for various ophthalmic complaints and diseases . the patients ( 51 males , 47 females ) had an age range of 1584 years , and mean age was 55.32 14.72 years . exclusion criteria were as follows : patients who are uncooperative in the measurement of iop by either method , those with severe visual loss who are unable to maintain fixation for both methods , history of intraocular surgery , history of refractive surgery , a known case of glaucoma , or history of antiglaucoma medications . prior to the assessment of iop , to minimize the effect of astigmatism on the accurate determination of iop , subjects with astigmatism of 3 diopters or more ( as detected by autorefraction ) were excluded from the study.18 the research follows the tenets of the declaration of helsinki , and each patient gave his or her informed consent to participate in the study . iop was measured in all patients using both a gat and an ap tonometer , and the difference in readings between the two methods was calculated . the ap tonometer used was a topcon ct-80 model ( topcon corporation , tokyo , japan ) . for the assessment of iop , three readings were averaged to get the iop values for an eye ; this procedure was adopted to suit the principle of iop measurement used by the topcon ct-80 noncontact tonometer . the iop assessment with the gat was always subsequent to that with the topcon ct-80 noncontact tonometer ; this was done to prevent bias due to a reduction of measured iop caused by applanation . for the measurement by gat , the eyes were anesthetized using alcaine ( proparacaine hydrochloride ophthalmic solution ) 0.5% eye drops ( alcon laboratories , inc , fort worth , tx ) and a fluorescein strip was applied to the inferior conjunctival fornix for a few seconds . the period of contact with the applanation probe was kept under 5 seconds to minimize the iop - reducing effect of aqueous massage on repeated applanation readings . all readings of iop were taken between 8 am and 1 pm , and the same examiner took both measurements . the data collected were classified into three groups according to the iop measurements by gat and ap tonometer : group 1 , iop < 12 mmhg ; group 2 , iop 1224 mmhg ; and group 3 , iop > 24 mmhg . the difference in readings between the two devices was calculated for each patient in each group . the data were also classified according to the patients age , sex , and laterality ( right and left eyes ) . the data were analyzed using statistical software ( spss , v 17 ; ibm corporation , armonk , ny ) . the paired t - test was used and a p - value < 0.05 was considered statistically significant . the mean iop value for all patients as measured by gat was 13.06 4.774 mmhg , with a range of 630 mmhg . the mean iop value for all patients as measured by ap tonometer was 15.91 6.955 mmhg , with a range of 730 mmhg . the mean difference of iop values between gat and ap tonometer measurements was 2.72 2.345 mmhg , with a range of 610 mmhg . the difference in iop values between the two devices was statistically significant ( p = 0.001 ) ( table 1 ) . in 74% of patients , the iop measurement by ap tonometer was higher than that measured by gat ( table 2 ) . this study showed that iop values measured with an ap tonometer were higher than those measured with a gat ( figures 1 and 2 ) , especially when the gat measurement of iop exceeded 24 mmhg , and that this difference was statistically significant ( p < 0.0001 ) . gats and ap ( ie , noncontact ) tonometers are the most common devices for measuring iop in daily practice . ap tonometers are easier to use and are more convenient , for both the patient and the examiner , than gats . in view of this , the author considers there is an increasing dependency in the medical community , especially in outpatient clinics , on the ap method of iop measurement , despite there being some doubt regarding the acceptance of all ap tonometer readings . this study shows there is a significant difference in measurements of iop between gats and ap tonometers . the readings obtained by ap tonometer were higher than those obtained by gat in 74% of the patients in this study . the difference in readings between the two instruments increased when the gat measurement of iop exceeded 24 mmhg . several other studies have compared iop measurements obtained with gat and those obtained by noncontact tonometers.1923 firat et als19 study concluded that noncontact tonometer measurements were higher than those obtained by gats and that this difference was statistically significant . martinez - de - la - casa et al20 compared iop measurements obtained with gats and with noncontact tonometers and found that the mean gat measurement was lower than the mean noncontact tonometer measurement . tonnu et al21 showed that the mean difference in iop between gat measurements and ap tonometer measurements was 0.7 mmhg . the present study showed the mean difference was 2.72 2.345 mmhg between the two devices . rao22 showed that noncontact tonometer readings were more accurate when the iop was < 20 mmhg . lagerlf23 showed that measurements by a noncontact tonometer were found to be unreliable between 20 and 30 mmhg . our present study shows that the lower the iop as measured by gat , the more reliable the corresponding readings made with ap tonometer . there was no statistically significant difference found in iop measurements between gats and ap tonometers according to patient , sex , or laterality of the eyes . some previous studies have shown that iop is equal between the sexes,24,25 while some have found sex - specific differences ( typically , higher iop in females and the magnitude of the difference increasing after 40 years of age).26 the main advantages of noncontact tonometers are that they are easier than gats to use ( they can even operate automatically , as the readings are largely operator independent ) ; they are noninvasive , so there is no requirement for topical anesthesia or fluorescein and there is minimum risk of infection ; there is no risk of corneal abrasion , so the method is more comfortable than applanation tonometry for the patient , and repeated measurements do not reduce iop ( unlike the ocular massage effect that occurs with applanation tonometry ) ; and iop screening with a noncontact tonometer may be performed by an ophthalmic assistant without the direct supervision of an ophthalmologist . a disadvantage is that where readings by ap tonometer are abnormally high , the readings should be checked the measurements should be repeated with another tonometric device before giving an opinion or a final diagnosis . the gat remains the most suitable , reliable device and is the international gold standard for measuring iop . measurements of iop by ap tonometer are usually higher than those obtained by gat , regardless of the patient s age , sex , or laterality of eyes ( particularly for higher iop values ) , and therefore the ap tonometer is suitable for community or mass screenings of iop . considering this difference in iop measurements between ap tonometers and gats , the increasing use in the medical community , especially in outpatient clinics , of the seemingly more user - friendly ap tonometry devices is worrying . it is necessary when supplying the primary health care centers with ap tonometers an emphasis is placed on training the users of apts . it may be reasonable to find correcting values ( nomogram ) for ap tonometer readings .

purposetonometry , or measurement of intraocular pressure ( iop ) , is one of the most important examination procedures in ophthalmic clinics , and iop is an important parameter in the diagnosis of glaucoma . because there are numerous types of tonometer available , it is important to evaluate the differences in readings between different tonometers . goldmann applanation tonometers ( gats ) and noncontact air - puff tonometers ( apts ) are largely available in ophthalmic clinics . the purpose of this study was to evaluate the role of ap tonometer by comparing the measurements of iop made using this device with those made using a gat.patients and methodsthis study involved 196 eyes from 98 study participants , all of whom were patients attending an ophthalmic outpatient clinic . each patient s iop was measured using both goldmann applanation tonometry and ap tonometry , and the difference in readings between the two methods was calculated.resultsthe mean iop as measured by gat was 13.06 4.774 mmhg , while that as measured by ap tonometer was 15.91 6.955 mmhg . the mean difference between the two methods of measurement was 2.72 2.34 mmhg . the readings obtained by ap tonometer were higher than those obtained by gat in 74% of patients , and this difference was most obvious when the gat measurement of iop exceeded 24 mmhg . no statistically significant variation in iop was noted between the devices when the patients age , sex , and laterality ( right and left eyes ) were considered.conclusionthere is a significant difference in the measurement of iop between gats and ap tonometers . goldmann applanation tonometry remains the most suitable and reliable method for measuring iop . because measurements of iop by ap tonometer are usually higher than those obtained by gat regardless of the patient s age , sex , or laterality of eyes , ap tonometry is a suitable method for community or mass screenings of iop .

You are an expert at summarizing long articles. Proceed to summarize the following text: swedish law mandates and regulates the registration of incident cancer cases in the swedish cancer register and deaths in the cause of death register . the cancer register contains each patient s 10-digit personal identity number , date of diagnosis , county of residence , and cancer site . the cause of death register contains the personal identity number , date of death , and underlying and contributory causes of death . since 1998 , approximately 98% of all incident prostate cancer cases in the swedish cancer register were also registered in the national prostate cancer register , including the reason for the work - up that led to diagnosis , tumor stage , gleason score , serum psa at time of diagnosis , and primary treatment ( 16,17 ) . we used the swedish cancer register to identify prostate cancer case patients diagnosed from january 1 , 1980 , to december 31 , 2009 , and linked by personal identity numbers ( 18 ) to the national prostate cancer register to obtain information on metastases at the time of diagnosis , evidenced by radiographic evaluation ( bone scans ) for the large majority of men or serum psa levels greater than 100ng / ml ( 16 ) . we obtained date and cause of death by linkage to the swedish cause of death register for death attributed to prostate cancer when it was coded as underlying cause of death . we calculated the predicted prostate cancer incidence that is , the incidence that would be expected if no psa testing had occurred . because psa testing was introduced in clinical practice in sweden in the 1990s , the prediction for each year up to 2009 was based on the observed incidence for the period from 1980 to 1990 . we used a linear regression model with a common slope for calendar year but separate intercepts for each county . age - adjusted prostate cancer incidence for men aged 50 to 74 years was calculated by direct standardization with weights from the swedish population census of 2000 ( 19 ) . we then calculated the cumulative difference between the observed and predicted age - adjusted prostate cancer incidence in men aged 50 to 74 years starting from 1995 and found a range of 126 per 100000 to 1634 per 100000 . we used this difference to categorize counties as having high , intermediate , or low prostate cancer incidence and chose the cutoffs of 100 per 100000 between low- and intermediate - incidence counties and 800 per 100000 between intermediate- and high - incidence counties . we used two measures of prostate cancer mortality prostate cancer specific mortality , which was based on the underlying cause of death given in the cause of death register ( 20,21 ) , and excess mortality ( 22 ) , based on the excess number of deaths ( observed minus expected ) regardless of cause of death among men with prostate cancer . we calculated the expected number of deaths as the product of person - years among the incident prostate cancer case patients and the total mortality rate in the population , calculated per year and per attained age in groups of 5 years . we determined prostate cancer mortality during two calendar periods , 1990 to 1999 and 2000 to 2009 . we calculated incidence - based mortality for each of the mortality measures based on deaths among men diagnosed with prostate cancer during the study period ( 20,21 ) . in addition , we calculated the 2000 to 2009 incidence of metastatic prostate cancer ( 23 ) . to determine incidence and mortality rates , we used person - years based on population statistics by year and by 5-year age group . all rates were measured at the population level ( with the male population , not the number of men with prostate cancer as denominator ) . we calculated rate ratios ( rrs ) for high- vs low - incidence counties and the rate ratios for the period from 2000 to 2009 vs the period from 1990 to 1999 within these two groups . finally we also determined rate ratios for high- vs low - incidence counties adjusted for time period by dividing by the corresponding rate ratio in the period from 1990 to 1999 . we calculated rate ratios for men aged 50 to 74 years and the subgroup aged 55 to 69 years , which was the core age group in the erspc study ( 24 ) . we based confidence intervals ( cis ) on the assumption of a poisson distribution of the number of events and calculated variances using the delta method on the logarithm of the estimates followed by normal approximation ( 25 ) . swedish law mandates and regulates the registration of incident cancer cases in the swedish cancer register and deaths in the cause of death register . the cancer register contains each patient s 10-digit personal identity number , date of diagnosis , county of residence , and cancer site . the cause of death register contains the personal identity number , date of death , and underlying and contributory causes of death . since 1998 , approximately 98% of all incident prostate cancer cases in the swedish cancer register were also registered in the national prostate cancer register , including the reason for the work - up that led to diagnosis , tumor stage , gleason score , serum psa at time of diagnosis , and primary treatment ( 16,17 ) . we used the swedish cancer register to identify prostate cancer case patients diagnosed from january 1 , 1980 , to december 31 , 2009 , and linked by personal identity numbers ( 18 ) to the national prostate cancer register to obtain information on metastases at the time of diagnosis , evidenced by radiographic evaluation ( bone scans ) for the large majority of men or serum psa levels greater than 100ng / ml ( 16 ) . we obtained date and cause of death by linkage to the swedish cause of death register for death attributed to prostate cancer when it was coded as underlying cause of death . we calculated the predicted prostate cancer incidence that is , the incidence that would be expected if no psa testing had occurred . because psa testing was introduced in clinical practice in sweden in the 1990s , the prediction for each year up to 2009 was based on the observed incidence for the period from 1980 to 1990 . we used a linear regression model with a common slope for calendar year but separate intercepts for each county . age - adjusted prostate cancer incidence for men aged 50 to 74 years was calculated by direct standardization with weights from the swedish population census of 2000 ( 19 ) . we then calculated the cumulative difference between the observed and predicted age - adjusted prostate cancer incidence in men aged 50 to 74 years starting from 1995 and found a range of 126 per 100000 to 1634 per 100000 . we used this difference to categorize counties as having high , intermediate , or low prostate cancer incidence and chose the cutoffs of 100 per 100000 between low- and intermediate - incidence counties and 800 per 100000 between intermediate- and high - incidence counties . we used two measures of prostate cancer mortality prostate cancer specific mortality , which was based on the underlying cause of death given in the cause of death register ( 20,21 ) , and excess mortality ( 22 ) , based on the excess number of deaths ( observed minus expected ) regardless of cause of death among men with prostate cancer . we calculated the expected number of deaths as the product of person - years among the incident prostate cancer case patients and the total mortality rate in the population , calculated per year and per attained age in groups of 5 years . we determined prostate cancer mortality during two calendar periods , 1990 to 1999 and 2000 to 2009 . we calculated incidence - based mortality for each of the mortality measures based on deaths among men diagnosed with prostate cancer during the study period ( 20,21 ) . in addition , we calculated the 2000 to 2009 incidence of metastatic prostate cancer ( 23 ) . to determine incidence and mortality rates , we used person - years based on population statistics by year and by 5-year age group . all rates were measured at the population level ( with the male population , not the number of men with prostate cancer as denominator ) . we calculated rate ratios ( rrs ) for high- vs low - incidence counties and the rate ratios for the period from 2000 to 2009 vs the period from 1990 to 1999 within these two groups . finally we also determined rate ratios for high- vs low - incidence counties adjusted for time period by dividing by the corresponding rate ratio in the period from 1990 to 1999 . we calculated rate ratios for men aged 50 to 74 years and the subgroup aged 55 to 69 years , which was the core age group in the erspc study ( 24 ) . we based confidence intervals ( cis ) on the assumption of a poisson distribution of the number of events and calculated variances using the delta method on the logarithm of the estimates followed by normal approximation ( 25 ) . between 1980 and 2009 , 197014 swedish men aged 50 to 74 years were diagnosed with prostate cancer , and of those , 6900 men with noninvasive or secondary prostate cancers were excluded from the study . flow chart of linkages between the swedish cancer register , the swedish cause of death register , and the national prostate cancer register of sweden and final study population . * distant metastasis defined as m1 and/or prostate - specific antigen 100ng / ml . there were 4528134 person - years at risk , 1577 deaths from prostate cancer , and 1210 excess deaths in men with prostate cancer in high - incidence counties and 2471373 person - years , 985 prostate cancer deaths , and 878 excess deaths in low - incidence counties in the period from 2000 to 2009 . a rapid increase in prostate cancer incidence began in some counties in 1990 but not until 10 years later in other counties ( figure 2a ) . figure 2b shows the cumulative difference between observed and predicted prostate cancer incidence in each county from 1995 to 2009 . the difference in incidence between the high- and low - incidence counties was largest in 2005 and decreased thereafter , disappearing in 2009 ( supplementary figure 1 , available online ) . counties ranked by the cumulative difference between observed and predicted prostate cancer incidence per 100000 from 1995 through 2002 . a ) observed and predicted age - standardized prostate cancer incidence in men aged 5074 years in 24 swedish counties during the period from 1980 to 2009 . b ) cumulative difference between observed and predicted incidence of prostate cancer during the period from 1995 to 2009 . negative differences resulting from the predicted incidence being higher than the observed incidence in low - incidence counties were set to zero . g & b = gteborg and bohus county ; h = high - incidence county ; l = low incidence county . in the period from 2000 to 2009 , the cumulative incidence of metastatic disease , prostate cancer specific mortality , and excess mortality was statistically significantly lower in high - incidence counties than in low incidence counties ( figure 3 , a c ) , with rate ratios of 0.85 ( 95% = 0.79 to 0.92 ) for metastatic disease , 0.87 ( 95% ci = 0.81 to 0.95 ) for prostate cancer specific mortality , and 0.75 ( 95% ci = 0.66 to 0.86 ) for excess mortality ( figure 4a ) . prostate cancer incidence and mortality in men in sweden aged 50 to 74 years , 2000 to 2009 . risk of prostate cancer mortality according to county of residency ( in groups of counties with high and low incidence ) and time period in groups of counties with high , intermediate and low incidence of prostate cancer a ) rate ratio ( rr ) of incidence of metastatic prostate cancer , prostate cancer specific mortality , and excess mortality in high- vs low - incidence counties . b ) rate ratio of prostate cancer specific mortality and excess mortality in the period from 2000 to 2009 vs the period from 1990 to 1999 . c ) rate ratio for high- vs low - incidence group adjusted for time period . * metastatic prostate cancer defined as m1 and/or prostate - specific antigen 100ng / ml at diagnosis . * * excess mortality defined as the excess number of deaths ( observed minus expected ) , regardless of cause of death among men with prostate cancer . ci = confidence interval . in high - incidence counties , prostate cancer specific mortaliy and excess mortality were statistically significantly lower during the period from 2000 to 2009 than during the period from 1990 to 1999 , and we observed similar , albeit somewhat weaker differences in low - incidence counties ( figure 4b ) . when taking both county group and time period into consideration , the differences in cancer - specific mortality and excess mortality between high- vs low - incidence counties remained statistically significant ( figure 4c ) . the rate ratios adjusted for time period for high- vs low - incidence counties were 0.81 ( 95% ci = 0.73 to 0.90 ) for prostate cancer specific mortality and 0.74 ( 95% ci = 0.64 to 0.86 ) for excess mortality , and the rate ratios for the subgroup of men aged 55 to 69 years were similar . the estimated rate ratio of prostate cancer specific mortality of 0.81 would correspond to an annual absolute reduction at 0.23 per 1000 men when applied to the swedish prostate cancer mortality year 2000 in the age group 55 to 79 years . data in the national prostate cancer register from 2000 to 2009 indicated that diagnostic and therapeutic activity was higher in high - incidence counties than in low - incidence counties ( table 1 ) . in the high - incidence counties , median age at diagnosis was lower , a higher proportion of men had low - risk cancer ( clinical stage t1t2 , gleason score 26 , and psa < 10ng / ml at diagnosis ) , a higher proportion underwent radical prostatectomy , and median serum psa at diagnosis was lower . the difference between high- vs low - incidence counties in diagnostic psa levels was largest in 2000 ( 10.0 vs 17.6ng / ml ) and decreased steadily after that ( supplementary table 1 , available online ) . the use of radiotherapy and radical prostatectomy showed similar temporal trends with the highest use in high - incidence counties and with a decreasing difference over time ( supplementary figure 2 , available online ) . characteristics of men aged 50 to 74 years with prostate cancer in the national prostate cancer register of sweden , 2000 to 2009 * * iqr = interquartile range ; psa = prostate - specific antigen ; sd = standard deviation . initiated or planned within the 6 months after diagnosis . low risk : t1 to 2 , gleason score 2 to 6 , and psa < 10ng / ml . intermediate risk : t1 to 2 , gleason score 7 , and/or psa 10 to < 20ng / ml . high risk : t3 , and/or gleason score 8 to 10 , and/or psa 20 to < 50ng / ml . regionally metastatic disease : t4 and/or n1 and/or psa 50 to < 100ng / ml in the absence of distant metastases ( m0 or mx ) . in this register - based , population - based study in sweden , incidence of metastatic prostate cancer was 15% lower , and prostate cancer specific mortality and excess mortality adjusted for time period were 19% and 26% lower , respectively , in counties with high vs low incidence of prostate cancer , reflective of early vs late uptake of psa testing . the strength of our study lies in its population - based design , its magnitude , the completeness of the registers , and the equal access health care in the two study groups . it covered nearly 7 million person - years at risk and 2562 prostate cancer deaths registered between 2000 and 2009 and had the power to detect moderately strong associations between psa testing and prostate cancer death . furthermore , psa testing is likely to be particularly effective in sweden because prostate cancer mortality is higher in sweden than in other countries , with a lifetime risk of prostate cancer death of 5% to 6% , so swedish men with prostate cancer are at high risk of disease progression ( 26 ) . other strengths of our study were the use of incidence - based mortality , which enabled us to avoid diluting risk estimates by including deaths among men diagnosed before the introduction of psa testing , and the use of three separate endpoints incidence of metastatic prostate cancer , prostate cancer - specific mortality , and excess mortality . the swedish cancer register captures 96% of all cancer diagnoses , and the capture rate is particularly high for solid tumors and in subjects aged less 70 years ( 27 ) . for example , in the gteborg screening trial , there was a 96% agreement between a chart review of death certificates and the cause of death register ( 28 ) , and in another study with a wider range in stage and grade , the agreement was 86% ( 29 ) . besides prostate cancer specific mortality , we also investigated the incidence of metastatic prostate cancer , which was the first indication of the efficacy of psa screening in the european trials ( 1,2 ) . we assessed the occurrence of metastatic disease at date of diagnosis by use of data on the presence of bone metastases or a serum level greater than 100ng / ml available from 2000 in the national prostate cancer register . our study also had some limitations because we were unable to directly measure the extent of psa testing in the population . instead , we used the difference between the observed and predicted cumulative incidence of prostate cancer under the assumption that a high incidence indicated an early introduction and a high prevalence of psa testing with ensuing early prostate cancer diagnosis and treatment . this assumption was corroborated by data in the national prostate cancer register on distribution of risk categories with lower median serum psa levels at diagnosis , higher proportion of clinically localized low - risk cancers , higher proportion of curative treatments , and a lower age at diagnosis in high- vs low - incidence counties . geographical comparisons can be hampered by differences in baseline risk , and prior observational studies comparing high and low prostate cancer incidence areas in the united states reported no difference in prostate cancer mortality ( 12,13 ) . in the first time period of our study , prostate cancer specific mortality was higher in high - incidence counties than in low - incidence counties , showing that the subsequently lower prostate cancer mortality in high - incidence counties was not simply the result of differences in baseline risk . temporal comparisons can be hampered by changes in diagnostic criteria over time and thus can also be affected by bias . to address these issues , we made separate geographical and temporal comparisons and used a combined approach as well , including adjustment for time periods in the analysis of geographical differences . the decrease in excess mortality was consistently larger than the decrease in prostate cancer specific mortality . excess mortality likely overestimates the benefit of screening because it reflects a lower mortality from causes other than prostate cancer . there may be selection bias for healthy swedish men with a long life expectancy who undergo psa testing and early detection , as suggested in a previous study in the national prostate cancer register , which showed lower 10-year all - cause mortality among men with low- and intermediate - risk prostate cancer compared with the background population , indicating a healthy screenee effect ( 30 ) . specific mortality underestimates the risk reduction because it is affected by attribution bias ; death from an uncertain cause is more likely attributed to prostate cancer in men with a prostate cancer diagnosis than in other men ( 31 ) . furthermore , our follow - up time was 10 years at maximum , which is likely too short a time to reap the full effect of early detection . finally , confounding by unknown factors can not be ruled out . despite these shortcomings , a higher incidence of prostate cancer the erspc study , the largest randomized screening trial to date with 761 prostate cancer deaths , showed virtually the same reduction ( 21% ) in mortality observed after 11 years of follow - up as our study ( 1 ) . in the gteborg screening trial in sweden , based on 122 prostate cancer deaths , a larger reduction in mortality was observed ( 44% ) , likely because of the longer median follow - up of 14 years . speculatively , the larger effect in the gteborg trial compared with our observations may , in addition to a longer follow - up , also be because of a more stringent work - up of men with elevated serum psa in a trial setting and to a superior diagnostic and therapeutic level of care in a high - volume setting as compared with our results that were based on routine clinical practice among all health - care providers in 14 swedish counties . our results from a population - based , real - life study indicate that more - intense as compared with less - intense opportunistic psa screening decreases prostate cancer mortality , which reconciles the findings of the two largest trials on psa screening to date , namely erspc ( organized vs no screening ) and plco ( organized vs opportunistic screening ) and is congruent with the reduction of prostate cancer mortality that has occurred in the united states during the last decades , during which time period early diagnosis and early treatment has increased drastically ( 32 ) . however , opportunistic screening as it is currently implemented in real life is inefficient and is implemented too frequently in the wrong age groups . in a recent swedish study , 6% of men aged 40 to 49 years , 16% of men age 50 to 59 years , 27% of men aged 60 to 69 years , 30% of men aged 70 to 79 years , and 23% of men age 80 to 89 years had an annual psa test ( 33 ) , whereas in the united states , 45% of men aged 75 years and older have a yearly psa test ( 34 ) . the frequent psa testing of older men leads to overdetection and overtreatment , and to maximize the benefits while at the same time minimizing the adverse effects of screening and ensuing treatment , risk - stratified screening with regular but infrequent psa testing of middle - aged men holds promise ( 35 ) . in conclusion , in our population - based study we observed lower incidence of metastatic prostate cancer , lower prostate cancer specific mortality , and lower excess mortality in counties with high vs low incidence of prostate cancer , reflecting psa uptake . this indicates that more - intense as compared with less - intense opportunistic psa screening reduces prostate cancer mortality . this work was funded by the swedish research council 825 - 2008 - 5910 and the swedish cancer society 11 0471 , vsterbotten county council , and lions cancer research foundation at ume university , sweden . hl is supported by grants from the national cancer institute ( r33 ca 127768 - 03 , p50-ca92629 ) ; the swedish cancer society ( 110624 ) ; the sidney kimmel center for prostate and urologic cancers ; david h. koch through the prostate cancer foundation ; the national institute for health research , oxford biomedical research centre , oxford university hospitals nhs trust and university of oxford ; and fundacin federico sa . sc is supported by grants from the swedish cancer society , the sweden america foundation , the swedish council for working life and social research , and the swedish society for medical research .

backgroundthe effect of prostate - specific antigen ( psa ) screening on prostate cancer mortality remains debated , despite evidence from randomized trials . we investigated the association between prostate cancer incidence , reflecting uptake of psa testing , and prostate cancer mortality.methodsthe study population consisted of all men aged 50 to 74 years residing in eight counties in sweden with an early increase in prostate cancer incidence and six counties with a late increase during two time periods . incidence of metastatic prostate cancer was investigated in the period from 2000 to 2009 , and prostate cancer specific mortality and excess mortality were investigated in the period from 1990 to 1999 and the period from 2000 to 2009 by calculating rate ratios for high- vs low - incidence counties and rate ratios for the period from 2000 to 2009 vs the period from 1990 to 1999 within these two groups . all statistical tests were two-sided.resultsthere were 4528134 person - years at risk , 1577 deaths from prostate cancer , and 1210 excess deaths in men with prostate cancer in high - incidence counties and 2471373 person - years at risk , 985 prostate cancer deaths , and 878 excess deaths in low - incidence counties in the period from 2000 to 2009 . rate ratios in counties with high vs low incidence adjusted for time period were 0.81 ( 95% confidence interval [ ci ] = 0.73 to 0.90 ) for prostate cancer specific mortality and 0.74 ( 95% ci = 0.64 to 0.86 ) for excess mortality , and the rate ratio of metastatic prostate cancer was 0.85 ( 95% ci = 0.79 to 0.92).conclusionsthe lower prostate cancer mortality in high - incidence counties reflecting a high psa uptake suggests that more - intense as compared with less - intense opportunistic psa screening reduces prostate cancer mortality .

You are an expert at summarizing long articles. Proceed to summarize the following text: intracranial hemorrhage from moyamoya disease has been infrequently reported during pregnancy , and is exceptional in a caucasian pregnant woman . the intensive care management is also complicated as the patient may present both ischemic or hemorrhagic complications . we present a case with a favorable outcome despite a low glasgow coma score ( gcs ) on admission and refractory high intracranial pressure . a 26-year - old caucasian pregnant woman at 36 weeks of gestation presented to the emergency department of a first hospital for a severe headache . soon after admission , she developed generalized tonic - clonic seizures with a gcs at 3 immediately after seizure . a caesarian section was performed without any delay under general anesthesia and mechanical ventilation . the brain computerized tomography ( ct ) performed immediately after revealed extensive bilateral intraventricular hemorrhage and a large hematoma in the splenium of the corpus callosum . an external ventricular drain was inserted bilaterally . despite bilateral ventricular drainage and intensive care management , intracranial pressure ( icp ) the patient was transferred to the university hospital on day 8 . on admission , gcs was 3/15 with abolition of brainstem reflexes . as the eeg showed burst suppression , barbiturate overdose was suspected and continuous infusion was stopped . however , high intracranial pressure persisted above 40 mm hg . on brain ct ( fig . 1 ) , the size of the intraventricular hemorrhage had decreased on the left but not on the right side and the sulci were diffusely obliterated , confirming the intracranial hypertension . the right drain was impinged in the ventricular clot and was ineffective , even after the in loco infusion of a fibrinolytic agent ( 5 mg rt - pa ) , leading to refractory high intracranial pressure . endoscopic removal of the right ventricular clots was first tried , but it was necessary to perform a larger right frontal craniotomy . intracranial pressure decreased postoperatively but the gcs remained at 3/15 with absence of brainstem reflexes . a brain magnetic resonance imaging ( mri ) performed on day 20 showed the partial removal of the intraventricular clot with decreased ventricular size and reopening of the sulci . mr - angiography disclosed extensive arterial anomalies with occlusion of the right internal carotid artery ( ica ) , severe stenosis of the left ica and of the m1 segment of the left middle cerebral arteries ( mca ) , occlusion of the left posterior cerebral artery , collaterals arising from the external carotid arteries , and an extensive abnormal vascular network appearing as multiple small collateral vessels developed mainly in basal cisterna and in the thalami ( fig . this pattern evoked a moyamoya syndrome that occurred very early in age as demonstrated by the hypoplastic right bony carotid canal ( fig . perfusion - weighted mri showed moderate hemodynamic disturbances in both hemispheres , predominant on the left side , with delayed time - to - peak , prolonged mean - transit time and a compensatory increased cerebral blood volume . the patient was monitored in the neurosurgical intensive care unit ( nicu ) by a continuous measurement of jugular bulb venous oxygen saturation ( svjo2 ) . while normal values are in the range of 6065% , values ranging from 5055% were obtained in our patient . these values were considered as relatively low in a patient who was mildly hypothermic ( 35c ) and who had a remaining barbiturate impregnation as assessed by the eeg pattern and by the determination of serum thiopental concentration ( 28.5 g / ml ) . other factors that could have lowered svjo2 were ruled out ( hypoxia or hypercapnia ) . cerebral perfusion pressure ( cpp ) was maintained higher than 70 mm hg by a continuous norepinephrine infusion , with pao2 > 100 mm hg , paco2 > 30 mm hg , and hemoglobin concentration above 12 g / dl , with svjo2 values reaching 60% as a result . on day 16 , brainstem reflexes reappeared and gcs was 6 ( e1 , v1 , m4 ) , improving to e4 , v1 , m5 two days later . the patient was discharged from the nicu on day 40 with a gcs of 11/15 . intracranial hemorrhage during pregnancy is , in most cases , caused by cerebral aneurysms , arteriovenous malformation , and rarely by moyamoya disease . moyamoya disease is characterized by the formation of an abnormal vascular network , known as moyamoya vessels , secondary to the progressive stenosis or occlusion of the distal icas and proximal aspects of the main cerebral arteries . its etiology is unknown and the clinical presentation of this rare condition is usually characterized by recurrent ischemic strokes . different possible causes of intracranial hemorrhage in moyamoya disease were debated : rupture of saccular aneurysm in the circle of willis or small peripheral pseudoaneurysm , usually arising from the perforating arteries or choroidal arteries or rupture of fragile moyamoya vessels in the basal ganglia . intracranial hemorrhage at atypical sites such as callosal body and mesencephalon should raise suspicion of moyamoya disease . in the present case , the origin of the intraventricular bleeding was likely a rupture of fragile moyamoya vessels in the corpus callosum . we excluded moyamoya syndrome secondary to irradiation of the head , down syndrome , brain tumor , neurofibromatosis and meningitis . intracranial hemorrhage from moyamoya disease has been infrequently reported during pregnancy , and is exceptional in a caucasian pregnant woman in comparison with asian women . there is no firm evidence that pregnancy in patients with moyamoya disease is a risk factor for intracranial hemorrhage or cerebral ischemia . our patient had an uneventful pregnancy and delivery 3 years before . however , it appears logical that intracranial hemorrhage usually occurs in and after the second trimester related to hemodynamic changes during pregnancy . the maternal prognosis of such bleeding is usually poor . in a recent fatal case similar to our observation , a 29-year - old female developed intraventricular hemorrhage at 14 weeks of gestation , together with repeated bilateral cerebral infarction . the possibility of arterial vasospasm after intraventricular bleeding due to moyamoya disease is still debated . vasospasm is observed not only after subarachnoid hemorrhage , but also in patients with ruptured arteriovenous malformations resulting in intraventricular hemorrhage without subarachnoid clot . in moyamoya disease , the patient 's brain appears particularly vulnerable to ischemic conditions for several reasons : stenosis or occlusion of one or more major cerebral arteries , reduced caliber of the moyamoya vessels , and possible vasospasm . the intensive care management of the patients presenting simultaneously with ischemic and hemorrhagic complications from moyamoya disease appears difficult , particularly when high intracranial pressure is also present . the first objective is to obtain an adequate control of intracranial pressure ( icp ) . hemodynamic reserve for changes of intracranial perfusion pressure may be severely impaired in patients with moyamoya disease . intraventricular hemorrhage results in hydrocephalus , followed by increased icp . because hemodynamic insufficiency and an increase in icp may cause irreversible ischemia , resolution of increased icp is critical for patients with moyamoya disease in terms of cerebral hemodynamics [ 10 , 11 ] . ventricular drainage is the first measure , but may be ineffective when clots become obstructive . there are insufficient data to recommend the local use of fibrinolytic agents , even if in some series they seemed to enhance clot lysis [ 11 , 12 ] . endoscopic removal of the hematoma during ventriculostomy is a surgical option , or even , as in the present case , thrombectomy after craniotomy . hyperventilation is deleterious in moyamoya patients , showing that the abnormal vessels are hypersensitive to some physiologic parameters such as pco2 . the continuous monitoring of jugular bulb svjo2 is extensively used for detecting episodes of cerebral hypoxia / ischemia . it is determined by oxygen arterial saturation ( sao2 ) , hemoglobin concentration , cerebral blood flow , and cerebral metabolic rate of oxygen . in patients with traumatic brain injury , the ischemic threshold for svjo2 is less than 50% , but the value for other conditions is not precisely known . in the present case , svjo2 values of 50% were considered as low in a patient who was mildly hypothermic and still under the influence of barbiturates . as ischemic lesions were demonstrated on the brain ct , we tried to optimize oxygen delivery by maintaining the cpp at 70 mm hg , with also a special attention to respiratory parameters and to hemoglobin concentration . however , we agree that there are no literature data confirming that the therapy should be directly oriented to obtain svjo2 values higher than 60% . in conclusion , intraventricular hemorrhage following moyamoya disease is a rare entity during pregnancy , particularly in caucasian women . as some patients may have experienced a previous pregnancy without complication , it remains difficult to establish the risk factor directly related to pregnancy . the prognosis , usually poor , could be influenced by surgical removal of the clot , in case of refractory high icp , and by the adequate management of hemodynamic and respiratory parameters , particularly in the type with both hemorrhagic and ischemic complications . vasospasm is a possible complication that can not be easily demonstrated in this particular setting . the question if a revascularization procedure is effective to prevent rebleeding is not yet fully answered .

intraventricular hemorrhage during pregnancy is usually followed by a poor recovery . when caused by moyamoya disease , ischemic or hemorrhagic episodes may complicate the management of high intracranial pressure . a 26-year - old caucasian woman presented with generalized seizures and a glasgow coma score ( gcs ) of 3 during the 36th week of pregnancy . the fetus was delivered by caesarean section . the brain ct in the mother revealed bilateral intraventricular hemorrhage , a callosal hematoma , hydrocephalus and right frontal ischemia . refractory high intracranial pressure developed and required bilateral ventricular drainage and intensive care treatment with barbiturates and hypothermia . magnetic resonance imaging and cerebral angiography revealed a moyamoya syndrome with rupture of the abnormal collateral vascular network as the cause of the hemorrhage . intracranial pressure could only be controlled after the surgical removal of the clots after a large opening of the right ventricle . despite an initially low gcs , this patient made a good functional recovery at one year follow - up . management of refractory high intracranial pressure following moyamoya related intraventricular bleeding should require optimal removal of ventricular clots and appropriate control of cerebral hemodynamics to avoid ischemic or hemorrhagic complications .

You are an expert at summarizing long articles. Proceed to summarize the following text: mucopolysaccharidoses ( mps ) are a group of rare inherited disorders characterized by abnormal accumulation of glycosaminoglycans ( gags ) in various tissues . a common feature of several of these disorders is cardiac involvement , which often includes anatomic and functional abnormalities of the heart valves . mps types i ix each results from a deficiency of enzymes that are involved in the stepwise degradation of gags such as dermatan , keratan , heparin and chondroitin sulfates . mps iii comprises four related inborn errors of lysosomal degradation of heparan sulfate , known as mps iii types a , b , c , and d. all of them are characterized by progressive mental deterioration and behavioral problems , with only mild facial dysmorphism and mild somatic disease . the onset and severity of the disease are highly variable , but symptoms rarely appear during the first year of life . mps iii - a , or sanfilippo syndrome type a ( omim#252900 ) , arises when the activity of the enzyme n - sulfoglucosamine sulfohydrolase ( heparan n - sulfatase or sulfamidase ; ec 3.10.1.1 ) is lost . the sulfamidase gene ( sgsh;605270 ) is 11 kb long , comprises 8 exons , and is located on chromosome 17q25.3 . to date , around 140 different mutations associated with mps iii - a have been identified ( hgmd 2014 ) ( http://www.hgmd.org ) . cardiac compromise , including anatomical and functional abnormalities of the cardiac valves , myocardial hypertrophy , thickened chordae tendineae , and narrowing of the coronary arteries , develops in most patients with mps , , , , . involvement of the mitral valve , often associated with an aortic valve anomaly and/or left ventricular hypertrophy , is the most common presentation . cardiomyopathy has been reported in mps i and vi , , . however , cardiac involvement in mps iii is generally mild , . we report a case of a patient with mps iii - a who presented cardiac symptoms in the first year of life , ultimately requiring mitral valve replacement surgery in childhood . a 6-month - old girl was admitted to a tertiary public children 's hospital in northeast brazil for evaluation of signs and symptoms of cardiac insufficiency . the weight and length at birth were 2900 g and 49 cm respectively . according to her mother , the patient had exhibited cyanosis since age 1 month . the patient responded to medical therapy and was lost to follow - up until age 6 years , when she returned with anasarca and pneumonia . on physical examination , she had coarse facial features , with thick hair , a low hairline , thick eyebrows with synophrys , a wide and flat nasal bridge , thick lips and full cheeks ; generalized hirsutism ; short neck ; a cardiac murmur ; and hepatosplenomegaly . an echocardiogram showed dilated cardiomyopathy , rupture of the mitral chordae tendineae , severe mitral insufficiency , and mild tricuspid insufficiency . a ct scan of the chest revealed right apical pneumonia and left atelectasis in the lingula . the diagnosis of mps was confirmed by increased urinary excretion of heparan sulfate and deficient sulfamidase activity on leukocytes . the patient underwent cardiac surgery for mitral valve repair ( placement of biological prosthesis ) , which was completed successfully with an uneventful postoperative course . genomic dna was extracted from peripheral blood sample using a standard salting - out procedure . all coding exons of sgsh gene and intron - exon boundaries were amplified by polymerase chain reaction ( pcr ) as per beesley et al . . pcr fragments were sequenced using a standard protocol and submitted to capillary electrophoresis on a 3500 applied biosystems dna analyzer . cdna and protein numbering were based on the reference sequences nm_000199.3 and the nomenclature used for reporting sequence variants was according to . after bidirectional sequencing of all exons of the sgsh gene , we were able to identify three different alterations in homozygosis : c.239 g > t ( p.g80v ) , c.1337 a > g ( p.h446r ) and c.524 t > c ( p.y174y ) . these variants have not been previously described in the single nucleotide polymorphism database ( dbsnp ; http://www.ncbi.nlm.nih.gov/ ) and the human gene mutation database ( hgmd ) ( http://www.hgmd.org ) . according to polyphen ( http://genetics.bwh.harvard.edu/pph2/ ) algorithm , c.239 g > t ( p.g80v ) is predicted to be probably damaging , with a score of 1.00 , and c.1337 a > g ( p.h446r ) is predicted to be a benign mutation , with a score of 0 . genomic dna was extracted from peripheral blood sample using a standard salting - out procedure . all coding exons of sgsh gene and intron - exon boundaries were amplified by polymerase chain reaction ( pcr ) as per beesley et al . . pcr fragments were sequenced using a standard protocol and submitted to capillary electrophoresis on a 3500 applied biosystems dna analyzer . cdna and protein numbering were based on the reference sequences nm_000199.3 and the nomenclature used for reporting sequence variants was according to . after bidirectional sequencing of all exons of the sgsh gene , we were able to identify three different alterations in homozygosis : c.239 g > t ( p.g80v ) , c.1337 a > g ( p.h446r ) and c.524 t > c ( p.y174y ) . these variants have not been previously described in the single nucleotide polymorphism database ( dbsnp ; http://www.ncbi.nlm.nih.gov/ ) and the human gene mutation database ( hgmd ) ( http://www.hgmd.org ) . according to polyphen ( http://genetics.bwh.harvard.edu/pph2/ ) algorithm , c.239 g > t ( p.g80v ) is predicted to be probably damaging , with a score of 1.00 , and c.1337 a > g ( p.h446r ) is predicted to be a benign mutation , with a score of 0 . cardiac involvement is detected early in life in more than half of all patients identified as having mps , but it is rarely the first presenting feature of mps iii , as the case presented herein . cardiomyopathy and cardiac valve insufficiency develop as gag accumulates in the myocardium , expands the spongiosa of the cardiac valves , and proliferates within the myointima of the epicardial coronary arteries . in the most severe cases of mps i and mps vi , congestive heart failure and death occur in the first decade of life , , , , . in mps iii , however , severe cardiac manifestations are extremely rare , although a report of cardiomyopathy in a 53-year - old patient with mps iii - a patient has been published in the literature . besides that , in one patient with severe mitral valve stenosis , the detection of unexplained hepatomegaly led to further metabolic studies and , ultimately , a diagnosis of mps iii - a . in another case of mps iii - c , studied 57 cases of mps regarding cardiac symptoms , and found that only four had such symptoms as the presenting feature ( mps i , age 1.2 years ; mps ii , age 3 years ; mps iii , age 9 years ; mps iv , age 0.3 years ) . in the case presented herein , there was no initial suspicion of mps during the first year of life because the patient did not exhibit dysmorphic features or neurological impairment . in the literature , there are few cases of mps iii in which developmental delay was noted from birth ; in the majority of cases , symptoms were first noted at a median age of 2.5 years , and consisted of developmental delay and/or behavioral problems , . dangel examined 20 patients with mps iii and found that 50% had a normal echocardiogram , but one 8-year - old girl had congestive cardiomyopathy with severely impaired left ventricular function . phenotype association as the pathogenic mutation described here is novel , we are not able to predict if this is associated with a higher risk of development of cardiac disease . we propose that mps , including mps iii - a , should be suspected and added to the differential diagnosis of all patients presenting with cardiomyopathy during the first year of life , even without somatic feature characteristic of mps . we do not know whether severe cardiac involvement in mps iii - a is rare or simply underdiagnosed . however , the finding that mps iii is also associated with secondary storage of dermatan sulfate suggests that other organs , in addition to those of the nervous central system , can be severely affected by this disorder . furthermore , the rapidly lethal course of cardiomyopathy may hinder diagnostic investigation of mps in affected patients . erlane marques ribeiro , ida vanessa schwartz , ana carolina brusius - facchin , sandra leistner - segal and carlos antnio bruno da silva declare that they have no conflicts of interest . all procedures were conducted in accordance with the ethical standards of the institutional and national committees on human experimentation and with the 1975 declaration of helsinki , as revised in 2000 .

severe cardiac involvement is a common feature of mucopolysaccharidoses ( mps ) , but occurs only rarely in mps iii ( sanfilippo syndrome ) . we report herein a case of mps iii - a having cardiac involvement as its first manifestation . analysis of the sgsh gene showed homozygosity for the novel mutation p.g80v . we propose that mps disorders , including mps iii - a , should be included in the differential diagnosis of every case of cardiomyopathy presenting during the first year of life .

You are an expert at summarizing long articles. Proceed to summarize the following text: first , a person must have symptoms severe enough for medical care ( multiplier 1 ) . second , the physician must collect patients specimens ( multiplier 2 ) and forward them for testing by bacterial culture ( multiplier 3 ) . third , the sample test result must be positive ( multiplier 4 ) , and the confirmed case must be reported ( multiplier 5 ) ( 2,7,8 ) . to obtain multiplier 1 , we conducted a 12-month population - based household survey during march 1 , 2012february 28 , 2013 ( approved by the ethics committee of guangdong cdc ) . respondents were randomly selected from 4 districts in western , eastern , and central guangdong province . we used a standard questionnaire to collect information about diarrhea in the previous 4 weeks . the incidence rate of diarrhea was 0.1081 ( 95% ci 0.10040.1158 ) episodes / person - year ; 38.6% of the household survey respondents with diarrhea sought medical care . multipliers 2 and 3 were based on data from sentinel hospitals and comprised the overall number of diarrhea cases , samples collected , and samples submitted for culture during the year . a total of 75,583 ( 45.3% ) samples of 166,729 registered diarrhea cases in the sentinel hospitals were collected , of which 22,577 ( 29.9% ) were tested . laboratories of sentinel hospitals cultured samples for salmonella in accordance with standard protocol provided by the national reference laboratory by using macconkey agar as plating medium . according to a proficiency testing program , the numbers of salmonella isolates identified and reported to nndrs as nts infectious diarrhea by all sentinel hospitals yielded the proportion of cases reported ( 648/1,061 , 61.1% ) ( multiplier 5 ) . based passive surveillance system , multiplier 1 was the same as for active surveillance . according to a comparison with samples from the submission proportion in a survey of physician - diagnosed diarrhea in guangdong province during 2009 ( mann - whitney test , p = 0.246 ) ( 11 ) , and a comparison between medical institutions that charged and did not charge for testing ( kolmogorov - smirnov test , p = 0.837 ) , the proportion of samples submitted and tested from active surveillance were also used as estimates of passive surveillance . the average test sensitivity of sentinel laboratories before active surveillance began was used as an estimate of all medical institutions ( i.e. , the sensitivity of passive surveillance [ 48.2% ] ) . using numbers of salmonella isolates in guangdong province from laboratory data , and number of reported nts cases by all medical institutions , we determined the proportion of reported nts was 9.6% ( 991/10,360 ) . thus , for each reported nts case under passive surveillance , 414.8 cases actually occurred . multipliers of 5 age groups also were presented ( table 1 ) . to generate a more robust estimate , we conducted uncertainty and sensitivity analyses ( online technical appendix , http://wwwnc.cdc.gov/eid/article/22/4/15-1372-techapp1.pdf ) on passive surveillance data using monte carlo simulation ( @risk 6.0 ; palisade , ithaca , ny , usa ) ( 12 ) . we used distribution to describe the uncertainty of proportions and negative binominal distribution to estimate the number of cases . the uncertainty analysis model predicted a 411.9 ( 95% ci 308.4592.7 ) overall multiplier and estimated that 408,499 ( 95% ci 302,899591,901 ) salmonella cases occurred per year when the overall multiplier was applied to the 991 reported nts cases , resulting in 391.6 ( 95% ci 290.3567.4 ) cases/100,000 persons in 2012 . the rank correlation of various factors in the model showed that patients seeking medical care provided the highest uncertainty in the overall estimate ( influence rate 96% ) ( figure ) . rank correlations for the total number of nontyphoidal salmonella cases in the population ( tornado diagram ) , guangdong province , china , 2012 . our estimated nts incidence was lower than the incidence in china as determined from a literature review ( 626.5 cases/100,000 persons ) ( 13 ) but close to that in the united states ( 352.1 cases/100,000 persons ) ( 3 ) . however , incidences for persons < 5 years of age and 524 years of age in our study were higher than those for persons in china and the united states , highlighting that salmonella represents a major health problem in guangdong province , especially among younger persons . our estimated active surveillance rate ( 35.8 ) of nts infections per reported case is similar to estimates in the united states ( 38.6 and 39 ) ( 2,10 ) but different from those for england ( 3.2 ) , jordan ( 278 ) , and japan ( 63 ) ( 7,8,14 ) . such differences might be due to differences in methods used and to actual differences in salmonella infections . with fewer missing cases and less underestimation , active surveillance has lower overall multipliers than passive surveillance , indicating smaller surveillance artifacts and more accurate incidence estimate and presents remarkable advantages over passive surveillance . the estimate for active surveillance also showed that if we seek to reduce uncertainty in the overall estimate , we should first focus on encouraging patients to seek medical care . our study provides policymakers in china with a reference for the importance of salmonella incidence and calls for balanced surveillance on both foodborne infections and foods and enlarging active surveillance scales . more surveillance guidelines need to be developed to help physicians identify timing of sampling , tests , and performance . laws requiring reporting of foodborne diseases and pathogens need to be enacted to increase quantity and quality of reporting . the result suggests that to increase care seeking and sample submission , government health insurance schemes should be further developed to cover diagnostic tests and treatments of diseases of public health significance . uncertainty and sensitivity analysis and study limitations for a study of nontyphoidal salmonella infection , guangdong province , china , 2012 .

we used active and passive surveillance to estimate nontyphoidal salmonella ( nts ) infection during 2012 in guangdong province , china . under passive surveillance , for every reported nts infection , an estimated 414.8 cases occurred annually . under active surveillance , an estimated 35.8 cases occurred . active surveillance provides remarkable advantages in incidence estimate .

You are an expert at summarizing long articles. Proceed to summarize the following text: cardiovascular diseases is a common chronic disease all around the world causing high rate of mortality and disability . world health organization estimates that by 2020 , 25% of healthy life years would be wasted as a consequence of cardiovascular diseases and most of these patients originate from developing countries . studies conducted in iran show that mortality resulting from cardiovascular diseases is the primary reason of death in iran . nowadays hospice is a place of care designed to provided continued care at end of life . generally hospice means specified cares in order to create relaxation and support of patient and his / her family in a time that long - term treatments have not been useful and death is inevitable . agnes and colleagues showed that there are important differences between american and hungarian doctors ideas and attitudes about end - of - life cares . since death of these patients ( end - of - life ) is inevitable and considering the fact that no hospice services have been designed and provided yet in iran , and as the results of searches show no study has been conducted on this topic in iran and studies conducted in other countries on cardiovascular patients are limited , there is a great need for designing and providing hospice services in iran . in order to do so , first attitudes and points of view of people involved in this issue should be investigated . one of the most important group of these people are nurses who are responsible for the major part of providing services in health and care unit and have important role in taking care of these people . therefore current study aims to investigate the points of view of nursing staff about designing and providing hospice services in iran for cardiovascular patients in their final stages of life . this is a qualitative study aiming to investigate the points of view of nursing staff about designing and providing hospice services in iran for cardiovascular patients in their final stages of life . the reason of selecting qualitative method was its ability in accessing to the inside story of participants and extracting their experiences , knowledge and their silent information . participants were nursing staff of cardiac care unit ( ccu ) in hospitals of tabriz university of medical sciences . these people were selected due to their high experience facing with cardiovascular patients in the final stages of life and also having wide and rich information about cardiovascular cares provided to patients and their conditions . inclusion criteria were having at least 5 years of working experience in ccu , having adequate and proper knowledge of hospice care , and having tendency and ability for participating in study . to select participants , some people are selected as participants who have the most and the richest information and who are able to convey their information in the best way to researchers . this continued up to reaching informational saturation ; that is a stage in which researchers feel that no information could be gained by sampling . in current study 16 participants guiding questions were used which were questions about : possibility of designing and providing these services in iran , welcoming of authorities , service providers , patients , families , cultural and religious condition of iranian society about designing and providing these services , costs of these services , and official and legal aspects . duration of each of interviews varied between 45 and 90 minutes . to standardize interviews , the interviewer was trained and some demo interviews were conducted before starting the study , results of which were not analyzed . participants speeches were recorded after acquiring their permission and also interviewers were taking notes to register information during interviews . texts of interviews were immediately listened to by researchers for some times and were transferred to word 2007 software . to analyze data , responded validity was used for rigor of data in a way that at the end of session , speeches of attendants were summarized and represented to them in order for validity of notes to be verified by attendants . also peer checking and immersed data , which are methods of creating rigor data were used . to consider ethical issues which are very important in qualitative studies informed consent of participants was acquired and participants had the right of leaving study in any stage by their free will . moreover study objectives were clarified to participants at the beginning . to conduct this study , moral verification was acquired from regional committee of ethics in research located in tabriz university of medical sciences . in this study , perspectives of 16 nurses working in ccus of hospitals of tabriz university of medical sciences - iran , about designing and providing hospice services for cardiovascular patients in their final stages of lives were investigated . some of the nurses were for providing and designing these services in iran for cardiovascular patients and some were against this issue . finally 33 themes were extracted in 8 general under study fields , which have been shown in tables 1 and 2 . perspectives of nurses about designing and providing hospice services for cardiovascular patients in their final stages of life group 1 - nurses supporting hospice services points of view of nurses about designing and providing hospice services for cardiovascular patients in their final stages of life group 2 - nurses opposing hospice services the results of current study showed that some nurses support designing and providing these services in iran and have a positive point of view about it . the main reasons of this people for their support are : possibility of designing and providing these services with regard to high ethical values in iranian society ; welcoming of authorities due to increasing load of chronic diseases and aged population ; welcoming of service providers due to sense of philanthropy ; welcoming of families due to the problems in taking care of patients and life concerns ; welcoming of patients due to the feeling of disturbing family ; lower pain and respectful death ; welcoming of society due to sublime humanistic values ; decrease of costs as a result of lower usage of diagnostic - therapeutic services , of expensive facilities and drugs and better usage of hospital beds . on the other side , some nurses were against designing and providing these services for cardiovascular patients in our country because of lack of cooperation of physicians , lack of resources and cultural conditions of society , low motivation of authorities and operational problems , problems for women providers and lack of time , lack of support by families due to cultural and religious issues , lack of support by society due to traditionalistic nature of people , lack of awareness of people and lack of trust on service providers , increase in costs as a result of increasing need for more human resources and their training and need for more space for providing these services . most of the nurses have a positive point of view of hospice services but some of them were disagreeing on its designing and implementing due to conditions of our country . previous studies conducted in this field showed that nurses , physicians and other health service providers have a positive point of view about hospice services which is in accordance with the results of this study . therefore since having positive attitude of hospice service providers could be one of the main conditions and requirements needed for designing and implementing these services , changing point of view and attitudes of these people before designing and providing services seems necessary . as in many parts of the world providing required trainings to students and health service providers has been considered as effective strategy for this purpose , and much educational interventions are designed and implemented for this regard . it seems that considering educational credits for nursing courses in nursing faculties and holding training courses for nurses in their working place could have an effective role in acquiring positive attitude toward hospice services in points of view of nurses . based on the results of study and perspectives of nurses , it is possible to conclude that patient 's family could play an important role in providing hospice services in iran . in this field , hauser and kramer believe that families have a main and direct role in providing hospice services to patients . beside the supporting and caring role of family members , which is necessary , the skill and abilities of family members in taking care of patients is also very important matter . in a qualitative study conducted aiming to design the framework of medication management skills of family members in caring of patients at their end life and providing hospice services to them , role of family members is also mentioned , especially their caring skills . therefore in order to design and provide hospice services in iran , it is better to train family members of patients and make the best benefit of their supports . it is possible to mention to decrease in hospitalization period , not using expensive drugs , and limited usage of experimental tests as the main important reasons of these people . this decrease is also shown in the study of pedro and colleagues in 2008 , which investigates costs paid by government to these services . on the other hand , some nurses believed that as a result of need for more human resources , need for more space and facilities , training medical staff and families and some other reasons , designing and providing these services could cause increase in medical and health costs . so before designing and providing these services , it is necessary to conduct pilot study of cost - effectiveness and economical evaluation studies . also proper managerial acts would be necessary to control and decrease costs if these services would be designed and provided . by analyzing and coding the statements of participants of the study ( opponents and supporters ) , it is possible to conclude that communications and culturization among policy makers and managers , providers of health and medical services especially hospice services , patients , family members and society have very important role in acceptance and success of providing hospice services . lack of information and knowledge of nurses were one of the barriers of this study , and to overcome this problem , researchers provided nurses with some notes before interviews , so they could collect some information about the subject matter . due to increasing load of chronic diseases and aged population in iran , the need for designing and providing hospice services is felt more than before . by analyzing perspectives of nurses in this study , the aspects of designing and providing these services for cardiovascular patients in their end life , its operational aspects , and conditions of current iranian system about designing and providing these services were investigated . using and applying the results of this study in planning and policy making for designing and providing hospice services in iran could be useful .

introduction : the present study was conducted aiming to determine the points of view of cardiac care units nursing staff about designing and providing hospice services in iran for cardiovascular patients in the final stages of life.materials and methods : in this qualitative study , the perspectives of 16 cardiac care unit ( ccu ) nurses selected purposefully among hospitals of tabriz - iran university of medical sciences were investigated using semi - structured interviews and were analyzed in content analysis method.results:33 themes were finally extracted . some nurses were for and some were against designing and providing hospice services in iran . the main reasons identified for supporting this plan included : possibility of designing and providing these services consistent with high ethical values of iranian society ; approval of authorities due to increasing the load of chronic diseases and aged population ; need of families due to the problems in taking care of patients and life concerns ; better pain relief and respectful death ; decrease of costs as a result of lower usage of diagnostic - therapeutic services , less use of expensive facilities and drugs , and better usage of hospital beds.conclusion:growing load of chronic diseases has made the need for hospice as a necessary issue in iran . in order to provide these services , studying the viewpoints of health service providers is inevitable . therefore using and applying the results of this study in planning and policy making about designing and providing these services in iran for cardiovascular patients in their final stages of lives could be helpful .

You are an expert at summarizing long articles. Proceed to summarize the following text: obesity is not only a problem of appearance , but also a main cause of various lifestyle diseases such as hyperlipidemia , hypertension , cardiovascular diseases , and diabetes . although obesity has emerged as a cause of these complications , in reality , there are lack of efforts to prevent and manage it , thu , the prevalence of obesity is steadily increasing . obesity is mainly caused by lack of regular physical exercise , westernized diet , genetic factors , and excessive and unbalanced nutrition . especially , the workers have high vulnerability to obesity and lifestyle diseases by unhealthy life habits such as lack of physical exercise due to busy work , stress , eating - out , and alcohol consumption . impact of intestinal microbes on obesity and health is a new topic started to get attention recently . in 2009 , an experimental research was introduced to prove the hypothesis , " gastrointestinal bacteria contribute to obesity . " four atypical human twins ( pair of one lean and one obese twin ) were recruited . the observed results have shown that mice received gastrointestinal bacteria from the lean twin maintained their weight whereas mice transplanted with gut microbiota from obese twin showed a rapid weight gain . after the researchers confirmed " the effects of gastrointestinal bacterial transplantation on obesity " , they assessed two mice received bacteria from one pair of twins by an additional experiment to verify the exchange of two different bacteria . it confirmed the unidirectionality of bacterial survival , in which the gut microbiota from obese mice ceases to survive in the gastrointestinal tract of lean mice whereas bacteria from lean mice survived in the obese mice . bacteria in the gastrointestinal tract of lean mice did not tolerate high proportion of saturated fat ' human ' diet with less fruits and vegetables but transformed into the bacteria in the fat twin . follow - up studies have confirmed that diet determines the composition of a bacteria , and gastrointestinal bacteria has an impact on obesity . considering to the global concern and research trends , there are few research on the association between intestinal bacteria and body weight change in korean . in this report , one voluntary case ( female ) will be introduced to show the change in gut microbiota and weight by diet intervention . the 27-year - old korean woman with no underlying disease or medical history volunteered in this research to improve obesity . she visited outpatient department of family medicine on october 1 , 2013 . according to anthropometric measurements , she was 1.73 meters tall with body mass index ( bmi ) of 23.2 kg / m with weight of 69.5 kilograms . the who regional office for the asia pacific region recommends defines obesity by a bmi 25 kg / m and overweight by bmi above 23 kg / m and below 25 in asians . the korean society for the study of obesity also adopted the who - recommended definition to study the cutoff of bmi for obesity - related disease . now , korean government organizations officially use this definition when defining and implementing health policies regarding obesity in korea . after verifying obesity test results , she was explained about the research in detail and asked to compose a meal record for three days prior to the test . the result from the hospital 's dietician showed the causes of overweight are frequent drinking and meat consumption at late evening hours . to determine the diet responsible for the weight loss , change in the intakes of total calorie , carbohydrate , and fat ( especially animal fat ) the result showed that overall intakes of total calories , carbohydrate , and protein were evenly decreased after the diet intervention , and the reduction in large amount of animal fat was observed by cutting down the consumption of fish and meat . the amount of alcohol she consumes at once is approximately total of 95 grams ; from 30 grams in 4.5 glasses of soju and 65 grams in 9 cups of beer . blood and urine tests were performed to determine whether comorbid conditions associated with drinking habit . the results confirmed normal except for mild anemia ( hemoglobin , hb 11.6g / dl ) and mild increases in aspartate aminotransferase ( ast ; 58iu / l ) . in detail , frequent intake of carbohydrate= and excessive consumption of fish , meat , bread , ice cream , etc . at late evening hours however , after the diet intervention , she put efforts to reduce food intake and select vegetable side dishes and fruit as a replacement for snacks , thus , average consumption of calories , carbohydrates , protein , and animal fat decreased ( table 1 ) . additionally , decrease in frequency of food intake with high in sodium such as soup or stew was observed . changed behavior in alcohol consumption can not be determined by the short study period ; however , a consultation confirmed that she managed to reduce her alcohol intake by approximately 50 percent . for 47 days , she was administered an improved diet with breakfast and dinner with less meat and reduction of alcohol consumption and frequency by 50% and once a week , respectively . at the second follow - up the request on case 's fecal sample analysis was submitted to chunlab , inc . prior to participating in diet improvement research . after the 47 days of research , the case 's fecal sample was again collected on november 19 , 2013 to compare the distribution of intestinal micro flora with the first sample . bacterial dna was extracted from the fecal samples of subjects before and after the treatment using a fastdna spin extraction kit ( mp biomedicals , santa ana , ca , usa ) . gut microbiota were compared before and after the treatment using the high - throughput sequencing technique . the compositions of phyla and genera were compared between before and after the diet correction . firmicutes was predominant phylum ( 75.7% of total microbiota ) before the diet correction , whereas firmicutes ( 47.3% ) and bacteroidetes ( 47.7% ) were dominant phyla after the diet correction . in sample collected before the diet correction , genera of faecalibacterium ( 14.9% of total microbiota ) , roseburia ( 14.8% ) , blautia ( 9.5% ) and lactobacillus ( 9.1% ) within firmicutes , and prevotella ( 15.0% ) within bacteroidetes after the diet correction , the relative abundance of prevotella ( 42.1% of total microbiota ) and megasphaera ( 10.7% ) within firmicutes was observed , while those of faecalibacterium ( 8.6% ) , roseburia ( 1.2% ) , blautia ( 3.0% ) , and lactobacillus ( 1.7% ) were decreased . the proportion of bacteroides ( 4.4% ) within bacteroidetes was also increased after sample ( figure 1 ) . the 27-year - old korean woman with no underlying disease or medical history volunteered in this research to improve obesity . she visited outpatient department of family medicine on october 1 , 2013 . according to anthropometric measurements , she was 1.73 meters tall with body mass index ( bmi ) of 23.2 kg / m with weight of 69.5 kilograms . the who regional office for the asia pacific region recommends defines obesity by a bmi 25 kg / m and overweight by bmi above 23 kg / m and below 25 in asians . the korean society for the study of obesity also adopted the who - recommended definition to study the cutoff of bmi for obesity - related disease . now , korean government organizations officially use this definition when defining and implementing health policies regarding obesity in korea . after verifying obesity test results , she was explained about the research in detail and asked to compose a meal record for three days prior to the test . the result from the hospital 's dietician showed the causes of overweight are frequent drinking and meat consumption at late evening hours . to determine the diet responsible for the weight loss , change in the intakes of total calorie , carbohydrate , and fat ( especially animal fat ) were analyzed based on the diet history of the case . the result showed that overall intakes of total calories , carbohydrate , and protein were evenly decreased after the diet intervention , and the reduction in large amount of animal fat was observed by cutting down the consumption of fish and meat . the amount of alcohol she consumes at once is approximately total of 95 grams ; from 30 grams in 4.5 glasses of soju and 65 grams in 9 cups of beer . blood and urine tests were performed to determine whether comorbid conditions associated with drinking habit . the results confirmed normal except for mild anemia ( hemoglobin , hb 11.6g / dl ) and mild increases in aspartate aminotransferase ( ast ; 58iu / l ) . in detail , frequent intake of carbohydrate= and excessive consumption of fish , meat , bread , ice cream , etc . at late evening hours however , after the diet intervention , she put efforts to reduce food intake and select vegetable side dishes and fruit as a replacement for snacks , thus , average consumption of calories , carbohydrates , protein , and animal fat decreased ( table 1 ) . additionally , decrease in frequency of food intake with high in sodium such as soup or stew was observed . changed behavior in alcohol consumption can not be determined by the short study period ; however , a consultation confirmed that she managed to reduce her alcohol intake by approximately 50 percent . for 47 days , she was administered an improved diet with breakfast and dinner with less meat and reduction of alcohol consumption and frequency by 50% and once a week , respectively . at the second follow - up the request on case 's fecal sample analysis was submitted to chunlab , inc . prior to participating in diet improvement research . after the 47 days of research , the case 's fecal sample was again collected on november 19 , 2013 to compare the distribution of intestinal micro flora with the first sample . the seoul national university - boramae hospital institutional review board approved this study bacterial dna was extracted from the fecal samples of subjects before and after the treatment using a fastdna spin extraction kit ( mp biomedicals , santa ana , ca , usa ) . gut microbiota were compared before and after the treatment using the high - throughput sequencing technique . the compositions of phyla and genera were compared between before and after the diet correction . firmicutes was predominant phylum ( 75.7% of total microbiota ) before the diet correction , whereas firmicutes ( 47.3% ) and bacteroidetes ( 47.7% ) were dominant phyla after the diet correction . in sample collected before the diet correction , genera of faecalibacterium ( 14.9% of total microbiota ) , roseburia ( 14.8% ) , blautia ( 9.5% ) and lactobacillus ( 9.1% ) within firmicutes , and prevotella ( 15.0% ) within bacteroidetes after the diet correction , the relative abundance of prevotella ( 42.1% of total microbiota ) and megasphaera ( 10.7% ) within firmicutes was observed , while those of faecalibacterium ( 8.6% ) , roseburia ( 1.2% ) , blautia ( 3.0% ) , and lactobacillus ( 1.7% ) were decreased . the proportion of bacteroides ( 4.4% ) within bacteroidetes was also increased after sample ( figure 1 ) . this observation , confirmed the association between the changes in body weight , diet and gut microbiota . in particular , 3 kilograms of body weight was reduced by diet correction , which includes limiting the overall intakes of total calories , fat , protein , and carbohydrate , as well as reducing salt intake and alcohol consumption frequency . considering previous studies with various method of short - term dietary interventions , it is observed that a person with diet intervention showed 2 - 4% additional weight loss than general attempts . during the weight loss , this change was consistent with previous studies which determined that the ratio of firmicutes / bacteroidetes was higher in an obese person than a lean person . although the impact on gut microbiota depends on genetic , and environmental factors , and obesity , obese people showed a change of microbiota on the phylum levels and rapid decrease of microbiota diversity compared to healthy people . it is meaningful to confirm the changes in gut microbiota and weight loss through the diet intervention . further study on this subject is needed to investigate the effect of dietary intervention on body weight loss and gut microbiota change .

impact of intestinal microbes on obesity and health is a new topic recently started to get attention . comparing to the global concern and research trends , there are few research on the association between intestinal bacteria and life style disease in korean . one voluntary case ( female ) was reported to show the change in gut microbiota and weight by diet intervention . she was overweight ( bmi 23.2 kg / m2 ) and has abnormal liver function , and the causes of overweight were frequent drinking and meat consumption at the late evening hours . for 47 days , she was administered an improved diet on breakfast and dinner with reduction of meat consumption frequency by 50% . alcohol consumption was reduced to once a week . as a result , she lost 3 kilograms of body weight . her fecal sample was collected before and after the intervention , and gut microbiota change was compared using a high - throughput sequencing technique . after diet correction , the shift of gut microbiota was clearly observed with decreased proportion of firmicutes ( from 75.7% to 47.3% in total microbiota ) but increased proportion of bacteroidetes upto 47.7% . after incorporating the diet intervention , it is meaningful to confirm the changes in dominant gut microbiota and weight loss .

You are an expert at summarizing long articles. Proceed to summarize the following text: melanoma remains a public health concern , as incidence continues to rise with mortality remaining stable . a 53-year - old caucasian female was diagnosed with malignant melanoma of the superficial spreading variant on the right shoulder in 1992 ; the tumor , originally 4 cm in diameter , was considered adequately excised along the length of her right shoulder with 3 mm maximal depth . the patient presented to the emergency department complaining of sudden , worsening shortness of breath and palpitations for 5 days . she denied any chest pain , cough , orthopnea or paroxysmal nocturnal dyspnea . on examination , her blood pressure was 123/70 and pulse at 115 beats per minute with respiratory rate at 25 breaths per minute with oxygen saturations at 95% on room air . electrocardiogram ( ecg ) documented upon arrival showed sinus tachycardia with diffuse , low - voltage qrs complexes . blood workup , which included complete blood count , comprehensive metabolic profile , and troponin levels , was within normal limits . chest x - ray found an enlarged cardiomediastinal silhouette with mild pulmonary edema ( fig . 1 ) . a computed tomography angiography ( cta ) of the chest to rule out pulmonary embolism ( pe ) was ordered . after the patient returned from imaging , she was found to have a heart rate of 178 . patient was awake , did not appear to be in any more distress and remained hemodynamically stable . a transthoracic echocardiogram depicted a large mass measuring 5 cm by 7 cm occupying the basal and mid portion of the anterior and lateral walls of the left ventricles with large pericardial effusion located at the lateral posterior wall of the heart , findings suggestive of impending tamponade ( fig . 2 ) . cta of the chest reported no acute pe with a large mass ( 10.5 7.5 9.5 cm ) occupying the anterior wall of the left ventricle and extending to the pulmonary outflow tract ( fig . figure 1:anterior posterior one view chest x - ray depicting enlarged cardiomediastinal silhouette with mild pulmonary edema . figure 2:transthoracic echocardiogram depicting large effusion within pericardial membrane with left ventricular mass . figure 3:large ventricular mass measuring 10.5 7.5 9.5 cm invading epicardium and myocardium . posterior one view chest x - ray depicting enlarged cardiomediastinal silhouette with mild pulmonary edema . cardiothoracic surgery team was consulted , and the patient underwent a pericardial window with 750 cc of serosanguinous fluid drained from her pericardial space . a chest tube placed status - post pericardial window , which initially continued to drain 500 cc of serosanguinous fluid , with fluid volume decreasing in the following 5 days with stable vital signs . amiodarone and discharged upon her request to restart chemotherapy , after removal of her chest tube . histopathology results of the pericardial fluid were positive for reactive mesothelial cells and chronic inflammation . follow - up positron emission tomography ( pet)/ct scan depicted increased uptake in the cardiac chamber ( fig . 4 ) . repeated echocardiography 2 months later depicted a return in pericardial fluid with the patient remaining hemodynamically stable with preserved ejection fraction . to better stage malignant melanomas , breslow first established a rating system in 1970 to estimate prognoses . his staging system , based on thickness of metastatic tumor and depth of invasion , continues to be of value in assessing prognosis . our patient , having received a breslow depth of 3 mm , qualified for a stage iv ; stage iv 5-year survival rates are 1520% . nearly one - third of all patients diagnosed with metastatic melanoma will experience reoccurrence of their disease . metastatic melanomas are considered common neoplasms having the propensity to metastasize to a multitude of regions , including the heart . for patients with a history of malignant melanomas , up to 71% of them can have some cardiac metastatic involvement , while only 10% of them are actually symptomatic . within the heart , our patient had no right atrium findings ; the mass had invaded both the epicardium and myocardium of the left ventricle . in addition , the patient continued to remain hemodynamically stable despite the large metastatic mass present within her left ventricle . for patients with cardiac metastatic melanoma involvement , hemorrhagic pericardial effusions are often the first presentations of such involvement . utilizing ecgs to detect cardiac involvement may prove futile ; while patients with normal ecgs were less likely to have cardiac metastases , nonspecific st - t wave changes were difficult in differentiating involvement . the typical presentation of cardiac tamponade is hypotension , pulsus paradoxus > 12 mmhg and elevated jugular venous pressures , or alternate - beat variation in the beat , direction , amplitude and duration of a component of the ecg . for our patient , there was difficulty in appreciating ecg findings such as low - voltage or eletricans alternans due to her ventricular tachycardia . for patients with a history of melanoma , metastatic involvement the unique aspect of our case is the length of asymptomatic metastatic growth . for patients with a history of stage iv malignant melanoma , close follow - up should be thoroughly maintained , regardless of symptomatology , to determine if there are any metastases . ecg may not be a reliable source to rule out pericardial involvement as such findings are nonspecific and unreliable and should therefore not be used as the only test to exclude cardiac involvement .

a 53-year - old non - distressed caucasian female complains of dyspnea and palpitations for 5 days . past medical history includes stage iv melanoma with adequate resection 23 years prior . the patient suddenly became increasingly tachycardic in mild respiratory distress while maintaining hemodynamic stability . tte depicted 10.5 7.5 9.5 cm3 mass within her left ventricle and a large volume of pericardial effusion , which progressed to cardiac tamponade . pericardial window was performed . metastatic involvement should be ruled out for all symptomatic patients with a history of melanoma .

You are an expert at summarizing long articles. Proceed to summarize the following text: catecholaminergic polymorphic ventricular tachycardia ( cpvt ) is an inherited arrhythmogenic disease that can cause syncope or sudden cardiac death during emotional or physical stress in the absence of detectable structural heart disease and a prolonged qt interval on an electrocardiogram ( ecg ) . mutations in two genes , the cardiac ryanodine receptor gene ( ryr2 ) and calsequestrin 2 gene ( casq2 ) , have been identified in patients with cpvt . these mutations lead to an increase in intracellular ca concentration , resulting in life - threatening ventricular arrhythmias , possibly via delayed depolarizations . a 16-year - old male , who had suffered from recurrent episodes of syncope triggered by physical exertion was referred to our hospital after undergoing defibrillation at a local emergency department ( ed ) . he had lost consciousness at school during a volleyball test that was also emotionally stressful . an initial ecg at a local ed revealed ventricular fibrillation . although his arrhythmia was converted to sinus rhythm after defibrillation , the patient was stuporous and had repeated episodes of nonsustained ventricular tachycardia ( vt ) . after referral to our hospital , ecg monitoring in the ed and intensive care unit showed intermittent nonsustained vt and bidirectional vt ( fig . when the patient became agitated , his heart rate increased , and the ecg showed nonsustained polymorphic vt despite intravenous administration of a -blocker . he was sedated and placed on mechanical ventilation . two days later , his heart rate was regular , and no additional episodes of vt were observed . his ecg showed a sinus rhythm with a corrected qt interval of 423 msec ( fig . 2 ) . routine laboratory findings , including electrolytes and two - dimensional echocardiography , were unremarkable . a detailed history of the patient included several episodes of syncope since the age of 8 years associated with physical activities , such as sprinting , playing football , and fighting with a sibling . his father also experienced an episode of syncope associated with sprinting at the age of 9 years . the patient and his family underwent a genetic analysis , and his father and mother each had one different de novo missense mutation in ryr2 ( exon 97 c.14009t > a p.l4670h in the father and exon 37 c.5428g > c p.v1810l in the mother ) . as his episodes of syncope were associated with sympathetic activation , an exercise ecg test and epinephrine infusion test ( intravenous bolus of 0.1 g / kg followed by continuous infusion at rates of 0.1 g / kg per minute ) were performed . however , only premature ventricular complex ( pvc ) bigeminy was induced with no episodes of syncope during the exercise ecg test ( fig . 3 ) and epinephrine only increased his heart rate without an arrhythmia . with these clinical features , we made the diagnosis of cpvt . atenolol ( 37.5 mg bid ; 1.9 mg / kg / day ) was prescribed , and a follow - up exercise ecg test while on the -blocker was performed 3 days later . during the follow - up exercise ecg test the patient remains on 50 mg bid atenolol ( 2.3 mg / kg / day ) and is being followed . to date catecholaminergic polymorphic ventricular tachycardia , arrhythmogenic right ventricular cardiomyopathy , and long qt syndrome are well known causes of exercise - induced syncope that commonly manifest normal baseline ecgs.1)2 ) therefore , many provocation tests , including vt induction , an exercise ecg test , and epinephrine infusion tests , have been used to diagnose exercise - induced syncope.1)2 ) exercise - induced bidirectional vt has been considered the hallmark of cpvt for many years . however , recent studies1)2 ) have shown that ventricular bigeminy is the most common exercise - induced arrhythmia among patients with cpvt , and serious arrhythmias such as bidirectional vt and polymorphic vt are rarely induced . therefore , exercise - induced ventricular bigeminy no longer should be considered an innocent arrhythmia , at least in suspicious cases of cpvt . catecholaminergic polymorphic ventricular tachycardia may have both an autosomal dominant and an autosomal recessive pattern of inheritance . the more common type 1 autosomal dominant cpvt is caused by mutations in ryr2 on chromosome 1q42-q42 and results from defective calcium release from the sarcoplasmic reticulum , which is required for myocardial contraction.3 ) a mutation in ryr2 can increase calcium release and cause life - threatening ventricular arrhythmias . patients with ryr2 mutations become symptomatic at an early age , and men are at higher risk for cardiac events.4 ) in the autosomal recessive variant , type 2 cpvt , the causative gene is casq2 , located on chromosome 1p13 - 21.5 ) casq2 encodes calsequestrin , a calcium buffering protein in the sarcoplasmic reticulum , which binds a large amount of calcium . while the mechanism by which this mutation causes ventricular arrhythmias has not been clearly established , the mutated protein may be associated with the following : loss of polymerization of casq monomers , loss of calcium buffering capability , or indirect destabilization of the ryanodine receptor channel.6)7 ) patients with cpvt , in which many forms of exercise are associated with catecholamine release that triggers vt , should be cautioned against virtually all forms of vigorous and/or competitive physical activity.8 ) since the early reports on cpvt , -blockers have been used as primary therapy for cpvt,9)10 ) and they are indicated for both chronic treatment and acute therapy for sustained vt . other antiarrhythmic drugs such as amiodarone and class i drugs have proved to be ineffective.11 ) however , these issues were addressed in a study that evaluated both the molecular mechanisms and clinical efficacy of flecainide in mice and humans.12 ) implantable cardioverter defibrillators can be considered for primary prevention despite the potential drawbacks in young patients and concerns about provoking arrhythmic storms . left cardiac sympathetic denervation has been reported effective in patients whose symptoms were not adequately controlled by -blockers.13 ) this approach may also be considered for individuals with intractable arrhythmic storms to reduce the number of implantable cardioverter - defibrillator shocks .

a 16-year - old male with a prior history of recurrent syncope was referred to our hospital after being resuscitated from cardiac arrest developed while playing volleyball . his electrocardiogram ( ecg ) demonstrated ventricular fibrillation at a local emergency department . after referral , an ecg showed bidirectional ventricular tachycardia ( vt ) and nonsustained torsade de pointes . two days later , his heart rate became regular , and no additional episodes of vt were observed . his ecg showed sinus rhythm with a corrected qt interval of 423 msec , and two - dimensional echocardiography was unremarkable . we made the diagnosis of a catecholaminergic polymorphic vt . however , only premature ventricular complex bigeminy was induced on exercise ecg and epinephrine infusion tests , and the patient showed no episodes of syncope . his father and mother had different missense mutations in the cardiac ryanodine receptor on genetic testing . the proband had both mutations in different alleles and was symptomatic . it was recommended that the patient avoid competitive physical activities , and a -blocker was prescribed .

You are an expert at summarizing long articles. Proceed to summarize the following text: low back pain is classified as acute , sub - acute , or chronic according to the duration of symptoms1 . chronic low back pain is normally consistent back pain experienced for more than 12 weeks2 . more than 80% of the world population experiences low back pain at least once , and 15% of that 80% suffer from chronic low back pain due to unrecovered symptoms3 . unbalanced mobilization order among stability muscles and mobility muscles , as well as muscle length , causes low back pain5 . for patients with low back pain , deep muscle exercise is required to counteract muscle atrophy and damage to the deep muscles2 . it was found that patients with low back pain experienced a mobilization delay in their deep muscles , which generates activation and contraction before the movement of the limbs6 . for lumbar region stability , strengthening and co - contraction of the multifidus and transversus abdominis ( ta ) , which are deep stability muscles , and the erector spinae ( es ) and abdominal muscles , which are superficial stabilizer muscles , is required7 . in recent years , the trunk stability approach has been widely used as a method of spine treatment , and many efforts have been made to objectively prove the effect . among the exercises for trunk muscle activity of patients with low back pain , the effect of ball exercise has been reported to comprehensively improve muscle strength , endurance , and flexibility , as well as strengthen body reflexes , sense of balance and proprioception8 . in addition , stanton et al.9 reported that the swiss ball exercise is an effective stability exercise for trunk core muscles . pnf has been recommended for sensory - motor control training , as well as for stimulating lumbar muscle proprioception10 . among the pnf patterns , the motions of the sprinter ( sp ) and skater ( sk ) patterns were reported to have the advantages of not only strengthening the muscle due to large - scale movement , but also functional training due to active motor control , the strengthening of coordination , increases in the active range of motion , and the efficient control of movement11 . this study aimed to determine effective methods for pain reduction through the activation of the ta and the es by comparing lumbar strengthening training using a ball , which is generally carried out along with traditional physiotherapy treatment for lumbar stabilization , and pnf combination patterns12 . the goal was to increase patients muscle strength , stability , and coordination control ability by inducing isometric contractions in manufacturing workers who had chronic low back pain . the subjects of this study were 40 adult manufacturing workers from d industrial , located in daegu metropolitan city , who had previously experienced cardiovascular system but not orthopedic illnesses , who currently had no specific exercise plan , and carried out daily living activities experiencing had chronic low back pain . the participants in this study were told prior to the start of the experiment about the purpose and procedure of the experiment , as well as potential effects of the experiment . all the participants understood the purpose of this study and provided their written informed consent prior to their participation in the study in accordance with the ethical standards of the declaration of helsinki . the participants were randomly and equally assigned to a pnf combination pattern group ( experimental group ) and a ball exercise group ( control group ) . the average age , height , and weight of the experimental group were 34.750.85 years , 174.071.05 cm , and 71.254.59 kg , respectively . the average age , height , and weight of the control group were 34.200.69 years , 172.851.24 cm , and 70.753.81 kg , respectively . the experimental group performed a combination of sprinter / skater posture in a bridge position , sprinter / skater posture in a side - lying position , sprinter / skater posture in a sitting position , and sprinter / skater posture in a standing position for 15 minutes in parallel with pnf . the ball exercise group in the control group was told that the femoral region must be parallel to the floor while sitting on the ball , and that their knees should maintain a 90-degree angle , using jandas13 basic principle program . the ball exercise was done with two 20-repetition sets of pelvic tilts ( anterior / posterior , right / left , circle ) while sitting on the ball . then , two sets of hip lifts while lying back on the ball were performed , lifting one leg while lifting the hip , lifting the hip while bending the knees , and lifting the hip while bending the knee and lifting one leg for 10 seconds . following this , one set of marching was performed while lying with the chest on the ball and crunching , followed by arching while holding the ball between the calves , moving the body right and left while lifting the legs on the ball , bridging , and right and left stretches while leaning on the ball , for 10 seconds each . the participants subjectively recorded their pain on a sheet of 10-cm - long paper divided by 10 lines . pain was rated on a scale of 0 to 10 , in which 0 indicated that the participant could not feel the symptom of low back pain and could carry out daily life without any problems , while 10 indicated that the participant could not stand the pain and could not conduct daily living activities at all due to continuous severe pain . pain measurement was performed prior to the exercises , and again at two weeks , four weeks , and six weeks after the start of the intervention . in order to measure muscle activity , the maximal voluntary isometric contraction ( mvic ) of each muscle was obtained by manual muscle testing , and root mean square ( rms ) values of the mvic of each muscle were calculated . the flexcomp infiniti emg ( thought technology ltd . canada ) , a surface electromyogram ( emg ) , was used for muscle activity measurement . muscle activity was measured by attaching surface electrodes 3 cm away from the spinous process at the lateral side for es , and 2 cm from the inferior medial area of the anterior superior iliac spine ( asis ) for ta14 . the recorded surface emg analog signal was , converted to a digital signal , and then filtered and processed using infiniti software ( v. 3.0 ) on a personal computer . for statistical processing of data in this study , spss v. 18.0 was used to analyze the data with a its significance level of =0.05 . in order to determine the changes in pain and muscle activity of the pnf and ball exercise groups , repeated anova measurements were performed and the bonferroni correction was used to compare data between measurement times . in order to find the significance of differences between the groups with regard to muscle activity and pain , the independent t - test was performed . the pnf combination pattern group and the ball exercise group showed significant reductions of vas over time ( p<0.05 ) ( table 1table 1 . variation of vas score during the intervention period ( unit : score)pre2 weeks4 weeks6 weekspnf pattern group ( n=20)7.951.004.951.002.850.811.500.69ball exercise group ( n=20)7.851.005.200.833.251.122.100.85 , significant difference between pre and 6 weeks , , significant difference between pnf pattern group and ball exercise group at 6 weeks . ) . after 6 weeks of the intervention , the pnf combination pattern group showed a more significant reduction of vas than the ball exercise group ( p<0.05 ) . , significant difference between pre and 6 weeks , , significant difference between pnf pattern group and ball exercise group at 6 weeks . in the ball exercise and pnf combination pattern groups , each group showed muscle activity increases in ta and es over time ( table 2table 2 . variation of transverse abdominal and erector spinae muscles during the intervention period ( unit : % mvic)musclegrouppre2 weeks4 weeks6 weekstapnf pattern ( n=20)33.867.4538.066.2239.916.9242.066.70ball exercise ( n=20)34.507.3140.267.1140.077.4340.727.27espnf pattern ( n=20)50.0615.8951.6913.7053.4615.3156.1015.96ball exercise ( n=20)49.8710.2653.589.0353.929.4155.358.42 , significant difference between pre and 6 weeks , , significant difference between pnf pattern group and ball exercise group at 6 weeks . ) , while ta showed no statistically significant difference between the two groups over time ( p>0.05 ) , es showed a statistically significant difference between the two groups over time ( p<0.05 ) . , significant difference between pre and 6 weeks , , significant difference between pnf pattern group and ball exercise group at 6 weeks . patients with chronic low back pain frequently experience a decrease in lumbar flexibility and a weakening of muscle strength and endurance due to decreased motility . as a result , low back movement depression can lead to increased pain in patients with chronic low back pain and muscle fatigue . strengthening low back muscles therefore , this study aimed to determine whether conduct of the pnf combination pattern and ball exercise were effective at increasing trunk muscle activity in patients with chronic low back pain , in order to find an effective method of exercise for chronic low back pain . in this study , low back pain was assessed using the vas in order to determine the effect of the exercise treatment on the subjective pain intensity of patients with low back pain . the reason for the reduction in pain in both groups was the training of unbalanced trunk muscles , which induced an interaction between the trunk muscles which reduced pain . in a related study , lee et al.16 reported a significant reduction in pain of patients with chronic low back pain after training the patients with a ball , a result consistent with our study result . kofotolis and kellis17 also reported the reduction of pain in the lumbar muscle of patients with chronic low back pain after a pnf program consisting of static and dynamic pnf programs , a result which was also consistent with our study result . furthermore , our present study also showed that pain reduction was greater in the pnf combination pattern group than in the ball exercise group after six weeks of training . the reasons for this are that the pnf combination patterns used a technique that used the limbs to indirectly affect the pain area in a posture which did not cause pain to the patients with low back pain , in order to avoid direct stimulation of the pain area . in particular , the pnf technique is one that controls the proprioception and sensory - motor functions to reduce pain further . nachemson et al.18 reported that extensor muscles are more closely related to low back pain than flexor muscles . in this study , the pnf combination patterns technique started in a side - lying position , which was followed by a standing position , so the extensors acted as an anti - gravity muscle , thereby strengthening extensor muscle strength to effectively reduce pain . hodges and richardson19 reported that unbalanced trunk muscles in patients with chronic low back pain should be trained to balance the trunk muscles interactively , and that trunk muscle strength was an essential element for maintaining spinal stability , so that muscle strength becomes be a foundational support for maintaining balance . in that sense , the pnf combination pattern and ball exercise groups in our study significantly reduced low back pain through the balanced training of trunk muscles and training induced increase in muscle strength . in a similar study , kofotolis and kellis17 directly applied the pnf technique to the shoulder area of the trunk for four weeks . they reported that trunk endurance increased significantly by indirectly inducing the motion of the trunk , giving resistance to the limbs . in this study , while muscle activity increased in both the pnf combination pattern ball exercise groups , the pnf combination pattern group showed a more significant increase than the ball exercise group . this can be explained by the fact that the pnf combination patterns technique concentrated on sprinter and skater patterns , and that trunk muscle activity increased more than in the lumbar stabilization group using ball exercise , which used a combination of isotonic techniques . accordingly , we anticipate that low back pain would be reduced if the sprinter and skater pnf combination patterns used in this study are applied to patients with chronic low back pain , in order to improve trunk stability . therefore , our study results can be a clinical foundation for the effectiveness of exercise treatment for trunk muscle stabilization of patients with chronic low back pain . first , the intensity of the application of the isotonic combination was not uniform when the pnf combination patterns were applied . also , we did not measure the subjects balance abilities , so the quantitative improvement of balance ability due to improvement of stabilizing muscles could not be presented . in the future , the limitations of this study can be overcome by demonstrating the appropriate application intensity and proper way of measuring balance ability in order to verify the effectiveness of the pnf combination patterns .

[ purpose ] the purpose of this study was to compare two methods for the muscle stabilization of the trunk of patients with chronic low back pain . the methods comprised combination patterns of proprioceptive neuromuscular facilitation ( pnf ) and ball exercise . [ subjects and methods ] the subjects were 40 volunteers who had low back pain . all subjects were randomly assigned to either a group which received proprioceptive neuromuscular facilitation or a group which performed ball exercise . measurements were taken four times in total , at pre - intervention , two weeks later , four weeks later , and six weeks later . the main measurement methods used were the visual analogue scale ( vas ) for pain and electromyography ( emg ) for muscle activity . [ results ] vas and emg activity were significantly reduced in the pnf combination pattern group and the ball exercise group . a comparison of the groups showed significant differences . in vas and emg activity ; in particular , the combination pattern group using pnf increased emg activity more than the ball exercise group did after six weeks of intervention . [ conclusion ] this study showed that pnf combination pattern training for six weeks was more effective for patients with low back pain than performing ball exercise .

You are an expert at summarizing long articles. Proceed to summarize the following text: this cross - sectional study used pooled dataset from nine hdss sites in five asian countries namely matlab , mirsarai , abhoynagar and watch ( bangladesh ) , kanchanaburi ( thailand ) , filabavi and chililab ( vietnam ) , vadu ( india ) , and purworejo ( indonesia ) . the choice of these hdss sites ( and countries ) happens to arise from their affiliation to the indepth , a network of hdss sites in developing countries ( http://www.indepth-network.org ) . its purpose is to monitor population dynamics and to test and evaluate various health interventions to influence policy and practice , and improve population health . all these rural sites are conveniently located in particular geographical areas of the respective countries and as such is not representative of the entire country . these low ( bangladesh , vietnam , india ) and middle income ( thailand , indonesia ) countries are experiencing different stages of demographic , economic , and epidemiological transitions . in each site , a sample was drawn following the who steps methodology ( 27 ) , which included a minimum of 250 individuals in each 10 years age group ( 2564 years ) for each sex to a total of 1,000 males and 1,000 females . from the hdss sampling frame , a stratified random sampling technique was used to draw samples in each age and sex group . in step 1 , an assessment of chronic ncds risk factors ( such as tobacco and alcohol consumption , physical inactivity , fruit and vegetable intake ) was undertaken by questionnaire . data on core items of selected risk factors were collected through face - to - face interview during household visits by trained interviewers using a pre - tested local version of the who steps questionnaire . in addition , because of the widespread practice of chewing tobacco in most of the hdss , expanded questions on this item were also included as an option . in step 2 , weight , height , and to ensure uniform and standard method of data collection across sites , the principal investigators initially met and agreed on standard study protocol and data collection instruments and later , training was organised by them at the site levels . bp was measured using digital device ( omron m4-i , omron healthcare , europe bv , hoofddorp , the netherlands ) . bp was measured at the right arm at heart level after a period of 10 minutes of rest . out of three measurements , the average of the last two readings were used . raised bp was defined as systolic bp ( sbp)140 mmhg and diastolic bp ( dbp)90 mmhg or under any anti - hypertensive drug medication . weight and height were measured in light - weight clothing and standing barefoot on instruments placed on a flat surface . weight was measured to the nearest 10 grams using an electronic scale ( seca gmbh , hamburgh , germany ) and height was measured to the nearest 0.1 cm using a portable stadiometer . body mass index ( bmi ) was calculated as weight in kg divided by height in meter squared . the details of the study design , other measurements , and the process of quality control in the survey are described elsewhere ( 28 ) . a standardised data entry programme using epidata software was used in each site for data entry to ensure uniformity . all analyses were weighted by the age and sex structure of the hdss population and categorisation of the variables followed the who steps standard format ( 28 ) . the choice of the variables included in the model was based on the who steps summary table for surveillance sites ( http://www.who.int/chp/steps ) . the prevalence of risk factors clustering at different sites was compared and multivariate logistic regression was undertaken to explore the association between clustering of risk factors and sociodemographic variables of interest . the multi - site study protocol was approved by the scientific board of the indepth network and also passed through the usual institutional review process at the different study sites . informed consent ( both verbal and written ) was taken from every respondent before including him / her in the study . a commitment to confidentiality any participant with high bp or other disease was referred to appropriate facilities for investigation and treatment . this cross - sectional study used pooled dataset from nine hdss sites in five asian countries namely matlab , mirsarai , abhoynagar and watch ( bangladesh ) , kanchanaburi ( thailand ) , filabavi and chililab ( vietnam ) , vadu ( india ) , and purworejo ( indonesia ) . the choice of these hdss sites ( and countries ) happens to arise from their affiliation to the indepth , a network of hdss sites in developing countries ( http://www.indepth-network.org ) . its purpose is to monitor population dynamics and to test and evaluate various health interventions to influence policy and practice , and improve population health . all these rural sites are conveniently located in particular geographical areas of the respective countries and as such is not representative of the entire country . these low ( bangladesh , vietnam , india ) and middle income ( thailand , indonesia ) countries are experiencing different stages of demographic , economic , and epidemiological transitions . in each site , a sample was drawn following the who steps methodology ( 27 ) , which included a minimum of 250 individuals in each 10 years age group ( 2564 years ) for each sex to a total of 1,000 males and 1,000 females . from the hdss sampling frame , a stratified random sampling technique was used to draw samples in each age and sex group . in step 1 , an assessment of chronic ncds risk factors ( such as tobacco and alcohol consumption , physical inactivity , fruit and vegetable intake ) was undertaken by questionnaire . data on core items of selected risk factors were collected through face - to - face interview during household visits by trained interviewers using a pre - tested local version of the who steps questionnaire . in addition , because of the widespread practice of chewing tobacco in most of the hdss , expanded questions on this item were also included as an option . in step 2 , weight , height , and bp measurements were taken using standardised instruments and protocols . to ensure uniform and standard method of data collection across sites , the principal investigators initially met and agreed on standard study protocol and data collection instruments and later , training was organised by them at the site levels . bp was measured using digital device ( omron m4-i , omron healthcare , europe bv , hoofddorp , the netherlands ) . bp was measured at the right arm at heart level after a period of 10 minutes of rest . out of three measurements , raised bp was defined as systolic bp ( sbp)140 mmhg and diastolic bp ( dbp)90 mmhg or under any anti - hypertensive drug medication . weight and height were measured in light - weight clothing and standing barefoot on instruments placed on a flat surface . weight was measured to the nearest 10 grams using an electronic scale ( seca gmbh , hamburgh , germany ) and height was measured to the nearest 0.1 cm using a portable stadiometer . body mass index ( bmi ) was calculated as weight in kg divided by height in meter squared . the details of the study design , other measurements , and the process of quality control in the survey are described elsewhere ( 28 ) . a standardised data entry programme using epidata software was used in each site for data entry to ensure uniformity . all analyses were weighted by the age and sex structure of the hdss population and categorisation of the variables followed the who steps standard format ( 28 ) . the choice of the variables included in the model was based on the who steps summary table for surveillance sites ( http://www.who.int/chp/steps ) . the prevalence of risk factors clustering at different sites was compared and multivariate logistic regression was undertaken to explore the association between clustering of risk factors and sociodemographic variables of interest . the multi - site study protocol was approved by the scientific board of the indepth network and also passed through the usual institutional review process at the different study sites . informed consent ( both verbal and written ) was taken from every respondent before including him / her in the study . a commitment to confidentiality any participant with high bp or other disease was referred to appropriate facilities for investigation and treatment . a total of 18,494 men and women were included into the study representing an overall 98% response rate . detailed information on their socioeconomic characteristics , which were extracted from the overall database , was reported in the first paper in this supplement ( 28 ) . among the behavioural risk factors , current daily smoker of tobacco was high in men ( > 50% ) in all sites except vadu and abhoynagar ( table 1 ) . reported prevalence of physical inactivity was highest in filabavi ( 58% ) followed by vadu ( 53% ) and matlab ( 51% ) with gender difference disfavoring women in all sites except those from vietnam ( table 1 ) . except in chililab and kanchanaburi , more than 80% of the respondents in other sites reported low consumption of fruits and vegetables . prevalence of five major behavioural and biological risk factors ( 95% ci ) in nine asian hdss sites , men and women 2564 years kanchanaburi ( 28% ) , purworejo ( 24% ) , and vadu ( 24% ) reported greater prevalence of raised bp ( sbp 140 mmhg and dbp 90 mmhg ) compared to other sites . prevalence was higher in men than in women except in the sites from bangladesh ( table 1 ) . over - weight ( bmi 25 ) was greater in kanchanaburi ( 35% ) and purwarejo ( 18% ) than other sites , with women being heavier than men in all hdss except in vadu and chililab ( table 1 ) . table 2 presents the distribution of risk factors clustering ( three or more ) by age group and sex among the different sites . the proportion of respondents without any of the above behavioural and biological risk factors was negligible , with the exception of chililab in vietnam where around 20% reported none of the major risk factors . higher prevalence of clustering ( > 20% ) was observed in kanchanaburi and mirsarai for men and in all sites except abhoynagar , watch , and chililab for women . the level of clustering among women was higher than men overall , and especially in the two sites in vietnam . prevalence of risk factors clustering ( 95% ci ) in nine asian hdss sites , by gender table 3 presents results from multivariate logistic regression analysis of predictors of risk factors clustering ( 3 risk factors ) among the different sites . the probability increased significantly with age in all sites , especially in the elderly age group ( 5564 years ) ; the probability was more than three times higher in sites from india , indonesia , and partly bangladesh ( mirsarai and abhoynagar ) compared to other sites . sites from vietnam showed a very large difference ( nine times more in men compared to women ) . again , the higher the education level , the greater the probability of risk factors clustering , except sites from vietnam ; the probability was significant for sites from matlab , vadu , filabavi and purworejo . logistic regression analysis of predictors of chronic ncd risk factors clustering ( 3 ) ( 95% ci ) in nine asian hdss sites in summary , chronic ncds risk factors clustering was predicted by age ( probability increasing with age ) , sex ( probability increased if male ) , and education ( probability increasing with higher educational level ) . clustering of risk factors , whether behavioural or biological , is associated with the occurrence of the major chronic ncds ( 8 , 19 ) . as such , it is important to identify the groups at risk to design appropriate intervention measures . this paper explores this phenomenon using risk factor prevalence data from nine hdss sites in five asian countries affiliated with indepth . the findings revealed widespread use of tobacco in men , low consumption of fruits and vegetables , low physical activity levels in women , and a high proportion of the population with raised bp ( sbp 140 mmhg and dbp 90 mmhg ) . extensive clustering of risk factors ( both biological and behavioural ) was found to be a function of age , sex , and educational achievement . the finding that the risk factors cluster as age advances is not surprising , as age - related biological risks ( e.g. hypertension or obesity ) are super - imposed upon the cumulative life - style behavioural risk factors ( e.g. tobacco and alcohol use , diet high in salt , fat and sugar and low in fruits and vegetables , physical inactivity , etc . ) this is also consistent with the observation that the prevalence of chronic diseases increases with age ( 2931 ) . this may be due to the fact that with increasing education also comes affluence ( 32 , 33 ) , and greater access to tobacco , alcohol , diets high in fats , salt , and sugar . however , education was also found to be associated with low probability of risk factors clustering in sites from vietnam , possibly because higher level of education may also increase both awareness of , and capacity to take preventive actions against the common chronic ncds ( 13 ) . modifying life - style factors through health promotion interventions , supported by policy such as tobacco control measures , may become more feasible as education improves . however , perhaps the most useful aspect of looking at the constellation or clustering of major risk factors , is to identify the strata of individuals in a known population who may well be at high overall risk of a cardiovascular disease event . this high risk section of the population is the candidate for integrated management of multiple risk factors in a cost - effective way ( 34 ) . in this study , the age group 5564 years was found to be such a vulnerable group who had two to three times more probability of risk factors clustering compared to the younger age groups . this may also be the group who will benefit from recent preventive innovations such as the polypill ( polycap ) ( 35 ) . it is interesting to note the differences among the different sites with respect to prevalence of risk factors , both between and within country . this may be due to differences in the socio - cultural characteristics as well as economic development of the hdss catchment populations ( e.g. mobility and participation in public sphere , and concept of sports and leisure in case of women ) , representativeness of the sites ( localised or geographical spread ) , timing of survey , and level of farm activities , etc . for example , gender differences at site level in bangladesh and vietnam can be explained by the characteristics of the hdss catchment areas : the 10 data collection locations of watch hdss is geographically spread all over bangladesh while the matlab and amk sites are localised to specific parts of the country . in case of vietnam , filabavi has 30 data collection locations compared to seven locations in chililab ; also , chililab is mainly a peri - urban area compared to filabavi which is predominantly rural . for more on this these variations among sites ( and thereby countries ) need to be kept in mind when designing preventive interventions . the main strength of the study is the use of an established hdss infrastructure which ensured a reliable sampling frame , mutual trust , and respect between the researchers and the respondents which has been built over time . together with the use of standard protocols , it was also possible to link the data with other health and demographic data . a limitation of the hdss sites is that they are not representative of their respective countries due to non - random , convenient placement of the study sites ; however , they provide an indication of what is happening in these selected well - defined populations . other limitations include : the socio - cultural context in the construction of the different risk factors , the possibility of measurement errors including measurement of prevalence based on self - reported responses , and the possibility of recall bias . quality control efforts were made by following the steps methodology , training ( for the principal investigators ) , use of common measuring instruments ( digital bp machines , measuring tape , and weighing scale ) , and intensive monitoring and supervision of field activities . some results were well outside the expected responses and raised the need for qualitative exploration for a fuller understanding of the quantitative data ( e.g. why asian populations consume little fruits and vegetables despite their availability , at least the indigenous varieties ) . the findings suggest a need for the adoption of population - based approaches to prevention , and the need for information on which to base cost - effective interventions to reduce individual risk ( 36 ) . this needs appropriate adjustment to the particular context of low - income countries ( 37 ) . a life - cycle approach to preventive interventions such as reducing salt intake and controlling tobacco use at the population level ( 38 ) may forestall the cummulative effects of multiple risk factors which occur over time ( 39 ) . at the individual level , interventions targeted at vulnerable groups such as older age groups with three or more risk factors may be helped by identifying the section of the population who could benefit from cost - effective interventions ( 40 ) . even so , our study suggests that further refinement ( e.g. the elderly with sbp > 160 mmhg ) will be required to identify a smaller group of individuals who could benefit from individual intervention . in conclusion , it can be said that since there is an extensive clustering of risk factors for the chronic ncds in the populations studied , the interventions also need to be based on a comprehensive approach rather than on a single factor to forestall its cumulative effects which occur over time . that such integrated , life - style interventions work in the developing country settings is already documented ( 37 ) . in low and middle - income countries , this can work best if it is integrated within the primary health care system for optimal benefit and convenience and the hdss can be an invaluable epidemiological resource in this endeavor ( 41 ) .

backgroundthe major chronic non - communicable diseases ( ncds ) operate through a cluster of common risk factors , whose presence or absence determines not only the occurrence and severity of the disease , but also informs treatment approaches . primary prevention based on mitigation of these common risk factors through population - based programmes is the most cost - effective approach to contain the emerging epidemic of chronic ncds.objectivesthis study was conducted to explore the extent of risk factors clustering for the major chronic ncds and its determinants in nine indepth health and demographic surveillance system ( hdss ) sites of five asian countries.designdata originated from a multi - site chronic ncd risk factor prevalence survey conducted in 2005 . this cross - sectional survey used a standardised questionnaire developed by the who to collect core data on common risk factors such as tobacco use , intake of fruits and vegetables , physical inactivity , blood pressure levels , and body mass index . respondents included randomly selected sample of adults ( 2564 years ) living in nine rural hdss sites in bangladesh , india , indonesia , thailand , and vietnam.resultsfindings revealed a substantial proportion ( > 70% ) of these largely rural populations having three or more risk factors for chronic ncds . chronic ncd risk factors clustering was associated with increasing age , being male , and higher educational achievements . differences were noted among the different sites , both between and within country.conclusionssince there is an extensive clustering of risk factors for the chronic ncds in the populations studied , the interventions also need to be based on a comprehensive approach rather than on a single factor to forestall its cumulative effects which occur over time . this can work best if it is integrated within the primary health care system and the hdss can be an invaluable epidemiological resource in this endeavor .

You are an expert at summarizing long articles. Proceed to summarize the following text: to maintain a functional and repetitive gait pattern , it is important to not only increase stride length but also to recover gait symmetry1 . however , hemiplegic patients have a problem with gait symmetry due to the asymmetry of the lower limbs and restrictions to the movements in the upper extremity of the paretic side during gait2 . in normal gait , rotational compensation of the arms in the direction opposite to pelvic rotation plays a role in maintaining body balance3 . maintaining body balance reported that energy consumption is reduced in terms of the overall body , despite energy consumption by the muscles of the upper extremities involved in swing motion of the arms during a gait cycle5 . this is because the swing of the upper extremities during the gait cycle induces trunk rotation which helps to maintain body balance , thereby minimizing energy consumption . it has been reported that treadmill gait - training programs are effective at improving the gait and balance abilities of hemiplegic patients6,7,8 . therefore , this study aimed to prove the clinical effect of treadmill gait training with active arm swings , which can induce trunk rotation in the direction opposite to pelvic rotation . this maintains body balance3 , 9 , 10 and minimizes the deviation of the body s center of gravity4 , 11 , 12 . the subjects were randomly assigned to a control group of 10 subjects who performed treadmill gait training with their arms fixed , and an experimental group of 10 subjects who performed treadmill gait training with arm swings . all subjects were informed of the purpose of this study and they each gave their consent to participation . all of the protocols used in this study were approved by the university of daejeon . before participation , the procedures , risks , and benefits the participants rights were protected according to the guidelines of the university of daejeon . the general characteristics of the study subjects are shown in table 1table 1.general characteristics of the subjectsvariableseg ( n=10)cg ( n=10)gendermale7 ( 35.0)8 ( 40.0)female3 ( 15.0)2 ( 10.0)stroke typehemorrage1 ( 5.0)5 ( 25.0)infarction9 ( 45.0)5 ( 25.0)affected sidelt5 ( 25.0)3 ( 15.0)rt5 ( 25.0)7 ( 35.0)age ( years)51.511.955.29.5onset ( months)17.314.518.76.9the number of persons ( % ) , meansd , eg : experimental group , cg : control group . the number of persons ( % ) , meansd , eg : experimental group , cg : control group the timed up and go ( tug ) test , the dynamic gait index ( dgi ) , and the 6-minute walk test ( 6mwt ) were conducted before and after the intervention . in the tug , functional mobility and balance ability are evaluated . it has been reported that the intra - rater and inter - rater reliabilities of the tug test are r=0.99 and 0.98 , respectively , which are high values13 . dgi is used to evaluate gait control abilities in response to task changes in external environments14 . the intra - rater and inter - rater reliabilities of dgi are r=0.98 and r=0.96 , respectively , which are high values14 . for the intervention program of this study , the gait training implemented by behrman et al . and stephenson et al . the subjects held nordic poles in both hands during treadmill ( m90 t , motus , korea ) gait training , while the experimenter also held nordic poles behind the subject and walked together with the subject , counting out loud to help the subject swing the upper limbs . the gait velocity was increased gradually in accordance with the individual gait abilities of the study subjects , and without interfering with gait independence or stability . if degradation of gait independence or stability of a study subject was noticed , the velocity was reduced to its previous value . the nordic pole was fixed with a bandage if a subject could not hold the grip of the pole using the hand on the affected side . arm swing treadmill gait training was performed by the experimental group for 30 min , three times a week for four weeks . the control group performed arm - fixed treadmill gait training in the same way as the experimental group , but with their hands holding the treadmill grip . if the affected hand could not hold the grip , a bandage was used to fix it to the grip . starting at a velocity that did not interfere with gait independence or stability , the walking aped was gradually raised from 1.0 km / h initially up to 3.0 km / h , according to the individual gait abilities of the subjects . the velocity was increased in increments of 5%19 , and if gait independence or stability were compromised due to the increased velocity , the velocity was reduced to its previous value . arm fixed treadmill gait training was performed for 30 min , three times a week for four weeks . the average speeds of the experimental and control groups were ( meansd ) 2.80.4 and 2.10.7 km / h , respectively , and there was no significant difference between them . the paired t - test was conducted to test the significance of differences in each group between before and after the training , while the independent t - test was conducted to test the significance of differences between the groups before and after the training . a significance level to 0.05 table 2table 2.comparison of the tug and dgi and 6mwt values of the experimental and control groupseg ( n=10)cg ( n=10)tug ( seconds)pre - test20.613.620.57.5post - test16.57.918.87.2pre - post difference4.16.01.72.8dgipre - test13.53.914.75.1post - test17.04.3 * 15.04.8pre - post difference3.51.7 * 1.51.76mwt ( metres)pre - test239.698.8215.8102.4post - test278.599.3 * 219.4105.3pre - post difference38.919.3 * 3.612.0 meansd , * p<0.05 , eg : experimental group , cg : control group , tug : timed up and go test , dgi : dynamic gait index , 6mwt : 6-minute walk test presents the values of tug , dgi , and 6mwt of the two groups . the tug values were not significantly different between before and after the training in the two groups . the dgi values were significantly different ( p<0.05 ) after the training in the arm - swing treadmill gait training group , but not in the arm - fixed treadmill gait - training group . the 6mwt values were significantly different ( p<0.05 ) after the training in the arm - swing treadmill gait - training group , but not in the arm - fixed treadmill gait training group . meansd , * p<0.05 , eg : experimental group , cg : control group , tug : timed up and go test , dgi : dynamic gait index , 6mwt : 6-minute walk test no significant difference was found in the tug values of the arm - swing and arm - fixed treadmill gait training groups before or after the experiment . however , the improvement in the arm - swing treadmill gait training group after the intervention had a p - values of 0.06 , which was close to the significance level , whereas that of the arm - fixed treadmill gait training group was 0.10 . the arm - swing treadmill gait training group showed a significant improvement in dgi compared to the arm - fixed treadmill gait training group after the intervention . arm - swing during gait helps hemiplegic patients to concentrate on awareness of the upper limb on the affected side9 . furthermore , arm - swing helps hemiplegic patients to recognize their arms as a feedback mechanism , which is good for postural adaptation and balance maintenance9 , 10 , as well as for minimizing the deviation of the body s center of gravity , thereby reducing muscle effort and energy consumption during gait4 . thus , arm- swing treadmill gait training can be considered a method that improves the overall gait and dynamic balance abilities of hemiplegic patients . the arm - swing treadmill gait training group showed a significant improvement in 6mwt from 239.698.8 to 278.599.3 m , which was significantly better than that of the arm - fixed treadmill gait training group . the movements of the upper limbs of hemiplegic patients can induce trunk rotation and influence stride length during gait . according to the study of stephenson et al . , the simultaneous harmonic movements of the upper limbs during the gaits of hemiplegic patients induce trunk rotation and increase the range of movement of the ankle joints , thereby increasing stride length18 . moreover , wagenaar and van emmerik reported that when the movements of the upper limbs of hemiplegic patients are restricted , trunk rotation is limited , thereby reducing stride length , weakening muscle power , and impairing coordination2 . accordingly arm - swing treadmill gait training for hemiplegic patients induces trunk rotation leading to increases in stride length , muscle power , coordination , and gait endurance18 . the limitations of this study are that the study results can not be generalized to all hemiplegic patients due to the small number of study subjects . also , the results do not guarantee the long - term effect of arm - swing treadmill gait training , as the effect was studied after only a four - week intervention . therefore , it will be necessary to conduct research that includes more subjects and analyzes the long - term effects .

[ purpose ] this study was conducted to find out the effect of arm swing during treadmill training on the gait of stroke patients . [ subjects and methods ] this study subjects were 20 stroke subjects patients who were randomly assigned to either the experimental group ( eg ) or the control group ( cg ) , 10 subjects in each group . therapists induced arm swing of affected side of eg subjects using nordic poles , while subjects in cg had the affected arm restricted to prevent arm swing . training was performed for 30 minutes , 3 times a week for 4 weeks . the timed up and go test ( tug ) , the dynamic gait index ( dgi ) and the 6-minute walk test ( 6mwt ) were assessed before and after the training . [ results ] after the training , there were no significant differences in the tug times of eg and cg . there were significant differences in the dgi and the 6-minute walking distance of eg , but not of cg . there were also significant differences in the improvements of the dgi and the 6-minute walking distance between the groups . [ conclusion ] arm swing training had a positive effect on patients gait ability . further studies are required to generalize the results of this study .

You are an expert at summarizing long articles. Proceed to summarize the following text: patients with latent tuberculosis infection ( ltbi ) have an increased risk for activation of tuberculosis ( tb ) if they are treated with cytostatic drugs or systemic corticosteroids . the risk of ltbi reactivation is further increased by the treatment with tumour - necrosis - factor-- ( tnf- ) blocking agents , which have been proven to be effective therapy in autoimmune conditions such as rheumatoid arthritis ( ra ) , psoriasis and psoriasis arthritis ( psa ) , and ankylosing spondylitis . in ra patients the treatment with tnf-blocking agents causes a 24-fold increase in the risk of tb . in countries with a low incidence / prevalence of tb , this occurrence of tb in ra is considered to derive mainly from reactivation of ltbi . to prevent the reactivation , national guidelines have been expressed for screening and treatment of ltbi prior to starting anti - tnf therapy [ 46 ] . two commercial interferon- ( ifn ) release assays ( igras ) , namely , t-spot.tb ( oxford immunotec , oxford , uk ) and quantiferon - tb gold in - tube ( cellestis limited , carnegie , victoria , australia ) , have been developed . both utilize the ability of sensitized t lymphocytes to release ifn upon stimulation with synthetic peptides specific to mycobacterium tuberculosis . these methods show superior diagnostic accuracy in comparison to the tuberculin skin test ( tst ) . the present retrospective study aimed to investigate associations between the risk factors for ltbi , vaccination status , or prior immune suppression and the results of the two commercially available igras , which were appropriately modified , and tst in patients with psoriasis and inflammatory musculoskeletal diseases . we analyzed the results of the 109 patients treated at the helsinki university central hospital between february 2007 and december 2008 who were screened for ltbi with igras and with tst . all the igras had been carried out at huslab , helsinki university central hospital , helsinki , finland . we reviewed the medical records and collected data on chest x - ray examinations , history of exposure to mycobacterium tuberculosis , ongoing use of glucocorticoids , immunosuppressive drugs , and/or biologicals . the study protocol was approved by the ethics committee of helsinki and uusimaa hospital district area . patients with a history of tuberculosis whose anti - tuberculosis therapy had not included a three - drug regimen were considered to have had a partial treatment . apical scar , primary complex , fibrosing pleural changes with / without calcifications , and fibrotic parenchymal foci were the signs indicative for ltbi . igras were performed according to the standard operating procedures ( sops ) adopted for both methods in our laboratory . for each test we developed an internal quality control sample , that is , the preparation resembling the actual clinical sample that was divided into aliquots and assayed regularly . briefly , the modifications include : the following ( i ) results are expressed as a number of reactive spots/10 lymphocytes , and the lymphocyte count from isolated pbmc preparation is calculated with an automated hematologic analyzer ( advia 60 , bayer , germany ) for cell quantification and purity assessment ; ( ii ) an additional positive control , that is purified protein derivative ( ppd ) ( statens serum institut , copenhagen , denmark ) that was used with each sample ; ( iii ) the analysis is performed in duplicates . the b - tbifng is a modified version of the quantiferon - tb gold in - tube . the major modification was the substitution of the original enzyme immunoassay ( eia ) for ifn- ( cellestis limited , carnegie , victoria , australia ) by that of pelikine compact human eia ( sanquin , amsterdam , the netherlands ) . the latter gave a steeper calibration curve and ensured more accurate result interpretation in the cutoff zone . based on our imprecision study and a pilot evaluation [ 8 , 9 ] , we used the following cut - offs for our routine : for the b - tbifng 0.350.5 iu / ml and for the ly - tbspot 2550 reactive cells/10 lymphocytes . however , to make the results comparable with other studies , the calculations were based on the cut - offs defined by the manufacturer , that is 0.35 iu / ml and 25 reactive cells/10 lymphocytes , equal to 6 spots / well . tst was performed by properly trained operators with 2 tu of purified protein derivative ( ppd , rt23 , statens serum institut , copenhagen , denmark ) according to the mantoux technique on the surface of the forearm . the result was recorded after 4872 h , and induration 10 mm was used as a positive result . in the absence of the gold standard , we evaluated the performance of ly - tbspot , b - tbifng , and tst and assessed the results according to the presence of any risk factor for ltbi : history of active tuberculosis , birth in an endemic country , or a history of a close tb contact . chest x - ray finding suggestive of a history of tb was primarily considered as a risk factor but was omitted from the index because ( i ) it was associated with odds less than 1 for positive test results ; ( ii ) when the chest x - ray findings indicated ltbi , igra and tst were often not requested by physicians . we evaluated the results in association with an attribution to a group that is , each result was compared to all other results and to potential confounding factors such as age , sex , bcg - vaccination status and medications . covariates with significance of p < 0.1 in the univariate analyses and independent from each other were included . we used logistic regression for the analysis of factors contributing to concordance and discordance between tests pairwise . the majority of the participants were finnishborn , 12 ( 11% ) had a history of tb contacts , and 12 ( 11% ) had a history of tb . eight of 99 ( 8% ) patients had radiological evidence for ltbi , and less than a half of the participants had received bcg vaccination ( n = 46 ( 42% ) ) . ly - tbspot test was performed in 98 , b - tbifng in 71 , and tst in 80 patients , respectively ( table 2 ) . the risk factor analysis revealed that those being born in endemic country or having a history of contact or previous tb had higher odds for positive ly - tbspot ( or 2.9 ; p < 0.05 , table 3 ) and b - tbifng ( or 5.0 ; p < 0.01 , table 4 ) . patient group or medication did not have significant effects on igra results ( tables 3 and 4 ) . females had lower odds for positive ly - tbspot ( or 0.4 , p < 0.05 ) than men , also in multivariate analysis . age correlated negatively with a positive tst reaction , or 0.95 ( p < 0.01 ) , that is patients with negative tst were older ( mean 65.9 years ) than those with positive tst ( 52.4 years ) . also bcg vaccination correlated moderately with tst ( 10 mm , p < 0.1 ) . females had lower odds for positive tst , or 0.2 ( p < 0.01 ) , than men . group 3 had lower odds for positive test results compared with the other groups , although the number of tst performed was lower in this group ( table 5 ) . we found an association between tst positivity and birth in tb - endemic country , sex , and inclusion in group 3 . as age and bcg vaccination status were not independent , they were included as covariates separately , both showing significant association with test results . ongoing glucocorticoid therapy had an effect on tst , or 0.3 ( p < 0.05 ) , but this effect was not confirmed in multivariate analysis ( data not shown ) . in the pairwise analysis ( table 6 ) , we found no significant factors explaining the disagreement between the igra results . the ltbi risk factors were associated with concomitant positivity in both igra tests . younger persons tended to be in the tst + ve / ly - tbspotve discrepancy group , whilst advanced age was associated with tst ve / ly - tbspot + ve discrepancy . young age was associated both with tst + ve / b - tbifng ve discrepancy and concomitant tst / b - tbifng positivity . the limitation of this analysis is the low number of ly - tbspot ve / b - tbifng + ve and tst ve / b - tbifng + ve discrepancy groups . the igras produced highly concordant results ( = 0.71 ) ( table 6 ) . on the contrary , tst showed poor concordance with the igras ( = 0.240.32 ) . when the concordance of the tests was assessed for each group separately , the conclusion drawn for the whole cohort held true also for each group ( data not shown ) . the rates of indeterminate results were 2/98 ( 2% ) and 1/71 ( 1.4% ) for ly - tbspot and for b - tbifng , respectively . although the b - tbifng test was negative showing an acceptable pha reactivity , we doubted its validity because this method provides neither visual assessment nor lymphocyte normalisation , as for example , ly - tbspot . in one patient , the b - tbifng was indeterminate due to nonsufficient pha reactivity but the same sample tested in ly - tbspot was acceptable because the reactivities both to pha and ppd were sufficient . here , we present findings that are not consistent with some previous studies [ 10 , 11 ] . we did not observe a severe impairment with ongoing glucocorticoid or immunosuppressive antirheumatic therapy on the ex vivo function of lymphocytes in igra tests . indeed , in our practice the rates of indeterminate results were very low and were mainly attributed to lymphopenia . in our laboratory , eia - based methods performed equally well as the elispot method , although eia - method measures only the bulk of excreted interferon gamma and does not allow visual assessment of the quality . the good performance may be partly attributed to the eia reagents from another manufacturer providing a steeper calibration curve , which makes the reading and interpretation more reproducible at the cut - off zone . there are several studies where the igras have been compared in rheumatic and psoriatic patients ( [ 1016 ] . as reported [ 1017 ] and reviewed [ 7 , 18 , 19 ] ) , the concordance between igras and tst in adults was poor . in accordance with recent studies [ 10 , 16 ] , similarly to switzerland , almost 100% of the finnish population born after fifties is bcg vaccinated . this goes hand in hand with the positive association between bcg vaccination and tst results . on the contrary , our study has some limitations : the design was retrospective and the cohort was limited in patient numbers with unequal sizes of the patient groups . another limitation of the study was that the interpretation of the chest x - ray films was not always focused on finding the ghon 's complex , the only objective indication of a tb exposure . this makes the chest x - ray film inferior to the other risk factors studied . our finding corroborates the recent findings that the chest x - ray film gives a low yield in tb screening [ 10 , 16 , 20 ] and is a poor predictor of ltbi , although often this component is included into the diagnostic triad for ltbi . in our observation , calcified granuloma on the chest x - ray is not a precise correlate for ltbi because it may not be sensitive enough to reveal the lung tissue abnormalities in question . among all risk factors the strongest for a positive igra outcome appeared to be a partially treated tb ( or 7.2 and 4.6 for eia - based and elispot - based techniques , resp . ) . of note , this risk factor did not emerge in the tst analysis ( or 1.2 : 95 ci% 0.212 ) . furthermore , birthplace outside finland ( where the burden with environmental mycobacteria is often high ) emerged as a trend for a positive tst result whereas for the igras this factor was less strongly associated . it is of note that our participants were heterogeneous in relation to the factor of birthplace : only 5/12 persons were born in highly endemic countries as defined by who . of the rest of the subjects , 7/12 were born in the countries with a moderate and highly interregional variable tb incidence , as in estonia . the correlation between partial tb treatment and a positive igra test have observed that even complete three - drug antituberculosis regimen given decades ago may not lead to the complete attrition of earlier sensitized lymphocytes that may recognize cognate antigens upon new ex vivo stimulation . for that reason igras should not be recommended as a follow - up method to monitor treatment efficacy . the results of the present study encourage us to recommend eia - based techniques throughout finland and to other areas , where the sample transportation is challenged both by long distances and changes in temperature in the north temperate zone . this method can be applied to ltbi diagnostics in the majority of cases in whom systemic biological drugs are indicated . igra - based methods are of no doubt superior to tst because in contrast to tst , igras provide negative result that can be distinguished from a false negative result due to immunological anergy , a feature of extreme importance when testing immunosuppressed patients . we are not in favour of simultaneous tst and igra testing for the screening of ltbi in patients with autoimmune conditions as suggested by bartalesi et al . . in their study only 4% of subjects were bcg vaccinated which may lead to better agreement between the methods . moreover , our analysis showed that corticosteroid therapy is negatively associated with a positive tst making this method unreliable in patients with autoimmune disorders . in case of lymphopenia , an elispot - based method should be preferred because the method allows purification and concentration of lymphocytes . in the present study b - tbifng and ly - tbspot proved to be methods of choice in evaluation of ltbi .

the performance of the interferon gamma release assays ( igras ) and tuberculin skin test ( tst ) was reviewed retrospectively in patients with psoriasis , inflammatory musculoskeletal diseases , or miscellaneous inflammatory conditions . the study was carried out over a 22-month period using 109 records of patients with psoriasis ( n = 21 ) , musculoskeletal disease ( n = 74 ) , or other inflammatory conditions ( n = 14 ) . forty - four ( 48% ) of 109 patients were on immunosuppressive therapy and 38/109 ( 35% ) on systemic glucocorticoid therapy . the agreement between the igras was substantial ( = 0.71 ) whilst that between the igras and tst was low ( = 0.32 ) . logistic regression models revealed that igras associated with risk factors for latent tuberculosis infection better than tst . tst was influenced by age , bcg vaccination , sex , and glucocorticoid therapy . we found that igras performed equally well with low level of indeterminate results ( 1 - 2% ) . igras were superior to tst because the latter was influenced by bcg - vaccination status and immunosuppressive therapy .

You are an expert at summarizing long articles. Proceed to summarize the following text: bone cement has been extensively used since the early 1960 s , when charnley introduced it into hip joint replacement surgery , for fixing prostheses ( 1 ) . hypotension , pulmonary hypertension and oxygen desaturation are complications often reported during cemented hip arthroplasty and can even lead to cardiac arrest in 0.6 - 1% of patients ( 2 ) . this series of symptoms is known as the bone cement implantation syndrome ( bcis ) . morbidity associated with cementation has been one of the important factors that have led to the growth of uncemented prosthesis implantation in the last years . however , despite these advantages of the uncemented technique over the cemented technique , a significant number of surgeons still like to use cemented prosthesis , based on their experience of better long - term outcomes with cemented total hip arthroplasty . studies evaluating cemented fixation have reported advantages , such as better prosthesis fixation , lower osteolysis incidence , shorter length of stay and lower expenses ( 3 ) . for this reason , bcis and its prevention have constantly attracted the attention of scientists and orthopedic surgeons ( 4 - 7 ) . various theories have been postulated to define the underlying mechanisms that lead to development of bcis . the most accepted theories involve diffuse pulmonary microembolisation , induced by extrusion of air , fat , bone marrow and thrombokinase into the femoral venous channels by the expanding and pressurizing bone cement , as the cause of development of bcis ( 6 - 8 ) . inferior vena cava filters ( ivcf ) are , at present , extensively used to prevent pulmonary embolism ( pe ) of venous origin , in patients with high risks ( 9 , 10 ) . previously , clinicians have tried to implant ivcf and found that they could limit the size of emboli extruded to the right heart chambers through the intraosseous veins ( 11 ) . evidence from animal studies supporting the role of ivcf in the prevention of bcis ( 12 ) . the present study was designed to evaluate the prevention of ivcf against bcis in more detail , and to establish the role of pe in the genesis of bcis . fifteen male sheep weighing 25 - 30 kg were supplied by the experimental animal center of the fourth military medical university , xian , china . the experimental procedure has been approved by the committee of ethics and experimental animal administration of the fourth military medical university , xian , china . the 15 sheep were divided into three groups : bone cement free ( bcf ) group , cement implantation ( ci ) group and ivcf group . in all the three groups , an osteotomy proximal to the greater trochanter of left femur was carried out before the bone cement packing and ivcf implantation . the femoral canal was not reamed out or packed with any bone cement in the bcf group , whereas the left femoral canals of sheep were packed with the cement in ci and ivcf groups to simulate the cementing procedures carried out in hip replacement . in ivcf group , an optease filter ( cordis corporation , freemont , ca , usa ) was placed and released in inferior vena cava via the internal jugular vein , under x - ray fluoroscopic machine guidance , prior to packing the cement in the femoral canal , while the ivcf was placed in inferior vena cava without releasing in the ci group . the animals had the vaccinations and deparasitation required for their species and had not been used in any other experimental study . six hours before the operation , they were transferred to the stables of the minimally invasive techniques unit of xijing hospital ( xian , china ) , where they were put into individual boxes and their general state of health was confirmed to be satisfactory . all the sheep received general anesthesia throughout all the procedures , using the following anesthetic protocol : a ) an intramuscular injection of xylazine ( 0.1 mg / kg ) , as preanesthetic medication ; b ) an intravenous injection of ketamine ( 4 mg / kg ) into the cephalic or tarsal vein ; c ) after intubation , maintenance of anesthesia with 2 - 2.5% isoflurane in oxygen ; and d ) insertion of a nasogastric tube to avoid aspiration and possible lesions due to material that might be regurgitated . monitoring of the heart and respiratory rates , oxygen saturation , and electrocardiogram were performed in all animals with the hp3000 ultrasonic cardiogram equipment ( hewlett packard , palo alto , ca , usa ) . the right jugular vein was cannulated and connected with a venous transfusion pathway and pressure sensor by a three - way connector . lactated ringer 's solution was transfused at the rate of 2 - 4 ml / min . the right femoral artery was cannulated for arterial blood pressure ( bp ) monitoring and heart rate recording . arterial blood samples were obtained from the aforementioned bp monitoring catheter before and after bone cement manipulation at a 5 min interval in the ci group , or equivalent time points in the bcf group . oxygen saturation ( sao2 ) , partial pressure of carbon dioxide ( paco2 ) and ph were then measured by abl flex80 blood gas analyzer ( radiometer , brnshj , denmark ) for these samples . the devices were introduced percutaneously into the inferior vena cava via the internal jugular vein under x - ray fluoroscopic machine guidance ( siemens , munich , germany ) . cavography ( c - arm , philips v-29 , philips , hamburg , germany ) using 30 ml of iopamidol-370 ( bracco diagnostics inc . , all the filters were inserted using an 8.5 f introducer , carefully following the manufacturer 's instructions , which have been described by other researchers . the proximal end of the femur was exposed and an osteotomy was performed , proximal to the greater trochanter , to permit reaming of the medullary cavity . through a drill hole in the cortex of the distal one - third of the femur , a snugly fitting 15-gauge short beveled needle was introduced into the medullar cavity . the needle was then connected to a statham pressure transducer by means of rigid tubing filled with saline , in order to record the medullary pressures . approximately half the length of the medullary cavity was reamed out and 1 - 2 milliliters of type iii acrylic resin bone cement for injection ( tianjin synthetic material research institute , tianjin , china ) was injected into the cavity . the intra - cavity was pressurized by a stick , simulating a clinically used prosthesis , and indices of bcis were investigated . in bcis group , the bone marrow cavity was pressurized to 300 mmhg , within 5 minutes , and the pressure was held at 300 mmhg , for 25 min . all values are expressed as mean sd . data were analyzed by one - way analysis of variance ( anova ) followed by the student newman keuls test for multiple comparisons ( sigma stat , jandel , san rafael , ca , usa ) . fifteen male sheep weighing 25 - 30 kg were supplied by the experimental animal center of the fourth military medical university , xian , china . the experimental procedure has been approved by the committee of ethics and experimental animal administration of the fourth military medical university , xian , china . the 15 sheep were divided into three groups : bone cement free ( bcf ) group , cement implantation ( ci ) group and ivcf group . in all the three groups , an osteotomy proximal to the greater trochanter of left femur was carried out before the bone cement packing and ivcf implantation . the femoral canal was not reamed out or packed with any bone cement in the bcf group , whereas the left femoral canals of sheep were packed with the cement in ci and ivcf groups to simulate the cementing procedures carried out in hip replacement . in ivcf group , an optease filter ( cordis corporation , freemont , ca , usa ) was placed and released in inferior vena cava via the internal jugular vein , under x - ray fluoroscopic machine guidance , prior to packing the cement in the femoral canal , while the ivcf was placed in inferior vena cava without releasing in the ci group . the animals had the vaccinations and deparasitation required for their species and had not been used in any other experimental study . six hours before the operation , they were transferred to the stables of the minimally invasive techniques unit of xijing hospital ( xian , china ) , where they were put into individual boxes and their general state of health was confirmed to be satisfactory . all the sheep received general anesthesia throughout all the procedures , using the following anesthetic protocol : a ) an intramuscular injection of xylazine ( 0.1 mg / kg ) , as preanesthetic medication ; b ) an intravenous injection of ketamine ( 4 mg / kg ) into the cephalic or tarsal vein ; c ) after intubation , maintenance of anesthesia with 2 - 2.5% isoflurane in oxygen ; and d ) insertion of a nasogastric tube to avoid aspiration and possible lesions due to material that might be regurgitated . monitoring of the heart and respiratory rates , oxygen saturation , and electrocardiogram were performed in all animals with the hp3000 ultrasonic cardiogram equipment ( hewlett packard , palo alto , ca , usa ) . the right jugular vein was cannulated and connected with a venous transfusion pathway and pressure sensor by a three - way connector . lactated ringer 's solution was transfused at the rate of 2 - 4 ml / min . the right femoral artery was cannulated for arterial blood pressure ( bp ) monitoring and heart rate recording . arterial blood samples were obtained from the aforementioned bp monitoring catheter before and after bone cement manipulation at a 5 min interval in the ci group , or equivalent time points in the bcf group . oxygen saturation ( sao2 ) , partial pressure of carbon dioxide ( paco2 ) and ph were then measured by abl flex80 blood gas analyzer ( radiometer , brnshj , denmark ) for these samples . the devices were introduced percutaneously into the inferior vena cava via the internal jugular vein under x - ray fluoroscopic machine guidance ( siemens , munich , germany ) . cavography ( c - arm , philips v-29 , philips , hamburg , germany ) using 30 ml of iopamidol-370 ( bracco diagnostics inc . , all the filters were inserted using an 8.5 f introducer , carefully following the manufacturer 's instructions , which have been described by other researchers . the proximal end of the femur was exposed and an osteotomy was performed , proximal to the greater trochanter , to permit reaming of the medullary cavity . through a drill hole in the cortex of the distal one - third of the femur , a snugly fitting 15-gauge short beveled needle was introduced into the medullar cavity . the needle was then connected to a statham pressure transducer by means of rigid tubing filled with saline , in order to record the medullary pressures . approximately half the length of the medullary cavity was reamed out and 1 - 2 milliliters of type iii acrylic resin bone cement for injection ( tianjin synthetic material research institute , tianjin , china ) was injected into the cavity . the intra - cavity was pressurized by a stick , simulating a clinically used prosthesis , and indices of bcis were investigated . in bcis group , the bone marrow cavity was pressurized to 300 mmhg , within 5 minutes , and the pressure was held at 300 mmhg , for 25 min . all values are expressed as mean sd . data were analyzed by one - way analysis of variance ( anova ) followed by the student newman keuls test for multiple comparisons ( sigma stat , jandel , san rafael , ca , usa ) . systolic blood pressure ( sbp ) , sao2 , paco2 and arterial blood ph were determined to evaluate the establishment of bcis ( figure 1 ) . in the ci group , sbp began to decline significantly 10 min after the bone cement was stuffed into the medullary cavity . the sbp changed from 138.0 11.1 mmhg to 81.3 7.3 mmhg , at 20 min , and 68.8 5.8 mmhg , at 25 min , which were significantly lower than the parallel time point in the bcf group . the sao2 dropped from 98.3 1.3% to 76.0 4.7% , at 20 min , and 72 4.3 mmhg , at 25 min , and paco2 declined from 40.0 3.6 mmhg to 28.5 2.6 mmhg , at 20 min , and 25.8 2.1 mmhg , at 25 min , suggesting that type i respiratory failure occurred . the arterial blood ph climbed from 7.390.04 to 7.550.04 at 20 min , and 7.570.05 at 25 min , suggesting that respiratory alkalosis occurred . to determine the effects of ivcf on bcis , we compared sbp , sao2 , paco2 and arterial blood ph between bcf , ci and ivcf groups , 20 min after the bone marrow cavity was pressurized to 300 mmhg , rapidly . the sbp in ci group was 81.3 7.3 mmhg , significantly lower than the control ( bcf , 122.3 10.3 mmhg ) , and ivcf implantation effectively reversed the decline of sbp after bone cement stuffing . the sao2 were 90.8 2.2% , 76.0 4.7% and 88.3 1.7% in bcf , bcis and ivcf groups , respectively , which suggested the hypoxia induced by bone cement application was inhibited by ivcf . similar effect also occurred in relation to paco2 , with values of 37.5 2.1 mmhg , 28.5 2.6 mmhg and 34.5 1.5 mmhg in bcf , bcis and ivcf groups , respectively . for arterial blood ph , ivcf prevented the occurrence of respiratory alkalosis , with a value of 7.47 0.02 , which was much lower than that in the bcis group ( 7.55 0.04 ) . bone cement free , cement implantation and inferior vena cava filter models were prepared as mentioned in figure 2 . on echocardiographic evaluation , no emboli - like echoes were in bcf group throughout the experiment . uneven dotted echoes in the right atrium of the ci group were observed 5 min after bone cement stuffing . the echoes were exaggerated to snow - flask - like ones 10 min after bone cement stuffing ( figure 3 ) . on contrast , such echoes were invisible , even 25 min after bone cement stuffing , in ivcf group . autopsy oil red staining demonstrated that multiple fat emboli were present in the lungs of ci group subjects , which were not significant in the bcf and ivcf groups ( figure 4 ) . systolic blood pressure ( sbp ) , sao2 , paco2 and arterial blood ph were determined to evaluate the establishment of bcis ( figure 1 ) . in the ci group , sbp began to decline significantly 10 min after the bone cement was stuffed into the medullary cavity . the sbp changed from 138.0 11.1 mmhg to 81.3 7.3 mmhg , at 20 min , and 68.8 5.8 mmhg , at 25 min , which were significantly lower than the parallel time point in the bcf group . the sao2 dropped from 98.3 1.3% to 76.0 4.7% , at 20 min , and 72 4.3 mmhg , at 25 min , and paco2 declined from 40.0 3.6 mmhg to 28.5 2.6 mmhg , at 20 min , and 25.8 2.1 mmhg , at 25 min , suggesting that type i respiratory failure occurred . the arterial blood ph climbed from 7.390.04 to 7.550.04 at 20 min , and 7.570.05 at 25 min , suggesting that respiratory alkalosis occurred . to determine the effects of ivcf on bcis , we compared sbp , sao2 , paco2 and arterial blood ph between bcf , ci and ivcf groups , 20 min after the bone marrow cavity was pressurized to 300 mmhg , rapidly . the sbp in ci group was 81.3 7.3 mmhg , significantly lower than the control ( bcf , 122.3 10.3 mmhg ) , and ivcf implantation effectively reversed the decline of sbp after bone cement stuffing . the sao2 were 90.8 2.2% , 76.0 4.7% and 88.3 1.7% in bcf , bcis and ivcf groups , respectively , which suggested the hypoxia induced by bone cement application was inhibited by ivcf . similar effect also occurred in relation to paco2 , with values of 37.5 2.1 mmhg , 28.5 2.6 mmhg and 34.5 1.5 mmhg in bcf , bcis and ivcf groups , respectively . for arterial blood ph , ivcf prevented the occurrence of respiratory alkalosis , with a value of 7.47 0.02 , which was much lower than that in the bcis group ( 7.55 0.04 ) . bone cement free , cement implantation and inferior vena cava filter models were prepared as mentioned in figure 2 . on echocardiographic evaluation , no emboli - like echoes were in bcf group throughout the experiment . uneven dotted echoes in the right atrium of the ci group were observed 5 min after bone cement stuffing . the echoes were exaggerated to snow - flask - like ones 10 min after bone cement stuffing ( figure 3 ) . on contrast , such echoes were invisible , even 25 min after bone cement stuffing , in ivcf group . autopsy oil red staining demonstrated that multiple fat emboli were present in the lungs of ci group subjects , which were not significant in the bcf and ivcf groups ( figure 4 ) . our results demonstrated that ivcf could prevent bcis effectively , suggesting that pe might be the leading cause of the constellation of symptoms of bcis . these symptoms were all induced in the present ci model , which suggests that a reliable bcis model was established for the following experiments . zhou et al . established bcis model with dogs , in a recent study ( 13 ) . blood pressure ( bp ) and partial pressure of oxygen ( pao2 ) were both decreased in their models , which were consistent with our findings . however , partial pressure of carbon dioxide went down and arterial ph went up in our models , which were opposite to what was found in zhou s models . they used mechanical ventilation during their anesthesia and this might be the reason why their animals did not show respiratory alkalosis ( 13 ) . the mechanism suggested to cause these symptoms mainly involves four theories : the toxic effects of methyl methacrylate monomers , allergic responses , humoral factors , like cytokines and complement components , and pe induced by high temperature and pressure in the medullary cavity ( 14 - 18 ) . the emboli are composed of bone marrow , fat , bone particles and gas , which enter the inferior vena cava via injured veinlets , after pressurizing the medullary cavity ( 19 - 24 ) . the emboli then enter the right heart chambers and pulmonary arteries , where pulmonary artery resistance increases and blood flow is reduced . consequently , oxygen exchange is reduced , blood desaturates in oxygen , and bp decreases , as a result of hypoxia - induced cardiac depression . a previous study has proved that the peak pressure in the medullary cavity was positively relevant to the number of emboli ( 12 , 25 ) . they inserted bone wax instead of bone cement , into the medullary cavity , and the embolism and cardiovascular responses were aggravated after pressurizing . in this study , we gradually pressurized the medullary cavity to model bcis . with the pressure increasing , the ivcf is applied in patients who are at high risk of developing pe , secondary to venous thromboembolism ( vte ) . we hypothesized that the use of ivcf could decrease the incidence of bcis , since pe is also considered to be the major factor behind the development of bcis . in the ci model group , using echocardiography , emboli inside the right heart chambers was observed when cement was inserted to the cavity , in the ci group . the removed embolus was dotted first and became snowflake - like later , which is consistent with another study that demonstrated the development of pe ( 26 ) . no significant embolus was observed during osteotomy and reaming , in this study , which is in contrast to another clinical investigations that showed obvious embolism during drilling in femur and acetabular bones ( 27 ) . however , no significant image of embolus was detected throughout the procedure in the ivcf group , even when the pressure in the medullary cavity was raised to 300 mmhg . fat could be stained by oil red , which was used to detect fat component in sheep lungs . the findings from fat staining assay , performed during the autopsy of sacrificed sheep , were consistent with echocardiography , revealing the inhibitive effects of ivcf on pe . in respect to the components of the emboli in bcis , bone marrow , fat , bone debris , methyl methacrylate ( mma ) particles were detected in lungs of dead patients ( 28 - 30 ) . the ivcf was supposed to inhibit pe in bcis , and the influences of ivcf on manifestations , other than pulmonary embolism , were also investigated , as a part of this study . the pressure in the medullary cavity was raised to 150 mmhg , 5 min after bone cement insertion , and 300 mmhg at 10 min after insertion . arterial bp decreased continuously after cement insertion , in bcis group , while there was no statistically significant drop in ivcf group . pulse pressure dropped very fast after cement insertion , showing a tendency of shock , while ivcf impeded such tendency . simultaneously , there was a preventive effect of ivcf on oxygen desaturation during the development of bcis . the pao2 decreased the moment cement was implanted , and respiratory failure type i occurred 20 min after cement implantation , in bcis group . although pao2 dropped in the ivcf group , as well , it did not reach respiratory failure and kept stable 10 min after insertion . the ivcf also showed preventive effects against the devastating changes of ph and paco2 . in conclusion , this study had successfully recreated a bcis model , which was then used to study the effect of ivcf in preventing bcis . the results from this study suggest that there may be a role of ivcf in high - risk patients , in whom cemented arthroplasties are performed .

background : inferior vena cava filters ( ivcf ) are frequently used for preventing pulmonary embolism ( pe ) following deep venous thromboembolism.objectives:the present study was designed to investigate whether ivcf could prevent or impede the occurrence of bone cement implantation syndrome ( bcis ) , since pe is considered as the central mechanism of bcis.materials and methods : fifteen sheep were divided into three groups : bone cement free ( bcf ) group , cement implantation ( ci ) group and ivcf group . in all the groups , an osteotomy proximal to the greater trochanter of left femur was carried out . in bcf group , the femoral canal was not reamed out or packed with any bone cement . in ci and ivcf groups , the left femoral canals were packed with bone cement , to simulate the cementing procedures carried out in hip replacement . an optease filter was placed and released in inferior vena cava , prior to packing cement in the femoral canal in ivcf group , while the ivcf was not released in the ci group . the bcf group was considered as control.results:systolic blood pressure ( sbp ) , saturation of oxygen ( sao2 ) and partial pressure of carbon dioxide ( paco2 ) declined significantly 10 min after the bone cement packing , in ci group , compared to those in bcf group . this was accompanied by a rise in the arterial ph . however , ivcf prevented those changes in the ci group . on ultrasonography , there were dotted echoes in right atrium in the ci group , after bone cement packing , while such echoes were hardly seen in the ivcf group.conclusion:this study demonstrates that ivcf could prevent bcis effectively , and , as a corollary , suggests that pe represents the leading cause of the constellation of bcis symptoms .

You are an expert at summarizing long articles. Proceed to summarize the following text: parasites : t. congolense il3000 strain is a savanna type parasite that was discovered near the kenya / tanzania border in 1966 ( according to the records of the biological services unit at the international livestock research institute , nairobi , kenya ) . samples of this parasite were stored in liquid nitrogen at the national research center for protozoan diseases in japan . the emf and mcf of these parasites were produced from in vitro pcf culture [ 5 , 14 , 24 ] . pcf were routinely maintained by diluting 3 ml of log - phase parasite suspension with 7 ml of fresh medium every 2 days . adherent emf appeared in pcf cultures 12 months after the initiation of pcf cultures . the plastic - adherent emf cultures were maintained by replacing the entire culture supernatant with fresh medium every 2 days . live pcf were obtained from cultures by centrifugation at 1,500 g for 10 min at 4c . live emf were prepared from culture flasks by washing adherent cells three times with 10 ml of phosphate - buffered saline ( pbs ) containing 1% glucose ( psg ) to remove non - adherent cells , and the remaining cells were removed with a rubber cell scraper followed by centrifugation at 1,500 g for 10 min at 4c . since differentiation from emf to mcf continuously occurs in emf cultures , mcf accumulates in the culture supernatant . hence , mcf was purified from emf culture supernatants by de 52 anion - exchange column chromatography ( whatman plc . cloning of the tcp46 : total dna was extracted from the parasite using a puregene dna purification system kit ( qiagen , dusseldorf , germany ) according to the manufacturer s instructions and stored at 30c until used . the open reading frame of the tcp46 gene ( gene i d : tcil3000.0.25950 ) was amplified by pcr from t. congolense total dna using primers with the eco ri and sal i sites ( underlined ) , namely p1 ( 5-gcgaattc atg aac gga tcg gct gt-3 ) and p2 ( 5-gcggtcgac tta gta att cgc ctc gc-3 ) . the pcr products were inserted into the pcr2.1-topo vector and sequenced with m13 forward and m13 reverse primers . the hydrophilic and antigenic characteristics of tcp46 were predicted using the dnastar analyzer program ( netwell , tokyo , japan ) . the putative n - terminal signal peptide was analyzed using the signalp server ( http://www.cbs.dtu.dk/services/signalp/ ) . southern blot analysis : total dna was prepared from t. congolense by the phenol - chloroform method . for southern blot analysis , total dna was digested overnight with hind iii , kpn i , sal i , xba i , bcg i , bsp mi , msc i and xho i restriction enzymes and electrophoresed on 1.0% ( w / v ) agarose gel . the electrophoresed dna samples were transferred to a nylon membrane ( hybond - n , ge healthcare , pittsburgh , pa , u.s.a . ) as previously described . preparation of the labeled cdna probe with the full - length tcp46 gene , dna hybridization and labeling of the probe were performed using alkphos direct labeling kit and detection systems ( ge healthcare ) . the result was visualized by using cdp - star ( ge healthcare ) according to the manufacturer s instructions . imaging was performed using x - ray film ( eastern kodak co. , rochester , ny , u.s.a . ) . expression and purification of rtcp46 : the open reading frame ( orf ) of the tcp46 gene in the pcr2.1-topo vector was subcloned into a pgex-4t-1 escherichia coli expression vector ( ge healthcare ) . the correct orientation and sequence of the subcloned tcp46 gene was examined by sequence analysis and designated as the pgex-4t-1/tcp46 . rtcp46 was expressed as a glutathione s - transferase ( gst)-fusion protein in the e. coli bl21 strain according to the manufacturer s instructions ( ge healthcare ) . in order to purify rtcp46 , e. coli was suspended in tne buffer ( 50 mm tris - hcl ( ph 7.5 ) , 100 mm nacl and 2 mm edta ) , sonicated and then centrifuged at 9,000 g for 10 min at 4c . the rtcp46-gst fusion protein was affinity purified from the supernatant using glutathione - sepharose 4b beads ( ge healthcare ) . protein concentrations were measured using a modified lowry protein assay kit ( thermo scientific , pittsburgh , pa , u.s.a . ) . preparation of mouse anti - rtcp46 immune sera : five six - week - old icr mice ( clea , tokyo , japan ) were immunized intraperitoneally with 100 g of purified rtcp46-gst in an equal volume of titermax gold ( titermax usa inc . , norcross , ga , u.s.a . ) for the primary immunization . two booster immunizations were given at 14 day intervals using the same amount of the antigen emulsified in titermax gold . the experiment was conducted in accordance with the guiding principles for the care and use of research animals of the obihiro university of agriculture and veterinary medicine ( no . indirect fluorescent antibody test and confocal laser scanning microscopy : blood smears of t. congolense pcf , emf , mcf and bsf stages were fixed with 100% methanol for 30 min . anti - rtcp46 mouse serum , diluted 1:100 with pbs containing 0.5% bovine serum albumin ( pbs - bsa ) , was applied to the fixed smears as the primary antibody and incubated for 1 hr at 37c . after three washings with pbs , alexa - fluor 488 conjugated goat anti - mouse igg secondary antibody ( 1:600 dilution in pbs - bsa , molecular probes , eugene , or , u.s.a . ) the slides were washed four times with pbs and incubated with 6.25 g / ml propidium iodide ( pi ) ( molecular probes ) containing 100 g / ml rnase a ( qiagen ) for 10 min at 37c . after three washings with pbs , the glass slides were mounted by adding 50 l of a 50% glycerol - pbs ( v / v ) solution and then covered with a cover glass . the slides were examined by confocal laser scanning microscopy ( leica , solms , germany ) . sodium dodecyl sulfate - polyacrylamide gel electrophoresis ( sds - page ) and western blot analysis : to identify the molecular mass of native tcp46 throughout the life cycle stages of t. congolense , the mouse anti - rtcp46 serum was used to detect the native tcp46 from trypanosome cell lysates by western blot analysis . each life cycle of the parasite was harvested from in vitro culture and washed three times with pbs . the parasite pellets were treated with cell lysis buffer ( 20 mm tris - hcl , ph 8.0 , 150 mm nacl , 1 mm cacl2 , 10% glycerol and 1% the cell lysates were sonicated and centrifuged at 7,000 g for 20 min . the supernatants were collected , and bca protein assay was used for protein quantification ( bca protein assay kit , pierce chemical co. , rockford , il , u.s.a . ) . the supernatant ( 50 g / lane ) was then subjected to sds - page . the cell lysates were mixed with sds - page sample buffer ( 125 mm tris - hcl ( ph 6.8 ) , 4% ( w / v ) sds , 20% ( v / v ) glycerol , 3% ( v / v ) 2--mercaptoethanol and 0.02% bromophenol blue ) . after incubating at 100c for 5 min , the separated parasite proteins were then transferred to an immobilon - p transfer membrane ( millipore , billerica , ma , u.s.a . ) . western blot analysis was carried out as previously described . to determine the antibody response against tcp46 in mice infected with t. congolense , the gst - rtcp46 ( 25 g / lane ) and gst protein ( 25 g / lane ) were subjected to sds - page , and transferred to a membrane , and then probed with 100 times diluted infected mouse sera and pre - infected mouse sera , respectively , by western blot analysis . mice infections : after collection of blood to obtain pre - infection mouse sera , three icr mice ( female , 8 weeks old ) were inoculated intraperitoneally with in vitro prepared bsf ( 10 parasites / mouse ) . this experiment was conducted in accordance with the guiding principles for the care and use of research animals promulgated by obihiro university of agriculture and veterinary medicine ( no . enzyme - linked immunosorbent assay ( elisa ) : individual wells of a microtiter plate ( thermo scientific ) were coated with the purified gst - rtcp46 protein ( 0.5 g / well ) or the control gst protein ( 0.5 g / well ) in an antigen coating buffer ( 0.05 m carbonate - bicarbonate buffer , ph 9.6 ) overnight at 4c . the plates were then blocked with pbs containing 3% ( w / v ) skim milk for 1 hr at 37c . after washing , the plates were incubated with 200 times diluted mice serum samples or cattle serum samples . the plates were washed six times with pbst and then incubated with horseradish peroxidase ( hrp ) conjugated to goat anti - mouse igg or hrp conjugated to goat anti - bovine igg ( invitrogen , carlsbad , ca , u.s.a . ) diluted to 1:5,000 with the blocking solution for 1 hr at 37c . thereafter , the enzyme reaction was developed with 3,3,5,5-tetramethylbenzidine ( tmb , kirkegaard & perry laboratories , gaithersburg , md , u.s.a . ) at room temperature . finally , 50 l of stop solution ( 1 m phosphoric acid ) was added , and the absorbance was read at 450 nm . the cut - off value was defined as the mean value plus 3 standard deviations of the mean optical density ( od ) obtained from 9 spf mice serum samples and 26 normal cattle serum samples , respectively . at the same time , elisa was also performed according to the oie manual of diagnostic tests and vaccines for terrestrial animals ( 2012 ) using pcf cell lysate antigen . each microplate well ( thermo scientific ) was coated with 160 ng of antigen and incubated overnight at 4c . serum samples : the serum samples used in this study include 6 serum samples from mice experimentally infected with t. congolense il3000 strain , 9 samples from spf mice , 26 samples from healthy cattle obtained in japan , 9 samples from cattle experimentally infected with babesia bovis , 15 samples from cattle experimentally infected with babesia bigemina and 5 samples from cattle experimentally infected with anaplasma marginale . identification and characterization of the tcp46 gene : four proteins which were found to have greater expression in mcf and/or bsf stages were selected from the previously reported differential protein expression data set ( table 1table 1.selected proteins with greater expression in bsf and/or mcf than in pcf and emfgene idlength ( bp)bsfpcfpcfemfemfmcfmcfbsftcil3000.0.259501,2180.26dnr5.36dnrtcil3000.10.34807440.12dnr8.98dnrtcil3000.8.6290318dnr0.376.94dnrtcil3000.7.19801,179dnrdnrdnr7.96number indicates fold expression level of each protein in the two life - cycle stages ( eyford et al . , 2011 ) . all of these proteins were successfully expressed by the bacterial expression system and purified for preliminary evaluation as diagnostic antigens . western blot analysis of t. congolense - infected mouse sera was used for this evaluation . as a result , only the recombinant tcil3000.0.25950 protein was recognized in the infected mouse sera ( data not shown ) . analysis of the putative n - terminal signal peptide in the tcil3000.0.25950 protein ( tcp46 ) sequence using the signalp server showed that this sequence had no signal peptide . the tcp46 consisted of highly hydrophilic amino acid residues , and its predicted antigenic index was high throughout the entire sequence ( fig . ( a ) software analysis of hydrophilicity and antigenicity of tcp46 . ( b ) genomic dna was treated with hind iii ( lane 1 ) , kpn i ( lane 2 ) , sal i ( lane 3 ) , xba i ( lane 4 ) , bcg i ( lane 5 ) , bsp mi ( lane 6 ) , msc i ( lane 7 ) and xho i ( lane 8) . the restriction enzymes used for lanes 14 did not cut the tcp46 open reading frame ( orf ) , while the enzymes used for lanes 58 cut a single position within the orf . ) . number indicates fold expression level of each protein in the two life - cycle stages ( eyford et al . , 2011 ) . genomic dna was treated with hind iii ( lane 1 ) , kpn i ( lane 2 ) , sal i ( lane 3 ) , xba i ( lane 4 ) , bcg i ( lane 5 ) , bsp mi ( lane 6 ) , msc i ( lane 7 ) and xho i ( lane 8) . the restriction enzymes used for lanes 14 did not cut the tcp46 open reading frame ( orf ) , while the enzymes used for lanes 58 cut a single position within the orf . southern blot analysis : southern blot analysis was performed to determine the copy number of the tcp46 gene in the parasite genome . the genomic dna probed with tcp46 cdna showed a single hybridization band after dna digestion by hind iii , kpn i , sal i and xba i , which did not cut the tcp46 open reading frame ( fig . however , bcg i , bsp mi , msc i and xho i cut a single site within the tcp46 gene , yielding three bands with a common fragment at 4 kbp ( fig . 1b , lanes 58 ) . these results suggest that genomic dna of t. congolense contains at least 2 copies of tandemly arranged tcp46 genes . detection of anti - rtcp46 antibody from t. congolense - infected mouse sera : the full - length tcp46 gene was cloned into prokaryotic expression vector pgex-4t-1 and expressed in e. coli as a soluble gst - fusion protein with a molecular mass of approximately 72 kda , including the 26 kda gst tag ( fig . the rtcp46 fused with gst ( lane 1 ) and purified rgst ( lane 2 ) were stained by amide black . the gst - rtcp46 ( lane 3 ) and the rgst ( lane 4 ) were reacted with serum from mice infected with t. congolense . the rtcp46 ( lane 5 ) and the rgst ( lane 6 ) were reacted with pre - immune mouse sera . , lane 1 ) . the rtcp46 protein was recognized in sera from mice experimentally infected with t. congolense by western blot analysis ( fig . 2 , lane 3 ) , whereas there was no reaction with the gst protein ( fig . neither gst - rtcp46 nor gst was recognized in pre - immune sera ( fig . 2 , lanes 5 and 6 ) . sds - page and western blot analysis of the recombinant tcp46 . the rtcp46 fused with gst ( lane 1 ) and purified rgst ( lane 2 ) were stained by amide black . the gst - rtcp46 ( lane 3 ) and the rgst ( lane 4 ) the rtcp46 ( lane 5 ) and the rgst ( lane 6 ) were reacted with pre - immune mouse sera . characterization of the native tcp46 : mouse anti - rtcp46 sera were prepared and used to identify native tcp46 in all life cycle stages of t. congolense by means of western blot analysis and confocal laser scanning microscopy . the anti - rtcp46 sera specifically reacted with the approximately 46 kda protein in parasite lysates of all life cycle stages by western blot analysis . although the bands were broad , the molecular mass of native tcp46 was consistent with the expected mass ( fig . 3afig . western blot analysis of the native tcp46 was carried out using the cell lysate from bsf , mcf , emf and pcf stages of t. congolense and anti - rtcp46 mouse serum . ( b ) cellular localizations of the tcp46 in all four life cycle stages of t. congolense ( pcf , emf , mcf and bsf ) were examined by immunofluorescence staining and confocal laser scanning microscopy . green indicates immunofluorescence staining of tcp46 , and red indicates nucleus and kinetoplast . ) . this indicates that tcp46 is an invariable protein constitutively - expressed throughout the life cycle stages . meanwhile , specific and stronger reactions were detected in bsf and mcf - stage parasites in comparison with the weak reactions in the emf and pcf - stage parasites ( fig . 3a ) . to determine the cellular localization of tcp46 , all stages of t. congolense parasites confocal laser scanning microscopy demonstrated that the expression of native tcp46 was mainly in the cytoplasm in all of the developmental stages ( fig . western blot analysis of the native tcp46 was carried out using the cell lysate from bsf , mcf , emf and pcf stages of t. congolense and anti - rtcp46 mouse serum . ( b ) cellular localizations of the tcp46 in all four life cycle stages of t. congolense ( pcf , emf , mcf and bsf ) were examined by immunofluorescence staining and confocal laser scanning microscopy . specificity and sensitivity of the rtcp46-based elisa : the specificity of the rtcp46-based elisa ( p46-elisa ) was evaluated using the sera of mice experimentally infected with t. congolense and the sera of non - infected spf mice . this was calculated by the od value from the serum samples of 9 spf mice . furthermore , the 6 serum samples from mice experimentally infected with t. congolense showed a high absorbance value . there was no cross - reaction with 26 serum samples from healthy cattle , 9 samples from b. bovis - infected cattle , 15 samples from b. bigemina - infected cattle or 5 samples from a. marginale - infected cattle ( fig . ( a ) evaluation of specificity with t. congolense experimentally infected mouse sera ( n=6 ) ; spf mouse sera ( n=9 ) , dashed line indicates the cutoff value ( 0.07 ) . ( b ) evaluation of specificity with babesia bovis experimentally infected cattle sera ( n=9 ) ; babesia bigemina experimentally infected cattle sera ( n=15 ) ; anaplasma marginale experimentally infected cattle sera ( n=5 ) , dashed line indicates the cutoff value ( 0.46 ) . ) . the cut - off value of the p46-elisa for cattle serum samples was 0.46 ( fig . the sensitivity of p46-elisa was examined using sera sequentially obtained from 3 mice infected with t. congolense il3000 . specific antibodies against tcp46 were detected from sera of the 3 mice as early as 8 days post - infection . high antibody titers were maintained until the chronic stage of infection , which was characterized by undetectable levels of parasitemia ( fig . 5afig . 5.(a ) detection of the specific antibody response against tcp46 in three mice experimentally infected with t. congolense by rtcp46-based elisa . ( b ) detection of the antibody responses in three mice experimentally infected with t. congolense by means of pcf cell lysate antigen elisa . ) ; 6 days earlier than pcf cell lysate elisa ( fig . ( a ) evaluation of specificity with t. congolense experimentally infected mouse sera ( n=6 ) ; spf mouse sera ( n=9 ) , dashed line indicates the cutoff value ( 0.07 ) . ( b ) evaluation of specificity with babesia bovis experimentally infected cattle sera ( n=9 ) ; babesia bigemina experimentally infected cattle sera ( n=15 ) ; anaplasma marginale experimentally infected cattle sera ( n=5 ) , dashed line indicates the cutoff value ( 0.46 ) . ( a ) detection of the specific antibody response against tcp46 in three mice experimentally infected with t. congolense by rtcp46-based elisa . ( b ) detection of the antibody responses in three mice experimentally infected with t. congolense by means of pcf cell lysate antigen elisa . t. congolense infection ( nagana ) causes significant losses in livestock production in africa . to control this disease , it is important to develop sensitive and reliable serological tests for the detection of t. congolense infection in animals . so far , only a few recombinant antigens have been identified to develop serological diagnostic methods of trypanosome infection [ 2 , 3 , 26 , 28 ] . therefore , there is a need to seek more candidate diagnostic antigens in order to develop accurate and sensitive serodiagnostics for nagana . since t. congolense undergoes a complex developmental cycle , each developmental stage of the parasite expresses both stage - specific and constitutive proteins . in this study , we focused on the proteins with high expression levels in the mcf and bsf stages , because of their importance in serodiagnosis . four proteins ( tcil3000.0.25950 , tcil3000.0.10.3480 , tcil3000.8.629 and tcil3000.7.1980 ) were selected from the data for differential protein expression in all life cycle stages of t. congolense ( table 1 ) . all of these proteins were successfully expressed by the bacterial expression system and purified for preliminary evaluation as a diagnostic antigen by western blot analysis using t. congolense - infected mouse sera ( data not shown ) . as a result , only the recombinant tcil3000.0.25950 protein was recognized by t. congolense - infected mouse sera ( fig . 2 ) . thus , we decided to further investigate the tcil3000.0.25950 protein as a candidate serodiagnostic antigen . the tcil3000.0.25950 gene contained an orf of 1,218 bp encoding a 46.4 kda protein ( tcp46 ) . southern blot analysis revealed that at least 2 copies of the tcp46 gene are tandemly arranged in the parasite genome ( fig . the tcp46 protein is expressed throughout the life cycle stages of the parasite as an approximately 46 kda protein ( fig . 3a ) . as the tcp46 was predicted to be a soluble protein , tcp46 was localized in the parasite cytosol ( fig . a strong reaction was observed in the bsf and mcf parasite stages compared with emf and pcf . this result , in part , consists with the previously reported proteome analysis which revealed that tcp46 showed 5.36 times higher expression levels in mcf than emf parasite levels . the potential of rtcp46 as a serodiagnostic antigen was evaluated by elisa with sequentially collected serum samples from t. congolense experimentally infected mice . the results showed that rtcp46-based elisa was able to detect a specific antibody response from 8 days post - infection until the end of the experiment ( 92 days post - infection ) ( fig . this would imply that rtcp46-based elisa may be an applicable diagnostic test of both the acute and chronic stages of the infection . in addition , the high antigenicity suggested that tcp46 may play an important role in the host immune response during t. congolense infection . no false - positive samples due to cross - reaction with sera derived from cattle infected with b. bovis , b. bigemina or a. marginale were detected by p46-elisa . since mixed infection of these protozoan parasites and t. congolense possibly occurs , the result indicates that elisa could be a specific test . in conclusion , the tcp46 gene was identified and characterized as an immunodominant antigen that was a candidate serodiagnostic antigen of t. congolense infection . the gst - rtcp46-based elisa had high specificity and was applicable for both the acute and chronic stages of infection . a further study will require the use of a number of serum samples from t. congolense - infected cattle in order to evaluate its practical use in the field .

abstracttrypanosoma congolense is a major livestock pathogen in africa , causing large economic losses with serious effects on animal health . reliable serodiagnostic tests are therefore urgently needed to control t. congolense infection . in this study , we have identified one t. congolense protein as a new candidate serodiagnostic antigen . the 46.4 kda protein ( tcp46 , gene i d : tcil3000.0.25950 ) is expressed 5.36 times higher in metacyclic forms than epimastigote forms . the complete nucleotide sequences of tcp46 contained an open reading frame of 1,218 bp . southern blot analysis indicated that at least two copies of the tcp46 gene were tandemly - arranged in the t. congolense genome . the recombinant tcp46 ( rtcp46 ) was expressed in escherichia coli as a glutathione s - transferase ( gst ) fusion protein . western blot analysis and confocal laser scanning microscopy revealed that the native tcp46 protein is expressed in the cytoplasm during all life - cycle stages of the parasite . moreover , an enzyme - linked immunosorbent assay ( elisa ) based on rtcp46 detected the specific antibodies as early as 8 days post - infection from mice experimentally infected with t. congolense . no cross - reactivity was observed in the rtcp46-based elisa against serum samples from cattle experimentally infected with babesia bigemina , b. bovis and anaplasma marginale . these results suggest that rtcp46 could be used as a serodiagnostic antigen for t. congolense infection .

You are an expert at summarizing long articles. Proceed to summarize the following text: the organophosphate poisons ( opps ) , i.e. , herbicides and pesticides , are chemical compounds that are hazardous to environment ( 1 ) . increased population followed by increased demands for food , especially agricultural products , has pushed farmers to increase their products , and this has led to the greater use of pesticides and poisons ( 2 ) . opps can enter the human body through skin and mucous membranes , such as eyes , mouth , or by inhaling the poison while it is being sprayed . generally , opps have high toxicity and induce many negative effects on different organs ( 3 ) . they can cause many complications , including nausea , dizziness , dyspnea , and urticaria ( 4 ) . the human organs and systems that can be affected by opps are the liver , kidneys , pancreas , heart , immune system , and vascular walls ( 57 ) . studies have shown the destructive effects of opps on the endocrine and reproductive systems of animals ( 8) . one of the effects of these pesticides is that they produce free radicals , which consequently change cell antioxidant systems and induce membrane lipid peroxidation ( 9 ) . in the human body , there are two types of cholinesterase enzyme ; one is the real cholinesterase ( acetyl - cholinesterase ) , which is in the red blood cells , neural systems , and muscular systems . the other type is pseudo - cholinesterase , which has a structure similar to that of acetyl - cholinesterase and is in serum , the pancreas , the liver , the brain , and in heart cells ( 1012 ) . opps inhibit the activity of both types of cholinesterase , causing the accumulation of acetylcholine neurotransmitter in the sympathetic and parasympathetic fibers and in muscles neural connections . as a consequence , this accumulation disrupts the transportation of messages through the cholinergic synapses ( 4 , 13 ) . decreased serum cholinesterase activity ( pche ) is a sign of acute intoxication , and decreased acetylcholinesterase ( ache ) in erythrocytes indicates chronic intoxication ( 14 ) . malathion is one of the most important and most used opps in world , including iran . malathion ( diethyl methoxy thio phosphine thio succinate ) is a parasympatholytic organophosphadate poison , which makes an irreversible bond / link with cholinesterase ( 15 ) . after being absorbed into the body , malathion is converted to malaoxon and oxygen analogs by the metabolism , and malaoxon is 61 times more toxic than malathion ( 16 ) . the mechanism of induced oxidative stress by malathion is producing free radicals including reactive oxygen species ( ross ) . oxidative stress harms many macromolecules by starting destructive processes , including lipid peroxidation , dna oxidation , protein oxidation , inactivation of enzymes , and causing dysfunction in different membranes ( 18 ) . most of insecticides have hydrophobic molecules that readily attach to biological membranes , especially to the two phospholipid layers of membranes , which causes membrane lipid peroxidation ( 13 ) . one of the ways of dealing with opp intoxication is by using antioxidants , which prevent excessive production of toxic free radicals and the damage they induce . vitamin c or ascorbic acid is a known antioxidant that seems necessary in many processes in the body , including forming bones and and repairing tissue scars ( 19 ) . vitamin c decreases oxidative stress and lipid peroxidation , thereby preventing many damaging processes in cells ( 20 ) . since malathion is one of the most commonly used opps and it inhibits cholinesterase activity , our aim in this study was to determine the toxic effects of malathion on serum and erythrocyte cholinesterase activity in male rats . this was an experimental study performed in pharmacology laboratory of pharmacy faculty and in advanced histology techniques laboratory of medical faculty of mashhad university of medical sciences ( mums ) in january 2014 . the study s sample size was calculated based on a formula and previous studies ( 11 , 13 ) . the study population consisted of 30 two - month - old vistar rats that weighed between 200 and 250 grams . the groups exposures were as follows : experimental group 1 : daily administration of 50 mg / kg of malathion in normal saline solution experimental group 2 : daily administration of 200 mg / kg of vitamin c experimental group 3 : daily administration of 50 mg / kg of malathion and 200 mg / kg of vitamin c sham group : administration of 50 mg / kg of normal saline control group : received nothing ( 21 , 22 ) . exposure to malathion , vitamin c , and normal saline ( product of sigma company ) were by intra - peritoneal injection ( 23 ) . after six weeks of daily exposure , the levels of acetylcholinesterase in erythrocyte and serum were measured . malathion 99% was purchased from ariashimi company and stock solution with a concentration of 50 mg / ml in normal saline was prepared as needed . to measure erythrocyte cholinesterase , the rats were anesthetized with intra - peritoneal injection of 0.1 ml/100 g ( 24 ) . half of the blood sample was centrifuged and then 3 ml of reactant dtnb ( dithiobis nitrobenzoic acid ) and 100 ml of the substrate solution ( acetyl thio colin idone ) were added to a glass tube , and the tube was placed in a water bath at 37 c for 10 seconds . then , 100 l of the hemolysis solution were added , and the glass tube remained in the water bath at 37 c for 10 more minutes , after which 1 ml of reactant stopper was added to it . the contents of the tube were stirred , and the tube was removed from the water bath . the blank samples were prepared with this same method with the exception that , in the last step after adding reactant stopper , 100 l of hemolysis solution were added to each tube that was taken out of the water bath . since each hemolyzed sample had its own absorption characteristics , one separate blank was prepared independently for use in determining the enzyme activity in each sample , and each sample s absorption in front in of its blank was read immediately at the wavelength of 440 nm . this process was repeated three times for each hemolyzed sample , and their mean was calculated . the element method was used to measure the inhibition of acetyl - cholinesterase enzyme in erythrocyte ( 51 ) , and serum cholinesterase was measured with titrometery . in this method , the main solution was acetylcholine chloride , and 0.5 ml of serum was added to 10 ml of the acetylcholine chloride . then , two drops of trizol reagent ( a ph indicator that is yellow in acidic condition and purple in alkaline condition ) were added and mixed . also , 5 cm3 of 10% acetic acid were added to the acetylcholine chloride to enhance its stability . the collected results were entered into and analyzed by spss version 16 ( spss inc . , chicago , illinois , usa ) . the statistical analysis of erythrocyte cholinesterase was made by anova , and the means were compared by the tukey - kramer test . since serum cholinesterase data were reported as percentages , the mann - whiney test was used to compare the means between the groups , and p - values < 0.05 were considered to be significant . this was an experimental study performed in pharmacology laboratory of pharmacy faculty and in advanced histology techniques laboratory of medical faculty of mashhad university of medical sciences ( mums ) in january 2014 . the study s sample size was calculated based on a formula and previous studies ( 11 , 13 ) . the study population consisted of 30 two - month - old vistar rats that weighed between 200 and 250 grams . the groups exposures were as follows : experimental group 1 : daily administration of 50 mg / kg of malathion in normal saline solution experimental group 2 : daily administration of 200 mg / kg of vitamin c experimental group 3 : daily administration of 50 mg / kg of malathion and 200 mg / kg of vitamin c sham group : administration of 50 mg / kg of normal saline control group : received nothing ( 21 , 22 ) . exposure to malathion , vitamin c , and normal saline ( product of sigma company ) were by intra - peritoneal injection ( 23 ) . after six weeks of daily exposure , the levels of acetylcholinesterase in erythrocyte and serum were measured . malathion 99% was purchased from ariashimi company and stock solution with a concentration of 50 mg / ml in normal saline was prepared as needed . to measure erythrocyte cholinesterase , the rats were anesthetized with intra - peritoneal injection of 0.1 ml/100 g ( 24 ) . half of the blood sample was centrifuged and then 3 ml of reactant dtnb ( dithiobis nitrobenzoic acid ) and 100 ml of the substrate solution ( acetyl thio colin idone ) were added to a glass tube , and the tube was placed in a water bath at 37 c for 10 seconds . then , 100 l of the hemolysis solution were added , and the glass tube remained in the water bath at 37 c for 10 more minutes , after which 1 ml of reactant stopper was added to it . the contents of the tube were stirred , and the tube was removed from the water bath . the blank samples were prepared with this same method with the exception that , in the last step after adding reactant stopper , 100 l of hemolysis solution were added to each tube that was taken out of the water bath . since each hemolyzed sample had its own absorption characteristics , one separate blank was prepared independently for use in determining the enzyme activity in each sample , and each sample s absorption in front in of its blank was read immediately at the wavelength of 440 nm . this process was repeated three times for each hemolyzed sample , and their mean was calculated . the element method was used to measure the inhibition of acetyl - cholinesterase enzyme in erythrocyte ( 51 ) , and serum cholinesterase was measured with titrometery . in this method , the main solution was acetylcholine chloride , and 0.5 ml of serum was added to 10 ml of the acetylcholine chloride . then , two drops of trizol reagent ( a ph indicator that is yellow in acidic condition and purple in alkaline condition ) were added and mixed . also , 5 cm3 of 10% acetic acid were added to the acetylcholine chloride to enhance its stability . the collected results were entered into and analyzed by spss version 16 ( spss inc . , the statistical analysis of erythrocyte cholinesterase was made by anova , and the means were compared by the tukey - kramer test . since serum cholinesterase data were reported as percentages , the mann - whiney test was used to compare the means between the groups , and p - values < 0.05 were considered to be significant . the mean of serum cholinesterase activity was 26.66 2.88 , 24 4.18 , and 29.16 4.91 in the control , normal saline , and vitamin c groups . these means in the malathion and malathion + vitamin c groups were 12 2.73 and 18 4.47 , respectively . the results indicated that the activity of serum cholinesterase in the malathion group was significantly decreased compared to the other groups . the differences between the means for the control group , normal saline group , and vitamin c groups and the mean of the malathion group were significant ( p - value < 0.001 for all three comparisons ) ( table 1 ) . the mean of erythrocyte cholinesterase activities in the control , normal saline , and vitamin c groups were 3.33 0.28 , 2.72 0.42 , and 2.8 0.43 . these means in the malathion and the malathion + vitamin c groups were 1.29 0.17 and 2.04 0.18 , respectively . the comparison of mean erythrocyte cholinesterase activities in the control , normal saline , vitamin c and malathion + vitamin c groups with the malathion group showed significant differences ( p < 0.0001 for the first three groups and p = 0.002 for the last group ) ( table 2 ) . regarding the protective effects of vitamin c , the comparison of mean and standard deviation of both serum and erythrocyte cholinesterase activity between the control group and the group that received only vitamin c showed that enzyme activity was significantly improved by the administration of vitamin c ( p = 0.03 for both comparisons ) . our results also showed that the mean of serum cholinesterase activity in the rats that received malathion + vitamin c was not significantly different from the control group ( p = 0.009 ) , while the difference between the group that was exposed only to malathion and the control group was significant ( p < 0.0001 ) . the differences between the mean of erythrocyte cholinesterase activity in the control group and the malathion and the malathion + vitamin c groups also were significant ( p < 0.0001 for both ) . this study aimed to evaluate the activity level of serum and erythrocyte cholinesterase in male rats exposed to malathion and vitamin c. our results showed that the activity of both serum and erythrocyte cholinesterase significantly decreased in rats exposed to malathion compared with control group ( p < 0.0001 ) . the administration of vitamin c alone significantly increased serum and erythrocyte cholinesterase activity in comparison with control group ( p < 0.03 ) . the difference between serum cholinesterase activity in the rats that received malathion + vitamin c and the control group was not significant ( p = 0.09 ) , however the difference between mean of erythrocyte cholinesterase activity was significant ( p < 0.0001 ) . these findings indicated that vitamin c had a protective effect on serum cholinesterase activity but not on erythrocyte cholinesterase activity . the results of this study showed that serum and erythrocyte cholinesterase activities in the group exposed to malathion were significantly less than the control group ( p < 0.001 ) , which were similar to the results of other studies . these findings confirmed the results of inbaraj et al.s study that was performed on fish exposed to malathion ( 25 ) . the results of ansari et al.s study on fish and abdollahi et al.s study on rats also demonstrated the decrease in acetylcholinesterase activity upon exposure to opps , especially malathion ( 26 , 27 ) . another study that evaluated the effects of three opps ( malathion , diazinon , and parathion ) on wildfowl eggs showed that all of these opps can significantly decrease the activity of fetal plasma cholinesterase ( 28 ) . the results of all of these studies indicated the intoxication of live animals by opps , especially malathion . since opps are very commonly used poisons worldwide , intoxication by them seems inevitable , therefore attention is now being focused on determining ways to reduce their intoxication . the studies results have shown that vitamin c can reduce the production of free radicals produced by oxidative stress ( 13 ) . in our study , one group of rats received vitamin c and malathion , and the results illustrated a significant increase in serum cholinesterase compared with the group that received only malathion . this finding was similar to the results of uzun et al.s study about malathion - induced testicular toxicity in male rats and the protective effect of vtamins c and e ( 13 ) . their results indicated that co - treatment of rats exposed to malathion with vitamins e and c had a protective effect on sperm count , sperm motility , and abnormal sperm numbers . kalender et al . also found that vitamins c and e can reduce malathion hepatotoxicity ( 29 ) . the reduction in serum cholinesterase caused by malathion restrains the activity of hypothalamus - hypophysis - gonadal axis and leads to the reduction of the production of sexual hormones and causes disorders in the reproductive system ( 30 ) . it must be considered that the results of this study only showed changes of serum and erythrocyte cholinesterase activity under malathion exposure and also indicated that vitamin c , as an antioxidant , reduced the effects of oxidative stress caused by malathion intoxication . however , the results do not imply any protective effect of vitamin c for the reproductive system upon exposure to malathion . since antioxidants can reduce the harmful effects of exposure to opps , people who are exposed to opps in direct ways ( contact or inhalation ) or indirect ways ( using contaminated agricultural products or proteins ) , the use of antioxidants , such as vitamin c , may decrease the damage . our findings showed that malathion decreased the activity of serum and erythrocyte cholinesterase in exposed rats and that the administration of vitamin c reduced the induced damage . since malathion is a very commonly used insecticide and people are exposed to it in different ways , it could have similar intoxication effects on people who are exposed to it . vitamin c has been shown to have protective effects against malathion toxicity in animal studies , therefore vitamin c supplementation is suggested for people who are exposed to malathion . however , to generalize these results , additional studies with larger sample sizes or different populations are recommended .

introductionmalathion is one of organophosphate poisons ( opps ) that inhibit cholinesterase activity and induce oxidative stress in target organs , such as the reproductive system . the aim of this study was to assess the effects of malathion on serum and erythrocyte cholinesterase activity in male rats and also to assess the protective effects of vitamin c in this regard.methodsthis experimental study was performed in the pharmacology laboratory of the pharmacy faculty and in the advanced histology techniques laboratory of the medical faculty of mashhad university of medical sciences ( mums ) in january 2014 . thirty male wistar rats , weighting 200250 g , were divided into five groups of six . the different groups were exposed as follows : group 1 : malathion 50 mg / kg ; group 2 : vitamin c ; group 3 : malathion plus vitamin c with the specified doses ; sham group : normal saline ; and control group : no exposure . after six weeks , 3 ml blood samples were taken from the rats , and titrimetric and ellman methods were used to assess serum and erythrocyte cholinesterase activity , respectively . the data was analyzed by spss 16 , and p < 0.05 was considered significant.resultsthe activities of serum and erythrocyte cholinesterase were inhibited significantly in the malathion exposed group compared to the control group ( p < 0.001 ) . the administration of vitamin c alone significantly increased the activities of serum and erythrocyte cholinesterase . the serum and erythrocyte cholinesterase inhibition showed improvement in the group that received both malathion and vitamin c.conclusionmalathion reduced the activities of serum and erythrocyte cholinesterase in exposed animals . it probably has the same intoxication effects on people who are exposed . improvement of cholinesterase activity by antioxidant effects of vitamin c suggests that vitamin c supplementation can be used to decrease side effects of opp exposure .

You are an expert at summarizing long articles. Proceed to summarize the following text: the early diagnosis of the acute abdomen is a major goal in surgical practice . despite the introduction of novel imaging modalities , acute abdominal conditions are still a challenging problem . to date , many inflammatory markers have been used for the diagnosis of acute surgical conditions , including acute appendicitis . leukocyte count and c - reactive protein ( crp ) procalcitonin ( pct ) and d - dimer have been studied as novel biomarkers for the diagnosis of acute abdomen in recent years 1 . pct , inactive precursor of calcitonin , is a 116 amino acid polypeptide glycoprotein with a molecular weight of 13 kda 2 . it is found only in the c cells of the thyroid gland under normal metabolic conditions . assicot has first reported the increased pct levels in patients with bacterial and fungal infections and sepsis 3 . thereafter , many studies have confirmed that pct is a biomarker of inflammatory host response to microbial infections and increased in surgical pathologies such as ileus and pancreatitis 4,5 . there is also a proportional increase in pct levels with the severity of the infection . recently , d - dimer has also been used as a diagnostic marker in the acute abdomen . it is a non - specific acute phase reactant 6 and mainly stimulates the cell - mediated immunity and chemotaxis in inflammation . the aim of this prospective study was to evaluate the diagnostic value of d - dimer , pct and crp measurements in the acute appendicitis . this prospective study enrolled 78 consecutive patients who were operated with the diagnosis of acute appendicitis between march 1 , 2010 and july 1 , 2011 . the patients using warfarin or heparin , with a pregnancy , and under antibiotherapy were excluded from the study . the diagnosis of acute appendicitis was established based on the clinical findings of acute abdomen , routine laboratory tests and abdominal ultrasonography or computed tomography . blood samples were taken immediately after admission for measuring pct , d - dimer and crp levels . pct levels were measured by a pct kit ( vidasbrahms pct- france ) . a pct level of > 0.05 ng / ml was considered abnormal . d - dimer levels were measured by stratus cs acute care d - dimer method . it is a two - site sandwich assay based upon solid phase radial partition immunoassay ( rpia ) technology . the normal range of d - dimer levels is between 0 and 600 ng / ml . pct , d - dimer and crp levels were compared between the patients in the study . the normal range of leukocyte count is between 4.6 and 10.2 k / ul . all appendectomies were performed by conventional surgery and the specimens were sent for routine histopathological examination . the patients were grouped as phlegmonous appendicitis ( group 1 ) , gangrenous appendicitis ( group 2 ) , perforated appendicitis ( group 3 ) and negative appendectomy ( group 4 ) according to the surgical findings and histopathological results . the data were presented as mean sem ( standard error of mean ) or median and interquartile range . the clinical and demographic variables were compared using the student - t test for continuous variables with a normal distribution , the wilcoxon rank sum test for nonparametric variables and the chi - square test ( or fisher 's exact test ) for categorical variables . the data were presented as mean sem ( standard error of mean ) or median and interquartile range . the clinical and demographic variables were compared using the student - t test for continuous variables with a normal distribution , the wilcoxon rank sum test for nonparametric variables and the chi - square test ( or fisher 's exact test ) for categorical variables . of 78 patients , 54 ( 69.2 % ) were male and 24 ( 30.8 % ) were female , and the mean age was 25.4 11.1 years ( range , 18 to 69 years ) . the most common symptom was abdominal pain with an occurrence in 64 ( 82% ) patients . right lower quadrant tenderness was the most common sign with an occurrence in 71 patients , followed by rebound tenderness in 64 patients and defense during physical examination in 19 patients . there were 47 patients ( 60.3 % ) with phlegmonous appendicitis ( group 1 ) , 19 patients ( 24.3% ) with gangrenous appendicitis ( group 2 ) , 8 patients ( 10.2 % ) with perforated appendicitis ( group 3 ) and 4 patients ( 5.2 % ) with normal appendix ( group 4 ) 66 ( 84.6 % ) patients had increased leukocyte count . the pct values were higher than the upper normal limit in 20 ( 25.6% ) patients , followed by d - dimer in 22 ( 28.2 % ) patients and crp in 54 ( 69.2 % ) patients . the mean values for leukocyte , pct , d - dimer and crp are shown in ( table 2 ) . the mean age and duration of pain were statistically higher in perforated appendicitis ( group 3 ) when compared with the phlegmonous , uncomplicated appendicitis ( group 1 ) ( p<0.05 ) . pct and crp levels were also higher in perforated group ( p<0.05 ) ( table 3 ) . crp levels were found to be significantly different between the phlegmonous group and the perforated group ( p<0.05 ) . the roc curve for pct ( with a cut off value of 0.05 ng / ml ) was not helpful for differentiating between phlegmonous and negative appendicitis ( p>0.05 ) . in addition , d - dimer ( with a cut off value of 600 ng / ml ) was also not helpful for differentiating between phlegmonous and negative appendicitis ( p>0.05 ) . however , crp ( with cut off value of 0.8mg / ml ) was found to be helpful for differentiating between phlegmonous and negative appendicitis ( p<0.05 ) . sensitivity , specificity , positive and negative predictive values and diagnostic value of inflammatory markers are shown in table 4 and figures 1 and 2 . however , leukocyte count showed a very low specificity , and the diagnostic value of pct and d - dimer were found to be very low ( 26% and 31% , respectively ) for detecting acute appendicitis . roc curves of the diagnostic value of pct , d - dimer and crp in differentiating between phlegmonous and perforated appendicitis were shown in figures 3 , 4 and 5 . despite the introduction of novel diagnostic tools in recent years , the diagnosis of appendicitis is still an important problem . leukocyte count and crp are the most frequently used laboratory tests for diagnosis of acute appendicitis . they are easily implemented in routine practice and have an advantage of cost effectiveness , but their sensitivity and specificity are limited 12 . although it was not the major objective of this study , the sensitivity and specificity of leukocyte count were found to be 85% and 25% , respectively . many inflammatory markers , including phospholipase a2 , serum amyloid a , interleukins and cytokines have been used to increase diagnostic accuracy in acute appendicitis 13,14,15 . pct and d - dimer are new inflammatory markers , which are increased in septic conditions and also used in diagnosing acute appendicitis . they were concluded that pct was specially increased in patients with appendiceal perforation and gangrenous appendicitis . but it has a very low sensitivity , which prohibits its routine use for the diagnosis of acute appendicitis . kouame db has also reported similar results and stated that pct had a sensitivity of 28% in acute appendicitis 18 . in our study , the sensitivity and specificity , and the diagnostic value of pct were 24 % , 50 % , and 26 % , respectively . these results showed that pct was not a useful marker for the diagnosis of the acute appendicitis . on the other hand , this study also demonstrated that pct was significantly increased in patients with perforated appendicitis . pct level was statistically higher in group 3 ( perforated appendicitis ) when compared to group 1 ( phlegmonous appendicitis ) ( p<0.05 ) . pct levels have been found to be lower in acute appendicitis compared to the other bacterial infections . in addition , it was claimed that uncomplicated appendicitis does not cause significant bacterial translocation 19 , which may explain the low levels of pct in uncomplicated , phlegmonous appendicitis . d - dimer levels may be increased in many conditions , including venous thromboembolism , acute coronary syndromes , trauma , and malignancies 20 - 24 . in recent years , kurt y et al 25 studied the diagnostic value of d - dimer for acute mesenteric ischemia in rats . they stated that d - dimer may be a valuable diagnostic tool in acute mesenteric ischemia . on the other hand , the results of other clinical studies on different acute abdominal conditions including acute appendicitis are controversial . akyildiz hk et al 26 studied the d - dimer in non - traumatic acute abdominal conditions . in their study , the sensitivity of d - dimer test in patients needing urgent laparotomy was found as 95.7% . they concluded that d - dimer can be an alternative to leukocyte count in diagnosing the acute abdomen . in addition , the sensitivity of d - dimer was estimated to be 29 % in our study . mentes o et al 27 have reported the similar results for the diagnostic value of d - dimer . we found that specificity of d - dimer test in acute appendicitis was relatively higher ( about 75% ) . but similarly with pct , the diagnostic value of d - dimer was very low ( 31% ) in the acute appendicitis . we think that the low sensitivity and diagnostic value of d - dimer is an important hindrance for its routine use as a diagnostic marker in acute appendicitis . it is an acute phase reactant that synthesized in liver in response to the tissue injury . the previous studies have demonstrated a sensitivity of 40 to 94% and a specificity of 38 to 87 % for crp measurement 28 - 30 . in this study , the sensitivity of crp measurement was found to be 72 % and the specificity was 75 % . hallan s reported in a meta - analysis that crp had moderate accuracy in diagnosing acute appendicitis 31 . when compared to other two inflammatory markers ( pct and d - dimer ) , crp was found to have higher sensitivity and diagnostic accuracy for the acute appendicitis . some authors have claimed that crp could predict the severity of appendicitis and perforation 32 - 33 . we have also obtain similar results showing that crp levels were significantly higher in perforated appendicitis cases than non - perforated cases ( p<0.05 ) . although this study has some limitations , such as having a small sample size for negative appendicitis , we can conclude that crp seems to be a useful marker in the evaluation of acute appendicitis . but an increase in crp levels alone is not sufficient to make the decision of the surgical intervention in the acute appendicitis . despite the increase in the other inflammatory markers , pct and d - dimer , in the acute appendicitis , the diagnostic value of crp is higher than these two markers for the acute appendicitis . future studies with larger sample size would be beneficial to evaluate the role of pct , d - dimer and crp in the acute appendicitis .

background : the early diagnosis of acute abdomen is of great importance . to date , several inflammatory markers have been used for the diagnosis of acute abdominal conditions , including acute appendicitis . the aim of this study was to evaluate the diagnostic utility of d - dimer , procalcitonin ( pct ) and c - reactive protein ( crp ) measurements in the acute appendicitis.methods : this prospective study was conducted between march 1st , 2010 and july 1st , 2011 . in this period , seventy - eight patients were operated with the diagnosis of acute appendicitis , and d - dimer , pct and crp levels of the patients were measured . the patients were grouped as phlegmonous appendicitis ( group 1 ) , gangrenous appendicitis ( group 2 ) , perforated appendicitis ( group 3 ) and negative appendectomy ( group 4 ) according to the surgical findings and histopathological results.results : of 78 patients , 54 ( 69.2 % ) were male and 24 ( 30.8 % ) were female , and the mean age was 25.4 11.1 years ( range , 18 to 69 years ) . 66 ( 84.6 % ) patients had increased leukocyte count ( white blood cell count ) . the pct values were higher than the upper normal limit in 20 ( 25.6% ) patients , followed by d - dimer in 22 ( 28.2 % ) patients and crp in 54 ( 69.2 % ) patients . the diagnostic value of leukocyte count and crp in acute appendicitis was higher than that of the other markers , whereas leukocyte count showed very low specificity . crp values were higher in perforated appendicitis when compared with the phlegmonous appendicitis ( p<0.05 ) . however , pct and d - dimer showed lower diagnostic values ( 26% and 31% , respectively).conclusion : an increase in crp levels alone is not sufficient to make the diagnosis of acute appendicitis . however , crp levels may differentiate between phlegmonous appendicitis and perforated appendicitis . due to their low sensitivity and diagnostic value , pct and d - dimer are not better markers than crp for the diagnosis of acute appendicitis .

You are an expert at summarizing long articles. Proceed to summarize the following text: common cold or upper respiratory tract infection is an acute , minor , self - limiting , and viral infection and a worldwide health problem that affects sleep , social life , and school and work efficiency . common cold presumably imposes a significant economic burden on society because it causes time off school or work and reduced working capacity . adults have an average of two or three episodes annually , and young children may have up to five episodes . the common cold is caused by various respiratory viruses , most commonly a rhinovirus and characterized by sore throat , rhinorrhea , sneezing , nasal congestion , cough , watery eyes , and sinus pain . sore throat , malaise , and low - grade fever are developed at the beginning . these symptoms eliminate within a few days and are replaced with nasal congestion , rhinorrhea , and cough within 2448 hours after onset of the first symptoms . the second group of symptoms is what stimulates most patients to see a physician for alleviation . symptoms usually peak on the 34 days and most symptoms resolve within 1 week . nasal discharge , occurring at the peak of disease , can be thick or purulent and may be misdiagnosed as a bacterial sinusitis . complications include otitis media , sinusitis , pneumonia , exacerbations of asthma and chronic obstructive pulmonary disease , and serious illness in immune - compromised patients . currently , drugs such as corticosteroids , opioid analgesics , immunosuppressive agents , and nonsteroidal anti - inflammatory drugs are used to control the clinical manifestation . the use of these medications can cause side effects such as respiratory depression , renal and hepatic damage , tolerance , sedation , spasm , bone marrow depression , constipation , gastrointestinal disturbances , suppression of response to infection or injury , and osteoporosis . despite great advances in medicine , the common cold is still a burden on society in terms of human anguish and economic waste . iranian traditional medicine ( itm ) has defined specific classification and treatment for types of cold and its complications . this study presents the most important herbal treatments that are used by iranian traditional physicians . itm ( humoral medicine ) is one of the oldest forms of medicine . in early medieval times ( islamic course ) , muslim physicians ( frequently persians ) ourished . iranian traditional physicians and scientists greatly aided medical science by their own observations and skills through > 7000 years of persian history . the persians not only collected existent medical data but also added to this science their own accurate observations and experimentation and presented many new scientific theories . the most influential iranian physicians were abu bakr muhammad ebn zakariya al - rzi ( rhazes ; 865925 ce ) , ali ebn al - abbas - al - majusi ( haly abbas ; 949982 ce ) , abu ali al - hossein ebn abdullah ebn - e - sina ( avicenna ; 9801037 ce ) , and zinn - ol - abedin ismael jorjani ( sorsanus ; 10421137 ce ) . the texts of qanoon fel teb ( the canon ) by ebn - e - sina , rzi 's kitab al - hawi ( the continens ) , zakhireh kharazmshahi ( the treasure of kharazmshah ) by jorjani , and kitab - al - maliki ( liber regius ) by haly - abbas were central to western medical science from the 13 century to the 19 century . traditional medicine is the knowledge , skills and practices based on the theories , beliefs and experiences indigenous to different cultures , used in the maintenance of health and in the prevention , diagnosis , improvement or treatment of physical and mental illness . traditional medicine covers a wide variety of therapies and practices which vary from country to country and region to region . itm was established by the four - humor theory ( sanguine , phlegm , bile , and melancholy ) and disease is based on an imbalance in humors . the history of the use of medicinal plants in ancient persia can be traced back to about 10,000 years ago from the prehistoric times to 637 ce , and the development of pharmaceutical science and practice were particularly remarkable . medieval persian physicians used plants with various therapeutic actions , such as anti - inflammatory and antimicrobial , to treat catarrh . in the medical texts of medieval persia , such as the canon by ebn - e - sina , the physicians classified catarrh as warm and cold . . clinical manifestation of warm catarrh are redness of eye and face , warmth , sharpness , dilution and yellowness of discharges , burning sensation in nose and throat and in cold catarrh tension and heaviness in head , face , and forehead , thick whitish or livid discharge , roughness of tongue , discharges with cold and unsavory nature , heaviness of senses , malaise , feeling better after consuming foods of warm nature , nasal stuffiness , and losing the sense of smell . also the classification system of catarrh was important for designing the treatment plan , which contained the prescription of medicinal herbs , topical treatments , and manual practices . despite progress in the advancement of therapy in recent years the search for new pharmacologically active anti - inflammatory and antimicrobial substances obtained from plants has led to the discovery of some clinically beneficial drugs that have played a major role in the treatment of human diseases . recently , some of the medicinal herbs that were used in medieval persia for treatment of catarrh have been evaluated with the application of modern scientific methods ( table 1 ) . these studies have increased the feasibility of a revival of traditional treatments , and it is hoped that a review of the effect of some drugs that were prescribed in itm will prompt further research into the clinical benefits of these treatments for catarrh . in this study , known sources of itm were searched and the ideas of former great scholars and physicians about medicinal plants that are used for the treatment of catarrh were collected . then we searched pubmed and google scholar and found 10 herbal medicines that have the ability to treat the catarrh . gn zo ) has a long history of usage as a fruit and remedy in itm . it is used in the treatment of diseases such as warm catarrh , cough , asthma , and other inflammatory diseases of the lung , inflammatory diseases of eye , and inflammation and rash . the principal biologically active components are vitamin c , flavonoids , triterpenic acids , phenolics , and polysaccharides . new phytochemical studies of jujube fruit have indicated some clear biological effects , such as the anti - inflammatory , anticancer , antiobesity , immunostimulating , antioxidant , hepatoprotective , and gastrointestinal protective activities and inhibition of foam cell formation in macrophages . assyrian plum ( cordia myxa l. ) is another drug in itm that is used to treat warm catarrh , cough , and inflammatory diseases of the pharynx , gastrointestinal system , and lung . recent studies on certain species of cordia indicate that they have anti - inflammatory properties . one of the studies tested the effects of assyrian plum fruit on experimentally induced colitis in rats and proved the anti - inflammatory effect of cordia myxa . opium poppy ( popaver somnifrum l. ; yng s ) has been often used in itm to treat warm catarrh , inflammatory lung diseases , and inflammatory gastrointestinal diseases , and for anesthesia . hollyhock ( althea officinalis l. ( marshmallow ) ; sh ku ) is one of the most famous and important drugs in itm . it is used to treat warm catarrh , inflammatory diseases of the respiratory system , gastrointestinal , urinary tract , nervous system , joints , and breast , and inflammations of the neck and eye . hollyhock contains flavonoids , polysaccharides , quercetin , volatile oil , glycosides and organic acids . pharmacological studies on hollyhock confirm anti - inflammatory , antipyretic , and antibacterial effects against escherichia coli , staphylococcus aureus , bacillus cereus , and listeria monocytogene . violet ( viola odorata l. ) is another therapeutic drug used for warm catarrh , inflammatory lung and gastrointestinal diseases , inflammations of the neck and head , headache , and insomnia in itm . it is also an important medicinal plant that is used to treat bronchitis , common cold , and gastrointestinal diseases . in an in vitro study , the antimicrobial effect of violet was evaluated on three microbial species ( s. aureus , e. coli , and pseudomonas aeruginosa ) ; the maximum antimicrobial effect was on s. aureus and the least effect on p. aeruginosa . the antimicrobial effect is low in the leaves and roots of the violet high in the flowers . violet also has anti - inflammatory properties , so it is useful in the treatment of inflammatory and infectious diseases ( fig . 1 ) . purging cassia ( cassia fistula l. ) is a well - known compound used as a laxative in itm , and for warm catarrh , lung diseases , gastrointestinal diseases , and joint diseases . it is also used as an antipyretic . in vivo and in vitro studies on purging cassia show that it has hepatoprotective , hypolipidemic , antimutagenic , anti - inflammatory , antibacterial , antiulcer , antifungal , and antioxidant activities . antimicrobial properties are against e. coli , bacillus mycides , bacillus subtilis , mycobacterium smegmatis , klebsiella aerogenes , p. aeruginosa , and proteus vulgaris , and antifungal effects are against trichophyton mentagrophytes and epidermophyton floccosum . chamomile ( matricaria chamomilla l. ) has been used for warm and cold catarrh , inflammatory diseases in different parts of the body such as the lungs , gastrointestinal , and brain and also used for infectious fever in itm . according to research , the basic constituents of chamomile include several phenolic compounds , primarily the flavonoids apigenin , patuletin , quercetin , glucoside , and luteolin . based on in vitro studies , chamomile has moderate antioxidant and antimicrobial effects , and significant antiplatelet effect . according to animal model studies , chamomile has potent anti - inflammatory , antimutagenic , cholesterol - lowering , anxiolytic , anticonvulsant , and antispasmotic effects . hyssop ( hyssopus officinalis l. ) is a well - known compound in itm that is used for cold catarrh , pneumonia , cough , asthma , and other inflammatory lung diseases . the studies on hyssop have proved antimicrobial and antifungal effects against e. coli , p. aeruginosa , s. aureus , staphylococcus pyogenes , and candida albicans and also anti - inflammatory effects . galangal ( alpinia galangal ; go ling jing ) has been used for cold catarrh , asthma , chronic cough , and other diseases of lung , joint pain , ear pain , urinary tract diseases , nervous system diseases , and amnesia in itm . new research on galangal shows that its components include 1-acetoxychavicol acetate ( galangal acetate ) and it also has antibacterial effects , especially against s. aureus . aloeswood ( aquilaria agallocha roxb ; chn xing ) has been one of the most important drugs in the itm . it is used to treat cold catarrh , inflammatory lung diseases , heart disease , gastrointestinal and genitourinary diseases , and toothache . the research on aquilaria agallocha has shown in - vivo ( by carrageenan - induced paw edema in a rat model ) and in - vitro ( by human red blood cell membrane stabilization method ) anti - inflammatory effects of aloeswood . aquilaria agallocha exerts its anti - inflammatory properties via two mechanisms : ( 1 ) erythrocyte membrane stability this causes lysosomal membrane stability and as a result limits the inflammatory response ; and ( 2 ) inhibition of serotonin , histamine , or prostaglandins synthesis . it is reported as a treatment for anaphylactic reactions and also has an antihistamine effect . the plant is used to treat inflammation , arthritis , vomiting , cardiac disorders , cough , asthma , leprosy , and anorexia traditionally and is used to treat headache , inflammation , gout , and arthritis in folk medicine . plants discussed in this study are consistent with new research and can be used in modern treatments . according to the antimicrobial resistance and complications of antibiotic and anti - inflammatory drugs , it seems that the various components of the medicinal herbs are effective in producing new drugs . we hope that further research on medicinal plants will benefit the future treatment of catarrh and other diseases related to it .

catarrh is a condition that is carefully explained in iranian traditional medicine . medieval iranian physicians used some medicinal plants in the treatment of the catarrh . some of these substances are used in treatment today , although still more of these materials can be used in modern medicine.in this study we searched known sources of iranian traditional medicine and collected the ideas of former great scholars and physicians about medicinal plants that are used for treatment of catarrh . then we searched pubmed , google scholar , scopus , and web of science databases and found 10 medicinal herbs that have the ability to treat catarrh.plants discussed in this study are consistent with new research and can be used in modern treatments . according to rising bacterial resistance to antibiotics and complications of antibiotic and anti - inflammatory drugs , it seems that the various components of the medicinal herbs can be beneficial in producing new drugs . also it is hoped that more investigations on medicinal plants will be conducted in the future treatment of catarrh and other diseases related to it .

You are an expert at summarizing long articles. Proceed to summarize the following text: deficits in social cognitive skills in schizophrenia patients ( sz ) have been demonstrated in numerous studies . facial affect recognition ( far ) is particularly relevant for effective social interaction ( johnston et al . , 2010 ; sachs et al . , 2012 ; wlwer et al . , 2012 ) . as impaired social cognitive skills are linked to functional impairment ( e.g. , poole et al . , 2000 ; sachs et al . , 2004 ; hofer et al . , 2009 ) , remediation programs have targeted social - cognitive skills including far ( e.g. , wlwer et al . , 2005 ; habel et al . , 2010 ; mazza et al . , 2010 ; wlwer and frommann , 2011 ; kurtz and richardson , 2012 ) . in their meta - analysis of 19 studies including 692 sz , kurtz and richardson affirmed moderate - to - large effects on social cognitive measures ( including facial affect identification tasks ) and on observer - rated social function , with training effects varying with age , duration of illness , and extent of training . understanding brain processes contributing to social cognition deficits should facilitate the development and evaluation of tailored remediation strategies . numerous studies have studied cortical and subcortical correlates of emotion processing in sz including far ( for hemodynamic imaging evidence , see pinkham et al . , 2007 ; seiferth et al . , 2010 ; for event - related brain potential evidence , turetsky et al . , 2007 ; wlwer et al . , 2012 ; wynn et al . , 2013 ; for oscillatory activity , singh et al . , 2011 ; these studies provide substantial evidence of deviant brain activity related to social cognition , including far . yet few studies have evaluated the effects of social - cognition training on brain activity ( habel et al . , 2010 ; wlwer et al . , 2012 ; luckhaus et al . , popov et al . ( 2013 ) proposed a neural mechanism for such disrupted facial affect processing and its remediation . the study demonstrated group differences in 1015 hz ( alpha ) neuromagnetic oscillatory power modulation in bilateral sensorimotor regions while sz and healthy controls ( hc ) viewed 5 s videos of dynamic facial stimuli that changed from neutral to fear or to happy expressions . during the period prior to correct affect recognition , hc exhibited a significant alpha power increase relative to baseline , whereas the significantly smaller increase in sz varied with poorer discrimination accuracy . because sensorimotor alpha activity has been linked to social information processing including far ( e.g. , singh et al . , 2011 ) , the present study employed a targeted intervention to test the hypothesis that this recruitment of neural processes facilitates the recognition of unfolding facial affect in hc and is apparently impaired in sz . support for the hypothesis would mean that appropriate training can address deficits in recognition skills . the present study evaluated a new facial affect recognition training ( fat ) protocol , designed specifically to address mechanisms facilitating far , and assessed alpha - power modulation as a possible mechanism of the training effect . because beneficial effects of specific cognitive and/or social cognitive training protocols as add - ons to general sz remediation programs have been reported ( e.g. , keefe and harvey , 2012 ; sacks et al . , 2013 ) , the present study compared fat with a well established cognitive training protocol , cognitive exercises ( ces ; positscience , sf , usa ) already shown to be effective in sz ( fisher et al . , 2014 ; see also popov et al . , 2011 , 2012 ) . ce focuses on perceptual and cognitive skills and does not include facial or emotional judgments . thus , it served as an active control for fat 's use of a training regimen . in between - group analyses , fat and ce were compared with the inpatient unit 's treatment as usual ( tau ) , which provided a nonspecific control for the passage of time and general treatment efforts . analyses addressed a series of questions : does training affect brain dynamics , and does specific training ( fat ) affect specific far - related oscillatory dynamics ? does training normalize brain dynamics ( does fat reduce pre - training differences in far - related alpha dynamics between sz and hc to nonsignificance ) ? to what extent are changes dependent on an active intervention in general ( does fat do so better than tau ) or on specific far - focused training ( does fat do better than ce ) ? inpatients with an icd diagnosis of paranoid - hallucinatory schizophrenia ( code number 20.0 ) were recruited at the regional center for psychiatry . inclusion criteria were normal intellectual function and no history of any neurological condition or disorder such as epilepsy or head trauma with loss of consciousness . according to the standard treatment regimen of the center , all patients were stably medicated at the time of the study . from the pool of eligible sz ( n = 114 1 ) , n = 80 were randomly assigned to three intervention groups , of which n = 62 completed the interventions and all pre- and post - intervention assessments ( symptom ratings , neuropsychological assessment , magnetoencephalographic ( meg ) recording ) . after providing written informed consent , sz were randomly assigned ( with some adjustment to ensure balanced group sizes ) to one of three groups : the two computer - based training methods , fat or ce , or tau . recruitment continued until at least 20 sz were enrolled in each intervention . at post - intervention assessment , data from one subject in each group were discarded because of meg artifact or missing meg data . thus , results are reported for n = 19 patients in each group . symptom severity pre- and post - intervention was assessed via the positive and negative symptom scale ( panss , kay et al . , 1987 ) and the global assessment of functioning ( gaf ) scale of dsm - iv . upon treatment assignment , groups did not differ in gender , age , educational level , iq , symptom severity ( panss ) , global function ( gaf ) , medication ( evaluated by cpz equivalent ) , or neuropsychological test performance ( below and table 2 ) . in each group 2 patients were left - handed , and 24 were ambidextrous , as assessed by a modified version of the edinburgh handedness questionnaire ( oldfield , 1971 ) . sz participants completed a protocol consisting of ( 1 ) assessment of clinical and demographic data , neuropsychological test performance ( matrics consortium cognitive battery , mccb , nuechterlein et al . , 2008 ) , and a far criterion task during meg , all prior to intervention , ( 2 ) 4-week intervention ( fat , ce , or tau ) , and ( 3 ) post - intervention assessment of clinical data , mccb , and the far criterion task during meg . the study was approved by the ethics committee of the university of konstanz and registered as a clinical trial ( http://clinicaltrials.gov registration nct01781000 ) . pre - intervention meg data from 14 of the present sz were included in popov et al . in addition to primary analyses comparing these three patient groups , data from two groups of healthy comparison participants ( hc ) , each tested once , were included in targeted analyses . following a standard protocol , hc were recruited from the community by oral advertisement and flyers and were included if they did not meet the criteria for a lifetime diagnosis of mental illness ( screened with mini international neuropsychiatric interview ackenheil et al . , 1999 ) , did not report any history of head trauma with loss of consciousness , and were free of psychoactive medication . the hc19 group ( n = 19 ) was recruited when sz were provided a pre-/post - intervention comparison of oscillatory activity in the far outcome criterion task . the hc24 group ( n = 24 ) was recruited after the meg study ended , in order to provide a normative performance standard for the newly developed fat training tasks . none of the dependent measures overlapped for the two hc groups ( no fat performance data available for hc19 , and no meg data for hc24 ) . the hc19 sample included 15 subjects from the hc group reported in popov et al . gender distribution of the hc19 ( 12 m , 7 f ) did not differ from that of the 57 sz , though the hc19 were younger ( 27.0 3.7 years vs. 37.2 9.1 years , f(1,74 ) = 22.18 , p < .001 ) and had more years of education ( 13 0 vs. 11.2 1.7 ; f(1,70 ) = 20.82 , p < .001 ; data on education were not available for 4 sz ) . this hc19 group completed the far criterion task during meg in a single session ( they did not undergo training ) . far performance data for the hc19 was used twice , to confirm a pre - training abnormality in neural oscillatory activity in the sz that would undergo fat and to evaluate the extent of the normalization of this abnormality after this sz group underwent training . in the hc24 sample , gender distribution ( 10 m , 14 f ) and education ( 12.0 vs. 11.7 years ) did not differ from that of the 19 sz participating in fat , though hc24 were younger ( mean age 31.8 5.4 vs. 39.6 7.9 years , f(1,41 ) = 13.99 , p < comparison of the hc24 data to those from the first training session of the fat - trained sz group confirmed a performance deficit on the training tasks in the sz group . subsequent comparison of these hc24 data to those from the last training session of the fat - trained sz group evaluated the extent to which training normalized performance on the training tasks . the two active training protocols ( fat and ce ) were identical with respect to computer - based exposure : 20 daily 1-hour sessions scheduled on consecutive workdays within 4 weeks , a computer algorithm providing individual adjustment of task difficulty as a function of performance , and motivating task feedback . fat involved four tasks , two emphasizing facial affect discrimination , and two emphasizing working memory . emotional faces were obtained from the kdef databank ( http://www.emotionlab.se/resources/kdef ) and included male and female caucasian faces expressing one of seven emotions ( sad , happy , disgusted , fear , surprised , angry , neutral ) . within each task , level of difficulty was adjusted to individual performance by increasing difficulty after 6 correct ( nonconsecutive ) responses or decreasing difficulty after 3 consecutive errors . performance feedback was provided within session after 6 correct responses per level ( the transition to the next level of difficulty ) and at the end of each task . fat was developed to be comparable to the commercially available cognitive training protocol cognitive exercises ( ces , posit science , sf , usa ) used in popov et al . ( 2014 ) and elbert and rockstroh ( 2004 ) , such as the value of massed practice , shaping by individual adjustment of task difficulty as a function of performance within each session and task , and frequent motivating reinforcement . fat was not developed as a treatment alternative intended to be superior to other social - cognitive training protocols . in the present study , fat served to examine neural correlates of training targeting facial affect discrimination , which popov et al . fat differs from ce principally in that fat includes a series of visual exercises involving human face expression . in contrast , ce includes auditory as well as visual exercises , none of which focuses on facial expressions . in particular , fat is meant to differ only in the content of tasks : the same / different task trained the ability to discriminate whether two different posers express the same or different emotions , replacing the discrimination of two syllables / phonemes in the ce protocol . the blended emotion task addressed the identification of a target emotion in morphed faces , which popov et al . ( 2014 ) found to be impaired in schizophrenia patients : in order to train this type of affect discrimination , each face combined two 50/50 morphed facial expressions . the participant was asked to indicate which of the two emotions in an array of seven basic ekman emotional expressions was morphed in the presented face by clicking on the respective expression in the array of facial pictures . the emotion sequence task trained the reproduction of the sequence of a series of facial affect expressions from a single poser per trial , corresponding to the ce task of reproducing the sequence of a series of syllables / phonemes per trial . in the emotion location task patients learned to recall the location of identical pairs of poser / emotion combinations among an array of hidden faces corresponding to the ce task of recalling the location of identical pairs of syllables / phonemes , which were acoustically presented upon touching the respective cards in an array . performance on the four tasks was evaluated as the proportion of correct responses per level of difficulty for each task and each session . performance change following fat was evaluated by comparing scores for the first and the last session . therefore , change in performance scores was evaluated separately for each task , using dependent sample t - tests and effect size ( hedges ' g ) . in addition , performance differences prior to training between sz assigned to fat and the hc24 group were compared by single - factor analysis of variance ( anova ) for each task . similar anovas evaluated sz performance after fat against the performance of the untrained hc24 group . ce consists of four exercises emphasizing auditory verbal discrimination and memory , not involving faces . description of this training is provided elsewhere ( fisher et al . , 2009 ; popov et al . , 2011 ) . neuropsychological test performance was evaluated using the german version ( regents of the university of california , 2006 ) mccb ( nuechterlein et al . , 2008 ) that covers domains of cognitive function that have been shown to be impaired in schizophrenia , including processing speed , attentional vigilance , working memory , verbal learning , visual learning , reasoning , and social cognition . community sample of healthy subjects ( nuechterlein et al . , 2008 ; german norms have not been developed ) . intervention effects on mean t - scores for each mccb domain were evaluated by a 3 2 7 anova : the between - subject intervention factor compared fat , ce , and tau groups , the within - subject time factor compared pre- and post - training measurements , and the within - subject domain factor compared the seven cognitive domains . neuromagnetic activity before and after training was assessed in a dynamic far task that was developed and evaluated by popov et al . these studies showed that modulation of oscillatory activity primarily in the alpha frequency range varies with facial affect recognition and that this alpha modulation is weaker in sz than in hc . the present study used the same meg data collection and analysis protocol , concentrating on intervention effects on alpha modulation . eighty videos , 40 morphing from neutral to fear ( nf ) and 40 from neutral to happy ( nh ) , were presented on a screen about 50 cm from the eyes . forty pictures of caucasian individuals ( 20 males , 20 females , radboud faces database langner et al . , for each poser , two videos of the transition from neutral to emotional expression ( one fear , one happy ) were created . ( data from a third video , providing a transition from one poser 's neutral expression to another poser 's neutral expression , are not reported here . ) the first second of each video was a static picture of a neutral expression , after which the image gradually morphed toward the target facial expression ( fear or happy emotion ) . the face changed across the middle 3 s of the 5 s video . 33% , 67% , and 100% of the target expression was reached at the end of the second , third , and fourth seconds ( detailed description in popov et al . , 2013 , 2014 ) . the videos were presented in a pseudo - random order with a jittered offset to onset inter - trial - interval of 5 1 s and a white fixation cross in the center of the screen between videos . meg was recorded with a 148-channel whole - cortex magnetometer ( magnes 2500 wh , 4d neuroimaging , san diego , usa ) in a magnetically shielded room while participants lay on their back . prior to each measurement , the nasion , inion , cz , left and right ear canal , and head shape were digitized with a polhemus 3space fasttrack . the continuous meg time series was recorded with a sampling rate of 678.17 hz and a 0.1200 hz bandpass filter . trials consisted of epochs from 3 s before to 7 s after the onset of each video . data analyses comprised ( a ) segmentation ( time periods of 3 s before to 7 s after video onset ) and artifact removal of the continuously recorded time - series , ( b ) single - trial time frequency analysis of power and subsequent average over trials , ( c ) statistical evaluation of group differences focused on the alpha ( 1015 hz ) frequency range based on a randomization approach , and ( d ) evaluation of potential time ( pre / post - intervention ) by emotion ( fearful , happy ) effects for regions of interest ( rois , significant sensor clusters ) . prior to correcting for heart and eye - blink artifact by means of independent component analysis ( ica , jung et al . , 2001 ) , trials containing movement artifacts and squid jumps were rejected based on visual inspection : topographies and time courses of ica components were screened for signals of eye ( blink and horizontal eye movements ) and heart - beat - related activity , which were removed from further analysis . across the 12 group emotion session cells , the average number of trials per subject retained for analyses ranged from 37.9 to 39.1 of the total of 40 trials per emotion , without significant differences between intervention groups in the number of trials retained for the two emotions ( fear and happy ) for either pre- or post - intervention measurement ( main effects and interactions f < 1 ) . offline meg processing was accomplished primarily with the matlab - based open - source signal processing toolbox fieldtrip ( oostenveld et al . , 2011 ) complemented by in - house matlab code . spectral analysis was computed for each sensor and each trial using a sliding time window of five consecutive cycles ( t = 5 / f ) multiplied by a hanning taper . frequency representations of power were calculated as the log of the ratio of the power in a given time frequency bin to the power at that frequency during the 3 s prestimulus baseline for each emotion ( happy and fear ) , thus decibels ( db ) . these power values were analyzed as 4d clusters , latency frequency 2d sensor position on the scalp , with db being the entry in each cell . frequency windows showing relevant effects were defined in this space using a cluster - based , independent - sample t - test with monte carlo randomization . this procedure effectively controls for multiple comparisons ( maris and oostenveld , 2007 ) and allows the identification of clusters with significant group differences in 4d computational space . a cluster was determined to contain at least 5 neighboring sensors from 1000 randomizations for time frequency data . the test statistic was defined as the sum of the t - statistics within the respective 3d cluster . empirically observed clusters were labeled as statistically significant if the probability of clusters gained from permutation being larger did not exceed 5% . comparison prior to intervention of the 57 sz with the hc19 who completed the same far criterion task checked for a possible pre - intervention neural abnormality in alpha power during the pre - recognition period of the far criterion task , via a diagnosis ( sz , hc ) emotion ( fear , happy ) anova . this anova was based on the respective rois obtained after the cluster - based approach described above . effect sizes were characterized using hedges ' g. effects of the interventions on alpha power during the pre - recognition period of the far criterion task were examined with anovas addressing a series of a priori questions : ( 1 ) does fat have an impact on brain dynamics : emotion time in fat group . ( 2 ) does fat normalize brain dynamics : group ( fat pre - intervention or fat post - intervention , respectively , vs. hc19 ) emotion . ( 3 ) does fat do so better than treatment as usual : intervention ( fat , tau ) emotion time . ( 4 ) is the impact of fat specific : intervention ( fat , ce ) emotion time . because score distributions were somewhat nonnormal , primary analyses relied on winsorized data ( with a 5%/95% threshold ; p - values for non - winsorized data are provided in parentheses ) . relationships between fat - induced changes in alpha activity measures of the far criterion task and fat - task performance were examined via pearson product - moment correlations . reported p - values reflect huynh feldt ( hf ) adjustment as appropriate , and significant main effects and interactions were decomposed with simple - effects anovas or t - tests . clinical status improved in all three sz groups independent of type of intervention : general function ( gaf f(2,53 ) = 16.92 , p < .001 ) , positive symptoms ( panss - p f(2,53 ) = 17.92 , p < .001 ) , and general symptoms ( panss - g f(2,53 ) = 10.30 , p < .001 ; panss - n n.s . ) . 2 illustrates time frequency representation ( tfr ) of power during face morphing prior to intervention . the hc19 group tfr showed an increase from baseline in the 1013 hz range between 1 s ( morph onset ) and 3.5 s after stimulus onset , with maximum around 3 s. this increase was not evident in any sz group . 2 , bottom ) confirmed significant differences between hc19 and pre - intervention sz in alpha - power increase over a central sensor cluster in the time course from 2.5 to 3.5 s after stimulus onset . fat task performance was poorer in sz during their first fat session than in the hc24 group during their one fat session ( same - different task f(1,41 ) = 7.69 , p = .008 ; blended emotion task f(1,41 ) = 8.24 , p = .006 ; emotion sequence task f(1,41 ) = 16.11 , p < .001 ; emotion location task f(1,41 ) = 16.19 , p < .001 ; fig . performance improved with training on all four tasks in the fat group , significantly in three tasks ( fig . 3b , left ) : same / different , f(1,18 ) = 4.99 , p = .04 ; blended emotion f(1,18 ) = 10.17 , p = .005 ; emotion sequence f(1,18 ) = 3.28 , p = .09 ; emotion location f(1,18 ) = 13.12 , p = .002 . in the last fat training session , sz still performed worse in the emotion location task ( f(1,41 ) = 6.72 , p = .01 ; see also effect sizes in fig . 3b , right ) . an emotion time analysis of the fat group produced a main effect of time , f(1,18 ) = 5.61 , p = .03 ( p = .02 ) , reflecting a greater increase in alpha power from prestimulus baseline during the pre - recognition period of the far criterion task after training than before training ( fig . pre - training , a group ( fat pre - training vs. hc19 ) emotion analysis indicated smaller alpha power increase in sz than in hc19 ( f(1,36 ) = 22.05 , p < .001 ; fig . a similar comparison of fat post - training vs. hc19 verified this effect ( group f(1,36 ) = 5.73 , p = .02 ) . effect sizes indicated larger differences in alpha power modulation prior to fat ( fearful condition g = 1.29 , happy condition g = 1.08 ) than after fat ( fearful condition g = .66 , happy condition g = .58 ) . thus , dysfunctional oscillatory dynamics can be improved by fat , though not to full normalization . 4 illustrates the change in alpha power increase after intervention in the three patient groups . an intervention ( fat vs. tau ) emotion time analysis produced a marginal effect of time , f(1,36 ) = 2.80 , p = .1 ( p > .1 ) , reflecting some general improvement over time in the pooled sample , and an intervention time interaction , f(1,36 ) = 4.78 , p = .04 ( p = .05 ) , reflecting improvement in the fat group ( fig . thus , changes in alpha power modulation were specific to training . here and below , no main effects of intervention emerged . that was as anticipated , given random assignment to group , with group variance therefore expected only in intervention time effects . the final a priori anova assessed whether this improvement in alpha response with active training was specific to fat . an intervention ( fat vs. ce ) emotion time analysis produced an effect of time , f(1,36 ) = 8.54 , p = .006 ( p = .008 ) , reflecting improvement with training , but no intervention time interaction , indicating similar improvement in the two active treatment groups ( fig . 4 ) . an omnibus intervention ( fat , ce , tau ) emotion time analysis is of some value as a control for experiment - wise error . because the primary relevant hypothesis such an analysis addresses , that intervention improves brain function , is directional , a one - tailed test of the time effect would be appropriate , or equivalently a p = .10 criterion for the anova effect . the time effect exceeded that criterion , f(1,54 ) = 4.81 , p = .03 ( p = .06 ) , with alpha power increase from prestimulus baseline during the pre - recognition period of the far criterion task larger after training than before training . a secondary hypothesis that an omnibus test could address is that interventions differed in their impact , thus a nondirectional intervention time effect , which was marginal , f(2,54 ) = 2.44 , p < .10 ( p = .10 ) . however , the motivation for the present study was the series of specific , directional , a priori hypotheses provided above , which , to achieve partial experiment - wise error protection , were tested with a two - tailed criterion . in the fat group , alpha power increase in a left fronto - central sensor cluster ( fig . 5 left panel ) varied with performance improvement during the blended emotion task ( r = .46 , p < .05 ; fig . 5 right panel ) . as expected in an sz sample ( e.g. , kern et al . , 2008 , 2011 ) , patient performance was below the normative t - score of 50 and varied by mccb domain ( f(6,324 ) = 12.83 , p < .001 , hf = .94 ) . mccb performance generally improved after intervention ( time f(1,54 ) = 28.45 , p < .001 ) . a domain time interaction ( f(6,324 ) = 4.05 , p = .001 , hf = .91 ) reflected improvement in processing speed ( f(1,56 ) = 33.56 , p < .01 ) , attentional vigilance ( f(1,56 ) = 15.82 , p < .01 ) , and visual learning ( f(1,56 ) = 11.99 , p = .001 ) but not in working memory , verbal learning , reasoning , or social cognition ( see table 2 for normative t - scores ) . there was a time intervention effect , f(2,54 ) = 3.70 , p = .03 , resulting from significant performance improvement on reasoning after ce , t(18 ) = 2.06 , p = .05 , not after fat or tau . there was no time intervention domain effect ( f(12 , 324 ) = 1.28 , p > .1 ) . change in alpha power increase from baseline between pre- and post - intervention was not related to changes in neuropsychological test performance ( mccb ) or in clinical status ( symptom severity , gaf ) . popov et al . ( 2013 ) identified induced alpha power modulation as a measure that varied with performance during a dynamic facial affect recognition task . schizophrenia patients exhibited less induced alpha power modulation than healthy subjects , corresponding to poorer behavioral performance ( popov et al . the present study addressed the power and specificity of a computer - aided intervention targeting facial affect discrimination to ameliorate this deficit in schizophrenia patients . present results confirmed that deficient alpha modulation can be modified by psychological intervention : poor pre - intervention alpha power modulation during the far criterion task improved after training in facial affect discrimination . although neither performance on the training tasks nor alpha dynamics on the far criterion task reached normal levels , findings indicate that relevant brain dynamics in sz have considerable plasticity . similar training - induced neuroplasticity has been shown in other studies involving cognitive training ( adcock et al . , 2009 ; edwards et al . , 2010 ; subramaniam et al . , kelly and garavan ( 2005 ) proposed principles of redistribution and reorganization as potential mechanisms of neuroplasticity . redistribution refers to a change in activation within neural networks as a function of practice , without altering neural network structure . in contrast , reorganization is thought to reflect remodeling of structure and of functional activity related to task performance in the course of practice . normalization via reorganization would be expected if training adequately addresses the neurobiological mechanisms of cognitive deficiency . present results support the conclusion that the observed changes in alpha power as a function of training result from redistribution of neuronal processing resources that support facial affect discrimination . of course , additional changes may have resulted that the present meg measures did not detect . changes in brain dynamics were larger after the two dense , computer - aided training procedures than after a treatment - as - usual program . in a meta - analysis genevsky and colleagues ( 2010 ) concluded that , rather than fostering broad skills , efficient remediation should involve targeted , computer - aided with high - dose schedules , supplemented by psychosocial intervention . the present fat and ce training protocols provided the first two elements , i.e. , targeted , high - dose computer training , relative to tau . moreover , both specific training protocols targeted functions that are dysfunctional in schizophrenia such as working memory , attention , or discrimination accuracy . this is in line with the success of the training of affect recognition ( tar ) protocol developed by wlwer and colleagues ( wlwer et al . , 2005 ; wlwer and frommann , 2011 ; sachs et al . , 2012 ; luckhaus et al . , 2013 ) , which includes a specific facial affect discrimination task within a broader spectrum of tasks . tar improved social cognition indices and increased activity in various brain regions related to attention and cognitive processing . ( 2013 ) combined ce with specific social cognition training and found improvements on social cognitive outcome measures in sz . training protocols targeting functions known to be dysfunctional in sz may be beneficial whether applied alone or within a broader spectrum of tasks . in the present study , the fat and ce training protocols were similar in various ways : both targeted neuroplasticity by intensity ( 20 consecutive 1-hour sessions ) , shaping ( performance - based adjustment of task demands ) , and motivational context ( tasks embedded in computer game , frequent motivating feedback ) ; both addressed working memory and visual learning . it is conceivable that these training protocols , though designed to target specific processes , modify more basic , general processes such as neural information sampling , readiness for information intake , and excitation inhibition and segregation integration balance , thus general computation mechanisms supporting diverse functions ( buzsaki , 2010 ; buzsaki and watson , 2012 ; buzsaki et al . . fat may have improved item discrimination and memory in general , not only facial affect recognition . within present data , nonspecific enhancement of visual learning did not extend to ( unchanged ) performance on the visual - learning domain of the mccb . in order to distinguish specific and nonspecific effects , fat effects on other tasks an effect of the specific facial affect training on the social cognition mccb domain , examined with the msceit ( mayer et al . , 2003 ) , might have been expected . similarly , the training of affect recognition protocol ( wlwer and frommann , 2011 ) provides various strategies for affect management and regulation . improvement in such skills may be better reflected in msceit than the effects of the present training that specifically addressed facial affect discrimination and working memory . the msceit managing emotions subtest , used in the measures is a multifaceted construct and may not be suitable to test effects of the more specific functions ( dawson et al . , 2012 ) targeted by , i.e. , facial affect discrimination accuracy and working memory . the extent to which modulation of brain dynamics can be directly related to complex constructs such as social cognition as measured by neuropsychological tests is a matter of debate ( miller , 2010 ) . ( 2014 ) anticipated an impact of training - enhanced basic processes on higher - order cognitive processes . additional dependent measures ( both specific and general ) would be needed to clarify the impact of fat on social cognitive functions in sz . it is also possible that the present 20-hour training was not intense enough to achieve more extended effects . for example , effects of intense cognitive training on social cognitive measures and global function were prominent after 50 training sessions ( fisher et al . relevant to present hypotheses , training - induced change in performance on fat varied with improvement in alpha response . the parallel change in and the correlation between fat task performance and alpha power modulation suggest a functional relationship , thus alpha power increase as a mechanism facilitating facial affect recognition . the effect of fat on alpha power modulation in the far criterion task ( a ) supports the hypothesis ( popov et al . , 2013 ) that alpha power increase contributes to facial affect recognition and ( b ) demonstrates that a potential impairment of this mechanism can be modified by targeted training . first , results indicated that targeted training can affect neuronal processes believed to contribute to facial affect recognition and shown to be compromised in sz . however , conclusions about specificity of training effects would require further evaluation of effects of different types of training on diverse tasks , for example identifying double dissociations . moreover , specific vs. more general effects of fat on social cognition were not comprehensively examined : performance on the fat tasks was not assessed in the ce and tau groups , and as noted above the mccb social cognition domain may not appropriately interrogate the effects of specific , targeted training ( fat ) on higher - order social cognitive functions . a broader range of tests of social cognitive function would be necessary to fully evaluate the specificity of training effects . second , the present study focused on alpha - power modulation based on the previous finding of specific modulation in the 1015 hz range during the process of affect recognition . whereas sz differed from hc in this measure , no difference was observed in other measures such as the event - related potential to face presentation , specifically the m170 component ( popov et al . , 2014 ) . this result , together with the lack of training - related changes in lower or higher frequency bands in the evaluated range ( 020 hz , see fig . 4 ) , supports the proposal of alpha activity as a mechanism supporting facial recognition ( popov et al . , nevertheless , the contribution of other neuronal processes to facial affect recognition and an impact of the present training protocols on other neuronal phenomena , potentially evident in evoked high - frequency activity or event - related magnetic field variation , can not be ruled out . third , conclusions are always limited by the statistical power provided by the sample size , a common challenge in clinical settings ( keefe et al . , 2013 ) . hc19 served to confirm dysfunctional alpha power modulation for the present sz samples , as had been shown in larger , well matched samples in popov et al . although a matched hc group for the entire group of 57 trained sz would have been of some interest , the present hc19 sufficed for evaluating this . taken together , present findings for an intervention targeting abnormal brain dynamics associated with deficient facial affect recognition in schizophrenia indicate considerable neuroplastic potential in schizophrenia . the intervention effects support the hypothesis of a neural mechanism facilitating facial affect recognition and its disruption in schizophrenia .

deficits in social cognition including facial affect recognition and their detrimental effects on functional outcome are well established in schizophrenia . structured training can have substantial effects on social cognitive measures including facial affect recognition . elucidating training effects on cortical mechanisms involved in facial affect recognition may identify causes of dysfunctional facial affect recognition in schizophrenia and foster remediation strategies . in the present study , 57 schizophrenia patients were randomly assigned to ( a ) computer - based facial affect training that focused on affect discrimination and working memory in 20 daily 1-hour sessions , ( b ) similarly intense , targeted cognitive training on auditory - verbal discrimination and working memory , or ( c ) treatment as usual . neuromagnetic activity was measured before and after training during a dynamic facial affect recognition task ( 5 s videos showing human faces gradually changing from neutral to fear or to happy expressions ) . effects on 1013 hz ( alpha ) power during the transition from neutral to emotional expressions were assessed via meg based on previous findings that alpha power increase is related to facial affect recognition and is smaller in schizophrenia than in healthy subjects . targeted affect training improved overt performance on the training tasks . moreover , alpha power increase during the dynamic facial affect recognition task was larger after affect training than after treatment - as - usual , though similar to that after targeted perceptual cognitive training , indicating somewhat nonspecific benefits . alpha power modulation was unrelated to general neuropsychological test performance , which improved in all groups . results suggest that specific neural processes supporting facial affect recognition , evident in oscillatory phenomena , are modifiable . this should be considered when developing remediation strategies targeting social cognition in schizophrenia .

You are an expert at summarizing long articles. Proceed to summarize the following text: arabinogalactan - proteins ( agps ) are extensively glycosylated hydroxyproline ( hyp)-rich proteins found in cell walls , plasma membranes , and extracellular secretions of plants . they are involved in various aspects of plant growth and development such as cell proliferation , cell viability , cell division , reproductive development , regeneration of somatic embryos , abiotic stress , and cellular signaling . agps are widely distributed in the plant kingdom , being present in land plants as well as in bryophytes like physcomitrella patens , basal angiosperms , and even in algae . agps also have several important industrial and biomedical applications including a direct food additive , a food emulsifier , a stabilizer , a sweetener , and an immunomodulatory molecule . structurally , agps are diverse and heterogeneous due in part to their various protein backbones as well as the extent and degree of ag polysaccharide addition to the backbones . agp protein backbones typically consist of repetitive dipeptide motifs such as ala - pro , ser - pro , thr - pro , and val - pro in which the pro residues are converted to hyp . about 40% of the agps agp glycans or arabinogalactans ( ags ) are characterized by the presence of a 1,3-galactan backbone which is substituted with 1,6-galactan side chains that are decorated further with arabinose , and less frequently with fucose , rhamnose , and ( methyl ) glucuronic acid . using nmr analysis of synthetic agp peptides expressed in tobacco by2 cells , tan et al . , however , concluded that the ag backbone is composed of repeating 1,3-galactotriose units with or without side chains , which are connected by 1,6-linkages , to generate a kinked galactan backbone . while debate continues over these 2 models of ag structure , it should be noted that based on linkage and mass spectroscopy analysis , longer 1,6-galactan side chains have been reported for agps from radish root , wheat flour and arabidopsis leaf . several glycosyltransferases ( gts ) are involved in assembling the ag chains , and these gts likely coordinate and regulate the density , length and sequence of the ag chains . given that the sugar side chains typically account for more than 90% of the mass of agps , sugars likely define the interactive molecular surface of agps and govern their function . several of the gts for ag biosynthesis are known and cloned ; however , many await discovery as previously reviewed . o - glycosylation of agps is initiated by a set of 8 hyp - galactosyltransferases ( hyp - galts / hpgts ) , which are members of the gt31 family of the cazy database and designated as galt2 - 6 and hpgt1 - 3 . other known and cloned gts include : one 1,3-galactosyltransferase in gt31 , 2 1,6-galactosyltransferases , galt31a and galt29a in gt31 and gt29 respectively , 3 -glucuronosyltransferases , glcat14a , glcat14b , and glcat14c , in gt14 , 2 -fucosyltransferases , fut4 and fut6 , in gt37 , and one arabinosyltransferase , reduced arabinose yariv1 or ray1 , in gt77 . several other gts for ag biosynthesis await identification and cloning , including arabinosyltransferases , rhamnosyltransferases , and other -galactosyltransferases . with regard to the 2 small gene families within gt31 that exhibit hyp - galt enzyme activity , which are the focus of this addendum , some additional information is warranted . first , the functional identity of these genes was verified by heterologous expression of the genes coupled with an in vitro enzyme assay and by biochemical characterization of genetic knock - out mutants . second , one gene family consists of 5 genes / enzymes ( galt2-at4g21060 , galt3-at3g06440 , galt4-at1g27120 , galt5-at1g74800 , and galt6-at5g62620 ) each of which contains both a galt domain as well as a galectin domain , while the other family consists of 3 genes / enzymes ( hpgt1-at5g53340 , hpgt2-at4g32120 , and hpgt3-at2g25300 ) , each of which contains only a galt domain . third , this paper presents the first direct comparison between members of these 2 related gene families in terms of their biochemical activity and mutant phenotypes . the importance of agps is reflected in their wide range of physiological functions related to vegetative processes , sexual reproduction , development , and signaling throughout the plant kingdom . given the complexity and heterogeneity of the numerous agps , little is known about the contribution of ag polysaccharides to agp function . identification of the genes responsible for agp glycosylation and their genetic mutants , however , is beginning to reveal such contributions . in vitro galt assays and functional analysis led to the identification of 8 hyp - galts within the gt31 family . it is interesting that one subclade consists of 5 proteins ( named galt2 - 6 ) each with 2 protein domains , a catalytic galt domain and a galectin domain , whereas the other subclade consists of 3 proteins ( named hpgt1 - 3 ) , each of which only contains a galt domain ( fig . 1 ) . ( a ) phylogenetic tree of the arabidopsis hyp - galt members which act on agps . the glycosyltransferase sequences were retrieved from the carbohydrate - active enzymes ( cazy ) database ( http://www.cazy.org/gt1_eukaryota.html ) and ncbi database . the full - length amino acid sequences of the arabidopsis hyp - galts were aligned with clustal omega and the maximum parsimony tree was generated using mega 6 . numbers at the nodes indicate bootstrap values calculated for 1000 replicates ( > 50% ) . ( b ) protein structure of the 8 hyp - galt genes found in arabidopsis . blue arrowheads indicate the position of the dxd motif , which is predicted for udp - galactose binding . tmhmm ( http://www.cbs.dtu.dk/services/tmhmm/ ) was used to predict the transmembrane domain ( t ) ; pfam domain predictions : pf01762 identified the galactosyltransferase ( galt ) domain ( http://www.sanger.ac.uk/software/pfam/ ) and pf00337 identified the galactose - binding lectin ( galectin ) domain . in silico analysis of hyp - galts for agps . ( a ) phylogenetic tree of the arabidopsis hyp - galt members which act on agps . the glycosyltransferase sequences were retrieved from the carbohydrate - active enzymes ( cazy ) database ( http://www.cazy.org/gt1_eukaryota.html ) and ncbi database . the full - length amino acid sequences of the arabidopsis hyp - galts were aligned with clustal omega and the maximum parsimony tree was generated using mega 6 . numbers at the nodes indicate bootstrap values calculated for 1000 replicates ( > 50% ) . ( b ) protein structure of the 8 hyp - galt genes found in arabidopsis . blue arrowheads indicate the position of the dxd motif , which is predicted for udp - galactose binding . tmhmm ( http://www.cbs.dtu.dk/services/tmhmm/ ) was used to predict the transmembrane domain ( t ) ; pfam domain predictions : pf01762 identified the galactosyltransferase ( galt ) domain ( http://www.sanger.ac.uk/software/pfam/ ) and pf00337 identified the galactose - binding lectin ( galectin ) domain . based on genotyping and phenotypic analysis of single , double , and triple t - dna insertion mutants for the galt and hpgt genes , these lines have a number of phenotypic alterations compared to wild - type . in particular , here we directly examined and compared the galt2galt5 double mutant with the hpgt1hpgt2hpgt3 triple mutant . the galt double and hpgt triple knockout mutants displayed 43% and 70% reductions in -gal - yariv precipitable agps compared to wild type , respectively . in addition , the double and triple mutants showed a 31% and 18% decrease in hyp - galactosylation activity compared to wild type using our in vitro enzyme assay , respectively ( fig . 2 ) . these results indicate that both subclades affect agps and that a greater reduction is observed when 3 genes were knocked out as opposed to two . however , it is not known whether this greater reduction is due to the greater effect of the hpgt genes or to the greater number of genes that were knocked out ( i.e. , 3 versus 2 ) . it is also interesting to note that while both the double and triple mutants show a decrease in hyp - galt activity using our in vitro assay , the decrease is not proportional to the reductions in -gal - yariv precipitable agps observed in these mutants . one likely explanation for this is that hpgts may have a different agp peptide substrate preference compared to the galts . figure 2.biochemical phenotype analysis of the galt2galt5 double mutant and the hpgt1hpgt2hpgt3 triple mutant . agps were extracted from leaves ( 5 g ) of 3 week old wt , galt2galt5 and hpgt1hpgt2hpgt3 plants as described in schultz et al . the galt assay contained 100 g of detergent ( 1% triton x-100 ) permealized golgi enriched microsomes as the enzyme source , [ ao]7 as the acceptor substrate , 3 m udp-[c]gal as the sugar donor , 0.1 m hepes - koh , ph 7 , 0.4 m sucrose , 0.1% bsa , 1 mm dithiothreitol , 5 mm mgcl2 , 5 mm mncl2 , 1 mm phenylmethylsulfonyl fluoride , and one tablet of roche edta - free complete protease inhibitor cocktail . the assays were incubated at room temperature for 2 h and analyzed by reverse phase hplc . the assay reactions were terminated by mixing with 400 l anion - exchange resin ( dowex 18100 ) , and incorporation of udp-[c]gal was determined using a liquid scintillation counter . different letters indicate statistically significant differences ( one way anova , p < 0.05 ) ; blue letters denote differences in agp content whereas gray letters denote differences in galt activity . biochemical phenotype analysis of the galt2galt5 double mutant and the hpgt1hpgt2hpgt3 triple mutant . agps were extracted from leaves ( 5 g ) of 3 week old wt , galt2galt5 and hpgt1hpgt2hpgt3 plants as described in schultz et al . the galt assay contained 100 g of detergent ( 1% triton x-100 ) permealized golgi enriched microsomes as the enzyme source , [ ao]7 as the acceptor substrate , 3 m udp-[c]gal as the sugar donor , 0.1 m hepes - koh , ph 7 , 0.4 m sucrose , 0.1% bsa , 1 mm dithiothreitol , 5 mm mgcl2 , 5 mm mncl2 , 1 mm phenylmethylsulfonyl fluoride , and one tablet of roche edta - free complete protease inhibitor cocktail . the assays were incubated at room temperature for 2 h and analyzed by reverse phase hplc . the assay reactions were terminated by mixing with 400 l anion - exchange resin ( dowex 18100 ) , and incorporation of udp-[c]gal was determined using a liquid scintillation counter . different letters indicate statistically significant differences ( one way anova , p < 0.05 ) ; blue letters denote differences in agp content whereas gray letters denote differences in galt activity . the reduced agp glycosylation and reduced hyp - galt activity observed in the galt and hpgt single and higher order mutants were also reflected in their physiological phenotypes . both the galt and the hpgt mutants demonstrated pleiotropic effects , which were generally subtle or non - existent in the single mutants but were more severe in the galt double and hpgt triple mutants . the galt mutants demonstrated reduced root hair growth , reduced seed coat mucilage , reduced seed set , and accelerated leaf senescence . the galt mutants also displayed several conditional phenotypes including impaired root growth and root tip swelling in response to salt and sucrose ; these mutants were also less sensitive to the growth inhibitory effects of yariv reagent in root and pollen tubes . in contrast , while the hpgt single mutants showed no obvious phenotypes , the hpgt triple mutants exhibited the pleotropic phenotypes of longer lateral roots , longer and denser root hairs , swollen root tips , smaller leaves , shorter inflorescence stems , reduced fertility , and shorter siliques . while the galt and hpgt mutant phenotypes share some similarities , there are also some differences , which may reflect the action of the galts and hpgts on different sets of agps . regardless of these differences , these results provide clear evidence that hyp - linked ag polysaccharide chains of agps , which are initiated by the action of the galts and hpgts , are essential for agp function . finally , identification of these 8 hyp - galts raises the following questions that should be addressed in future studies . 1 . do these 8 enzymes act on all agps or only on a subset of agps ? do these enzymes act in a complex as is apparently the case for biosynthesis of the 1,6-galactan side chains by galt31a - galt29a ? 4 . are there any other agp - specific hyp - galts / hpgts that remain to be identified and characterized ? nonetheless , based upon the progress to date , we are now beginning to understand how the hyp - ag polysaccharides of agps are made and their important contributions to biological function .

abstractarabinogalactan - proteins ( agps ) are ubiquitous cell wall components present throughout the plant kingdom . they are extensively post translationally modified by conversion of proline to hydroxyproline ( hyp ) and by addition of arabinogalactan ( ag ) polysaccharides to hyp residues . two small gene subfamilies within the cazy gt31 family , referred to as hyp - galactosyltransferases ( hyp - galts and hpgts ) , encode enzymes that specifically add galactose to agp protein backbones as revealed by heterologous expression of the genes coupled with an in vitro enzyme assay and by biochemical characterization of the genetic knock - out mutants . biochemical analysis of galt2galt5 double and hpgt1hpgt2hpgt3 triple knockout mutants revealed significant reductions in both agp - specific hyp - galt activity and -gal - yariv precipitable agps . further analysis of these mutants demonstrated both overlapping and distinct pleiotropic growth and development phenotypes , indicating the important contributions of the carbohydrate moieties toward agp function . current research indicates that all 8 hyp - galt / hpgt genes encode enzymes that catalyze the initial step for agp glycosylation and that agp glycans play essential roles in plant growth and development .

You are an expert at summarizing long articles. Proceed to summarize the following text: although the current trend in orthodontics is to plan treatment generally based on extraoral soft tissue dimensions , it is certainly impossible to ignore the limitations caused by bony structures . growth modification procedures which aim at skeletal discrepancies at younger ages also require an appraisal of maxillary and mandibular dimensions . this could be the reason why orthodontists still have to base diagnostic and treatment decisions on radiographic assessments such as cephalometric measurements . on the other hand , it is also evident that radiographic assessment methods can not be considered practical for screening purposes in routine dental settings or wide - scale epidemiologic surveys . two major limitations exist : concerns about exposing individuals to even minimal amounts of radiation , and the relatively costly and time consuming hardware requirements . these drawbacks could be good excuses why currently used orthodontic indexes rely mostly on dental findings and lack of skeletal components . therefore , it would be desirable to develop a brief yet acceptable chairside alternative for such measurements in order to determine the underlying skeletal relationships in a reliable manner ; and to eliminate the need for cephalograms in such occasions . reviewing the orthodontic literature shows that attempts have been made toward introducing alternatives for cephalometric analyses that are mainly based on soft tissue measurements . the underlying assumption in this domain is that the overlying facial soft tissue appearance is more or less influenced by its underlying bone structure [ 13 ] . this concept has been employed in the craniofacial superimposition method by forensics and is still in use . based on this concept , studies have been conducted that mainly deal with either photogrammetric or anthropometric methods . although photographic measurements have been reported as highly reproducible , the correlation between cephalometric and photographic measurements has not been high enough to consider it a consistent substitute to cephalometric measurements . the variable thickness of the overlying soft tissue does not allow for an accurate prediction of underlying bone dimensions . acknowledging this variation , displacing the soft tissues , as observed in some anthropometric studies could be a solution to the problem . farkas suggests application of force during anthropometric measurements as aid to determine bony landmarks . it appears that this concept has not been verified with the aid of radiographic assessments , but if proved , it can be proposed that this method could result in even better correlations with cephalometric measurements . at the same time it may be questioned that the amount of soft tissue displacement could be significantly different between assessors , possibly making the method unreliable ; especially when considering different soft tissue thicknesses at different facial regions . therefore , the current study was conducted in order to measure the reliability of some anteroposterior facial anthropometric measurements using a specially designed ruler under soft tissue compression . thirty - six consecutive adolescent patients enrolled for treatment in a single semester at the department of orthodontics of tehran university of medical sciences were chosen for this study . anthropometric measurements were performed with the aid of a custom designed sliding ruler ( fig 1 ) . the ruler was designed very similar to anthropometric sliding rulers ; the main modification was incorporation of an ear guide at one end ( fig 1 , a ) , which was placed in the external acoustic meatus , very similar to ear rods of cephalometric machines . the other end consisted of a metal rod also projecting perpendicular to the ruler ( fig 1 , b ) . the distance between these projections was easily determined by reading the measurement on the ruler . three measurements were done in this study which consisted of : distance between external auditory meatus to nasion ( ext n)soft tissue maxillary length measured from the external auditory meatus to the subnasal point ( ext sn)soft tissue mandibular length that was considered as the distance between the external auditory meatus to the soft tissue pogonion ( ext pog ) distance between external auditory meatus to nasion ( ext n ) soft tissue maxillary length measured from the external auditory meatus to the subnasal point ( ext sn ) soft tissue mandibular length that was considered as the distance between the external auditory meatus to the soft tissue pogonion ( ext pog ) it was decided that each assessor displaced or compressed the soft tissue in each area subjectively . examiners applied only enough pressure to feel the underlying hard tissue resistance and not too much to cause any discomfort for the patient . each measurement was independently performed twice by two assessors with a 14-day lag between the two measurements.the intraclass correlation coefficients ( icc ) using a two - way random model and absolute agreement type and corresponding 95% confidence intervals ( ci ) were calculated with spss 16 for windows ( spss inc . , chicago , ill , usa ) to measure the reliability of the repeated soft tissue measurements . the icc for the reliability of soft tissue measurements along with the 95% confidence intervals are listed in table 1 . as observed , all measurements had a reliability coefficient above 0.9 , with only a few parameters having a lower bound confidence interval below 0.9 , but more than 0.8 . the extensive work of farkas in anthropometry of the head and face is well known and it is clear that anthropometric measurement in the craniofacial region is not a new topic ) . but previous anthropometric measuring techniques which perform measurements on the soft tissue by merely touching soft tissues appear to be somehow inaccurate for bony measurements and specifically for orthodontic screening purposes . therefore , it would be desirable to develop a simple yet reliable method to assess the craniofacial relationships in clinical orthodontic situations . the results of the current study show that anthropometric anteroposterior measurements obtained with soft tissue displacement can achieve a reasonable level of reliability , even comparable to reproducible photographic measurements . in order to obtain such a level of agreement , there was no need for a calibrating session between examiners regarding the amount of soft tissue compression . but at the same time , the different levels of reliability among three anthropometric measurements in our study supposedly could be explained by the difference in soft tissue thickness in each area : less variation is expected in the soft tissue thickness at nasion and more in other areas . generally speaking , higher inter - and intra - rater reliability was observed in the external auditory meatus - nasion measurement and lower in other areas . cephalometric assessment a valuable tool for determining the underlying skeletal relationship , where others believe it to be an inappropriate method [ 1 , 9 ] . if further - developed research designs confirm the findings of our study , using such measurements at the chairside eventually become a more practical method in orthodontic screening procedures for skeletal assessment . as the current investigation basically intended to assess the effect of soft tissue displacement , the selection of cases as well as sample size was not based on specific sampling issues . examiners agreed that proper alignment of the ruler both sagittally and horizontally was a slight time consuming factor for the measurement process . this inconvenience could also be an explanation for the small intra- and inter - rater disagreement between measurements . this called for a redevelopment of the ruler design which was considered in our subsequent studies . in comparison to studies dealing with photographic measurements , if such anthropometric measurements show a better correlation with cephalometric data , we may hope that such methods become a reliable screening tool for both clinical and epidemiologic purposes . investigating the correlation between anthropometric and radiographic measurements could not be conducted since the reliability of soft tissue measurements under soft tissue displacement using the new device was unknown . but with the results of the current study , this correlation has been taken into consideration for our future studies . the results of this pilot study suggest that reliable anthropometric measurements could be obtained under soft tissue displacement .

objective : despite the current use of radiography for quantifying sagittal skeletal measurements , it is an unsuitable way for screening or epidemiologic purposes . although not fully approved , anthropometric measurements have been suggested as a substitute , and considering displacement of soft tissues , could possibly lead to more consistent results . the purpose of this study was to evaluate the reliability of anthropometric anteroposterior facial measurements under soft tissue compression using a special ruler.material and methods : anthropometric measurements were done with a specifically designed sliding ruler twice on 36 adult patients with a 14 day lag between two measurements . the ruler measured the distance between the external acoustic meatus and the nasion ( na ) , subnasal ( sn ) point and the soft tissue pogonion ( pog ) . the soft tissue was displaced during measurements only to the extent that the underlying hard tissue resistance was felt subjectively by each assessor . the intraclass correlation coefficient ( icc ) was calculated for both inter- and intra- rater measurements using spss software.results:all measurements had inter- and intrarater agreements above 0.9 , with only a few parameters having lower bound confidence intervals below 0.9 , but more than 0.8.conclusion:sagittal facial anthropometric measurements under soft tissue displacement using the specific ruler are valid and reliable and could possibly aid orthodontists in chairside craniofacial assessments .

You are an expert at summarizing long articles. Proceed to summarize the following text: charcot leyden crystals are hexagonal bipyramidal structures named after j. m. charcot who first described it in 1853 . these crystals are about 50 microns in length and are composed of lysophospholipase enzyme that inactivates cell - damaging lysophosphatides produced during membrane metabolism during degranulation . these are localised in the primary granules of the cytoplasm of eosinophils and basophils , and there is often formation of charcot leyden crystals during intense or prolonged eosinophilic inflammatory reaction . as reported in the literature , their presence may indicate infestation with parasites like toxocara , capilliriasis , ascariasis , or fasciola.[3711 ] sometimes , they may be found within macrophages in the vicinity of conglomerates of eosinophils , representing a disposal system by macrophages . these crystals were first observed in a patient with leukemia and later in the mucous plugs in asthma patients . however , they are not usually seen on direct microscopic examination of the aspirate or in the histopathology section in liver abscesses . here , we report two cases where abundant charcot leyden crystals were found in the smears prepared from hepatic abscess . a seven year - old male child from a rural area presented with mild pain over his right upper abdomen and sporadic fever of six months duration . examination revealed that the liver was palpable five cm below the right subcostal margin and was tender ; there was no other organomegaly . routine hematological investigations and liver function test results were within normal limits . on clinical suspicion of liver abscess , a computed tomography ( ct ) scan was done which showed multiple , small ( one cm ) , hypodense shadows , some with central hypoechoic zones . smears prepared from the aspirate showed an abundance of hexagonal , needle - shaped charcot leyden crystals in a background of degenerated hepatocytes , necrotic material , and mixed inflammatory infiltrate predominantly consisting of eosinophils [ figure 1 ] . no trophozoites or parasites could be demonstrated and culture of the aspirated pus was sterile . parasitic infestation was suspected and the patient was treated with anthelminthics to which he responded well . smear showing hexagonal charcot leyden crystals in a background of inflammatory cells and necrotic material ( mgg , 400 ) a 50 year - old female patient presented with fever and right upper abdominal pain of fifteen days 's duration . her routine hematological analysis was as follows : hemoglobin - 10.6 g / dl , hematocrit - 32.5% , total leucocyte count - 15,300/mm , differential leukocyte count - polymorphs : 60% , lymphocyte : 15% , eosinophil : 23% , monocyte : 2% . ultrasonography of the upper abdomen showed a solitary hypoechoic lesion with irregular borders , 3.5 cm in diameter , suggestive of a hepatic abscess or neoplastic lesion . fine needle aspiration was done from the lesion and the smears showed abundant , hexagonal , needle - shaped charcot leyden crystals in a background of degenerated hepatocytes , necrotic material , and mixed inflammatory infiltrate predominantly consisting of eosinophils . at places , poorly formed epithelioid cell granulomas were also seen [ figure 2a and b ] but ziehl neelsen staining for acid - fast bacilli was negative . a possibility of helminthic infestation was considered and the patient was treated with anthelminthics . after a full course of antihelminthics , her routine hemogram was repeated and an excellent improvement was seen : total leucocyte count - 9,000/mm , differential leucocyte count - polymorphs - 70% , lymphocyte - 20% , eosinophil - 8% , monocyte - 2% . spindle - shaped charcot leyden crystals in a necrotic background ( mgg , 400 ) a poorly formed epithelioid cell granuloma with inflammatory cells and necrotic debries ( mgg , 400 ) a seven year - old male child from a rural area presented with mild pain over his right upper abdomen and sporadic fever of six months duration . examination revealed that the liver was palpable five cm below the right subcostal margin and was tender ; there was no other organomegaly . routine hematological investigations and liver function test results were within normal limits . on clinical suspicion of liver abscess , a computed tomography ( ct ) scan was done which showed multiple , small ( one cm ) , hypodense shadows , some with central hypoechoic zones . smears prepared from the aspirate showed an abundance of hexagonal , needle - shaped charcot leyden crystals in a background of degenerated hepatocytes , necrotic material , and mixed inflammatory infiltrate predominantly consisting of eosinophils [ figure 1 ] . no trophozoites or parasites could be demonstrated and culture of the aspirated pus was sterile . parasitic infestation was suspected and the patient was treated with anthelminthics to which he responded well . smear showing hexagonal charcot leyden crystals in a background of inflammatory cells and necrotic material ( mgg , 400 ) a 50 year - old female patient presented with fever and right upper abdominal pain of fifteen days 's duration . her routine hematological analysis was as follows : hemoglobin - 10.6 g / dl , hematocrit - 32.5% , total leucocyte count - 15,300/mm , differential leukocyte count - polymorphs : 60% , lymphocyte : 15% , eosinophil : 23% , monocyte : 2% . ultrasonography of the upper abdomen showed a solitary hypoechoic lesion with irregular borders , 3.5 cm in diameter , suggestive of a hepatic abscess or neoplastic lesion . fine needle aspiration was done from the lesion and the smears showed abundant , hexagonal , needle - shaped charcot leyden crystals in a background of degenerated hepatocytes , necrotic material , and mixed inflammatory infiltrate predominantly consisting of eosinophils . at places , poorly formed epithelioid cell granulomas were also seen [ figure 2a and b ] but ziehl neelsen staining for acid - fast bacilli was negative . a possibility of helminthic infestation was considered and the patient was treated with anthelminthics . after a full course of antihelminthics , her routine hemogram was repeated and an excellent improvement was seen : total leucocyte count - 9,000/mm , differential leucocyte count - polymorphs - 70% , lymphocyte - 20% , eosinophil - 8% , monocyte - 2% . spindle - shaped charcot leyden crystals in a necrotic background ( mgg , 400 ) a poorly formed epithelioid cell granuloma with inflammatory cells and necrotic debries ( mgg , 400 ) the common cause of pyogenic liver abscess in children is reported to be visceral larva migrans by toxocara species . most of the cases remain subclinical but symptomatic patients may present with fever , malaise , weakness , pruritus , rash or urticaria , abdominal pain , anorexia , cough , dizziness , and weight loss . hepatosplenomegaly is common ; a long - standing , high eosinophil count is a characteristic diagnostic feature ( may be up to 90% ) . ct images show small , scattered , hypodense , nodular lesions of varying sizes ( usually < 1 cm ) ; rarely a large , abscess - like lesion up to 710 cm can be found . histologically , the lesion shows granulomas consisting of aggregates of eosinophils and other inflammatory cells and tissue necrosis . less frequently , charcot leyden crystals with eosinophilic infiltrate and , rarely , parasitic remnants are seen in the biopsy tissue . the illness may persist from several months to years . in the first case , the only point against the diagnosis was the absence of peripheral eosinophilia . however , there are reports that highlight that visceral larva migrans should be suspected as the cause of a chronic liver disease in patients without fever and hypereosinophilia with cryptogenic cholestatic and focal liver lesions . the age of presentation , poor socioeconomic status , and the characteristic ct scan findings of hepatic lesions along with the fine needle aspiration smear findings ( plenty of charcot leyden crystals in a background of degenerated hepatocytes , necrotic material , and mixed inflammatory infiltrate , predominantly consisting of eosinophils ) favoured a diagnosis of parasitic nature . although no parasite could be demonstrated in the fine needle aspiration smears as well as by stool examination , a probable diagnosis of parasitic infestation , particularly with toxocara species , was considered . another possibility of such a presentation may be infestation with capillaria hepatica , but it usually affects small children living in unsanitary environments infested with rats ; no such history was present here . in adults presenting with similar clinical features of liver disease , a radiologically evident solitary hepatic lesion along with peripheral eosinophilia can pose as a diagnostic problem . differential diagnosis in these cases may include fasciola infestation , inflammatory pseudotumor , and neoplastic lesion . in asian countries , fasciola gigantic is more common than fasciola hepatica . whatever the cause , fasciola infestation presents with acute illness with symptoms of fever , abdominal pain , headache , rash , or urticaria . a biphasic pattern of peripheral eosinophilia is very common and liver function test results are either normal or slightly raised . solitary or multiple migratory abscesses that change in shape , size , and position over time and are evident radiologically particularly in ct scans are a very characteristic feature of fasciola infestation . in the chronic stage , the patient may become asymptomatic or may have episodes of some nonspecific symptoms . in the present case , although the features were quite suggestive of fasciola infestation , it was not considered as diagnosis due to its rare occurrence in india and inability to detect any parasite . hepatic inflammatory pseudotumor is a rare benign lesion that has the features of fever , pain , and the hepatic mass . the etiology and pathogenesis are uncertain but infection or parasitic infestation may be possible causes . three cases reported in the literature include one case caused by e. coli , another by gram - positive cocci , and in the third one , ascaris larvae were demonstrated in the hepatic lesion . fine needle aspiration smears , as well as biopsy , mainly show intense inflammatory reaction ( neutrophils , eosinophils , histiocytes , and lymphocytes ) along with charcot leyden crystals . in the present series in case 2 , inflammatory reaction was not severe enough to consider the case to be an inflammatory pseudotumor . in adults , a possibility of neoplastic and metastatic lesions should also be ruled out based on the presence of eosinophil - predominant , inflammatory infiltrate and the absence of hyperchromatic , pleomorphic cells . finally , considering the fine needle aspiration findings from the hepatic lesion of the lady ( abundant , hexagonal , needle - shaped charcot leyden crystals in a background of degenerated hepatocytes , necrotic material , and mixed inflammatory infiltrate predominantly consisting of eosinophils with poorly formed epithelioid granulomas at places ) along with peripheral eosinophilia as an indirect evidence of parasitic infestation , the patient was treated with anthelminthics and showed marked improvement . eosinophilic granuloma ( langerhans cell histiocytosis ) which may also show numerous charcot leyden crystals in a background of eosinophils , was ruled out due to the absence of characterstic histiocytes with folded or grooved nuclei ( langerhans cells ) . charcot leyden crystals with eosinophils are a common finding in the stool samples of patients with amoebic enteritis . however , they are rare in the pus from an amoebic liver abscess which mainly consists of necrosed inflammatory and parenchymal cells , red blood cells , and trophozoites of e. histolytica . both the cases emphasise that the presence of an abundance of charcot leyden crystals in a background of eosinophils or eosinophilic granuloma in fine needle aspiration smears from hepatic lesions can be an indirect evidence of parasitic infestation in the absence of demonstrable parasite . these patients should be given anthelminthic treatment before considering other diagnoses even in adults , especially in a developing country like india where the incidence of parasitic infestation is high .

charcot leyden crystals are hexagonal bipyramidal structures localised in the primary granules of the cytoplasm of eosinophils and basophils . their presence , along with eosinophilic infiltrate , is an indirect evidence of parasitic infestation particularly with toxocara , capilliriasis , ascariasis , or fasciola . we report here two cases where charcot leyden crystals with eosinophilic infiltrate were found in the smears prepared from hepatic abscess .

You are an expert at summarizing long articles. Proceed to summarize the following text: cerebral insults such as a traumatic brain injury ( tbi ) , stroke , or status epilepticus ( se ) can lead to detrimental outcomes for patients who suffer from one of these events . all of these insults have been shown to cause acute cell death , disruption of the blood brain barrier , reduced neurological functional performance and altered cellular signaling within the injured tissue . one signaling pathway that has been shown to be activated after all of these cerebral insults is the janus kinase 2 and signal transducer and activator of transcription 3 ( jak2-stat3 ) signaling pathway . this pathway activates numerous genes responsible for many cellular functions that may play a critical role in both neural injury and repair ; however , the precise contribution of jak2-stat3 activation after tbi , stroke , and se remains incompletely understood . when the jak2-stat3 pathway is activated after cerebral insults , it leads to the increased expression of genes associated with cell proliferation , differentiation and survival . activation of this pathway occurs when a hormone , growth factor or cytokine binds to a receptor which then phosphorylates jak2 . jak2 in turn phosphorylates stat3 , which then dimerizes and translocates to the nucleus where it binds to the promotor region of genes containing gamma - activated sequences . in the adult nervous system , this pathway is mostly dormant unless the central nervous system suffers a stressor or insult . the insult , whether a tbi , stroke , or se , leads to release of hormones , growth factors and cytokines which result in activation of this pathway . this review will examine the effects of jak2-stat3 activation in each of these injury models and how altering this pathway after these cerebral insults effects neurological recovery in preclinical models . traumatic brain injury ( tbi ) is a major public health problem and is the leading cause of morbidity and mortality in individuals under the age of 45 . tbi causes a host of health issues including cognitive and motor defects as well as posttraumatic epilepsy . these adverse outcomes significantly decrease the quality of life for individuals who suffer tbi and new therapies are needed . one approach is to identify and disrupt the cellular and molecular changes that contribute to these adverse outcomes . the jak2-stat3 pathway has been shown to become activated after tbi in several different experimental models . although there are several differences in the method of experimental tbi , the current findings all show that there is an increase in the phosphorylation of jak2 and/or stat3 within the injured tissue as early as 3 h after injury . several groups have also shown that many known stat3 genes have increased expression after experimental tbi , however , the effect of jak2-stat3 pathway modulation on outcome is variable . 2011 has been able to partially block jak2 and stat3 phosphorylation 3 h after a tbi with administration of the jak2 inhibitor ag490 . they also determined that neurological recovery was worsened with the administration of ag490 after a tbi . this same group also found that giving human recombinant erythropoietin ( rhepo ) after a tbi increased jak2 and stat3 phosphorylation and decreased apoptosis of cortical cells in peri - injured cortex cells of rats after an experimental tbi . when they added both rhepo and the jak2 inhibitor ag490 they found that pjak2 and pstat3 levels were reduced and that the mrna levels of several apoptosis related genes were increased while they did not see a difference in tunel staining . their findings suggest that activation of the jak2-stat3 pathway after a tbi is advantageous for neuronal recovery . while several groups have investigated inhibitory neurotransmitter receptor regulation , specifically gaba(a ) receptor regulation , after a tbi , raible et al . has found a correlation between pstat3 levels and gabaar 1 after an experimental tbi , suggesting that activation of this pathway may lead to altered inhibitory signaling . since one of the sequelae of a tbi is the subsequent development of epilepsy , preventing this alteration of inhibitory signaling after injury could inhibit the development of post traumatic epilepsy . within developed countries , stroke is the leading cause of death and disability and beyond the immediate 46 h after an acute ischemic stroke , there is no known therapy that improves outcomes for this illness . numerous pathological events such as necrosis , apoptosis , edema , and altered cellular signaling occur after cerebral ischemia as well as after subdural hematomas . as with tbi , several groups have shown that the jak2-stat3 pathway is activated in in vitro and in vivo experimental models of stroke . while all of the research to this point has shown that there is an increase in phosphorylation of jak2 and/or stat3 after stroke , there are conflicting data whether this pathway activation leads to improved neurological recovery . several groups have found that treating animals with hypoxic preconditioning , rhepo , or other novel compounds increased the activation of the jak2-stat3 pathway and improved neurological recovery after experimental stroke . furthermore , some investigators have blocked jak2-stat3 phosphorylation with ag490 or wp1066 ( an analog of ag490 ) and found that cell death markers or functional performance were worsened . these findings suggest that treatments that activate the jak2-stat3 pathway after experimental stroke may lead to improved functional performance and/or decreased cell death . on the contrary , satriotomo et al . found that administration of the jak2 inhibitor ag490 or a stat3 sirna after experimental cerebral ischemia decreased infarction volume , neuronal damage , apoptosis , and gfap - positive cells . these results suggest that activation of the jak2-stat3 pathway leads to decreased cerebral recovery and that blocking this pathway leads to better neurological outcomes . the jury thus remains out and further studies are required to determine the functional effects of jak2-stat3 pathway activation following cerebral ischemia . status epilepticus ( se ) is clinically defined as the occurrence of a single unremitting seizure with a duration longer than 1530 min or frequent clinical seizures without interictal return to baseline lasting at least 1530 min . se is a common life - threatening neurological disorder that is seen most commonly in the pediatric population . individuals who have had se may experience morbidities including cognitive impairment , epilepsy , and recurrent se . pilocarpine or kainic acid induced se in rodents is a common model used by researchers to study the mechanisms underlying epilepsy development or epileptogenesis . these se models mimic human se and result in rodents that have similar morbidities as humans . as with both tbi and stroke , several studies have found that the jak2-stat3 pathway is activated in the hippocampus as early as 1 h after experimental se and that several known stat3 regulated genes are activated . two reports have shown jak2-stat3 activation can be blocked pharmacologically ( by wp1066 or pyridone 6 ) and prevent some stat3-related genes from being activated . these stat3 regulated genes are involved in gabaar subunit regulation , cell survival , cell proliferation , and cell cycling . grabenstatter et al . found that when stat3 phosphorylation was blocked during se , the severity of the subsequent epilepsy was reduced in the rat pilocarpine model . this may suggest that jak2-stat3 activation after se at least partially contributes to the subsequent development of epilepsy . this same study also found that after administration of wp1066 , there was no difference in fjb staining ; suggesting that cell death was not altered by blocking jak2-stat3 activation after insult . multiple types of cerebral insults , including tbi , stroke and se , have been shown to activate the jak2-stat3 pathway and increase expression of stat3 related genes involved in cellular proliferation , differentiation , survival and inhibitory neurotransmission ( fig . 1 ) . some have reported worsened neurological recovery when blocking this pathway , while others have demonstrated advantageous effects . further investigation is needed to determine if it is feasible to selectively block only certain genes downstream of the jak2-stat3 pathway to prevent the deleterious effects associated with activation of this pathway while maintaining the beneficial neuroprotective effects of jak2-stat3 pathway activation . traumatic brain injury ( tbi ) , stroke , and status epilepticus ( se ) injury models have shown that the jak2-stat3 pathway becomes activated which is indicated either by the increased phosphorylation of jak2 and/or stat3 . when jak2-stat3 becomes phosphorylated it results in the increased expression of stat3 related genes involved in cell proliferation , cellular differentiation , cell survival , and inhibitory neurotransmission .

the jak2-stat3 signaling pathway has been shown to regulate the expression of genes involved in cell survival , cell proliferation , cell - cycle progression , and angiogenesis in development and after cerebral insults . until recently , little has been known about the effects of this pathway activation after cerebral insults and if blocking this pathway leads to better recovery . this review exams the role of this pathway after 3 cerebral insults ( traumatic brain injury , stroke , and status epilepticus ) .

You are an expert at summarizing long articles. Proceed to summarize the following text: atlas fractures account for approximately 25% of the upper cervical spine injuries , roughly 2%13% of all acute cervical spine fractures , and approximately 1%2% of all fractures of the human spinal column.123 the unstable jefferson fracture is a c1 burst fracture with concomitant injury of the transverse atlantal ligament ( tal ) , characterized by the outward spread of the lateral masses under axial compression.2456 several authors have reported successful surgical stabilization and fusion for jefferson fractures when they are associated with disruption of the transverse ligament and resultant instability.789 stabilization constructs include either c1c2 fusion or occiput - to - c2 fusion as surgical treatment is increasingly popular for treatment of these unstable injuries . the relative paucity of patients with atlas fractures treated with surgical stabilization and fusion described in the literature limits the ability to address questions about optimal treatment strategy.10 this study compares the clinical and radiological outcome parameters between posterior atlantoaxial fusion ( aaf ) and occipitocervical fusion ( ocf ) constructs in treatment of the unstable atlas fracture . sixty eight consecutive cases with unstable atlas fractures treated between october 2004 and march 2011 with either aaf or ocf fusion were reviewed at a single institution after institutional review board approval was obtained . the study population included 43 males and 25 females ranging in age from 18 to 78 years ( average 46 years ) . the patients were divided into two surgical groups and were treated with aaf ( n = 48 , m / f 30:18 ) or ocf [ n = 20 , m / f 13:7 , table 1 ] based on surgeon preference . forty eight consecutive patients were treated using c1c2 screw - rod or screw - plate fixation with bicortical iliac crest allograft or autograft bone . all patients had a recent history of trauma , with the most common cause of injury being : fall from a standing height ( n = 44 , 64.7% ) , motor vehicle accidents ( n = 17 , 25% ) , and diving injuries ( n = 7 , 10.3% ) . all conscious patients had complained about the neck pain and restriction of neck movement on admission , 27 ( 39.7% ) patients experienced an associated head or face injury . four patients had an american spinal injury association ( asia ) score of d , and one had an asia score of c. all patients with neurologic injury had spondylotic changes , canal narrowing , and posterior osteophytes , which damage the cord by causing kinking in a narrow canal . forty cases demonstrated tal rupture ( dickman type i ) with the instability of the atlantoaxial articulation , twenty comminuted fractures of atlas associated with tal rupture at the attachment site of bony structure of medial - lateral mass of atlas ( dickman type ii ) . in ocf group , twenty cases of burst atlas fracture had combined occipito - atlanto articulation instability or other injuries . sixteen patients underwent c0c2 fixation and fusion , four underwent c0c3 fixation and fusion . in the aaf group , 17 patients with typical unstable jefferson fractures and ten fractures with involvement of only one - half of the c1 ring underwent c1c2 fixation and fusion . twenty seven patients with atlas fractures also sustained associated axis fractures ( 39.7% ) [ table 2 ] . the shadow from the retropharyngeal soft tissue in front of c1c3 on a lateral radiograph measured average 10.5 mm wide ( range 4.313.4 mm ) . patients were followed at regular intervals after surgery . each patient was immobilized postoperatively using a cervical collar for 68 weeks . clinical details of patients associated injuries , treatment , and adverse outcomes in 27 patients of atlas fracture associated with axis fractures we retrospectively reviewed radiographs , clinical records , and hospital charts for all patients . operative time , estimated blood loss ( ebl ) , japanese orthopaedic association ( joa ) score , visual analog scale ( vas ) score , and the fusion status were recorded . atlas fractures were evaluated using open mouth odontoid view , lateral , flexion extension radiographs , and ct scan . any displacement of the c1 lateral mass lateral to the lateral borders of the c2 facets is suggestive of an atlas burst fracture . on lateral views , a predental space > 3 mm in adults is highly suggestive of a ruptured transverse ligament . posterior arch fractures can be assessed on lateral or 60 oblique x - rays.11 anterior arch fractures are often difficult to diagnose from plain x - rays . however , levine and edwards1 showed that the shadow from the retropharyngeal soft tissue at c1c3 was often significantly widened ( > 9.5 mm ) in the presence of an anterior arch fracture compared with a posterior arch fracture . magnetic resonance imaging ( mri ) and thin - cut computerized tomography ( ct ) scans ( including sagittal and coronal reconstructions ) were available for each patient . we utilized previously proposed criteria to identify tal injury including a sum of the displacement of the lateral masses of c1 on c2 of more than 8.1 mm on plain x - rays corrected for magnification ( rule of spence12 ) and mri evidence of ligamentous disruption or avulsion . axial ct cuts may reveal dickman type ii injuries of the transverse ligament even when the lateral mass spread is < 7 mm and does not imply instability under the rule of spence . when available , high - resolution mri is the modality of choice to assess the integrity of the transverse ligament.13 mri is capable of diagnosing dickman type i injuries of the transverse ligament that may exist without the significant spread of the lateral mass . atlanto - occipital instability is mostly judged by powers ratio and occipito - dental interval . a power 's ratio > 1 indicates anterior subluxation or dislocation of the atlanto - occipital joint has occurred ; occipito - dental interval > 6 mm similarly indicates dislocation or subluxation of atlanto - occipital joint . change in the occipito - dental interval on lateral flexion extension radiographs of > l mm also is indicative of occipitocervical instability . in summary , unstable atlas burst fractures are diagnosed by any of the following radiographic criteria : lateral mass displacement ( lmd ) > 6.9 mm on open - mouth odontoid view , atlanto - dens interval ( adi ) > 3 mm in adults on lateral radiographs suggestive of transverse ligament rupture of atlas , adi change on dynamic flexion extension radiography > 1 mm , and high - resolution mri showing transverse ligament injury . data from the two surgical groups were analyzed to compare groups , as well as preoperative and postoperative variables , using a paired t - test for preoperative and postoperative variables , and a two - sample t - test for independent samples for comparing different surgical groups . chi - square test was used to compare the satisfaction of these two surgical groups . data from the two surgical groups were analyzed to compare groups , as well as preoperative and postoperative variables , using a paired t - test for preoperative and postoperative variables , and a two - sample t - test for independent samples for comparing different surgical groups . chi - square test was used to compare the satisfaction of these two surgical groups . all patients were followed for between 12 and 46 months ( average 28 months ) . the average operative time was 110 min ( range 70180 min ) and mean blood loss was 650 ml ( range 2001600 ml ) . there were statistically significant difference in the ebl and operation time of aaf and ocf ( p < 0.05 ) . at final followup , the patient who presented with an asia c injury preoperatively improved to grade d postoperatively , and all four patients with grade d injuries improved to grade e postoperatively . all five patients with incomplete neurologic injuries ( 7.4% ) showed postoperative improvement in their asia impairment scale . the average vas score of the aaf group decreased from 4.8 1.5 preoperatively to 1.0 0.4 postoperatively ( p < 0.01 ) , the vas score of the ocf group decreased from 5.4 2.2 preoperatively to 1.3 0.9 postoperatively ( p < 0.01 ) . there was no significant difference in average vas score between two groups ( p > 0.05 ) . the joa score of the aaf group improved from 12.5 1.6 preoperatively to 14.2 2.1 postoperatively ( p < 0.01 ) , while the joa score of the ocf group improved from 12.2 2.3 preoperatively to 13.8 1.2 postoperatively ( p < 0.01 ) . there was no significant difference in joa score between two groups ( p > 0.05 ) . there was a statistically significant improvement in postoperative joa score [ p < 0.01 , table 3 ] . the average preoperative lmd values for the aaf and ocf groups were 12.5 mm ( range 8.216 mm ) and 14.6 mm ( range 1019 mm ) , respectively , measurements which imply a rupture of the transverse ligament . after surgery , the average lmd for the aaf and ocf groups measured 4.0 mm ( range 1.27.4 mm ) and 5.2 mm ( range 3.09.0 mm ) , respectively . the average adi for the aaf and ocf groups before surgery were 3.6 mm ( range 3.05.0 mm ) and 4.2 mm ( range 3.86.2 mm ) , respectively , and decreased after surgery to 1.8 mm ( range 1.03.2 mm ) and 2.5 mm ( range 1.44.0 mm ) , respectively [ table 4 ] . based on radiograph and ct imaging , no patient developed postoperative upper cervical spine instability or loss of reduction after surgery . visual analogue scale and japanese orthopaedic association scores in pre- and post - operation ( meanstandard deviation ) between atlantoaxial fusion group and occipitocervical fusion group radiographic outcome between atlantoaxial fusion and occipitocervical fusion in pre- and post - operation forty six out of 48 patients ( 95.8% ) with aaf subjectively estimated their global cervical spine flexion extension range of motion > 50% of their preillness status and were satisfied with the outcome of treatment . the remaining two patients who reported more limited range of motion self - reported that obesity and short neck morphology contributed to their deficit . all twenty patients with ocf complained of significant restriction of cervical spine flexion extension range of motion , and only 14 patients ( 70% ) were satisfied with their outcome . there was a statistically significant difference in the satisfaction of these two surgical methods ( p = 0.0085 ) . the rotation was restricted in both groups at 12 months . however , the combined restriction of flexion extension and rotation produced significant self - reported disability more commonly in the ocf group . successful posterior fusion was obtained in 67 of 68 patients ( 98.5% ) with the exception being one patient treated with ocf [ figures 1 and 2 ] . thirty four out of 68 patients ( 50% ) showed fusion as early as 3 months after surgery . in the aaf group , 28 out of 48 patients ( 58.3% ) fused completely by 3 months and the fusion was complete in all patients by 9 months after surgery . in the ocf group , six patients ( 30% ) fused by 3 months and 16 ( 80% ) by 9 months [ figure 3 ] . as mentioned above , one ocf patient developed nonunion at last followup at 24 months . breakage of a single c2 pedicle screw was seen in a different patient who still went on to successful fusion . superficial occipital headache or numbness occurred in five ( 25% ) cases of ocf . this was transient in one patient having settled at 2 months followup , while the other patient still had persistent neuralgia at 2-years after surgery , necessitating referral to the clinical pain service . a dural puncture during drilling of the skull occurred in one patient . delayed wound healing was seen in one patient . in the aaf group , two patients had superficial wound infections , but no patient developed deep wound infections . fracture of the posterior arch of c1 occurred during drilling of the entry point for the c1 lateral mass screw in two patients . hemorrhage from the c1c2 venous plexus occurred in five cases in the ocf group and 12 cases in the aaf group after damage to the c1c2 venous plexus from electrical cauterization or sharp dissection but was controlled through the use of hemostatic gauze and cotton packing . postoperative ct scans showed that three screws placed in c1 ( one screw in aaf group , two screws in ocf group ) and four screw placed in c2 ( two screws in aaf group , two screws in ocf group ) breached the medial cortex , and three screws ( two patients ) partially breached the transverse foramen of c3 in the ocf group . there were no cases of neurologic deterioration after surgery or at followup related to the procedure . no occurrences of va ( vertebral artery ) injury or neural element injury were detected intraoperatively or postoperatively . ( a ) preoperative lateral x - ray of cervical spine showing bilateral posterior arch fractures of atlas , ( b - d ) preoperative axial , coronal , and three - dimensional computerized tomography reconstruction images showing bilateral anterior and posterior arch fracture , typical jefferson fracture , lateral mass displacement = 7.0 mm , ( e ) preoperative t2w magnetic resonance imaging of cervical spine showing the shadow width from the retropharyngeal soft tissue at c1c3 was 10.6 mm , no abnormal signal within the spinal cord was observed , ( f and g ) postoperative ct scan showing that bilateral lateral mass screws , a c2 lamina screw , and a c2 pedicle screw are well positioned , ( h - j ) postoperative open - mouth , anteroposterior and lateral views showing satisfactory cervical alignment a 37-year - old male presented after a fall . ( a ) preoperative x - ray lateral view of cervical spine showing posterior arch fracture of atlas with a compression fracture of the superior endplate of c7 , ( b and c ) . preoperative axial and coronal computerized tomography images showing posterior arch fracture of atlas on left side and comminuted fracture of lateral mass , with extension into the atlanto - occipital articulation and the c7 vertebral compression fracture , ( d ) preoperative t2w magnetic resonance imaging showing no abnormal signals of spinal cord , ( e - g ) at 2-year followup , open - mouth , anteroposterior , and lateral views showing that occipitocervical articulation was well fixed , and bony fusion was achieved . ( h - k ) computerized tomography scan showing that the atlas lateral mass fracture and occipitocervical articulation have fused , c2 bilateral pedicle screws are well - positioned , c3 bilateral mass screws partially breach the transverse foramen of c3 but without clinically detectable vertebral artery or nerve injury a bar diagram showing atlantoaxial fusion and occipitocervical fusion in follow up at regular intervals at final followup , the patient who presented with an asia c injury preoperatively improved to grade d postoperatively , and all four patients with grade d injuries improved to grade e postoperatively . all five patients with incomplete neurologic injuries ( 7.4% ) showed postoperative improvement in their asia impairment scale . all patients with neck pain had a significant improvement . the average vas score of the aaf group decreased from 4.8 1.5 preoperatively to 1.0 0.4 postoperatively ( p < 0.01 ) , the vas score of the ocf group decreased from 5.4 2.2 preoperatively to 1.3 0.9 postoperatively ( p < 0.01 ) . there was no significant difference in average vas score between two groups ( p > 0.05 ) . the joa score of the aaf group improved from 12.5 1.6 preoperatively to 14.2 2.1 postoperatively ( p < 0.01 ) , while the joa score of the ocf group improved from 12.2 2.3 preoperatively to 13.8 1.2 postoperatively ( p < 0.01 ) . there was no significant difference in joa score between two groups ( p > 0.05 ) . there was a statistically significant improvement in postoperative joa score [ p < 0.01 , table 3 ] . the average preoperative lmd values for the aaf and ocf groups were 12.5 mm ( range 8.216 mm ) and 14.6 mm ( range 1019 mm ) , respectively , measurements which imply a rupture of the transverse ligament . after surgery , the average lmd for the aaf and ocf groups measured 4.0 mm ( range 1.27.4 mm ) and 5.2 mm ( range 3.09.0 mm ) , respectively . the average adi for the aaf and ocf groups before surgery were 3.6 mm ( range 3.05.0 mm ) and 4.2 mm ( range 3.86.2 mm ) , respectively , and decreased after surgery to 1.8 mm ( range 1.03.2 mm ) and 2.5 mm ( range 1.44.0 mm ) , respectively [ table 4 ] . based on radiograph and ct imaging , no patient developed postoperative upper cervical spine instability or loss of reduction after surgery . visual analogue scale and japanese orthopaedic association scores in pre- and post - operation ( meanstandard deviation ) between atlantoaxial fusion group and occipitocervical fusion group radiographic outcome between atlantoaxial fusion and occipitocervical fusion in pre- and post - operation forty six out of 48 patients ( 95.8% ) with aaf subjectively estimated their global cervical spine flexion extension range of motion > 50% of their preillness status and were satisfied with the outcome of treatment . the remaining two patients who reported more limited range of motion self - reported that obesity and short neck morphology contributed to their deficit . all twenty patients with ocf complained of significant restriction of cervical spine flexion extension range of motion , and only 14 patients ( 70% ) were satisfied with their outcome . there was a statistically significant difference in the satisfaction of these two surgical methods ( p = 0.0085 ) . however , the combined restriction of flexion extension and rotation produced significant self - reported disability more commonly in the ocf group . successful posterior fusion was obtained in 67 of 68 patients ( 98.5% ) with the exception being one patient treated with ocf [ figures 1 and 2 ] . thirty four out of 68 patients ( 50% ) showed fusion as early as 3 months after surgery . in the aaf group , 28 out of 48 patients ( 58.3% ) fused completely by 3 months and the fusion was complete in all patients by 9 months after surgery . in the ocf group , six patients ( 30% ) fused by 3 months and 16 ( 80% ) by 9 months [ figure 3 ] . as mentioned above , one ocf patient developed nonunion at last followup at 24 months . breakage of a single c2 pedicle screw was seen in a different patient who still went on to successful fusion . this was transient in one patient having settled at 2 months followup , while the other patient still had persistent neuralgia at 2-years after surgery , necessitating referral to the clinical pain service . a dural puncture during drilling of the skull occurred in one patient . delayed wound healing was seen in one patient . in the aaf group , two patients had superficial wound infections , but no patient developed deep wound infections . fracture of the posterior arch of c1 occurred during drilling of the entry point for the c1 lateral mass screw in two patients . hemorrhage from the c1c2 venous plexus occurred in five cases in the ocf group and 12 cases in the aaf group after damage to the c1c2 venous plexus from electrical cauterization or sharp dissection but was controlled through the use of hemostatic gauze and cotton packing . postoperative ct scans showed that three screws placed in c1 ( one screw in aaf group , two screws in ocf group ) and four screw placed in c2 ( two screws in aaf group , two screws in ocf group ) breached the medial cortex , and three screws ( two patients ) partially breached the transverse foramen of c3 in the ocf group . there were no cases of neurologic deterioration after surgery or at followup related to the procedure . no occurrences of va ( vertebral artery ) injury or neural element injury were detected intraoperatively or postoperatively . ( a ) preoperative lateral x - ray of cervical spine showing bilateral posterior arch fractures of atlas , ( b - d ) preoperative axial , coronal , and three - dimensional computerized tomography reconstruction images showing bilateral anterior and posterior arch fracture , typical jefferson fracture , lateral mass displacement = 7.0 mm , ( e ) preoperative t2w magnetic resonance imaging of cervical spine showing the shadow width from the retropharyngeal soft tissue at c1c3 was 10.6 mm , no abnormal signal within the spinal cord was observed , ( f and g ) postoperative ct scan showing that bilateral lateral mass screws , a c2 lamina screw , and a c2 pedicle screw are well positioned , ( h - j ) postoperative open - mouth , anteroposterior and lateral views showing satisfactory cervical alignment a 37-year - old male presented after a fall . ( a ) preoperative x - ray lateral view of cervical spine showing posterior arch fracture of atlas with a compression fracture of the superior endplate of c7 , ( b and c ) . preoperative axial and coronal computerized tomography images showing posterior arch fracture of atlas on left side and comminuted fracture of lateral mass , with extension into the atlanto - occipital articulation and the c7 vertebral compression fracture , ( d ) preoperative t2w magnetic resonance imaging showing no abnormal signals of spinal cord , ( e - g ) at 2-year followup , open - mouth , anteroposterior , and lateral views showing that occipitocervical articulation was well fixed , and bony fusion was achieved . ( h - k ) computerized tomography scan showing that the atlas lateral mass fracture and occipitocervical articulation have fused , c2 bilateral pedicle screws are well - positioned , c3 bilateral mass screws partially breach the transverse foramen of c3 but without clinically detectable vertebral artery or nerve injury a bar diagram showing atlantoaxial fusion and occipitocervical fusion in follow up at regular intervals the most common causes of this injury were fall ( n = 44 , 64.7% ) and motor vehicle accidents ( n = 17 , 25% ) . because of the relatively capacious spinal canal at c1 , neurological deficits are very unusual after jefferson fractures.114 jefferson fractures are associated with other traumatic cervical injuries in up to 50% of cases , most commonly with posteriorly displaced type ii odontoid fractures.114 unstable jefferson fractures are characterized by a rupture of the transverse ligament of the atlas , resulting in the lateral displacement of the lateral masses after excessive axial loading.4715 lateral mass overhang of > 6.9 mm was found to be associated with rupture of the transverse ligament in cadavers and became known as the rule of spence.12 however , after correction for magnification on standard radiography technique , a lateral mass overhang of more than 8.1 mm on open - mouth odontoid x - rays was widely adopted as diagnostic of transverse ligament rupture.16 the tal plays an important role as a checkrein for the movement of the dens . rupture of the tal can lead to an anterior c1 dislocation with backward movement of the dens leading to spinal cord injury . dickman et al.13 thought that even without tal rupture , fracture through the anterior half of the atlas still carries a risk of atlas dislocation because the anterior arch alone can not restrain the dens . injuries in which the ring is disrupted twice on a single side without tal rupture also has the potential for associated dislocation because the tal can not prevent the lmd nor control the rotational displacement of the ring and must be considered to be an unstable fracture . in our study , average postoperative lmd decreased to 4.0 mm and 5.2 mm , respectively , in the aaf and ocf groups . the average postoperative adi decreased to 1.8 mm and 2.5 mm , respectively , in the aaf and ocf groups . the shadow width from the retropharyngeal soft tissue at c1c3 averaged 10.5 mm ( 4.313.4 mm ) . according to levine and edwards,1 soft tissue shadow width at c1c3 > 9.5 mm is more commonly associated with anterior arch atlas fractures than posterior arch fractures . although some form of external immobilization is the accepted treatment for stable jefferson fractures , there is no established standard of care for the treatment of unstable jefferson fractures . many different treatment methods have been reported for the treatment of unstable jefferson fractures.7891718 because of the lack of larger comparative series , relative advantages or disadvantages of any one treatment method remain hypothetical . advantages of surgical fixation in unstable jefferson fractures are immediate stability , better rates of reduction , and patient avoidance of halo use and its potential complications.519 moreover , it is also highlighted in a review summarized by ryken20 that the complications associated with halo immobilization of atlas fractures should be paid more attention in the elderly . riesner21 suggested that isolated stable c1 fracture without dislocation can be treated conservatively ( cervical collar ) , unstable fracture , depending on the general condition , should be referred to surgical therapy or halo extension . surgical stabilization strategies most commonly used are aaf or ocf in the treatment of the unstable jefferson fractures . all patients in our study had a significant relief of neck pain . while we found no difference in vas score and joa score between aaf and ocf groups , both groups demonstrated a statistically significant improvement after surgery and also had a significant improvement in neurologic status . fowler et al.22 reported that indications for surgery in patients with unstable jefferson fractures include ( 1 ) atlas burst fracture with tal injury , ( 2 ) concomitant odontoid fracture or hangman 's fracture , ( 3 ) associated lower cervical spine injury , ( 4 ) associated neurological deficit , and ( 5 ) atlantoaxial or occipitocervical instability . vieweg et al.23 believed that surgical indications for stabilization of atlas fractures are met in the setting such as unstable atlas fractures , stable atlas fracture combined with type ii / iii odontoid fracture or type iii hangman 's fracture . a relative indication for surgery is persistent neck pain after atlas fracture nonunion . for atlas fractures associated with atlanto - occipital joint instability , ocf is necessary ; for unstable atlas fractures with bilateral posterior arch fracture , ocf should be selectively employed . in the present study , twenty patients with atlas burst fractures associated with atlanto - occipital joint instability underwent occipitocervical fixation and fusion , while four cases of atlas fractures associated with levine and edwards type iii hangman 's fractures received occipitocervical fixation and fusion surgery . postoperatively , one patient treated with ocf had bone absorption , which may be due to the small amount of bone graft and graft shielding . the reported success rate of bony fusion using posterior wiring techniques ranges from 75% to 80% , while with the magerl technique it is 90%.242526 in 2002 , goel et al.27 published the results of a group of 160 patients treated between 1988 and 2001 using an original stabilization method . it is noteworthy that both harms et al.28 and goel et al.27 succeeded in achieving the c1c2 bony fusion in 100% of cases . wang et al.29 reported all 319 cases ( 100% ) achieved solid fusion between c1 and c2 . stulk et al.17 published the results of a group of 57 patients underwent occipitocervical fixation . of the remaining 47 , bony union was achieved in 44 patients ( 93.6% ) . pseudoarthrosis developed in three elderly patients who had minimal complaints and therefore did not require revision surgery . we found no difference in union rate between short ( c0c2 ) and long ( c0cx or c - t ) fixation constructs or when different bone grafting strategies were used ( autograft vs. morselized allograft vs. structural allograft ) . while patients treated with autograft tended to achieve fusion much earlier than those treated with allograft , we confirmed that even patients treated with allograft achieved solid fusion by 3 months after surgery . the use of autograft may be advisable in those patients with risk factors for nonunion . ct scan is essential for evaluation of successful union in patients treated surgically for jefferson fractures as radiographs have a very limited ability to demonstrate bridging trabecular bone in this region of the spine . in contrast , open - mouth , anteroposterior , lateral , and flexion extension radiographs are useful for the evaluation of instrumentation and upright alignment . because of the use of ct scan , we have high confidence in the accuracy of the fusion rate reported in our series at 24 months of 98.5% for patients treated with ocf with 34 out of 68 patients ( 50% ) showing fusion by 3 months . in the aaf group , 28 out of 48 patients ( 58.3% ) fused by 3 months after surgery and the fusion was complete in all patients by 9 months . in the ocf group , six patients ( 30% ) fused by 3 months and 16 ( 80% ) by 9 months . breakage of a single c2 pedicle screw was seen in a different patient , but this did not interfere with eventual fusion . our data demonstrate that patients treated with aaf with short - segment structural bone grafting successfully fuses similarly to those patients treated with long - segment constructs for unstable jefferson fractures . about 95.8% patients with aaf subjectively graded the cervical spine flexion extension movement as slightly more than 50% of the preillness status and were satisfied with the outcome of treatment . all twenty patients with ocf complained of significant restriction of spinal movements , and only 14 patients ( 70% ) were satisfied with the outcome . rotations were restricted in both groups at 12 months . however , the combined restriction of flexion extension and rotation produced significant self - assessed disability in the ocf group . in summary , fusion rates and patient satisfaction rates were significantly higher in aaf group compared to the ocf group . superficial occipital pain and scalp numbness occurred in five ( 25% ) cases of ocf . of the two patients with postoperative occipital neuralgia , one had only transient pain which resolved by 2 months after surgery , while the other patient still had pain at final followup which was adequately but incompletely controlled with pain management . potential causes of postoperative occipital neuralgia include irritation of the nerve root by the c1 lateral mass screw and traction on the dorsal root ganglion during screw insertion . c1 lateral mass screws with an 8 mm threadless section were used to reduce the likelihood of irritation of the c2 nerve root.30 bleeding from the venous plexus around the greater occipital nerve occurred in five cases and 12 cases in the ocf group and the aaf group , respectively , due to damage to the c1c2 venous plexus from electrocautery or sharp dissection . goel et al.27 recommended dissection to identify the c2 nerve and control of venous bleeding by direct bipolar coagulation . bleeding instead from the c1 screw tracts was treated by stulik et al.31 by prompt insertion of a screw into the c1 lateral mass and by tamponad . wang et al.,29 in contrast , recommend against placing screws to stop bleeding in case the bleeding represented vertebral artery injury which could then result in vertebral artery occlusion . a dural puncture during drilling of the skull occurred in one patient . there were no cases of neurologic deterioration after surgery or at followup related to the procedure . the main limitation of the current study is the relatively small number of patients in each surgical group which increases the risk of group heterogeneity . the traditional view is that ocf is the better option for the patient with unstable jefferson fracture with associated occipito - atlantal instability , and the aaf is only used to treat the patients with atlantoaxial instability . however , that is not exactly because the disadvantages of the ocf have a strong impact on the movable function of occipitocervical region . hence , in the young patients , we suggest to use the aaf and halo vest for 3 months and observe the status of bony fusion . our results showed that the ocf or aaf combined with short - term external immobilization can establish the upper cervical stability and prevent further spinal cord injury and nerve function damage . the patients treated with aaf demonstrated higher fusion rates and greater patient satisfaction than those treated with ocf , aaf patients developed fewer complications .

background : controversy exists regarding the management of unstable jefferson fractures , with some surgeons performing reduction and immobilization of the patient in a halo vest and others performing open reduction and internal fixation . this study compares the clinical and radiological outcome parameters between posterior atlantoaxial fusion ( aaf ) and occipitocervical fusion ( ocf ) constructs in the treatment of the unstable atlas fracture.materials and methods:68 consecutive patients with unstable jefferson fractures treated by aaf or ocf between october 2004 and march 2011 were included in this retrospective evaluation from institutional databases . the authors reviewed medical records and original images . the patients were divided into two surgical groups treated with either aaf ( n = 48 , f / m 30:18 ) and ocf ( n = 20 , f / m 13:7 ) fusion . blood loss , operative time , japanese orthopaedic association ( joa ) score , visual analog scale ( vas ) score , atlanto - dens interval , lateral mass displacement , complications , and the bone fusion rates were recorded.results:five patients with incomplete paralysis ( 7.4% ) demonstrated postoperative improvement by more than 1 grade on the american spinal injury association impairment scale . the joa score of the aaf group improved from 12.5 3.6 preoperatively to 15.7 2.3 postoperatively , while the joa score of the ocf group improved from 11.2 3.3 preoperatively to 14.8 4.2 postoperatively . the vas score of aaf group decreased from 4.8 1.5 preoperatively to 1.0 0.4 postoperatively , the vas score of the ocf group decreased from 5.4 2.2 preoperatively to 1.3 0.9 postoperatively.conclusions:the ocf or aaf combined with short - term external immobilization can establish the upper cervical stability and prevent further spinal cord injury and nerve function damage .

You are an expert at summarizing long articles. Proceed to summarize the following text: systems involving surfactants constitute a field of great interest due to their wide - ranging applications in detergent and pharmaceutical industries , food technology , petroleum recovery , and so forth . therefore , physics , chemistry , biology , and technology meet at the frontier area of interdisciplinary research on association colloids formed by surfactants . the presence of both non - polar ( hydrophobic ) and polar ( hydrophilic ) groups in the same molecule gives to the surfactant an amphiphilic character . these structural features determine their assembly into either micelles or other morphological forms of membranous aggregates . the micelles are generally spherical or spheroidal at concentrations slightly above the critical micelle concentration ( cmc ) . with increasing surfactant concentration , micelles can undergo a structural transition under appropriate conditions of salinity , temperature , or addition of some organic additives [ 39 ] . for most surfactants , micelles tend to grow and , in this process , change shape when an appropriate parameter is modified . in most instances , this process results in the formation of elongated micelles that can become extremely long and referred to as giant , rod - like , wormlike , thread - like and polymer - like micelles [ 1014 ] . in recent years , a new class of surfactants ( known as dimeric or gemini surfactants ) has generated a lot of interest in colloid chemistry [ 15 , 16 ] . these gemini surfactants possess two hydrophobic tails and two polar , or ionic , headgroups covalently attached through a linker or spacer . a great deal of variation exists in the nature of spacers , hydrophobic tails , and headgroups [ 1619 ] . the gemini surfactants are the subject of increasing study due to their unusual solution and interfacial properties and their enhanced performance in applications , compared to analogous single - chain conventional surfactants . these surfactants have been found to be superior to conventional surfactants on several counts and are said to be the next generation of surfactants . for example , their cmc values are generally 10 to 100 times lower than the corresponding conventional surfactants [ 1521 ] . surfactants are generally used in the presence of additives in order to improve their properties . thus , it is likely that dimeric surfactants in the future can be used in mixtures with various additives ( e.g. , conventional surfactants , organic / inorganic compounds , non - electrolytes , etc . ) . the existence of synergistic effects between them may render the use of such mixtures even more attractive [ 2224 ] . it is also known that the structures of supramolecular assemblies constructed by ionic surfactants depend on counterion species ; especially , the organic counterions affect the assembly structures more strongly than the inorganic counterions . several reports have been published on the structural aspects and aggregation behavior of dimeric surfactants [ 2530 ] . however , literature on the micellization of gemini surfactants in the presence of different classes of additives is scarce . to our knowledge , no report has been published yet on the effect of adding salts of aromatic acids on the structure of gemini micelles . some of these salts , depending on the nature of the groups attached to the central benzene ring , are known to produce viscoelasticity in conventional cationic surfactants [ 3133 ] . therefore , as a first step , we have explored the influence of the partitioning site of an aromatic salt counterion near the gemini micelle and its possible impact on overall micellar structural changes . for the purpose , we have used h nmr to see the effect of the addition of sodium anthranilate ( naan , i ) to 5 mm 1,4-bis(n - hexadecyl - n , n - dimethylammonium)butane dibromide ( ii , a dimeric cationic surfactant , referred to as 16 - 4 - 16 ) solution at 25c . the surfactant was synthesized by refluxing 1,4-dibromo butane ( 98% , fluka ) with n , n - dimethylhexadecylamine ( 95% , fluka ) ( molar ratio 1:2.1 ) in dry ethanol at 80c for 48 h. the solvent was removed under vacuum and the solid thus obtained was recrystallized four to five times from acetone to benzene ( 3:1 ) mixture to obtain a pure surfactant . the gemini surfactant was characterized adequately ( solvent cdcl3 , internal standard tms ) which gave satisfactory h nmr and c , h , n data . the cmc values determined from conductivity ( 2.010 m , 25c ) and surface tension ( 2.6310 m , 35c ) measurements were in close agreement with the literature value [ 3436 ] . also , the presence of no minimum in the surface tensions vs. [ surfactant ] plot was taken as additional evidence regarding the purity of 16 - 4 - 16 . stock solution of 5 mm 16 - 4 - 16 was prepared in d2o ( 99.9% , aldrich ) . sample solutions of 5 mm naan ( 99% , cpc ) were prepared first by taking requisite amounts and making up the volumes by freshly prepared 5 mm surfactant solution . to get lower concentrations , the sample solutions were syringed in the nmr tubes and the spectra were recorded on a bruker cryomagnet spectrometer working at 300 mhz . viscosity measurements on 16 - 4 - 16 and cetyltrimethylammonium bromide ( ctab ) ( 98% , bdh ) were carried out by an ubbelohde viscometer thermostated at 250.1c as done earlier . the surfactant was synthesized by refluxing 1,4-dibromo butane ( 98% , fluka ) with n , n - dimethylhexadecylamine ( 95% , fluka ) ( molar ratio 1:2.1 ) in dry ethanol at 80c for 48 h. the solvent was removed under vacuum and the solid thus obtained was recrystallized four to five times from acetone to benzene ( 3:1 ) mixture to obtain a pure surfactant . the gemini surfactant was characterized adequately ( solvent cdcl3 , internal standard tms ) which gave satisfactory h nmr and c , h , n data . the cmc values determined from conductivity ( 2.010 m , 25c ) and surface tension ( 2.6310 m , 35c ) measurements were in close agreement with the literature value [ 3436 ] . also , the presence of no minimum in the surface tensions vs. [ surfactant ] plot was taken as additional evidence regarding the purity of 16 - 4 - 16 . stock solution of 5 mm 16 - 4 - 16 was prepared in d2o ( 99.9% , aldrich ) . sample solutions of 5 mm naan ( 99% , cpc ) were prepared first by taking requisite amounts and making up the volumes by freshly prepared 5 mm surfactant solution . to get lower concentrations , the sample solutions were syringed in the nmr tubes and the spectra were recorded on a bruker cryomagnet spectrometer working at 300 mhz . viscosity measurements on 16 - 4 - 16 and cetyltrimethylammonium bromide ( ctab ) ( 98% , bdh ) were carried out by an ubbelohde viscometer thermostated at 250.1c as done earlier . figure 1 shows the h nmr spectra of pure 5 mm 16 - 4 - 16 in d2o . the concentration of the surfactant is much higher ( 100 times of the cmc ) , thus the observed chemical shifts , ( table 1 ) , can be considered those of micellized surfactant . 1a 300-mhz h nmr spectrum of pure 5 mm 1,4-bis(n - hexadecyl - n , n - dimethylammonium)butane dibromide ( 16 - 4 - 16 ) in d2otable 1 h nmr chemical shifts ( , ppm ) of 5 mm 1,4-bis(n - hexadecyl - n , n - dimethylammonium)butane dibromide ( 16 - 4 - 16 ) surfactant with various concentrations of sodium anthranilate ( naan ) at 25c chemical shift ( , ppm)naan ( mm)12345 + 6700.7761.1981.6661.7973.0653.33410.9151.3331.7261.8663.1743.41320.9201.3351.6501.8043.1453.35030.9271.340disappeardisappear3.123disappear50.9281.318disappeardisappear3.062disappear a 300-mhz h nmr spectrum of pure 5 mm 1,4-bis(n - hexadecyl - n , n - dimethylammonium)butane dibromide ( 16 - 4 - 16 ) in d2o h nmr chemical shifts ( , ppm ) of 5 mm 1,4-bis(n - hexadecyl - n , n - dimethylammonium)butane dibromide ( 16 - 4 - 16 ) surfactant with various concentrations of sodium anthranilate ( naan ) at 25c table 1 shows the values for all surfactant resonances in the absence and presence of increasing naan concentration . change in environment is experienced by the different parts of the surfactant monomers , which is indicated in the chemical shift via the shielding and deshielding effects experienced by the h nuclei . the non - polar part of the surfactant ( hydrophobic part ) near the core of the micelle is highly shielded . the presence of n atoms in the headgroup makes its adjacent protons more deshielded . on increasing the salt concentration , when the molar ratio of salt to surfactant is close to unity , signals become very broad , making evaluation difficult , as shown in fig . 2 ( 5 mm salt ) . 2a 300-mhz h nmr spectrum of 5 mm 16 - 4 - 16 containing different concentrations of sodium anthranilate ( naan ) in d2o . for abbreviation , see fig . 1 a 300-mhz h nmr spectrum of 5 mm 16 - 4 - 16 containing different concentrations of sodium anthranilate ( naan ) in d2o . the line widths at half height of the signals from the protons of the n - methyl groups of the surfactant are shown in fig . the data show an increase in the proton line widths with increasing [ naan ] . the line width values can be used to discuss structural changes in the gemini skeleton . changes in the width can be inferred as the changes in the micellar morphology [ 39 , 40 ] . 3line widths of the signals from the protons of the n - methyl groups of 16 - 4 - 16 plotted against different concentrations of added naan . for abbreviation , see figs . 1 and 2 line widths of the signals from the protons of the n - methyl groups of 16 - 4 - 16 plotted against different concentrations of added naan . for abbreviation , see figs . 1 and 2 viscosity data of different concentrations of naan with 5 mm of the surfactant show an increase in viscosity with increase in the [ naan ] ( fig . 4 ) . the presence of salt ions near the polar heads of the surfactant molecules decreases the repulsion force between the headgroups . a reduction in the repulsion makes it possible for the surfactant molecules to approach each other more closely and form larger aggregates . this leads to an increase in the relative viscosity ( r ) indicating the formation of larger aggregates [ 41 , 42 ] . viscosity data with 5 mm ctab having the same concentrations of naan ( as used with the gemini ) are also shown in fig . the viscosity remaining almost constant for the former indicates that naan addition to 16 - 4 - 16 causes structural changes at fairly low concentration in comparison to conventional ctab . 4plots between relative viscosity ( r ) against different concentrations of added naan . , cetyltrimethylammonium bromide ( ctab ) ; , 16 - 4 - 16 . for abbreviation , 1 plots between relative viscosity ( r ) against different concentrations of added naan . . for abbreviation , see fig . 1 this behavior of 16 - 4 - 16 is understandable due to the following . in ctab , the headgroups are randomly distributed on the micellar surface separating the aqueous phase and micelle core . these distances between the headgroups are determined by the opposite forces at play in micelle formation . the reported values of the surface area per headgroup at interface suggest that the distance is 0.70.9 nm . with gemini surfactants , , the inter - headgroup distance exhibits a maximum at the equilibrium distance ( as for conventional ctab in the present case ) and another narrow maximum at a distance corresponding to the length of the spacer . the bimodal distribution of headgroup distances and effect of the chemical link between headgroup on the packing of surfactant alkyl chain in the micellar core are expected to strongly affect the packing parameter or curvature of surfactant layers , and thus to the micelle shape and the properties of the solution . the present viscosity behavior reflects the ability of 16 - 4 - 16 to give rise to worm - like micelles at fairly low naan concentration which , however , is absent with the conventional ctab due to packing requirements . 4 ) suggest that the presence of an ion in the micellar solution of 16 - 4 - 16 causes a change in micellar morphology . the intercalation of an ion into the micellar surface region ( due to electrostatic interactions with the oppositely charged surfactant headgroups ) seems to be the prime cause of inducing such morphological changes . additionally , naan ( i ) has a nh2 group attached to 2- position that would prefer to remain in more polar environment due to its polar nature and the geometric hindrance . therefore , the site of solubilization of an has direct links to the overall changes . information regarding the environment around an can throw some light on the partitioning of an near micellar surface . the signals for the amino protons are not seen separately , as they are labile and thus merge with the solvent peak . the spectra of the ring protons at different concentrations of naan in 5 mm 16 - 4 - 16 are also shown ( fig . it is clear that signals for the h protons are in a polar environment and signals for h , h and h are in the non - polar environment indicating that an intercalate near the headgroups of the dimeric surfactant . at higher salt concentrations , the peaks for the an shift up - field this shows that at higher concentrations of an , the effective environment experienced by h and h protons is different ( slightly polar ) . 5a 300-mhz h nmr spectrum of naan : a 5 mm pure naan , b with 5 mm 16 - 4 - 16 at different naan concentrations . for abbreviation , see figs . 1 and 2 a 300-mhz h nmr spectrum of naan : a 5 mm pure naan , b with 5 mm 16 - 4 - 16 at different naan concentrations . we conclude that the intercalation of an ion causes a decrease in interheadgroup repulsion with a consequence of which hydrophobic interaction predominates . these cylindrical or rod - shaped micelles may produce viscoelasticity in the solution , which we are currently studying in our laboratory .

the effect of addition of sodium anthranilate to 5 mm micellar solutions of gemini surfactant 1,4-bis(n - hexadecyl - n , n - dimethylammonium)butane dibromide is investigated by 1h nmr . the solubilization site of anthranilate anion near the micellar surface is inferred . in the micelles , the an ions intercalate among the surfactant headgroups producing morphological changes .

You are an expert at summarizing long articles. Proceed to summarize the following text: lung volume recruitment ( lvr ) is a dynamic physiologic process used to reopen collapsed aveoli ; augment voice volume and duration ; prevent ( micro)atelectasis ; preserve or improve respiratory compliance ; and augment cough flows to facilitate continued use of noninvasive ventilation ( niv ) . when deeply insufflated air volumes are followed by coughing , cough flows can be greatly increased , facilitating the expulsion of bronchial secretions . in patients with decreased respiratory muscle function due to neuromuscular disease or chest wall deformity , air stacking has been recommended as a method for deep lung insufflation ( chart 1 ) . with this technique , a manual resuscitator is used to deliver volumes of air that the glottis holds to volumes greater than vc until the maximum insufflation capacity ( mic ) is reached . , the technique is considered to be safe , because complications have been seldom reported . we report the case of a chronically ventilator dependent patient who presented with severe respiratory distress almost a day after she experienced acute chest pain and dyspnea while stacking air . we discuss the findings and the possible consequences of management , as well as suggest future recommendations . pcf : peak cough flow ; as : air stacking ; li : lung insufflation ; nmd : neuromuscular disease . bvc and mep of at least 0.56 l and 11 cmh2o , respectively , are mandatory to elevate pcf > 3 l / s using as . cas cumbersome or impossible ; passive lung insufflation remains feasible , according to bach et al.(8 ) ddefined as chronic abnormalities in chest x - ray and spo2 < 95% or fev1/fvc ratio two standard deviations less than normal . a 72-year - old woman who had poliomyelitis as a child developed scoliosis and post - polio syndrome , which led to chronic respiratory failure at age 54 . she had been on nocturnal ventilatory assistance for 15 years , resulting in normal blood gases during the day . she had a history of bronchial asthma and a 20 pack - year smoking history , having quit smoking 30 years prior . because of ineffective peak cough flows registered in 2005 , she was taught how to stack air . thus , she gradually improved her assisted as well as her spontaneous peak cough flows ( pcf , table 1 ) . after having used air stacking uneventfully for nearly 3 years , the patient suddenly experienced a sharp pain during deep inflation one morning in june of 2008 . the pain , which was located in her back and on her right side , was accompanied by acute dyspnea . the following morning , she was referred to the emergency room and presented with worsening respiratory distress . she required emergent intubation and invasive ventilation before a diagnostic work - up could be initiated . subsequently , blood gas analysis results were as follows : ph , 6.99 ; paco2 , 127.5 mmhg ; bicarbonate , 29.0 mmol / l ; base excess , 8.4 mmol / l ; pao2 , 101.3 mmhg ; and sao2 , 92% . a chest x - ray revealed right - sided pneumothorax ( figure 1 ) . immediately after chest tube drainage her respiratory distress resolved and she was successfully extubated . in order to minimize pleural air leakage during positive pressure ventilation , we considered to temporarily discontinue nocturnal niv , but she could not tolerate sleeping without niv . after healing of the pleurodesis ( 16 days later ) the patient was oxygen dependent during spontaneous breathing and she was discharged home on long - term oxygen therapy for 15 hours daily . during nocturnal niv table 1lung volume recruitment and pulmonary function during admissions due to asthma exacerbation.variables , 1991 - 20091991199420062008april 1 , 2009(3 mo . after the start of niv)(1.5 mo . before the incident)pulmonary function vc , l ( % ) 1.00 ( 37)1.32 ( 49)1.2 ( 51 ) fev1 , l ( % ) 0.70 ( 30)0.92 ( 41)0.6 ( 34 ) albuterol0.80 ( 34)0.7 ( 38 ) fev1/vc , % 707051 albuterol , % 78 58 tlc , l ( % ) 3.00 ( 65)3.38 ( 74)3.47 ( 77 ) itgv , l ( % ) 2.30 ( 90 ) 2.53 ( 99 ) raw , kpa.l.s ( n)0.56 ( 0.3)0.57 ( 0.3)blood gas analysisarterialarterialcapillarycapillarycapillary ph7.377.397.407.427.44 pco2 , mmhg5248.0454451 bic , mmol / l313027.928.031.6 po2 , mmhg5261616159 so2 , % 8590919190 spo2 , % 959493variables , 2004 - 2009lvr - related measurements20042005200620072009(prior to the start of as)(3 mo . after the start of as ) pcf unassisted , l / s2.202.252.503.082.83 - - pcf after mic , l / s2.753.504.084.00 - - rr , min 1618221620 - 24mo . : monthsniv : noninvasive ventilation ; incident : acquisition of pneumothoraxitgv : intrathoracic gas volumeraw : airway resistancebic : bicarbonatepco2 : carbon dioxide tensionpo2 : oxygen tensionso2 : oxygen saturationlvr : lung volume recruitmentpcf : peak cough flowmic : maximum insufflation capacity : noninvasive ventilation ; incident : acquisition of pneumothorax : intrathoracic gas volume : carbon dioxide tension : lung volume recruitment : maximum insufflation capacity figure 1 in a , a chest x - ray , taken at admission , shows right - sided pneumothorax . notice the total collapse of the lung ( upper white arrowhead ) , diaphragmatic bullae ( lower white arrowhead ) , and widened intercostal spaces . the black arrow shows the depressed right hemidiaphragm . in b , a detail of the right lower lobe reveals inflated bullae in the collapsed lung . in c , a chest x - ray , taken an hour after the first one ( a ) and immediately after chest tube drainage ( white arrow ) shows the normal position of the hemidiaphragm ( black arrow ) . nine months later ( april 1st , 2009 ) , the patient visited the outpatient clinic . she was slightly hypercapnic , without wheezing , and used o2 1 l / min during spontaneous respiration ( table 1 ) . the patient did not report having experienced chest pain , backache , or sudden dyspnea . to our knowledge , this is the first report of pulmonary barotrauma / volutrauma caused by lvr using air stacking . although it seems prudent to avoid lvr when patients have a history of recent pneumothorax , pulmonary emphysema , or bronchiectasis , barotrauma and volutrauma have seldom been reported as complications of air stacking . we identified only one report of intestinal barotrauma as a complication of passive lung insufflation via a manual resuscitator with a one - way valve in a nine - month - old infant with neuromuscular weakness . recently , suri et al . reported two cases of pneumothorax ( possibly resulting from volutrauma ) associated with daily use of mechanical insufflation - exsufflation via a cough - assist device and niv . although one of those patients resumed using the cough - assist device without recurrence of pneumothorax , the second patient died of acute - on - chronic congestive heart failure after re - expansion of the collapsed lung . our patient used neither a one - way valve for air stacking nor a cough - assist device for maximum lung insufflation . a pneumothorax suggests a pleural ( i.e. , peripheral alveolar ) lesion , a bleb , or an emphysematous bulla ( figure 1 ) . it remains unknown how often milder forms of alveolar damage , such as pulmonary interstitial emphysema or subclinical pneumothorax , occur as a consequence of deep insufflation of the lungs . although rare , the clinical course in our patient clearly shows that potentially life - threatening complications can develop . however , we still feel that , after having weighed the pros and cons at that time ( in 2005 ) , there were no reasons to withhold air stacking for deep lung insufflation in this patient . in fact , the patient met several of the criteria for being trained in the use of and using this lvr technique ( chart 1 ) , which improved her pcf and might have prevented respiratory deterioration for a period of 3 years . a pcf > 2.7 l / s is considered minimal for airway secretion clearance , whereas a pcf > 4.5 l / s is needed in order to achieve such clearance during respiratory tract infections . in retrospect , this complication might have been aggravated by her stable bronchial asthma , which occasionally caused airflow limitation . however , even though the patient had asthma attacks , they were infrequent ( only four hospitalizations in 18 years ) , and she did not meet the criteria for a diagnosis of copd ; nor was she suffering from chronic asthma . in addition , since a pneumothorax would have been expected to induce a hypercapnic exacerbation in the presence of copd , the fact that , following chest tube drainage , she immediately could be extubated and maintained spontaneous respiration , argues against concomitant airflow limitation . furthermore , her dlco was normal ( after correction for her restricted alveolar ventilation-92% of the predicted value ) , which excludes parenchymatous pulmonary disease . moreover , her former smoking habit and the use of niv might have put her at risk for developing a pneumothorax , as may have her severe scoliosis . presumably , the use of nocturnal niv following the incident and the delay in seeking medical attention might have contributed to the severity of the clinical condition at presentation . despite the use of nocturnal niv oxygen the daytime hypercapnia noted nine months after discharge might have been caused by progressive restriction due to pleurodesis or the use of oxygen . although lvr is considered safe for individuals with normal lungs and the risk - benefit ratio of lvr , after thousands of patient - hours of use , is still favorable , this event raises concern as to whether the indiscriminate use of lvr is advisable in all patients with restrictive respiratory disease , especially in older patients , who might have an undiagnosed pulmonary pathology resulting in structural abnormalities . in addition , patients should be advised of the warning symptoms of possible complications of lvr in order to avoid a delay in seeking medical attention and to ensure immediate access to medical care . we therefore recommend that patients with restrictive respiratory disorders who develop chest pain or backache with acute dyspnea during or following lvr be referred for urgent diagnostic evaluation to exclude pulmonary barotrauma . in certain cases , and depending on the medical history , diagnostic imaging of the chest should be considered prior to lvr , especially in elderly individuals and in those with known risk factors for a parenchymatous pulmonary pathology or with a history of pulmonary disease .

lung volume recruitment involves deep inflation techniques to achieve maximum insufflation capacity in patients with respiratory muscle weakness , in order to increase peak cough flow , thus helping to maintain airway patency and improve ventilation . one of these techniques is air stacking , in which a manual resuscitator is used in order to inflate the lungs . although intrathoracic pressures can rise considerably , there have been no reports of respiratory complications due to air stacking . however , reaching maximum insufflation capacity is not recommended in patients with known structural abnormalities of the lungs or chronic obstructive airway disease . we report the case of a 72-year - old woman who had poliomyelitis as a child , developed torsion scoliosis and post - polio syndrome , and had periodic but infrequent asthma attacks . after performing air stacking for 3 years , the patient suddenly developed a pneumothorax , indicating that this technique should be used with caution or not at all in patients with a known pulmonary pathology

You are an expert at summarizing long articles. Proceed to summarize the following text: however none of them are considered of excellent performance to accurately determine what is ingested for all age groups . even in studies based on a " gold standard " method as food weighing , there can be deviations in the estimation of some items . the r24h is among the most widely used instruments for assessing the accuracy of selfreport measures . it is considered a fast and financially accessible tool that can reflect the individual 's diet when applied repetitively . this repetitive evaluation is important because deviations can be found in the estimates produced by self - report measures . studies involving parents of children or adults showed that the estimates of food intake are considerably underestimated for the unhealthy foods and overestimated for the healthy ones . moreover , estimates for children and adolescents can be affected by the recall bias . they have problems in correlating the frequency of food intake and the time of ingestion , and sometimes they also tend to remember just the preferred foods . children and adolescents frequently have difficulties in reporting the size of the consumed portion . this fact is often associated with cognitive constraints , a little explored subject in the literature . it is known that in children 7 - 8 years of age , there is an increased ability to participate in evaluations such as diet recall without the help of parents . these difficulties in associating items of diet with time are reported as an information overload , since many times the child does not have a clear memory of past events . thus , it is necessary to reconstruct the events by making inferences from what they usually ingest . this inference many times is n't what the child ingested , but can portray a usual diet . on the other hand , the period of adolescence is characterized by intense changes of physical , psychological and social context , and cognitive ability and level of emotional maturity may be variable in this period . most of the studies for validating food frequency questionnaires are concerned about investigating the nutritional composition of the diet and the intake amount of calories and nutrients ( macro or micro ) . however , fast and specific tools for estimating food behaviors , such as the frequency of carbohydrate intake with and without sugar , are scarce . this frequency is the main etiologic factor for dental caries , a chronic disease considered a serious public health problem . thus the objective of this study was to compare estimates of food behavior related to oral health produced by a self - report measure and dietary recalls of 24 hours . a cross - sectional study was conducted among adolescents attending public schools in piracicaba ( 0.7 ppm f in tap water ) , 157 km from the capital of so paulo - brazil , with an area of 1,377 km and a population of 364,571 people . the study was approved by the research ethics committee of public health school - usp ( protocol no . the study population was selected from the representative sample of 483 adolescents that participated in the study " determinant factors of the risk of obesity in adolescents from public schools of piracicaba : cross - sectional study as a first step in a cohort study " supported by fapesp ( so paulo research foundation ) , process no . nutritionists trained under the supervision of the department of nutrition from the public health school at the university of so paulo applied three 24 hours dietary recalls ( r24h ) . the dietary recalls were administered at nonconsecutive days to cover a day in the weekend , setting up 15-day intervals between them . the self - report instrument had three questions for each one of the eleven food items . the questions were about food intake related to oral health , as well as frequency and the time of the day in which the food was ingested . finally , we compared this instrument to the dietary recalls ( r24h ) . the tools ( self - report measure and r24h ) were tested in a pilot study and adjusted accordingly before being used in the feld . the nutritionists used utensils such as cups , plates , and spoons to apply r24h . to examine the food behavior related to oral health in the past 15 days , the eleven investigated items were ice cream , fruits , chocolate , soft drinks , vegetables , juices with added sugar , biscuits ( with and without filling ) , greens , chocolate milk , and sweets ( chewing gum , candy ) . these items were selected based on the results of a previous study on food intake conducted in piracicaba - sp , using data related to the intake average obtained from two 24-hour recalls ( r24h ) applied in 93 adolescents . the food items were chosen taking into account the content of sucrose , the frequency of consumption and the number of adolescents who reported the food intake . data from food frequency were collected in six categories : 1 to 3 times in the last 15 days ; 4 to 6 times in the last 15 days ; 1 time a day ; 2 times a day ; 3 times a day ; 4 or more times a day . time of the day related to the food ingestion was registered according to three categories : at mealtime ( breakfast , lunch or dinner ) , at another moment ( mid - morning or mid - afternoon or evening before bedtime ) or both . items such as vegetables , greens and fruits were included based on questionnaires from who ( 2010 ) and cdc about diet , due to the importance these foods in relation to oral health - related behavior . the measures of body weight and height of the adolescents were performed using a digital scale with a capacity of 150 kg , sensitivity of 100 grams ( tanita , solar digital scale hs 302 , tokyo , japan ) , and a portable estadiometer ( seca bodymeter 208 , hamburg , germany ) . the estadiometer was placed in one of the walls of the research site and the measurement used was the distance between the highest part of the head and the soles of the feet , in upright position . the volunteer was positioned so that the head was aligned with the frankfurt plane ( imaginary line from the external auditory canal until the lower orbit of the eye ) . to weigh the volunteers , the volunteer was asked to look straight ahead while the weight was recorded by the researcher . brazilian economic classification based on schooling level of the household head and the presence of household goods and appliances in the house was used . the families were categorized in eight economic classes : a1 , a2 , b1 , b2 , c1 , c2 , d and e. the data from r24h were converted into energy and nutrients by the software dietwin and the average consumption ( kcal ) was estimated . moreover , they were separated in 11 food items : ice cream , fruits , chocolate , soft drink , greens , juices with added sugar , biscuits ( with and without filling ) , vegetables , chocolate milk , sweets ( chewing gum , candy ) to allow the comparison with the issues of the self - report instrument . the data about the ingested item , intake frequency and the time of the food intake were checked in the r24h and the self - report measure . we performed the data checking to ensure their reliability , examining 20 chips randomly , and errors of data transcription were not found . chi - square and student 's t test were used to compare the characteristics between the sub - sample and the reference population . the correspondence between the responses in the individual level was verified by simple agreement and kappa statistics when the response categories showed balance , and the difference between the highest and lowest value reached no more than 20% of the respondents . the responses on the intake frequency obtained through self - report instrument were grouped into three categories : " one or more times a day " ; " up to 3 times over the past 15 days " ; " 4 to 6 times in the last 15 days " . we could thus have a better visualization of categories of frequency and could keep the category " one or more times a day " apart . the wilcoxon test was used to analyze the differences in average consumption estimated by r24h and the self - report measure . the chi - square of mcnemar test was used to compare the differences in the percentage of respondents according to the category " one or more times a day " and the intake moment ( only at mealtime or in another moment ) . assuming type 1 error equal to 5% and type 2 error equal to 20% , a sample of 85 or more participants would be needed to detect an effect size corresponding to 0.3 between the average daily intakes . the same sample size would be appropriated to detect a ratio between 1.8 and 2.2 between two proportions since the relative frequency of discordant pairs ranged from 0.5 to 0.9 . nutritionists trained under the supervision of the department of nutrition from the public health school at the university of so paulo applied three 24 hours dietary recalls ( r24h ) . the dietary recalls were administered at nonconsecutive days to cover a day in the weekend , setting up 15-day intervals between them . the self - report instrument had three questions for each one of the eleven food items . the questions were about food intake related to oral health , as well as frequency and the time of the day in which the food was ingested . the tools ( self - report measure and r24h ) were tested in a pilot study and adjusted accordingly before being used in the feld . the nutritionists used utensils such as cups , plates , and spoons to apply r24h . to examine the food behavior related to oral health in the past 15 days , the eleven investigated items were ice cream , fruits , chocolate , soft drinks , vegetables , juices with added sugar , biscuits ( with and without filling ) , greens , chocolate milk , and sweets ( chewing gum , candy ) . these items were selected based on the results of a previous study on food intake conducted in piracicaba - sp , using data related to the intake average obtained from two 24-hour recalls ( r24h ) applied in 93 adolescents . the food items were chosen taking into account the content of sucrose , the frequency of consumption and the number of adolescents who reported the food intake . data from food frequency were collected in six categories : 1 to 3 times in the last 15 days ; 4 to 6 times in the last 15 days ; 1 time a day ; 2 times a day ; 3 times a day ; 4 or more times a day . time of the day related to the food ingestion was registered according to three categories : at mealtime ( breakfast , lunch or dinner ) , at another moment ( mid - morning or mid - afternoon or evening before bedtime ) or both . items such as vegetables , greens and fruits were included based on questionnaires from who ( 2010 ) and cdc about diet , due to the importance these foods in relation to oral health - related behavior . the measures of body weight and height of the adolescents were performed using a digital scale with a capacity of 150 kg , sensitivity of 100 grams ( tanita , solar digital scale hs 302 , tokyo , japan ) , and a portable estadiometer ( seca bodymeter 208 , hamburg , germany ) . the estadiometer was placed in one of the walls of the research site and the measurement used was the distance between the highest part of the head and the soles of the feet , in upright position . the volunteer was positioned so that the head was aligned with the frankfurt plane ( imaginary line from the external auditory canal until the lower orbit of the eye ) . to weigh the volunteers , the volunteer was asked to look straight ahead while the weight was recorded by the researcher . brazilian economic classification based on schooling level of the household head and the presence of household goods and appliances in the house was used . the families were categorized in eight economic classes : a1 , a2 , b1 , b2 , c1 , c2 , d and e. the data from r24h were converted into energy and nutrients by the software dietwin and the average consumption ( kcal ) was estimated . moreover , they were separated in 11 food items : ice cream , fruits , chocolate , soft drink , greens , juices with added sugar , biscuits ( with and without filling ) , vegetables , chocolate milk , sweets ( chewing gum , candy ) to allow the comparison with the issues of the self - report instrument . the data about the ingested item , intake frequency and the time of the food intake were checked in the r24h and the self - report measure . we performed the data checking to ensure their reliability , examining 20 chips randomly , and errors of data transcription were not found . chi - square and student 's t test were used to compare the characteristics between the sub - sample and the reference population . the correspondence between the responses in the individual level was verified by simple agreement and kappa statistics when the response categories showed balance , and the difference between the highest and lowest value reached no more than 20% of the respondents . the responses on the intake frequency obtained through self - report instrument were grouped into three categories : " one or more times a day " ; " up to 3 times over the past 15 days " ; " 4 to 6 times in the last 15 days " . we could thus have a better visualization of categories of frequency and could keep the category " one or more times a day " apart . the wilcoxon test was used to analyze the differences in average consumption estimated by r24h and the self - report measure . the chi - square of mcnemar test was used to compare the differences in the percentage of respondents according to the category " one or more times a day " and the intake moment ( only at mealtime or in another moment ) . assuming type 1 error equal to 5% and type 2 error equal to 20% , a sample of 85 or more participants would be needed to detect an effect size corresponding to 0.3 between the average daily intakes . the same sample size would be appropriated to detect a ratio between 1.8 and 2.2 between two proportions since the relative frequency of discordant pairs ranged from 0.5 to 0.9 . in this study , 87 of the 92 selected adolescents completed all phases of the research . among these adolescents , 39.2% were male and the mean age was 13.4 years old ( sd=0.7 ) . regarding socioeconomic level , 4.6% were class a2 , 24.1% were b1 , 43.7% were b2 , and 27.6% were c1 . according to table 1 , there were no statistically significant differences between the characteristics of the adolescents included in the study and the participants of the representative sample from the city . the samples did not differ statistically by gender , body mass index ( bmi ) and socioeconomic level . characteristics of sample and subsample according to gender , body mass index ( bmi ) , consumption of sweets , sugar and soft drinks . piracicaba , brazil , 2011 notes : data sample ( 2007 ) and subsample ( 2011 ) sd = standard deviation the average energy intake in the 3 dietary recalls ( r24h ) in kcal was 2021.95 ( 671.64 ) , and the maximum and minimum values were respectively 4612.71 and 633.72 . the volunteers had a mean weight of 54.67 kg , height of 1.60 m and bmi equal to 21.28 kg / m ; 21 were overweight and 7 were considered obese according to the who values . the self - report instrument used was composed of 33 questions , 27 on the consumption of sweet products ( containing sugar ) interspersed with 6 items related to consumption of fruits , greens and vegetables . the mean values obtained through the self - report instrument were always higher than those reported by the r24h , with statistically significant differences for most items ( wilcoxon p<0.05 ) , except ice cream , vegetables and biscuits without filling ( table 2 ) . there were no differences between boys and girls when the analysis was stratified by gender ( data not shown ) . mean , median , and standard deviation ( sd ) of daily intake ( grams ) assessed by three r24hs and a self - report measure ( srm ) , in 87 adolescents attending public schools in piracicaba , brazil , 2011 wilcoxon test ( p<0.05 ) the higher spearman 's correlations were found for the items ice cream ( rs=0.35 , p=0.00 ) , soft drink ( rs=0.39 , p=0.00 ) and chocolate milk ( rs=0 , 38 , p=0.00 ) , positioning them on the edge between a weak and moderate correlation . for fruits ( rs=0.23 , p=0.03 ) , biscuits without filling ( rs=0.15 , p=0.15 ) , and sweets / candy / gum ( rs=0.25 , p=0.02 ) , the observed values showed a weak correlation . for other items , the percentage of adolescents who reported intake frequency " one or more times daily " was higher than the value obtained through r24h for all food items , except soft drinks ( table 3 ) . regarding the time of intake ( only at the mealtime or at another time ) , there was no statistically significant difference for the items greens , juice with added sugar , vegetables , chocolate milk , biscuits without filling and sweets ( chewing gum , candy ) . for four of the five remaining items , namely ice cream , fruits , chocolate , soft drink and biscuits with filling , significant differences were observed leading to an overestimation of the intake in other times ( table 3 ) . percentage of adolescents according to their intake frequency over the past 15 days and time of the day of intake , both assessed by r24hs and self - report measure ( srm ) . piracicaba , brazil , 2011 statistical test not applied at the individual level , the kappa statistic was applied only for soft drinks ( 0.27 ) and sweets/ candy / gum ( 0.15 ) , with level of agreement rated as " considerable " and " mild " consecutively . higher values of crude agreement between instruments , individually , were for the items biscuits without filling ( 75.9% ) , ice cream ( 72.4% ) , chocolate ( 57.5% ) and soft drinks ( 56.3% ) ( figure 1 ) . percentage of agreement ( % ) related to the responses obtained through the r24h and by the self - report measure ( srm ) according to the intake frequency and type of food , piracicaba , 2011 , brazil in relation to the time of sugary food intake , the r24h showed that soft drinks and sweets are consumed in other times besides the main meals , reaching 77.0% of agreement between the instruments ( figure 2 ) . percentage of responses of crude agreement ( % ) and kappa test comparing the r24h and the self - report measure ( srm ) , according to the time of the day and type of food ingested , piracicaba , 2011 , brazil the kappa test was only possible to apply for the soft drink and the value was considered " mild " ( 0.10 ) . sugars have an evidenced etiologic role in to tooth decay , not only by the amount of the sugar ingested , but mainly by the frequency of intake . thus , the instruments aiming to measure this consumption are important to deepen understanding of the relationship between food behavior and dental caries in a context of multiple sources of fluoride . therefore , comparing estimates of dietary behavior related to oral health among adolescents produced by a self - report instrument and by 24 hour recalls is important to verify the reliability of these instruments . in the present study , we assessed the degree of crude agreement of responses , the average intake estimates , and the percentage distribution of participants according to the frequency of food intake in the last 15 days and the time of consumption . the measurement of the degree of agreement between the values produced by both tools was made in relation to the categories of consumption frequency and time of intake ( only at mealtime and at another moment ) . values of crude agreement equal or higher than 70% regarding the time of ingestion were observed for four food items . in relation to the intake frequency , this agreement level was noticed only for two items , which may indicate that adolescents have more readiness to describe the moment of food intake than its frequency in the last 15 days . the degree of correlation between the average daily intakes was estimated as weak for the most studied foods . only items as ice cream ( rs=0.35 , p=0.00 ) , soft drink ( rs=0.39 , p=0.00 ) and chocolate milk ( rs=0.38 , p=0.00 ) presented weak to moderate correlation suggesting that the deviations are not homogeneous or subject to a linear correction . the proportion of adolescents who reported intake frequency " one or more times daily " for a particular food was higher than the estimate obtained by reference measure for all items , except for the soft drink , which displayed equivalent consumption . the implication is that the estimates provided by the self - report measure should be used with caution . according to the reference method , the percentage of adolescents who reported intake frequency " one or more times a day " for fruits , greens and vegetables was always lower than the value estimated by self - report measure . the results suggest that adolescents , before a self - report instrument , tend to report a degree of exposure to the food items larger than actually experience in their daily lives . regarding the moment of ingestion , no tendency for overestimating for some items whose estimates differed , it was observed that the most frequent category changed from mealtime to other times outside the main meal . this occurred for the items ice cream , fruits , chocolate , soft drink , and biscuits with filling , which may suggest that in the face to face interview , a feature of reference method , adolescents tend to underestimate the consumption of these products outside the period of the mealtime . in this case , the self - report measure might be a useful tool considering that different behaviors in relation to the expected standard are less reported in a face to face interview . deviations in the estimation of food behavior are highlighted by several researchers . some of them have argued that teenagers tend to remember only the preferred foods and do not possess the time dimension completely formed . there is a reasonable increase from individuals 7 - 8 years to 12 years of age in the ability of children to participate in dietary recalls , but only for the food consumed in the immediate past , corresponding to the last 24 hours . parental involvement may be important to provide details about the types and amounts of food consumed , as children have not completed their cognitive development . however , the help of the parents is not a solution to all difficulties of assessing the diet of the children , particularly if the study is concerned about evaluating what is consumed between main meals , in the period when the kids are at school or in other places out of their parents ' sight . in the case of adolescents , additional difficulties associated with patterns of irregular diet , including eating out of the house , and concern with self - image can contribute to a greater or lesser lack of accuracy in reporting habitual diet . in recent years , changes have been observed in the social context of eating with a shift from a pattern based on family meal to a pattern based on more irregular and solitary eating . this not only increases the frequency of consumption but also confuses the function of the foods . items that traditionally were part of the main meal and did not pose a risk to the oral health have become a threat , as the introduction of the snacks in other moments during the day . some authors have emphasized that adolescents do not have cognitive maturity for decision - making . they would be influenced by emotional factors , because some factors of configural stimuli are still being formed in the adolescence . thus , to ask for a teen to answer an instrument that assesses food consumption in the last 15 days may require a mental and cognitive effort beyond his / her ability , leading to errors in the estimation of food consumption . it is important to point out that the discrepancies in this study were found in a sample size relatively too small to detect differences between the estimates produced by different measurement instruments . the characteristics of volunteers who formed the present investigation did not differ from the representative sample of adolescents who participated in the previous study in the same county . in addition to demographic characteristics , the composition according to body mass and exposure to sugary products , both by frequency and by the amount ingested , were equivalent . while this represents a strong aspect of the study , a limitation is that it was not possible to ensure a more balanced frequency for some food items , which would have allowed the application of kappa test . food items that composed the instrument were selected based on a previous study , which was conducted with participants of similar age enrolled in the same city . nevertheless , for two items investigated by the reference method , none was consumed by adolescents at least once a day . in spite of indicators related to group analysis have showed better application when compared to individual analysis indicators since the kappa test could not be applied to all food groups , from a clinical point of view , the results suggest that the utilization of self - report instrument can lead to an overestimation of individual exposure compared to r24h . to minimize recall bias , one might make use of food weighing as the " gold standard " . the present study used kitchen utensils , glasses and cups to help the adolescents remember the consumed amount in the previous day , making sure to apply the 24-hour recall at least one day after the weekend , since the diet might vary in this period . the method was applied by trained nutritionists . to apply the self - report instrument , the adolescents were divided in small groups , distant from each other in individual portfolio , always with the presence of the researcher responsible to aid in case of any doubt . there was considerable variability in the degree of concordance between the instruments , at the individual level , depending on the type of food . the response of the adolescents led to an overestimating of daily intake for 8 out of 11 food items measured by the self - report instrument . the percentage of adolescents that reported the intake frequency " one or more time daily " was higher than the estimate obtained through r24h for all food items , excepting soft drinks . further studies are needed to develop a self - report measure particularly for items in which there was an overestimation .

objectiveto compare estimates of food behavior related to oral health obtained through a self - report measure and 24 hour dietary recalls ( r24h).methodwe applied three r24h and one self - report measure in 87 adolescents . the estimates for eleven food items were compared at individual and group levels.resultsno significant differences in mean values were found for ice cream , vegetables and biscuits without filling . for the remaining items , the values reported by the adolescents were higher than the values estimated by r24h . the percentage of adolescents who reported intake frequency of 1 or more times/ day was higher than the value obtained through r24h for all food items except soft drinks . the highest values of crude agreement between the instruments , individually , were found in the biscuits without filling ( 75.9% ) and ice cream ( 72.4%).conclusionthe results suggest that adolescents tend to report a degree of exposure to the food items larger than what they actually experience in their daily lives .

You are an expert at summarizing long articles. Proceed to summarize the following text: lipoma is the most common soft tissue mesenchymal neoplasm in adults , which is located in any part of the body . the majority occurs in the upper - half of the body , particularly the trunk , head , and neck region , and it is rarely described in the oral cavity . conventional lipoma has been divided into three forms according to the origin of the localization : superficial lipoma ( arise within subcutaneous tissue ) , deep lipoma ( arise within deep soft tissue ) and parosteal lipoma ( arise within the surfaces of bone ) . the histological characteristics and types vary , which include angiolipoma , angiomyolipoma , myolipoma , osteolipoma and chondrolipoma . both osteolipomas and chondrolipomas are rare entities.[24 ] however , occurrence of osteolipomas or in other term lipomas with oseous and cartilagenous metaplasia are less common than other subtypes of lipomas . the term of osteochondrolipoma has been used for the lipomas containing both cartilage and bone which , are very rarely seen and generally associated with a paraosteal localization . to our knowledge , a 64 year old male patient with painless mass on his mandibulary symphysis region , was referred to the department of oral and maxillofacial surgery , faculty of dentistry on september , 2007 . the lesion had been first noticed 2 months prior of the presentation to the clinic with no significant enlargement . clinical examination of the oral cavity revealed a well demarcated , firm , round and exophitic lesion of approximately 2 cm in diameter at the symphysis region of the left mandible . the lesion was firmly attached to the bone in the clinical examination and the overlying mucosa was intact and of normal color . radiographically , at the site of the lesion some degree of radioopacity was observed [ figure 1 ] . under local anesthesia , the patient was taken to the operating room and the lesion was completely excised with an intraoral approach . during the surgical intervention , the encapsulated lesion was not adherent to the underlying periosteum and overlying mucosa , thus the lesion was dissected and removed easily [ figure 2 ] . the surgical specimen was histopathologically evaluated for final diagnosis at department of oral pathology , faculty of dentistry , gazi universitys . the 6-month postoperative follow - up showed healing of the oral mucosa without any recurrency . preoperative panoromic radigoraph exhibiting the dense radioopacity ( arrow ) in the symphysis region of the mandible intraoperative view of the lesion with encapsulation macroscopically , the gross specimen was a 2.7 1.8 1.4 cm encapsulated mass mostly comprising of adipose tissue with a few number of encapsulated nodular structures . on section , focal areas of hyaline chondroid structures and lamellar bone with fatty marrow were seen throughout the lesion . both islands of bone and cartilage were surrounded with well defined fibrous tissue [ figure 3 ] . there was no histological evidence of malignancy , such as mitosis , cellular atypia , necrosis , and hemorrhage . histochemistry with alcian blue periodic acid - schiff stain showed acid mucopolysaccaride presence in chondroid tissue ; hence , this was hyaline chondroid . on immunohistochemistry , adipocytes were positively stained with vimentin antibody , while both adipocytes and chondrocytes were positive for s-100 protein [ figure 4 ] . histopathological features of osteochondrolipoma showing mature adipose tissue containing cartilage islands and lamellar bone trabecules ( h and e , 40 ) chondrocytes and adipocytes demonstrating positivity for s 100 protein ( immunoperoxidase , 40 ) however , they are relatively uncommon in the oral cavity with incidence of 14% . variants of lipoma especially osteolipoma and chondrolipoma are very rare lesions which are located in the oral cavity . furthermore , intaoral lipoma with both osteoid and cartilaginous metaplasia has been reported just in two cases . we presented an osteochondrolipoma case that differed from the typical arrangement by two rare alterations . first , the lesion showed well - defined cartilaginous and osseous areas within lipoma that is also considered as osseous and cartilaginous metaplasia . in the a study of fregnani et al . , fibrolipoma was reported as the dominant subtype in 46 lipoma cases , in which neither osteolipoma nor chondrolipoma was found . two lipomas with cartilaginous or osseous metaplasia was reported out of 125 lipoma cases in another study , whereas none of the cases represented osteochondrolipoma . although , any case in the name of oral osteochondrolipoma has not been reported , lipoma with osteoid and cartilaginous metaplasia has been represented by two cases in the oral region . the osteochondrolipoma is the specific term of the lipoma with mature cartilaginous and osseous differentiation ; thus , both terms represents the same entity . some authors consider such type of lipoma as a benign mesenchymoma due to consisting of two or more mesenchymal elements such as lipocytes , chondrocytes , osteocytes , and fibroblasts . jones et al . stated that the term of benign mesenchymoma should be used strictly to describe an unencapsulated neoplasm composed of two or more mature mesenchymal tissues not ordinarily associated with each other , excluding fibrous connective tissue . in the present case , as the tumor is well demarcated and partially encapsulated and moreover the prominent component is mature adipose tissue , the tumor is considered as osteochondrolipoma . second alteration that took part in this case , was the parosteal localization of the lesion . the parosteal lipoma which is defined as lipoma exhibits a conguous relationship with the periosteum , usually demonstrating some form of attachment to periosteum with an underlying osseous reaction , is rarely seen in the oral cavity . various types of osseous cortical responses from a reactive overproduction of bone to cortical erosion can be seen underlying bone . the radiopacity in our case may reflect either the reactive bone production of underlying bone or the density of cartilagenous and ossous component of the tumor . multipotent cells of mesenchyme , different cell lines and metaplastic differentiation of the adipose tissue are three hypothesis regarding the origin of the tumor . however , considering its parosteal location , histological findings of well - formed cartilage and bone tissue within the adipose tissue neoplasm , it is decided to be a true neoplasm of mesenchymal tissue stem cells showing characteristics of three different tissues originating from the mesenchyme .

osteochondrolipoma is a rare benign soft tissue neoplasm . it is occasionally considered to be a variant of adipose tissue neoplasm lipoma showing multiple differentiation pathways of pluripotent stem cells . as with the lipomas they can be seen at any location and show cartilagenous and osteoid differentiation when located parosteally . we present a case of osteochondrolipoma located at the symphysis of the mandible . to our knowledge , this is the first reported case of an oral osteochondrolipoma associated with parosteal localization .

You are an expert at summarizing long articles. Proceed to summarize the following text: she had pelvic and right lower quadrant pain starting a week prior to and lasting for up to a week after her menstrual cycle . the uterus was normal with the exception of a 19-mm mass of the anterior fundus . due to her persistent right lower quadrant pain , her ct findings included a 3-cm cecal mass and the 19-mm uterine mass seen on ultrasound that was thought to represent a fibroid . colonoscopy was then performed that was remarkable for an inflamed , ulcerated area in the cecum suggestive of an extrinsic mass . biopsies of this area were consistent with a hyperplastic polyp and a benign lymphoid mucosal nodule . given the cyclical nature of her pain as well as the presence of the uterine and the cecal masses , there was a high suspicion for endometriosis . the patient elected to undergo laparoscopic hysterectomy / bilateral salpingo - oophorectomy and excision of the cecal mass . the decision to perform bilateral salpingo - oophorectomy was based on her desire for prophylaxis of ovarian cancer as well as definitive treatment for endometriosis . at the time of surgery , the laparoscopic hysterectomy and bilateral salpingo - oophorectomy was completed first . five - mm trocars were placed in the right lower quadrant ( rlq ) and ( llq ) , with the patient in the suprapubic position . several implants of endometriosis were found in the posterior cul de sac and overlying the right uterosacral ligament . once the cecum and terminal ileum were adequately mobilized , then the bowel was resected . the endocutter was placed through the 12-mm umbilical trocar and was used to divide the terminal ileum and ascending colon . an intracorporeal side - to - side ileocolic anastomosis was then created with the endocutter . the patient was seen in follow - up at 2 weeks , 6 weeks , 9 months , and 19 months . furthermore , removal of the colon specimen through the vaginal cuff has been described fewer than 5 times in the surgical literature . although laparoscopic colon surgery shares many of the minimally invasive benefits of other laparoscopic procedures such as cholecystectomy and fundoplication , the need for a specimen extraction incision is a drawback . in this case , the vaginal cuff was simply left open following hysterectomy to allow for specimen removal . wilson et al recently described a technique for posterior colpotomy for specimen retrieval thus bypassing the need for a cutaneous extraction site . lakshman et al described a series of 3 patients undergoing simultaneous laparoscopic hysterectomy and anterior resection of the recto sigmoid colon . jadoul et al described combined hysterectomy and nephrectomy for severe endometriosis with vaginal extraction of the kidney . the new era of natural orifice transluminal endoscopic surgery ( notes ) procedures has the potential for another paradigm shift in surgery in a similar fashion to that of laparoscopic surgery . multiple reports have demonstrated the possibility of the colon as an access point , but few have focused on colectomy as the procedure to be performed via notes . whiteford et al showed in a cadaver model that sigmoid colectomy can be performed with transanal endoscopic microsurgery equipment . this case report demonstrates the feasibility of combined ileocectomy and hysterectomy via the laparoscopic approach . furthermore , this report demonstrates that colon specimen retrieval via the vagina is an acceptable alternative to a cutaneous extraction incision . as the technology for notes continues to develop , hybrid techniques such as this may bridge the learning curve from pure laparoscopy to notes .

surgical therapy remains the mainstay for the treatment of endometriosis . in this case report , we review the surgical management of a patient who presented with a cecal implant of endometriosis . she was successfully treated with combined laparoscopic hysterectomy and ileocecal resection . the laparoscopic ileocecal resection was completed with an intracorporeal anastomosis and retrieval of the specimen through the vaginal cuff . this presentation demonstrates the feasibility of combined colon resection and hysterectomy as well as vaginal colon specimen extraction . the vagina as a colon specimen retrieval site has significant implications for the future of natural orifice colorectal surgery .

You are an expert at summarizing long articles. Proceed to summarize the following text: infectious diseases , especially those that can mimic vasculitis , are of particular importance in the differential diagnosis of antineutrophil cytoplasmic antibody ( anca)-associated vasculitis ( aav ) because the misdiagnosis of an infectious disease as aav , and the administration of immunosuppressive therapy could promote the infection and produce disastrous consequences . thus , an accurate understanding of anca test specificity in infectious diseases is critical . a variety of infectious diseases this case suggests that somehow the infectious process induces the production of anca , possibly through non - specific b - cell activation or auto - immunization after the release of proteinase 3 ( pr3 ) from neutrophils . the anca may contribute to the inflammatory process . when encountered with anca positivity in patients suspected of having systemic vasculitis , physicians should take appropriate steps to rule out infectious diseases , including sub - acute bacterial endocarditis ( sbe ) , before committing to long - term immunosuppressive therapy . a 45-year - old male consulted a general practitioner for his pedal edema of 1 week duration . the patient was unwell , 2 months after a tooth extraction and had consulted three doctors for his clubbing and generalized feeling of lassitude . he never had any medical illness in the past and was told to be normal after evaluation . the patients also had dyspnea on doing more than ordinary work for 6 months and had paroxysmal nocturnal dyspnea ( pnd ) of 1 month duration . the blood pressure was 110/70 mm hg , pulse rate 98/min , and respiratory rate 26/min . the kidneys were 9.5 cm long on both sides with increased cortical echogenicity , hemoglobin was 6.5 g / dl , serum urea 107 mg / dl , serum creatinine 4.5 mg / dl , modified diet in renal disease estimated glomerular filtration rate ( mdrd e - gfr ) 23 ml / min/1.73 m ) , and normal wbc count ( total count 5600/mm ) . the urine showed microscopic hematuria ( rbc > 100/hpf ) , hyaline , granular casts , and 24-h proteinuria was 650 mg / day . the renal biopsy showed pauci - immune fibro - cellular crescentic vasculitis [ figures 1a and b ] with vessel necrosis and inflammation [ figure 1c ] . renal biopsy showing cellular crescent around a glomerulus ( h and e , 40010 ) renal biopsy showing interstitial granuloma with interstitial inflammation with loss of tubular architecture ( h and e , 40010 ) renal biopsy showing vascular inflammation and areas of necrosis ( h and e , 40010 ) the c - anca and p - anca were elevated , and the c3 complement was repeatedly low and c4 was low normal . three doses of 0.5 g of injectable methylprednisolone were given followed by oral steroid ( 0.5 mg / kg / day ) along with oral cyclophosphamide ( 1 mg / kg / day ) . echocardiography showed small vegetations in the mitral leaflets with severe mitral regurgitation , moderate severe mitral stenosis , and severe pulmonary arterial hypertension . possible infective endocarditis as per the modified duke 's criteria for infective endocarditis with one major criteria positive echocardiogram for infective endocarditis with an oscillating intra - cardiac mass on the mitral valve , and two minor criteria : ( 1 ) predisposing rheumatic mitral valve disease with a recent history of tooth extraction and ( 2 ) immunological renal involvement in the form of dual anca - positive vasculitis . the cyclophosphamide was stopped and steroids were rapidly tapered and stopped . the vegetations grew in size over the next 4 weeks despite empirical antibiotics for culture - negative endocarditis . due to absence of history of fever or leukocytosis and as all the blood cultures were negative , it was not clear if the patient had infective endocarditis or the small vegetations were secondary to vasculitis . the vegetation continued to grow despite vancomycin , cefaperazone / sulbactum therapy , and hence the valve was replaced with a bioprosthetic valve . the c3 normalized within a month after valve replacement , c - anca was negative after 2 months , and p - anca normalized when it was tested after 4 months . the immunosuppression was stopped within 2 weeks after diagnosis and the patient continues to be stable over the 4 months follow - up now . both anca - associated small vessel vasculitis ( svv ) with endocardial compromise and sbe have overlapping clinical manifestations such as valvular vegetations , inflammatory signs , renal involvement , and constitutional symptoms . aortic valve is almost always involved in anca - associated svv and is associated with skin , renal , respiratory involvement , and normal complement levels with no splenomegaly . a variety of infectious and non - infectious diseases could sometimes result in false - positive anca tests by indirect immunoflorescence ( if ) . however , they are associated with negative specific enzyme linked immunosorbent assay ( elisa ) testing for anti - pr3 or anti - mpo . in our case , the c - anca and p - anca were positive by if and elisa testing which confirmed that they were specific for anti - pr3 and anti - mpo . the initial vegetations were small and discrete raising the suspicion of vasculitis - induced cardiac involvement . the patient 's symptoms started months after tooth extraction , and the pattern of valve involvement was suggestive of rheumatic heart disease . cardiac involvement in wg is more common than generally thought , ranging from 6% to 44% of patients and includes coronary arteritis , pericarditis , myocarditis , valvulitis / endocarditis , conduction system granulomata , sinus node arteritis , av node arteritis , myocardial infarction , and epicarditis . in addition to infections , anca has been reported in heroin users in the absence of hcv or other infections . antithyroid drug - induced anca - positive vasculitis is usually p - anca positive with high titers and skin is involved in nearly two - third of patients . bacterial endocarditis can also be associated with anca antibodies,[79 ] rarely combined c - anca and p - anca positivity . infections have been considered to be one of the potential triggering factors for anca - associated vasculitides . bacterial endocarditis can mimic clinical vasculitis and should be in the differential diagnosis of idiopathic systemic necrotizing vasculitides . both idiopathic and aav associated with infections can not be discriminated by the pattern of renal and skin lesions . however , aav patients more frequently had pulmonary and nervous system manifestations . patients with infections more frequently had dual anca ( high pr3 , low mpo ) , anti - cardio lipid antibodies , anti - beta2-gp i , cryoglobulins , and hypocomplementemia . as seen in our case there can be discrepancy between clinical recovery and the titers of anca . anca levels fall or become negative in 30 - 80% of patients within the first 1 - 3 months of induction treatment in primary aav . in aav , persistence of anca beyond this point is usually associated with ongoing disease activity , but most patients ultimately reach remission and become anca - negative . but little is known about the time to recovery of the anca titers after treatment for infective endocarditis in patients with infective endocarditis - associated anca vasculitis . in our case , the c - anca had normalized with a month after valve replacement , but the p - anca normalized only around 4 months . double - positive anca with low serum complements is seen in sbe - associated vasculitis . there is poor correlation between p - anca titers and recovery from infective endocarditis and infection - associated vasculitis .

the most common pattern of renal involvement in infective endocarditis is infection - associated glomerulonephritis . due to clinical symptoms and signs that overlap with vasculitis , the diagnosis of infective endocarditis may be delayed . the unusual combination of reduced complement with positive antineutrophil cytoplasmic antibody should raise the suspicion of infections such as infective endocarditis .

You are an expert at summarizing long articles. Proceed to summarize the following text: for decades , breast implants have been used to augment or reconstruct the female breasts . three types of implants are available : implants filled with saline , implants filled with silicone gel ( sg ) and silicone oil and implants filled with a mixture of saline and cellulose , called the monobloc hydrogel ( mh ) . the sg implant is used most frequently , whereas the saline implants are hardly used anymore . he was a french plastic surgeon who was also an engineer and he was motivated to create this implant by the patients who had silicone granulomas . the major property of the mh implant is a biodegradable content of 97% saline and 3% cellulose ( carboxymethylcellulose ) . the mh implant comes very close to being a saline implant , and with this , it has in common a chance of spontaneous rupture . , the hydrogel will cause the production of clear serous fluid , without the implant becoming empty . as a result there will be an increase of one cup size within a couple of days and therefore the patient will be alarmed by the implant itself that it has ruptured . the replacement can be planned as an elective procedure under local anaesthesia of the submammary scar within 20 min , because the implant is never adherent to the capsule as is usually the case with a textured sg implant . the latter phenomenon is only seen sporadically in patients who had sg implants before they received the mh implant . the mh implant is reported by patients to take on body temperature easier than alternative implants , and radiologists have less difficulty in examining the mammary gland . it is delivered in many sizes as a round implant with a high profile and has a ce mark . there is a chance of visible rippling when the skin and subcutaneous cover are thin . this can be corrected with lipofilling or the use of a commercial tissue matrix . images of pre - operative ( a ) and post - operative ( b ) chest of a woman who had breast augmentation with the mh implant . images of pre - operative ( c ) and post - operative ( d ) chest of a woman who had a breast reconstruction with the mh implant . because of irradiation on the right side , a muscular cutaneous latissimus dorsi flap was transposed breast augmentation and reconstruction with monobloc hydrogel implants . images of pre - operative ( a ) and post - operative ( b ) chest of a woman who had breast augmentation with the mh implant . images of pre - operative ( c ) and post - operative ( d ) chest of a woman who had a breast reconstruction with the mh implant . because of irradiation on the right side , a muscular cutaneous latissimus dorsi flap was transposed there are two indications for using the mh implant . the first is the choice of women who do not want the sg implant nor an extensive autologous reconstruction , and the second , to have another option for women who have reacted adversely to the sg implant . in summary , the main characteristics of the mh implant are the possession of a ce mark , a biodegradable filling , self - alarm and easy replacement under local anaesthesia in an outpatient procedure in case of a spontaneous rupture , a natural look and feel , and lack of capsular contracture . in this article , the performance of the mh implant is presented separately from that of the sg implants . the mh implant should not be confused with the related poly implant prostheses ( pip ) implant , which has a content of hydroxypropyl cellulose hydrogel . the pip implant was taken from the market by the medical devices agency in the uk because there was one report of a filler leak and the manufacturer 's biological safety assessment of this product was inadequate . the aim of this study was to investigate the behaviour of the mh implant and to investigate whether women with mh implants may incidentally experience similar health complaints as those that are sometimes seen in women with sg implants . women in a general plastic surgery practice who received the mh implant either as the first implant ( c group , n = 42 ) or had a replacement of the sg implant by the mh implant because of health complaints ( b group , n = 35 ) filled out questionnaires with regard to complaints that patients with sg implants in some cases tend to have , such as chronic fatigue , painful joints and muscles , etc . participants could also give their opinion on the aesthetic results . the b group was subdivided in those who had an additional capsulectomy ( b1 group , n = 22 ) and those without capsulectomy ( b2 group , n = 13 ) . the same questions were put forward to the control group ( n = 34 ) , which was recruited from healthy female hospital workers without breast implants . the reader is referred to table 1 for an overview of the general characteristics of the groups . when the results for pre- and post - operative parameters were compared , paired t tests were used to analyse the statistical significance . table 1overview of all participating groupsgroupnumber of patientsmean age ( years)mean duration sg implant ( years)capsulectomymean follow - up ( years)sg implant rupture ( % ) pre - operative complaints ( % ) control3435.0n.a.n.a.n.a.n.a.10 ( 29)b12250.515.5yes312 ( 55)18 ( 82)b21347.510.5no3.55 ( 39)10 ( 77)c4236.00n.a.3n.a.6 ( 14)n.a . not applicablepostoperative follow - up period overview of all participating groups postoperative follow - up period women with mh breast implants ( c group ) , sg implants replaced by mh implants ( b1 and b2 groups ) , and a control group without implants were asked to share their experiences through filling out questionnaires focused on health problems and general aspects related to the breast augmentation or reconstruction . the questionnaires were filled out on average 33.5 years after the operation during which the implant was inserted / replaced . prior to the replacement , women of the b groups had sg implants for an average period of 13 years . the control group had hardly any complaints , nor did the women of the c group . with regard to their pre - operative health complaints , the women of the b group improved on the whole spectrum , which was statistically significant for most complaints . importantly , the improvement appeared to be more pronounced when a capsulectomy was also performed ( fig . 2 ) . in both the b and the c groups , the satisfaction of women with the mh implant was high ( fig . 2complaints reported by patients and controls . the frequency of complaints ( specified below the graphs ) reported by the different patient groups before ( pre - op . ) and after ( post - op . ) mh implant insertion ( c group ) or replacement of their breast implants ( b1 and b2 groups ) , and those reported by the control group without implants is illustrated by the graphs . the results were analysed by paired t tests : ns not significant , * p < 0.05 ; * * p < 0.01 ; * * * p < 0.001fig . 3patients ' opinion on the results of breast augmentation / reconstruction with mh implants . improvements are indicated by the green bars , no change by the yellow bars and a deterioration by the red bars . the parameters evaluated as a result of mh implantation ( c group ) or sg implant replacement with mh implants ( b1 and b2 groups ) are specified below the graph complaints reported by patients and controls . the frequency of complaints ( specified below the graphs ) reported by the different patient groups before ( pre - op . ) and after ( post - op . ) mh implant insertion ( c group ) or replacement of their breast implants ( b1 and b2 groups ) , and those reported by the control group without implants is illustrated by the graphs . the results were analysed by paired t tests : ns not significant , * p < 0.05 ; * * p < 0.01 ; * * * p < 0.001 patients ' opinion on the results of breast augmentation / reconstruction with mh implants . improvements are indicated by the green bars , no change by the yellow bars and a deterioration by the red bars . the parameters evaluated as a result of mh implantation ( c group ) or sg implant replacement with mh implants ( b1 and b2 groups ) are specified below the graph working with the mh implant and keeping an eye on the complaints that over the years have been mentioned by women with the sg implant [ 28 ] , it became obvious that there might be a novel disease that is probably caused by silicone gel bleed [ 915 ] . the major difference between the mh and sg implants is the content of the implant . both have a silicone elastomere shell , which is a solid rubber . since patients who start on the mh implant do not develop the same complaints as some patients with the sg implant , even after a longer follow - up period than was used in this study for the b and the c groups ( unpublished results ) , it can be concluded that the silicone elastomere shell does not seem to play a role in development of complaints . moreover , the replacement of the sg implant by an mh implant resulted in a pronounced reduction of complaints , which suggests a direct connection between the contents of the sg implant and the complaints . this connection is seen in the b group for ruptured as well as intact sg implants ( data not shown ) , indicating that bleeding rather than rupture of the implants is associated with the appearance of complaints . this is also in concurrence with the finding that a capsulectomy ( b1 group ) resulted in a stronger reduction of complaints . the explanation could be that the capsule is the first line of defence of the body against gel bleed [ 11 , 16 ] and will absorb the bleed until it can no longer be contained . if the capsule is left in place during the replacement operation , it will gradually regress , leaving the bled molecules behind [ 2 , 9 , 12 , 14 , 15 ] and loosing the supreme moment to gain clearance of much of the bleed in women with complaints . our data suggest that a simultaneous capsulectomy in patients with complaints is preferred for an optimal reduction of these complaints . however , in certain b group patients , a number of complaints remained , even after capsulectomy . it is possible that in these patients , a certain threshold has been passed and that a chronic disease has been generated that might have been triggered by the exposure to silicones , but is not dependent on this anymore . indeed , symptoms of chronic autoimmune diseases have been frequently reported in patients with sg implants [ 4 , 6 , 8 ] . a larger retrospective study focused on a comparison of the mh and sg implants has been performed and is in preparation . for instance , rippling in case of a thin soft tissue cover can be corrected by lipofilling or insertion of a tissue matrix . surgeons tend to be taken aback by the innocuous clear serous fluid in case of rupture of the mh implant ( fig . 4 ) , but one should keep in mind that rupture of an sg implant goes unnoticed by the patient and will lead to a highly increased exposure to silicones , which may be detrimental to a women 's health . moreover , the insidious gel bleed of an intact sg implant over the years can be catastrophic in some women , who are genetically predisposed to the development of chronic health complaints in relation to the sg implant , even though the pathogenetic mechanism remains elusive . 4replacement of ruptured mh implant . a rupture of the mh implant on the right side caused an enlargement of the breast within a couple of days ( a ) . the scar and capsule are incised under local anaesthesia and the clear serous fluid is drained . a new mh implant is inserted without drains , resulting in a normal breast size immediately after the short procedure ( c ) . directly following this procedure , the treated woman has to wear a supporting and compressive bra for a period of 3 weeks replacement of ruptured mh implant . a rupture of the mh implant on the right side caused an enlargement of the breast within a couple of days ( a ) . the scar and capsule are incised under local anaesthesia and the clear serous fluid is drained . a new mh implant is inserted without drains , resulting in a normal breast size immediately after the short procedure ( c ) . directly following this procedure , the treated woman has to wear a supporting and compressive bra for a period of 3 weeks for women who do not wish to have an sg implant either for augmentation or reconstruction , or who have developed health complaints in relation to sg implants , or those who do not want to have an extensive autologous breast reconstruction with additional scarring , the mh implant appears to be a good option . one should realise though that it has to be replaced now and then because it is not everlasting . but neither is the sg implant . once a woman is informed about the advantages and disadvantages of the mh and sg implants , she can give a truly informed consent about either implant and then she seems to be in favour of the mh implant . our study demonstrates that the vast majority of individuals are satisfied with the mh implant .

this study is focused on the properties of the monobloc hydrogel ( mh ) breast implant , which has been around for more than 30 years , and to see how it behaves with regard to health complaints as sometimes seen in some patients who had received silicone gel ( sg ) breast implants . patients responded to a questionnaire examining their experience with breast implants . three groups were included . first , the control group ( n = 34 ) of women without breast implants . second , a c group of women ( n = 42 ) who began and remained on the mh implant . third , the b group of women who had their silicone gel implant replaced by the mh implant . in the b1 subgroup ( n = 22 ) , a capsulectomy was also performed . in the b2 subgroup ( n = 13 ) , the replacement was carried out without a capsulectomy . the c group behaved very much like the control group . the women of the b group experienced an improvement of their complaints and the improvement was even better after a capsulectomy . the only difference between the mh and sg implants is the content of the implant . the satisfaction of women with mh implants is generally high and not or hardly associated with health complaints . in women with sg implants and health complaints , these complaints can be relieved by replacement of the implants by mh implants .

You are an expert at summarizing long articles. Proceed to summarize the following text: severe acute pancreatitis ( sap ) is associated with a high rate of complications and significant mortality , as high as 8%39% . although the major causes of death are secondary infection of pancreatic necrotic tissue and , subsequently multiple organ failure , peripancreatic arterial pseudoaneurysm ( ap ) is still a rare but life - threatening complication , seen most often in patients with chronic pancreatitis . ap is due to wall erosion of vessels crossing the inflammation area , and its rupture can led to haemorrhagic complications , which require immediate intervention , . ap involves the splenic artery in up to 50% of cases , and usually appears after weeks to months from an episode of acute pancreatitis , , . contrast - enhanced computed tomography ( cect ) is the gold standard to detect such kind of complications , and its use is recommended not only in the initial phase of sap but also and mainly in the late phase . because of the low incidence of ap as acute pancreatitis complication ( 1.3 - 10% ) , the high rate of mortality due to its rupture ( 4090% ) , and the uncommon localization in the pancreaticoduodenal arteries ( 10% ) , the authors decide to report the case of an asymptomatic pseudoaneurysm of the posterior superior pancreaticoduodenal artery and of the right gastric artery , which occurred after 13 days from the episode of acute pancreatitis and then , it was treated with vascular angioembolization . a 71 year - old female came to the emergency room of sant anna university hospital of ferrara ( italy ) , complaining abdominal pain spread to all quadrants , with nausea and vomiting , and anuria from one day . personal history was characterized by obesity ( body mass index of 33.3 kg / cm2 ) , diabetes , arterial hypertension , chronic renal failure , severe osteoporosis , hypothyroidism , previous appendectomy and ovariectomy for a mature cystic ovarian teratoma . no history of alcohol abuse was reported . at admission , the laboratory results ( neutrophilic leukocytosis : 41.51 10 ^ 3/l total white blood cells with 37.07 10 ^ 3/l neutrophil ; amylases : 251 u / l ; c - reactive protein : 34.1 mg / dl ; procalcitonine : 10.93 ng / ml ) and the cect ( fig . 1 ) reveled an acute severe pancreatitis , which involved the whole pancreatic gland and presented peripancreatic , perihepatic and perisplenic free fluid , with a modified ct severity index of 8 ( range 010 ) . moreover , the cect showed cholelithiasis and partial thrombosis of the splenic vein until its confluence with the superior mesenteric vein . so she was admitted to the department of emergency surgery , a medical therapy was established and the patients was strictly observed , without alteration of vital signs . at day five , a control cect showed a stability of the radiological imaging , with a contemporary improvement of laboratory tests and clinical conditions . after 13 days from admission , patient s clinical conditions were improving and she was completely asymptomatic ; by the way , another control cect was planned before transferring the patient to a medical ward . it revealed an organized fluid collection of 11 6.5 cm in the body of the pancreas and the appearance of a 7 mm pseudoaneurysm of the right gastric artery inside the collection ( fig . selective angiography of celiac trunk and of superior mesenteric artery showed a pseudoaneurysm localized not only in a branch of the right gastric artery , but also in a branch of the posterior superior pancreaticoduodenal artery ( fig . the pseudoaneurysms were angioembolized successfully with platinum coils mri - compatible , without any complications ( fig . after ten days from pseudoaneurysms angioembolization , a cect showed the good outcomes of the radiological interventive procedure and an improvement of the pancreatic gland inflammation process with the persistent of the organized fluid collection of 10 6.5 cm in the pancreatic body . the patient was discharged after 30 days of hospital stay , a cect for pseudocysts monitoring was planned after 3 months and it did not present any new pseudoaneurysm formation but , on the other side , it confirmed the presence of the enlarging pancreatic body pseudocysts ( 12 cm ) . at four months follow - up , the patient was in good clinical conditions and the gastroenterology unit charged her for planning an endoscopic ultrasound - guided drainage of pancreatic pseudocysts . a 71 year - old female came to the emergency room of sant anna university hospital of ferrara ( italy ) , complaining abdominal pain spread to all quadrants , with nausea and vomiting , and anuria from one day . personal history was characterized by obesity ( body mass index of 33.3 kg / cm2 ) , diabetes , arterial hypertension , chronic renal failure , severe osteoporosis , hypothyroidism , previous appendectomy and ovariectomy for a mature cystic ovarian teratoma . no history of alcohol abuse was reported . at admission , the laboratory results ( neutrophilic leukocytosis : 41.51 10 ^ 3/l total white blood cells with 37.07 10 ^ 3/l neutrophil ; amylases : 251 u / l ; lipases : 816 u / l ; c - reactive protein : 34.1 mg / dl ; procalcitonine : 10.93 ng / ml ) and the cect ( fig . 1 ) reveled an acute severe pancreatitis , which involved the whole pancreatic gland and presented peripancreatic , perihepatic and perisplenic free fluid , with a modified ct severity index of 8 ( range 010 ) . moreover , the cect showed cholelithiasis and partial thrombosis of the splenic vein until its confluence with the superior mesenteric vein . so she was admitted to the department of emergency surgery , a medical therapy was established and the patients was strictly observed , without alteration of vital signs . at day five , a control cect showed a stability of the radiological imaging , with a contemporary improvement of laboratory tests and clinical conditions . after 13 days from admission , patient s clinical conditions were improving and she was completely asymptomatic ; by the way , another control cect was planned before transferring the patient to a medical ward . it revealed an organized fluid collection of 11 6.5 cm in the body of the pancreas and the appearance of a 7 mm pseudoaneurysm of the right gastric artery inside the collection ( fig . 2 a - b ) . selective angiography of celiac trunk and of superior mesenteric artery showed a pseudoaneurysm localized not only in a branch of the right gastric artery , but also in a branch of the posterior superior pancreaticoduodenal artery ( fig . the pseudoaneurysms were angioembolized successfully with platinum coils mri - compatible , without any complications ( fig . after 6 days from the procedure , the patient was transferred to a medical ward to continue observation and medical therapy . after ten days from pseudoaneurysms angioembolization , a cect showed the good outcomes of the radiological interventive procedure and an improvement of the pancreatic gland inflammation process with the persistent of the organized fluid collection of 10 6.5 cm in the pancreatic body . the patient was discharged after 30 days of hospital stay , a cect for pseudocysts monitoring was planned after 3 months and it did not present any new pseudoaneurysm formation but , on the other side , it confirmed the presence of the enlarging pancreatic body pseudocysts ( 12 cm ) . at four months follow - up , the patient was in good clinical conditions and the gastroenterology unit charged her for planning an endoscopic ultrasound - guided drainage of pancreatic pseudocysts . vascular complications , associated with pancreatitis , include hemorrhage due to vascular erosion , pseudoaneurysm and venous thrombosis . ap is rare but potentially lethal disease and it can appear in different clinical conditions , even though it is mostly associated with pancreatitis and pancreatobiliary surgery . ap usually does not occur immediately after an episode of pancreatitis and typically presents itself with bleeding or abdominal pain . other presenting symptoms might be melena and hypotension due to ongoing bleeding in the gastrointestinal tract , the peritoneum cavity or the retroperitoneum , while on the other hand , ap might be also asymptomatic . in this case , ap was detected after 13 days from acute pancreatitis onset , which was earlier in comparison to literature , where some authors reported pseudoaneurysms occurring 3 to 5 weeks after sap , others from 2 months to 8 years ( mean , 2.3 years ) and , finally , bretagne et al . reported a presentation even from 1 to 9 years after sap ( mean , 4 years ) . moreover , ap was occasionally detected with a control cect and it was completely asymptomatic . regarding this , guidelines did not define a precise timing for repeating cect when monitoring an acute pancreatitis , but it is recommended to perform cect at beginning of the late phase of disease to identify patients at increased risk for an adverse outcome . in fact , cect had nearly 100% of sensitivity in recognizing pseudoaneurysms , even though the tiny one still might only be seen on angiography . in agreement to this , in this case the cect detected only a pseudoaneurysm of a branch of the right gastric artery and the following angiography showed a further pseudoaneurysm of a branch of the posterior superior pancreaticoduodenal artery . angiography had the advantage of permitting to treat the pseudoaneurysm with coil embolization , which is the gold standard management for that kind of vessels disease , in hemodynamically stable patients , . a particularity of this case was the ap localization in right gastric artery and pancreaticoduodenal artery branches : in literature , the most affected vessel is the splenic artery ( up to 50% ) , followed by gastroduodenal artery ( up to 20% ) and , finally , pancreaticoduodenal artery ( up to 10% ) , with minor involvement of superior mesenteric and proper hepatic arteries , . although the early phase of sap is the most critical because of the risk of persistent multi - organ failure onset , the late phase might be marked by life - threatening complications , such as the vascular ones , . therefore , it is important to be aware of pancreatitis - related arterial pseudoaneurysms , as they have a mortality of 90% if not recognized and treated , not only in chronic but also in acute pancreatitis , and to work out a scheduled follow - up with abdominal cect or pancreatic contrast - enhanced ultrasound in order to control and prevent late onset complications . this was an unusual case of arterial pseudoaneurysm complicating acute pancreatitis because it appeared in an early phase , during the acute process , and it had an uncommon arterial localization . data from the present case suggest being aware of sap vascular complications , which might be treated with arterial angioembolization , if promptly recognized . so design the study , lm and da acquire data and draft the article , lc and rs revise it critically for important intellectual content , gv and so final approved version to be submitted . written informed consent was obtained from the patient for publication of this case report and any accompanying images . a copy of the written consent is available for review by the editor - in - chief of this journal . written informed consent was obtained from the patient for publication of this case report and accompanying images . a copy of the written consent is available for review by the editor - in - chief of this journal on request .

highlightspseudoaneurysm of pancreaticoduodenal and gastric artery are rare complications of acute pancreatitis.arterial pseudoaneurysms have 90% of mortality if not recognized and treated during pancreatitis.presented an unusual case of arterial pseudoaneurysm complicating acute pancreatitis because it appeared in an early phase , during the acute process , and it had an uncommon arterial localization.presented an unusual case of arterial pseudoaneurysm complicating acute pancreatitis.it appeared in an early phase , during the acute process , and it had an uncommon arterial localization .

You are an expert at summarizing long articles. Proceed to summarize the following text: at the transfusion departments is necessary to timely provide adequate amounts of blood and blood products for surgeries . for various surgical programs these estimates are provide big savings in levels and supplies , decrease number of additional steps to achieve self - sufficiency in blood and blood derivatives ( 1 - 3 ) . for example , in surgeries such as total gastrectomy , total cystectomy , pulmonary resection , assumed blood loss can be recovered with 4 units of blood after surgery . then , the surgery of the femoral head fractures , partial cystectomy , radical mastectomy , and nephrectomy require the preparation of 2 units of blood after surgery . surgery of aortic aneurysm due to the complexity of the surgical procedure requires a larger amount of blood levels of 10 - 12 doses per surgery ( 3 ) . the potential revision in the number of transfusions for surgeries programs are every day , estimates carried out are largely beneficial , primarily to determine how effectively the blood is used in elective surgery ( 1 - 3 ) . studies are significant for comparisons and use in transfusion practice , identifying predictors of transfusion in hospitals and developing strategies to optimize practice ( 1 - 3 ) . the goals of the study were : a ) to determine the total amount of preoperative requirements ( bt / ab and bt / ab / mt ) for blood and blood products in surgical departments of general hospital prim . abdulah nakas sarajevo in 2014 ; b ) to determine the number of applications for surgical programs by the surgical departments and the type of surgery ; c ) to analyze the number of requests of blood and blood products in relation to the time period , age and patient s gender ; d ) to identify the largest spending of blood products in relation to the type of surgery . abdulah nakas at the department of transfusion medicine as retrospective study during the period from june 1 , 2014 to december 31 , 2014 . this study investigates the supply and demand of blood in surgical departments through two types of requisitions for blood . this retrospective study determined the total number of requests for bt / ab / mt and bt / ab for blood and blood products for surgical departments , then determined their total consumption for different surgical programs within the surgical wards of the general hospital prim . trough descriptive scientific method is collected , processed and analyzed data from conventional samples , then of the final calculation and determination of statistical indicators . with processed and analyzed data is determined the total number of transfusions ( tr ) , in relation to specific surgical disciplines , surgical programs . after that was determined the highest preoperative requirements of individual departments , according to the type of surgery and established their actual consumption . conducted is descriptive statistical analysis of the data in this study , which is composed of the collected data are entered in the microsoft excel 2013 tables from requests ( paperwork ) for transfusion with surgical departments . the data were analyzed , calculated and performed is the statistical analysis using the statistical package ibm spss statistics in 21.0 ( chicago , illinois , usa ) . data are presented in the form of tables , using the classical methods of descriptive statistics , and depending on the nature and scale of measurement data . to test differences were used chi - square test , student s t test and one - way analysis of variance ( anova ) with significance level of 95% or p < 0.05 . in the period from june 1 , 2014 december 31 , 2014 the total of requests by the surgical wards / departments was 927 requests for bt / ab and bt / ab / mt . of that 623 , or 67.2% of requests for bt / ab and 304 or 32.8% of claims for bt / ab / mt . almost the same number of requests with a slightly higher percentage was during december and october and the lowest in june . the average age of patients was 52.220.1 years with the youngest patient aged 9 and the oldest at the age of 97 years . according department s largest number of requests was from gynecology 273 or 29.5% and the lowest with ent 3 or 0.3 . the largest number of requests was for patients in intensive care after surgery hemicolectomy l. dex laparoscopy , 14 requests . on average , after the surgery were used 3.2 units of blood . statistical analysis indicates that there is no significant difference in the average number of used blood units ( p > 0.05 ) . hartman had 11 requests the department of general surgery , most of the blood is used for performing the surgery gastrectomy partialis , 3 doses , followed by the colectomia totalis and anastomosis ileorectalis 2.5 , statistical analysis indicates no significant difference in the average number of used units of blood ( p > 0.05 ) . the largest number of applications was the primary operation installation hip replacement98 , on average , after the operation was spent 1.6 units , then surgery of disc herniation 72 requests , this operation did not use blood . the largest number of units consumed blood was for surgery amputation of the lower leg , three doses in two cases . statistical analysis indicates that there is a significant difference in the average number of consumption to the number of surgeries ( p < 0.05 ) . on average the highest number of blood because of surgery mastectomia totalis and hemicolectomia 5 dose levels , while the largest number of applications was due to surgery resectio prostatae transuretralis 61 . statistical analysis indicates that there is no significant difference in the average number of consumption based on the number of surgical procedures ( p > 0.05 ) . the largest number of requests for blood was for hysteroscopy surgery to remove a myoma according to the number of spent dose / units of blood in surgery curettage . statistical analysis indicates that there is a significant difference in the average number of consumption to the number of surgeries ( p<0.05 ) . with delivery wards on average statistical analysis indicates that there is a significant difference in the average number of consumption to surgery ( p < 0.05 ) . the surgical intensive care : the number of spent units of blood in relation to the number and type of request for surgery . f=1.726 ; p=0.074 general surgery : number of used units of blood in relation to the number and type of request for surgery . f=0.698 ; p=0.812 orthopedics : number of used units of blood in relation to the number and type of request for surgery . f=6.750 ; p=0.0001 urology , number of used units of blood in relation to the number and type of request for surgery . f=1.509 ; p=0.099 gynaecology , number of used units of blood in relation to the number and type of request for surgery . f=1.843 ; p=0.029 delivery department , number of used units of blood in relation to the number and type of request for surgery . sufficient quantities of blood prepared for surgical programs play an important role in the stabilization of the patient and increasing the function of vital organs in the event of blood loss . this study was aimed at assessing the required amount of blood and consumption at certain surgical procedures in the general hospital prim . , the retrospective study found no preoperative requirements for blood and blood products and their actual consumption of various operational programs in certain surgical departments in the period from june 1 , 2014 december 31 , 2014 . during this period since the department of transfusion medicine at this institution uses two types of requisitions for different blood testing , in terms of rationalization of reagents and consumables transfusion materials , it was found that there were 623 requests , or 67.2% for testing bt / mt , while 304 or 32.8% for testing bt / ab / mt . dr . abdulah nakas the hospital that has the surgical of abdominal , urological , orthopedic , ent surgery and gynecology and obstetrics ward . the largest number of requests was from gynecology 273 or 29.5% , followed by obstetrics department with 217 requests , or 23.4% , orthopedics 206 ( 22.2% ) , urology 119 ( 12.8% ) , surgical intensive 57 ( 6.2 % ) , general surgery 52 ( 5.6% ) . in respect of the months in the time the largest number of applications was 166 in december , or 17.9% , and october 153 , or 16.5% , and the lowest number of applications was in the month of june , 109 or 11.8% . in terms of the type of operational requirements the majority of requests were for surgery elective cesarean section 208 ( 22.5% ) at delivery ward , then for surgery or hip replacement in orthopedics with 98 ( 10.6% ) requests and hysteroscopic removal of uterine fibroids with 92 ( 10.0% ) requests . the average age of patients was 52.2 20.1 years with the youngest patient aged 9 and the oldest at the age of 97 years . although the largest number of surgeries was the gynecology and maternity analysis shows total consumption of blood and blood products to surgery statistical analysis indicates that there is a significant difference in the average number of consumption to surgery ( p < 0.05 ) . according to reports in the literature of gynecological bleeding showing that these operational procedures can be successfully controlled without the use of blood , and to women , especially of childbearing age to avoid transfusions due to known risk of transfusion with more possible sensitization to blood antigens ( 4 ) . sensitization to blood antigens , particularly affect the pregnancy with all the other possible early and late risks associated with transfusions . among younger women recommended to resort to mostly other / alternative or surgical methods at stopping bleeding ( 4 , 5 ) . treatment with multiple traumas , surgical patients often requires blood transfusion in very different quantities . however , the precise incidence of blood transfusion in these patients is not known ( 6 ) . it has been reported that 10 - 15% of the concentrated red blood cells used in the treatment of patients with multiple traumas in the united states ( 7 ) . the phrase , massive transfusion defines the application of more than 10 units of concentrated red blood cells , it has an impact on the length of hospitalization as well as the health system of a country in terms of costs , also has an impact on the development of potential complications in about 22% of patients ( 8) . early complications of massive transfusion are leucopenia , hypothermia , acidosis , hyperkalemia , hypocalcemia , immunomodulation and hemodilution / coagulopathy ( 8 - 11 ) . late complications of massive transfusion are : failure of organs and organ systems , especially the cardiovascular , pulmonary , renal , multi - organ failure , possible infection , hepatitis and hiv ( 12 - 17 ) . data on the incidence of these complications are very rare in the literature , to the late twentieth centuries when monitoring shows the survival rate of patients with massive transfusion , which was very low ( 15 ) . analyzing potentially poor outcome of patients with massive transfusion , with increasing costs , the question arises whether there is a limit to the amount of use of blood ( 13 - 18 ) . dr . abdulah nakas in the same time period maximum consumed doses had gynecology at operational program hysterectomy totalis abdominals 15 doses of blood , then orthopedics surgery at primary hip prosthesis 11 , intensive care for 10 operational programs mastectomia radicalis , gastrectomia partialis and unmarked surgery with complications radiation ( gastroenteritis et colitis radiationalis ) . the established processes and control of processes ( management of disorders on transfusion unit as predictor of safety of transfusion treatment ) ,

introduction : transfusion is an activity that assures sufficient supply of blood and blood components to treat the sick and injured . in transfusion departments is necessary to timely provide adequate amounts of blood and blood products for various surgical procedures.material and methods : to determine the total amount of preoperative requirements ( bt / ab and bt / ab / mt ) for blood and blood products in surgical departments of general hospital prim . dr . abdulah nakas in the period from june 1 , 2014 december 31 , 2014 and analyze the requirements for blood in relation to surgical procedures , surgical discipline , period , age and gender of patients . to determine the maximum consumption levels surgeries.results:the total amount of preoperative requirements for blood and blood products in surgical departments amounted to 927 . almost the same number of requests with a slightly higher percentage was in december and october and the lowest in june . the average age of patients was 52.220.1 years with the youngest patient aged 9 and the oldest at the age of 97 years . women were more prevalent with 686 or 74% of the time compared to men . the largest number of requests for surgery elective cesarean section 208 ( 22.5% ) with delivery wards , then for surgery or hip replacement 98 ( 10.6% ) . maximum consumption for surgical operations hysterectomy totalis abdominals 15 doses of blood.conclusion:the largest number of requests were for elective cesarean section 208 ( 22.5% ) with delivery wards , then for surgery or hip replacement with 98 ( 10.6% ) . maximum consumed doses had gynecology surgery at hysterectomy totalis abdominals 15 doses of blood , then orthopedics surgery at primary hip prosthesis 11 doses .

You are an expert at summarizing long articles. Proceed to summarize the following text: the national cancer institute ( nci ) defines a cancer survivor as anyone who has been diagnosed with cancer , regardless of time since diagnosis , treatment status , or overall prognosis . because the overall mortality rates for breast cancer are relatively low while incidence is relatively high , there are estimated to be more than 2,000,000 women in the u.s . who are breast cancer survivors . for these women , breast surveillance following completion of treatment is based on guidelines recommending annual surveillance mammography [ 3 , 4 ] , and on adoption of new technologies such as breast mri . recommendations for annual mammographic surveillance do not stem from clinical trial evidence [ 69 ] , but on evidence from observational studies and consensus panels . consensus opinion holds that women with a personal history of breast cancer may benefit from early detection of subsequent breast cancers . risk of new or recurrent breast cancer is increased among these women compared to women with no history of breast cancer . survivors are at a 2 to 6 times greater risk of a new primary in the contralateral breast . the overall risk of a recurrence or new primary breast cancer is estimated to be 5.46.6/1,000 woman - years . despite recommendations for annual mammography put forth by entities , such as the national comprehensive cancer network , the american cancer society , and the american college of radiology , breast surveillance has been shown to be low among women who are elderly , black , had late - stage disease , had mastectomy or breast conserving surgery ( bcs ) without radiation , did not see a physician , and had more comorbid illnesses [ 1216 ] . also , adherence to surveillance mammography diminishes over time , with one study showing a decline from 80% to 63% over five years for women undergoing annual mammography . guidelines do not provide evidence - based recommendations for how long annual mammography should be continued in women with a personal history of breast cancer a particularly relevant issue for elderly breast cancer survivors whose life expectancies may not yield any potential benefit from early detection of breast cancer . further , there is an absence of evidence or recommendations for surveillance use of other imaging modalities , such as ultrasound or breast mri for surveillance , although reports demonstrate the use of these modalities for surveillance . guidelines from the american cancer society , which are endorsed by the european society of breast imaging and other groups , suggest mri screening for women with a lifetime breast cancer risk 20% and brca gene mutation carriers based on evidence of value in these high - risk groups [ 2024 ] . however , there is specific inclusion of personal history of breast cancer in these mri guidelines . also , without validated risk models for specific factors related to risk of a second breast cancer , it is difficult for physicians to risk - stratify patients for determining surveillance management , such as how frequently to screen over time , which imaging modalities to use , and how long to continue surveillance as women age . there is recognition that surveillance patterns should be tailored to women 's informed decisions based on the evidence that does exist for benefits and harms . still lacking , however , is a comprehensive understanding of how much and what kind of breast surveillance is occurring among women with a personal history of breast cancer . this study provides a more complete characterization of surveillance patterns among women with a personal history of breast cancer than has been reported to date . as in other studies , we examined factors associated with mammography , but have included family history , which has not been previously reported . finally , we included all major breast imaging modalities mammography , ultrasound , and mri , as well as related breast biopsies in our characterization of surveillance patterns . the new hampshire mammography network ( nhmn ) registry has collected mammographic information since 1995 . in 1999 , the nhmn became part of a national breast cancer surveillance program , funded by the national cancer institute ( nci ) , known as the breast cancer surveillance consortium ( bcsc ) . in 2008 , nci worked with center for medicare & medicaid services ( cms ) to link bcsc data to the medicare claims data . the bcsc - medicare linkage provides a unique database that includes claims covering years 19982006 . from the 19982006 bcsc - medicare linked file , the bcsc identified 4,242 nhmn women with breast cancer , their date of diagnosis and type of cancer . using a unique bcsc i d variable , the 4,242 nhmn women and their nhmn data records were linked to the medicare files . the medicare outpatient and carrier files , were used to determine breast events including mammography , ultrasound , magnetic resonance imaging ( mri ) , and biopsy ; comorbidities were calculated using the medicare outpatient , carrier , and the review file ( medpar ) ; the medicare enrollment file , used to determine women 's date of enrollment in medicare ; and nhmn data , used to determine family history of breast cancer and education , were utilized to characterize breast surveillance ( image and biopsy ) in relation to age at diagnosis , cancer type and stage , primary therapy , family history of breast cancer , comorbidities , and education . using the medicare enrollment file for the 4,242 women with a breast cancer , we selected 3,899 women who had aged in , that is , turned 65 sometime during 19982006 . to ensure a woman had at least 18 months of follow - up and 6 months of medicare data after a cancer diagnosis , she had to be eligible for medicare 6 months before her date of diagnosis and her cancer diagnosed in the time period between june 1 , 1998 and january 1 , 2005 ; thereby , we removed 1,869 women who did not meet these conditions . woman younger than 64 years at time of diagnosis ( n = 484 ) and those with a bilateral mastectomy ( n = 15 ) were removed . since imaging in more advanced stages may represent continued management of metastatic disease , women with stage iv ( n = 196 ) were removed . women without at least one primary or specialist visit during an 18 month surveillance window were removed ( n = 60 ) , resulting in a total of 1,275 women eligible for this analysis . we defined surveillance broadly as breast imaging occurring at least 6 months after a woman 's breast cancer diagnosis . we included breast biopsies in order to characterize the totality of breast care women receive following primary treatment of breast cancer . the surveillance window began 6 months after a breast cancer diagnosis and continued through the end of the study period , with discrete surveillance windows categorized in increments of 18 months . figure 1 shows the specific inclusion criteria for each of the 18 month surveillance windows . deceased women or women who were lost to follow up during each 18 month window were excluded . women were only represented in a given window if they completed the time period . since medicare does not receive billing claims for physician services from either hmo plans or missing part b , women participating in hmo plans or who were not continuously enrolled in medicare dual parts a and b throughout a particular window were removed . of the 1,219 women , 895 women were followed for 42 months , 619 women were observed for 60 months and 363 had 78 months of continued surveillance ( figure 1 derivation of study population and surveillance windows ) . the primary endpoints were the occurrence of any breast imaging event of a mammogram , ultrasound , mri , and related breast biopsies . current procedural terminology codes ( cpt ) , healthcare common procedure coding system ( hcpcs ) , and international classification of disease , 9th edition codes ( icd-9 ) were used to identify mammograms ( diagnostic , screening , any mammography ) , other breast imaging ( ultrasound and mri ) , and breast biopsies from outpatient and carrier medicare files . indicator variables were created for any mammogram , ultrasound or mri breast event , or breast biopsy during each surveillance window . the sum of all breast events was calculated for each woman during each 18 month window . the date of diagnosis , type , and stage of breast cancer were provided in the bcsc - medicare linked file . age at diagnosis was calculated from date of diagnosis and the birthdate indicated in the medicare file . family history of breast cancer ( indicated by first degree relatives of mother , daughter , or sister ) and education were provided in the nhmn data . primary therapies of mastectomy , breast conserving surgery ( bcs ) with radiation , bcs without radiation , and unknown / other occurring within the first six months after diagnosis were calculated using breast procedure codes in the outpatient and or carrier files . a hierarchical assignment was used to designate primary therapies if more than one therapy was used during the six months . if a primary therapy was used that did not fall into the three categories of mastectomy , bcs with radiation , or bcs without radiation , an unknown or other category was appointed . a modified charlson comorbidity index algorithm reflecting the deyo and romano adaptations for classifying prognostic comorbidities with respect to breast cancer was used . the code uses diagnostic and surgery codes found in medicare 's outpatient , carrier , and medpar files . we defined the number of primary care or specialty visits and the proportion of specialty care visits a woman had during a surveillance window using the healthcare financing administrative provider specialty codes ( hcfaspec ) from the carrier file . for each surveillance window , utilization rates for each breast imaging ( mammogram and combined ultrasound and mri ) , biopsy , and breast events by the patient characteristics of age at diagnosis , stage of diagnosis , primary therapy , family history of breast cancer , comorbidities , and education were calculated . additionally , overall utilization rates were computed for breast imaging , biopsy , and breast events per surveillance window . our data is unbalanced ; that is , not all of the women were in all 4 surveillance windows . in order to characterize the population - average or the mean response of breast events over all the windows by the women 's characteristics , accounting for both repeated measures and correlated observations , we used generalized estimating equations ( gee ) to estimate the incidence rate ratios for each of the outcomes . poisson models with a log link were implemented for both count data and binary outcomes . risk ratios are more meaningful than odds ratios when the outcome is common , such is the case in our study for mammograms . gees were chosen to correct the standard errors ( se ) by using robust ses in the poisson models for binary outcomes . we assumed a separate correlation for each pair of time points and therefore assigned an unstructured correlation matrix . models were adjusted for all patient characteristics , including but not reported , the number of primary or specialty visits , proportion of specialty care visits , and diagnosis year . of the 1,219 women , most ( 59.3% ) were less than 75 years of age , had stage i disease ( 55.4% ) , were treated with mastectomy ( 68.3% ) , had no family history of breast cancer ( 71.8% ) , and no comorbidities ( 65.7% ) ( table 1 ) . except for biopsy rates , the proportion of overall women with surveillance declined over the follow - up time for imaging the proportion of women receiving mammography by 24 months was 89.3% , and decreased to 81.5% by 78 months of follow - up ( table 2 ) . for ultrasound and mri , the rate of use during the first surveillance window was 8.0% , but was 4.7% by the last window ( table 3 ) . biopsy was comparable across windows ( range : 7.4%9.4% , table 4 ) . examining mammography surveillance patterns by age showed a greater decline over time with each successively older age group ( table 2 ) . age group had an 11.1% rate of advanced imaging from 6 to 24 months from diagnosis and 4.7% from 60 to78 months . of women ages 7579 and 80 + , 6.2% and 5.4%,respectively , had us and/or mri in the first surveillance window . by the last surveillance window , biopsy use across all windows was somewhat high for 6574 year olds ( table 3 ) . even in the 6078 month window , biopsy rates were 10.3% for 6569 yrs . and 13.8% for 7074 yrs . in the first surveillance window , the unadjusted rates of mammography by stage at diagnosis were higher for dcis ( 91.0% ) and stage i ( 91.3% ) than for stages iia ( 85.7% ) , iib ( 78.5% ) , and iii ( 81.1% ) ( table 2 ) . higher stage demonstrated generally higher rates of biopsy , but no declines over time were noted ( table 4 ) . surveillance in relation to primary therapy types , showed crude rates of mammography ( table 2 ) and biopsy ( table 4 ) highest across all follow - up windows for women with bcs + radiation . in contrast , women with bcs alone showed higher rates of advanced imaging ( table 3 ) . there were no clear trends in surveillance imaging or biopsy when examined crudely in relation to family history of breast cancer , comorbidities , and education . in multivariable poisson gee models , we found increasing age to significantly lower the incidence of mammography , biopsy , and total breast events , particularly for the 80 + age group ( table 5 ) . in general , higher stage at diagnosis was associated with lower incidence of surveillance . for example , the incidence rate ratio for total number of breast events for women with stage iia compared to stage 1 was 0.85 ; 95% ci 0.790.92 ; for stage iib versus i , 0.81 ; 95% ci 0.710.94 , and for stage iii versus i , 0.65 ; 95% ci 0.520.81 . women with bcs + radiation were more likely to have mammography compared to women with unilateral mastectomy ( irr = 1.09 ; 95% ci 1.061.12 , mastectomy referent ) . for us and/or mri , women with bcs alone were more likely to receive this advanced imaging surveillance ( irr = 1.68 ; 95% ci 1.062.66 , mastectomy referent ) . for total breast events , bcs radiation was significantly associated with an increased incidence compared to unilateral mastectomy ( table 5 ) . in our multivariable models , no significant associations were seen with the breast imaging surveillance measures and family history of breast cancer , comorbidity status , or education . using a state - based mammography registry linked to medicare claims , we elucidated patterns of breast surveillance extending to at least 6.5 years following completion of primary treatment among women with breast cancer . a high proportion of women underwent surveillance mammography , although this proportion declined steadily over time . when adjusting for time since diagnosis , and important covariates , age but not comorbidity primary therapy seemed to influence use of breast imaging ; compared to mastectomy , bcs plus radiation was significantly associated with greater use of mammography , and bcs alone with advanced imaging modalities . stage at diagnosis was also significant in surveillance patterns , with higher invasive stages less likely to receive surveillance than stage i. the intensity of surveillance , as measured by number of breast events , seems to decrease with age and stage at diagnosis , and increase for women who had bcs ( with or without radiation ) compared to unilateral mastectomy . this study supports the findings of previous work showing a decline in surveillance mammography over time [ 1216 ] , but additionally demonstrates this effect over a longer time period than previously reported . our findings suggest that the decline in mammography over time is more notable among the older medicare population , which may reflect a decreasing likelihood of benefit from surveillance mammography as women age , since early detection of breast cancer is less likely to reduce mortality among those with diminished life expectancy . we also show a similar overall trend of decline for ultrasound and mri , although without the same apparent effect of age . in fact , us and mri occur at almost twice the rate for younger medicare beneficiaries than older women early in the surveillance period , but was the same later . one possible interpretation of this result is that imaging tests may be more discretionary , but once an abnormal imaging test occurs , biopsy is the definitive test to diagnose a lesion . in examining factors associated with breast surveillance while adjusting for other variables , we are among the first to report on total number of imaging and/or biopsy events , which help to characterize intensity of breast care from the women 's perspective . this measure helps our understanding of how the experience of surveillance may differ from screening in an older population . the number of breast events is lower for women over age 75 compared to whether this result is due to weighing of competing risks , use of general screening guidelines , or other reasons is unknown . the lower number of breast events as stage at diagnosis increases is difficult to interpret , but may represent bias in that women with early stage breast cancer may be a population more likely to be screened or to have benefited from screen detection , and therefore also more likely to undergo surveillance . in contrast women with later stage disease either may not have benefited from screening , that is , experienced false negative mammography , or be more likely to have their index cancer come to light clinically . similarly unclear are the reasons for higher breast events among women with breast conserving surgery ( bcs ) ( with or without radiation ) compared to women with mastectomy . this finding may also reflect selection bias , as the need for less intensive surveillance maybe a reason for selecting mastectomy from the outset . increased surveillance in women with bcs ( with or without radiation ) may be due to a perception that having more remaining breast tissue suggests a greater need for imaging or be due to a perception of insufficient treatment in women undergoing bcs only . because there was no association between biopsy and primary therapy , the relation between number of breast events ( biopsy plus imaging ) and primary therapy is attributable only to imaging . other studies have also reported a higher likelihood of mammography among women with bcs plus radiation , but not among those without radiation [ 1216 ] . these studies have suggested possible reasons , such as access issues , socioeconomic factors , or communication deficits . interestingly , our findings for us and/or mri show significant increase for women with bcs alone ( no radiation ) compared to mastectomy , but no similar increase for women with bsc with radiation . this may reflect a bias that women selecting bcs only are concerned about radiation exposure . nevertheless , although women with bcs without radiation may possibly be receiving less mammography than is recommended , they are receiving more advanced imaging than women with other primary treatments , and thereby may be undergoing surveillance . in prior studies of surveillance mammography , although family history of breast cancer is an important factor in breast cancer risk models , there are currently no accepted , validated risk models for subsequent breast tumor events ( recurrence or new primary ) among women with a personal history of breast cancer . thus , without knowing the role family history plays in risk for these women , it is difficulty to weigh the importance of family history in breast surveillance decisions . nevertheless , it is possible that women and/or providers perceive an increased risk and potential increased benefit from breast surveillance , and therefore use it more . however , our null finding in the association between family history and breast surveillance use suggests that this factor is not significant to women and/or providers in surveillance decisions . unlike in some studies [ 1214 ] , we did not see any significant associations of breast surveillance imaging or biopsy with comorbidity status . our comorbidity measure was based prior to breast cancer diagnosis , while others included a period after diagnosis . further , we used an absolute count of comorbidities , rather than quantiles based on our study population . one would expect to see a decrease in breast imaging surveillance among medicare - aged women with high - comorbidity burdens , since the likelihood of benefit from early detection is low . it is possible that the observed decrease in surveillance with age partly reflects increasing comorbidities occurring with advancing age that has not been captured by our methodology . this study is the first , to our knowledge , to report on breast surveillance use beyond just mammography . although inclusion of us , mri , and biopsy is a strength of this study , we acknowledge the limitation of using medicare claims data to ascertain breast - related utilization in the surveillance periods . medicare claims for mammography ascertainment have been shown to be quite accurate , although no such validations have been made for the other breast modalities examined . another limitation of using claims to identify imaging events is the lack of information regarding indication for exam , exam interpretation , and patient preferences . our results , like those of other similar studies , characterize use of breast surveillance , but are not able to directly measure appropriate patterns of utilization . that is because , although guidelines exist for annual surveillance mammography , they are not based directly on performance / outcome data . at least one , but very few studies have examined the performance of annual mammography among breast cancer survivors , particularly in terms of false positives , recall rate , biopsy rate , and biopsy yield . further , no empirical evidence currently informs how competing risks , such as comorbidities and influence surveillance guidelines for upper - ages . there is a similar lack of evidence for the efficacy and effectiveness of other imaging modalities and of other intervals , although the need for tailored surveillance approaches based on informed decision making , is documented . optimal regimens for surveillance breast imaging intervals , modalities , and targeted populations of breast cancer survivors are not known , but have tremendous population - wide implications for health , health care utilization , cost , and mortality .

background . patterns of surveillance among breast cancer survivors are not well characterized and lack evidence - based practice guidelines , particularly for imaging modalities other than mammography . we characterized breast imaging and related biopsy longitudinally among breast cancer survivors in relation to women 's characteristics . methods . using data from a state - wide ( new hampshire ) breast cancer screening registry linked to medicare claims , we examined use of mammography , ultrasound ( us ) , magnetic resonance imaging ( mri ) , and biopsy among breast cancer survivors . we used generalized estimating equations ( gee ) to model associations of breast surveillance with women 's characteristics . results . the proportion of women with mammography was high over the follow - up period ( 81.5% at 78 months ) , but use of us or mri was much lower ( 8.0%first follow - up window , 4.7% by 78 months ) . biopsy use was consistent throughout surveillance periods ( 7.4%9.4% ) . surveillance was lower among older women and for those with a higher stage of diagnosis . primary therapy was significantly associated with greater likelihood of breast surveillance . conclusions . breast cancer surveillance patterns for mammography , us , mri , and related biopsy seem to be associated with age , stage , and treatment , but need a larger evidence - base for clinical recommendations .

You are an expert at summarizing long articles. Proceed to summarize the following text: a 12-month - old boy was admitted to the hospital because of recurrent pulmonary infection and combined severe respiratory distress . the patient had already been diagnosed with congenital pulmonary agenesis on the right side based on pre - natal ultrasonography and a postnatal computed tomography ( ct ) scan . after admission , a follow - up ct scan and bronchoscopy were performed to evaluate the condition of the lung and trachea and their relationship with surrounding structures . bronchoscopy found tracheal narrowing at the level of the aortic arch , and chest ct confirmed that the trachea was compressed between the aortic arch and the spine . the cause of tracheal stenosis was mediastinal deviation that developed due to congenital lung agenesis ( fig . the operation was performed under general anesthesia , with the patient in the left lateral decubitus position . posterolateral thoracotomy was performed at the level of the sixth intercostal space ( ics ) , and an additional mini - thoracotomy incision was made at the level of the ninth ics to facilitate identification of the margin of the diaphragm . we approached the thorax through the extrapleural space . upon evaluation of the pleural space , the parietal pleura and mediastinal pleura were found to be intact , although no structure was associated with the lung and bronchus in the pleural space . the diaphragm was detached along the costal margin , from the sternum to the spine . the peritoneum was preserved in the costal area ; however , around the tendinous portion of the diaphragm , the peritoneum needed to be dissected for sufficient mobilization of the diaphragm . several interrupted prolene sutures reinforced with pledgets were applied to anchor the harvested diaphragm to the chest wall . the diaphragm was fixed at the level of the third rib laterally , at the level of the fourth rib anteriorly , and to the adjacent ribs posteriorly to achieve tension - free attachment of the diaphragm ( fig . finally , two separate soft drains were inserted into the pleural cavity and peritoneal cavity . the patient was transferred to an intensive care unit ( icu ) with mechanical ventilation because he had suffered severe preoperative respiratory distress due to a large volume of secretions . the following day , the patient was extubated and the drains were removed at postoperative day 12 . the postoperative course was favorable ; however , bronchitis developed and the patient suffered from a large amount of sputum and mild dyspnea . the patient received conservative care at the icu and was transferred to a general ward at postoperative day 7 . a follow - up ct scan performed on postoperative day 14 revealed improved mediastinal and tracheal deviation . furthermore , because of the rearrangement of the mediastinal structure , tracheal narrowing seemed to have improved . the patient underwent follow - up at the out - patient department until 1 year after surgery . a follow - up ct scan and bronchoscopy revealed improvement of the tracheal narrowing ( fig . congenital lung agenesis is defined as the absence of the lung and pulmonary vasculature on the affected side with preservation of the carina and main - stem bronchus . in this condition , mediastinal deviation can progress to the diseased side , which can cause kinking of the great vessels and trachea . furthermore , as mediastinal deviation develops , air trapping in the contralateral lung and severe respiratory distress can occur due to the tracheal abnormality . moreover , recurrent infections such as pneumonia or bronchitis may cause retention of bronchial secretions , and as a result , respiratory distress worsens and may lead to mortality . numerous medical treatments for repeated respiratory infections and distress have been applied , such as ventilator management , extracorporeal membrane oxygenation , and appropriate antibiotic management , all of which control respiratory infection . in 1995 , becmeur et al . attempted to reduce mediastinal deviation surgically for the first time . an inflatable prosthesis was inserted into the diseased pleural cavity . however , the patient suffered severe scoliosis until the prosthesis was removed . another surgical attempt was made to reduce secondary problems arising from mediastinal shifting , such as extrinsic tracheal compression or kinking . performed aortopexy and its result was favorable . however , in patients with this condition , such as those with pulmonary agenesis , pulmonary aplasia , or postpneumonectomy syndrome , the left main bronchus is compressed between the right main pulmonary artery , vertebral column , and aorta . aortopexy only relieves compression by the aorta and can not change the underlying condition of mediastinal shifting ; therefore , relapse is a considerable problem as patients mature . moreover , hyperinflation , which is a result of mediastinal deviation and air trapping distal to the compressed bronchus that can not be repaired by aortopexy , is another problem that compromises functional status . diaphragm translocation was first attempted by krivchenya et al . in 1995 , and the results of this operation were published in 2000 . the diaphragm was translocated in the cephalad direction to reduce the empty hemithorax cavity , and the result seemed favorable . we also considered aortopexy and prosthesis implantation ; however , we decided to perform diaphragm translocation because the patient was only 1 year old , and the growth potential of the patient might be an important factor in ensuring good long - term results . the outcome appeared to be satisfactory as of the last follow - up . to our knowledge , this is the first case of diaphragm translocation in korea . in conclusion , we report a case of pulmonary agenesis , which was successfully treated by diaphragm translocation . to further verify the feasibility and reproducibility of diaphragm translocation , reports of a larger number of patients with long - term follow - up will be required .

a 12-month - old boy was diagnosed with agenesis of the right lung . mediastinal deviation progressed to the diseased side as the patient matured ; therefore , tracheal distortion developed . as a result , tracheal compression developed between the vertebral body and aorta . the patient was repeatedly admitted to the hospital because of recurrent pulmonary infection and combined severe respiratory distress . diaphragm translocation was performed to treat the patient . the postoperative course was favorable , and computed tomography scan findings and symptoms had improved at 1 year after surgery .

You are an expert at summarizing long articles. Proceed to summarize the following text: the majority of cases of obsessive compulsive disorder ( ocd ) begin in childhood and adolescence ; but in clinical practice , early onset ocd with slowness is rarely encountered . the obsessive slowness ( os ) was first described by rachman ( 1974 ) who documented ten cases of primary obsessive slowness . the literature on obsessive slowness is limited and primarily deals with the diagnostic criteria , neurobiology , along with some highlights on the management . we report a case of early onset ocd with obsessive slowness , which was satisfactorily treated with combined pharmacotherapy and behavioral therapy . m , a 15-year - old boy from middle socioeconomic status , hindu , nuclear family , student of eighth class , without any past medical and psychiatric illness , with anankastic traits in parents as rigidity and stubbornness , and with slow to warm premorbid temperament ; presented with 3 year history of insidious onset and progressively deteriorating course of symptoms characterized by repeated doubts ( regarding locking and unlocking the door knobs , turning switches on and off ) , repeated fears ( something bad would happen with him if somebody would touch him while performing almost all routine activities ) , magical thinking ( roof falling on him if he would not stand properly from toilet seat ) , mental compulsion ( counting ) with progressive slowness in self - care behavior ( brushing , bathing , changing clothes , walking , and eating ) , and avoidance of routine activities with academic decline . for 6 months prior to reporting to a tertiary level referral hospital in india , the patient started having anxious and low mood , loss of interest in all pleasurable activities , and stopped going to the school . he would remain confined to bed , would not speak and communicate mostly by gestures . he would spend 2 - 3 h in finishing his one meal , and similar time in bathing , changing clothes , etc . , the mental status examination revealed obsessive slowness , obsessive doubts and fears , magical thinking , yielding , and mental compulsions . yale - brown obsessive compulsive scale ( ybocs ) score was 40 at the time of initial assessment . he was diagnosed as a case of ocd with slowness following international classification of diseases and related health problems ( icd-10 ) . after detailed behavior analysis , it was found that he had slowness and repetition in all routine activities with score of 9 - 10 for distress on a scale of 1 - 10 . he would remain in bed throughout the day and would do all routine activities only on being coaxed by parents . prompting , pacing , and shaping of routine activities were carried out daily . also , fluoxetine was slowly titrated to 60 mg / day and was well tolerated by him . initially , it was difficult to get him involved in the treatment as he would take several minutes while coming to interview room , starting conversation , and following instructions . it was decided to make individual sessions longer because the slowness and resistance made it difficult to achieve the individual session goals . the duration of sessions was increased to 90 - 120 min instead of usual 45 - 50 min . also , psychoeducation for the family members was started . initially , the parents had difficulty in accepting the fact that their son 's problems were because of a psychiatric illness as they believed that m 's problems were due to maladaptive behavior and he did it on purpose to annoy them . however , later on with psychoeducation , his mother understood the nature of his illness . she agreed to be cotherapist and her increased involvement and dedication made the therapy more intense and helped the team to achieve more and more cooperation from the patient . the two major hurdles in managing the case were difficulty in establishing rapport with the patient and retaining him in the therapy . after beginning of the combined therapy , he started showing improvement in almost all the problem areas ( as tabulated below ) and after 3 months , ybocs score reduced to 25 with improvement in the time spent in getting out of bed , brushing , going to toilet , answering to questions , changing clothes , and eating . post discharge from the hospital , he came regularly for follow - ups and his mother continued to be a cotherapist and would practice therapy at home . in our case , ocd had started at the age of 12 years with obsessive doubts and fears , magical thinking , mental compulsions , and slowness in self - care behavior . slowness in his behaviors like brushing , getting up from bed , urinating and defecating , and responding to questions was not preceded by obsessive ideas , doubts or fears , or mental compulsions and was not accompanied by anxiety . the features like prominent slowness in self - care behavior , absence of an increase in anxiety , or discomfort either before or following the behavior corresponds to description of primary obsessive slowness by rachman ( 1974 ) . however , some researchers ( veale , 1993 ) have suggested that the slowness is secondary to the recognized phenomena of ocd or anakastic personality disorder . our patient responded to combined therapy of fluoxetine along with behavioral therapy in the form of prompting , pacing , shaping for symptoms related to slowness , and exposure - response prevention directed for the repetitive behavior he improved considerably . in most of the interventional studies available for obsessive slowness , the interventions sped up specific target behaviors without affecting other areas of ocd . in a case series of 11 down 's syndrome patients with obsessive slowness by charlot et al . , ( 2002 ) , good response to behavioral pacing and shaping was demonstrated . however , replicable details of the treatment were not provided by the authors . in our case , there was considerable improvement after 12 weeks of intervention ; most of the studies reported that effect occurs over 6 - 16 weeks . his case demonstrates a successful treatment of ocd with obsessive slowness and the challenges met during the course of treatment .

obsessive slowness is a rare entity and is conceptualized either as primary psychiatric illness or as part of obsessive compulsive disorder ( ocd ) . often its outcome is frustrating even with treatment . we report a case of early onset severe ocd with obsessive slowness which showed good response to combined pharmacotherapy and behavioral therapy .

You are an expert at summarizing long articles. Proceed to summarize the following text: leber s hereditary optic neuropathy ( lhon ) is a maternally inherited mitochondrial disorder with bilateral loss of central vision predominantly in young males.1 clinically , lhon is characterized by unilateral acute loss of central vision followed by the same event in the fellow eye within a few weeks to months , with disk hyperemia in the acute phase.2 in ~25% of cases , visual loss may be bilateral at onset . lhon is mainly due to three so - called primary lhon mitochondrial dna ( mtdna ) mutations m.11778g > a , m.3460g > a , and m.14484t > c , localized in the coding regions for nd4 , nd1 , and nd6 of complex i of the respiratory chain , respectively.1 other mtdna mutations ( eg , m.3434t > c , m.3483g > a , m.3635g > a , m.3866t > c , m.9011t > c , m.11253t > c , m.11696g > a , m.13042g > a ) have also been reported to cause lhon.36 there is increasing evidence that lhon is not a mono - organ disorder but rather a multiorgan disease with predominant manifestations in the eyes . this review is aimed at summarizing and discussing recent findings concerning the multisystem nature of lhon . data for this review were identified by searching medline , current contents , embase , web of science , web of knowledge , lilacs , scopus , and google scholar for references of relevant articles using the search terms central nervous system , peripheral nervous system , endocrine , cardiac , gastro - intestinal , kidney , and renal , in combination with randomized ( blinded or open - label ) clinical trials , longitudinal studies , case series , and case reports were considered . abstracts and reports from meetings were not included . only articles in english , french , spanish , japanese , or german that were published between 1966 and 2015 were included . relevant papers were studied and discussed for their usefulness to be incorporated in this review . the ophthalmologic compromise in lhon may be associated with central nervous system ( cns ) disease,7 otologic disease,8 endocrinologic disease,9 cardiac disease,10,11 bone marrow abnormalities,12 vascular disease,13 kidney disease,14 or peripheral nervous system ( pns ) disease.15 cns disease in lhon includes myoclonic epilepsy,7,16 temporal lobe epilepsy,17 leukoencephalopathy mimicking multiple sclerosis,18 psychomotor regression,1 posterior reversible encephalopathy syndrome,19 migraine with or without aura,16,20 chorea,21 cerebellar ataxia,22 or dementia.21 otologic disease in lhon includes hypoacusis or hearing loss.8,23 endocrine involvement in lhon may manifest as diabetes,9 pituitary adenoma,24 hashimoto hypothyroidism,18 or hyperthyroidism.25 cardiac involvement in lhon can manifest as left ventricular hypertrabeculation / non - compaction , an unclassified cardiomyopathy characterized by a bilayered structure of the left ventricular myocardium with a spongy inner layer and a compacted outer layer,10 dilated cardiomyopathy,11 arrhythmias,2628 syncope,29 palpitations,29 angina,29 exertional dyspnea,29 or sudden cardiac death.30 vascular involvement in lhon can manifest as aortic stiffness13 and bone marrow abnormalities as anemia.12 affection of the pns in lhon can manifest as myopathy , muscle cramps,16 or demyelinating polyneuropathy.15 involvement of the kidneys has been only rarely reported and can manifest as chronic renal failure.14 a few patients with lhon and neuromyelitis optica and lhon and fibrous dysplasia of the bones have been reported . some tissues may be subclinically affected , such as fibroblasts31 or the muscle.1 the non - ophthalmologic manifestations in lhon may manifest before or after the occurrence of optic atrophy . some patients with lhon have been reported in whom in addition to optic atrophy , other ocular manifestations were present , such as increased ocular pressure,32 retinopathy , and cataract.5 lhon was first described by von graefe33 in 1848 and later by leber34 in 1871 . already leber himself reported that some of his lhon patients presented with headache , vertigo , epilepsy , mental impairment , nystagmus , tremor , areflexia , loss of sphincter control , pyramidal tract disease , ataxia , or sensory disturbances.35 further evidence was provided later for the fact that lhon is not exclusively an ophthalmologic disorder but rather a multisystem disease with predominant affection of the eyes ( mitochondrial multiorgan disorder syndrome).36,37 there are also indications that primary lhon mutations may not manifest phenotypically with ophthalmologic disease but with dominant organ involvement other than the eyes.30,38,39 patients carrying lhon mutations but without optic neuropathy may present with arterial hypertension,30 different neurodegenerative disease,38 or leigh syndrome.39 though it is evident that multisystem involvement can occur in lhon , most of the abnormalities were reported in case reports only . first , most patients with lhon reported in the literature were not systematically and prospectively investigated for involvement of other organs . second , affection of organs other than the eyes is often subclinical and can be confirmed only by histological investigations . third , multisystem involvement in lhon is often age - dependent , and hence these patients require regular follow - up investigations not to miss the point at which organs other than the eyes become clinically affected . fourth , affection of organs other than the eyes is not regarded as part of the lhon phenotype . this can be due to unawareness of the nature of the disease , due to mis - presentation of lhon as a mono - organ problem in the literature , or due to attribution of non - ocular manifestations to causes other than the lhon mutations . the degree of multisystem involvement appears to depend on various factors such as the patient s age and the type of the underlying lhon mutation . additionally , there seem to be ethnic differences concerning the variability of the phenotype,40 since in thai lhon patients , the male / female ratio is lower and the prevalence of some lhon mutations is higher than that in other ethnic groups.40 additionally , the prevalence of primary lhon mutations is particularly low in northern finland.41 it is also conceivable that secondary lhon mutations may determine or modify the phenotype . though primary lhon mutations are regarded as homoplasmic , there are several indications that they are heteroplasmic in organs other than the eyes . furthermore , heteroplasmy rates of primary lhon mutations are not 100% in all patients.42,43 for clinical manifestations of lhon , however , a heteroplasmy rate of at least 60% is required . the lower the heteroplasmy rate , the higher the chance for spontaneous recovery of the ophthalmologic compromise.44 the lower the heteroplasmy rate in carriers of the disease , the more likely the carrier remains unaffected.45 a further factor influencing the lhon phenotype is penetrance of the mutations . penetrance can vary markedly in different branches of the same family and between families harboring the same lhon - causing mtdna pathogenic variants . several modulators of lhon penetrance have been discussed , such as the mtdna background haplotypes , ill - defined nuclear dna background modifiers , environmental factors , such as tobacco smoking and alcohol , and epigenetic factors , such as estrogen hormones . whether all patients with multisystem disease but without an ocular problem should be investigated for primary lhon mutations remains questionable . this review shows that lhon can be a multiorgan disorder , that involvement of organs other than the eye may be subclinical possibly depending on the heteroplasmy rates of the responsible primary lhon mutation or other modulators , that primary lhon mutations may rarely manifest without ocular compromise , and that lhon patients need to be closely followed up to detect at which point organs other than the eyes become affected .

leber s hereditary optic neuropathy ( lhon ) is a maternally inherited mitochondrial disorder with bilateral loss of central vision primarily due to mitochondrial dna ( mtdna ) mutations in subunits of complex i in the respiratory chain ( primary lhon mutations ) , while other mtdna mutations can also be causative . since the first description , it is known that lhon is not restricted to the eyes but is a multisystem disorder additionally involving the central nervous system , ears , endocrinological organs , heart , bone marrow , arteries , kidneys , or the peripheral nervous system . multisystem involvement may start before or after the onset of visual impairment . involvement of organs other than the eyes may be subclinical depending on age , ethnicity , and possibly the heteroplasmy rate of the responsible primary lhon mutation . primary lhon mutations may rarely manifest without ocular compromise but with arterial hypertension , various neurodegenerative diseases , or leigh syndrome . patients with lhon need to be closely followed up to detect at which point organs other than the eyes become affected . multiorgan disease in lhon often responds more favorably to symptomatic treatment than the ocular compromise .

You are an expert at summarizing long articles. Proceed to summarize the following text: posterior urethral valves ( puv ) are the commonest cause of lower urinary tract obstruction in male infants [ 13 ] . the incidence of this congenital anomaly in our setting is unknown , although reports from unites states and europe indicates that it occurs in about 1 : 8000 and 1 : 25,000 male live births [ 1 , 3 , 4 ] . prolonged and unrelieved lower urinary tract obstruction leads to back pressure effects on the kidneys resulting in obstructive uropathy with renal impairment . puvs are also a common cause of chronic renal failure in children if treatment is delayed [ 68 ] . late presentation in patients with puv is associated with urosepsis , uremia , and anemia and these form the bulk of patients seen in our centre . early diagnosis and prompt commencement of treatment is therefore germane to the overall outcome of these patients [ 9 , 10 ] . this is particularly important in a resource limited environment like ours where facilities for renal replacement therapy in children is not readily available . the aim of this study is to document the pattern of presentation in our centre and outcome of management . . records of patients with puv at the university of nigeria teaching hospital ( 19972004 ) and enugu state university of technology teaching hospital , both in enugu from [ 2005 to 2009 ] were reviewed . inclusion criteria were all patients who had radiological diagnosis of puv with voiding cystourethrogram and renal ultrasound . late presentation is defined in this study as patients presenting to our centre four or more weeks after the onset of symptoms . data such as age at presentation , symptoms and duration of symptoms , complications , investigation , and initial management instituted were collated . the patients mean age at presentation is 2.75 + 3.67 years while the mean duration of symptoms is 2.59 + 3.56 years . clinical findings at presentation include voiding anomaly ( 100% ) ; recurrent fever ( 90.5% ) ; ballotable kidneys ( 71.4% ) ; palpable bladder ( 76.2% ) ; failure to thrive ( 28.6% ) ; other symptoms like urinary incontinence , polyuria , and enuresis ( 47.6% ) ( table 1 ) . complications at presentation were renal failure ( 71.4 ) ; urinary tract infection ( 90.5% ) ; anemia ( 57.2% ) ; high blood pressure ( 47.6% ) . escherichia coli accounted for 66.7% of the urinary tract infection ( uti ) while 14.3% did not grow any organism . pseudomonas aeruginosa was found in 4.8% of the urine culture of patients with uti while 14.3% also grew klebsiella . only one ( 4.8% ) of the patients had vesicoureteral reflux on the voiding cystourethrography . of these , 62% required renal replacement therapy but only 19.05% were able to receive the therapy during the study period ( figure 2 ) . initial management instituted were continuous bladder drainage by urethral catheterization in 76.2% and cutaneous ureterostomy in 23.8% and none had vesicostomy . the outcome of the patients showed that 31% survived on dialysis ( 23% received peritoneal dialysis and 8% received hemodialysis ) . the remaining 69% were lost to followup or presumably died for inability to access required management for profound renal impairment . posterior urethral valve is the commonest cause of obstructive uropathy in children [ 11 , 12 ] . posterior urethral valves and other congenital obstructive uropathy accounted for 1.46.4% of all renal diseases in most of the centers in nigeria [ 1315 ] . all ( 100% ) our patients presented with one form of voiding abnormality or another . most of them presented with poor urinary stream while some others presented with straining during micturition . it is important to have a high index of suspicion of puv in any child presenting with the above symptoms and refer to a specialist early for appropriate intervention . furthermore , most of our patients presented late with features such as ballotable kidneys and palpable bladders . while the diagnosis of puv can be made prenatally [ 1618 ] , none of our patients was diagnosed prenatally . negative attitude , long distances to service providers , considerably heavy financial cost , long waiting periods , and unsatisfactory previous scan experience are major barriers to prenatal ultrasound in a study from nigeria , and these barriers had indirectly made prenatal diagnosis of puv intricate in our setting . the presence of ballotable kidneys suggests back pressure effect of the lower urinary obstruction with attendant hydronephrosis . this predisposes to stasis of urine and colonization by bacteria with attendant urinary tract infection and fever which was present in over 90% of our patients . in addition , majority of our patients also presented with complications including high blood pressure , urosepsis , and renal failure . elevated serum creatinine level has been shown to be associated with poor prognosis in puv patients [ 2022 ] , and this may not be reversed even with the relief of the obstruction . another possible reason is the ignorance that a poor urinary stream could be a transient event and that the baby will improve with time . a situation in which general practitioners do not refer patients to specialist for early diagnosis of the cause but rather they treat only the symptoms should be discouraged . the maxim should be that any child presenting with poor urinary stream should see a specialist for a second opinion . several studies have shown better preservation of renal function with early intervention and relief of obstruction [ 9 , 23 , 24 ] . therefore , with early presentation , diagnosis , and treatment the outcome the survival figure of 31% in this study is low compared to other centers in africa ( 87.5% ) and western world ( 96.2100% ) [ 2528 ] . medical education programs to improve the awareness among general practitioners should be encouraged by the health ministry . mothers presenting with oligohydramnious to the obstetricians should have their neonates screened for puv when born . patients presenting with features of urinary tract infection should have a full workup to rule out underlying urogenital anomaly . in conclusion , this study has shown that there is delayed presentation of patients with puv in our setting . efforts at improving awareness and early diagnosis among the health team should be made to stem the tide .

delayed presentation of patients with posterior urethral valve with complications like severe urosepsis , uremia , and anemia are seen in our setting . renal replacement therapy which should have been offered to these patients is not readily available for children in our country . the aim of this study is to determine the pattern of late presentation and outcome of management of posterior urethral valve in a resource - limited setting . a descriptive retrospective study ( 19972009 ) was conducted . data including pattern of presentation , duration of symptoms , complications , and outcome of initial management were analyzed . twenty - one patients were seen . the median age was 3 years ( 2 days13 years ) . the mean duration of symptoms before presentation was 2.6 years . nineteen patients ( 91% ) presented with urosepsis while 8 patients ( 36% ) presented with significant renal insufficiency . laboratory findings varied from - mild - to marked elevation in serum creatinine . radiological findings confirmed the diagnosis of posterior urethral valve . we concluded that late presentation is common in our setting . this is associated with high morbidity and mortality rates . efforts at improving awareness and early diagnosis among the health team should be made to stem the tide .

You are an expert at summarizing long articles. Proceed to summarize the following text: it is well established that tolerance of maternal immune system is decisive for pregnancy success . the tolerogenic maternal immune response against paternal alloantigens not only is achieved in the presence of a fetus , but also may be a consequence of several overlapping physiological mechanisms . most of the immune responses associated with pregnancy have been described in the context of mid - gestation , while the shaping of immune mechanisms in early pregnancy , especially within the preimplantation period , is still poorly understood . three events inducing immune tolerance against a semiallogeneic conceptus may play a crucial role in the preimplantation period of pregnancy : ( i ) the influence of sex hormones in the sex cycle [ 16 ] ; ( ii ) the presence of an oocyte or embryo [ 710 ] ; ( iii ) and the presence of semen in the female reproductive tract [ 1118 ] . we paid attention to this period of pregnancy because it seems to be significant for establishment of peripheral tolerance to fetal antigens without impairment of the capability of effective anti - infectious defense . therefore , potent activity of antigen - presenting cells ( apcs ) may be crucial for these events . in a previous study we found that mating changed the level of costimulatory molecules cd40 , cd80 , and cd86 and mhc class ii on splenic apcs ( cd11c , f4/80 , cd11b , and cd11b ) before implantation . in opposition to local response , peripheral awareness of early pregnancy may be decisive for a generation of split tolerance , which is believed to operate during pregnancy of placental mammals . differential expression of costimulatory molecules on spleen apcs of mated v. pseudopregnant mice was observed by us mainly at day 3.5 after conception . moreover , we observed that the costimulatory potential of f4/80 macrophages measured by the expression level of costimulatory molecules seemed to be higher in comparison with other populations of apcs studied by us . in an in vivo experiment , where blocking antibodies against costimulatory molecules were given i.p . at day 3.5 after mating , cytokine expression was modulated after administration of anti - cd40 , anti - cd80 , and anti - cd86 at day 10.5 . administration of anti - cd40 ( stimulating antibody ) and anti - cd86 ( blocking antibody ) decreased the possibility of pregnancy , whereas blocking the cd40 molecule led to an increase of treg lymphocyte concentrations . we hypothesize that the changes in the levels of cd80 and cd86 during preimplantation period of pregnancy have functional meaning and are directly connected with regulation of t cell response . therefore , we evaluated antigen presentation potency of splenic apcs isolated from mice in the preimplantation stage of pregnancy . for this aim , sorted dendritic cells cd11c and f4/80 and cd11b macrophages loaded with ovalbumin ( ova ) were cultured with cd4 t cells derived from ot - ii mice 's ( c57bl6/j - tg(tcratcrb)1100mjb / j ) spleen . we found that proliferation of cd4 t lymphocytes depends entirely on cd86 availability both in pregnant and pseudopregnant mice ; however , cytokine production in pregnancy is mainly regulated by the cd80 costimulatory molecule . adult ( 8-week - old ) female c57bl/6j , male dba/2j , and male balb / c strains of mice were purchased from the experimental medicine center , medical university of bialystok ( poland ) . ot - the animals were housed in a constant light - to - dark ratio of 12 : 12 hours under specific pathogen free ( spf ) conditions . all described procedures were approved by the local ethics committee of the institute of immunology and experimental therapy in wroclaw ( permission number 4/2009 ) . the stage of the estrous cycle was determined every day ( 8:0010:00 am ) by cytology of vaginal smears . the smears were stained with a cytocolor kit ( merck , germany ) , according to the manufacturer 's instructions . the act of mating was confirmed by the presence of a vaginal plug next morning ( considered as day 0.5 ) . because the presence of the vaginal plug does not verify pregnancy , these animals are described as mated . pseudopregnancy was induced by mechanical stimulation of the uterine cervix when the females were in estrus . pseudopregnancy was confirmed by analysis of vaginal smears in the morning after stimulation and in consecutive days before killing . this control has an important advantage over the control consisting of cyclic nonpregnant mice because the pseudopregnant mice have the same endocrine background as pregnant females . animals displaying the continuous microscopic image of metestrus were recognized as pseudopregnant . at 3.5 days after mating freshly acquired spleens were weighed and immediately pushed through a 40 m sieve to obtain a single cell suspension . the cells were incubated for 1 min in 0.84% ammonium chloride solution for erythrocytes lysis . next , leucocytes suspensions were centrifuged ( 400 g , 5 min ) and supernatants were discarded . to remove debris , cd11c , cd11b , and f4/80 were isolated from a suspension of total spleen cells in pbs supplemented with 2 mm edta ( sigma - aldrich , poznan , poland ) and 0.5% bsa ( sigma - aldrich ) according to the producer 's instructions . we used a magnet , columns , and magnetically labeled antibodies from miltenyi biotec . in the case of f4/80 cells we performed indirect staining with anti - f4/80 fitc ( ebioscience , vienna , austria ) and anti - fitc magnetic beads , whereas cd11c and cd11b cells were labeled directly . cd4 t cells were isolated with a kit for negative selection ( depletion of non - cd4 cells ) . in the case of splenic apcs , we sorted cd11c at the beginning , next f4/80 cells , and cd11b cells at the end . in all cases the purity of sorted cells was 85% or higher , as determined by flow cytometry . sorted cd11c , f4/80 , and cd11b cells were suspended in rpmi 1640 ( sigma - aldrich ) , 10% fetal calf serum ( fcs , invitrogen ) , and l - glutamine - penicillin - streptomycin stock from sigma - aldrich 1 : 100 and treated with mitomycin c ( santa cruz biotech . ) for 15 min and at 37c . after triple washing in pbs , the cells were resuspended in complete rpmi 1640 supplemented with 10 m ova ( sigma - aldrich ) . after counting , the cells were diluted to a concentration of 6 10 and 50 l of suspension was added to a 96-well u - bottom culture plate ( becton dickinson ) . the cells were treated with suppressive armenian hamster anti - mouse cd80 ( clone 16 - 10a1 ) and suppressive rat anti - mouse cd86 antibody ( clone po3.1 ; all functional grade antibodies were purchased from ebioscience ) . control cells were treated with appropriate isotype controls : rat igg2a or armenian hamster igg ( ebioscience , functional grade immunoglobulins ) . after 30 min treatment with antibodies we added ot - ii cd4 t cells ( 6 10 cells per well ) . the total volume for each well was 100 l and final concentration of each antibody was 5 g / ml . certain cocultures were destined for proliferation assay with the colorimetric brdu proliferation elisa kit ( roche ) . briefly , the cells were treated with bromodeoxyuridine ( brdu ) 12 hours before the end of incubation . after centrifugation of plates , the pellets were dried for 15 min with a hair dryer and fixed / denatured for 60 min at room temperature ( rt ) , according to the producer 's instructions . next , the plates were blocked for 30 min with 2% bsa solution and brdu was detected by direct staining with anti - brdu - pod antibody ( 90 min , rt ) . after triple washing , an enzymatic reaction with tmb as the substrate was carried out for 7 min and impeded with h2so4 . absorbance at wavelength = 450 nm was measured within 15 min after h2so4 addition . since the procedure was performed on distinct plates and days , isotype control treated cells were considered as a reference measurement and the results of costimulatory molecule blockade are depicted as a percentage of the reference value . ifn - gamma , il-2 , il-4 , il-10 , il-12 , and tgf - beta were measured using murine ready - set - go kits from ebioscience . briefly , costar 96-well elisa plates were coated with specific antibodies overnight ( 4c ) and blocked for 1 hour , rt . next , supernatants diluted 1 : 10 and standard concentration of cytokines ( 100 l / well ) were incubated overnight at 4c , washed three times , and incubated with biotinylated specific detection antibodies ( 60 min , rt ) . after further triple washing , we added horseradish peroxidase - conjugated avidin and incubated the plates for 30 min , rt . washed plates were next incubated for 10 min in the dark at rt with tmb substrate and inhibited with 50 l of 1 m h2so4 . all antibodies and isotype controls for cell labeling were purchased from ebioscience ( usa ) and were diluted in pbs with 2% normal mouse serum ( sigma - aldrich ) . after 132-hour coculture incubation , the cells were stained in a total volume of 50 l with anti - cd4-fitc ( clone rm4 - 5 , final concentration 1.2 g / ml ) and anti - cd25-pe ( clone pc61.5 , 0.24 g / ml ) or isotype controls which were used at the same concentration as specific antibodies . after 45 min of incubation at 4c , the cells were washed twice in pbs and then fixed in 1% buffered formaldehyde . the samples were acquired with a facscalibur ii cytometer ( becton , dickinson and company ) . we performed facs analysis to determine the ratio of total number of activated ( cd4cd25 ) t cells to nonactivated ( cd4cd25 ) cells . the shape of data distribution was assessed with the shapiro test and analysis of quantile - normal plots . student 's t - test ( parametric ) or wilcoxon ( nonparametric ) test was performed on the basis of data distribution shape . to assess the involvement of cd80 and cd86 molecules in activation of t cells , we enriched murine splenic apcs populations : macrophages ( f4/80 or cd11b cells ) and dendritic cells ( cd11c cells ) . the cells were obtained from both pseudopregnant mice ( control ) and mated animals ( experimental group ) . next , the apcs were loaded with ova and exposed to ova - specific ot - ii cd4 t cells . additionally , the cocultures were treated with anti - cd80 and anti - cd86 blocking antibodies or relevant control immunoglobulins . after 6 days we performed the test for proliferation and expression of t cell activation marker cd25 . the proliferation test revealed that in most cases treatment of costimulatory molecules with specific antibodies led to similar effects in mated and pseudopregnant mice . the blockade of cd80 significantly increased the proliferation of t cells only in the presence of f4/80 cells obtained from pseudopregnant animals ( p = 0.002 ; figure 1(a ) ) . although the capability of cd11b cells to elicit t cells proliferation seemed to be similar , this observation was not significant due to higher variance . insignificant increases of proliferation were also observed after anti - cd80 treatment in the same populations of apcs in pregnancy . the cd80 molecule blockade seemed to have completely no effect on ot - ii t cell proliferation in culture with dendritic cells . on the other hand , blockade of cd86 led to decreased proliferation ratio of these cells in cultures with all types of studied apcs both in pregnancy ( p = 0.002 for cd11c cells ; p = 0.005 for f4/80 cells ; p = 0.007 for cd11b cocultures ) and pseudopregnancy ( p = 0.01 , p = 0.02 , and p = 0.04 , resp . ) ( figure 1(a ) ) . additionally , we performed facs analysis to determine the ratio of total number of activated ( cd25 ) and nonactivated ( cd25 ) cd4 t cells . the representative flow cytometry dot - plots are shown in figure 2 . the changes in the ratio of cd25/cd25 t cell number were convergent with the proliferation test in the case of cd86 blockade on f4/80 ( p = 0.01 in pregnancy ; p = 0.008 in pseudopregnancy ) and cd11b macrophages ( p = 0.002 and p = 0.01 , resp . ) . however , treatment of cd11c / t cell cocultures with anti - cd80 led to a decrease in cd25/cd25 ratio ( p = 0.006 for pregnancy and p = 0.008 for pseudopregnancy ) ( figure 1(b ) ) . notably , the proliferative response was not affected under these conditions ( figure 1(a ) ) . next , in supernatants from the above - mentioned cocultures we assessed the level of ifn- , il-2 , il-4 , il-10 , il-12 , and tgf- by elisa ( figure 3 ) . the concentration of ifn- was significantly changed only in cocultures of ova - specific t cells with f4/80 macrophages ( p = 0.02 for both anti - cd80 and anti - cd86 treatment ; figure 3(a ) ) isolated from pseudopregnant but not mated animals . il-2 level was downregulated after blockage of cd80 on f4/80 cells isolated from both mated ( p = 0.003 ; figure 3(b ) ) and pseudopregnant ( p = 0.028 ; figure 3(a ) ) mice . in pseudopregnancy we also observed a decrease of the il-2 level in cultures containing cd86-blocked cd11b cells ( p = 0.02 ; figure 3(a ) ) . blockade of cd80 in b6 mice led to a decrease of il-4 concentration in cocultures with all studied apcs populations ( p = 0.02 for cd11c cells , p = 0.007 for f4/80 macrophages , and p = 0.009 for cd11b cells ; figure 3(a ) ) , but in mated females we observed a significant decrease in the presence of f4/80 ( p = 0.028 ; figure 3(b ) ) and in contrast to pseudopregnant mice an increase in cocultures with cd11b cells ( p = 0.046 ; figure 3(b ) ) . we observed a decrease in il-10 concentration in the presence of cd11c cells in pseudopregnant and pregnant mice ( p = 0.005 and p = 0.04 , resp . ) . the difference between pseudopregnant and pregnant mice was related to a decrease of il-10 concentration in cocultures with cd80-blocked f4/80 cells ( p = 0.01 ; figure 3(b ) ) and a decrease of this cytokine level in cocultures with cd86-blocked cd11c cells ( p = 0.04 ; figure 3(a ) ) . in the case of il-12 , the concentration was downregulated in cocultures with cd11c cells of b6 animals treated with anti - cd80 ab ( p = 0.046 ) and anti - cd86 ab ( p = 0.04 ) ( figure 1(a ) ) . il-12 level was affected by cd80 blockade of all studied apc populations isolated from pregnant mice ( p = 0.018 for cd11c cells ; p = 0.018 for f4/80 cells ; p = 0.028 for cd11b cocultures ; figure 3(b ) ) . tgf- concentration was decreased after blockade of stimulation of t cells ( anti - cd80 ab ) with f4/80 cells isolated from both control ( p = 0.01 ; figure 3(a ) ) and experimental mice ( p = 0.04 ; figure 3(b ) ) . however , in mated but not pseudopregnant animals anti - cd80 ab treatment led to a decrease in concentration in the case of cd11c cells ( p = 0.03 ) . addition of anti - cd86 ab to cocultures prompted a decrease in the level in the case of f4/80 ( p = 0.036 ) ( figure 3(b ) ) . cumulatively , these results led to the observation that cd80 is the main costimulatory molecule influencing secretion of cytokines in pregnant mice ( table 1 ) . our research on cd4 t lymphocytes and the cytokine secretion profile in in vivo and in vitro conditions highlights the distinct role of cd80 and cd86 molecules . data concerning other experimental models , such as human normal pregnancy and miscarriage , experimental autoimmune encephalomyelitis ( eae ) , or a murine model of leishmaniasis , also indicate differential action of these costimulatory molecules . it is obvious that these costimulatory molecules take part in the regulation of cytokine production . however , each of them may be differentially engaged in the regulation of cytokines synthesis . for instance , the level of mrna expression for cd86 , but not cd80 , is positively correlated with the level of th1 cytokines during human miscarriage . in a model of eae a blockade of cd80 or cd86 has different effects : blockade of cd80 interactions with its ligands leads to production of th2 cytokines and cessation of disease symptoms , while cd86 blocking has adverse effects . in a murine model of leishmaniasis a blockade of cd86 results in inhibition of th2 cytokine secretion and enhancement of the th1-type immune response , while a blockade of cd80 exerts the opposite effect . on the other hand , in in vitro experiments th1/th2 mechanisms data from coculture experiments of antigen - specific t cells with apcs isolated from cd80 ko or cd86 ko mice indicate that cd86 and , to a lesser extent , cd80 are involved in regulation of both ifn- and il-4 production , but without preferential support of a th1 or th2 response . similarities in cd80 and cd86 action under the scope of th1/th2 balance were demonstrated in other experimental models , for example , in human pbmcs or murine cd4 t lymphocytes cultured in in vitro conditions [ 2628 ] . additionally , the outcome of cytokine production is dependent on other factors , such as antigen density and priming / restimulation . for example , if cd4 t cells recognize an antigen with low affinity / avidity , they are committed to th2 cells ; otherwise , they are redirected to th1 development . moreover , the role of cd80 and cd86 can be distinct in priming or restimulation , since previous in vitro study demonstrated that blockade of cd86 influences the production of il-4 , but cd80 blockade has an effect only after restimulation and is related to both il-4 and ifn- . in the context of pregnancy , the blockade of cd80 and cd86 molecules in early stages of gestation abortion - prone mice ( cba / jxdba/2 ) increased production of th2 cytokines and frequency of treg cells and decreased the fetal resorption [ 31 , 32 ] . in our in vitro experiments we observed that cytokine production from cd4 ot - ii t cells cocultured with splenic apcs after blockade of cd80 and cd86 is not specifically related to th1 or th2 profile ( table 1 ) . firstly , the influence of blockade of costimulatory molecules with specific ab is cell - type dependent . from studied populations of splenic apcs , blocking of costimulatory molecules affected mainly f4/80 cells , whereas cd11c and cd11b cells were targeted to a lesser extent . in a previous study we observed that at embryonic day 3.5 all studied costimulatory molecules ( cd40 , cd80 , and cd86 ) were upregulated on the surface of f4/80 cells , in contrast to the population of cd11c and cd11b , where the observed increased expression of these molecules was not even . thus , we can speculate that f4/80 macrophages may be the main cell population of murine splenic apcs affected during the preimplantation period of pregnancy and these cells are primarily linked with the regulation of the immune response . secondly , in pregnancy most changes were induced by blockade of cd80 and resulted in diminished secretion of both th1 and th2 cytokines . only tgf - beta production was diminished by a blockade of both costimulatory molecules . however , an increase in cytokines production ( il4 and il-12 ) was also observed , but only in the case of cd11b cells . in pseudopregnancy thirdly , in pregnant mice ifn- production was not dependent on availability of both costimulatory molecules . additionally , the proliferation of t cells was decreased after blockade of cd86 both in pregnant and pseudopregnant mice while cd80 blockade had no effect on proliferative response except for f4/80 macrophages as stimulatory cells in the group of pseudopregnant mice , where they led to an increase of proliferation . moreover , the changes in ratio of cd25 to cd25 t cells were convergent with the results of brdu assay ; cd86 blockade on f4/80 and cd11b macrophages suppressed both proliferation and generation of activated t cells . since this effect is not visible in cocultures of t cells with dcs , this observation suggests that cd86 may regulate activation of t cells during their interaction with macrophages . on the other hand , the effect of anti - cd80 treatment limited frequency of activated t cells only in the presence of dcs , but not macrophages . in this case , however , the intensity of proliferation was not affected , while the concentrations of studied cytokines were clearly affected by cd80 blockade . thus , cd86 seems to be the main costimulatory molecule involved in the proliferation response in both pregnant and pseudopregnant mice , whereas cd80 is engaged in stimulation of cytokine production , especially in the group of pregnant mice ( table 1 ) . nevertheless , in our previous paper we showed that splenic apcs during preimplantation period of pregnancy clearly upregulate cd86 , while cd80 expression was changed to a lesser extent . therefore , our current observation indicating that blockade of cd80 decreases the cytokines synthesis can be irrelevant in the in vivo models and require more detailed analysis . still , the effect of cd86 blockade is consistent with our former study . we postulate that regulation of cd86 expression on macrophages may be an important mechanism tuning tolerant immune response during early stages of pregnancy . in summary , this study showed that cd80 and cd86 costimulatory molecules differentially regulate ot - ii cd4 t lymphocyte proliferation and cytokine response in cocultures with antigen - presenting cells derived from pregnant and pseudopregnant mice . proliferation of t cells depends on the availability of cd86 molecules , but cd80 molecules are involved in the regulation of cytokines secretion in pregnant mice .

immune phenomena during the preimplantation period of pregnancy are poorly understood . the aim of our study was to assess the capacity for antigen presentation of splenic antigen - presenting cells ( apcs ) derived from pregnant and pseudopregnant mice in in vitro conditions . therefore , sorted cd11c+ dendritic cells and macrophages f4/80 + and cd11b+ presenting ovalbumin ( ova ) were cocultured with cd4 + t cells derived from ot - ii mice 's ( c57bl6/j - tg(tcratcrb)1100mjb / j ) spleen . after 132 hours of cell culture , proliferation of lymphocytes ( elisa - brdu ) , activation of these cells ( flow cytometry ) , cytokine profile ( elisa ) , and influence of costimulatory molecules blocking on these parameters were measured . we did not detect any differences in regulation of th1/th2 cytokine balance . cd86 seems to be the main costimulatory molecule involved in the proliferation response but cd80 is the main costimulatory molecule influencing cytokine secretion in pregnant mice . in conclusion , this study showed that cd80 and cd86 costimulatory molecules regulate ot - ii cd4 + t lymphocyte proliferation and cytokine response in cocultures with antigen - presenting cells derived from pregnant and pseudopregnant mice . the implications of these changes still remain unclear .

You are an expert at summarizing long articles. Proceed to summarize the following text: amnesic mild cognitive impairment ( mci ) is characterized by memory impairment , either associated or not with mild deficit in other cognitive domains whereas the function of daily living is essentially preserved [ 13 ] . annual conversion rate from normality to dementia of alzheimer 's type ( alzheimer 's disease , ad ) ranges between 0.2% and 4% [ 3 , 4 ] whereas that from mci to ad is between 6% and 25% [ 3 , 5 ] . it is an open issue with important clinical implications whether or not mci is essentially a prodromic stage of ad . although clinical manifestations of cognitive dysfunction and impairments of activities of daily living are the current standard measures for the diagnosis of ad , biomarkers are receiving increasing attention in research centers as possible early diagnostic surrogate measures of the ongoing pathology . not surprisingly , there is already a growing literature of biomarkers associated with the transition of mci to ad [ 714 ] . connectivity plays a critical role in mediating cognitive function . the breakdown of connectivity , both in the functional and structural system domain , plays a major role in the onset of ad symptoms . thus , a failure of the regions of a network to interact at a high level of coordination may underpin the cognitive disorders which are present in ad . the failure of network function may be due to interaction failure among the regions of a network , which is denoted as the disconnection hypothesis . the breakdown is thought to be due to chronically progressive ad neuropathology with underlying molecular mechanisms leading downstream to neuronal and synaptic dysfunction and ultimately to neuronal loss . such ad - characteristic structural and functional changes are hypothesized to reflect , at least partially , the progressive impairment of fiber tract connectivity and integrity [ 1618 ] , suggesting that disconnection in ad is evident at both the functional and structural level . advances in electroencephalographic ( eeg ) signal analysis permit relatively precise localization of brain neural sources and the ability to track their hierarchical connectivity in sustaining a given function . this information can be integrated with structural and functional imaging provided by fluorodeoxyglucose ( fdg ) positron emission tomography ( pet ) , perfusion single - photon emission computed tomography ( spect ) , and functional magnetic resonance imaging ( fmri ) . such integrated measures can index patterns of neural activation responsible for sensory perception , attention , memory , movement , and higher mental operations including language and thought , since electromagnetic signals change in parallel over time and task , and can be impaired directly during such activity . actually , in the new guidelines for the ad diagnosis , eeg is not mentioned as a diagnostic measurement , instead of giving greater emphasis on mri , cerebrospinal fluid ( csf ) , pet , and genetic findings . the associations between brain pathology and indices of functional and structural connectivity may help our understanding of the role of connectivity in brain function . the aim of this review is to investigate the brain functional network in ad focusing on main neurophysiological techniques and integrating the results with functional brain imaging findings . we will mainly review studies using eeg data to investigate functional networks ; moreover , some very recent studies utilizing pet and spect to investigate functional brain imaging of ad - related pathology are reported . studies in normal elderly individuals have consistently showed that healthy ageing is not associated with substantial eeg changes , which instead are caused by pathological conditions . usually , the eeg signal is elaborated ( quantitative eeg - qeeg ) performing a fast fourier transform ( fft ) in order to estimate the power density of selected eeg frequency band , providing a power spectrum and high - density spatial eeg mapping of each frequency band . a tendency toward a slower alpha rhythm has been reported in the elderly subjects , but it is poorly significant in comparison to normal adults . in fact , the normal alpha frequency is higher than 8 hz also in the elderly . a qeeg study of age - related changes during cognitive tasks revealed no conclusive differences between the young and the elderly . therefore , it should be taken in mind that an abnormal eeg in aged people should prompt further investigation to disclose brain pathology , since normal aging per se is not associated with significant eeg alterations . to make this point clear , it is noteworthy that slow waves over the temporal areas ( mainly of the left hemisphere ) are occasionally seen in the eeg of normal elderly subjects . the main features of these nonpathological slow waves are that they do not disrupt background activity , they are not associated with a substantial asymmetry of the alpha rhythm , their morphology is usually rounded , and their voltage is usually greater than 6070 v . moreover , they are attenuated by mental activity and eye opening , and their prevalence is increased by drowsiness and hyperventilation . finally , they occur sporadically as single waves or in pairs , not in longer rhythmic trains . although eeg is the only clinical diagnostic instrument directly reflecting cortical neuronal functioning , the genesis of surface eeg rhythms is still the object of current investigation and partly not understood . the biological complexity of the brain modular function and the physical sum effect of different brain electrical fields on surface eeg recordings make the understanding of eeg components a very difficult task . in general , normal alpha was shown to be suppressed during eye opening in ad patients with significantly higher wais performance iq scores whereas in ad patients with irregular alpha it does not or only weakly change during eye opening . the most frequent findings are the power reduction of beta activity and alpha rhythm , the power increase of slow activities in the theta bands in milder dementias , and of delta activities in more severe dementia . both intrahemispheric and interhemispheric coherence of fast and alpha eeg activities is reduced in neurodegenerative diseases causing dementia , thus suggesting a reduction of neural connections . on the contrary , coherence in delta and theta bands have been reported to be increased in ad , but this data is not agreed upon by all researchers . the alpha ( or background activity ) also suffers from the slowing - down of its frequency , often till its peak falls below the 88.5 hz . this phenomenon can happen together with a true increase of the theta power . according to the transition hypothesis that considers mci as a reservoir of patients possibly developing dementia , mainly of the ad type , eeg studies have tried to highlight early changes . considered altogether , it is difficult to identify mci patients from normal controls , but emerging data is consistent with the hypothesis that those who will convert to dementia already show similar eeg changes as early ad patients [ 7 , 8 , 13 , 25 ] . moreover qeeg features could predict longitudinal cognitive decline in normal elderly with subjective complaints , with an overall predictive accuracy of 90% . it should be taken in mind that eeg measures electrical field variations , and a number of clinical conditions can disturb the normal electrical field of the brain . for instance , electrolyte changes may alter the appearance and time variation of the brain - generated electrical fields , and medications can slow the posterior dominant rhythm . moreover , in assessing the frequency of the alpha rhythm , alerting manoeuvres are essential in order to ensure that the patient is not drowsy . hence , a large number of conditions cause the eeg to appear abnormal . in eeg practice , the clinician has to rely to a large extent on the clinical history and the neurological examination findings to make a clinically meaningful conclusion . in summary , a shift - to - the - left of background activity and the increase of theta power are the earliest and more robust features of ad . when the disease progresses to its moderate stage , theta activities increase further and delta activities appear . in the most severe stages , delta and theta activities increase again while the background activity can not be longer recognized . these increasing eeg changes according to severity of ad have been highlighted by a study based on 4 clinical classes of severity ( gds , from 3 to 6 , figures 1 and 2 ) . with this basis , the understanding of pathophysiology of eeg changes in ad is even more complex and just some general concepts can be commented . scalp alpha rhythms ( 813 hz ) mainly result from sequences of inhibitory ( ipsp ) and excitatory ( epsp ) postsynaptic potentials at the dendrites of cortical pyramidal neurons . these potentials depend mainly on the influence of near and distant cortical modules , as well as on the interactions of excitatory corticothalamocortical relay fibres and inhibitory thalamic reticular fibres [ 29 , 30 ] . cholinergic and glutamatergic synapses are especially involved in the genesis of these potentials . in alzheimer 's disease ( ad ) , characterized by an early cholinergic ( and possibly glutamatergic ) deficit , this may produce a slowing - down of alpha rhythm and a reduction up to disappearance of alpha rhythm in the severe stages . , a theta power increase is observed over the frontal and temporal areas during learning and memory tasks . the theta rhythms that are recorded during these tasks are thought to be produced by the activation of septal - hippocampal system . hippocampus has a cholinergic innervation originating from basal forebrain , the medial septum , and the vertical limb of the diagonal band of broca . populations of gabaergic and glutamatergic neurons have also been described in several basal forebrain structures . the synchronized depolarization of hippocampal neurons produces field potentials that have a main frequency of 312 hz and are usually known as hippocampal theta rhythm . a cholinergic - glutamatergic hypothesis of ad , in which most symptoms may be explained by cholinergic - glutamatergic deficits , has been advanced . neuronal injury / loss may include an excitotoxic component that possibly contributes to the early cholinergic deficit . this excitotoxic component may occur , at least in part , at the septal level where somas of cholinergic neurons are found . this insult may modify septal networks and contribute to the abnormal information processing observed in ad brain , including its hyperexcitability states . according to this theory , the increased theta production in ad would derive from hyperexcitability of the septal - hippocampal system . by means of observations in head injury patients , it has been suggested that delays in corticocortical fiber propagation may play a global role in determining human eeg frequencies , increasing the amount of delta activity . increased t2 relaxation times in cortical gray matter and white matter were correlated with a shift in relative eeg power to lower frequencies in the delta range ( delta activity : 14 hz ) and reduced cognitive performance . generally , these data are consistent with the idea that head injury somehow damages the ability of brains to form local cell assemblies within the global synaptic action field environment . the increment of delta oscillations in mild cognitive impairment ( mci ) and ad subjects might be related to loss of hippocampal and posterior cortical neurons , which are impinged by cholinergic inputs . indeed , it has been demonstrated that early degeneration in mesial temporal cortex of ad subjects can affect functional connectivity between hippocampal formation and temporoparietal cortex . furthermore , a bilateral reduction of gray matter volume in the hippocampal formation and entorhinal cortex of ad subjects was correlated with an increment of delta rhythms in posterior cortex [ 9 , 35 ] . historically , morphological imaging became easily a reliable diagnostic procedure for several brain disease , like neoplastic or cerebrovascular injuries , and at least for degenerative disease . this has actually slowed down these biomarkers introduction into dementia diagnostic criteria . recently , dubois et al . a specific pattern on functional neuroimaging with fdg - pet has been proposed as one of the supportive features in the diagnosis of probable ad , specifically in terms of reduced glucose metabolism in bilateral temporal parietal regions . in fact , a reduction of glucose metabolism as seen on pet in bilateral temporal parietal regions and in the posterior cingulate is the most commonly described diagnostic criterion for ad . the newly proposed diagnostic criteria for ad entails a two - step diagnostic process , first identifying dementia syndrome ( lack of episodic memory and other cognitive impairment ) and then applying criteria based on the ad phenotype ( presence of plaque and neurofibrillary tangles ) . as a matter of fact furthermore , the pathogenetic role of amyloid deposition in ad patients is still unclear , highlighting the necessity of another diagnostic path [ 3740 ] . in summary , alzheimer 's disease should refer only to the in vivo clinicobiological expression of the disease . . actually , metabolic changes ( as identified by fdg - pet ) associated with neocortical dysfunction are detectable before atrophy appears . moreover , metabolism reductions exceeded volume losses in mci , and in presymptomatic early - onset familial ad . actually , a pattern of parietotemporal metabolic reductions in mci and ad , and frontal metabolic reductions later in the disease , has been established through the last decades of research [ 4446 ] and has recently been confirmed in adni pet data . the usefulness of fdg - pet could be highlighted also in detecting prodromal ad showing metabolic reductions in the anterior cingulate , posterior cingulate , and temporal , parietal , and medial temporal cortices [ 4850 ] . finally , several compounds have been developed for the imaging of amyloid for pet and spect . the rapid development of different compounds suitable for the visualising of amyloid during the past 10 years has led to the first promising in vivo studies of the amyloid ligands pib ( n - methyl-[11c]2-(4l-methyl aminophenyl)-6-hydroxybenzothiazole ) and fddnp ( 2-(1-[6-[(2-[18f]fluoroethyl](methyl)amino]-2-naphthyl]ethylidene)malononitrile ) ; the latter compound also seems to label neurofibrillary tangles in patients with ad . furthermore , both compounds have shown a pattern of increased radioligand retention in patients with ad compared with control individuals that is consistent with ad pathology [ 5254 ] . accumulation of amyloid , however , has also been reported in cognitively intact older people [ 3740 ] . in a recent paper , oh et al . using pet imaging with the pib compound , structural mri , and cognitive measures identify two brain networks in which the degree of gray matter volume fluctuates in a similar manner : a frontal network and a posterior network . the authors suggested that -amyloid deposition in older people without dementia may influence a wide structural network , although it is not clear whether people with higher -amyloid deposition will progress to ad . because spect is more widely available and cheaper than pet , it has received much attention as an alternative to pet . however , at present , the technique is not included in the criteria proposed by dubois et al . as the diagnostic accuracy estimates for this modality generally fall below the requisite 80% levels specified by the reagan biomarker working group . in a clinical context , some firm points can be made concerning eeg in the evaluation of ad . in a more strict sense , the main applications of eeg should be as a different diagnostic tool between dementia and other conditions characterized by peculiar eeg pattern such as creutzfeldt - jakob disease ( cjd ) , toxic - metabolic encephalopathy , or in case of pseudodepressive dementia . in a broader sense , eeg can be useful to stage the severity of dementia on a pathophysiological basis , and , in ad , gives useful information for prognostic purposes . when a substantial part of the dominant rhythm falls within the range of theta band physicians should be encouraged to perform qeeg . this , in order to identify the so - called transition frequency between dominant and theta activity , as suggested by klimesh . moreover , qeeg is a highly sensitive method to evaluate the biological effect of drugs [ 59 , 60 ] . cortical sources of scalp eeg rhythms have been successfully evaluated in ad patients by single dipole sources deeply located into a spherical brain model . single dipole sources of alpha or beta rhythms are located more anteriorly as a function of ad severity . such anteriorization of the dipole source is observed in ad patients not only with respect to normal subjects but also with respect to subjects with mci [ 8 , 61 ] . notably , the location of the dipole sources correlates with the reduction of rcbf in anteroposterior and laterolateral brain axes . by applying the loreta technique , which elaborates solutions to compute the cortical sources of eeg activities , several multicenter studies have been performed in recent years in ad as well as in mci , gaining substantial information [ 79 , 63 ] . even if not usually used in clinical practice , other neurophysiological measurements could be performed in the evaluation of ad . event - related potentials ( erp ) may reflect cognitive decline in the longitudinal followup of mci and ad patients , and erp and mri data fusion could improve diagnostic accuracy of early ad . moreover , transcranial magnetic stimulation ( tms ) , especially combined with eeg , may provide useful information about the degree and progression of ad [ 6769 ] . however , it is obviously important to combine multiple biomarkers in order to obtain complementary information to be used in clinical ad diagnosis practice . this kind of investigation has been recently performed [ 41 , 7072 ] confirming that each biomarker ( including eeg , pet , spect , mri , apolipoprotein e risk gene ( apoe4 ) , cerebrospinal fluid ( csf ) , and neuropsychological tests ) does carry complementary information , and the simple combination of classifiers trained on these different modalities can improve the diagnostic performance . indeed , apoe2 has been suggested as having a protective effect and delaying the age of onset of ad [ 73 , 74 ] . for instance , qeeg was analysed together with regional cerebral blood flow ( rcbf ) quantitative measurements in order to investigate the correlation between eeg activities and hypoperfusion and to assess the diagnostic accuracy of the two methods used alone or in combination . in a study on 42 ad patients and 18 healthy controls , rcbf and qeeg were correlated with one another , suggesting that these measurements used together are reasonably accurate in differentiating ad from healthy aging . another qeeg - spect ( semiquantitative tc-99 hmpao technique ) correlative study on 42 ad patients underlined that bilateral hippocampal rcbf was the perfusional index best correlated with the mmse as well as being significantly correlated to qeeg ( figures 3 , 4 , and 5 ) . a very interesting application of qeeg measures tried to evaluate their prognostic meaning in ad . in a preliminary study on 31 ad patients , right delta relative power predicted both the loss of activities of daily living ( adl ) and death whereas right theta relative power predicted the onset of incontinence . because patients were in different stages of the disease , the statistical analysis was performed in the entire group as well as in the subgroup of 41 patients with mild ad ( scoring 3 or 4 on the gds ) . in the whole group , the loss of adl was predicted by delta relative power in either side , incontinence was predicted by alpha relative power in the right side , a borderline statistical significance was reached for death ( p < .05 ) . in the subgroup of mildly demented patients , the loss of adl was predicted by left delta relative power , incontinence by both delta and alpha relative powers in the right side , and death was not significantly predicted ( p = .08 ) . using both conventional visual analysis and qeeg , other authors found that ad patients with an abnormal eeg at an early stage had a different pattern of cognitive decline than those ( matched for severity of dementia ) with a normal eeg . the patients with a deteriorating eeg during the first year of followup subsequently showed a greater decline of praxic functions , a tendency to parkinsonism and a higher risk of institutionalisation than patients with a stable eeg during the 1st year . in another study , more marked eeg abnormalities were found in patients with delusions and hallucinations who also showed a more rapid cognitive decline . the same authors also found that an abnormal eeg and psychosis were independent predictors of disease progression . as discussed in a recent paper , most of the eeg studies in ad patients have reported a prominent decrease of coherence at the alpha band . the reduction of alpha coherence in ad patients has been also found to be associated with apoe genetics risk of dementia ; this alpha power reduction is supposed to be mediated by cholinergic deficit . instead some studies have shown a decrement of slow eeg coherence in ad patients whereas others have reported its increase . examined intrahemispheric coherence at rest and during photic stimulation in 10 ad patients . in the resting eeg , patients with ad had significantly lower coherence than gender- and age - matched healthy control subjects in the alpha-1 , alpha-2 , and beta-1 frequency bands . eeg analysis during photic stimulation demonstrated that the patients had significantly lower coherence , irrespective of the stimulus frequency . the changes in coherence from the resting state to the stimulus condition showed significant group differences in the region of the brain primarily involved in visual functioning . these findings suggest that patients with ad may have an impairment of functional connectivity in both nonstimulus and stimulus conditions . this suggests a failure of normal stimulation - related brain activation in ad . in another study , alpha coherence was decreased significantly in temporo - parieto - occipital areas in the majority of patients while significant delta coherence increase was found in a few patients between frontal and posterior regions . this was expressed to a greater extent in patients with a more severe cognitive impairment . the authors speculated that their findings could reflect two different pathophysiological changes : ( i ) the alpha coherence decrease could be related to alterations in corticocortical connections whereas ( ii ) the delta coherence increase suggests lack of influence of subcortical cholinergic structures on cortical electrical activity . jelic et al . found a positive correlation between levels of tau protein in the cerebrospinal fluid ( csf ) and delta / alpha ratio . in a subgroup with high csf tau levels , a strong relationship between eeg alpha / theta and alpha / delta power ratios was found . no such correlation was found in healthy controls and mildly cognitively impaired individuals with elevated csf tau levels . apoe 4 allele is a risk factor for late - onset ad and is proposed to have an impact on cholinergic function in ad . the qeeg of 31 patients with ad was recorded at the early stage of the disease and after a 3-year followup . patients with ad were divided into several subgroups according to the number of apoe4 alleles , with a similar clinical severity and duration of dementia . the ad patients carrying the apoe4 alleles had more pronounced slow - wave activity than ad patients without the apoe4 alleles , although the disease progression rate did not change . these differences in eeg may suggest differences in the degree of the cholinergic deficit in these subgroups .

alzheimer 's disease ( ad ) is the most common type of dementia that is clinically characterized by the presence of memory impairment and later by impairment in other cognitive domains . the clinical diagnosis is based on interviews with the patient and his / her relatives and on neuropsychological assessment , which are also used to monitor cognitive decline over time . several biomarkers have been proposed for detecting ad in its earliest stages , that is , in the predementia stage . in an attempt to find noninvasive biomarkers , researchers have investigated the feasibility of neuroimaging tools , such as mr , spect , and fdg - pet imaging , as well as neurophysiological measurements using eeg . in this paper , we investigate the brain functional networks in ad , focusing on main neurophysiological techniques , integrating with most relevant functional brain imaging findings .

You are an expert at summarizing long articles. Proceed to summarize the following text: our study site ( 90.6 e , 23.8 n ) is located in the fluvial floodplain of central bangladesh . here groundwater as concentrations are elevated within the shallow , gray sands , reaching 210 g l at 38 m depth . below 50 m lie brown sands characteristic of partially reduced fe oxides that are associated with very low ( < 2 g a distinguishing feature of this study is that as adsorption parameters in the low - as aquifer were determined from both in situ experiments and batch as adsorption experiments . in situ estimates were derived from push - pull tests , where low - as groundwater was pumped from the brown sands and immediately injected into a nearby well at the same depth after adding 200 g the extent and rate of adsorption of both as species onto aquifer sands was determined by stepwise pumping of the injected water and measuring its loss of as over 9 days . concentrations of br remained near the level of the injection for several of the withdrawals during the first 2 days of the experiment ( fig . 1 ) . in contrast , concentrations of as(v ) and as(iii ) dropped markedly within the first day to 14% and 31% of their initial level , respectively , and declined further during subsequent days . batch experiments were conducted to support the field experiments by further characterizing adsorption of as(iii ) and as(v ) using sands and groundwater from the same brown aquifer . the sorption capacity of brown sands freshly collected from drill cuttings is very high ( 40,000 g kg ) and follows a langmuir isotherm ( fig . the resulting adsorption constant , k , is therefore effectively equal to the more commonly used partitioning coefficient , kd ( l kg , i.e. the ratio of adsorbed as to dissolved as at equilibrium ) . over the entire range of as additions up to 32,000 g l , the mean k for both as(iii ) and as(v ) is 20 l kg , and somewhat higher at concentrations below 3,000 g l ( 30 and 50 l kg for as(iii ) or as(v ) , respectively , fig . 2 ) . measurement of adsorption over time indicates that rapid adsorption was followed by a slower approach to equilibrium ( supplementary information ) . the result is best described by rapid adsorption for 25% of the sites ( xf ) and 50-fold slower adsorption for the remaining sites . a simple model that takes into account the spatial distribution of the injected as in groundwater and aquifer sands is required to relate batch adsorption parameters to the push - pull experiments . this model assumes homogeneous plug flow and langmuir adsorption , and accounts for the stepwise withdrawal ( supplementary information ) . the field experiments indicate a conservative range of kd 's from 1 to 10 l kg , while the batch experiments provide an upper limit for as adsorption that may occur given sufficiently slow flow conditions . the most conservative approach for estimating in situ as adsorption is to assume that all adsorption sites are equally accessible ( xf = 100% ) , which results in k values of 1.8 l kg for as(v ) and 0.5 l kg for as(iii ) . this model does not fit the data well beyond the second day of the experiment ( r=0.94 and 0.87 , fig . alternatively , two - step adsorption can be assumed by applying the two batch - derived adsorption parameters , xf = 25% or k = 50 kg l. when xf is set to 25% , the resulting k values are 5.1 l kg for as(v ) and 1.7 l kg for as(iii ) ( r=0.97 and 0.96 , fig . 1 ) ; these values are much lower than observed in the batch experiments ( table s8 ) . when k is set to 50 l kg , the high end estimate from the as(v ) batch experiments , the best model fit is achieved when xf = 3% and slow adsorption sites comprised 97 % of the total adsorption sites ( r=0.97 , fig . 1 ) , modestly higher than the fraction of less accessible adsorption sites in other heterogeneous flood plain aquifers ( 70 to 90% ) that have been attributed to the presence of fine material , weathering , and sand compaction . when applying this xf to the as(iii ) push - pull experiment , the calculated k is 13 l kg ( r=0.99 , fig . 1 ) , which approaches the as(iii ) batch k of 30 l kg . taken together , the lower xf and k values estimated here suggest that the limited duration and relatively rapid flow induced during the push - pull tests limited adsorption compared to the shaken slurries used in the batch experiments . similar high adsorption estimates in batch studies ( kds ranging from 35 to 70 l kg ) and lower estimates derived indirectly from field observations ( kds ranging from 1 to 4 l kg ) have been observed in multiple locations . the distribution of oxidized brown and reduced gray sediments associated with low - as , deep groundwater in the bengal basin is variable and not well - documented . batch studies of shallow , high - as gray sediment indicate kd values between 1 and 6 l kg ( see also supplementary information ) , although a push - pull test carried out in high - as gray sands suggests that little as adsorption may occur above a concentration of 100 g l. infiltration of reducing shallow groundwater may also result in the reduction of fe oxyhydroxides ( converting brown sands to gray ) and potentially releasing bound as , however these mechanisms are likely secondary to adsorption . given the likely lower adsorption on deeper gray sediments , we conservatively assume that the lower adsorption ( kd of 1 ) is characteristic of the majority of the deeper aquifer zones , though the spatial distribution of sorption parameters is currently unknown . the adsorption properties of aquifer sands determined experimentally can be incorporated into transport models to identify regions of the bengal basin most at risk of contamination . the modflow - based advective flow model of michael and voss was modified to include advective - dispersive solute transport and linear as adsorption ( kd ) by using mt3dms , allowing for the calculation of as concentrations and depth - variable sorption . within the source region where groundwater as concentrations are elevated in shallow aquifers , initial concentration is constant ( c0=1 ) in the upper 50 m. sorption is simulated only at depths > 95 m , with retardation factors of 14 and 130 representing kd values of 1.2 and 12 l kg , which are the average of the most conservative estimates of as(iii ) and as(v ) adsorption from the push pull experiments and an order of magnitude greater . we consider pumping from deep aquifers to be unsustainable , i.e. at risk of contamination , when predicted as exceeds 10% of the upper aquifer concentrations in < 1,000 years at 162 m depth , i.e. when c / c0=0.1 is 12 m below the top of the deeper pumping zone . in the district with the highest average as concentration in shallow groundwater , the threshold would be reached on average at 37 g l. the time span considered is longer than the practical management scale , but this allows for uncertainty and variability in local geochemical and hydrogeologic conditions . adsorption experiments indicate that deeper sediments have a kd of at least 1 l kg . the protective effect of this weak as adsorption compared to the no - adsorption scenario ( kd of 0 l kg ) is illustrated with maps of c / c0 > 0.1 after 1,000 years within the deep pumping zone ( fig . 3 ) . three water use scenarios were simulated using the domestic and irrigation pumping rates of michael and voss . pumping rates were distributed based on district population and irrigation extents ; estimated total irrigation pumping is 10-fold greater than current domestic pumping rates ( 0.210 m yr compared to 0.019 m yr ) . shallow domestic pumping was simulated from 10 - 50 m , shallow irrigation pumping from 50 to 100 m , and deep pumping from 150 to 200 m depth . in the two split scenarios ( s ) , irrigation pumping is shallow , while domestic pumping is deep with an estimated current rate of 50 l person day ( sc ) and a possible future rate of 200 l person day ( sh ) , which was based on a quadrupling of current usage and is in line with the average domestic usage in asia in 2000 ( 171 l person day ) . in the deep scenario , both irrigation and domestic pumping are deep and at current rates ( dc ) . in the split pumping scenario with current domestic usage ( sc ) , adsorption increases the area with sustainable deeper , low - as groundwater from 44% ( sc0 ) of the affected region without retardation to 99% ( sc1 ) with weak adsorption ( fig . low - as water is still available for 91% of the high - as area when there is weak adsorption ( sh1 ) , but only for 16% of the area without as adsorption ( sh0 ) . while as sorption is still protective in the deep irrigation pumping scenario ( dc ) , the simulated area that is sustainable is significantly reduced , with only 8% of the area sustainable with no sorption ( dc0 ) and 37% with weak sorption ( dc1 ) . additional simulations suggest that increasing kd to 12 l kg , which may be appropriate for some sediments based on our adsorption isotherms , adds a considerable measure of protection , with 100% of the affected area in the deep scenario ( dc10 ) remaining low - as over time ( supplementary information ) . the results from physically- and chemically - homogeneous basin - scale simulations provide understanding of effects of pumping and sorption on overall flow and transport behaviour and indicate regional trends resulting from basin geometry . quantitative inferences about specific locations require knowledge and incorporation of site - specific parameters and heterogeneity ( see ref 34 for more information ) . however , the simulations do suggest that some regions are particularly vulnerable to contamination based solely on their location within the basin . where the basin is shallow , the flow paths connecting the contaminated shallow aquifers to the deeper aquifer zones are short , thus making these areas more vulnerable . for example , simulated as concentrations are high in a portion of northern west bengal and west - central bangladesh in < 1,000 years in the deep pumping scenario , even with adsorption ( fig . 3 ) . another concern is areas where long flow paths still originate within the high as region and connect the shallow and deeper aquifers , as is found in south - central bangladesh . breakthrough of high - as water in these and other areas may also be due to factors that were not incorporated in the model , such as high - capacity pumping wells , improperly installed or broken well casings , and hydrogeologic and geochemical heterogeneity . we investigate specifically the sensitivity of the sc1 scenario to local increases in vertical hydraulic conductivity due to fewer than average layers of fine - grained sediment that are oriented horizontally . on the basin - scale , vertical flow is increased and results in larger areas of contamination . for anisotropy values of 1,000:1 and 100:1 , the areas where deep domestic pumping is estimated to be sustainable are reduced to 89% and 52% , respectively , compared to 99% for the standard model anisotropy of 10,000:1 . such low anisotropy is not likely to occur everywhere in the basin , but there are regions where low - permeability horizontal layers may be missing , including our study location . this and other uncertainties motivated the conservative timescale and adsorption coefficients used in the modelling . the depth at which wells are screened to access low - as groundwater depends on many factors , including cost and sediment lithology . while some deep well installations have targeted the brown , oxidized sediment for their low - as groundwater , wells are often screened only a few meters into such oxidized sediments , despite a government recommendation to install wells below a clay layer . we illustrate the protective effect of greater sediment thickness with breakthrough curves at several depths ( fig . 4 ) at a specific location in central bangladesh that is vulnerable to downward as migration . at this location , flow paths are downward and travel times are short in both the deep and split pumping scenarios ( dc and sc ) . an intermediate depth of 162 m was used in the vulnerability maps ( fig . breakthrough is twice as fast when the depth into adsorbing sediments is reduced by 50 m whereas increasing depth by 50 m delayed breakthrough by a factor of 5 ( fig . the delay of breakthrough is even greater , with breakthrough occurring more than 5-fold slower at 162 m than it does at 112 m. drawing water from beyond the shallowest possible depth therefore offers considerably more protection against intrusion of shallow high - as water , but must be weighed against the increased installation and operation costs , greater drawdowns , and decreased water yields of deeper wells . the combination of in situ field measurements with basin - scale modelling presented in this study shows that as adsorption on deeper sediments significantly impedes as migration , allowing for the provision of low - as drinking water to a majority of the as - affected areas of bangladesh for the foreseeable future . this suggests that the high as concentrations observed in some isolated deep wells may not be the result of widespread contamination , but that well construction quality and naturally occurring groundwater as at depth must be considered as possible causes . modelling indicates that greater withdrawals due to increased domestic use are unlikely to trigger contamination of deep groundwater by as in most of the bengal basin . caution is needed , however , as piped water supplies for growing municipalities are developed , since this analysis considers only spatially - distributed pumping by millions of hand pumps . our results also indicate that most of the bengal basin is highly vulnerable to downward migration of high - as groundwater caused by increased withdrawals of deeper groundwater for irrigation , even with the protective effect of sorption . the use of low - as deep groundwater for irrigation should therefore be discouraged , particularly in the areas that are vulnerable to as contamination under domestic - only withdrawal scenarios ( sc and sh ) . because irrigating rice paddies with high - as groundwater can have adverse effects , alternative sources of irrigation water as well as farming less water - intensive crops our study highlights particular areas and pumping scenarios where the risk of downward migration of high - as groundwater is elevated . these findings can be used to prioritize both monitoring and water - use management of deeper aquifers . the many deep community wells currently in use throughout the country clearly need to be tested periodically to prevent renewed exposure to as . the as adsorption push - pull tests were conducted in two wells , for as(iii ) and as(v ) , using groundwater from a third well with a similar geochemical composition and all were screened at 60 m ( supplementary information ) . to limit the geochemical alteration of the groundwater , a concentrated solution of as and br was dynamically added to 1,000 litres of low - as groundwater as it was pumped from the source well into the receiving well 10 m away , such that the injected water contained 200 g l of as(iii ) or as(v ) and 50 mg l br . an inflation packer ( solinst ) adsorption was monitored through 21 individual pulls of 100 l over 9 days . the br only push - pull test employed two separate wells , screened at 65 m and 10 m apart , at the same location and injected 540 l of deep groundwater with 130 mg l of br , followed by 80 l of groundwater without tracer . after 2 days , 910 l of groundwater was continuously pumped out . batch experiments were conducted on freshly collected drill cuttings and groundwater and the slurries were prepared in the field under near anaerobic conditions within a few hours of collection . adsorption isotherms were constructed with as additions ranging from 440 to 32,000 g l and sampled after 145 hours . kinetic parameters were determined from monitoring a 3,000 g l addition of as(iii ) over 400 hours . the kinetics of adsorption was modelled by a two - step adsorption process in which a portion ( xf ) of sites react rapidly with solution , while residual sites ( 1-xf ) have equivalent reactivity but react more slowly , presumably due to diffusion . this division of sites could reflect differences in adsorption sites themselves or the physically restricted access to some sites due to intra - granular or immobile porosity . the push - pull experiments were modelled assuming homogeneous plug flow through concentric rings , each with 100 l of groundwater . since the time between pulls is large ( from 1 to 24 hours ) , the resting time was divided into 20 equal - sized time steps . the simplification to plug flow is supported by the push - pull test at the same site with only br tracer that determined dispersivity in the aquifer was small , only 0.5 cm over the 70 cm radius penetrated by the tracer , and 90% of the injected br was recovered when the injected volume was removed ( v = v0 ) . for the longer duration push - pull experiments with as , > 75% of the injected br was recovered when v = v0 . because our model neglects dispersion , we constrain our model fitting to the early part of the experiment when samples were only marginally affected by these processes ( [ br]/[br]0<0.85 ) . the first sampling point was ignored because the concentrations are changing so rapidly that small timing differences at this point significantly altered the fit of the other data ; best parameter fit was achieved by minimizing the least square differences between modelled and measured groundwater as concentrations . the sensitivity of model results to the box size was tested using a model with 10-fold smaller boxes and this did not substantially change results . transport was simulated using an initial concentration ( c0=1 ) in the upper 50 m and a constant concentration of 1 at the ground surface as a normalized representation of variable as concentrations , of which average as concentration of districts within the affected region of bangladesh range from 50 to 366 g l. model geometry and flow parameters , homogeneous over the basin , were identical to those estimated as the base case model of michael and voss , with a horizontal hydraulic conductivity of 510 m s , a vertical hydraulic conductivity of 510 m s , and a porosity of 0.2 . the longitudinal dispersivity value of 100 m was chosen as small as possible on the coarse ( 5 km 5 km ) grid while minimizing errors and preventing excessive simulation times ; this value is consistent with literature values for systems with similar spatial scale . transverse dispersivity in the horizontal direction was 0.1 m and in the vertical direction 0.01 m. the sensitivity of model results to grid spacing and numerical solver was tested . doubling the spatial discretization in the vertical and horizontal directions did not substantially change results or improve convergence , though it should be noted that even 2.5 km 2.5 km cells are very large compared to the scale of solute transport processes , so this regional study may exaggerate dispersion . the numerical solver that best minimized numerical dispersion and oscillation and mass balance errors in this case was third - order tvd .

drinking shallow groundwater with naturally elevated concentrations of arsenic is causing widespread disease in many parts of south and southeast asia . in the bengal basin , growing reliance on deep ( > 150 m ) groundwater has lowered exposure . in the most affected districts of bangladesh , shallow groundwater concentrations average 100 to 370 g l1 , while deep groundwater is typically < 10 g l1 . groundwater flow simulations have suggested that , even when deep pumping is restricted to domestic use , deep groundwater in some areas of the bengal basin is at risk of contamination . however , these simulations have neglected the impedance of as migration by adsorption to aquifer sediments . here we quantify for the first time as sorption on deeper sediments in situ by replicating the intrusion of shallow groundwater through injection of 1,000 l of deep groundwater modified with 200 g l1 of as into a deeper aquifer . arsenic concentrations in the injected water were reduced by 70% due to adsorption within a single day . basin - scale modelling indicates that while as adsorption extends the sustainable use of deep groundwater , some areas remain vulnerable ; these areas can be prioritized for management and monitoring .

You are an expert at summarizing long articles. Proceed to summarize the following text: motherhood is the most important position a woman can have in her life but can be a life threatening event as well . during pregnancy , any woman can develop serious , life - threatening complications that require medical care . in the international statistical classification of diseases and related health problems , tenth revision , 1992 ( icd-10 ) , who defines maternal death as the death of a woman while pregnant or within 42 days of termination of pregnancy , irrespective of the duration and site of the pregnancy , from any cause related to or aggravated by the pregnancy or its management but not from accidental or incidental causes . for every woman who dies , pregnancy related complications are among the leading causes of death and disability for women aged 1549 in developing countries . because there is no reliable way to predict which woman will develop pregnancy - related complications , it is essential that all pregnant women have access to high quality obstetric care throughout their pregnancies . maternal complications and poor perinatal outcome are highly associated with nonutilisation of antenatal and delivery care services and poor socioeconomic conditions of the patient . poorer outcomes are seen in unbooked than booked patients . in low- and middle - income countries , less than half of all pregnant women , the reproductive and child health programme aims at providing at least three antenatal checkups which should include a weight and blood pressure check , abdominal examination , immunization against tetanus , and iron and folic acid prophylaxis , as well as anaemia management . the risk of maternal mortality is the highest for adolescent girls under 15 years old . complications in pregnancy and childbirth are the leading cause of death among adolescent girls in most developing countries , including india . their inadequate knowledge about pregnancy care , breast feeding , and immunisation leads them to complications of pregnancy and ill health of infants . this situation is more in case of primigravida females ( pregnant for first time ) , because they have no previous experience of pregnancy . their lower educational status and other social factors limit their access to proper anc care . in recent times hence there is need to focus on all primi females to improve their utilisation of anc . although india 's rural population has doubled between 1961 and 2001 , the urban population has grown 3.6 times . the urban population growth in india represents the 2 - 3 - 4 - 5 syndrome : in the last decade india grew at an average annual growth rate of two percent , urban india grew at three percent , mega cities at four percent , and the slum population rose by five to six percent . the public sector urban health delivery system , especially for the poor , has so far been sporadic , far from adequate , and limited in its reach . although urban areas have a greater number of doctors per a thousand populations as compared to rural areas ( 80 percent of the doctors serve in urban areas ) and do not face the transport bottleneck as compared to rural areas , yet doctors are functionally inaccessible to a majority of the urban poor population . cost , timings , distance , attitude of health providers , and other factors put the secondary care and private sector facilities out of reach of most of the poor urban residents . other factors contributing to the inadequate reach of services are illegality , social exclusion of slums , hidden slum pockets , weak social fabric , lack of coordination among various stakeholders , and neglected political consciousness . the health of the urban poor is considerably worse off than the urban middle and high income groups and is maybe even worse than the rural population . thus maternal health in urban slum is not the same as can be seen from indicators of maternal health of urban area . anc services though available in enough amount their adequate utilisation among slum population is of question . factors influencing the utilisation of anc services are different for urban poor and rural areas . urban poor populations are mostly migrants and of low educational status and they live in compromised state of living condition . these women have less access to health care facilities before the illness is well advanced . this situation is directly linked to poverty ; a vast majority of poor women caught in this vicious circle are young mothers in the reproductive age , who are deprived of their basic right to be healthy . to a large extent , the national rural health mission ( nrhm ) launched in april 2005 is beginning to contribute toward addressing rural health needs . unlike rural areas that have a dedicated government healthcare structure , urban areas do not have such a structure . keeping in view the above mentioned factors , it is necessary to compare the availability of anc services in rural and urban slum areas and their utilisation by the pregnant females and the present study was an attempt towards this . present study was carried out to compare utilization of reproductive and child health care services by urban and rural primigravida ( primigravida : woman pregnant for first time ) females . the present longitudinal epidemiological study was carried out during january 2012 to march 2013 in parole primary health care centre covering seven subcentres and maternity home of cheetah camp urban health centre after taking prior approval from higher authorities including head of institutional ethical committee . community of cheetah camp and population covered by parole phc come under the department of preventive and social medicine , of tn medical college which provide preventive , promotive , curative , and rehabilitative health care services to the community in coordination with the urban health centre , health post , and municipal dispensary under m / east ward of brihanmumbai municipal corporation . data collection tools were prepared ( i.e. , consent forms and preformed , pretested , semistructured , and open - ended questionnaires ) . a semistructured questionnaire - cum - examination form was devised to collect information from a mother - child unit , pertaining to demographic and socioeconomic profile , past obstetric history , history of present pregnancy , history of delivery , infant feeding practices , immunization of infants , and history of common early childhood infections . the interview schedule - cum - examination form which was devised during the preparatory phase of the study was pretested by doing pilot study on 30 subjects each in rural and urban areas for assessment of its feasibility for use in the field . on the basis of the results of pilot study , a group of consecutive 240 primigravida ( pregnant for the first time ) women fulfilling the inclusion and exclusion criteria registered over the period of four months . from parol village , 120 primigravidae attending anc clinic in all seven subcentres were enrolled to represent rural population . to represent urban population 120 primigravidae attending anc clinic at cheetah camp maternity home the information was collected maintaining utmost privacy as per the convenience of the respondents after taking their written consent . after completion of four months after pregnancy , home visits were conducted by the investigator himself to collect information about pregnancy outcomes and immunization status of newborn children . data thus collected on the preformed questionnaire was entered in the excel sheet 2007 and analysis of the data was done using spss 19.0 package . the comparison of qualitative data was done using chi - square test . the confidence limit for significance table 1 describes that almost 17% of rural subjects were illiterate compared to urban population ( 7.5% ) . incidence of early marriage ( below 18 years ) was high in both the rural and urban study area . however , more rural subjects than urban subjects ( 46.70% rural and 34.10% urban primi females ) were married before the age of 18 years . in this study , majority of subjects were from age group 18 to 21 years , that is , 79 ( 65.80% ) in rural and 56 ( 46.70% ) in urban area . the mean age at the time of marriage was 20.39 2.15 years in rural and 21.39 2.62 years in urban group . with reference to socioeconomic class , majority of rural and urban study participants were from socioeconomic class ii [ rural : 62 ( 51.7% ) and urban : 67 ( 55.8% ) ] . majority of urban study participants [ 118 ( 98.3% ) ] were housewives and only 2 ( 1.7% ) did the job of tailoring at home . comparatively , among rural study population , only 92 ( 76.7% ) study participants were housewives . table 2 describes that , in rural area , majority of study participants had received advice for anc registration from auxiliary nurse midwives ( 52.5% ) and anganwadi worker ( 3.3% ) , whereas , in urban study participants , major source of motivation for anc registration was mother - in - law ( 34.2% ) or mother ( 30.8% ) of the participants . in addition , self - awareness for anc registration was better in urban females ( 15% ) than in rural subjects ( 4.2% ) . majority of females ( 87.5% ) in rural and urban area ( 86.7% ) had registered their pregnancy after first trimester . also 5 ( 4.2% ) study participants from rural area and 8 ( 6.7% ) from urban area did anc registration after 2nd trimester . the commonest reason for registration after second trimester in most study participants [ in six subjects ] was that they were at their native place . they were waiting to come to parents ' home at cheetah camp , where maternity home is within reach to them . in rural primigravida husbands ' counselling during the anc visit plays a crucial role in health of pregnant female . both in rural and urban areas poor involvement of husband in anc care was noted . table 3 reveals statistical significant difference between urban and rural participant about knowledge regarding ifa tablet consumption . only 32.5% of urban participants knew the importance of tt injection as to prevent tetanus . fifty percent of participants were not aware of tetanus as a complication of pregnancy which will reflect adversely during the subsequent pregnancies . few ( 3.3% ) participants from rural area would like to deliver at home for reasons like long distance of hospital and more comfort at home . six participants had not decided about the place of delivery [ 2 from rural and 4 from urban ] . eight females in rural had a wrong concept of early pregnancy ( less than 18 years ) while 3 among rural group and 9 among urban group were of the opinion that pregnancy should be planned beyond 25 years of age . surprisingly 17 ( 14.2% ) rural primi and 6 ( 5% ) urban primi were not aware of the right age to get pregnant . significantly higher proportions of urban primi 106 ( 88.3% ) were aware of the hiv / aids than rural primi 64 ( 53.3% ) . in spite of having better knowledge of hiv , very few urban subjects were aware of all the four major routes of hiv transmission , that is , 24 ( 22.6% ) . though the urban population has integrated counselling and testing centre ( ictc ) in maternity home and provision of hiv testing with counselling in phc by trust hospital in rural area , very few primi , that is , out of 120 , 32 ( 30.2% ) urban participants and 25 ( 39.1% ) rural participants , were aware of sexual route as route of transmission of hiv . about 76 ( 63.3% ) of urban primi females were counselled for hiv testing which was considerably higher than rural primi , that is , 25 ( 20.8% ) . sixty - seven percent of primi not being counselled for hiv prior to testing is ethically wrong . it was seen that only 56 ( 46.7% ) of urban subjects responded that colostrums should be given to child which was further less in case of rural subjects , that is , 47 ( 39.2% ) . only 9.2% of primi from rural area opined that prelacteal feed should be given to child which was more ( 25.8% ) among urban women . seventy - eight ( 65% ) of urban primi were aware that immunisation prevents diseases of children , whereas only 35.8% of rural primi were aware of this importance . similar to prelacteal feeds , colostrums , and hiv , the rural subjects were poor in knowledge pertaining to immunization . this was also reflected in lower age at pregnancy and poor knowledge pertaining to other components of anc among the rural participants . table 4 describes pregnancy outcome in both urban and rural participants . in rural participants more home deliveries ( 12.2% ) , less ( < 100 ) ifa tablet consumption ( 65.4% ) , more preterm babies 13 ( 12.2% ) , and more newborn babies ( 11.2% ) who had not received colostrums were noted . while in case of urban study participants , practices of prelacteal feeding and breastfeeding initiation after 24 hours of birth were more common . in terms of birth weight , 80.4% and 82.5% babies born in rural and urban area , respectively , had birth weight more than 2.5 kg . in urban area a higher proportion of subjects had undergone abortion , that is , 23 ( 19.2% ) more than rural area 13 ( 10.8% ) . among all 23 abortions in urban area , in 18 cases it occurred spontaneously and in remaining 5 cases by self - medication to abort the child due to medical and/or social reasons , while among rural participants , out of 13 abortions , spontaneous abortion occurred in 7 cases . self - medication was used by 4 cases and two study participants had undergone dilatation and curettage ( d and c ) as advised by doctor . in 14 ( 60.9% ) of urban and 7 ( 53.8% ) of rural study participants , abortions occurs due to unknown reason . probably the abortion may be the result of lower age , lower weight , poor nutritional status and delayed registration for antenatal care in both study groups . second common cause of abortion was found to be unplanned pregnancies which lead to abortion with self - medication by them . immunization status was high in case of bcg and opv0 , but it steadily declined from dpt1/opv1 to dpt3/opv3 in both rural and urban areas . present study was conducted during january 2012 to december 2012 . in the rural area majority of participants were of hindu religion belonging to the native residents of that region of maharashtra , whereas , in urban area , muslim participants were in greater number possibly because the area has been predominantly habited by muslims from southern states of india . religion brings a gambit of cultures and practices pertaining to pregnancy , nutrition , and diet in pregnancy and child rearing . adhikari and sawangdee reported that imr was significantly higher among muslim women , who had more children ( 36 per 1000 live births among women who had one child and 59 per 1000 live births among those who had four or more children ) . education is the key factor for improving quality of maternal health care and access to and utilisation of anc services . ignorance towards girl 's education was more common reason than the poverty and unavailability of the educational facility in both areas as free educational facilities existed at both places . families of many of the subjects were economically capable of educating the child , but still 35% of rural and 20% of urban subjects were educated till primary level indicating overall pathetic scenario towards girls ' education . in an analysis of the data in coverage evaluation survey by unicef , according to educational background of the respondents indicates that 34.3% were illiterate . for instance , 45% of urban women had passed high school as compared to 22.1% of rural women . bhalotra and soest in their study revealed that secondary or higher education of the mother is associated with a 2% reduction in mortality , relative to the case of mothers having no education . mentioned that significantly more malnutrition was noted in children with less educated mother . in the present study husbands of 57.5% of rural and 63.3% of urban study participants were educated till secondary level only . at the time of interview majority of the subjects were of age 18 to 21 ( 65.80% in rural area and 46.70% in urban area ) . as all the subjects were primigravidae , this indicates that many of the married girls had become pregnant around the age of 20 years . this early age of getting pregnant has significant impact over the mother 's health and also her attitude towards self - care . adolescent girls are not mature enough physically and mentally to decide how to improve their health . agnihotram reported risk to maternal health as in case of lower age of becoming pregnant . among teenage mothers ( 1519 ) death due to abortion is the highest , followed by bleeding of pregnancy , anaemia , and toxaemia study total of 46.70% of rural and 34.10% of urban primi females married before the age of 18 years indicating the existence of tradition of early marriages in our country . reason for this could be insecurity of safety of young daughters among parents , traditions , culture , mass psyche , feeling that girls are profitable only to in - laws if they earn , and fear of not finding an equally suitable groom for a well - educated girl . this early marriage put them early in pregnancy as only minute number of primi planned their pregnancy to be delayed after 20 years . low education further makes them unaware of available contraceptive methods which could be utilised for delaying the pregnancy . this indicates a need to focus on adolescents particularly with a view to delay their age at marriage . this will improve the chances of survival and better health for both mothers as well as infants / neonates . singh and arora found that lesser percentage of abortion or still births were reported in current pregnancy as compared to first pregnancy . this implies that there is a need to focus on enhancing the quality of antenatal care particularly for primi pregnant females . their study revealed that overall 2.6% pregnancies resulted in stillbirth . in rural area in spite of having low educational status , 23.3% were engaged in some kind of work like in farm or brick furnaces . in urban area almost all , that is , 98.3% , of the females were unemployed and were confined to staying at home . the reason could be that low education can only fetch a pity job in city with low earning or travel associated with working status in city may be the hindrance . besides most husbands in urban area were working in the locality and possibly earning sufficient money . also many subjects had migrated after marriage from other parts of country and were new to the city . majority of study participants belonged to class ii and very few in both areas to class iv . revealed that mothers belonging to upper socioeconomic background ( 82.36% ) preferred hospitals for delivery and those from lower ( 66.6% ) and middle ( 57.83% ) socioeconomic group preferred home . they also had false notion about ifa tablet consumption that ifa tablets should be started after 3 months and that was the time of anc registration . this was probably because of their younger age at pregnancy as well as poor educational status , not following advice given by peripheral staff , and distance from nearest health care facilities . nfhs 3 data shows that although 76% of women who had a live birth in the five years preceding the survey received antenatal care , only 44% started antenatal care during the first trimester of pregnancy , as recommended . another 22% had their first visit during the fourth or fifth month of pregnancy . just over half of mothers ( 52% ) had three or more antenatal care visits . urban women were much more likely to have three or more antenatal visits than rural women . according to coverage evaluation survey by unicef , the proportion of women who received three or more antenatal checkups was higher in urban ( 82.7% ) than rural areas ( 63.3% ) . an analysis of the timings of the first antenatal checkup shows that 59.2% of women received the first antenatal checkup in the first trimester . urban women ( 70.4% ) were more likely to receive anc in the first trimester than rural women ( 54.9% ) . this can be reflected from the fact that comparatively there were more full term deliveries among urban ( 91.8% ) subjects who were more educated than that of among the rural subjects ( 87.8% ) . adekanle and isawumi reported that those who had primary school education or none , 152 ( 85.4% ) , were more likely to register late compared to those who had secondary school education and above , 215 ( 79.3% ) . study participants in both rural and urban area had poor knowledge and awareness about ifa tablet consumption . also they had poor knowledge about importance of tt injection . according to coverage evaluation survey by unicef , the percentage of women receiving ifa supplements was comparatively more in urban ( 86.1% ) than rural areas ( 79.6% ) . even though many of the subjects had married at lower age , very few had tried to postpone the first pregnancy with the use of contraceptive method . lack of decision making power about family planning , tradition of proving capability to bear a child after marriage , unawareness about need for delaying pregnancy , and male apathy towards contraception may be the factors responsible for nonutilisation . reported lack of contraceptive knowledge among women participated in study , which could be due to the lack of education regarding contraceptive methods among adolescents . in present study we found that average daily calorie intake in rural area was 1902 235 kcal whereas in urban area it was 1937 262 kcal . women who are undernourished themselves are also much more likely than other women to have children who are undernourished . according to nfhs 3 data , more than one - third ( 36% ) of women of age 1549 in india have a bmi below 18.5 indicating chronic nutritional deficiency , including 16% who are moderately to severely thin . the proportion of ever - married women who are thin ( 33% ) has decreased slightly from 36 percent in nfhs-2 . in present study few participants in rural area preferred home delivery because of lack of health facility near home and being more comfortable at home . khan et al . found that an important barrier to acceptance of services is economic constraint . a total of 30% of the families from the urban slum in the study said they were unable to afford services even in government hospitals because of the cost of medicines and investigations , even though consultation was free . they visited hospitals because of complications during delivery in the current or an earlier pregnancy . evidence suggests that demand side barriers such as cost of services are important barriers to obtaining services , especially in poor and vulnerable groups . . carried out a study in sub - saharan africa ( ssa ) . in nine countries they have asked common reasons for preference of home birth to going to a facility . the responses from these nine countries grouped into three groups cost , access , and being not necessary . in this study comparatively good knowledge was found in urban subjects about complications during pregnancy at younger age ( < 18 years ) . in this study , facilities for hiv counselling were available in both the rural and urban but still mothers ' knowledge was not good enough . though having heard of hiv , awareness of modes of transmission among the subjects was very poor . nfhs 3 data reveals that only 40% of currently pregnant women know that hiv / aids can be transmitted from a mother to her child and only 15% are aware that transmission from a mother to her baby can be reduced by taking certain drugs . in comparison , the knowledge was indeed poor among both the urban and rural subjects in present study and is an issue of concern . during the antenatal checkups , women were supposed to be counselled for danger signs during antenatal period and should be told about where to go for treatment when such problems arose . the effectiveness of antenatal checkups in ensuring safe motherhood depends on tests and measurements done and the advice given during antenatal checkups . this study demonstrates that knowledge of complications like leaking per vaginum ( pv ) , bleeding pv , convulsion , oedema feet , and loss of foetal movement was found to be good in both areas . according to nfhs 3 data many women do not receive high quality antenatal care and only 36% received information about pregnancy complications . early initiation of breastfeeding was more common among children born in an institution and children of mothers who received anc services . poor knowledge of initiation of breastfeeding like giving first feed after one day was found more in urban subjects , that is , 16.7% , than in rural subjects , that is , 7.5% . this had reflected after delivery as 1.7% from urban and 2.5% from rural mothers delayed breastfeeding after one day . in the coverage evaluation survey 2009 , information on breastfeeding practices was obtained from women who delivered in the past 12 months . data revealed that 33.5% of mothers reported that they started breastfeeding the child within one hour of birth , and 24.2% began breastfeeding within 1 - 2 hours after delivery . women from rural areas ( 34% ) were slightly more likely to initiate breastfeeding within one hour as compared to women from urban areas ( 32.3% ) . comparison between two groups shows that more urban subjects ( 467% ) than rural ones ( 39.2% ) opined about giving colostrum to the child . after delivery 24.2% of rural subjects had not given colostrums to child compared to 10% of urban subjects . significant difference was found in urban subjects ' knowledge of colostrums feeding and actual colostrums feeding after delivery which might be due to better educational status and higher number of institutional deliveries among the urban subjects . in coverage evaluation survey by unicef ( 2009 ) data illustrated that 85.3% of women who delivered during the past 12 months fed colostrums to their children . colostrum feeding was practiced a little more by urban women ( 87.2% ) than by women from rural areas ( 84.6% ) . study reveals that there was a steady and significant decrease in the number of primigravid abortions in the study years from 8.3% in 2000 to 4.2% in 2004 . there has been a campaign regarding adolescent health and sex education in the state with the advent of hiv epidemic in the recent years . it might be due to increased awareness about sexuality and safe sex . to achieve national target of 80% institutional delivery emphasis in current study , home delivery incidence was more in rural , that is , 11.7% , than in urban , that is , 10% subjects . reason for home delivery was found to be due to inaccessibility and transport problem to health system in rural area while in urban area because of traditional belief that delivery was a natural process and could be safely done at home . coverage evaluation survey by unicef ( 2009 ) found that muslim women were less likely to go for institutional deliveries than women from other religious groups . further analysis shows that institutional deliveries were significantly higher among better educated women and those from households belonging to higher wealth quintiles . for instance , only 53.5% of the illiterate women delivered in institutions and this percentage increased to 93.1% among women who had passed higher secondary . rural - urban differentials existed with regard to place of delivery and the person attending the home delivery across the states / union territories . in rural areas , institutional deliveries ranged from 24.3% in nagaland to 100 percent each in kerala and goa . in 14 states institutional deliveries in urban areas ranged from 60.0% in nagaland to 99.7% each in kerala and goa . in this study 65% of urban and only 35.8% of rural were aware about the importance of immunisation as to prevent transmission of diseases to children . knowledge of timing of vaccination was also poor because only 12.5% of urban and 10% of rural subjects knew that first vaccine should be administered at birth or within three days . in coverage evaluation survey conducted by unicef ( 2009 ) around three - fifths ( 58.1% ) of the mothers knew about all the four vaccines that need to be given to the child within the first year of life . awareness was comparatively higher among mothers from urban areas ( 68.1% ) than that of rural areas ( 54.3% ) . vaccination coverage was better in case of bcg and opv0 and poor in case of dpt3 , opv3 , and hbv3 in both groups . they have reported that in urban slum of mumbai bcg and opv0 vaccine doses had the maximum coverage ; but as the age advanced , frequency of individual vaccination decreased . utilization of maternal and child health care ( mch ) services was poor in both urban and rural areas . awareness of women regarding her health assumes special significance in the indian context because the maternal health problems are mainly due to ignorance , poverty , and lack of knowledge regarding the issue . it is therefore very important to first focus on services for the increasing awareness level of the mother . a sustained and focussed iec campaign to improve the awareness amongst community on mch will help in improving community participation leading to sustaining and improving the quality , accessibility , and utilization of maternal health care services provided by the government agencies in both rural and urban areas .

maternal complications and poor perinatal outcome are highly associated with nonutilisation of antenatal and delivery care services and poor socioeconomic conditions of the patient . it is essential that all pregnant women have access to high quality obstetric care throughout their pregnancies . present longitudinal study was carried out to compare utilization of maternal and child health care services by urban and rural primigravida females . a total of 240 study participants were enrolled in this study . more illiteracy and less mean age at the time of marriage were observed in rural population . poor knowledge about prelacteal feed , colostrums , tetanus injection and iron - follic acid tablet consumption was noted in both urban and rural areas . very few study participants from both areas were counselled for hiv testing before pregnancy . more numbers of abortions ( 19.2% ) were noted in urban study participants compared to rural area . thus utilization of maternal and child health care ( mch ) services was poor in both urban and rural areas . a sustained and focussed iec campaign to improve the awareness amongst community on mch will help in improving community participation . this may improve the quality , accessibility , and utilization of maternal health care services provided by the government agencies in both rural and urban areas .

You are an expert at summarizing long articles. Proceed to summarize the following text: a 62-year - old male was transferred to the emergency department due to presyncopal attacks developed after taking pilsicainide . the patient has history of paroxysmal atrial fibrillation and stroke and was treated by cibenzoline 300 mg / day in combination with adequate anticoagulation . since his atrial fibrillation could not be suppressed by cibenzoline alone , his home doctor prescribed additional pilsicainide of 100 mg for pill - in - the - pocket treatment . this was a first attempt of the pill - in - the - pocket treatment for this patient . his electrocardiography ( ecg ) on arrival shows 2 to 1 atrial flutter , interventricular conduction disturbance , and coved - type st segment elevation in leads v1 - 2 consistent with type i brugada ecg1 ( figure 1 ) . his previous ecg taken during daily cibenzoline treatment antiarrhythmic drugs were terminated after admission and the ecg returned normal and his clinical course was uneventful . based on the ecg findings on admission one possibility is due to nonsustained ventricular fibrillation which was associated with brugada syndrome , and another possibility is 1 to 1 atrio - ventricular conduction during the atrial flutter . sodium channel blockers are now widely used for rhythm control therapy for paroxysmal atrial fibrillation.2 however , physicians must care for the side effects . the class ic drug can unmask brugada syndrome or induce atrial flutter called ic flutter . the pill - in - the - pocket treatment for atrial fibrillation is recognized as safe and effective therapy for the rhythm control for the atrial fibrillation.3 it is important that this therapy should be applied after confirming the drug safety to the patients .

rhythm control therapy by sodium channel blockers is widely performed for the treatment of paroxysmal atrial fibrillation . here , we present a case of acquired brugada syndrome by pill - in - the - pocket treatment using pilsicainide . it is important that this therapy should be applied only after confirming the drug safety to the patients .

You are an expert at summarizing long articles. Proceed to summarize the following text: it is unclear how these commensals regulate immunologic responses to food antigens , but there is mounting evidence that the microbiological environment of the intestine has a profound influence on oral tolerance [ 15 ] . in addition to the commensals and pathogens residing in the intestine , food products are often contaminated by a wide array of bacteria and fungi . it is likely that contaminating organisms can shape oral tolerance to foods . while all microbial pattern recognition receptors ( prrs ) are likely to have some relationship to food tolerance and allergen processing , tlr2 may be of unique importance due to its expression by intestinal epithelial cells ( iecs ) and dendritic cells ( dcs ) in the intestinal environment . moreover , a majority of commensal bacteria are gram - positive and thereby have a high capacity for activation of tlr2 [ 6 , 7 ] . tlr2 is important in identifying bacterial and fungal wall components , but it must first combine as a heterodimer with tlr1 or tlr6 . the tlr1/2 heterodimer responds to triacyl lipopeptides , while the tlr2/6 heterodimer responds to diacyl lipopeptides and peptidoglycan . both heterodimers of tlr2 signal through the myd88-dependent pathway leading to transcriptional activation of nf-b [ 11 , 12 ] . tlr2 is expressed by a wide range of cells relevant to mucosal immunity and tolerance including iecs , dcs , t cells , and b cells . while the activation of these tlr2-mediated inflammatory responses is adaptive in the context of pathogenic infection , we are in the early days of understanding how this axis impacts oral tolerance to foods and commensal bacteria . regulation of iec permeability [ 14 , 15 ] and the enteric nervous system both rely on tlr2 . furthermore , although the mechanisms are controversial , several studies report exacerbation of inflammatory bowel disease in the absence of tlr2 [ 15 , 17 ] . this suggests a critical role for tlr2 in regulating the intestinal microenvironment and local inflammation . a definitive role for tlr2 expression and activation in the orchestration of tolerance to food antigens has not been characterised . however , growing evidence points to tlr2 as an important factor directing the immunological balance between tolerance and active immune responses to allergens . tlr2 polymorphisms have been associated with deficits in immune regulation such as inflammatory bowel disease , allergic asthma , and atopic disease [ 1821 ] . notably , a recent study by nawijn et al . demonstrated that intranasal tlr2 activation concurrent with aerosolized allergen promoted the expansion of allergen - specific regulatory t cells ( tregs ) and accordingly suppressed asthma in mice . this is consistent with an earlier observation that sublingual tlr2 agonist therapy concurrent with allergen exposure can abrogate airway hyperresponsiveness in mice . a multitude of studies demonstrate that tlr2 stimulation with systemic or mucosal administration of synthetic agonists can prevent antigen presenting cells from eliciting a th2-polarized response , thereby reducing ige antibodies and allergenicity in murine asthma models [ 2427 ] . while it is apparent that the delivery of tlr2 agonists via a mucosal route can protect against airway disease in mice , the impacts of tlr2 activation on the processing and tolerance to foods have yet to be characterized . interestingly , many common foods such as processed meats , chocolate , yoghurt , and cheese contain tlr2 activators . iecs in both the small and large intestine express tlr2 , although the distribution and localisation of tlr2 ( luminal versus apical ) within the cell may vary . in addition , this receptor is expressed by multiple traditional immune effector cells , as described above , often in both intracellular and extracellular compartments . iecs are bathed in an environment replete with tlr2 agonists , such that these cells are probably calibrated to function amid a constitutive level of activation . accordingly , in tlr2 animals , the iec tight junctions are compromised [ 14 , 15 ] . furthermore , tlr2 stimulation promotes tight junctions that could have implications for food processing and the antigen dosage presented to t cells . defects in tlr2 are associated with inflammatory bowel disease [ 15 , 17 ] and inappropriate innate responses to intestinal tissue injury in mice . conversely , intestinal regulation and treg levels were unchanged in tlr2 mice in a chronic model of inflammatory bowel disease . these divergent results may highlight differential roles of tlr2 in chronic inflammation versus acute inflammatory models such as dextran sodium sulphate ( dss ) colitis and the different immune cells and mediators driving these models over their respective timeframes [ 15 , 17 ] . it stands to reason that , in the absence of tlr2 , the resulting leaky epithelium could allow amplified allergen dosing and exacerbated allergic responses . the impact of this increased permeability during the initial antigen tolerizing stage is not known . interestingly , it has also been suggested that iecs are largely unresponsive to tlr2 stimulation , despite their tlr2 expression . this is believed to be an adaptive mechanism to prevent uncontrolled intestinal inflammation in response to the constant barrage of tlr2 agonists from gram - positive commensals . consistent with this , tlr2 expression is higher in iecs of the colon compared to the small intestine where earlier food antigen exposure occurs and oral tolerance is thought to be established . tlr2 functions both as a heterodimer with tlr1 or tlr6 and also potentially as a homodimer . pam3csk4 is a selective ligand for the tlr1/tlr2 heterodimer , while tlr6/tlr1 responds to other ligands such as fsl-1 . the distinct role of tlr6 is of particular interest since it is expressed on only selected cell types in the intestine , while tlr1 is much more widely expressed . in a very recent study , cells from the intestinal lymphoid tissues activated with anti - cd3 were shown to be more effectively polarized towards th17 and th1 responses by treatment with fsl-1 than with pam3csk4 . using a dss model of colitis in parallel studies of human tissues , tlr6 expression was found to be correlated with the levels of rorc mrna in inflamed intestines of ibd patients . these results could suggest a role for tlr6 in ibd therapy and have potential implications for the development of t cell responses in the context of tlr6 activators . clearly , the roles of tlr signaling in the context of inflammatory intestinal disease are not limited to the tlr2 molecule alone . eosinophils represent an important aspect of chronic allergic disease , and tlr2 may have a key relationship to eosinophils in the mucosal environment within the context of allergy and gastrointestinal inflammation . in animal studies , tlr2 expression and activation were sufficient to facilitate eosinophil recruitment and tissue eosinophilia of the large intestine in the context of experimental colitis . similarly , eosinophil recruitment to the large intestine and the subsequent chronic inflammatory responses were tlr2-dependent during parasitic schistosoma mansoni infection in mice . a causal link has not been established , but patients with eosinophilic gastrointestinal diseases experience elevated rates of asthma and allergy with up to 76% of patients testing positive for food allergen skin pricks . ige class switch recombination and local ige production are also both significantly higher in patients with eosinophilic esophagitis . by contrast , the mucosal administration of a synthetic tlr2 agonist in the airways reliably reduced eosinophilia of the lungs in murine asthma models [ 24 , 26 , 38 ] . tlr2 stimulation therefore has different outcomes on eosinophil tissue homing depending on the activation site and inflammatory status of the tissue in question . the induction of tlr2-dependent eosinophil homing to the intestine may impact the th2 polarization of antigen responses and ultimately alter allergic inflammation or the ongoing regulation of responses to food and the microflora within this compartment . the interplay between the nervous system and the immune system can be critical for homeostasis and effective immunity . this is particularly true in the intestine where the enteric nervous system ( ens ) modifies intestinal motility and epithelial barrier function . tlr2 has been shown to be expressed on enteric neurons , glia , and smooth muscle cells of the intestinal wall . tlr2 mice demonstrated disrupted ens architecture as well as intestinal dysmotility that could be corrected by the addition of glial cell line - derived neurotrophic factor ( gdnf ) . the increased susceptibility to dss colitis exhibited by tlr2 mice can be abrogated by treatment with gdnf . notably , wild type mice depleted of intestinal microbiota had similar defects in the ens and intestinal motility to mice deficient in tlr2 . it is not yet clear whether the substantial impact of tlr2 deficiency on ens function is direct or via secondary effects on the microbiota . however , tlr2 has been implicated in the response to nerve injury in other tissues via the action of local macrophages , confirming the importance of this receptor to neuronal function regardless of microbial influences . oral tolerance can be defined as antigen - specific humoral and cellular hyporesponsiveness following oral antigen exposure [ 40 , 41 ] . tolerance is readily induced in mice and humans following oral treatment with food antigen , and food allergy is often considered to result from a failure of oral tolerance mechanisms . the complex process of oral tolerance is known to involve several different cell subsets within the gut associated lymphoid tissues , perhaps most notably the tregs which are required for the induction and maintenance of tolerance to foods [ 4346 ] . several studies have directly investigated the impact of tlr2 activation on t cell homing and function . wang et al . demonstrated that tlr2 and myd88 are necessary for dcs to imprint t cells with intestinal homing markers 47 and ccr9 . this homing is pertinent in light of evidence that treg intestinal homing to the lamina propria is essential for the ongoing maintenance of oral tolerance to foods . importantly , lamina propria dc subsets were shown to have high expression of tlr2 relative to other lymphatic dc populations . however , among lamina propria dcs , the cd103 cells , known to be tolerogenic , had lower tlr2 expression compared to other subpopulations . this suggests that tlr2 expression on dcs may not be necessary to drive treg differentiation . the expression of foxp3 , associated with treg development , is abrogated by tlr2 signaling events within the t cell . similarly , tlr2 activation with the lipopeptide pam3csk4 can abrogate the suppressive capacity of tregs and dcs in vitro [ 5052 ] . paradoxically , a systemic administration of pam3csk4 promoted the expansion of adoptively transferred tregs in vivo but mitigated their suppressive activity in mice . it may be that the source of tregs , natural or inducible , impacts the nature and sensitivity of responses to tlr2 stimulation . it is difficult to reconcile the data above regarding tlr2 abrogation of treg function , which may be most relevant to oral tolerance induction , with the observation that tlr2 can support the induction of tregs in the context of commensal microbes ; but there is mounting evidence that tlr2 activation by intestinal commensal bacteria can promote local regulatory responses . microbiota are important for the appropriate maturation of intestinal immunity and this can complicate the interpretation of experimental studies examining the role of bacterial flora in specific immune responses . however , elegant studies with bacteroides fragilis in mice have shown that tregs induced by tlr2 activation with the unique bacterial polysaccharide a are necessary for successful intestinal colonization [ 53 , 54 ] . similarly , the probiotic bifidobacterium infantis promotes tregs and regulatory cytokine production in humans and functions via tlr2 . it was also recently demonstrated that probiotic bifidobacterium breve induces regulatory il-10 secreting tr1 cells via tlr2 stimulation of cd103 dendritic cells , thereby reducing inflammation in the large intestine . treatment with bifidobacterium components or the tlr2 activation of mast cells by pam3csk4 has even been reported to suppress ige - mediated mast cell degranulation in vitro and in vivo . while recent studies show a clear relationship between some commensals and immunologic tolerance , the antigen - specificity of these treg responses has not been adequately characterized . moreover , studies exploring commensal treg induction and the resulting suppression of inflammation tend to examine responses in the colon and cecum , while little attention has been paid to the relationship between commensals and tregs in the small intestine . the small intestine is an important site of food tolerance induction , and few studies have addressed the role of commensal colonization on food allergy . we do know that commensal bacteria are required for appropriate levels of tregs to be established in the mln , and without them oral tolerance is inadequate as shown by studies in germ - free ( gf ) mice . furthermore , it has been proposed that the inability of gf mice to establish oral tolerance may be directly related to the failure of these mice to establish adequate t cell populations in the pps . several studies have also shown that gf mice display a more th2-polarized response to oral antigens , resulting in ige antibody production specific to oral antigen and a failure to be tolerized [ 6062 ] . a recent study by noval rivas et al . demonstrated that variations in the murine commensal flora will dictate the balance between oral tolerance and allergy to oral antigen through involvement of treg populations . the changes in treg and humoral responses to food antigen in the context of commensals are likely to implicate tlrs , but more directed investigations must be carried out to fully understand the precise role of tlr2 signaling in food tolerance . iga is the most abundant mucosal antibody , with an average of 5 g secreted daily in human feces . iga occurs both as a monomer in serum and as a dimer bound by the j - chain . the iga dimers are translocated to the gut lumen and to other mucosal surfaces by the poly - ig receptor ( pigr ) on iecs , where the antibodies participate in the immune exclusion of microbes . the relationship between secreted iga and food allergy has not been fully elucidated , but patients with selective iga deficiency demonstrate impaired mucosal immunity and deficits of intestinal regulation that correlate with higher rates of food allergy and inflammatory bowel disease [ 64 , 65 ] . further to this , secreted iga has been correlated with improved tolerance to peanut challenge in allergic patients . both serum and secreted antigen - specific iga have been shown to prevent oral anaphylaxis and allergic diarrhea in mice , suggesting that iga responses can be protective in the context of an oral allergen challenge . elevated secreted iga has been documented in mice treated with oral food antigen compared to nave animals , and antigen - specific iga is detected in the serum of mice upon oral immunotherapy treatment . thus , it appears likely that robust iga production is related to protection against allergic responses to food . tlr2 stimulation has well - documented effects on b cell activation and local iga responses . therefore , in addition to activating iecs , dcs , and t cells in the mucosal environment , tlr2 ligands can act directly on b cells . it was recently reported that tlr2 activation of resting murine b cells in concert with cd40l stimulation can dramatically enhance proliferation , class switch recombination , and plasma cell differentiation [ 72 , 73 ] . has also shown that tlr2 activation of b cells enhanced their ability to respond to cd40 stimulation by t cells upon antigen presentation . consistent with this , pam3csk4 treatment of nave human peripheral b cells results in production of il-6 and il-13 , both of which can promote b cell activation and antibody production . of particular relevance to oral tolerance , tlr2 stimulation of b cells with synthetic lipopeptide resulted in the proliferation of peyer 's patch b cells and subsequent antibody production in a murine model . furthermore , stimulation of human b cells with tlr2 agonists promotes iga production , j chain production , and the expression of intestinal homing markers ccr9 and ccr10 . prior to the characterization of tlr2 , an older study with lipopeptides found that oral administration of pam3csk4 ( now known to be a tlr2/1 agonist ) concurrent with oral antigen promoted significant antigen - specific plasma iga and secretory fecal iga responses in a murine model . finally , expression of the pigr and transcytosis of iga dimers across iecs are impaired in the absence of myd88 signaling . taken together , these findings identify key roles for tlr2 in regulating b cell maturation , expansion , homing , iga production , and even iga secretion . evidence points towards b cell activation and iga production as necessary to contain commensal microbes to the intestinal lumen [ 78 , 79 ] . the same principle may apply to food antigens , but the antigen - specificity of activated b cells is at issue . further investigation is necessary to elucidate whether bystander tlr2 activation of intestinal b cells by commensal bacteria or food contaminants is capable of promoting expansion of food - specific b cells and the associated iga response . tlr2 stimulation promotes intestinal barrier function , b cell maturation , mucosal homing , and iga responses ( figure 1 ) . however , most reports indicate that the direct impact of tlr2 stimulation on tregs is to suppress their function once induced , and systemic tlr2 activation promotes intestinal homing of eosinophils during intestinal inflammation and impacts enteric nerve function ( figure 1 ) . it is likely that the tlr2-dependent axis of regulation and allergic sensitization is plastic and responsive to changes in tlr2 agonist dosing . furthermore , the physiological site of activation may be critically important in dictating subsequent responses . for example , constitutive low grade commensal tlr2 stimulation may support tolerance to foods , but a breach in the mucosal barrier and amplified tlr2 agonist dosing may promote local inflammation and sensitization to bystander food antigens . such a scenario needs to be tested experimentally in order to better understand the relationship between tlr2 and food allergy . finally , a dedicated comparison between tlr2 activation in the small and large intestine and the subsequent treg and b cell responses would be extremely important for understanding the implications of tlr2 in food tolerance and allergy . unfortunately , the most fundamental question remains unanswered : does tlr2 activation support or disrupt human oral tolerance to food antigens ? as described above , a number of lines of evidence suggest that this may be the case , but there is insufficient evidence available to move forward with tlr2 targeted prevention or treatment strategies . with the current interest in host - commensal interactions and the growing importance of food allergy , we are sure to see rapid advancements in this area that will have implications both for allergic disease and for effective oral immunization .

food allergy , other adverse immune responses to foods , inflammatory bowel disease , and eosinophilic esophagitis have become increasingly common in the last 30 years . it has been proposed in the hygiene hypothesis that dysregulated immune responses to environmental microbial stimuli may modify the balance between tolerance and sensitization in some patients . of the pattern recognition receptors that respond to microbial signals , toll - like receptors ( tlrs ) represent the most investigated group . the relationship between allergy and tlr activation is currently at the frontier of immunology research . although tlr2 is abundant in the mucosal environment , little is known about the complex relationship between bystander tlr2 activation by the commensal microflora and the processing of oral antigens . this review focuses on recent advances in our understanding of the relationship between tlr2 and oral tolerance , with an emphasis on regulatory t cells , eosinophils , b cells , iga , intestinal regulation , and commensal microbes .

You are an expert at summarizing long articles. Proceed to summarize the following text: cancer is an increasing problem in low- and middle - income countries , with high mortality . cancer kills more people in the world each year than aids , tuberculosis , and malaria combined , with cancer accounting for 78 million deaths ( at least four million in low - income countries ) , aids in about two million deaths , tuberculosis in about 1.3 million deaths , and malaria in about 860,000 deaths.1,2 by 2020 , the global annual cancer incidence burden will be 20 million ( 70% in low- and middle - income countries ) and the annual death burden is expected to exceed 10 million.3 each year an increasing proportion of the global cancer burden is occurring in low- and middle - income countries , and , because of their large populations , in the countries of asia . the incidence rates are increasing , and mortality rates from most cancers remain high in many resource - poor countries.5 there are two general differences between higher- and lower - income countries . first , smoking - related cancers are increasing in low - income countries and decreasing in higher - income countries , and the burden of cancer in women is increasing worldwide . second , the burden of infection - related cancers is much greater in low - income countries than in high - income countries ( 25% versus 6% , respectively).4,5 progress against cancer in high - income countries has been modest and has come at extraordinary expense . incidence and mortality rates for some cancers have declined in selected western countries , including the us . these salutary trends are consequent to multiple factors , and have occurred mostly in groups with higher socioeconomic status . by the international standards suggested by the world health organization ( who ) commission on macroeconomics and health,6 few systemic interventions for cancer are significantly cost - effective . although few proven public health approaches are available , several hold promise , and some preventive interventions will also have beneficial effects on other chronic diseases . for example , antitobacco efforts , which have been successful in high - income countries , can be modified and duplicated with expectations of success in less resource - rich settings . the availability of effective human papilloma virus vaccines holds promise for a major reduction in uterine cervical cancer rates . in contrast , many specific cancers are of relatively low incidence , and therapeutic strategies developed in high - income countries are generally very costly . first , as suggested by a recent institute of medicine report,7 better cancer control is possible in truly developing countries by appropriate country - specific planning and policies which follow on from already available knowledge . national cancer control plans8,9 ( as described by the who , 2002 ) , and the recent who modular reports on cancer control : knowledge into action , who guide to effective programs ; planning , prevention , early detection , treatment and palliative care ( 20072008 ) . tobacco control ( following the framework convention on tobacco control ) , hepatitis b virus vaccination ( working with the global alliance for vaccines and immunization gavi ) , human papilloma virus vaccination , diet and nutrition ( who report , and report of world cancer research fund / american institute of cancer research , 2007 ) , centers of excellence ( international atomic energy agency programme of action for cancer therapy - pact ) , palliative care / pain control strategies ( as suggested by the who and international narcotics control board ) , surveillance and monitoring ( implementation as recommended by the who - stepwise approach to chronic disease risk factor surveillance : steps ; and the institute of medicine report ) . building on these international recommendations and resources requires leadership , political will , some level of country - specific financial resources , and rigorous evaluative and problem - solving approaches . second , emerging data indicate that transmissible / infectious agents or nutritional components and excesses contribute to , or are responsible for , the majority of global malignancies , explain the very large differences in cancer incidence between different populations , and account for most cancer deaths worldwide.4,5,10 stomach ( helicobacter pylori - associated ) , liver ( hepatitis b - associated ) and uterine / cervical ( human papilloma virus - associated ) cancers account for the overwhelming majority of the 25% of cancer deaths currently occurring in low- and middle - income countries . the increasing data associating diet , physical inactivity , and obesity , and increased incidence of several cancers ( breast , colorectal , and prostate ) have led to the recommendations of the world cancer research fund report.9 despite these circumstances , research resources directed towards understanding and treating these causes are relatively limited in low- and middle - income countries . specifically , the association between hepatitis b and liver cancer is long - known , and population - effective vaccination programs have been implemented in some countries ( eg , taiwan ) , but liver cancer still causes approximately 750,000 deaths annually , reflecting an absence of population vaccination coverage . for nutrition - related cancers , such as colorectal and prostate malignancies , the very low rates of these cancers in india , for example , offer important opportunities to investigate protective dietary factors . globally , the number of etiologic or interventional studies targeted towards these infectious and dietary issues is disproportionally low in comparison with their emerging public health significance . third , with respect to cancer diagnosis and systemic treatments other than surgery , which in most countries consumes the vast majority of resources allocated to cancer , knowledge is limited regarding specific effective applications of almost exclusively western population - derived information in low- and middle - income countries . breast cancer incidence in high - income countries is five times greater than in many low - income countries.11 this situation alone makes the costs of breast cancer screening and its cost - effectiveness less attractive in a low - incidence , low - income country . despite expectations that significant downstaging of disease at diagnosis and an associated decrease in case fatality should be associated with well - conducted screening , clinical breast examination , and cervical inspection with acetic acid , the first results of a rigorous indian clinical trial testing these interventions in 151,538 women after three rounds of screening at two - year intervals , have shown a statistically significant downstaging for cervical cancer , with a developing trend for improved case fatality , but limited evidence for downstaging of breast cancer and no improvement in case fatality.12 the biology and treatment of cancer exhibit significant differences between populations because of genetic differences in tumors and hosts ( which affect metabolism and thus the efficacy and toxicities of systemic treatments),1315 and in other lifestyle and environmental factors . increasingly , treatments are being designed for specific subgroups of patients with genetically - defined tumor changes . to study these treatments requires casting a wide net to recruit adequate numbers of study subjects in a timely manner . parenthetically , new evidence suggests that we can not consider all high - quality technical surgical interventions to be equivalent because host factors at the time of surgery may be associated with long - term outcomes.16 we are only beginning to understand the complex interrelationships of mind and body involved in sickness , and the interactions of cultural and personal representations of illness . additionally , medical interventions of all kinds vary dramatically in their feasibility , with favorable and unfavorable effects depending on psychosocial and cultural circumstances , particularly poverty . finally , western experiences in quality - of - care improvements have highlighted the challenges of defining truly effective interventions . improvements require changes to be made within complex systems , and unintended consequences often occur.17 in these contexts , interventions for cancer beyond surgery in previously unresearched populations ( ie , in any other than generally well - off western caucasian populations ) must be considered of uncertain benefit , and a formative evaluation strategy for application of any intervention in new populations is the safest approach . the current practice in low- and middle - income countries for wealthy people is that they are offered treatments which are essentially duplicative of perceived state - of - the - art care in high - income countries , with no attention paid to probable biologic / genetic differences in tumors and hosts . first , accumulating evidence suggests that there are different alleles of genes critical to the conversion of tamoxifen to its active metabolite , endoxifen . among asian populations the more prevalent gene forms lead to limited endoxifen levels and therefore likely limited benefits from this treatment.15,18 second , doxorubicin is an effective chemotherapeutic agent in breast cancer , but again variants in gene alleles are important in its metabolism , leading to greater individual patient exposure to cardiotoxic breakdown products . are more common among chinese women , in whom permanent iatrogenic heart damage is much more frequent , which changes the risk - benefit calculations for use of this drug.15 third , for the majority of individuals in low- and middle - income countries , cancer care is catch - as - catch - can and limited in many ways . it is difficult to support these last two statements with specific and rigorous quantitative data , but after 15 years of on - site visits and patient management discussions with physicians in vietnam , philippines , china , bangladesh , and , less frequently , in several other asian and african countries , it is probable that they are correct . fourth , currently defined useful systemic interventions for cancer are generally only widely applied in wealthy countries . the who commission on macroeconomics and health has suggested that the cut - off for cost - effective interventions should be that a country s per capita annual income should gain a year of life.6 by this standard , only a few current systemic interventions for cancer are cost - effective in most countries . public health policies are well - defined for important aspects of cancer , but optimal strategies for carrying these out in individual countries are poorly described and evaluated . research on a global scale regarding the likely transmissible agents and nutritional causes for the majority of cancers and their management is limited . rigorous evidence regarding screening for certain cancers , such as breast and cervical , is lacking in low - income countries . effective ( but often significantly toxic ) strategies in selected ( genetic ) populations have been developed , but these are not cost - effective . for the majority of citizens worldwide , effective , nontoxic , culturally appropriate , and attainable care for cancer has not yet been defined . a common thread in addressing cancer more effectively throughout the world is the need for research . how to intervene effectively is rarely known . a major increase in all aspects of population - targeted clinical cancer research is required , ie , etiologic , preventive , early detection , diagnosis , treatment , palliative care , and behavioral psychosocial . in many circumstances viewed globally , the preponderance of current clinical and basic cancer research is in the us and european populations . there is a major growing basic science research effort in the east ( hong kong , korea , china ) and south east asia ( singapore ) , and there is promise of similar activity in saudi arabia . in the us , most cancer research has been federally funded , but less than 2% of the us national institutes of health cancer - directed budget is allocated to foreign research and the overwhelming majority of this is to high - income countries , ie , 74 of 78 projects in 2005 . the us national cancer institute has assisted extensively in training foreign basic science and clinical researchers , and in the development of population cancer registries . there is no doubt that addressing cancer problems in low - income countries is more attainable when there are specific relevant data . recently research supported by the us federal government is shrinking . financial support for cancer research by nongovernmental organizations is growing , but is still modest compared with federal support , and tends also to be niched in specialized areas and not public health - directed . the truly international , population - based , health - directed cancer research portfolio is embarrassingly small.7 beyond the relatively small , but usually well - targeted , efforts of the international agency for research on cancer ( iarc ) , organizations focusing on international ( public health , broad population - benefiting ) cancer research are small and few in number , and the global research forum barely considers cancer . the iarc has contributed significantly and usefully to the development of better global cancer data , and meaningfully in developing public health early detection information , but has been resource - limited to follow up these efforts with interventional research . the biggest foundations funding health research are generally confining their attention to long - neglected communicable diseases . a global cancer research initiative should be launched to develop and facilitate significantly increased numbers of collaborative international research activities and to generate data of significant benefit to individuals with cancer worldwide , particularly to individuals living in countries with limited resources . an international partnership - collaborative group comprising , eg , the us national cancer institute , iarc , and european and asian organizations should be developed to formulate the major goals , vision , and mechanisms for this initiative , and to procure commitments for sustained financial resources to carry out the initiative in rapidly incremental steps . the financial support should come from federal and private sources . a core staff for the initiative should be recruited and should craft a series of requests for proposals from region - specific planning and organization through to intervention . also needed are specifications which target low- and middle - income countries , their locally defined priority target areas , and the full spectrum of clinical research areas and funding rules which call for matching funds from all country research partner applicants , with greater levels sought from high - income countries . rigorous low- and middle - income country clinical research investigator and proposal development , capacity - building training , and partnership / team development programs should be developed under the auspices of organizations such as the american association for cancer research and american society of clinical oncology . the deficit at present lies in mentoring foreign investigators in proposal and research team development . economic development efforts over the last 50 years have been broadly criticized for their limited successes , noting that planning rather than search and research approaches have dominated.19 much discussion and many activities around addressing the growing cancer burden globally , and the organization and presentations at large clinical meetings , have been characterized by similar planning - technology transfer . however , when we look at the state - of - the art in what we know about effective interventions in cancer in terms of how these might impact the majority of global citizens , it is clear that a more vigorous research approach is indicated to help low- and middle - income countries develop rigorous data on helpful interventions . the task is great , but if we are to realize the promise of the declaration of human rights , ie , that the fruits of medical science should benefit all mankind , then medical science must more specifically turn its focus to global clinical cancer research .

cancer is an increasing problem for low- and middle - income countries undergoing an epidemiologic transition from dominantly acute communicable disease to more frequent chronic disease with increased public health successes in the former domain . progress against cancer in high - income countries has been modest and has come at enormous expense . there are several well - conceived global policy and planning initiatives which , with adequate political will , can favorably impact the growing global cancer challenges . most financial resources for cancer , however , are spent on diagnosis and management of patients with disease in circumstances where specific knowledge about effective approaches is significantly limited , and the majority of interventions , other than surgery , are not cost - effective in resource - limited countries by global standards . in summary , how to intervene effectively on a global scale for the majority of citizens who develop cancer is poorly defined . in contrast to technology - transfer approaches , markedly increased clinical research activities are more likely to benefit cancer sufferers . in these contexts , a global cancer research initiative is proposed , and mechanisms for realizing such an effort are suggested .

You are an expert at summarizing long articles. Proceed to summarize the following text: endometriosis is a complex and enigmatic gynecologic disease with incompletely understood etiology and is defined as the presence of endometrial tissue outside the uterine cavity which causes an inflammatory reaction , chronic pelvic pain , and infertility . endometriosis prevalence is estimated to be 515% in women of reproductive age and 35% in postmenopausal women ( 1 ) . the morphologic appearance of endometriosis is marked by proliferation , infiltration , angiogenesis and severe adhesions to the surrounding tissues . researchers have focused on its pathogenesis , including anatomic , hormonal , immunologic and genetic factors ( 2 , 3 ) . the blood vessels supplying oxygen and nutrients are essential for the development and survival of endometriosis ( 4 ) . it has been shown that angiogenesis is necessary for the survival of tumors larger than 2 - 3 mm ( 5 ) and angiogenesis is found in endometriosis tissue ( 6 ) and it is considered as an angiogenic disease . previous study has shown increased incidence of cancer in women with endometriosis , and high prevalence of endometriosis has been seen in women with ovarian cancer ( 7 ) . endometriosis is often diagnosed by laparoscopy , and a high percentage of recurrences of endometriosis happen . drug treatments used for endometriosis are gonadotropin - releasing hormone analogs ( gnrh ) agonists ( 1 ) and oral contraceptives ( 9 ) , progestin antagonists such as mifepristone ( ru 486 ) ( 10 ) and new suggestions such as statin ( 11 ) and cyclooxygenase-2 ( cox-2 ) inhibitor ( celecoxib ) ( 12 ) . the main purpose of medical treatment of endometriosis is inhibition of the growth and activity of endometriosis tissue , although , their side effects may limit the use of these drugs ( 8) . programmed cell death or apoptosis plays an important role in the physiology of endometrial tissue . studies have shown that during the secretory phase of the menstrual cycle , the stromal and epithelial cells of endometrium undergo apoptosis ( 13 ) . on the other hand , programmed cell death ( apoptosis ) significantly is reduced in endometriosis compared to normal endometrial tissue , and there is possibly an inverse relationship between apoptosis and endometriosis ( 14 ) . noscapine , a phthalideisoquinoline alkaloid , is composed of 1 - 10% opium alkaloids and is used as an antitussive in humans and experimental animals ( 15 ) . also , it has anti - cancer activity ( 16 ) . this drug has high safety , low or no toxicity in the tumor suppression dosage and has been shown in liver , heart , bone marrow , spleen , and small intestine ( 17 ) . furthermore , noscapine solubility in water makes it more suitable than many other drugs to administer orally to treat cancer ( 15 ) . noscapine interacts with alpha - tubulin and induced apoptosis in cancer cells ( 18 , 19 ) . also , it has been shown to reduce neo - angiogenesis and tumor size and to stop apoptosis of tumor cells ( 20 , 21 ) . due to lack of definitive medical treatments for endometriosis and the need to identify new pharmaceutical compounds influencing this disease ; this study was conducted to identify the in vitro effect of noscapine on endometrial epithelial and stromal cells of endometriosis patients . in this in vitro experimental study , endometrial biopsies ( n = 9 ) were prepared from women in the reproductive age ( 25 - 40 years old ) and secretory phase of menstruation . the work on the human tissue was accepted by ethics committee of kermanshah university of medical sciences and all patients signed informed consent . the samples with polyps , endometrial hyperplasia and cancer , and hormone therapy in the last three months were excluded . endometrial cells were separated according to our previous studies ( 11 , 22 ) . after washing with phosphate buffer solution ( pbs ) containing 2% antibiotics - antimycotic solution , the biopsy was chopped using a sterile scalpel in a petri dish and the chopped tissue was transferred to collagenase i solution ( 2 mg / ml ) ( sigma , germany ) in medium : dulbecco s modified eagle medium / nutrient mixture f12 ( dmem / f12 ) ( gibco , denmark ) supplemented with 5% fetal bovine serum ( fbs ) , ( gibco , denmark ) and incubated at 37c for 60 - 90 min . cell suspensions were passed through 70 and 40 micrometer ( m ) filter mesh ( cell strainer ; becton dickenson company , usa ) . these glands were dissociated to single cells by 0.02% trypsin and were cultured in dmem / f12 with 10% fbs . the filtrate was centrifuged ( 2500 g ) for 15 minutes and the cell pellet was broken by the media and the layering on the ficoll ( amersham - abrahamson ) and centrifuged ( 1500 g ) for 30 min . then , the supernatant was collected and rinsed with saline solution ( 0.15 mm ) and was centrifuged ( 100 g ) for 10 minutes . stromal cells were cultured in dmem / f12 with fbs 5% . according to our previous work ( 11 , 22 ) , dako standard methods were done for cytokeratin as an epithelial cell marker and vimentin for stromal cell marker . isolated stromal and epithelial cells of each sample were divided into five groups ; control ( 0 ) , 10 , 25 , 50 and 100 m noscapine concentrations ( sigma ) and were cultured for three separate periods ( 24 , 48 and 72 hr ) , noscapine ( mw = 413.4 ) is water soluble and these doses were selected based on tayarani - najaran study ( 23 ) . noscapine ( 0.0413 g ) was dissolved in deionized water to made 0.1 millimole / liter ( 100 m ) . after treatment , the cells were examined for viability by colorimetric assay ( mtt ) assay . dead cell and its variants were stained with acridine orange and ethidium bromide ( ao / eb ) and terminal deoxynucleotidyl transferase ( tdt ) dutp nick - end labeling ( tunel ) assay . the amount of nitric oxide ( no ) release in the medium was measured by using griess reagent ( 24 , 25 ) . viability was assessed by mtt ( mtt [ 3-(4 , 5-dimethylthiazol-2-yl ) -2 , 5-diphenyltetrazolium bromide ] ) ( roche , gmbh , germany ) . after treatment of the cells , 20 l of mtt solution ( 0.5 mg / ml in pbs ) was added to each well of the 96 wells culture plate and incubated in a 5% co2 at 37c for 4 hr . after incubation , the supernatant of each well was gently removed and 100 lit dimethyl sulfoxide ( dmso ) was added to wells and placed at room temperature for 30 min to dissolve produced formazan crystals . absorbance was read at a wavelength of 570 nm against a reference wavelength of 630 nm using elisa reader ( stat fax , usa ) and the percentage of cell viability was calculated by dividing the absorbance of treated group to the absorption of control group 100 ( 25 ) . cell death detection was performed by acridine orange / ethidium bromide ( ao / eb ) double staining ( 26 ) . thus , 100 liter of the mixture of two colors ( 100 g / ml ao and 100 g / ml eb in pbs ) was added to the cells in 96-well culture plates , which were then washed with pbs and cells were observed by fluorescence microscopy ( nikon , germany ) . at least 200 cells were counted in each sample and the percentage of cell death was determined . apoptosis ( nuclear dna fragmentation ) was detected by the tunel method using an in situ cell death detection kit ( roche diagnostics corporation mannheim , germany ) according to the manufacturer s instructions . briefly , after 48 hr treatment of epithelial and stromal cells with noscapine , the cells were fixed in 4 % pbs - buffered paraformaldehyde for 30 min at room temperature and then permeabilized with 0.1% triton x-100 in sodium citrate for 2 min on ice . then , the cells were incubated with 50 l of terminal deoxynucleotidyl transferase end - labeling solution for 60 min at 37c in a humidified chamber in the dark . then , the cells were counterstained in pi staining solution for 4 min at room temperature in the dark . after each step , the stained cells were washed 1 - 2 times with pbs and were then observed by fluorescence microscopy ( nikon , germany ) . the percentage of positively stained cells was calculated as the percentage of the apoptotic cells relative to the total number of the cells ( 27 ) . the supernatants of epithelial and stromal cells were used for no measurement in 24 , 48 and 72 hr culture periods . nox ( total nitrite and nitrate ) levels were measured by griess method ( 24 ) . the supernatant was deproteinized by adding 400 l of the supernatant to 6 mg zinc sulfate powder and centrifuged for 12 min ( 5c ) at 12000 rpm . then , 100 l of deproteinized samples and 100 l of vanadium chloride ( iii ) ( to convert nitrate to nitrite ) were added to microplate wells . a mixture of sulfonamides 2% ( 50 l ) and naphthyl ethylenediamine dihydrochloride ( need ) 0.1% ( 50 l ) was added to wells and incubated for 30 min at 37c . concentrations of 6.25 , 12.5 , 25 , 50 , 100 and 200 l sodium nitrate were used as the standard . the absorbance of wells was measured at 540 and 630 nm by elisa reader ( stat fax 100 . data were analyzed using one - way analysis of variance ( anova ) to compare different groups . the analysis was carried out using statistical package for the social science ( spss ) version 16 ( chicago , il , usa ) . endometrial cells were separated according to our previous studies ( 11 , 22 ) . after washing with phosphate buffer solution ( pbs ) containing 2% antibiotics - antimycotic solution , the biopsy was chopped using a sterile scalpel in a petri dish and the chopped tissue was transferred to collagenase i solution ( 2 mg / ml ) ( sigma , germany ) in medium : dulbecco s modified eagle medium / nutrient mixture f12 ( dmem / f12 ) ( gibco , denmark ) supplemented with 5% fetal bovine serum ( fbs ) , ( gibco , denmark ) and incubated at 37c for 60 - 90 min . cell suspensions were passed through 70 and 40 micrometer ( m ) filter mesh ( cell strainer ; becton dickenson company , usa ) . these glands were dissociated to single cells by 0.02% trypsin and were cultured in dmem / f12 with 10% fbs . the filtrate was centrifuged ( 2500 g ) for 15 minutes and the cell pellet was broken by the media and the layering on the ficoll ( amersham - abrahamson ) and centrifuged ( 1500 g ) for 30 min . then , the supernatant was collected and rinsed with saline solution ( 0.15 mm ) and was centrifuged ( 100 g ) for 10 minutes . stromal cells were cultured in dmem / f12 with fbs 5% . according to our previous work ( 11 , 22 ) , dako standard methods were done for cytokeratin as an epithelial cell marker and vimentin for stromal cell marker . isolated stromal and epithelial cells of each sample were divided into five groups ; control ( 0 ) , 10 , 25 , 50 and 100 m noscapine concentrations ( sigma ) and were cultured for three separate periods ( 24 , 48 and 72 hr ) , noscapine ( mw = 413.4 ) is water soluble and these doses were selected based on tayarani - najaran study ( 23 ) . noscapine ( 0.0413 g ) was dissolved in deionized water to made 0.1 millimole / liter ( 100 m ) . after treatment , the cells were examined for viability by colorimetric assay ( mtt ) assay . dead cell and its variants were stained with acridine orange and ethidium bromide ( ao / eb ) and terminal deoxynucleotidyl transferase ( tdt ) dutp nick - end labeling ( tunel ) assay . the amount of nitric oxide ( no ) release in the medium was measured by using griess reagent ( 24 , 25 ) . viability was assessed by mtt ( mtt [ 3-(4 , 5-dimethylthiazol-2-yl ) -2 , 5-diphenyltetrazolium bromide ] ) ( roche , gmbh , germany ) . after treatment of the cells , 20 l of mtt solution ( 0.5 mg / ml in pbs ) was added to each well of the 96 wells culture plate and incubated in a 5% co2 at 37c for 4 hr . after incubation , the supernatant of each well was gently removed and 100 lit dimethyl sulfoxide ( dmso ) was added to wells and placed at room temperature for 30 min to dissolve produced formazan crystals . absorbance was read at a wavelength of 570 nm against a reference wavelength of 630 nm using elisa reader ( stat fax , usa ) and the percentage of cell viability was calculated by dividing the absorbance of treated group to the absorption of control group 100 ( 25 ) . cell death detection was performed by acridine orange / ethidium bromide ( ao / eb ) double staining ( 26 ) . thus , 100 liter of the mixture of two colors ( 100 g / ml ao and 100 g / ml eb in pbs ) was added to the cells in 96-well culture plates , which were then washed with pbs and cells were observed by fluorescence microscopy ( nikon , germany ) . at least 200 cells were counted in each sample and the percentage of cell death was determined . apoptosis ( nuclear dna fragmentation ) was detected by the tunel method using an in situ cell death detection kit ( roche diagnostics corporation mannheim , germany ) according to the manufacturer s instructions . briefly , after 48 hr treatment of epithelial and stromal cells with noscapine , the cells were fixed in 4 % pbs - buffered paraformaldehyde for 30 min at room temperature and then permeabilized with 0.1% triton x-100 in sodium citrate for 2 min on ice . then , the cells were incubated with 50 l of terminal deoxynucleotidyl transferase end - labeling solution for 60 min at 37c in a humidified chamber in the dark . then , the cells were counterstained in pi staining solution for 4 min at room temperature in the dark . after each step , the stained cells were washed 1 - 2 times with pbs and were then observed by fluorescence microscopy ( nikon , germany ) . the percentage of positively stained cells was calculated as the percentage of the apoptotic cells relative to the total number of the cells ( 27 ) . the supernatants of epithelial and stromal cells were used for no measurement in 24 , 48 and 72 hr culture periods . nox ( total nitrite and nitrate ) levels were measured by griess method ( 24 ) . the supernatant was deproteinized by adding 400 l of the supernatant to 6 mg zinc sulfate powder and centrifuged for 12 min ( 5c ) at 12000 rpm . then , 100 l of deproteinized samples and 100 l of vanadium chloride ( iii ) ( to convert nitrate to nitrite ) were added to microplate wells . a mixture of sulfonamides 2% ( 50 l ) and naphthyl ethylenediamine dihydrochloride ( need ) 0.1% ( 50 l ) was added to wells and incubated for 30 min at 37c . concentrations of 6.25 , 12.5 , 25 , 50 , 100 and 200 l sodium nitrate were used as the standard . the absorbance of wells was measured at 540 and 630 nm by elisa reader ( stat fax 100 . data were analyzed using one - way analysis of variance ( anova ) to compare different groups . the analysis was carried out using statistical package for the social science ( spss ) version 16 ( chicago , il , usa ) . the viability indices of stromal cells for control , 10 , 25 , 50 and 100 m noscapine concentrations were 97.9% , 91.7% , 90.3 % , 87.2 % and 85.7 % in 24 hr , 94.3% , 88.4% , 86.7% , 83.6% and 76.9% in 48 hr , and 95.7% , 84.3% , 82.7% , 79.6% and 72.9% in 72 hr , respectively . survival rate of stromal cells at concentrations of 10 , 25 , 50 and 100 m noscapine decreased compared to the control group in 24- , 48- and 72-hr time periods in time- and dose- dependent manner . the differences were significant at 50 and 100 m concentrations ( p < 0.05 ) ( figure 1 ) . the effect of different concentrations of noscapine on the human endometrial stromal ( a ) and epithelial cells ( b ) viability from endometriosis patients by mtt assay in 24 , 48 and 72 hr . the results showed as mean sem ( * p < 0.05 ; * * p < 0.001 ) the viability indices of epithelial cells were 93.7% , 86.2% , 83.4% , 75.7% and 69.7% for control , 10 , 25 , 50 and 100 m noscapine concentrations in 24 hr , 91.0% , 84.1% , 80.8% , 72.7% and 67.1% in 48 hr and 86.8% , 79.4% , 74.1% , 70.9% and 63.5% in 72 hr . the differences were significant at 50 and 100 m concentrations ( p < 0.05 ) . epithelial cells death increased significantly in 10 , 25 , 50 and 100 m noscapine concentrations ( 11.8% , 15.7% , 20.5% and 26.4% , respectively ) compared to control group ( 7.2% ) in 24 hr . stromal cell death increased significantly in 10 , 25 , 50 and 100 m noscapine concentrations ( 10.6% , 14.3% , 19.9% and 23.2% , respectively ) compared to control group ( 5.6% ) in 24 hr ( p < 0.05 ) ( figure 2 ) . epithelial and stromal cells comparison showed noscapine more prominently affects epithelial cells than stromal cells . the effect of different concentrations of noscapine on cell death in human endometrial stromal ( a ) and epithelial cells ( b ) of endometriosis patients by acridine orange and ethidium bromide staining ( ao / eb ) in 48 hr . l= live cells ( opaque green ) , ea= early apoptotic cells ( bright green ) , la= late apoptotic cells ( orange ) , n= necrotic cells ( reddish orange ) . the results showed as mean sem ( * p < 0.05 , * * p<0.001 ) epithelial and stromal cells death increased significantly in high concentrations of noscapine . apoptotic epithelial and stromal ( tunel positive ) cells in 10 , 25 , 50 and 100 m noscapine concentrations increased to 9.04% , 13.07% , 15.15% and 17.82% , and 7.48% , 12.56% , 14.44% and 16.11% , respectively compared to control groups ( 4.96% and 4.46% ) in 48 hr ( p < 0.05 ) , ( figure 3 ) . the effect of different concentrations of noscapine on cell death in human endometrial stromal ( a ) and epithelial cells ( b ) of endometriosis patients by tunel staining in 48 hr . the results showed as mean sem ( * p < 0.05 ; * * p < 0.001 ) no secretions by stromal cell were 29.125.8 , 28.131.89 , and 24.395.13 in 100 m concentration at 24 , 48 and 72 hr treatments , respectively compared to their controls : 66.8516.77 , 52.1711.47 , and 53.2813.5 . epithelial cells no secretions were 32.2511.8 , 27.4412.97 and 22.178.13 in 100 m concentration at 24 , 48 and 72 hr treatments respectively compare to their controls : 59.7611.62 , 49.9712.87 , and 46.52.57 . nitric oxide secretion of stromal and epithelial cells in the concentrations of 10 , 25 , 50 and 100 m noscapine decreased time- and dose- dependent manner , but there is no significant difference compared to control group in 24 , 48 and 72 hr . the effect of different concentrations of noscapine on no secretion by human endometrial stromal ( a ) and epithelial cells ( b ) from endometriosis patients by griess reagent in 24 , 48 and 72 hr . epithelial cells death increased significantly in 10 , 25 , 50 and 100 m noscapine concentrations ( 11.8% , 15.7% , 20.5% and 26.4% , respectively ) compared to control group ( 7.2% ) in 24 hr . stromal cell death increased significantly in 10 , 25 , 50 and 100 m noscapine concentrations ( 10.6% , 14.3% , 19.9% and 23.2% , respectively ) compared to control group ( 5.6% ) in 24 hr ( p < 0.05 ) ( figure 2 ) . epithelial and stromal cells comparison showed noscapine more prominently affects epithelial cells than stromal cells . the effect of different concentrations of noscapine on cell death in human endometrial stromal ( a ) and epithelial cells ( b ) of endometriosis patients by acridine orange and ethidium bromide staining ( ao / eb ) in 48 hr . l= live cells ( opaque green ) , ea= early apoptotic cells ( bright green ) , la= late apoptotic cells ( orange ) , n= necrotic cells ( reddish orange ) . the results showed as mean sem ( * p < 0.05 , * * p<0.001 ) apoptotic epithelial and stromal ( tunel positive ) cells in 10 , 25 , 50 and 100 m noscapine concentrations increased to 9.04% , 13.07% , 15.15% and 17.82% , and 7.48% , 12.56% , 14.44% and 16.11% , respectively compared to control groups ( 4.96% and 4.46% ) in 48 hr ( p < 0.05 ) , ( figure 3 ) . the effect of different concentrations of noscapine on cell death in human endometrial stromal ( a ) and epithelial cells ( b ) of endometriosis patients by tunel staining in 48 hr . the results showed as mean sem ( * p < 0.05 ; * * p < 0.001 ) no secretions by stromal cell were 29.125.8 , 28.131.89 , and 24.395.13 in 100 m concentration at 24 , 48 and 72 hr treatments , respectively compared to their controls : 66.8516.77 , 52.1711.47 , and 53.2813.5 . epithelial cells no secretions were 32.2511.8 , 27.4412.97 and 22.178.13 in 100 m concentration at 24 , 48 and 72 hr treatments respectively compare to their controls : 59.7611.62 , 49.9712.87 , and 46.52.57 . nitric oxide secretion of stromal and epithelial cells in the concentrations of 10 , 25 , 50 and 100 m noscapine decreased time- and dose- dependent manner , but there is no significant difference compared to control group in 24 , 48 and 72 hr . the effect of different concentrations of noscapine on no secretion by human endometrial stromal ( a ) and epithelial cells ( b ) from endometriosis patients by griess reagent in 24 , 48 and 72 hr . noscapine significantly decreased the viability of endometriotic epithelial and stromal cells in a dose- and time - dependent manner , which was more prominent in the epithelial cells ( higher apoptotic index ) . also , noscapine induced significant apoptosis in these cells and reduced their nitric oxide secretion . the inhibitory effect of noscapine on endometrial epithelial and stromal cells of endometriosis patients was similar to its inhibitory effect on breast cancer cells ; mda - mb-468 , mda - mb-231(28 ) , and melanoma cells ( b16ls9 ) in mice ( 29 ) . despite the different types of cells , the results of these studies were similar to our finding . in the present study , we used pure noscapine while noscapine derivatives such as brominated noscapine 5-bromonoscapine ( 5-br - nosc ) , reduced 5-bromonoscapine ( rd 5-br - nosc ) , inhibited cell proliferation effectively in lower concentrations in prostate , breast , ovary , and cervix cancer ( 30 ) . further , noscapine reduced the survival of liver cancer cells in a dose- and time - dependent manner and had no effect on non - malignant cells ( 23 ) which is in accordance with our results . heidari et al ( 2007 ) showed that noscapine increased the ratio of bax / bcl-2 expression and induced apoptosis in two myeloid cell lines . in this study , noscapine as a new therapeutic agent with potential anticancer activity was suggested for glioblastoma multiform patients ( 31 ) . our study also showed that noscapine induced apoptosis in endometriotic cells and higher concentrations of noscapine caused cell death by apoptosis . in the present study , high concentrations of noscapine inhibited the secretion of no from both endometriotic stromal and epithelial cells of endometriosis patients . the previous study has shown increased levels of no in the peritoneal fluid of women with endometriosis compared to women without endometriosis ( 32 ) . no has antioxidant activity and prevents ros - induced apoptosis leading to tumor growth by removing the oxygen free radicals ( ros ) ( 34 ) . on the other hand , there is a high no produced by macrophages in women with endometriosis ( 36 ) which correlates to increased expression of no synthetase and subsequent no production ( 37 ) . in the present study , we showed that nitric oxide production from endometriotic stromal and epithelial cells was lower in the experimental groups compared to the control group in time- and dose - dependent manner . however , this reduction did not show significant differences and this decrease was higher in epithelial cells than in stromal cells , which can be attributed to the amount of cell death which was higher in epithelial cells . so , noscapine increased epithelial and stromal cells apoptosis and reduced their nitric oxide secretion , and can be considered in endometriosis treatment . the study of cell death in epithelial and stromal cells of endometriosis has shown that cell death is varied in different phases of the menstrual cycle and the highest rate of cell death occurs at later stages of the secretory phase . apoptosis occurs in both epithelial and stromal cells in the functional layers of the endometrium of endometriosis patients . on the other hand , the comparison between normal endometrium and endometriosis has shown that the cell death rate is reduced in stromal and epithelial cells from endometriotic tissue ( 35 ) . the resistance of these cells to apoptosis and cell death has been demonstrated in previous studies ( 38 ) . therefore , induction of apoptosis in endometrial cells can prevent cell growth which was visible in our results . what is clear is that apoptosis is a mechanism that controls the promotion and development of endometriosis ( 39 ) . in both normal and endometriotic endometrium , the apoptosis index in epithelial glands is higher than stromal cells ( 40 ) . this suggests that these cells do not have an equal contribution in the creation and development of endometriosis . also , in our study , the rate of cell death was higher in epithelial cells than stromal cells . the present study was a preliminary two - dimensional cell culture study with a limited number of patients . it needs to examine noscapine effect on endometriosis tissue in three - dimensional culture which is a better model for endometriosis study ( 41 ) , and even animal model of endometriosis . also , we did nt survey apoptosis - related genes which may be affected by noscapine . in future study we plan to complete the present study by three - dimension culture of endometrial tissue of endometriosis patients . these results suggest that the inhibitory effects of noscapine on the endometriotic stromal and epithelial cells may be useful to treat and suppress the growth and proliferation of endometriosis tissue .

objective(s):endometriosis is a complex gynecologic disease with unknown etiology . noscapine has been introduced as a cancer cell suppressor . endometriosis was considered as a cancer like disorder , the aim of present study was to investigate noscapine apoptotic effect on human endometriotic epithelial and stromal cells in vitro.materials and methods : in this in vitro study , endometrial biopsies from endometriosis patients ( n=9 ) were prepared and digested by an enzymatic method ( collagenase i , 2 mg / ml ) . stromal and epithelial cells were separated by sequential filtration through a cell strainer and ficoll layering . the cells of each sample were divided into five groups : control ( 0 ) , 10 , 25 , 50 and 100 micromole / liter ( m ) concentration of noscapine and were cultured for three different periods of times ; 24 , 48 and 72 hr . cell viability was assessed by colorimetric assay . nitric oxide ( no ) concentration was measured by griess reagent . cell death was analyzed by acridine orange ( ao)ethidium bromide ( eb ) double staining and terminal deoxynucleotidyl transferase ( tdt ) dutp nick - end labeling ( tunel ) assay . data were analyzed by one - way anova.results:viability of endometrial epithelial and stromal cells significantly decreased in 10 , 25 , 50 and 100 m noscapine concentration in 24 , 48 , 72 hr ( p<0.05 ) and apoptotic index increased in 25 , 50 and 100 m noscapine concentrations in 48 hr significantly ( p<0.05 ) . concentrations of no did nt show a significant decrease.conclusion:noscapine increased endometriotic epithelial and stromal cell death and can be suggested as a treatment for endometriosis .

You are an expert at summarizing long articles. Proceed to summarize the following text: in the previous issue of critical care , waerhaug and colleagues test the hypothesis that inhaled activated protein c ( apc ) , a novel therapy approved for the treatment of severe sepsis , may be an effective treatment for acute lung injury ( ali ) . the benefits of apc therapy in sepsis are likely due to its anti - coagulant and anti - inflammatory properties , along with its roles as an anti - apoptotic factor and in the maintenance of endothelial barrier functions . ali and acute respiratory distress syndrome ( ards ) are a major cause of morbidity and mortality in critically ill patients , with an estimated mortality rate of 25% to 40% . although the use of a lung - protective ventilation strategy produced a major breakthrough in supportive care for ali patients , there is still no effective pharmacological therapy for ali . based on human and animal studies demonstrating that pathogenesis of ali involves exuberant inflammation and coagulation activation [ 7 - 9 ] , apc has been proposed as a treatment for ali / ards . however , systemic apc administration is associated with a modest increase in the risk of bleeding , which can be life - threatening . thus , waerhaug and colleagues hypothesized that inhaled aerosolized apc could be effectively delivered to reduce lung injury in a sheep model of lipopolysaccharide ( lps)-induced ali . these investigators had previously reported that intravenous recombinant apc attenuated lps and oleic acid - induced lung injury . infusion of lps led to a rapid deterioration in the arterial partial oxygen pressure ( pao2 ) with an associated rise in the alveolar - arterial ( a - a ) difference , and an increase in the intrapulmonary shunt ( qs / qt ) . these changes in oxygenation were associated with increased airspace disease on quantitative computed tomography scans . lps administration also resulted in hemodynamic changes , including increased pulmonary artery pressure , pulmonary artery occlusion pressure , and heart rate , as well as a trend towards decreased mean arterial pressure . while inhaled apc improved oxygenation with an associated decrease in the alveolar - arterial difference and the pulmonary shunt fraction , there was only a modest improvement in lung aeration in apc - treated animals . improved aeration could only be observed at functional residual capacity , but not at end - inspiration , when the lung is maximally inflated . further , there was no decrease in lung water in the apc - treated sheep . inhaled apc had no significant effect on any of the hemodynamic changes observed after lps administration . thus , waerhaug and colleagues demonstrate for the first time that apc administered by the inhaled route may have benefit in ali by improving gas exchange . given the increase in bleeding complications associated with administration of intravenous apc , the administration by the inhaled route is a novel approach that may allow for safer drug administration . first , administration of inhaled apc improved oxygenation as well as lung aeration as assessed by quantitative computed tomography scan . however , neither of these physiological measurements has been shown to correlate with mortality in patients with ali . the authors did not use formal recruitment maneuvers to assess lung aeration ( such as those described by gattinoni and colleagues ) , in which patients with a higher percentage of recruitable lung had higher rates of death than patients who had better lung aeration . second , inhaled apc did not improve the alterations in hemodynamics , and there was no reduction in the quantity of pulmonary edema . however , targeted administration of apc to the distal airspaces might in fact be appealing , because it could allow for attenuation of lung injury without significant systemic effects . finally , plasma and bronchoalveolar lavage concentrations of apc were not reported by the authors , so it is unknown whether or not significant plasma levels were achieved in this study . nonetheless , the present study is an excellent , large animal model - based study of ali ; the novelty of the study is the route of apc administration . additional studies are warranted to understand the distribution of inhaled apc within the lungs and whether or not this can be further optimized , as well as determination of plasma levels of apc . it will be of interest to see whether inhaled apc has benefit in other models of ali , given the common pathogenic mechanisms that underlie different types of ali . we found no therapeutic benefit of intravenous and intra - tracheal apc in a hyperoxic model of ali in mice . similarly , we have previously reported in a phase ii randomized clinical trial of apc in ali patients that there was no difference in patient outcomes ( ventilator - free days or mortality ) with apc administration . however , our patient population was limited to ali patients without severe sepsis and at low risk of bleeding complications . we hypothesized that one of the reasons that we did not observe a benefit with apc treatment was the low overall mortality ( 13.5% ) of this patient population . more studies will be needed to test aerosolized apc , especially in animal models of acute bacterial pneumonia . ali : acute lung injury ; apc : activated protein c ; ards : acute respiratory distress syndrome ; lps : lipopolysaccharide . kdl was supported by ncrr / od kl2 rr024130 ; mrl was supported by nhlbi hl082742 ; mam was supported by nhbli hl51856 .

acute lung injury ( ali ) is characterized by the presence of dysregulated coagulation and inflammation . therefore , waerhaug and colleagues hypothesized that administration of activated protein c ( apc ) via the inhaled route would be a novel and effective treatment for ali . they demonstrated that inhaled apc improved oxygenation and lung aeration in a sheep model of lipopolysaccharide - induced ali , but did not alter lung water or hemodynamics . future studies are needed to determine plasma and airspace apc levels when administered by the inhaled route , and to determine if inhaled apc has a similar effect in other models of ali .

You are an expert at summarizing long articles. Proceed to summarize the following text: based on the 10-year global earth observation system of systems ( geoss ) implementation plan , integration of global earth observation data associated with climate change and hydrological cycle has been conducted with the cooperation of nearly 60 countries . because water quantity in soils plays an important role in controlling energy balance and evapotranspiration rates on the earth surface [ 2 , 3 ] , the importance of estimating soil moisture distribution on the earth surface with satellite remote sensing has been recognized . for example , njoku et al . and koike et al . developed algorithms to estimate soil moisture content with microwave sensors equipped in satellites and evaluated the applicability of their algorithms by comparing the estimates and ground measurements . microwave sensor for satellite remote sensing is categorized into three methods : ( 1 ) synthetic aperture radar ( sar ) ( active microwave method ) , ( 2 ) microwave radiometer ( passive microwave method ) , and ( 3 ) the combination of active and passive methods to estimate surface soil moisture . while the microwave radiometer covers only large area ( more than 10 km ) , the sar has a finer sampling scale ( approximately 20 m ) . the microwave radiometer has been more applied because of its advantages of high temporal resolution and less influence of surface conditions . and recent study succeeded in enhancing the spatial resolution of radiometer as fine as 1 km . although the sar has fine spatial resolution , the current temporal resolution is not fine enough for the hydrological studies and the sar is sensitive to the surface roughness [ 11 , 12 ] . despite the disadvantages , the benefit of estimating fine scale ( meter order ) soil moisture distribution is attractive for soil and plant scientists , irrigation engineers , hydrologist , agronomists , and farmers . an advanced land observing satellite ( alos ) , which was named daichi , was launched on january 24 , 2006 , by japan aerospace exploration agency ( jaxa ) ( the alos operation has ended on may 2011 due to the power loss ) . the alos embedded a phased array l - band synthetic aperture radar ( palsar ) that enables us to observe the earth surface without restriction made by weather or solar radiation . microwaves used in the palsar are categorized into a horizontal polarized wave ( h ) and a vertical polarized wave ( v ) depending on the direction of the electric field toward the earth surface . since either the horizontal or the vertical polarized wave can be selected when the radar sends and receives both the microwaves , the palsar utilizes information from the four combinations of polarized waves ( hh , hv , vv , and vh ) . when a single polarization mode is used , that is , hh or vv , the palsar has the finest resolution up to 6.5 m 6.5 m at minimum . in addition , l - band microwave used in the palsar has a long wavelength ( 23 cm ) meaning the microwave penetrates plant canopies so that soil moisture is expected to be measured with no influence of plant conditions on the soil surface . because the palsar targets a small area using the single polarization mode , soil moisture estimation with palsar may be of interest especially for farmers in japan . for example , the average farmland size in the united states is approximately 450 ha while that in japan is 1.5 ha . the spatial variabilities of soil moisture , infiltration rate , and other soil properties are found even in a small area [ 18 , 19 ] . understanding the spatial variability of soil moisture in a small farmland may help japanese farmers detect patches where crops suffer from water stress to determine irrigating areas for stable crop production . the palsar has a potential to evaluate the spatial variability of soil moisture in a small farmland whereas traditional satellite remote sensing sensors did not provide fine enough resolution . previous studies using the palsar single polarization mode to estimate soil moisture were more or less focused on relatively large areas such as that by susaki estimating soil moisture distribution in noninundated paddy fields with the mesh size of 100 m and that by sonobe et al . to date , however , little attention has been paid to use the smallest palsar mesh size ( 6.25 m ) when the single polarization mode is used to investigate soil moisture distribution . volumetric soil water content in the field is well known as functions of both space and depth . njoku and entekhabi showed that the sampling depth of remote sensing microwave , that is , penetration of microwave , varied with soil moisture . for example , l - band microwave penetrates 1 m deep in dry soil but only 0.1 m deep in wet soil in their study . none of the previous studies investigated the penetration depth of the palsar with the single polarization mode . therefore , to obtain a fundamental knowledge for estimating soil moisture with the palsar , we aimed in this study to establish a relationship between backscattering coefficients measured with the single polarization mode of palsar and volumetric water content , in small - scale farmlands . the backscattering coefficient indicates the degree of microwave reflected from the surface and received by a radar receiver in a unit area . the backscattering coefficient is usually expressed with the unit of db , and it depends on various surface conditions such as soil moisture , surface roughness , and surface coverage . using average volumetric water content measured with the various depths of tdr probes , we investigated how deep microwave from the palsar single polarization mode penetrated in soil . in addition to the volumetric water content , a relationship between backscattering coefficients and surface crop coverage was investigated to better understand the palsar application . the palsar sends microwaves from its antenna , and with the antenna it receives the microwaves reflected from the earth surface . thus , when the microwave reaches the soil surface , considered as an electrically heterogeneous material , it reflects back to the antenna . the degree of the reflection may be described as follows : ( 1)=asa+s , where is a reflection coefficient , a is the dielectric constant of atmosphere , and s is the dielectric constant of soil surface . the value for a is approximately 1 , and the value for s ranges approximately between 3 and 40 . the magnitude of reflection is weak when the absolute value of is close to 0 , and it is strong when is close to 1 . based on ( 1 ) , the absolute value of increases as s increases . because of water ( approximately 80 ) is much higher than those of other soil constituents , that is , of air is 1 and of soil particles is between 2 and 12 , s strongly depends on soil moisture . m meshes in which each mesh has its own brightness ( dn : digital number ) associated with microwave reflection at the surface . the backscattering coefficient ( db ) may be calculated from dn as follows : ( 2)=20log10dn83 . on july 3 , 2008 , the degree of surface crop coverages was determined at 5 cabbage fields in a cool high - mountain region in tsumagoi village , agatsuma - gun , gunma prefecture in central japan , at the similar time when the alos passed over the fields . the terrestrial coordinates of each cabbage field were determined with gps ( table 1 ) . in each field the collected surface images were analyzed with binary image processing and surface coverage was calculated . from the palsar image ( off - nadir angle : 34.3 , ascending and polarimetric mode ) , brightness of each site the polarized waves of the palsar on july 3 , 2008 , were hh and hv . the correlation between the measured surface coverage and backscattering coefficient was determined . on august 18 , 2008 , volumetric water contents at 16 spots in a bare cabbage field ( 362945.60 n , 1382736.71 e ) were measured correspondingly to the palsar sending time . the measurement of volumetric water contents was made with time domain reflectometry ( tdr ) . the tdr multiprobes consist of five pairs that are 5 cm , 10 cm , 15 cm , 20 cm , and 30 cm long with 5 mm dia . stainless - steel rods with 45 mm spacing between the rods of a pair were developed ( figure 2 ) . by vertically inserting the tdr probes from the soil surface , average volumetric water contents at 05 cm , 010 cm , 015 cm , 020 cm , and 030 cm soil layers were measured . the backscattering coefficients of the spots were calculated with imagery from the palsar ( off - nadir angle : 34.3 , ascending and single polarization mode ) . the field had a consistent slope with a homogeneously smooth surface so that we assumed that the influence of slope and surface roughness on backscattering coefficient was negligible . the correlation between backscattering coefficient and volumetric water contents at each soil layer was determined . figure 3 shows the field images taken with the digital camera and surface coverage determined with the binary image processing . the crop coverage of site 1 and site 5 were visually determined as 100% and 0% , respectively . although the sample number is small , there was a significant correlation between the crop coverage and backscattering coefficient with both hh and hv . the correlation coefficient with hv ( r = 0.869 ) was slightly higher than that with hh ( r = 0.852 ) . this may partly be resulting from the microwave reflected by water retained in cabbage plants . even though the palsar uses l - band microwave , plants on the surface affect backscattering coefficient . as shown in figure 4 , the palsar successfully detected the crop coverage with a small mesh size . detecting various crop growing stages based on crop coverage would be possible for small - scale farmlands . based on volumetric water contents measured with tdr , volumetric water content distributions at 05 cm , 010 cm , 015 cm , 020 cm , and 030 cm soil layers were estimated , and isolines were drawn in figure 5 with surfer ver . volumetric water content was spatially distributed between 0.27 and 0.43 m m at 05 cm , between 0.31 and 0.39 m m at 010 cm , between 0.32 and 0.41 m m at 015 cm , between 0.37 and 0.44 m m at 020 cm , and between 0.41 and 0.52 m m at 030 cm soil layers . volumetric water contents at the 05 cm , 010 cm , and 015 cm soil layers in figures 5(a ) , 5(b ) , and 5(c ) , respectively , were relatively higher in the southwest ( lower slope ) of the field , indicated at around the upper left corner in figure 5(a)5(e ) , than that in the northeast ( upper slope ) since the field sloped down to the southwest from the northeast ( figure 1 ) . volumetric water content at 020 cm and 030 cm soil layers showed complicated distribution ; that is , wet areas and dry areas were mixed ( figures 5(d ) and 5(e ) ) . figure 6 shows a relationship between volumetric water content at each soil layer and palsar backscattering coefficient . correlations between volumetric water content and backscattering coefficient were not very strong for all the layers . the largest correlation coefficient ( r = 0.403 ) found for the 020 cm soil layer implied that the palsar microwave penetrated up to 20 cm deep in soil . field measurements of volumetric water content on august 18 , 2008 , mostly ranged between 0.30 and 0.50 m m , a wetter range . adding a dryer range of volumetric water content , for example , 0.050.3 m m a mosaic map showing volumetric water content distribution in figure 7 was made from palsar imagery using a linear regression equation with the largest r value shown in figure 6(d ) . the equation is read as(3)=0.0026+0.4427,where is the backscattering coefficient ( db ) defined by ( 2 ) . distributions of volumetric water content made with palsar using ( 3 ) and those made with tdr measurement at 020 cm soil layer seem to agree better with each other ( figure 7 ) . the upper half of the field shown in figure 7 ( the outside area of the broken line ) a cabbage - covered area obviously showed different values of the backscattering coefficient from those of the bare field . the backscattering coefficients varied even within the cabbage - covered area as well as in the bare field . this implies that the palsar detected various water contents of cabbage plants or a coverage ratio as shown in figures 3 and 4 . conclusively , the palsar has a potential to measure soil moisture distribution in bare small fields and to measure various crop growth stages when the field is under cultivation of crops . we investigated how well the aos / palsar estimated soil moisture distribution in a small - scale farmland . there was a linear correlation between volumetric water content and palsar backscattering coefficient when the soil surface was bare . the palsar seemed to detect volumetric water content at the 020 cm soil layer . when crops were cultivated in the field , the palsar was able to measure a crop coverage ratio as well . in this study , the assumption we made that the variability of those factors was negligible for the palsar measurement because of the steady and homogeneous slope and surface roughness might be inaccurate . the correction of backscattering coefficient corresponding for various slope and surface roughness may improve estimates of volumetric water content as reported by others [ 20 , 21 ] . it is well known that volumetric water content spatially varies even within a short distance such as 10 m . the palsar measures average volumetric water content inside a 6.5 6.5 m mesh area whereas tdr only measures volumetric water content of a pinpoint area . representative element volume ( rev ) differing from one measuring technique to another and the nature of spatially varied volumetric water content may be responsible for insignificant correlation coefficients between volumetric water content and backscattering coefficient . since the sampling areas of tdr and pasar substantially differ , a similar sampling area to palsar with such a ground penetrating radar may be preferred for the ground - based soil moisture measurement .

the alos ( advanced land observing satellite ) has an active microwave sensor , palsar ( phased array l - band synthetic aperture radar ) , which has a fine resolution of 6.5 m. because of the fine resolution , palsar provides the possibility of estimating soil moisture distributions in small farmlands . making such small - scale estimates has not been available with traditional satellite remote sensing techniques . in this study , the relationship between microwave backscattering coefficient ( ) measured with palsar and ground - based soil moisture was determined to investigate the performance of palsar for estimating soil moisture distribution in a small - scale farmland . on the ground at a cabbage field in japan in 2008 , the soil moisture distribution of multiple soil layers was measured using time domain reflectometry when the alos flew over the field . soil moisture in the 020 cm soil layer showed the largest correlation coefficient with ( r = 0.403 ) . the values also showed a strong correlation with the ground surface coverage ratio by cabbage plants . our results suggested that palsar could estimate soil moisture distribution of the 020 cm soil layer across a bare field and a crop coverage ratio when crops were planted .

You are an expert at summarizing long articles. Proceed to summarize the following text: familial mediterranean fever ( fmf ) is an autosomal recessive inherited disorder [ 1 , 2 ] . it is common among mediterranean populations ( jews , arabs , turks , and armenians ) . fmf is characterized by recurrent fever and inflammation of serous membranes , leading to abdominal pain , joint pain , and chest pain . the most important complication of fmf is amyloidosis , which eventually leads to kidney failure . symptoms of the disease usually occur during the first decade of life in more than 80% of patients . the highest prevalence of the disease among the sephardic jews and the armenians has been reported . fmf seems to be more common in males with the prevalence rate 1.5 to 2 times . its prevalence is one in 2,000 to one in 100 , according to different studies . mefv gene , responsible for the disease , located on chromosome 16 p ( 13.3 ) codes synthesis of a protein called pyrin . ongoing and recurrent inflammation leads to amyloid production and deposition of it in vital organs , especially the kidneys . the appearance of homozygous mutations was significantly associated with severe clinical presentations of the fmf [ 10 , 12 ] . this mutation is related to disease onset at an early age and more prevalence of arthritis and progression to amyloidosis . m680i is common among armenians and turks and is associated with more severe form of the relapsing fever in early childhood which may be the only presentation of familial mediterranean fever . in 90% of the patients disease is begun before 20 years of age . the most commonly involved joints include hip , knees , elbows , and wrists [ 1416 ] . protracted febrile myalgia syndrome ( pfms ) is presented with prolonged fever and an increase of esr and leukocytosis . it usually takes 6 to 8 weeks and respond to treatment with prednisolone [ 17 , 18 ] . the m694v mutation associated with a higher incidence of pfms . pericarditis and tamponade , myocarditis , and cardiac amyloidosis are the most common cardiovascular presentation in fmf [ 21 , 22 ] . the nonamyloidosis renal involvement has been reported in 22% of patients and include temporary or permanent hematuria , proteinuria , acute pyelonephritis , interstitial nephritis , and glomerulonephritis due to coexisting disease [ 23 , 24 ] . it is a pathognomonic finding in fmf which usually fades within 7248 hours ; fever and leukocytosis may accompany the rash . the incidence of rash is 3%46% and is usually associated with m694v mutation ; sometimes erysipelas rash and fever are the only sign of fmf . acute scrotal swelling , a painful inflammation of the testis , in a small percentage of children with fmf , has been reported . in arabs infertility in patients with fmf has no difference with the general population [ 27 , 28 ] . recurrent aseptic meningitis can rarely occur in fmf ; these attacks are prevented after treatment with colchicine . familial mediterranean fever may be associated with different systemic inflammatory diseases including behcet , polyarteritis nodosa and henoch - schonlein purpura , spondyloarthropathy , multiple sclerosis [ 31 , 32 ] , and inflammatory bowel diseases [ 33 , 34 ] . on the basis of clinical findings tel - hashomer criteria have been described to be fmf diagnosis [ 11 , 35 ] . there is no specific standard laboratory test for fmf ; nowadays compound mefv gene mutations in hemo- or heterozygote forms confirm the diagnosis of fmf . this study included all patients with familial mediterranean fever in fmf clinic at bouali hospital and fmf registration center in iran ( http://www.fmfiran.ir/ ) . 422 patients were enrolled in this study ; all patients had fmf according to tel - hashomer criteria and/or at least two mefv gene mutations . 19 patients were excluded because of unavailability and study was conducted on 403 patients with fmf . common mefv genes mutations ( e148q , p369s , f479l , m680i ( g / c ) , m680i ( g / a ) , i692del , m694v , m694i , k695r , v726a , a744s , and r761h ) have been analyzed in 239 patient . the youngest patient was 1.5 years old and the oldest one was 76 years old . the average age of onset of symptoms was 9.75 years and the first decade of life was the most common age range which was in 128 patients ( 31.8% ) . 228 patients ( 56.6% ) were males and 333 patients were living in urban area . the main complaint of patients was abdominal pain , in 200 cases ( 49.6% ) , and abdominal pain plus fever in 67 ( 16.6% ) patients was the second main complaint . interval between attacks was 36.5 29.6 days and the mean duration of each episode was 43.3 34.5 hours . the most common homozygous mutation was m694v - m694v ( 7.1% ) and compound heterozygous mutation was m694v - v726a ( 10.46% ) and monoheterozygous mutation was e148q ( 8.7% ) . with regard to the time between onset of symptoms and diagnosis of fmf in 207 patients ( 52.3% ) this period was more than 3 years . colchicine administration in 89.9% patients had good results and in 7.2% patients showed moderate response while 2.9% patients had poor response . the most common colchicine side effect was diarrhea in 4.7% of patients . in our series two cases had erysipelas - like skin rash with negative mefv results which indicate the rarity of this feature in this area . we had two siblings with idiopathic hepatitis and massive ascites who were homozygous for m694v gene . many studies have shown male preponderance in fmf [ 38 , 40 , 41 ] . in sackesen in yilmaz study 90% of patients had fever , 95% of patients had abdominal pain , and 19% of patients had erroneous appendectomy . in a study on 229 patients , 115 were females and 68% of patients had mefv gene mutations . high fever in 94% of patients and abdominal pain in 83% were the main symptoms . in ebrahimi - fakhari et al . fever in 78% of patients , peritonitis symptoms in 95% , pleuritis in 59% , arthritis in 32% , arthralgia in 60% , erysipelas - like skin rash in 23% , vasculitis in 8% have been reported . in dundar 's report 49.6% of patients had no mefv mutations , 26.41% were heterozygous , 15.29% were compound , and 8.60% were homozygous mutation . in balci the genetic expression of this study is similar to arabs and somewhat to armenians . in this study , the common combined heterozygous mutation was m694v - v726a with 10.46% , m694v - m694v with 7.1% , and m680i - v726a with 6.27% . the most common genotype of patients was m694v - m694v in different studies [ 38 , 40 , 41 ] ; this genotype was in second rate of our results . in this study m694v mutation with 18.3% and compound mutation v726a - m694v with 12.7% were common mutations in male , while m694v mutation with 24.5% and m694v - m694v with 10.7% were the common genotype in female . rare mutations were observed in this study such as k695r and f479l with 0.2% frequency . in manna report rare mutations were k695r with 0.67% , m694i with 1.04% , and r761h with 1.91% . in yilmaz study the r761s in 1% and v726a in 3% of patients were rare mutations . the bonyadi study showed these rare mutations : a744s in 0.5% , m694i in 2.2% , f479l in 1.3% , p369s in 1.3% , e167d in 1.2% , and r408q in 1.2% . in our study there was one case of amyloidosis who presented with resistant nephrotic syndrome and m694i - m694i mutations . some studies have shown that the m694v mutation is associated with a severe form of the disease . this study showed that m694v - m694v mutations are more common in patients with presentation during first decade of life , while in those with disease presentation during second decade or later genotype v726a - m694v was common . two patients presented with the complaint of recurrent orchitis and compound heterozygous mutations m694v - v726a and m694v - e148q , and two female siblings had massive ascites , abdominal pain , and idiopathic hepatitis with homozygous mutation m697v ; this association has been reported in the literature . this study showed that first decade of life is the most common age in disease presentation of fmf ; abdominal pain is the main symptom ; m694v and m694v - v726a are the most common alleles and compound genotype . our genotype is similar to arabs and in some way armenians and erysipelas - like skin rash is not common feature in our patients .

background . familial mediterranean fever ( fmf ) is a periodic ar autoinflammatory disorder . this comprehensive study describes fmf in iran as a country near mediterranean area . materials and methods . from the country fmf registration center 403 patients according to tel - hashomer criteria enrolled this study , 239 patients had mefv gene mutations analyses . data , if needed , was analyzed by spss v20 . results . 175 patients ( 43.4% ) were female and 228 patients ( 56.6% ) were male . the mean age was 21.3 years . abdominal pain was in 93.3% patients and 88.1% had fever . abdominal pain was the main complaint of patients in ( 49.6% ) . the mean interval between attacks was 36.5 29.6 days and the mean duration of every episodes was 43.3 34.5 hours . 15.1% of patients had positive family history and 12.7% had previous surgery ; in 52.3% of patients delay in diagnosis was more than three years . 12 common mefv gene mutations were analyzed , 21.33% were without mutations , 39.7% had compound heterozygote , 25.52% showed heterozygous , and 13.38% showed homozygous results . the most common compound genotype was m694v - v726a ( % 10.46 ) and in alleles m694v ( % 20.9 ) and v726a ( % 12.7 ) were the most frequent mutations , respectively . conclusion . m694v was the most common mutation , and the most common compound genotype was m694v - v726a . our genotype results are similar to arabs and in some way to armenians , erysipelas - like skin lesions are not common in this area , and clinical criteria are the preferred methods in diagnosis of fmf .

You are an expert at summarizing long articles. Proceed to summarize the following text: the framingham heart study is a prospective cohort study that began in 1948 . in 1971 , the offspring and spouses of the original cohort were enrolled in the offspring study , and in 2002 the children of the original cohort 's offspring were enrolled in the third generation study . between june 2002 and april 2005 , 3,529 offspring and third generation participants underwent chest and abdominal computed tomographic ( ct ) scanning in conjunction with the multi - detector computed tomography ( mdct ) substudy . the present study sample consisted of the 3,001 participants ( 1,455 women and 1,546 men ) who had interpretable ct scans ( both chest and abdominal ) , who were free of cardiovascular disease , and who had complete covariate information . the institutional review boards of the boston university medical center and massachusetts general hospital approved the study protocol . all subjects provided informed written consent . participants underwent eight - slice mdct abdominal scanning in a supine position ( lightspeed ultra , general electric , milwaukee , wi ) . twenty - five contiguous 5-mm thick slices ( 120 kvp , 400 ma , gantry rotation time 500 ms , and table feed 3:1 ) were obtained , covering 125 mm above the level of s1 . vat and sat volumes were quantified from ct scans using a dedicated offline workstation ( aquarius 3d workstation ; terarecon , san mateo , ca ) using a semiautomatic segmentation technique . an image display window width of 195 to 45 hounsfield units and a window center of 120 hounsfield units were used to identify pixels containing fat . vat was defined as adipose tissue inside the abdominal muscular wall and sat as adipose tissue outside the abdominal muscular wall . interclass correlations for inter - reader comparisons were 0.997 for sat and 0.992 for vat on a random sample of 100 scans ; high intra - reader correlations were similarly obtained . covariates were measured at the seventh framingham offspring examination ( 19982001 ) and the first third generation examination ( 20022005 ) . bmi was calculated as weight in kilograms divided by the square of height in meters . serum triglycerides , total and hdl cholesterol , and fasting plasma glucose were measured in fasting morning samples obtained from attendees . diabetes was defined as fasting plasma glucose 126 mg / dl or treatment with a hypoglycemic agent or insulin ; impaired fasting glucose was defined as a fasting plasma glucose level of 100125 mg / dl in the absence of diabetes treatment . hypertension was defined as systolic blood pressure 140 mmhg and diastolic blood pressure as 90 mmhg or antihypertensive treatment . low hdl was defined as < 40 mg / dl for men or < 50 mg / dl for women . alcohol use was evaluated through a physician - administered questionnaire and categorized as more or less than 14 drinks per week ( men ) or 7 drinks per week ( women ) . metabolic syndrome was defined by modified adult treatment panel iii criteria ( impaired fasting glucose defined as fasting plasma glucose 100125 mg / dl in the absence of treatment of diabetes , the high triglyceride component was defined as triglycerides150 mg / dl or treatment with a lipid - lowering agent , and blood pressure criteria were modified to include treatment for hypertension ) . study participants were stratified by vat into sex - specific tertiles . within each tertile , subjects were categorized further into sex - specific abdominal sat tertiles . age - adjusted means and prevalences of risk factors including bmi , waist circumference , fasting glucose , diabetes , hdl cholesterol , triglycerides , hypertension , and the metabolic syndrome were compared across the sat tertiles . because overall and visceral adiposity increases with age , all analyses were age - adjusted . as a secondary analysis , participants were separately stratified into sat tertiles within each clinical bmi category ( normal weight , overweight , and obese ) , and the analyses were repeated . all analyses were performed using sas ( version 9.1 ) ; two - tailed values of p < 0.05 were considered significant . participants underwent eight - slice mdct abdominal scanning in a supine position ( lightspeed ultra , general electric , milwaukee , wi ) . twenty - five contiguous 5-mm thick slices ( 120 kvp , 400 ma , gantry rotation time 500 ms , and table feed 3:1 ) were obtained , covering 125 mm above the level of s1 . vat and sat volumes were quantified from ct scans using a dedicated offline workstation ( aquarius 3d workstation ; terarecon , san mateo , ca ) using a semiautomatic segmentation technique . an image display window width of 195 to 45 hounsfield units and a window center of 120 hounsfield units were used to identify pixels containing fat . vat was defined as adipose tissue inside the abdominal muscular wall and sat as adipose tissue outside the abdominal muscular wall . interclass correlations for inter - reader comparisons were 0.997 for sat and 0.992 for vat on a random sample of 100 scans ; high intra - reader correlations were similarly obtained . covariates were measured at the seventh framingham offspring examination ( 19982001 ) and the first third generation examination ( 20022005 ) . bmi was calculated as weight in kilograms divided by the square of height in meters . serum triglycerides , total and hdl cholesterol , and fasting plasma glucose were measured in fasting morning samples obtained from attendees . diabetes was defined as fasting plasma glucose 126 mg / dl or treatment with a hypoglycemic agent or insulin ; impaired fasting glucose was defined as a fasting plasma glucose level of 100125 mg / dl in the absence of diabetes treatment . hypertension was defined as systolic blood pressure 140 mmhg and diastolic blood pressure as 90 mmhg or antihypertensive treatment . low hdl was defined as < 40 mg / dl for men or < 50 mg / dl for women . alcohol use was evaluated through a physician - administered questionnaire and categorized as more or less than 14 drinks per week ( men ) or 7 drinks per week ( women ) . metabolic syndrome was defined by modified adult treatment panel iii criteria ( impaired fasting glucose defined as fasting plasma glucose 100125 mg / dl in the absence of treatment of diabetes , the high triglyceride component was defined as triglycerides150 mg / dl or treatment with a lipid - lowering agent , and blood pressure criteria were modified to include treatment for hypertension ) . study participants were stratified by vat into sex - specific tertiles . within each tertile , subjects were categorized further into sex - specific abdominal sat tertiles . age - adjusted means and prevalences of risk factors including bmi , waist circumference , fasting glucose , diabetes , hdl cholesterol , triglycerides , hypertension , and the metabolic syndrome were compared across the sat tertiles . because overall and visceral adiposity increases with age , all analyses were age - adjusted . as a secondary analysis , participants were separately stratified into sat tertiles within each clinical bmi category ( normal weight , overweight , and obese ) , and the analyses were repeated . all analyses were performed using sas ( version 9.1 ) ; two - tailed values of p < 0.05 were considered significant . overall , 1,455 women ( mean age 51.4 years ) and 1,546 men ( mean age 48.6 years ) comprised the study sample . the average bmi was 26.7 kg / m for women and 28.3 kg / m for men , with 24.1% of women and 27.3% of men classified as obese . approximately one - quarter of women had high triglycerides , low hdl , hypertension , and the metabolic syndrome , whereas 41.1% of men had high triglycerides , 31.1% had low hdl , 28.5% had hypertension , and 35.2% had the metabolic syndrome . * defined as fasting plasma glucose 100125 mg / dl in the absence of diabetes treatment . defined as hdl < 40 mg / dl ( men ) or < 50 mg / dl ( women ) . all measures of adiposity ( bmi , waist circumference , sat , and vat ) increased significantly for women and men across sat tertiles within each vat tertile ( table 2 ) . among those in the lowest vat tertile , risk factor prevalence was uniformly low and increased with increasing sat tertile ( table 3 ) . among women , the age - adjusted linear trend was significant for systolic blood pressure ( 109 mmhg in sat tertile 1 vs. 114 mmhg in sat tertile 3 , p < 0.001 ) . of particular note are the significant increases in prevalence rates of impaired fasting glucose ( 19.1% in sat tertile 1 vs. 29.1% in sat tertile 3 , p = 0.03 ) and high triglycerides ( 12.1% in sat tertile 1 vs. 20.4% in sat tertile 3 , p = 0.04 ) . -age - adjusted measures of adiposity by sex - specific sat tertiles within sex - specific vat tertiles data are means sem . * age - adjusted risk factors by sex - specific sat tertile within sex - specific vat tertiles data are means sem or % . * defined as fasting plasma glucose 100125 mg / dl in the absence of diabetes treatment . defined as hdl < 40 mg / dl ( men ) or 50 mg / dl ( women ) . vat tertile , risk factor prevalence was generally higher than that in vat tertile 1 and again displayed a pattern of increase across sat tertiles . among women , linear trends were significant for systolic blood pressure ( 117 mmhg in sat tertile 1 vs. 122 mmhg in sat tertile 3 , p = 0.01 ) and the metabolic syndrome ( 8.3% in sat tertile 1 vs. 27.2% in sat tertile 3 , p < 0.0001 ) . among men , linear trends were also significant and increasing for the metabolic syndrome ( 22.5% in sat tertile 1 vs. 50.7% in sat tertile 3 , p < 0.0001 ) , as well as for fasting glucose , impaired fasting glucose , and hypertension . in the top vat tertile , absolute risk factor prevalence was high and increased significantly with increasing sat for several risk factors . for example , linear trends for rates of metabolic syndrome were significant for both women ( 51.2% in sat tertile 1 vs. 65.1% in sat tertile 3 , p = 0.02 ) and men ( 55.6% in sat tertile 1 vs. 73.0% in sat tertile 3 , p = 0.001 ) . however , the pattern of increase in risk factor prevalence across sat tertiles present among the bottom two vat tertiles was notably absent among both men and women in the highest vat tertile for low hdl and among men for fasting glucose and impaired fasting glucose despite large increases in bmi across sat tertiles ( 27.1 vs. 36.3 kg / m for women and 28.1 vs. 35.7 kg / m for men ) . in addition , prevalence rates of high triglycerides in men decreased significantly with increasing sat ( 64.4% in sat tertile 1 vs. 52.7% in sat tertile 3 , p = 0.03 ) . a similar trend was seen in women , although it was not statistically significant ( 50.6% in sat tertile 1 vs. 41.0% in sat tertile 3 , p = 0.10 ) . when the study sample was stratified into bmi categories ( normal weight , overweight , and obese ) , similar patterns were observed ( fig . the prevalence of all risk factors markedly increased through the bmi categories . among those of normal weight , rates of high triglycerides increased significantly with sat in both women ( 5.2% in sat tertile 1 vs. 14.4% in sat tertile 3 , p = 0.002 ) and men ( 8.4% in sat tertile 1 vs. 28.6% in sat tertile 3 , p < 0.001 ) . among the overweight and obese , however , the prevalence of high triglycerides did not increase with sat and decreased significantly among obese women ( 48.8% in sat tertile 1 vs. 33.0% in sat tertile 3 , p = 0.02 ) . age - adjusted levels of risk factors by tertile of sat in normal - weight ( a and d ) , overweight ( b and e ) , and obese ( c and f ) subjects . * p < 0.05 , * * p < 0.01 , and * * * p < 0.001 for linear trend across tertiles . dm , diabetes ; htn , hypertension ; ifg , impaired fasting glucose ; mets , metabolic syndrome ; tgs , triglycerides . overall , 1,455 women ( mean age 51.4 years ) and 1,546 men ( mean age 48.6 years ) comprised the study sample . the average bmi was 26.7 kg / m for women and 28.3 kg / m for men , with 24.1% of women and 27.3% of men classified as obese . approximately one - quarter of women had high triglycerides , low hdl , hypertension , and the metabolic syndrome , whereas 41.1% of men had high triglycerides , 31.1% had low hdl , 28.5% had hypertension , and 35.2% had the metabolic syndrome . * defined as fasting plasma glucose 100125 mg / dl in the absence of diabetes treatment . defined as hdl < 40 mg / dl ( men ) or < 50 mg / dl ( women ) . all measures of adiposity ( bmi , waist circumference , sat , and vat ) increased significantly for women and men across sat tertiles within each vat tertile ( table 2 ) . among those in the lowest vat tertile , risk factor prevalence was uniformly low and increased with increasing sat tertile ( table 3 ) . among women , the age - adjusted linear trend was significant for systolic blood pressure ( 109 mmhg in sat tertile 1 vs. 114 mmhg in sat tertile 3 , p < 0.001 ) . of particular note are the significant increases in prevalence rates of impaired fasting glucose ( 19.1% in sat tertile 1 vs. 29.1% in sat tertile 3 , p = 0.03 ) and high triglycerides ( 12.1% in sat tertile 1 vs. 20.4% in sat tertile 3 , p = 0.04 ) . -age - adjusted measures of adiposity by sex - specific sat tertiles within sex - specific vat tertiles data are means sem . * age - adjusted risk factors by sex - specific sat tertile within sex - specific vat tertiles data are means sem or % . * defined as fasting plasma glucose 100125 mg / dl in the absence of diabetes treatment . defined as hdl < 40 mg / dl ( men ) or 50 mg / dl ( women ) . risk factor prevalence was generally higher than that in vat tertile 1 and again displayed a pattern of increase across sat tertiles . among women , linear trends were significant for systolic blood pressure ( 117 mmhg in sat tertile 1 vs. 122 mmhg in sat tertile 3 , p = 0.01 ) and the metabolic syndrome ( 8.3% in sat tertile 1 vs. 27.2% in sat tertile 3 , p < 0.0001 ) . among men , linear trends were also significant and increasing for the metabolic syndrome ( 22.5% in sat tertile 1 vs. 50.7% in sat tertile 3 , p < 0.0001 ) , as well as for fasting glucose , impaired fasting glucose , and hypertension . in the top vat tertile , absolute risk factor prevalence was high and increased significantly with increasing sat for several risk factors . for example , linear trends for rates of metabolic syndrome were significant for both women ( 51.2% in sat tertile 1 vs. 65.1% in sat tertile 3 , p = 0.02 ) and men ( 55.6% in sat tertile 1 vs. 73.0% in sat tertile 3 , p = 0.001 ) . however , the pattern of increase in risk factor prevalence across sat tertiles present among the bottom two vat tertiles was notably absent among both men and women in the highest vat tertile for low hdl and among men for fasting glucose and impaired fasting glucose despite large increases in bmi across sat tertiles ( 27.1 vs. 36.3 kg / m for women and 28.1 vs. 35.7 in addition , prevalence rates of high triglycerides in men decreased significantly with increasing sat ( 64.4% in sat tertile 1 vs. 52.7% in sat tertile 3 , p = 0.03 ) . a similar trend was seen in women , although it was not statistically significant ( 50.6% in sat tertile 1 vs. 41.0% in sat tertile 3 , p = 0.10 ) . when the study sample was stratified into bmi categories ( normal weight , overweight , and obese ) , similar patterns the prevalence of all risk factors markedly increased through the bmi categories . among those of normal weight , rates of high triglycerides increased significantly with sat in both women ( 5.2% in sat tertile 1 vs. 14.4% in sat tertile 3 , p = 0.002 ) and men ( 8.4% in sat tertile 1 vs. 28.6% in sat tertile 3 , p < 0.001 ) . among the overweight and obese , however , the prevalence of high triglycerides did not increase with sat and decreased significantly among obese women ( 48.8% in sat tertile 1 vs. 33.0% in sat tertile 3 , p = 0.02 ) . age - adjusted levels of risk factors by tertile of sat in normal - weight ( a and d ) , overweight ( b and e ) , and obese ( c and f ) subjects . * p < 0.05 , * * p < 0.01 , and * * * p < 0.001 for linear trend across tertiles . dm , diabetes ; htn , hypertension ; ifg , impaired fasting glucose ; mets , metabolic syndrome ; tgs , triglycerides . cardiometabolic risk increases with increasing visceral adiposity and bmi . among those in the bottom two vat tertiles , increasing subcutaneous fat is generally associated with increases in risk factor prevalence . among those in the highest vat tertile , however , increasing sat is not associated with uniform increases in risk factors prevalence , despite significant increases in bmi , waist circumference sat , and vat . most striking , linear trends for triglycerides actually decrease with increasing sat in the top vat tertile , suggesting that subcutaneous fat may be associated with beneficial effects on triglyceride levels in those with the most visceral fat . although total adiposity is strongly associated with metabolic and cardiovascular risk , it is becoming increasingly clear that different fat compartments contribute differentially to these risks . abdominal visceral fat is a stronger correlate of cardiovascular disease risk than bmi , waist circumference , or abdominal subcutaneous fat ( 5,6 ) . central obesity , in which fat mass is predominantly intra - abdominal , is more strongly associated with insulin resistance , dyslipidemia , and atherosclerosis than is peripheral obesity , in which fat is predominantly gluteofemoral ( 1,15 ) . weight loss through diet and exercise , which results in reductions in visceral fat ( 16 ) , is associated with improvements in insulin sensitivity ( 17 ) , blood pressure ( 18 ) , serum lipids ( 19 ) , and inflammatory markers ( 20 ) . similarly , loss of vat by omentectomy leads to decreases in glucose and insulin levels ( 11 ) , whereas loss of sat by liposuction does not always produce the same beneficial effects ( 12,13 ) , suggesting that vat is more likely to be responsible for the metabolic abnormalities associated with obesity . a few studies have suggested a possible beneficial role for sat , observing that increased hip and thigh fat mass is associated with lower glucose and lipid levels , independent of abdominal fat ( 9 ) . patients with lipodystrophic loss of sat have an increased risk for insulin resistance , diabetes , and dyslipidemia ( 21 ) . in mice , transplantation of subcutaneous fat into visceral compartments leads to decreases in body weight and total fat mass and improved glucose metabolism , whereas transplantation of visceral fat into either subcutaneous or visceral compartments results in no such improvements . this suggests that subcutaneous fat may differ from visceral fat in ways that are metabolically beneficial ( 14 ) . the prevalence of many risk factors , including hypertension and the metabolic syndrome , also increases with increasing sat for all vat and bmi tertiles . among those in the lower two - thirds of the vat distribution , more sat is also associated with increased risk of most other risk factors examined , suggesting that sat is not protective in these individuals . among those with the most vat , however , increased sat is associated with lower triglycerides , suggesting that sat may be associated with beneficial effects on triglyceride levels in the obese . the ectopic fat hypothesis suggests that a hallmark of obesity is fat deposition in liver , skeletal muscle , and pancreatic -cells resulting from insufficient adipocyte growth and differentiation in the setting of nutritional excess ( 22 ) . such ectopic fat stores are theorized to affect tissue and organ function by physical compression , the secretion of various locally acting substances , and cell dysfunction or cell death of nonadipose cells , a phenomenon known as lipotoxicity ( 7 ) . in line with this theory , sat represents a proper expansion of nonpathogenic adipocytes and therefore may be considered a protective fat depot ( 22 ) . improvements in insulin sensitivity with thiazolidinedione treatment , which increases subcutaneous fat stores , are suggestive of a protective effect of sat ( 10 ) . our results are consistent with a potential protective role for sat in the case of triglycerides among the obese . another possible explanation for obesity - related cardiometabolic disease is the portal vein hypothesis , which proposes that increased visceral fat leads to higher free fatty acid concentrations in the portal vein , increased systemic fatty acid flux , and increased hepatic lipase activity , which removes lipids from ldl and hdl , and may lead to dyslipidemia ( 23 ) . although our results do not contradict the detrimental effects of vat proposed by the portal vein hypothesis ( the prevalence of all risk factors increased with vat tertile in our sample ) , they do support the notion that such a theory is , at best , incomplete because it does not explain either the detrimental or the beneficial effects of sat , which does not drain through the portal vein , on cardiometabolic risk . vat and sat differ not only in anatomic location but also in cytokine secretion profile . sat releases 23 times more leptin than vat ( 24 ) , whereas vat secretes more adiponectin , interleukin-6 , interleukin-8 , plasminogen activator inhibitor 1 , and angiotensin than does sat ( 23 ) . although the relationships between vat and sat secretion profiles and cardiometabolic pathogenesis are , at present , unclear , it may be that paracrine and perhaps endocrine factors contribute to the differential effects of vat and sat . it is important to note that our results suggest a possible protective effect of sat only among those in the highest tertile of vat . indeed , in the lower vat tertiles , increasing sat one explanation for this difference is that there is a relatively larger increase in vat in the lower tertiles and that sat is simply a marker for increased vat in these groups . sat by itself may not be deleterious or beneficial in the absence of the positive energy balance of obesity . accordingly , sat may only be protective in obese individuals because these individuals are already in positive energy balance and sat provides a nonpathological energy storage depot . it is also important to note that the lack of increase in the prevalence of risk factors such as low ldl and impaired fasting glucose with increasing sat among the obese may be due to a threshold effect , whereby risk factor prevalence is already so high that increasing sat is not associated with further increases in prevalence . compared with previous work on subcutaneous fat and cardiometabolic risk , the strengths of the present study include a large sample size with a wide range of bmi and age , thereby reducing the likelihood of ascertainment bias in the results . in addition , the study benefits from the quantification of fat volumes from ct scans rather than a single - slice measurement of fat area . a major limitation of the study is its lack of data on subcutaneous fat stores aside from the abdomen ; therefore , we can not generalize our findings to gluteofemoral fat . . it may be that superficial sat is less pathogenic than deep sat ( 25 ) . in addition , analysis by vat and sat tertiles increases the number of statistical tests performed , increasing the likelihood of false - positive results at the p < 0.05 significance level . other limitations include the cross - sectional study design , which precludes inferences of causality , and the lack of ethnic diversity , which may limit generalizability to nonwhite groups . in summary , whereas abdominal adiposity is associated with a higher absolute risk of metabolic and cardiovascular disease , subcutaneous abdominal fat is not associated with a linear increase in the prevalence of all risk factors among the obese . indeed , in the case of high triglycerides , sat may actually be a protective fat depot in obese individuals . cardiometabolic risk increases with increasing visceral adiposity and bmi . among those in the bottom two vat tertiles , increasing subcutaneous fat is generally associated with increases in risk factor prevalence . among those in the highest vat tertile , however , increasing sat is not associated with uniform increases in risk factors prevalence , despite significant increases in bmi , waist circumference sat , and vat . most striking , linear trends for triglycerides actually decrease with increasing sat in the top vat tertile , suggesting that subcutaneous fat may be associated with beneficial effects on triglyceride levels in those with the most visceral fat . although total adiposity is strongly associated with metabolic and cardiovascular risk , it is becoming increasingly clear that different fat compartments contribute differentially to these risks . abdominal visceral fat is a stronger correlate of cardiovascular disease risk than bmi , waist circumference , or abdominal subcutaneous fat ( 5,6 ) . central obesity , in which fat mass is predominantly intra - abdominal , is more strongly associated with insulin resistance , dyslipidemia , and atherosclerosis than is peripheral obesity , in which fat is predominantly gluteofemoral ( 1,15 ) . weight loss through diet and exercise , which results in reductions in visceral fat ( 16 ) , is associated with improvements in insulin sensitivity ( 17 ) , blood pressure ( 18 ) , serum lipids ( 19 ) , and inflammatory markers ( 20 ) . similarly , loss of vat by omentectomy leads to decreases in glucose and insulin levels ( 11 ) , whereas loss of sat by liposuction does not always produce the same beneficial effects ( 12,13 ) , suggesting that vat is more likely to be responsible for the metabolic abnormalities associated with obesity . a few studies have suggested a possible beneficial role for sat , observing that increased hip and thigh fat mass is associated with lower glucose and lipid levels , independent of abdominal fat ( 9 ) . patients with lipodystrophic loss of sat have an increased risk for insulin resistance , diabetes , and dyslipidemia ( 21 ) . in mice , transplantation of subcutaneous fat into visceral compartments leads to decreases in body weight and total fat mass and improved glucose metabolism , whereas transplantation of visceral fat into either subcutaneous or visceral compartments results in no such improvements . this suggests that subcutaneous fat may differ from visceral fat in ways that are metabolically beneficial ( 14 ) . the prevalence of many risk factors , including hypertension and the metabolic syndrome , also increases with increasing sat for all vat and bmi tertiles . among those in the lower two - thirds of the vat distribution , more sat is also associated with increased risk of most other risk factors examined , suggesting that sat is not protective in these individuals . among those with the most vat , however , increased sat is associated with lower triglycerides , suggesting that sat may be associated with beneficial effects on triglyceride levels in the obese . the ectopic fat hypothesis suggests that a hallmark of obesity is fat deposition in liver , skeletal muscle , and pancreatic -cells resulting from insufficient adipocyte growth and differentiation in the setting of nutritional excess ( 22 ) . such ectopic fat stores are theorized to affect tissue and organ function by physical compression , the secretion of various locally acting substances , and cell dysfunction or cell death of nonadipose cells , a phenomenon known as lipotoxicity ( 7 ) . in line with this theory , sat represents a proper expansion of nonpathogenic adipocytes and therefore may be considered a protective fat depot ( 22 ) . improvements in insulin sensitivity with thiazolidinedione treatment , which increases subcutaneous fat stores , are suggestive of a protective effect of sat ( 10 ) . our results are consistent with a potential protective role for sat in the case of triglycerides among the obese . another possible explanation for obesity - related cardiometabolic disease is the portal vein hypothesis , which proposes that increased visceral fat leads to higher free fatty acid concentrations in the portal vein , increased systemic fatty acid flux , and increased hepatic lipase activity , which removes lipids from ldl and hdl , and may lead to dyslipidemia ( 23 ) . although our results do not contradict the detrimental effects of vat proposed by the portal vein hypothesis ( the prevalence of all risk factors increased with vat tertile in our sample ) , they do support the notion that such a theory is , at best , incomplete because it does not explain either the detrimental or the beneficial effects of sat , which does not drain through the portal vein , on cardiometabolic risk . vat and sat differ not only in anatomic location but also in cytokine secretion profile . sat releases 23 times more leptin than vat ( 24 ) , whereas vat secretes more adiponectin , interleukin-6 , interleukin-8 , plasminogen activator inhibitor 1 , and angiotensin than does sat ( 23 ) . although the relationships between vat and sat secretion profiles and cardiometabolic pathogenesis are , at present , unclear , it may be that paracrine and perhaps endocrine factors contribute to the differential effects of vat and sat . it is important to note that our results suggest a possible protective effect of sat only among those in the highest tertile of vat . indeed , in the lower vat tertiles , increasing sat is associated only with increases in risk factor prevalence . one explanation for this difference is that there is a relatively larger increase in vat in the lower tertiles and that sat is simply a marker for increased vat in these groups . sat by itself may not be deleterious or beneficial in the absence of the positive energy balance of obesity . accordingly , sat may only be protective in obese individuals because these individuals are already in positive energy balance and sat provides a nonpathological energy storage depot . it is also important to note that the lack of increase in the prevalence of risk factors such as low ldl and impaired fasting glucose with increasing sat among the obese may be due to a threshold effect , whereby risk factor prevalence is already so high that increasing sat is not associated with further increases in prevalence . compared with previous work on subcutaneous fat and cardiometabolic risk , the strengths of the present study include a large sample size with a wide range of bmi and age , thereby reducing the likelihood of ascertainment bias in the results . in addition , the study benefits from the quantification of fat volumes from ct scans rather than a single - slice measurement of fat area . a major limitation of the study is its lack of data on subcutaneous fat stores aside from the abdomen ; therefore , we can not generalize our findings to gluteofemoral fat . further , we are unable to separate deep versus superficial sat in the abdomen . it may be that superficial sat is less pathogenic than deep sat ( 25 ) . in addition , analysis by vat and sat tertiles increases the number of statistical tests performed , increasing the likelihood of false - positive results at the p < 0.05 significance level . other limitations include the cross - sectional study design , which precludes inferences of causality , and the lack of ethnic diversity , which may limit generalizability to nonwhite groups . in summary , whereas abdominal adiposity is associated with a higher absolute risk of metabolic and cardiovascular disease , subcutaneous abdominal fat is not associated with a linear increase in the prevalence of all risk factors among the obese . indeed , in the case of high triglycerides , sat may actually be a protective fat depot in obese individuals .

objectiveobesity is associated with increased metabolic and cardiovascular risk . the ectopic fat hypothesis suggests that subcutaneous fat may be protective , but this theory has yet to be fully explored.research design and methodsparticipants from the framingham heart study ( n = 3,001 , 48.5% women ) were stratified by visceral adipose tissue ( vat ) into sex - specific tertiles . within these tertiles , age - adjusted abdominal subcutaneous adipose tissue ( sat ) tertiles were examined in relation to cardiometabolic risk factors.resultsin the lowest vat tertile , risk factor prevalence was low , although systolic blood pressure in women and rates of high triglycerides , impaired fasting glucose , hypertension , and the metabolic syndrome in men increased with increasing sat tertile ( all p < 0.04 ) . in contrast , in the top vat tertile , lower triglycerides were observed in men with increasing sat ( 64.4% high triglycerides in sat tertile 1 vs. 52.7% in sat tertile 3 , p = 0.03 ) . similar observations were made for women , although results were not statistically significant ( 50.6% high triglycerides in sat tertile 1 vs. 41.0% in tertile 3 , p = 0.10 ) . results in the highest vat tertile were notable for a lack of increase in the prevalence of low hdl in men and women and in rates of impaired fasting glucose in men with increasing subcutaneous fat , despite sizable differences in bmi across sat tertiles ( 27.1 to 36.3 kg / m2[women ] ; 28.1 to 35.7 kg / m2[men]).conclusionsalthough adiposity increases the absolute risk of metabolic and cardiovascular disease , abdominal subcutaneous fat is not associated with a linear increase in the prevalence of all risk factors among the obese , most notably , high triglycerides .

You are an expert at summarizing long articles. Proceed to summarize the following text: the early and late mortality after acute myocardial infarction ( ami ) is declining , but cardiovascular disease ( cvd ) is still one of the leading causes of morbidity and death in the western world . ischemic heart disease is a feared , but often inevitable complication of atherosclerosis , the main underlying cause of myocardial infarction [ 1 , 2 ] . inflammation is considered to be a key process for development of atherosclerosis and this includes a number of cellular and molecular responses resulting in plaque formation [ 2 , 3 ] . despite well - documented treatment of ami survivors , both medically and by percutaneous coronary intervention ( pci ) , some patients either do not receive this treatment , do not respond satisfactorily , or develop congestive heart failure despite treatment . several animal studies have shown that bone marrow stem cells differentiate to cardiomyocytes when infused into the affected myocardium . treatment with autologous stem cells from bone marrow has been suggested to reduce myocardial damage in patients with ami . results from clinical trials are , however , conflicting with regard to improvement of left ventricular ejection fraction [ 510 ] . possible mechanisms by which autologous bone marrow stem cells act are discussed to be cardiac transdifferentiation , paracrine effects , angiogenesis , and reduced apoptosis [ 11 , 12 ] . matrix metalloproteinases ( mmps ) , a class of 24 endopeptidases , participate in plaque instability by degrading the extracellular matrix . mmp-9 , a zinc - dependent gelatinase , is found in the shoulder of the plaque , contributes to plack instability and rupture , and has been associated with acute coronary syndrome ( acs ) [ 3 , 13 ] . circulating mmp-9 has been shown to be elevated in patients with ami , stable , and unstable angina pectoris [ 13 , 14 ] , as well as in hypertensives and smokers . in addition , mmp-9 is discussed to be involved in adverse left ventricular remodelling and associated with higher cardiovascular risk score . the mmps are regulated by specific endogenous inhibitors , tissue inhibitor of metalloproteinases ( timps ) , and mmp-9 is specifically regulated when pro - mmp-9 binds to timp-1 [ 14 , 17 ] . lately , the extracellular matrix metalloproteinase inducer ( emmprin , cd147 ) , a member of the immunoglobulin superfamily , has been discussed to be involved in both expression and release of mmp-9 , thus , having a potentially regulatory role in cvd . emmprin has been shown to be expressed in atherosclerotic plaques as well as in cell types like monocytes , macrophages , and platelets . in humans , limited data exists on the influence of bone marrow stem cells on mmps that may be of importance for the myocardium and the infarction process . in the ( astami ) trial , the main aim was to assess the effects of intracoronary injection of autologous mononuclear bone marrow - derived cells ( mbmc ) on left ventricular ejection fraction in patients with st - elevation myocardial infarction ( stemi ) . the main hypothesis was that the treatment would reduce the infarction sequelae , which , however , could not be demonstrated . the aim of this astami substudy was to investigate the influence of coronary injection of mbmc on mmp-9 , timp-1 , and emmprin , circulating levels as well as on gene expression in leukocytes , in patients with stemi undergoing successful pci . furthermore , to investigate any association between the measured biomarkers and infarct size and left ventricular function , our hypothesis was that mmp-9 levels would be reduced after mbmc treatment , in parallel with reduction of emmprin . briefly , it was a randomized 1 : 1 open - labelled study , where one arm was intracoronary treatment with mbmc , and the other controls without aspiration and injection of bone marrow . they were all treated with pci with stent implantation in the left anterior descending ( lad ) coronary artery . exclusion criteria were previous q - wave infarction , cardiogenic shock , or severe comorbidity interfering with compliance to the protocol . baseline recordings were performed during day 4 - 5 after ami , before bone marrow aspiration ( in the treatment group ) . the study protocol , including the biobank , was approved by the regional committee for medical research ethics and all patients gave written , informed consent . a biobank , kept at 80c consisting of plasma , serum , and paxgene tubes ( preanalytix gmbh , hombrechtikon , ch ) , the latter for gene expression measures in circulating leukocytes , was established . blood samples were collected in fasting condition between 08.00 and 10.00 am the day before transplantation in the mbmc group ( day-1 ) ( baseline ) , the day after ( day 1 ) and further day 3 , after 2 - 3 weeks and after 3 months . the same time interval was used for the control group , except baseline sampling ( day-1 ) which was drawn median 4 days after pci compared to 5 days in the mbmc group . for analyses of mmp-9 , timp-1 , and emmprin commercial enzyme linked immunosorbent assays ( elisa ) ( r&d systems europe , abingdon , oxford , uk ) were used on serum samples , which were performed within 1 hour by centrifugation at room temperature 2500 g for 10 min . the interassay coefficients of variation ( cv ) were 7.3% for mmp-9 , 4.4% for timp-1 , and 5.4% for emmprin . isolation of rna from paxgene tubes was performed according to the manufacturers instruction ( preanalytix , qiagen gmbh , germany ) in a subset of randomly selected samples ( n = 47 ) , with an additional cleaning step ( rneasy minelute cleanup kit , qiagen ) . a complementary dna ( cdna ) of the messenger rna ( mrna ) content was achieved by inversely transcribing total rna in the samples . the genetic expression of mrna of mmp-9 and emmprin was performed by use of real - time pcr on the viia 7 real time pcr system ( applied biosystems , foster city , ca , usa ) and the ct method was applied . this relative or comparative ct method determines the relative target quantity ( rq - values ) in the samples , by measuring the amplification ( crossing threshold ct ) of the target samples and in a reference sample and normalized to an endogenous control ( house - keeping gene ) . assays for the target genes were hs00234579_m1 for mmp-9 , hs00936295_m1 for emmprin , and -2 macroglobulin ( hs99999907_m1 ) was chosen as house - keeping gene . left ventricular ejection fraction ( lvef ) and infarct size were obtained by electrocardiogram - gated single photon emission computed tomography ( spect ) ( ge medical systems with 4d - mspect software ) at baseline ( 4.0 1.4 days after the ami ) . mmp-9 , timp-1 , and emmprin levels were all skewly distributed and nonparametric statistics were used throughout . for group comparisons the mann - whitney test was used for continuous data and chi square test for categorical data . friedman test was performed to analyze for differences between any time points within the groups . for changes from baseline ( day-1 ) to the subsequent time points , wilcoxon test was used only when friedman test was significant . for differences in changes between the randomized groups , baseline characteristics of the study population according to the randomized groups are shown in table 1 . one hundred patients included in the astami study , 50 randomized to mbmc treatment and 50 controls , were followed . from one patient they were all medically treated according to current guidelines , thus , all patients were on statins , beta - blockers , ace - inhibitors / atii antagonists , and antithrombotic agents . although blood samples at baseline were obtained one day later ( median ) from symptom start of ami in the mbmc group compared to controls , no significant differences between the groups were recorded at baseline ( day-1 ) . no differences in mmp-9 , timp-1 , or emmprin between the mbmc group and controls were seen at any further time points . in the mbmc group there was a significant increase in mmp-9 levels from baseline to 2 - 3 weeks ( p = 0.009 ) , which could not be demonstrated in the control group . emmprin levels were significantly reduced from baseline to 2 - 3 weeks and 3 months in both groups ( p < 0.0001 , all ) . when analyzing for differences between the groups in changes from baseline to further time points , we could demonstrate a significant difference in change in mmp-9 levels between the two groups at 2 - 3 weeks and after 3 months , showing a more pronounced increase in the mbmc group ( p = 0.030 and p = 0.05 , resp . ) . we observed no differences in mmp-9 gene expression between the two groups at any time points , while the emmprin gene expression was significantly lower in the mbmc group ( n = 23 ) versus the controls ( n = 24 ) after 3 months ( p = 0.03 ) ( table 3 ) . the levels of both mmp-9 and emmprin gene expressions were significantly reduced from baseline to 3 months in the mbmc group ( p < 0.0001 and p = 0.002 , resp . ) . there were , however , no differences between the groups in changes from baseline to any later time points . when defining baseline mrna level ( rq - values ) in the total population to 1 , there was a 20% reduction in mmp-9 gene expression from baseline to 2 - 3 weeks , and a 50% reduction after 3 months in the mbmc group . a similar pattern was seen in gene expression of emmprin , with a 20% reduction after 2 - 3 weeks and 60% reduction after 3 months in the mbmc group . the results of the gene expression presented as fold changes are illustrated in figure 1 . in the total population at baseline we observed a significant correlation between mmp-9 and emmprin ( r = 0.25 , p = 0.011 ) . a strong correlation was also shown between mmp-9 and timp-1 ( r = 0.66 , p < 0.0001 ) and also between timp-1 and emmprin ( r = 0.36 , p = 0.01 ) . significant correlations between ck and baseline levels of both mmp-9 and emmprin were found ( r = 0.29 p = 0.005 and r = 0.43 p < 0.001 , resp . ) . mmp-9 and emmprin , but not timp-1 , showed also significant correlations to infarct size measured by spect ( r = 0.24 , p = 0.018 and r = 0.27 p = 0.008 , resp . ) . emmprin levels were also found to be inversely correlated to lvef at baseline ( r = 0.31 p = 0.002 ) . we observed no significant correlations between circulating mmp-9 and gene expression of mmp-9 at any time points in the total population , or in the single groups . likewise there were no correlations between circulating emmprin and gene expression of emmprin , or between gene expression of emmprin and mmp-9 levels in either groups or in the total population . the main finding in the present study was that there was limited influence of intracoronary injection of mbmc transplantation after ami on circulating levels of mmp-9 , timp-1 , and emmprin , other than a more pronounced increase in mmp-9 after 2 - 3 weeks in the mbmc group . emmprin levels were reduced after 2 - 3 weeks and 3 months in both groups . at baseline both mmp-9 and emmprin were significantly correlated to myocardial injury assessed by biomarkers and infarct size and might therefore support their predictory ability for later outcome . all patients were medically treated according to current guidelines ; thus , any influence by medication on the measured variables would be equally affected in the randomized groups . in both in vitro and in vivo studies , stem cell transplantation has been shown to reduce mmps after ami and improve ventricular remodeling . our hypothesis was therefore that treatment with mbmc would reduce the circulating levels of the selected biomarkers . in a study using modified mesenchymal stem cell transplantation into ami rat hearts , mesenchymal stem cells are multipotent stromal cells that can differentiate into a variety of cell types , and the results are thus not quite comparable to ours . in addition , in contrast , we found a significantly more pronounced increase in mmp-9 levels from baseline to 2 - 3 weeks in the mbmc group compared to controls . in accordance with our findings roderfelt et al . demonstrated a transient inflammatory response and upregulation of mmp-9 activity after bone marrow transplantation in abcb4 ( hepatic fibrosis ) mice . therefore we assume that the levels were normalized when baseline sampling in the present study was performed and limited influenced by the acute phase reaction . in the control group in our study , this procedure which itself is a trauma could influence the release of inflammatory markers and contribute to the elevated levels in the mbmc group . in the study by shu et al . using mesenchymal stem cell transplantation , timp-1 levels did not vary significantly , which is in accordance with our findings of no changes in this variable during the observation period in any of the groups . the significant reduction in genetic expression of mmp-9 seen at 3 months might be discussed as compensatory to the increase observed in the circulating levels . mmp-9 expression is a crucial pathogenic feature in a range of conditions and disease states , also other than cvd [ 2830 ] , in which treatment with stem cells has been shown to suppress or downregulate the mmp-9 expression and thereby improving the current condition . the underlying mechanisms for the influence of stem cells on mmps are not clarified . in cell culture of cardiac fibroblasts could demonstrate that the protein expression and activity of mmp-2 , but not mmp-9 , were increased in response to hypoxia and decreased when cocultured with mesenchymal stem cells . it has also been demonstrated that early endothelial progenitor cells increased mmp-9 expression in vitro , whereas mmp-2 was increased in outgrowth endothelial cells . the type of stem cells seems to be of importance regarding the degree of influence on mmps . the importance of emmprin as an inducer of mmp-9 has been explored to a limited extent in humans . in our study circulating levels of mmp-9 and emmprin were significantly correlated , indicating a common regulatory pathway . circulating levels as well as genetic expression of emmprin there was , however , no influence of mbmc on circulating levels or gene expression of emmprin , shown by the significant reduction in both groups during the observation period . expression of the emmprin - gene in circulating leukocytes , also reported by xu et al . assessed by flow cytometry , may indicate that the leukocytes contribute to the circulating levels , although no correlation between circulating levels and gene expression was observed . the reduction over time seen in emmprin expression , with subsequent reduction in mmp-9 gene expression , contributes to the assumption that emmprin is an inducer of mmp-9 . the significant correlations found between both mmp-9 and emmprin , and myocardial injury assessed by biomarkers as well as infarct size measured by spect , have been sparsely explored in humans . in experimental ami , mmp-9 has been shown to increase infarct size and left ventricular fibrosis , in accordance with our findings . an association between emmprin and the degree of myocardial injury and lvef has previously been reported in the work by nie et al . , but this was a post mortem immunohistochemistry study which showed a strong increase in emmprin around the zone of necrosis in the ami group . this can to some degree be compared to our findings of the correlations between mmps and biomarkers of ami and also to our results of an inverse correlation between emmprin and lvef . an additional contribution to this understanding has been demonstrated in cd147 mice , where the disruption of the emmprin - cyclophilin a interaction reduced infarct size . our findings contribute to the suggestion that the expression of emmprin is a decisive factor in regulating mmp-9 activity and thereby involved in myocardial remodeling . the strength of the present study is the randomized design , the rather frequent sample collection for determination of the profiles , and gene expression analysis in a relatively large subpopulation . all patients were medically treated according to current guidelines ; thus any influence by medication on the measured variables would therefore be equal in the randomized groups . there was , however , no significant difference between the two groups at baseline , that is , after the bone marrow aspiration in the mbmc group . it should be noted that the measures of circulating mmp-9 and timp-1 were performed in serum , as also used in many other studies . the proteins are released upon platelet activation during clotting , thus , the levels measured do not reflect the true circulating levels . however , the same standardized procedure for serum preparation was applied throughout the study , and therefore we assume that the comparisons between the randomized groups have been limited influenced . from the literature there are both coincide results and not when using plasma or serum samples , thus , it is important to take this into account when comparing results between studies . the gene expression analyses were performed in whole blood with circulating leukocytes as the rna source , which might not be the most important source of either mmp-9 or emmprin . when performing stem cell transplantation as treatment regimen , several studies have discussed the timing , type of stem cells , and the procedure of the transplantation for optimization of the results [ 37 , 38 ] , but a conclusion has not yet been made . limited effects of intra coronary injection of mbmc transplantation on circulating levels as well as gene expression of mmp-9 and emmprin in patients with stemi treated with pci could be demonstrated . emmprin levels were reduced in both groups , whereas mmp-9 showed increased levels in the mbmc group . both mmp-9 and emmprin were significantly correlated to myocardial injury and infarct size , indicating that the regulation of metalloproteinases is important in the process of an ami . the results contribute to the understanding of the pathophysiology of metalloproteinases in ami , but further investigations are needed regarding timing and type of stem cells .

background . matrix metalloproteinase-9 ( mmp-9 ) , regulated by tissue inhibitor of metalloproteinase-9 ( timp-1 ) and the extracellular matrix metalloproteinase inducer ( emmprin ) , contributes to plaque instability . autologous stem cells from bone marrow ( mbmc ) treatment are suggested to reduce myocardial damage ; however , limited data exists on the influence of mbmc on mmps . aim . we investigated the influence of mbmc on circulating levels of mmp-9 , timp-1 , and emmprin at different time points in patients included in the randomized autologous stem - cell transplantation in acute myocardial infarction ( astami ) trial ( n = 100 ) . gene expression analyses were additionally performed . results . after 2 - 3 weeks we observed a more pronounced increase in mmp-9 levels in the mbmc group , compared to controls ( p = 0.030 ) , whereas emmprin levels were reduced from baseline to 2 - 3 weeks and 3 months in both groups ( p < 0.0001 ) . gene expression of both mmp-9 and emmprin was reduced from baseline to 3 months . mmp-9 and emmprin were significantly correlated to myocardial injury ( ck : p = 0.005 and p < 0.001 , resp . ) and infarct size ( spect : p = 0.018 and p = 0.008 , resp . ) . conclusion . the results indicate that the regulation of metalloproteinases is important during ami , however , limited influenced by mbmc .

You are an expert at summarizing long articles. Proceed to summarize the following text: moreover , it is the fifth and eighth most frequent cancer among men and women worldwide , respectively . the most common histological type of liver cancer is hepatocellular carcinoma ( hcc ) accounting for 80 to 90% of the cases . hcc incidence is highly variable among geographic regions depending on the prevalence of risk factors and the incidence of liver cirrhosis ; actually , 70 to 90% of hcc cases develop from cirrhotic liver . major risk factors of hcc include hepatitis b virus ( hbv ) and/or hepatitis c virus ( hcv ) infection and heavy alcohol consumption . in fact , chronic hbv and hcv infections have been recognized as liver carcinogens with an imputable fraction of at least 75% of hcc cases ; moreover , it has been estimated that hbv is responsible for 50 to 80% , whereas hcv is associated to 10 to 25% of hcc cases . other environmental and genetic hcc risk factors include dietary exposure to aflatoxins , diabetes , obesity , nonalcoholic steatohepatitis , and hereditary hemochromatosis [ 13 ] . central and south america were in the past known as low - incidence liver cancer regions . however , according to the last published globocan analysis , the incidence rates of liver cancer in these countries correspond to low and intermediate incidence . colombia is a country of relatively low incidence of liver cancer with incidences of primary liver and bile duct cancers of 3.1/100,000 in males and 2.7/100,000 in females . however , there is only one active cancer registry in the country , based in cali city , an urban area ; nevertheless , whether this situation is representative for the country as a whole is unknown . additionally , the national mortality registry reported around 1,300 deaths from malignant liver and intrahepatic bile ducts cancer that corresponds to a mortality rate of 3.23 and 3.09/100 000 in men and women , respectively . so far , there is no study assessing the geographic variations in incidence or risk factor of chronic liver disease and liver cancer in colombia . the first recent prospective study of hcc etiology in 9 latin american countries showed that the primary risk factor was chronic hcv infection ( 30.8% ) , followed by chronic alcoholism ( 20.4% ) , and chronic hbv infection ( 10.8% ) . although hcv infection is the most important hcc risk factor in argentina , mexico , and brazil , regional differences have been described between northern and southern states in brazil . indeed , hbv infection is the most prevalent risk factor in northern states in brazil , as in peru [ 714 ] . according to the world health organization , colombia has a moderate endemicity for hbv ; although there are several epidemiological patterns given the geographic , ethnic , cultural , and socioeconomic status of the population . data from the colombian national institute of health indicate that , in 2007 , a seroprevalence of hbsag of 0.27% ( range 0.081.27 ) was found in 1573 blood bank samples from across the country . in some rural areas , such as amazonas state , rates of chronic hbv carriage over 5% have been reported [ 15 , 16 ] . although the prevalence of hcv infection in the general population in colombia is unknown , the who estimates a prevalence between 1 to 2.5% for this country , considering the data from the national blood banks unit of the colombian national institute of health . indeed , while the seroprevalence of hcv in blood donors was 0.71% in 19931996 and 0.5% in 2002 , in a cohort of 500 multitransfused patients recruited from the two largest cities in colombia , bogota and medellin , the hcv prevalence was 9% . data on exposure to aflatoxins , a class of mycotoxin contaminating traditional foodstuff in tropical countries , are even scarcer . a survey of aflatoxin contamination in selected colombian foods was conducted over a 12-month period on a total of 248 samples collected in supermarkets , retail stores , and stock centres . aflatoxins were detected in 22 samples , including 14 of 109 samples of corn and corn products and 4 of 40 samples of rice and rice products . twelve of the 22 positive samples exceeded the maximum tolerable level of afb1 adopted by most countries ( 5 ng / g ) , including 10 samples of corn and corn products . given that corn is part of the common diet of colombian inhabitants ; it is likely that afb1 may represent a significant exposure at least in a fraction of the population . finally , the role of chronic alcoholism ( mostly in the form of cane sugar alcohol ) may also be significant [ 2023 ] . in the present study , we describe the sociodemographic variables of 202 hcc cases , who attended four reference institutions in colombia during the period 20002007 , and , for the first time , the prevalence of biomarkers in a series of 49 hcc cases . we report that the hbv biomarker was detectable in 58.1% of the cases and the hcv biomarker in 37% . among tp53 mutations , 10.5% occur at the common aflatoxin mutation hotspot , codon 249 , although g12457 t ( exon 5 ) and g13804a ( exon 8) were present in 2.9% of the hcc samples . these results suggest that the principle hcc risk factor in this colombian population is hbv infection and low to moderate of afb1 exposure . hcc samples were obtained from archived cases in the departments of pathology of four institutions in the three largest cities in colombia , bogota , medellin , and cali , during the period from 2000 to 2007 . the institutions correspond to fundacion santa fe de bogota ( 47 cases ) , hospital pablo tobon uribe ( 31 cases ) , facultad de medicina , universidad de antioquia ( 114 cases ) , and hospital universitario del valle ( 10 cases ) . from 202 hcc cases registered at the archives , 49 paraffin - fixed liver samples were available for immunochemistry and molecular biology assays . the histological pattern and grade of tumor differentiation ( edmonson and steiner grading system ) was assigned by two independent pathologists . the isoforms of p53 were detected on deparaffinized tissue sections using standard protocols with cm1 antibody ( rabbit polyclonal immunoglobulin g antihuman p53 , 1/500 , novacastra laboratories ltd . , the antibodies were detected using biotinylated immunoglobulin g , streptavidine - peroxidase , and diaminobenzidine - based detection ( vector laboratories , inc . , burlingame , calif , usa ) . after deparaffinization and rehydratation antigen retrieval was applied by vaporizer in target retrieval solution ph 6.0 ( dako ) . as primary antibody core hcv monoclonal antibody ( anti - core hcv aa7090 chemicon , millipore ) or hbx monoclonal antibody hepatitis b virus x - protein ( trans - activator x gene product ) monoclonal antibody ( clon 227 , chemicon , international , inc . ) the kit ultravision lp detection system hrp polymer and dab plus chromogen ( lab vision corporation ) was used for the detection of hbv and hcv antigens . the standardization of adducts detection was performed using liver tissue sections from rats treated with afb1 . the liver tissue sections were labeled using the antibody highly specific for afb1-fapy adducts 6a10 , developed and characterized by hsieh et al . . briefly , the sections were first treated with 5 mm na2co3/30 mm nahco3 ( ph 9.0 ) to open the guanine adducts ring . the liver sections were then treated with rnase a ( 100 l / ml , fermentas , rnase a , dnase , and protease - free ) , with proteinase k for 10 min at 37c ( 10 l / ml , gentra puregene ) and with naoh 50 mm in 40% ethanol for dna denaturation . slides were then incubated with the antibody 6a10 at a dilution 1 : 20 at 4c overnight . the reaction was detected using the kit ultravision lp detection system hrp polymer & dab plus chromogen ( lab vision corporation ) . then , the tumor tissue areas of interest were scrapped into 1.5 ml sterile microcentrifuge . dna was extracted using qiamp dna micro kit ( qiagen , hilden , germany ) , according to the manufacturer 's instructions . dna was used for amplification of exon 7 of tp53 gene with the primers flanking the exon ( sense-333 acttgccacaggtctccccaa and antisense-313 aggggtcagcggcaagcaga ) as described elsewhere . briefly , the pcr was carried out in a volume of 25 l containing 5 l of dna , 1 u of platinum taq dna polymerase high fidelity ( invitrogen carlsbad , usa ) , 0.4 m of each primer , dntp ( 200 m each ) , 1x high fidelity buffer taq polymerase ( invitrogen ) , 0.5 mm of mgso4 ( invitrogen ) , and nucleases - free water ( amresco , solon , usa ) . the pcr reaction involved a 15 min hot - star taq polymerase activation at 95c followed by 45 cycles of denaturing at 94c for 30 sec , annealing at 60c for 30 sec and extension at 72c for 30 sec , followed by a final extension for 10 min at 72c . the specific g to t transversion at codon 249 of exon 7 was analyzed by restriction fragment length polymorphism ( rflp ) . pcr products were digested by haeiii restriction endonuclease ( promega , madison , usa ) . the fragments were visualized on 3% agarose gel stained with ethidium bromide , eluted , reamplified , and sequenced by automated sequencing ( sequencer 3730xl ) . additionally , all samples were analyzed by direct sequencing of pcr products corresponding to tp53 exons 7 and also exons 5 , 6 , and 8 as described elsewhere . briefly , the pcr was carried out in a 20 l volume containing colorless gotaq flexi buffer , mgcl2 1.5 mm , dntp ( 200 m each ) , primers dg - xf4 ( gggacgtcctttgtctacgt ) , and dg - x1r ( gggagaccgcgtaaagagag ) and 0.8 u of gotaq dna polymerase ( promega ) . the pcr reaction involved a step at 95c for 2 min followed by 50 cycles of denaturing at 94c for 45 sec , annealing at 62c for 45 sec and extension at 72c for 45 sec , followed by a final extension for 7 min at 72c . the small s gene fragment of hbv was amplified using ys1-ys2 in the first round , and s3-s3as ( 319 nt ) in a second round [ 27 , 28 ] , or hep3hep33 as a unique round of pcr . phylogenetic analyses by neighbour joining and maximum likelihood were conducted with mega 5.1 ; this program was also used for tree representation . during the period 20002007 , 192 hcc cases were diagnosed at fundacion santa fe de bogota ( 23.3% ) , hospital pablo tobon uribe ( 15.3% ) and facultad de medicina , universidad de antioquia ( 56.4% ) . additionally , 10 cases ( 5% ) were diagnosed at hospital universitario del valle during the period 20002004 . among the total hcc cases , 36% were diagnosed in females and 64% in males corresponding to a male / female ratio of 1.8 : 1 . the average age was 62 years , the median was 61 years , and the age range was 22 to 90 . the records of hcc by age showed a higher frequency starting in the sixth decade of life in both populations genders . no data from the cases were available on hcv or hbv status or alcohol consumption . the 49 hcc cases included in this study were classified according to the edmonson - steiner criteria as g1 well - differentiated ( 4.9% ) , g2 moderately differentiated ( 39% ) , or g3 poorly differentiated ( 56.1% ) . the trabecular type was the most frequent ( 56.5% ) followed by solid ( 21.7% ) , mixte ( 13% ) , glandular ( 4.4% ) , and pseudoglandular ( 4.4% ) . the clinicopathological characteristics of the hcc cases included in this study are summarized in table 1 . the 249 mutation was investigated in hcc samples by rflp followed by sequencing and by direct sequence of tp53 exon 7 ( figure 1 ) . the presence of a mutation was confirmed by both techniques in 4 ( 10.5% ) of 38 hcc samples . the mutation was associated with overexpression of p53 in two of these samples ( 10%50% of cells stained ) ; for the other two cases , the immunochemistry analysis was not available . the analysis by direct sequence of tp53 exons 5 , 6 , and 8 revealed two point mutations in exon 5 ( g12457t / v157f ) and exon 8 ( g13804a / c275y ) and one snp in exon 6 ( a12708g / r213r ) in three ( 8% ) hcc samples of the 34 without 249 mutation . no accumulation of p53 protein was demonstrated in the hcc sample exhibiting the mutation g12457 t . the assay of p53 protein by immunochemistry was not available for the other two samples . this biomarker was detected in hepatocyte nuclei of treated rat liver tissue included in each of the assays as a positive control ; however , none of the hcc samples analyzed was positive for dna adducts ( figures 2(a ) and 2(b ) ) . twenty - three hcc samples were analyzed for both afb1-dna adducts and tp53 exon 7 , but none of these samples was positive for the 249 mutation . considering that data on the hbv infection status of the hcc cases analyzed was unavailable , two biomarkers were included in order to identify the cases associated with hbv infection . twenty - five hcc samples ( 58.1% , 25/43 ) were positives for nuclear hbx protein by immunohistochemical detection ( figures 2(c ) and 2(d ) ) and/or hbx sequence detection by pcr ( nucleotides 14111549 ) . from the 25 positives hcc cases , 5 samples were positive for both biomarkers ; eleven samples were positives for one of hbv biomarkers ( hbx immunohistochemical detection or hbx pcr ) , while 9 samples positive were analyzed for only one of the biomarkers . the 249 and g13804a ( exon 8) mutations were identified in two samples positive for hbv biomarkers . regrettably , the analysis of hbv biomarkers was not available in one of the samples positive for the 249 mutation . the small s gene fragment was analyzed by pcr and sequenced in 23 hcc samples positive for hbv biomarkers ( hbx protein and/or hbx pcr ) . one of the reasons for this limited number of samples characterized for the viral genotype could be the quality of the dna extracted from the paraffin - fixed liver tissues . phylogenetic study of the s sequence showed that two isolates belonged to genotype f and one isolate to genotype d according to the grouping with hbv prototype genbank sequences . similar topology was observed between trees generated by the different inference methods ( data not shown ) . the identification of the subtype was not available in these samples taking into account the limitations of the size sequence ( figure 3 ) . the core hcv protein was detected by immunohistochemistry in 37% of the samples analyzed ( 10/27 ) ; cytoplasmic staining was observed in all positive hcc samples ( figures 2(e ) and 2(f ) ) . hbv / hcv coinfection was demonstrated in 19.2% ( 5/26 ) of the liver tissue samples included in the assays ; two were positive for both biomarkers of hbv and hcv infection , while the other three were positive for hbx by immunohistochemical detection or hbx pcr , in addition to the core hcv protein detection . the health centers of this study included two leading departments of pathology at the national level ( fundacion santa fe de bogota and facultad de medicina , universidad de antioquia ) and two of the most important hospitals in medellin and cali cities ( hospital pablo tobon uribe and hospital universitario del valle ) . although , the 202 cases recruited in these centers during the period 20002007 do not represent the national registries , the data obtained from these reference institutions contributes to the knowledge of hcc epidemiology of colombia . the burden of hcc has demonstrated an increasing trend over the past two decades in some regions of the world . even in latin america , previously considered as a low incidence of liver cancer region , the data from different countries revealed increasing rates of hcc . indeed , the mortality rates for primary liver cancer have increased in mexico from 4.1/100.000 inhabitants in 2000 to 4.7/100.000 in 2006 . a similar tendency is observed in colombia ; the mortality rates for primary liver and intrahepatic bile duct cancer were 4.8/100.000 inhabitants in 2000 and 5.0/100.000 inhabitants in 2001 [ 5 , 31 ] . moreover , the mortality rates for these cancers in antioquia state increased from 6.9/100.000 in 2003 to 33/100.000 in 2005 . the increased trend in mortality rates for the country and for antioquia state could be related to improved diagnostic procedures in the health system . on the other hand , changes in risk factors over time could also be implicated . the analysis of globocan data revealed an overall male : female ratio of 2.4 : 1 . the reported ratios usually varied between 2 : 1 to 4 : 1 depending on the incidence rates and risk factor patterns over the world . the higher rates of liver cancer in male population could be due to differences in risk factor exposure . central and south america have the lowest reported male : female ratio for liver cancer ; for example , 1.2 : 1 in colombia and 1.6 : 1 in costa rica . however , as mentioned previously the data sources from colombia in the globocan database are restricted to the cancer registry of cali city . in this study , from the 202 hcc cases , diagnosed at 4 institutions in bogota , medellin , and cali cities , the male : female incidence ratio was 1.8 : 1 . in low - risk populations , the highest age - specific rates arise in patients around 75 years old while in high - risk population it occurs around 60 to 65 years old . the age - specific pattern is related to differences in hbv and hcv prevalence , age of infection , and other relevant risk factors in a population . the mean age of the 202 hcc cases of this study was 62 years and the median 61 years . these data are similar to the median age in other studies carried out in peru and argentina and also in a multicenter prospective hcc study in 9 latin american countries . nevertheless , in other studies the mean age of hcc patients was 41.4 years in the peruvian population , 55.9 years in the brazilian population , and 56 years in the chilean population . the mean age difference among the hcc studies in latin american countries could be related to the risk factor patterns in each country . according to the iarc tp53 database ( r15 , http://www-p53.iarc.fr ) , tp53 mutations have been described in up to 31.4% of hcc cases , with the 249 mutation being the most common . this mutation has been associated with afb1 exposition and there is robust evidence that supports this finding . afb1 is classified as an iarc group 1 carcinogen for the liver and causes an inactivating mutation at codon 249 of the tp53 tumor suppressor gene , inducing the substitution of an arginine by a serine ( r249s mutation ) . this mutation has a high frequency in populations from the highest - hcc - incidence areas like qidong , china ( 43.8% ) , guangxi , china ( 36% ) , and gambia ( 39.8% ) . moreover , 71.5% of reported mutations in codon 249 of tp53 , which correspond to the transversion g : c t : a have been detected in hcc , whereby this mutation could be a biomarker for dietary exposure to anatoxin . in this study , a similar prevalence was reported in other areas in anhui , province of china ( 10.5% ) , india ( 9.5% ) , and taiwan ( 13% ) ; in recent studies a prevalence around 2% was reported in turkey and in taiwan . the main risk factor of hcc in these studies was hbv infection , similar to that reported in this colombian population . the 249 mutation frequency described for the first time in a colombian population suggests an afb1 exposure level between low to intermediate . three of the four hcc samples positive for this mutation were cases recruited in one of the most important reference national health center ( fundacion santa fe de bogota ) ; probably these samples corresponded to hcc cases from rural areas . a correlation between afb1 adducts and the 249 was demonstrated in two studies carried out in taiwan [ 42 , 44 ] however , none of the hcc cases included in our study were positive for afb1-dna adducts , even though there is evidence of ab1 contamination in corn and rice collected in supermarkets , retail stores , and stock centers in colombia . until now , there are only two studies published regarding the 249 mutations in hcc cases in latin american countries . one of them was carried out in mexico in 16 hcc samples with a 249 frequency of 19% . the other one was carried out in brazil , where the maximum afb1 level in food allowed is higher than in north america and europe ; the 249 prevalence was 28% ( 21/74 ) by pcr - rflp and 16% by direct sequencing . the 249 prevalence data of 16% in brazil and 10.5% in colombia using both techniques ( rflp and direct sequence ) for mutation analysis suggest that dietary exposure to afb1 is an hcc risk factor in these latin america countries , although not as important as in africa and asia . different studies have suggested that 249 mutation occurs almost exclusively in the context of chronic hbv infection in addition to afb1 chronic dietary exposure . demonstrated in a prospective study in gambia , a multiplicative effect on hcc risk resulting from hbv chronic infection and the mutational effect of afb1 on the tp53 gene ( codon 249 ) . actually , in 216 hcc incident cases and 121 cirrhosis cases , the risk for hcc was associated with hbv markers with an odds ratio ( or ) of 10.0 ( 95% , ci : 5.1619.6 ) , 249 with an or of 13.2 ( 95% , ci : 4.9935.0 ) , and both markers with an or of 300 ( 95% , ci : 48.63270 ) . in this study of a colombian population , the analysis of hbv biomarkers and tp53 exon 7 sequences was performed in 32 hcc samples , including 3 from 4 249 mutation - positive samples . the negative results for hbv biomarkers in the other two samples could be explained by technical limitations of immunohistochemistry and pcr protocols used in this study . however , kirk et al . have described 15.3% of hcc samples hbv()/tp53 249(+ ) . additionally , we report two point mutations , g12457 t ( exon 5 ) and g13804a ( exon 8) , located in the p53 dna - binding domain . these missense mutations modify the stability and transactivating properties of p53 protein ; according to the tp53 database , their frequency in hcc is 2.1 and 0.26% , respectively . in this study , the mutations were described in two hcc cases ( 2.9% , 1/34 , each one ) . hbv biomarkers were demonstrated in 58.1% of the hcc samples analyzed in this study by hbx protein immunohistochemistry detection and hbx pcr . these data are expected considering the epidemiological pattern of hbv infection in colombia , average moderate prevalence but with regions of high prevalence [ 47 , 48 ] . a higher frequency of hbv infection than other risk factors has also been described in hcc patients from peru ( 38.9% , 42.2% ) [ 34 , 35 ] and in states of the north eastern and northern regions of brazil ( average 43.1% ) , including para ( 71.4% , 5/7 ) , bahia ( 45% , 9/20 ) , minas gerais ( 37.8% , 14/37 ) , and espirito santo ( 41.6% , 10/24 ) . hbv infection was diagnosed in these studies by the detection of hbsag in serum samples from the patients . as mentioned previously , the phylogenetic study of the s sequence in three hcc samples in this study was successful . two isolates were characterized as genotype f and one as genotype d. the hbv genotypes in the colombian population have been characterized in four studies in blood donor populations , pregnant women , and recently in end - stage liver diseases cases . the predominance of genotype f was demonstrated in three of these studies ( 77% , 87.23% , and 100% ) [ 4951 ] . additionally , genotypes a , d , c , g , and e were also described in some cases of those studies [ 49 , 50 , 52 ] . the hcv infection status was established by hcv core protein immunohistochemistry detection . regrettably , molecular biology markers for hcv infection were not available . a prevalence of 37% was found in the hcc samples analyzed in this study with an hbv / hcv coinfection prevalence of 19.2% . in other latin american countries where the hbv infection is the most important hcc risk factor , the prevalence of the hcv marker is lower ( 5.3%16.6% ) than described in this colombian population . nevertheless , the hcv biomarker in these studies carried out in peru [ 34 , 35 ] and brazil corresponded to anti - hcv detection ; unfortunately , data on this biomarker were not available for the colombian population in this study . on the other hand , hcv infection is the predominant hcc risk factor in argentina , chile , and the south eastern states of brazil ( rio de janeiro , sao paulo , parana , and rio grande do sul ) . the prevalence range of the serum anti - hcv marker was 32.8% to 44% in hcc cases from these south american countries [ 1214 ] . furthermore , in a recent prospective multicenter study of hcc cases from 9 latin american countries , including argentina , brazil , chile , colombia , uruguay , and venezuela , the main hcc risk factor was hcv infection ( 30.8% ) , followed by alcohol ( 20.4% ) , hbv infection ( 10.8% ) , and hcv plus alcohol ( 5.8% ) . some cases from this multicenter study corresponded to patients recruited in a prospective study carried out at hospital pablo tobon uribe ( hptu ) in medellin city ; interestingly , from the total 131 cases of end - stage liver disease in this hospital in the period of the study , the most important risk factor was chronic alcoholism ( 37.4% , 49/131 ) , whereas viral infection ranked second ( 10.7% hbv and 6.9% hcv ) ; the serum markers for diagnosis of viral infections were hbsag and anti - hcv . chronic alcoholism was also an important risk factor in hcc patients in argentina ( 42% ) , brazil ( 37% ) , and chile ( 31% ) [ 1214 ] . these results suggest that the hcc risk factors pattern in latin america is changing to the pattern seen in developed countries , where one of the principle hcc risk factors is chronic alcohol abuse . unfortunately , only demographic and histopathological data but not alcohol intake were available from the hcc cases in this study . the discrepancy between the risk factor pattern revealed in this retrospective study carried out in four departments of pathology from health institutions in cali , medellin , and bogota cities and in the prospective one performed at hepatology unit of hptu in medellin city could be partially explained by differences in age range , male : female ratio , viral infection biomarkers , and quality of clinical information , including follow - up of the patients in the second study . however , the predominance of hbv infection compared to hcv infection was described in both populations . further case - control studies in the colombian population are necessary in order to define the burden of alcohol intake and viral infections as hcc risk factors . in conclusion , this first retrospective study exploring the epidemiological features of hcc in patients from 4 leading health institutions in the three most important cities in colombia revealed that the majority of the patients are male and in their 6th to 7th decade of life . the main hcc risk factor is hbv infection but the presence of codon 249 mutations , a biomarker of afb1 exposure , was also found in some hcc samples .

hepatocellular carcinoma ( hcc ) is a leading cause of cancer - related death worldwide . globally , the most important hcc risk factors are hepatitis b virus ( hbv ) and/or hepatitis c virus ( hcv ) , chronic alcoholism , and dietary exposure to aflatoxins . we have described the epidemiological pattern of 202 hcc samples obtained from colombian patients . additionally we investigated hbv / hcv infections and tp53 mutations in 49 of these hcc cases . hbv biomarkers were detected in 58.1% of the cases ; hbv genotypes f and d were characterized in three of the samples . the hcv biomarker was detected in 37% of the samples while hbv / hcv coinfection was found in 19.2% . among tp53 mutations , 10.5% occur at the common aflatoxin mutation hotspot , codon 249 . no data regarding chronic alcoholism was available from the cases . in conclusion , in this first study of hcc and biomarkers in a colombian population , the main hcc risk factor was hbv infection .

You are an expert at summarizing long articles. Proceed to summarize the following text: with an estimated number of about 3000 species , distributed from central and south america , across africa to madagascar and southern india , cichlid fishes ( cichlidae ) represent the most species - rich family of vertebrates , accounting for about 10% of today 's teleost diversity [ 1 , 2 ] . throughout their distribution range cichlids have repeatedly demonstrated their capacity of forming adaptive radiations explosive speciation with niche partitioning ( reviewed in ) , generating an outstanding variation of body shapes , colour patterns and behaviour , and an enormous diversity of trophic and ecological specializations [ 46 ] , which attracted numerous evolutionary biologists and established them as one of the prime model systems in evolutionary biology ( e.g. , [ 79 ] ) , but the greatest diversity of cichlid fishes is found in the east african great lakes . although endemic cichlid species assemblages are known from most east african lakes , the largest lakes tanganyika , malawi , and victoria harbour a particularly rich fauna of cichlid fishes , with an estimated number of 250800 species in each lake [ 1 , 2 ] . thus , the number of species seems to be correlated with lake size , congruent with the expectation that species diversity increases with habitat heterogeneity and with the opportunity for isolation by distances and allopatric diversification . because of high degrees of endemism ( 9599% ) , these cichlid radiations most likely originated via intralacustrine speciation [ 1 , 7 , 10 ] . with an estimated age of 912 myr , lake tanganyika is by far the oldest of these lakes , and thus harbours the morphologically , behaviourally , ecologically , and genetically most diverse species assemblage [ 1 , 2 , 1215 ] , although the number of species is the smallest . currently 200 valid species are recognized with several more awaiting scientific descriptions such that the total number of lake tanganyika 's cichlid species has been estimated to 250 . these 200 species have been classified into 12 or alternatively 16 tribes , largely supported by molecular data . the specialized , diverse morphologies of these fish appear to be the result of adaptations in their respective niches , and thus , these fish are regarded as ideal model system for the study of adaptive radiation [ 4 , 8 , 9 ] . schluter defined adaptive radiation as the differentiation of a single ancestor into an array of species that inhabit a variety of environments and that differ in traits used to exploit those environments , and employed four features as criteria to detect adaptive radiation : ( 1 ) common ancestry , ( 2 ) phenotype - environment correlation ( empirical evidence of correlation between the diverse phenotypes of descendant species and their divergent environments ) , ( 3 ) trait utility ( experimental or theoretical tests of performance or fitness of a trait in its corresponding environment ) , and ( 4 ) rapid speciation . the first and fourth criteria are the subject of phylogenetic analyses of the species assemblage . the second and third criteria are to find adaptive phenotypes that differ between species as a result of divergent natural selection . these adaptive phenotypes may have caused reproductive isolation between species as byproduct ( ecological speciation , e.g. , [ 20 , 21 ] ) or allowed co - occurrence of two or more closely related species at the same place and in the same time ( resource partitioning , e.g. , [ 22 , 23 ] ) . within the lake tanganyika numerous morphological studies on lake tanganyika cichlid fish have been published in the past . in this short review , we summarize the findings from these studies and highlight their importance for understanding the process of adaptive radiation . the first molecular phylogeny of lake tanganyika cichlids was published by nishida in 1991 . this allozyme - based phylogeny resolved the relationships of 20 species representing all lake tanganyika cichlid tribes and suggested that the lake tanganyika cichlids were polyphyletic . subsequently , many molecular phylogenetic studies have been published , such that , in contrast to the situation in the much younger cichlid species flocks of lakes malawi and victoria , we now have rather precise knowledge on the phylogenetic relationships within the lake tanganyika cichlid species flock and the relationship among african lacustrine and riverine cichlid faunas ( figure 1 ) ( reviewed by [ 810 ] ) . with the exception of tylochromis polylepis and oreochromis tanganicae , the lake tanganyika cichlids evolved from a common ancestor after the formation of the lake 912 ma [ 24 , 27 , 33 ] . these fish are thought to have rapidly radiated within the lake , which fulfils the first and fourth criteria of adaptive radiation presented by schluter ( common ancestry and rapid speciation ) . tylochromis polylepis and o. tanganicae colonized the lake only recently , thus establishing themselves in an already mature adaptive radiation [ 25 , 31 ] . excluding these species , the lake tanganyika cichlid species flock comprises at least six major lineages . the substrate - brooding tribe lamprologini consists of about 80 species endemic to the lake , plus eight species that colonized the congo river and one species that colonized the malagarazi river after the intralacustrine radiation of this tribe [ 37 , 38 ] . the mouth - brooding c - lineage ( sensu ) includes about 100 endemic species assigned to six or ten tribes ( species numbers , phylogenetic relationships , and biological characteristics of tribes are reviewed in ) . whereas the monophyly of each tribe is well supported , the phylogenetic relationships among the tribes are still largely unresolved , indicating rapid diversification and adaptation to particular ecological niches at the onset of the lake tanganyika radiation . the tropheini , one of the endemic mouth - brooding tribes , were shown to be nested within the haplochromines , the most species - rich lineage that also includes the species flocks of the remaining east african great lakes and the majority of the northern , eastern , and southern african riverine cichlid species but originated in the course of the primary tanganyika radiation [ 29 , 30 ] . the simultaneous radiation of the lamprologini and the c - lineage was probably triggered by the onset of deep - water conditions in lake tanganyika about 56 ma ( primary lacustrine radiation ) [ 27 , 30 , 38 ] . alternative hypotheses [ 39 , 40 ] suggest a two- to fivefold older age for the lake tanganyika radiation which would considerably predate the establishment of a real lacustrine habitat [ 11 , 41 , 42 ] and imply that the onset of the radiation has happened in a riverine environment , a habitat generally considered as not suitable to host a radiation . the biological characteristics of the lake tanganyika cichlid species assemblage with a clear resource partitioning between most tribes and the relative age of the east african cichlid species flocks strongly argue for the lake tanganyika radiation to have happened in a single deep - water lake [ 10 , 30 ] . unlike for the younger lakes malawi and victoria molecular phylogenies of lake tanganyika cichlids are typically well resolved , with most species , genera , and tribes being resolved as monophyletic , indicating that lineage sorting has been largely completed . thus , it has been assumed that these molecular phylogenies ( typically based on mitochondrial genes ) do closely approach the true species trees although the placement of some taxa was inconsistent with taxonomy [ 4446 ] . recent evidence from complementary analyses of nuclear dna , however , clearly demonstrated that , despite being well resolved , the mitochondrial phylogenies do not necessarily reflect the true phylogenetic relationships but might be severely misleading due to ancient incomplete lineage sorting , ancient ( and recent ) introgression , and even hybrid speciation [ 26 , 38 , 4753 ] . nevertheless , mitochondrial phylogenies have been and are still used as proxies of species trees in comparative approaches to study the interaction and evolution of biological traits in a phylogenetic context ( e.g. , [ 5457 ] ) , thus potentially introducing an error in inferred evolutionary patterns . the evolutionary success of cichlids has been attributed to the interaction of extrinsic environmental factors and intrinsic species - specific traits . some of these intrinsic traits might be naturally selected ( e.g. , the trophic morphology , body size , body shape , and visual pigments ) , whereas others are predominantly sexually selected ( e.g. , body colouration , smell , and courtship sounds ) , though distinctions between naturally and sexually selected traits might be not that clear ( reviewed in ) . these studies may be classified into four major groups : studies of trophic morphology , body shape , body size , and nervous system . cichlid fishes exhibit a functionally decoupled set of jaws , the oral jaws and the pharyngeal jaws ( figure 2 ) . in particular the pharyngeal jaw is considered a key innovation , representing a key factor for the emergence of a diversity unparalleled among vertebrates [ 5961 ] . the pharyngeal jaw apparatus of cichlid fish is a functionally integrated and highly specialized system and considered to represent a major adaptive complex . decoupled from the oral jaws , the pharyngeal jaws are used for efficient crushing and processing of food items . thus , the oral jaws are freed from their dual task of food collection and preparation . due to this division of functions the development of numerous specializations of food collection and procession mechanisms became possible and minor modifications in oral and pharyngeal jaw structure allow for the utilization of novel food resources within a few generations , such that unexploited ecological niches can be rapidly occupied [ 62 , 63 ] . thus , the specialized pharyngeal jaws in cichlid fish seem to be particularly important for their propensity to rapidly adapt to novel ecological niches , but other trophic morphological features have probably also played key roles for their rapid diversification . likely , rapid differentiation in trophic specializations results in effective resource partitioning and thus drives the evolution of complex cichlid communities by ecological segregation ( e.g. , [ 64 , 65 ] ) . several studies on lake tanganyika cichlids described correlations of the trophic morphology with food habits ( oral jaws and teeth [ 6569 ] , pharyngeal jaws [ 59 , 69 , 70 ] , preorbital region [ 15 , 71 ] , and intestine [ 72 , 73 ] ) , suggesting resource - based divergent selection as an important diversifying force in lake tanganyika cichlids . in algae feeding species , for example , the shape of jaw teeth differs according to the resources they exploit . thus , the species of the genus petrochromis have tricuspid teeth in high density that make a brash - like structure to comb unicellular algae from filamentous algae on rocks , whereas species of tropheus and some other genera have large bicuspid teeth in the most anterior row that allow to nip and tear off filamentous algae from rocks . tooth shape both on oral and pharyngeal jaws in cichlid fish was shown to respond quickly to selection and change even within the lifetime of a single individual [ 74 , 75 ] . recently , significant advances regarding the developmental pathways and genetic basis leading to different tooth shapes and numbers have been made [ 7678 ] . further work on this issue will certainly be important to fully understand how inter- and intraspecific differences in tooth shape and numbers emerge as a sometimes quick response to environmental / trophic constraints in species - rich adaptive radiations where species typically occupy a rather narrow ecological niche . besides the number and shape of teeth , the shape of the pharyngeal jaws and the oral jaws ( or the preorbital region in general ) are well known to strongly correlate with diet and were shown to respond quickly to natural selection when new habitats are colonized or when it comes to optimize feeding performance throughout ontogeny . thus , piscivorous fish were shown to have longer oral jaws than insectivorous and herbivorous fishes , and likewise , slender and elongated pharyngeal jaws have been found to be highly correlated with piscivory [ 79 , 80 ] . however , recent evidence on the lake tanganyika cichlid lepidiolamprologus elongatus suggests that the mature piscivorous morphotype is refined by a relative widening of the caudal part of the lower pharyngeal jaw , which has been interpreted as prerequisite to the insertion of well - developed musculature and the construction of a powerful lever system which allows for processing large prey fish and relying on exclusive piscivory . the length of the intestine typically varies in the order of piscivores < invertivores < herbivores , and hence diet has been shown to be a good predictor of intestine length at both intra- and inter - specific levels in lake tanganyika cichlid fish , indicating that plasticity in intestine length in response to diet is a further important mechanism for driving trophic shifts in adaptive radiations . correlations between trophic morphology and diet quality were recognized even when accounting for phylogeny in the shape of oral jaw teeth and intestine length . though divergent natural selection on trophic morphologies leading to rapid morphological change has been shown to be of tremendous importance for the emergence of lake tanganyika 's astounding cichlid diversity , stabilizing selection seemingly prevents further drastic changes in structures relevant for trophic specializations if species are already well adapted to a particular niche within a multispecies assemblage . balancing selection on trophic traits , on the other hand , may have acted to maintain intrapopulation polymorphism in lake tanganyika cichlids [ 83 , 84 ] . the scale - eating perissodus microlepis , for example , has morphological dimorphism in the mouth - opening direction to right and left . this deflection of mouth has been shown to be heritable [ 86 , 87 ] , though environmental factors can influence the formation of this mouth laterality through development . several population models have demonstrated that this lateral dimorphism is maintained by negative frequency - dependent selection , resulting from interactions between predator and prey species ( e.g. , [ 89 , 90 ] ) . an empirical study has suggested that disassortative mating between right - mouthed individuals and left - mouthed individuals stabilizes this intrapopulation dimorphism more strongly than only negative frequency - dependent selection acted . in recent years , significant advances have been made towards the understanding of the genetic basis of differences in the cichlids ' jaw morphologies [ 9294 ] . yet , further work on the genetic determination of jaw morphologies , the genetic basis of other diet - related traits ( e.g. , pharyngeal bone and intestine ) , and studies on the efficiency of particular trophic morphologies in feeding , processing , and digesting food items are required to gain further insights into the mechanisms underlying the rapid generation of a multitude of trophic types as adaptation to particular resources in lake tanganyika cichlid fishes . the trophic specialization of the pharyngeal jaws may also lead to reproductive isolation between species via mate choice . cichlid fish produce sound during male courtship display [ 95 , 96 ] , and this sound appears to be produced by stridulation of the pharyngeal jaws . courtship sounds have been shown to differ among closely related species of lake malawi cichlids [ 96 , 98 ] . thus , if females use male courtship sound as a cue for mate choice , inter - specific differences in sound may possibly cause assortative mating , and consequently reproductive isolation [ 95 , 97 ] . the lake tanganyika cichlids are highly diverse in pharyngeal jaw morphology , and thus , mate choice based on courtship sounds might represent an additional mode of diversification or prevent heterospecific pairings between already differentiated closely related species , a hypothesis that calls for further detailed investigations . the influence of phylogeny on the evolution of body shape is small in the lake tanganyika cichlids , and it appears that body shape evolution is strongly affected by feeding habits . piscivorous fish , for example , typically have a much larger head and benthivorous fish tend to have a slender body . the body shapes are generally associated with swimming modes in fish ( e.g. , [ 100102 ] ) , suggesting that the divergent body shapes of the lake tanganyika cichlids also relate to other ecological factors , such as the efficiency of escaping from predators . in some maternally mouth - brooding species , this sexual dimorphism in head size and shape appears to be related to a larger buccal cavity in females [ 103 , 104 ] , suggesting that the evolution of body shape is partly associated with reproductive ecology . in the tropheus moorii species complex , differences in the orientation of the mouth and the head profile have been observed among populations , despite a lack of obvious differences in food preferences , mating , and breeding behaviour [ 104 , 105 ] , indicating that these observed difference in body shape might be due to random genetic drift . genetic drift can evolve phenotypes without adaptation , and perhaps it can take populations through adaptive valleys and into the domains of new adaptive peaks ( peak shifts by drift , reviewed in ) . nevertheless , the lake tanganyika cichlid species have to establish themselves in a densely packed multispecies community . consequently intraspecific morphological variation is typically rather low in the natural environment due to inter - specific competition and narrow ecological niches confining the morphospace occupied by a single species . this phenomenon has been recently shown by comparing morphologies of individuals of four wild populations of the tropheus moorii species complex with their pond - raised f1 offspring . the extent of morphological change between wild and pond - raised f1 fish was 2.4 times larger than the pairwise population differences , and all four populations exhibited the same overall trend in morphological change . in the lake tanganyika cichlids , the diversity of body shape may at least partly be associated with adaptive radiation of the fish through resource partitioning , assortative mating , low hybrid fitness , and/or other mechanisms . however , nothing is known about the genetic basis of body shapes and also detailed studies on the efficiency of particular body shapes in feeding and swimming are lacking , thus opening a huge field of research for the future . body size evolution results from a balance between selection favouring large body size and selection favouring small body size ( e.g. , [ 107 , 108 ] ) . while it is widely agreed that fecundity selection for females and sexual selection for males are the major evolutionary forces that favour larger body size in most sexual animals , counterbalancing selection favouring small body size is often masked by the good condition of the larger individuals and is therefore less obvious . in the lake tanganyika cichlid fish , body size greatly varies from 42 to 650 mm in standard length ( the smallest species is the shell - brooder neolamprologus multifasciatus , and the largest species is the substrate brooder boulengerochromis microlepis ) . the effect of environmental constraints on body size has been studied in telmatochromis temporalis . this species comprises dwarf and normal morphs , and the two morphs were shown to have evolved through divergent natural selection , in which the small body size of the dwarf morph was a result of adaptation to utilize empty gastropod - shells as shelters [ 109 , 110 ] . the trait utility of body size has been examined in another shell - brooder , lamprologus callipterus , that shows the most extreme male - biased sexual size dimorphism among animals ( males > 12 times heavier than females ) . experimental and theoretical tests suggested that the large male size of this species was determined by the ability to carry empty shells and intersexual selection , and experimental tests suggested that the female size was limited by the ability to spawn eggs inside the shells . size - assortative mating has been reported in a wide range of animal taxa ( e.g. , planarians , snails , gammarus , insects [ 117119 ] , fishes [ 120 , 121 ] , toads , snakes , lizards , mammals , and birds ) and can cause reproductive isolation between species or morphs as byproducts of differences in body size [ 127129 ] . in the lake tanganyika cichlid fish , divergent natural selection on body size might have been contributed to at least a part of explosive radiation of this species flock through assortative mating , and further , other various mechanisms such as low hybrid fitness and resource partitioning . further work on intrinsic and extrinsic factors that affect the body size may give deep insights into the mechanisms underlying the adaptive radiation of these fish . huber and colleagues and pollen and colleagues demonstrated that the relative development of various brain structures relates to habitat , social behaviour , resources , and environment . thus , in the tribe ectodini for example , telencephalon , that appears to be involved in a variety of tasks , such as processing olfactory , visual and gustatory stimuli , and in learning , agonistic and courtship behaviours , was larger , and hypothalamus , that appears to have integrative functions relating to feeding , aggression , reproduction , and vision , was smaller in monogamous species compared to polygamous species . gonzalez - voyer and colleagues showed that female brain size correlated with brood care type and diet type and that male brain size correlated with diet type only , suggesting that more complex diet selection and larger burden on brood care may demand larger brain size . sylvester and colleagues showed that an alternative snp in irx1b potentially causes differences in the relative size of the telencephalon versus the thalamus between rock - dwelling and sand - dwelling lake malawi cichlids . although it is not at all obvious how an increase in the size of brain would give rise to functional differences ( e.g. , increased cognitive abilities ) , the brain morphology may have played important roles in adaptive radiation of the lake tanganyika cichlids . we reviewed a trophic morphology , body shape , body size , and nervous system , morphological traits that might be causally involved in the adaptive radiation of the lake tanganyika cichlids . . the diversity of these other traits may be a result of adaptation to various environments , genetic drift , or phenotypic plasticity during development . for example , the infraorbitals ( a series of bones surrounding the lower half of the eye ) were shown to vary considerably in shape among the lake tanganyika cichlids ( figure 3 ) . however , it is still unknown what exactly caused the observed inter - specific differences in this morphological structure , though it has been argued that infraorbitals have the function to regulate the movement of jaws in relation to some other bones , and that the number and size of sensory pores on these bones may be associated with the noise sensitivity . some morphological characters differ at various taxonomic levels , reflecting difference in the relative time of morphological divergence . for example , the shape of infraorbitals tends to differ between tribes , suggesting that this morphology diverged during the initial radiation . the body shape and the shape of oral jaw teeth , on the other hand , tend to differ at lower taxonomic levels , such as between genera and between species , suggesting that the divergence of these morphologies reflect later evolutionary events . studies on adaptation and natural selection typically focus on traits in adult organisms , but high mortality among juveniles indicates that in addition to predation pressure strong selection pressure , competition avoidance , and resource partitioning are presumably important already early on in life ( e.g. , ) . thus , individuals do not only have to compete for resources against heterospecific individuals but also against conspecifics . for species that comprise a number of cooccurring size - classes ( many invertebrates , fish , amphibians , and reptiles ) niche separation by body size differences poses a complex problem since the smallest size - classes of one species often overlap with the largest of another . since resource utilization abilities and predation risk are generally related to body size , many species undergo sometimes dramatic ontogenetic shifts in habitat use and/or food choice . thus , among fish , ontogenetic changes in resource use are nearly universal and size - related shifts in food choice have been documented in numerous species , typically with positive correlations between food size and body size ( e.g. , [ 139145 ] ) . these ontogenetic shifts in resource use might vastly complicate species interactions with important consequences for community dynamics , in particular in multispecies communities . if small and large species coexist , the most critical feature of this interaction is not how adults of these two species interact , but how the larger species is able to recruit through juvenile stages that are identical to the size ranges present in the smaller species . interactions of this sort might form bottlenecks in recruitment to the species , and thus adaptive fine - tuning is particularly important in juvenile stages , especially in regions / periods where / when resources are limited . ontogenetic niche shifts aid in maximizing fitness by reducing competition with conspecifics via resource segregation , by minimizing predation risk through habitat shifts , and by maximizing growth through dietary shifts . these ontogenetic shifts in resource use might be rather abrupt and are often correlated with discrete growth periods in the life history ( e.g. , [ 149 , 150 ] ) . for many primarily piscivorous fishes the transition to piscivory is a crucial ontogenetic niche shift . typically , highly specialized piscivores are not particularly well adapted to feeding on zooplankton and benthic invertebrates , which are their predominant prey early in life [ 138 , 151 ] , and delayed shifts to piscivory can result in slow growth and increased mortality , in particular when competing for resources with specialist planktivorous species [ 138 , 151 , 152 ] . the switch to piscivory often initiates an increase in growth rate , translating into larger body size and greater survival larger individuals are typically less vulnerable to predation and are better adapted to survive periods of starvation throughout life for specialized piscivores [ 151 , 152 ] . several factors , for example , species - specific differences in the allometry of trophic structures , hatching time and size at hatching , have been proposed to at least partially explain these inter - specific differences in the timing of the switch to piscivory [ 151 , 153 ] . although there is a considerable amount of studies relating dietary shifts to ontogenetic changes of overall body shape in fishes ( e.g. , [ 139141 , 144 , 145 ] ) , studies that directly relate ontogenetic changes in diet and growth patterns of the trophic apparatus are scarce ( e.g. , ) . whereas isometric growth of the lower pharyngeal jaw was reported for the lake tanganyika cichlid lamprologus ornatipinnis , a species that predominantly feeds on invertebrates and thus does not experience a drastic shift in feeding habits throughout ontogeny , hellig and colleagues showed that an allometric change in ontogenetic lower pharyngeal jaw development of lepidiolamprologus elongatus , a top predator in the shallow rocky habitat of lake tanganyika , coincides with the dietary shift to exclusive piscivory ( figure 4 ) . this observation might indicate that distinct allometry is correlated with strong specialization , but it remains to be tested whether this is a general phenomenon in trophic specialists , what is the genetic basis of such morphological changes , and to what extent differential gene expression producing differences in morphology contributes to the astounding diversity of cichlid fishes in lake tanganyika . along with the darwin 's finches from the galpagos islands ( e.g. , ) and the hawaiian silverswords ( e.g. , ) the east african cichlid species flocks represent well - established model systems for the study of adaptive radiation . numerous morphological studies on the lake tanganyika cichlid species flock have greatly contributed to the ever - increasing knowledge on the evolutionary pathways and mechanisms generating tremendous diversity within a short period of time . rapid changes in particular morphological traits allow for the rapid adaptation of cichlid fish to novel resources . the lake tanganyika cichlids are highly diverse in their morphology , and many morphological traits appear to have been concerned with adaptive radiation . clearly , more studies are required to reveal the mechanisms of adaptive radiation of these fish , but recent methodological advances , in particular in the field of geometric morphometrics , appear promising for answering a wide variety of evolutionary questions and even allow for addressing population - level questions regarding ( adaptive ) shape changes ( reviewed in ) . in the present review , we only surveyed morphological studies . however , only the integration of evidence from various fields of research will significantly advance our understanding of the evolutionary mechanisms underlying the adaptive radiation(s ) of ( lake tanganyika ) cichlid fish . for example , disruptive sexual selection on male colouration has been shown to drive speciation in some lake malawi and victoria cichlids ( e.g. , [ 161163 ] ) , and olfactory cues are important for mate choice in some lake malawi cichlids . thus , female choice for male nuptial colour and olfactory signals may also have played ( and still play ) important roles in at least a part of the explosive radiation of the lake tanganyika cichlid species flock . indeed , more than 10% of lake tanganyika 's cichlid species ( e.g. , cyprichromini , benthochromini , and some species of ectodini , tropheini , and bathybatini ) exhibit obvious sexual colour dimorphism . however , at present there is no clear evidence for sexual selection based on body coloration being of great importance for driving rapid diversification in lake tanganyika 's cichlid species flock . however , body coloration might serve as cue for species / mate recognition and prevent inter - specific or intermorph gene flow in case of secondary contact , be it human induced or due to lake level fluctuations , exemplified by evidence for colour assortative mating among originally allopatrically distributed colour morphs of tropheus moorii [ 165167 ] . thus , allopatrically evolved mate choice cues serve as prezygotic isolation mechanisms preventing cichlid species / morphs from hybridization in the case of secondary contact . recent paleolimnological and geological studies have shed light on the dynamics of past water level fluctuations that act as species pumps by recurrent fragmentation and secondary admixis of populations in the east african great lakes [ 169171 ] . ecological studies provide insights into the degree of intra- and inter - specific interactions ( e.g. , [ 172179 ] ) , and the recent developments in sequencing techniques allow for the generation of huge amounts of sequence data at comparatively low costs provide exciting new possibilities to investigate phylogenetic relationships among taxa , population genetic structure , and the genetic basis and regulation of particular traits . at present , we are still far away from completely understanding what has driven and still drives the rapid diversification in east african cichlid species flocks , but recent advances in various fields of research hold a promising future for researchers .

lake tanganyika is the oldest of the great ancient lakes in the east africa . this lake harbours about 250 species of cichlid fish , which are highly diverse in terms of morphology , behaviour , and ecology . lake tanganyika 's cichlid diversity has evolved through explosive speciation and is treated as a textbook example of adaptive radiation , the rapid differentiation of a single ancestor into an array of species that differ in traits used to exploit their environments and resources . to elucidate the processes and mechanisms underlying the rapid speciation and adaptive radiation of lake tanganyika 's cichlid species assemblage it is important to integrate evidence from several lines of research . great efforts have been , are , and certainly will be taken to solve the mystery of how so many cichlid species evolved in so little time . in the present review , we summarize morphological studies that relate to the adaptive radiation of lake tanganyika 's cichlids and highlight their importance for understanding the process of adaptive radiation .

You are an expert at summarizing long articles. Proceed to summarize the following text: age - related macular degeneration ( amd ) is the leading cause of legal blindness in the elderly [ 13 ] . vascular endothelial growth factor a ( vegf - a ) plays an important role in vascular homeostasis , promotion of endothelial cell proliferation and the growth of new blood vessels [ 4 , 5 ] . however , expression of vegf - a in the retina is a major mediator of angiogenesis and vascular leakage in neovascular amd , which , if left untreated , can result in loss of central vision . intravitreal injection of a vegf - a inhibitor is currently the primary treatment for neovascular amd . at present , four anti - vegf therapies are used for such patients : pegaptanib ( macugen , pfizer , new york city , ny , usa ) , alfibercept ( eylea , bayer healthcare , berlin , germany / regeneron pharmaceuticals , inc . , tarrytown , ny , usa ) , ranibizumab ( lucentis , novartis , basel , switzerland / genentech , south san francisco , ca , usa / roche , basel , switzerland ) and bevacizumab ( avastin , genentech / roche ) . pegaptanib , a ribonucleic acid aptamer that only blocks the pathologic vegf - a 165 isoform , was the first anti - vegf therapy to be approved for intravitreal treatment , although it is in limited use , as pan - vegf - a blockers produce better outcomes . aflibercept is a fusion protein originally developed for oncology use that binds all forms of vegf - a , as well as vegf - b and placental growth factor ( pigf ) , additional angiogenic growth factors that appear to play a role in tumor angiogenesis and inflammation [ 9 , 10 ] . ranibizumab is a recombinant , affinity - matured , humanised antibody fragment ( fab ) against vegf - a produced in an e. coli expression system . ranibizumab was designed specifically for intravitreal use , and , in addition to amd , is approved for the treatment of diabetic macular oedema in the european union ( eu ) and macular oedema secondary to retinal vein occlusion in the eu and the usa [ 6 , 11 , 12 ] . bevacizumab is a full - length , recombinant , humanised antibody to vegf - a produced in a chinese hamster ovary mammalian expression system . as such , bevacizumab ( unlike ranibizumab ) is glycosylated , which prolongs systemic half - life , and contains the fragment crystallisable region ( fc region ) of the antibody , which facilitates systemic absorption . bevacizumab was designed to have a long systemic half - life , important for use in oncology , and is not approved for intravitreal use . despite this , bevacizumab is often used , off - label and unlicensed , for intravitreal treatment by ophthalmologists . this practice began and spread rapidly in the period following release of the key clinical trial results of ranibizumab but prior to its approval , when ranibizumab was not yet available . given the huge unmet medical need and rapid loss of vision in patients with amd , there was little other choice during that time in many health economies but to use off - label bevacizumab . thus , bevacizumab use in ophthalmology grew rapidly and has remained widespread in several economies . currently , there is a perception that bevacizumab and ranibizumab are identical in terms of safety and efficacy . as single vials of bevacizumab intended for intravenous use can be compounded into many small doses for intraocular use , there is also a cost difference between the two drugs that some may argue takes precedence over inequalities in the safety and efficacy between the drugs . several head - to - head trials of ranibizumab and bevacizumab are ongoing ( table 1 ) . the 12- and 24- month of the comparison of amd treatment trials ( catt ) study were reported in april 2011 and april 2012 , respectively [ 16 , 17 ] . the inhibition of vegf in age - related choroidal neovascularisation ( ivan ) study released 12-month results in may 2012 . for this reason , we consider it timely to evaluate the safety profiles of ranibizumab and bevacizumab , examine the need for continuing pharmacovigilance to ensure that rare adverse events ( aes ) are detected for both drugs , and consider the risks , for both patients and clinicians , associated with unlicensed prescribing . a debate - style symposium at the 2nd world congress on controversies in ophthalmology in barcelona , spain , in march 2011 , centred around a discussion of these topics , and is the basis of this review.table 1current head - to - head trials of ranibizumab versus bevacizumab in neovascular age - related macular degenerationstudycountryn ( target)trial identifiercatt us1208nct00593450ivanuk600isrctn92166560gefalfrance600nct01170767viberagermany366nct00559715lucasnorway420nct01127360bramdnetherlands320ntr1704mantaaustria320nct00710229clinicaltrials.gov ; international standard randomised controlled trial number register ; nederlands trial register current head - to - head trials of ranibizumab versus bevacizumab in neovascular age - related macular degeneration clinicaltrials.gov ; international standard randomised controlled trial number register ; nederlands trial register while serious failures in patient safety are uncommon , patient safety incidents or adverse health care events are a global concern . many such incidents are preventable for example , around 15 % of hospital - acquired infections are thought to be avoidable . fatal adverse drug reactions are thought to be the sixth leading cause of death in the us . over 20,000 people / year in the uk are reported to have experienced serious adverse reactions to drugs , and this may be just a small proportion of the true figure . in uk national health service hospitals , patient safety incidents are estimated to occur in around 10 % of admissions , and only a fraction are reported . a review of patient safety incident reports submitted to the national patient safety agency from across england and wales relating to anti - vegf use in ophthalmic care found 166 relevant reports from 2003 to june 2010 , suggesting considerable under - reporting of such incidents . the incidents so reported included infection and inflammation , delays in treatment , problems with medication availability , errors in medication , and errors in the patient or eye injected . it is recognised that under - reporting of adverse drug reactions is significant . with licensed medications , reports from post - marketing surveillance and pharmacovigilance programmes add to data from clinical trials to build a picture of the safety profile of a drug in a given indication and patient population . since serious safety signals may not be detected during clinical trials and may only appear during post - approval marketing . collection of safety data from post - marketing studies and routine clinical use is critical . one such example is rosiglitazone ( avandia , glaxosmithkline , london , uk ) , approved for treatment of type 2 diabetes mellitus in 2000 . in 2007 , a black - box warning on myocardial ischaemia was added to the label owing to concerns that had arisen in independent meta - analyses of 42 short - term randomised controlled trials involving 27,847 patients , linking rosiglitazone with increased risks of myocardial infarction and death from cardiovascular causes [ 2628 ] . subsequently , a number of observational studies using routine clinical data ( medicare claims data ) for rosiglitazone and pioglitazone , a member of the same drug class , found a significantly increased risk of arterial thromboembolic events ( ates ) with rosiglitazone versus pioglitazone [ 2931 ] , and rosiglitazone use was suspended in europe in 2010 . importantly , the initial clinical trials of rosiglitazone were not designed to generate cardiovascular safety outcomes data , and this ae was not detected . this case demonstrates the importance of rigorous post - marketing surveillance to enable detection of serious safety signals that may not be apparent pre - registration . however , pharmaceutical companies do not typically enter into official pharmacovigilance programmes for indications that are unlicensed or off - label , as such use is at the discretion of the prescriber . in addition , if a patient dies , or misses an appointment due to disability resulting from a stroke , the ophthalmologist often does not learn of these events , which then go unreported irrespective of whether a formal pharmacovigilance programme is in place . this illustrates the importance of large - scale clinical trials such as catt , even for off - label drugs , to assess safety in a more robust manner . the key principal underpinning the regulations governing the production , distribution , and use of medicines is the safeguarding of public health . for this reason , eu legislation requires a marketing authorisation ( ma ) to be granted for the purposes of placing a medicinal product on the market [ 32 , 33 ] . the medicines regulatory system in the uk was developed following the thalidomide tragedy , and exists to protect the public from exposure to unsafe drugs . an ma is granted if the applicant can demonstrate that the drug is safe , efficacious , and of suitable quality . medicines must not be promoted without , or outside the terms of , their ma . furthermore , the ma provides a clear and comprehensive description ( via the summary of product characteristics , smpc ) of how a medicine may be used . if a drug is prescribed in a manner outside the description given in the smpc ( or label ) , then this use is known as off - label ( used in an indication , dosage or patient group not specified in the label ) , unlicensed ( modified in form or strength in a way that has not been assessed or approved , such as splitting a vial into syringes ) or potentially both off - label and unlicensed . the use of bevacizumab to treat amd is an example of the latter , since both the indication and the formulation are currently unapproved . eu regulations envisage off - label / unlicensed use only under limited special need circumstances , including authorised clinical trials , compassionate / named patient use when no other treatment is available , emergency scenarios ( e.g. , pandemics ) or at the discretion of a treating physician [ 32 , 33 , 35 ] . where doctors choose to prescribe under one of the exemptions above , patients must be fully informed , in accordance with their fundamental right to be informed about the treatments they receive , about the presence of any approved alternative treatments , and be able to participate in treatment decisions . the concept of informed consent for off - label / unlicensed use is reflected in the european convention of human rights and associated case law , as well as in national laws and ethical guidance . national requirements for informed consent vary across the eu , but it is generally agreed that physicians should inform their patients of the unlicensed nature of the proposed treatment , the reasons for proposing the treatment , any potential side - effects , the risks and benefits , and available alternatives [ 3742 ] . for example , in the uk , general medical council ( gmc ) guidance on prescribing off - label / unlicensed medicines states that:[y]ou must explain the reasons for prescribing a medicine that is unlicensed or being used outside the scope of its licence where there is little research or other evidence of current practice to support its use , or the use of the medicine is innovative [ 43 , 44 ] . [ y]ou must explain the reasons for prescribing a medicine that is unlicensed or being used outside the scope of its licence where there is little research or other evidence of current practice to support its use , or the use of the medicine is innovative [ 43 , 44 ] . while the use of a drug outside the terms of its licence can be an important tool to provide patients with treatment in cases of unmet medical need where there are no licensed therapy options , the use of an unlicensed medicinal product , when a suitable tested and approved alternative is available , may put prescribing physicians at risk of liability if safety issues arise . should any untoward event arise through the use of that drug , the treating physician would have the burden of proof to demonstrate that its use was performed as standard of care . by prescribing licensed drugs , physicians can be confident that the risk benefit balance of the therapy has been assessed and is supported by quality pre - clinical and clinical data . physicians should also bear in mind that cost is not a relevant consideration when deciding whether to prescribe a drug off - label . in the uk , gmc guidance does not allow doctors to factor in the cost of a medicine [ 43 , 44 ] . rather , doctors must be satisfied that an unlicensed or off - label medication would better serve the patient s needs than an appropriately licensed alternative , and be satisfied that there is a sufficient evidence base and/or experience of using the medicine to demonstrate its safety and efficacy . in march 2012 , the court of justice of the european union ruled that a polish law allowing the import and sale of unapproved and less costly medications to similar , approved drugs under the special need exemption breaches eu law . the ruling noted that the exemption must be used only when completely essential and based solely on therapeutic need . if approved medicines with the same active ingredients , dosages , and forms are on the market , there can not be a requirement for special needs , and financial considerations can not be used as a justification . as a result of the important role of vegf in promoting vascular homeostasis , there is a theoretical risk of ates following the use of any vegf inhibitor [ 4 , 47 , 48 ] . when anti - vegf agents are given systemically , there is a known risk of increased blood pressure and ischaemic cardiac events . this is important , since studies have shown increased risks of stroke and coronary heart disease in untreated patients with amd compared with controls [ 4951 ] . a difference in the rates of these events in patients with amd treated with ranibizumab and bevacizumab would be of particular clinical relevance . as bevacizumab and ranibizumab are derived from the same mouse monoclonal anti - vegf antibody , they are sometimes perceived to have equivalent safety and efficacy . however , as reviewed recently , bevacizumab and ranibizumab are different at the molecular level , so safety and efficacy data can not be extrapolated . while bevacizumab is a full - length recombinant antibody , ranibizumab was developed by inserting sequences from the parent antibody into a human antigen binding fragment ( fab ) framework . the humanised fab was then selectively mutated by changing six amino acids to increase its affinity for binding and inhibiting vegf - a over the original mouse antibody and bevacizumab . as an antibody fragment , ranibizumab has a relatively short systemic elimination half - life , estimated at ~2 hours compared with ~20 days for bevacizumab , and lacks the fc region of an antibody ( present in bevacizumab ) , which has been reported to initiate complement activation and an immune response [ 53 , 54 ] . in addition , bevacizumab reaches the systemic circulation following intravitreal injection more rapidly than might be expected for a full - length antibody . experiments in rabbits demonstrated the vitreous half - life of intravitreal bevacizumab to be 4.3 days , similar to that of the much smaller molecule of ranibizumab ( 2.8 days ) [ 55 , 56 ] . an explanation for this has been provided by studies in mice indicating that the neonatal fc receptor , expressed by retinal pigment epithelial cells , is involved in the active transport of bevacizumab across the blood retina barrier . this receptor may be upregulated in eyes with neovascular amd , leading to rapid elimination of bevacizumab from the vitreous humor into the systemic circulation . in comparison , a study of the half - life in humans measured intraocular concentrations of bevacizumab from 29 patients , and found the half - life of bevacizumab to be dose - dependent . the half - life of bevacizumab from a single 1.5 mg dose was determined as 7.85 days , compared with 11.67 days for a 3.0 mg dose . studies in rabbits detected bevacizumab , but not ranibizumab , in the serum following intravitreal injection , suggesting that bevacizumab may be more likely to have clinically observable systemic effects than ranibizumab [ 55 , 56 ] . importantly , systemic vegf inhibition has been demonstrated in patients with diabetic retinopathy following intravitreal bevacizumab injection . plasma vegf levels were significantly reduced for at least 30 days ( p < 0.001 ) after a single bevacizumab injection . similarly , patients with amd treated with intravitreal bevacizumab have a significant reduction in plasma vegf levels up to 28 days after injection ( p < 0.001 ) , but no significant reduction in plasma vegf following ranibizumab treatment . the molecular and pharmacological differences between ranibizumab and bevacizumab signal that safety and efficacy data from one can not be extrapolated to the other . an accumulating body of clinical and regulatory evidence supports the hypothesis that these fundamental differences translate into clinical differences in the safety profile of these two drugs . a recent , non - randomised , comparative study in patients with amd confirmed bevacizumab as an independent and significant predictor for new ates , associated with around a 10-fold higher risk than ranibizumab . two independent retrospective analyses of the us medicare claims database also report differences in rates of systemic aes with ranibizumab and bevacizumab [ 61 , 62 ] . the first examined data from 146,942 patients with amd , to compare the risks of several systemic aes with current treatments for amd . while the primary analysis of this study did not identify significant differences in risk between the ranibizumab and bevacizumab groups , a secondary analysis in which the study population was limited to 40,841 newly - treated patients who received bevacizumab or ranibizumab only showed significantly increased risks of all - cause mortality and stroke with bevacizumab ( fig . 1 ) . these results are consistent with those of a second ( unpublished ) medicare data analysis , which showed a significantly increased risk of mortality with bevacizumab versus ranibizumab in an analysis of 77,886 claimants . while the limitations of such database analyses are recognised , neither showed fewer systemic ates with bevacizumab , indicating that there may be an emerging safety signal , as was the case with the early warning signs with rosiglitazone discussed above.fig . 1hazard ratios adjusted for patient characteristics ( with 95 % confidence intervals ) for systemic adverse events at 1 year in the secondary analysis of a medicare claims database study ( n = 40,841 ) hazard ratios adjusted for patient characteristics ( with 95 % confidence intervals ) for systemic adverse events at 1 year in the secondary analysis of a medicare claims database study ( n = 40,841 ) several prospective comparative studies of ranibizumab and bevacizumab are ongoing . none have the statistical power to determine if a safety difference exists between the drugs . considering the catt study primary efficacy endpoints at 12 months , monthly injections of bevacizumab successfully demonstrated non - inferiority to monthly ranibizumab as well as ranibizumab given as needed . it is important to note that in year 1 there were no differences in venous thrombolic events or ates ; however , there was a significantly higher rate of serious systemic aes ( of which 80.5 % were associated with hospitalisation ) with bevacizumab compared with ranibizumab , which remained significantly higher after adjustment for baseline demographics and coexisting illnesses ( p = 0.04 ) . in catt year 2 , ranibizumab maintained visual acuity gains from year 1 with both regimens . greater numerical visual acuity gains and significantly fewer injections were seen with ranibizumab versus bevacizumab as needed , and the 2-year catt data confirmed an overall significantly higher risk of serious systemic adverse events with bevacizumab versus ranibizumab ( p = 0.004 ) . ates , systemic haemorrhage , congestive heart failure , venous thrombotic events , hypertension , and vascular death were more frequent in bevacizumab - treated patients , and as in year 1 , there were significantly more gastrointestinal disorders in patients treated with bevacizumab compared with ranibizumab ( p = 0.005 ) . similarly to catt , the 2-year ivan study includes comparisons between ranibizumab and bevacizumab and between regimens . however , there is no comparison between individual treatment arms , due to the study lacking the statistical power to compare these groups . the year 1interim analysis showed that improvement in visual acuity was greater in the ranibizumab arms than in the bevacizumab arms . bevacizumab failed to demonstrate non - inferior vision gains to ranibizumab at 1 year using a 3.5 letter non - inferiority margin ( 95 % ci , 4.04 , 0.06 ; p = 0.056 ) . secondary findings ( e.g. , fluid on optical coherence tomography , dye leakage on angiogram ) also favoured ranibizumab . there was no significant difference in the proportion of patients experiencing at least one serious adverse event ( sae ) with ranibizumab versus bevacizumab in ivan at 1 year . however , there were numerically more saes with bevacizumab ( n = 37 ) than with ranibizumab ( n = 30 ) . given the relatively small study populations in catt , ivan , and the other current head - to - head trials , it is unlikely that any of these studies are powered to reveal significant differences in rates of individual serious aes between treatment groups . there is the possibility that a meta - analysis of these trials may reveal a safety signal , and there remains a huge need for large studies powered for safety to elucidate fully the incidence of infrequent serious aes . in addition to the fundamental structural and pharmacokinetic differences between the two drugs , manufacturing and packaging specifications also differ between ranibizumab and bevacizumab . ranibizumab is manufactured to meet united states pharmacopeia ( usp ) standards for ophthalmic solutions ( usp789 ) , which are more stringent with regard to sterility and particulate matter than the requirements for intravenous medications such as bevacizumab ( usp788 ) . in the latter , more particulate matter is tolerated , which has the potential to cause irritation and inflammation if injected into the eye . in contrast , bevacizumab vials are intended for single use as an intravenous infusion , and in practice undergo compounding into smaller aliquots for use in amd care . active immunoglobulin levels in compounded bevacizumab samples have been shown to vary significantly between compounding pharmacies , leading to the possibility of variable efficacy depending on the amount of antibody present . in addition , compounded bevacizumab samples have also been shown to have an increase in particulate matter , which may lead to elevated intraocular pressure and inflammation . the recent analysis of medicare claims data reported that patients given bevacizumab were significantly more likely to require treatment for ocular inflammation than those receiving ranibizumab , and a precautionary recall of compounded bevacizumab was issued in march 2012 by a leading national health service ( nhs ) hospital compounding pharmacy in the uk after a number of reports of suspected sterile endophthalmitis following intravitreal injection . whenever the physician does not control the source of drugs , there is an increased potential for human error , either by an incorrect dose or incorrect drug . a recent series of endophthalmitis cases in china was traced back to counterfeit bevacizumab being used by the compounding pharmacy . finally , there is an increased risk of contamination when single - use vials are accessed multiple times . clusters of cases of endophthalmitis traced back to such contamination led to an alert being issued by the us food and drug administration . more recently , the medical products agency in sweden issued a position statement in march 2012 recommending the use of ranibizumab for retinal conditions , due to concerns that available safety data for bevacizumab in this setting are inadequate , but indicate an increased risk for ocular inflammation and potentially also for certain systemic adverse events . in february 2012 , the emilia romagna region of italy temporarily suspended the off - label use of bevacizumab for newly diagnosed patients following a response from the italian medicines agency ( aifa ) to a request from emilia romagna to reimburse bevacizumab through a law that regulates the off - label use of drugs at national level . aifa stated that the results of the catt study do not justify the off - label use of bevacizumab , both in terms of safety and efficacy . in contrast , having previously supported and endorsed use of bevacizumab in patients , in 2012 the german ophthalmological society , the retinological society , and the association of ophthalmologists in germany released a new statement on therapeutic strategies for treating wet amd in response to the catt study report , which refers to a similar efficacy of bevacizumab but also acknowledged the legal implications of off - label use . in december 2011 the royal college of ophthalmologists stated that the college believes the use of ranibizumab for amd should be the default position until the nhs commissions a national institute for health and clinical excellence ( nice)/ medicines and healthcare products regulatory agency ( mhra ) assessment of bevacizumab and until a national policy is formulated . debate currently surrounds the use of unlicensed treatments in medicine , with wide - reaching implications for informed consent , patient safety , and the regulatory process itself . it is our hope that greater understanding of these issues by ophthalmologists may lead to better patient care in ophthalmic practice . the primary role of regulatory systems is to promote patient safety . despite this , the regulatory apparatus surrounding post - marketing monitoring and safety is less coherent than that concerned with the drug discovery , development and ma process . only in recent years , following public and media interest in high - profile drug safety cases such as those of rosiglitazone and rofecoxib ( vioxx , merck , whitehouse station , nj , usa ) , is the process of proving drug safety receiving similar attention to the process of demonstrating efficacy , and this has led to reform of eu pharmacovigilance laws . however , in order to make real differences in patient safety , regulatory bodies must make rational safety decisions and allocate resources to implement changes . professional bodies could have an important role in raising safety concerns in ophthalmology in general and with regulatory authorities . for example , the royal college of ophthalmologists has provided detailed guidance on patient safety in ophthalmology , which should be of merit to eye - care teams to improve patient safety in local departments and aims to keep members updated of emerging issues [ 72 , 77 ] . ranibizumab and bevacizumab are distinctly different at the molecular level , have different target profiles and different approved routes of application . these differences mean that safety and/or efficacy data from one can not be extrapolated to the other , and the rosiglitazone case provides a timely illustration that agents in the same drug class can have significant differences in safety profiles . since bevacizumab is unlicensed for use in ophthalmology , post - marketing pharmacovigilance normally implemented for licensed drugs has not been carried out to date . existing clinical evidence comes solely from clinical studies , with a number of studies reporting trends towards an increased risk of systemic aes with bevacizumab [ 1618 , 5759 ] . though such studies have limitations , the consistency of findings reinforces the plausibility of patient safety differences between these vegf inhibitor agents . however , large studies specifically powered for safety are needed to reveal the significance of rare serious aes with these agents . the issues discussed here regarding pharmacovigilance and unprofessional compounding of bevacizumab physicians may be liable for serious aes that occur in patients they treat , particularly if they have not provided patients with sufficient information about the unlicensed drug to allow them to provide informed consent . this leads to particular concerns for ophthalmologists who may be encouraged or even pressured to prescribe off - label bevacizumab by their employing institutions or insurance companies . in such situations , it is even more important that the patient is fully informed .

vascular endothelial growth factor ( vegf ) inhibitor medications such as ranibizumab , pegaptanib and bevacizumab are in use for the treatment of neovascular age - related macular degeneration ( amd ) and other retinal conditions , although only ranibizumab and pegaptanib are approved for these conditions . in contrast , bevacizumab was developed for the intravenous systemic treatment of colorectal cancer and is not formulated for intravitreal use , but is commonly used off - label in ophthalmology . european union legislation permits the use of drugs outside the terms of their licence ( off - label ) only under certain circumstances , such as during clinical trials , compassionate / named patient use in the absence of a licensed alternative , emergency scenarios ( e.g. , pandemics ) or at the discretion of a treating physician . in such cases , patients should be fully informed regarding their treatment and any potential risks involved . off - label drug use can be an important tool to provide patients with treatment in cases of unmet medical need . however , the use of an unlicensed medicinal product , when a suitable licensed alternative is available , puts prescribing physicians at risk of liability if safety issues arise . emerging clinical evidence suggests safety differences exist between ranibizumab and bevacizumab .

You are an expert at summarizing long articles. Proceed to summarize the following text: in the last decades and almost all around the world , the disease burden profile has changed from communicable diseases in childhood to non - communicable diseases ( ncds ) in adulthood ( 1 , 2 ) . meanwhile , the worldwide healthy adjusted life expectancy ( hale ) has grown slower than life expectancy ( 0.8 years for each 1 year ) and in a few countries hale even has been reduced ( 3 , 4 ) . in addition , non - fatal health outcomes have resulted in increasing years lived with disability ( yld ) , worldwide ( 5 ) . the global burden of diseases ( gbd ) study on 2010 identified high blood pressure ( bp ) as the top global burden risk factor . in most parts of asia , middle east , north africa , and central europe , it had worldwide attributable deaths of about 9.4 million and disability adjusted life years ( dalys ) of about 173.6 million and comprised 53 percent of ischemic heart disease ( ihd ) dalys ( 1 ) . moreover , this study defined ihd , lower respiratory infections , and stroke as the three major causes for years of life lost ( yll ) due to premature death ( 6 ) , with high bp as one of the most important risk factors for all of them . in 2001 , high bp resulted in 7.6 million premature deaths and 92 million dalys ; it also caused 54% of strokes and 47% of ihds worldwide ( 7 ) . in 2002 , ihd and stroke were the two principal causes of global death ( 8) . the world health organization ( who ) ranked high bp ( 13% of global death ) ( 9 ) and , cardiovascular diseases ( cvds ) ( 45% of global deaths ) ( 10 ) as the leading risk factors for global death in 2009 and 2011 , respectively . it is well documented that elevated bp during adulthood roots in childhood ( 11 - 13 ) . given the importance of tracking bp from childhood , the fourth report on the diagnosis , evaluation , and treatment of high bp in children and adolescents highlighted that all children aged above 3 years , who are seen in a medical setting the growing pattern of ncds and the pattern of the gbd are of special concern in low- and middle - income countries ( 1 ) . as a low - middle income country located in the middle east and north africa ( mena ) region , iran is facing rapid epidemiological transition and change in the disease pattern ( 15 ) . therefore , increasing our knowledge on the risk factors of ncds , would be helpful for designing and implementing timely preventive health programs . it seems necessary to cumulate their findings and estimate the overall burden of elevated bp for the country . furthermore , comparing data at the local and sub - national levels might yield useful results , which could be used by health policy makers and health workers . even the gbd study has drawn an overview of the situation at global level and does not provide each country s specific situation . therefore in the current review , first we looked for the studies conducted on bp among iranian pediatric population . thereafter , we tried to deliberate the relevant trends and burdens in the country . due to the scarcity of accessible information in many areas of the country , we need to use advanced statistical modeling methods in order to impute the missed data ( 16 , 17 ) . the present systematic review is a sub - component of cardio - metabolic risk factors burden study in iranian children and adolescents which itself is a part of the national and sub - national burden of diseases , injuries and risk factors ( nasbod ) study in iran . we have described detailed designs and protocols elsewhere ( 18 , 19 ) , and here we explain it in brief . the major outcome in the current review was elevated bp . according to the us national heart , lung , and blood institute ( nhlbi ) , bp is considered normal when the systolic and diastolic values are less than the 90 percentile for the child s age , sex , and height . prehypertension , is diagnosed when a child s average bp is above the 90th percentile but below the 95th . every adolescent with a bp greater than 120.80 mmhg is also diagnosed to have prehypertension , even if the bp would be below the 90 percentile . stage i hypertension is diagnosed if a child s bp is greater than the 95th percentile but less than or equal to the 99th percentile plus 5 mmhg . stage ii hypertension is diagnosed if a child s bp is greater than the 99th percentile plus 5 mmhg ( 14 ) . in the current review , the majority of the retrieved articles had used these cut points or earlier definitions proposed by nhlbi ( 20 , 21 ) . measures consisted of the values / mean ( standard deviation , sd ) values of sbp and/or dbp , or the frequency rates of high bp . in all studies selected for this review , bp value was measured by sphygmomanometer through brachial artery with appropriate cuff size and was reported in mmhg or cmhg . in most of them , bp was measured two to three times in a single session and the mean value was recorded . in some others , two to three measurements were made on separate occasions and the last one was included in their analysis . we searched international databases including pubmed / medline , isi web of science , and scopus , as well as the iranian scientific databases ( iranmedex , scientific information database ( sid ) , irandoc ) from january 1990 to january 2014 . the search terms were as follows : hypertension , blood pressure , high blood pressure , systolic pressure , diastolic pressure , arterial pressure in any possible combination with school or student or girl or boy or child * or adolescen * or pediatr * or paediatr * and iran for searching in the international databases ; the farsi equivalent of these terms were used for searching the national databases . a definite search strategy for each database we also looked at the reference list of relevant retrieved articles to find more publications . to the best of our knowledge the only nationwide study on cardio - metabolic risk factors in iranian pediatric population with the age specific definitions are the surveys of a national surveillance program entitled : childhood and adolescence surveillance and prevention of adult non - communicable diseases ( caspian ) study ( 24 , 25 ) . it has been conducted in four different surveys from 2003 to 2012 ( 25 - 29 ) . we included all cross sectional studies on bp values and prevalence of high bp in 6 - 18 year - old iranian population . we also included cohort and case - control studies if they had reported their baseline data . we limited the search to human studies conducted from january 1990 to january 2014 in iran ( iran , i.r.iran , islamic republic of iran ) or with iran in the affiliation of the authors with no restriction in the language . we excluded the studies that reported population normal values or percentiles exclusively or reported findings in more extended age groups than our study age range , or did not use pediatric specific definitions for bp classification . in the case of finding multiple publications from one study , we selected the more comprehensive one . the selected documents were saved in computer files with back - ups . in the first stage , the retrieved titles were screened to find relevant articles , at the second stage the abstracts were screened , and at the third stage full texts of relevant papers were screened ( appendix 2 ) . for quality assessment , we considered our study eligibility criteria , study design , sample size , sampling method , response rates , measurement tools and their calibration , as well as measurement methods and estimates . two independent reviewers ( zf and rk ) qualified the articles and the poor rated ones were excluded . the data extraction process is explained in detail elsewhere ( 19 ) . for most papers , confidence intervals ( ci ) , we tried to make contact with main authors but unfortunately the response rate was not favorable . the major outcome in the current review was elevated bp . according to the us national heart , lung , and blood institute ( nhlbi ) , bp is considered normal when the systolic and diastolic values are less than the 90 percentile for the child s age , sex , and height . prehypertension , is diagnosed when a child s average bp is above the 90th percentile but below the 95th . every adolescent with a bp greater than 120.80 mmhg is also diagnosed to have prehypertension , even if the bp would be below the 90 percentile . stage i hypertension is diagnosed if a child s bp is greater than the 95th percentile but less than or equal to the 99th percentile plus 5 mmhg . stage ii hypertension is diagnosed if a child s bp is greater than the 99th percentile plus 5 mmhg ( 14 ) . in the current review , the majority of the retrieved articles had used these cut points or earlier definitions proposed by nhlbi ( 20 , 21 ) . measures consisted of the values / mean ( standard deviation , sd ) values of sbp and/or dbp , or the frequency rates of high bp . in all studies selected for this review , bp value was measured by sphygmomanometer through brachial artery with appropriate cuff size and was reported in mmhg or cmhg . in most of them , bp was measured two to three times in a single session and the mean value was recorded . in some others , two to three measurements were made on separate occasions and the last one was included in their analysis . we searched international databases including pubmed / medline , isi web of science , and scopus , as well as the iranian scientific databases ( iranmedex , scientific information database ( sid ) , irandoc ) from january 1990 to january 2014 . the search terms were as follows : hypertension , blood pressure , high blood pressure , systolic pressure , diastolic pressure , arterial pressure in any possible combination with school or student or girl or boy or child * or adolescen * or pediatr * or paediatr * and iran for searching in the international databases ; the farsi equivalent of these terms were used for searching the national databases . a definite search strategy for each database we also looked at the reference list of relevant retrieved articles to find more publications . to the best of our knowledge the only nationwide study on cardio - metabolic risk factors in iranian pediatric population with the age specific definitions are the surveys of a national surveillance program entitled : childhood and adolescence surveillance and prevention of adult non - communicable diseases ( caspian ) study ( 24 , 25 ) . it has been conducted in four different surveys from 2003 to 2012 ( 25 - 29 ) . to the best of our knowledge the only nationwide study on cardio - metabolic risk factors in iranian pediatric population with the age specific definitions are the surveys of a national surveillance program entitled : childhood and adolescence surveillance and prevention of adult non - communicable diseases ( caspian ) study ( 24 , 25 ) . it has been conducted in four different surveys from 2003 to 2012 ( 25 - 29 ) . we included all cross sectional studies on bp values and prevalence of high bp in 6 - 18 year - old iranian population . we also included cohort and case - control studies if they had reported their baseline data . we limited the search to human studies conducted from january 1990 to january 2014 in iran ( iran , i.r.iran , islamic republic of iran ) or with iran in the affiliation of the authors with no restriction in the language . we excluded the studies that reported population normal values or percentiles exclusively or reported findings in more extended age groups than our study age range , or did not use pediatric specific definitions for bp classification . in the case of finding multiple publications from one study , we selected the more comprehensive one . all retrieved publications underwent selection and qualification processes . the search was repeated throughout the study period to add any newly published articles . in the first stage , the retrieved titles were screened to find relevant articles , at the second stage the abstracts were screened , and at the third stage full texts of relevant papers were screened ( appendix 2 ) . for quality assessment , we considered our study eligibility criteria , study design , sample size , sampling method , response rates , measurement tools and their calibration , as well as measurement methods and estimates . two independent reviewers ( zf and rk ) qualified the articles and the poor rated ones were excluded . the data extraction process is explained in detail elsewhere ( 19 ) . for most papers , confidence intervals ( ci ) for which complementary data were needed , we tried to make contact with main authors but unfortunately the response rate was not favorable . the search algorithm including the number of initial search results and included studies are shown in appendix 2 . at first step after three steps of selection and then qualifying processes , we included 36 articles ( 30 - 68 ) ( tables 1 and 2 ) in our systematic review . 2 . sbp more than 95th percentile , defined as hypertension , dbp more than 95th percentile , defined as hypertension or bp under 90th percentile for age and sex : normal , between 90th to 95th : high normal , above 95th : high blood pressure . prehypertension was defined as an average systolic or diastolic blood pressure between the 90th and 95th percentiles for gender , age , and height . 4 . for children aged 6 - 9 years , significant hypertension and severe hypertension were defined as systolic blood pressure greater than 122 mmhg and 130 mmhg and diastolic blood pressure greater than 78 mmhg and 86 mmhg respectively . significant and severe hypertension in children aged10 - 12 years was defined as systolic blood pressure greater than 126 mmhg and 134mmhg and diastolic blood pressure greater than 82 mmhg and 90 mmhg respectively(second task force ) ( 20 - 21 ) . report of the second task force on blood pressure control in children1987.task force on blood pressure control in children.national heart , lung , and blood institute , bethesda , maryland.pediatrics . according to the harriet lane handbook : a manual for pediatric house officers ( 23 ) . according to the fourth report on the diagnosis , evaluation , and treatment of high blood pressure in children and adolescents(between 90 and 95 percentile : prehtn , between 95th percentile and 99th percentile+5 mmhg : stage 1 htn and over 99th percentile+5 mmhg : stage 2 htn ( 14 ) . according to the update on the 1987 task force report on high blood pressure in children and adolescents : a working group report from the national high blood pressure education program ( between 90th and 95th percentiles : significant htn and over 99th percentile severe htn ) ( 21 ) . 11 . bp above the 95th percentile for that age and sex after adjusting for weight and height = htn ( 19 - 21 ) . 12 . bp in the 90th percentile for their age , sex , and height = htn ( 19 - 21 ) . 13 . pre htn = bp equal or greater than the age- and gender - specific 90th percentile after adjusting for weight and height or bp equal or more than 120/80 mm hg when bp was equal or over the age- and gender - specific 95th percentile value , it was considered as htn ( 14 ) . 1 . hypertension ( systolic : 120 + , and diastolic : 100 + ) . 2 . sbp more than 95th percentile , defined as hypertension , dbp more than 95th percentile , defined as hypertension or bp under 90th percentile for age and sex : normal , between 90th to 95th : high normal , above 95th : high blood pressure . prehypertension was defined as an average systolic or diastolic blood pressure between the 90th and 95th percentiles for gender , age , and height . , significant hypertension and severe hypertension were defined as systolic blood pressure greater than 122 mmhg and 130 mmhg and diastolic blood pressure greater than 78 mmhg and 86 mmhg respectively . significant and severe hypertension in children aged 10 - 12 years was defined as systolic blood pressure greater than 126 mmhg and 134 mmhg and diastolic blood pressure greater than 82 mmhg and 90 mmhg respectively ( second task force ) ( 20 - 21 ) . report of the second task force on blood pressure control in children - 1987.task force on blood pressure control in children.national heart , lung , and blood institute , bethesda , maryland.pediatrics . according to the harriet lane handbook : a manual for pediatric house officers ( 23 ) . according to the fourth report on the diagnosis , evaluation , and treatment of high blood pressure in children and adolescents(between 90 and 95 percentile : prehtn , between 95th percentile and 99th percentile+5 mmhg : stage 1 htn and over 99th percentile+5 mmhg : stage 2 htn ( 14 ) . according to the update on the 1987 task force report on high blood pressure in children and adolescents : a working group report from the national high blood pressure education program ( between 90th and 95th percentiles : significant htn and over 99th percentile severe htn ) ( 21 ) . altogether , this review included 1,096,263 total population ( 515,098 girls , 47% ) and 277 data - points . they were from four national , one provincial , 29 district and two community study levels . the least value of mean sbp ( 90.10 4.00 mmhg ( 95% ci 89.25 , 90.94 ) ) and mean dbp ( 50.7 11.40 ( 50.01 , 51.38 ) mmhg ) are both reported from tehran city in the same study ( 54 ) . the highest mean values reported are 120.2 12.30 ( 118.98 , 121.41 ) mmhg for mean sbp from kerman city ( 59 ) and 79.20 12.30 ( 77.95 , 80.44 ) mmhg for mean dbp from isfahan city ( 53 ) . the study of kerman city also had the second rank of highest dbp , i.e. 76 11.4 ( 4.87 , 77.12 ) mmhg ( 59 ) . as presented in tables 1 and 2 , almost all articles reported mean bp values . from 36 published articles , fifteen reported prevalence rates of isolated high sbp and high dbp ( table 1 ) . fifteen articles reported the prevalence of high sbp and/or high dbp ( table 2 ) . table 1 also presents the national data of caspian studies ( 66 - 68 ) . the caspian - i study was a nationwide survey conducted in 2003 - 2004 in 23 provinces , and included 21,111 students , aged 6 - 18 years . elevated bp was defined as values equal or greater than 95th percentile , and the prevalence of high sbp , dbp as well as sbp and/or dbp in total population was 4.2% ( 3.96 , 4.51 ) , 5.4% ( 5.05 , 5.67 ) and 7.7 % ( 7.38 , 8.11 ) , respectively ( 66 ) . the caspian - iii study was conducted in 2009 - 2010 among 5,738 students aged 10 - 18 years living in 27 provinces . it reported prevalence rates for high bp ( values equal or greater than 90th percentile ) as follows : 3.8% ( 3.31 , 4.32 ) , 3.3% ( 2.86 , 3.8 ) , and 6% ( 5.41 , 6.65 ) ( 66 ) . the corresponding figures reported by caspian - iv study , conducted in 2011 - 2012 on 13,486 students from 30 provinces , were 4.17% ( 3.84 , 4.52 ) , 4.33% ( 3.99 , 4.68 ) and 6.88% ( 6.45 , 7.32 ) , respectively ( 68 ) . as it is obvious from these two tables , the reported range of high bp in iranian pediatric population in sub - national studies in the two past decades varies widely , with rates as low as 0.40% ( 95% ci 0.009 , 1.98 ) for high sbp in tehran province for 15 - 19-year - old boys ( 39 - 41 ) and as high as 24.10% ( 20.80 , 27.67 ) for high dbp in khorasan - razavi province ( 46 ) . moreover , in national screening of 6-year - old children at school entry , the prevalence of high bp was 0.10% ( 0.09 , 0.109 ) ( 31 ) . based on the use of 95th percentile to define hypertension , the prevalence of hypertension would be expected to be around 5% and in fact 1 - 3% ( 69 ) . our findings showed that the number of sub - national studies in iranian pediatric population that reported high bp rates above 5% ( 30 , 45 , 46 , 55 , 58 , 61 , 62 , 65 ) was equal to studies that reported rates below 5% ( 31 , 34 , 36 , 42 , 44 , 48 , 49 , 64 ) . in eight papers , the rates from both ranges ( below and above 5% ) for different age or sex categories are reported ( 37 - 41 , 43 , 50 , 57 , 63 ) . seven studies reported at least one prevalence rate of elevated bp of more than 10 percent ( 30 , 37 - 39 , 41 , 43 , 50 , 62 , 63 ) . to the best of our knowledge , this study is the first systematic review on studies related to bp in the pediatric population , not only in iran , but also , in the mena region . as expected , we found that the prevalence of elevated bp was not negligible in healthy children and adolescents in iran , and varied in different regions . it should be considered that in addition to detecting prehypertension and hypertension at early stages , bp screening programs would help in monitoring the mean sbp and dbp over time . though a decrease from 41% in 1990 to 25% in 2010 has occurred in the contribution of pediatric mortality and morbidity to global dalys ( 3 ) , considering that many adult ncds actually start from earlier stages of life , the importance of this side of pediatric health and its significant sequels in the adult life should not be neglected . even because of the high susceptibility of fetal life to environmental and nutritional disorders , preventive measures should focus on this stage of life ( 70 ) . the childhood obesity epidemic has resulted in left ventricular hypertrophy and evidence for premature development of atherosclerosis , therefore it makes the issue of tracking bp and screening for elevated bp of special concern in the pediatric age group ( 71 ) . children and adolescents with pre - hypertension and hypertension tend to maintain this situation over time ( 1 , 72 - 76 ) . many risky behaviors as smoking , alcohol use , physical inactivity , and unhealthy dietary habits are developed during adolescence period . changing such lifestyle habits would be difficult after establishment , and would have lifelong consequences including ncds and their risk factors as high bp ( 77 ) . a longitudinal study with 17 years of follow up of a pediatric population showed a 6.88 fold increase in the prevalence of hypertension in those who had high bp at baseline ( 78 ) . national studies in american children and adolescents found that that the mean bp levels ( 79 ) , as well as the prevalence of high bp ( 80 ) are gradually rising over time . the mean age of iranian population is estimated to be increasing by 6.5 years in the two coming decades . presuming the persistent prevalence of risk and protective factors and only because of that increase in the age , the country s yll from cvds will be duplicated in 2025 compared to 2005 , without difference in terms of gender ( 81 ) . a study in 2003 showed that in iran 58 percent of dalys resulted from ncds and the country health burden is changing from communicable diseases to ncds and road accidents ( 82 ) . who has reported an age - standardized mortality rate of 420.8 ( males ) and 348.0 ( females ) per 100000 for cvd and diabetes in iran for 2008 , and estimated a prevalence rate of around 33.7% for hypertension ( 7 ) . a national survey ( surfncd ) in 2007 showed a remarkable prevalence of ncds and their risk factors among iranians aged 15 65 ( 83 ) . another national study showed that high sbp is responsible for most deaths in all regions of iran . it is expected that by optimizing sbp , the years of life expectancy would increase by 3.2 ( 2.6 , 3.9 95% uncertainty interval ) years in men and by 4.1 ( 3.2 , 4.9 ui ) years in women , therefore it is concluded that prevention and control of high bp should be considered as a health priority for iran ( 84 ) . many studies documented high rates of cardio - metabolic predisposing factors in iranian pediatric population ( 25 - 29 , 85 - 90 ) . the caspian - i study ( 25 , 26 ) , showed that the percentiles of sbp and dbp of iranian children and adolescents were in close agreement with reference values ( 14 ) . as mentioned earlier , the study has continued to the 4th survey till now and different rates of elevated bp are reported . overall , these surveys showed that in recent years , the prevalence of elevated bp has increased slightly . the variation between surveys could be attributed to differences between definitions of elevated bp ( the first phase was conducted before the introduction of pediatric pre - htn ) and differences in study populations , i.e. different proportion of age and gender subgroups , different provinces , different total populations and changes in the prevalence of associated conditions as obesity , unhealthy dietary habits , inactivity , air and noise pollution , urbanization , etc . given the association of bp level with excess weight as well as with environmental factors as air pollution , noise pollution , and passive smoking ( 91 ) , and the high sodium intake of iranian children ( 33 ) , it is proposed that in the near future , the mean bp and the prevalence of high bp will be escalating in iranian children and adolescents . the high prevalence of ncd risk factors in various age groups of iranians , underscores the necessity of conducting comprehensive research and preventive programs to achieve a multidisciplinary intervention plan involving the whole health system of iran ( 92 ) . both in the 53rd session of eastern mediterranean region ( emro ) ( 93 ) and september 2011 session of the united nations ( un ) in new york , all members committed to develop national strategies as well as preventive and controlling action plans , to involve all stakeholders and to organize financial resources targeting ncds . it seems that still no effective public and community interventions have been done in this regard . the gbd study 2010 revealed that some parts of underachievement of the who 4th millennium goal is because of the lack of relevant information from the pediatric age group ( 94 ) . presenting the information regarding pediatric studies to policymakers in a systematic and concluding manner would be of help for planning action - oriented programs . moreover , there is increasing need to know where and how the complementary research and action plans must be implemented . the current study summarized the information on the mean bp and the prevalence of high bp in the iranian pediatric population . the wide heterogeneity of the retrieved papers and their point estimates led the researchers not to consider a meta - analysis . it is planned to draw the trend of bp changes across these years . as mentioned before after that , ylds , ylls , dalys and burden of the hbp in pediatric population of iran will be estimated . the importance of bp tracking and the pediatric hypertension per se and as a cvd risk factor becomes more obvious , making it important for including bp measurement in screening programs and conducting further comprehensive and cumulative studies on its time trends , primary prevention and early diagnosis . health policies on prevention and early control of high bp can be effective in reducing the prevalence and the adverse consequences of high bp in adulthood . therefore , the findings of the current systematic review and succeeding works on bp of iranian children and adolescents would be useful for future health policies and research activities aimed to reduce the burden of high bp at individual and public health levels . follow up surveillance programs and comparison of bp trends of children and adolescents over time are recommended .

context : blood pressure ( bp ) tracks from childhood to adulthood , and has ethnic variations . therefore , it is important to assess the situation of pediatric bp in different populations . this study aims to systematically review the studies conducted on bp in iranian children and adolescents.evidence acquisition : we conducted a systematic review on published and national data about pediatric bp in iran , our search was conducted in pub med , medline , isi , and scopus , as well as in national databases including scientific information database ( sid ) , iranmedex and irandoc from 1990 to 2014.results:we found 1373 records in the primary search including 840 from international and 533 from national databases . after selection and quality assessment phases , data were extracted from 36 papers and four national data sources . mean systolic bp ( sbp ) varied from 90.1 14 mmhg ( 95% ci 89.25 , 90.94 ) to 120.2 12.3 ( 118.98 , 121.41 ) mmhg , and for diastolic bp ( dbp ) from 50.7 11.4 ( 50.01 , 51.38 ) to 79.2 12.3 ( 77.95 , 80.44 ) mmhg . the frequency of elevated bp had large variation in sub - national studies with rates as low as 0.4% ( 0.009 , 1.98 ) for high sbp and as high as 24.1% ( 20.8 , 27.67 ) for high dbp . at national level , three surveys reported slightly raised rates of elevated bp from 2009 to 2012.conclusions:the findings provide practical information on bp levels in iranian pediatric population . although differences exist on the findings of various studies , this review underscores the necessity of tracking bp from childhood , and implementing interventions for primordial prevention of hypertension .

You are an expert at summarizing long articles. Proceed to summarize the following text: initially accepted as a diagnostic tool for patients with acute stroke , more applications of extracranial diffusion - weighted magnetic resonance imaging ( dwi ) are starting to emerge . tumors are frequently more cellular than the tissue from which they originate and thus appear to be of relatively high signal intensity ( restriction of water diffusion ) on dwi providing qualitative analysis . microscopic motion of water molecules can also be quantitatively assessed by measuring the apparent diffusion coefficient ( adc ) using at least two diffusion weighting measurements determined by the b values . in recent years , dwi has been extensively studied in oncology for differentiating between benign and malignant cervical lymph nodes or nodal staging , tumor detection and staging , tumor characterization , monitoring treatment response and predicting treatment response and local recurrence rate after therapy . lymphoma lesions are usually well visualized on dwi because of their high cellularity and high nuclear - to - cytoplasm ratio . lymphomas have been shown to have significantly lower adc values compared with other tumor types in different body regions . in lymphomas , therapeutic strategies , the patient s prognoses and treatment response monitoring all depend on accurate initial staging . therefore , the development of whole - body dwi for lymphoma in which extensive nodal and extranodal involvement is common would be of great clinical importance . performing whole - body dwi is challenging mainly because of the inhomogeneity of the magnetic field over a large imaging area and motion arising from different organs that might degrade the image quality . the developments of echo - planar imaging ( epi ) , high - gradient amplitudes , multichannel coils , and parallel imaging play a major role in extending the applications of dwi . in particular , the introduction of parallel imaging , which enables reduction in the echo time ( te ) , echo - train length , and k - space filling time , led to substantially less motion artifacts during image acquisition , thus enabling high - quality diffusion - weighted images of the body to be obtained . in 2004 , reported a unique concept of whole - body dwi using the short tau inversion recovery ( stir)-epi sequence and free breathing scanning ( diffusion - weighted whole - body imaging with background body signal suppression : dwibs ) . stir theoretically gives more homogeneous fat saturation because of its insensitivity to magnetic field heterogeneity and is commonly used . longer scanning time under free breathing allows multiple signal averaging in order to maintain good contrast - to - noise ratio and thinner axial images ( usually 4 mm in slice thickness with or without 1 mm overlap , but can be up to 6 mm ) can be obtained for volumetric three - dimensional image processing . most recently , kwee et al . used a 4-element phased - array surface coil ( higher signal - to - noise ratio ( snr ) than a body coil and allowing parallel imaging ) that can move sequentially to image the separate stations of the whole - body dwi , without patient repositioning . total acquisition time covering from head to upper thighs ranged from 20 to 30 min depending on the parameters chosen . whole - body dwi is mostly evaluated qualitatively for lesion detection on inverted gray images acquired with a single b value in the range of 8001000 s / mm with fat suppression , resulting in positron emission tomography ( pet)-like images . because anatomical details are lacking in these images , standard t1- and t2-weighted sequences remain indispensable to act as anatomical reference for the dwibs images , in order to exactly localize lesions , therefore adding another acquisition time to the entire magnetic resonance ( mr ) examination . whole - body dwi can also be performed with a combined surface coil , allowing parallel imaging over the entire body , and improved spatial resolution . we designed a whole - body dwi 1.5 t mr ( siemens , erlangen ) protocol using exclusively a single - shot spin - echo epi sequence with acquisition parameters detailed in ref .. patients were positioned with five sets of integrated phased - array surface coils installed simultaneously ( total imaging matrix system ) to cover from head to upper thighs for signal reception . in order to more reliably assess adc values on a whole - body scale , three trace b values , 50 , 400 and 800 s / mm ( b50 , b400 and b800 ) instead of the commonly used two data points , were used . although adc measurement of a large , relatively uniform organ such as the liver appears to be accurate with free breathing , respiratory motion can still result in adc errors for small focal lesions such as lymph nodes because of signal contamination by adjacent tissues . we therefore chose to perform whole - body image acquisition with respiratory gating in order to minimize slice position mismatch between different b values and different excitations . total acquisition time is longer in this case compared with that with free breathing . however , anatomical information can be obtained from b50 diffusion - weighted images therefore saving time for acquisition of standard t1- or t2-weighted images . moreover , signals from vessels are eliminated on b50 diffusion - weighted images therefore allowing more selective visualization of adjacent lymph nodes ( fig . 1 ) . most perfusion effects can be reduced in this case compared with adc calculation with the lowest b value set at 0 . spectrally selective fat saturation was used to achieve a reasonable total acquisition time ( 3045 min ) and a higher snr than stir ( acquisition time twice as long ) . the centre of each stack of images ( i.e. each station ) was placed in the isocentre during acquisition with b0 shim for each station . to our knowledge , this is the only whole - body dwi protocol with respiratory gating proven feasible in a routine clinical setting . image analysis was performed on source axial diffusion - weighted images with three b values as well as their corresponding adc maps , including both qualitative and quantitative analyses . figure 1diffusion - weighted images with b values of 0 and 50 s / mm ( b0 and b50 ) in a 53-year - old patient with mediastinal diffuse large b - cell lymphoma . tiny hyperintense dots ( cross - sections of small vessels ) on the b0 diffusion - weighted image ( arrowheads ) disappeared on the b50 diffusion - weighted image , which facilitates the detection of adjacent lymph nodes . diffusion - weighted images with b values of 0 and 50 s / mm ( b0 and b50 ) in a 53-year - old patient with mediastinal diffuse large b - cell lymphoma . tiny hyperintense dots ( cross - sections of small vessels ) on the b0 diffusion - weighted image ( arrowheads ) disappeared on the b50 diffusion - weighted image , which facilitates the detection of adjacent lymph nodes . several recent studies have shown the potential of whole - body dwi in lymphoma staging . included 29 patients for tumor staging with fluorodeoxyglucose ( fdg)-pet / computed tomography ( ct ) as the reference standard . they concluded that whole - body dwi using dwibs can be useful for lymphoma staging because of good delineation of nodal disease . more recently , whole - body magnetic resonance imaging ( mri ) , including dwi , was evaluated for initial staging in a study including only patients with lymphomas . the results were correlated with findings on fdg - pet , bone marrow biopsy or follow - up studies . overall , initial staging using whole - body mri ( without dwi and with dwi ) equals staging using ct in most patients . whole - body mri with dwi correctly over staged in 6 ( 21% ) out of 28 patients relative to ct , with a possible advantage of using dwi . however , the authors did not assess the usefulness of whole - body dwi alone for lymphoma staging . in addition , patients with hodgkin and non - hodgkin lymphoma ( nhl ) were included as well as nhl with different histological grades where tissue composition and cellularity may considerably vary . mri provides good soft tissue contrast , therefore , it should be theoretically advantageous in depicting extranodal disease . however , kwee et al . demonstrated that the ability of whole - body mri without dwi and with dwi in the detection of bone marrow involvement out of 12 patients with positive bone marrow biopsy ( bmb ) results was surprisingly low , with patient - based sensitivities of 41.7% and 45.5% , respectively . they speculated that bone marrow involvement in the false - negative patients might have been overlooked in part because of lower spatial resolution applied in the whole - body mr protocol compared with that of dedicated mri . in 8 other patients , mri ( both without and with dwi ) was positive and bmb was negative . bmb may miss focal bone marrow involvement because of limited sampling and further follow - up is needed to provide insight into the rate of correct upstaging by whole - body mri , including dwi . we have conducted a prospective pilot study of 15 patients with histologically proven diffuse large b - cell lymphoma ( dlbcl ) using the whole - body respiratory - gated dwi . among them , 2 patients had concomitant dlbcl and a follicular lymphoma component . fdg - pet is currently a powerful whole - body functional imaging modality and has been shown to be more accurate than contrast - enhanced ct for lymphoma staging in terms of nodal and extranodal involvement . in our study , fdg - pet / ct was taken as the reference standard because pathological proof for each lymph node region or organ suspected to have disease involvement is practically and ethically not possible . for lymph node involvement , based on the international working group ( iwg ) cheson s size criteria alone , dwi findings matched pet / ct findings in 277 node regions ( 94% ) , yielding sensitivity and specificity of 90% and 94% . among the 82 lymph node regions that were considered positive on both dwi ( size criteria alone ) and pet / ct , the lymph nodes were visually hypointense to muscle on adc maps ( restricted diffusion ) in 73 regions ( 89% ) ( fig . small lymph nodes adjacent to the lungs and the heart may show falsely high adc values probably related to heart motion , and are not well visualized on dwibs images with high b values . although it is known that size criteria lack the desired accuracy for characterizing lymph nodes , our preliminary results show that for pretreatment staging purposes , the ability of dwi for detection of lymph node involvement based on size criteria alone ( i.e. , node larger than 1 cm on its longest transverse diameter ) was comparable with that of fdg - pet / ct . studies of whole - body mri using only t2-weighted images ( again with size - based analysis ) for pediatric lymphoma staging also corroborated this point . in our study , when visual adc analysis was combined with the size measurement , the specificity of dwi increased to 100% but sensitivity decreased to 81% ( fig . 3 ) . regarding extranodal organ involvement , whole - body dwi agreed with pet / ct in all 20 organs recorded ( 100% ) . all organ lesions showed restricted diffusion therefore combining visual adc analysis would not change the diagnostic performance of dwi for extranodal disease detection . dwi was not able to depict diffuse spleen involvement in one patient because normal spleen already showed restricted diffusion . dwi can be more sensitive than pet in depicting hepatic and renal involvement in some cases ( fig . there was agreement with ann arbor stages in 14 ( 93% ) of the 15 patients . figure 2diffusion - weighted images with b values of 50 and 800 s / mm ( b50 and b800 ) and their corresponding adc map ( upper row ) and integrated fdg - pet / ct images ( lower row ) in a 57-year - old patient with histologically proven concomitant diffuse large b - cell lymphoma and follicular lymphoma . the lymph node ( arrow in white / black ) on the sigmoid mesocolon is hyperintense on b50 diffusion - weighted images and remains hyperintense on b800 diffusion - weighted images ; the signal from the intestinal loops and background structures drops significantly . therefore , this lymph node ( mean adc 0.61210 mm / s ) was easily depicted on diffusion - weighted images along with bilateral iliac nodes ( orange arrows ) , which all show restricted diffusion with signal hypointense to muscle on the adc map . this sigmoid mesocolon node , however , probably a follicular component , shows relatively low glycolytic activity on pet ( maximum suv 2.9 ) . the left iliac bone lesion ( arrowheads ) shows more intense fdg uptake , as well as bone lesions at other slice levels ( images not shown ) . note that fdg uptake by right iliac bone lesions ( open arrows ) was lower than on the left side , because of their small size . figure 3diffusion - weighted images with b values of 50 and 800 s / mm ( b50 and b800 ) and their corresponding adc map in a 24-year - old patient with gastric involvement of diffuse large b - cell lymphoma . in addition to sub - diaphragmatic disease , dwi depicted an additional enlarged lymph node ( arrow ) on both b50 and b800 diffusion - weighted images over left lower neck ( no abnormal fdg uptake , pet image not shown ) . however , this lymph node shows no restricted diffusion ( isointense to muscle ) on the adc map . therefore , with combined adc analysis , this lymph node can be considered negative , and the patient would have been correctly staged . figure 4whole - body fdg - pet image in maximal intensity projection ( left ) , transverse integrated fdg - pet / ct images ( middle two columns ) and diffusion - weighted b800 images with adc map ( right ) in a 42-year - old patient with diffuse large b - cell lymphoma . dwi and pet / ct show focal lesions ( arrows ) involving both kidneys . however , the mass protruding into the left renal pelvis ( open arrow ) is obscured by the physiologic fdg excretion on pet ; it is clearly depicted on dwi because of excellent lesion - to - normal renal parenchyma contrast . note that another lesion on the left kidney ( arrowhead on b800 image ) and a lymph node ( arrowhead on pet image ) were both detected by the other imaging technique on adjacent slices ( images not shown ) . diffusion - weighted images with b values of 50 and 800 s / mm ( b50 and b800 ) and their corresponding adc map ( upper row ) and integrated fdg - pet / ct images ( lower row ) in a 57-year - old patient with histologically proven concomitant diffuse large b - cell lymphoma and follicular lymphoma . the lymph node ( arrow in white / black ) on the sigmoid mesocolon is hyperintense on b50 diffusion - weighted images and remains hyperintense on b800 diffusion - weighted images ; the signal from the intestinal loops and background structures drops significantly . therefore , this lymph node ( mean adc 0.61210 mm / s ) was easily depicted on diffusion - weighted images along with bilateral iliac nodes ( orange arrows ) , which all show restricted diffusion with signal hypointense to muscle on the adc map . this sigmoid mesocolon node , however , probably a follicular component , shows relatively low glycolytic activity on pet ( maximum suv 2.9 ) . the left iliac bone lesion ( arrowheads ) shows more intense fdg uptake , as well as bone lesions at other slice levels ( images not shown ) . note that fdg uptake by right iliac bone lesions ( open arrows ) was lower than on the left side , because of their small size . diffusion - weighted images with b values of 50 and 800 s / mm ( b50 and b800 ) and their corresponding adc map in a 24-year - old patient with gastric involvement of diffuse large b - cell lymphoma . in addition to sub - diaphragmatic disease , dwi depicted an additional enlarged lymph node ( arrow ) on both b50 and b800 diffusion - weighted images over left lower neck ( no abnormal fdg uptake , pet image not shown ) . however , this lymph node shows no restricted diffusion ( isointense to muscle ) on the adc map . therefore , with combined adc analysis , this lymph node can be considered negative , and the patient would have been correctly staged . whole - body fdg - pet image in maximal intensity projection ( left ) , transverse integrated fdg - pet / ct images ( middle two columns ) and diffusion - weighted b800 images with adc map ( right ) in a 42-year - old patient with diffuse large b - cell lymphoma . dwi and pet / ct show focal lesions ( arrows ) involving both kidneys . however , the mass protruding into the left renal pelvis ( open arrow ) is obscured by the physiologic fdg excretion on pet ; it is clearly depicted on dwi because of excellent lesion - to - normal renal parenchyma contrast . note that another lesion on the left kidney ( arrowhead on b800 image ) and a lymph node ( arrowhead on pet image ) were both detected by the other imaging technique on adjacent slices ( images not shown ) . several recent studies have shown the potential of whole - body dwi in lymphoma staging . included 29 patients for tumor staging with fluorodeoxyglucose ( fdg)-pet / computed tomography ( ct ) as the reference standard . they concluded that whole - body dwi using dwibs can be useful for lymphoma staging because of good delineation of nodal disease . more recently , whole - body magnetic resonance imaging ( mri ) , including dwi , was evaluated for initial staging in a study including only patients with lymphomas . the results were correlated with findings on fdg - pet , bone marrow biopsy or follow - up studies . overall , initial staging using whole - body mri ( without dwi and with dwi ) equals staging using ct in most patients . whole - body mri with dwi correctly over staged in 6 ( 21% ) out of 28 patients relative to ct , with a possible advantage of using dwi . however , the authors did not assess the usefulness of whole - body dwi alone for lymphoma staging . in addition , patients with hodgkin and non - hodgkin lymphoma ( nhl ) were included as well as nhl with different histological grades where tissue composition and cellularity may considerably vary . mri provides good soft tissue contrast , therefore , it should be theoretically advantageous in depicting extranodal disease . however , kwee et al . demonstrated that the ability of whole - body mri without dwi and with dwi in the detection of bone marrow involvement out of 12 patients with positive bone marrow biopsy ( bmb ) results was surprisingly low , with patient - based sensitivities of 41.7% and 45.5% , respectively . they speculated that bone marrow involvement in the false - negative patients might have been overlooked in part because of lower spatial resolution applied in the whole - body mr protocol compared with that of dedicated mri . in 8 other patients , mri ( both without and with dwi ) was positive and bmb was negative . bmb may miss focal bone marrow involvement because of limited sampling and further follow - up is needed to provide insight into the rate of correct upstaging by whole - body mri , including dwi . we have conducted a prospective pilot study of 15 patients with histologically proven diffuse large b - cell lymphoma ( dlbcl ) using the whole - body respiratory - gated dwi . among them , 2 patients had concomitant dlbcl and a follicular lymphoma component . fdg - pet is currently a powerful whole - body functional imaging modality and has been shown to be more accurate than contrast - enhanced ct for lymphoma staging in terms of nodal and extranodal involvement . in our study , fdg - pet / ct was taken as the reference standard because pathological proof for each lymph node region or organ suspected to have disease involvement is practically and ethically not possible . for lymph node involvement , based on the international working group ( iwg ) cheson s size criteria alone , dwi findings matched pet / ct findings in 277 node regions ( 94% ) , yielding sensitivity and specificity of 90% and 94% . among the 82 lymph node regions that were considered positive on both dwi ( size criteria alone ) and pet / ct , the lymph nodes were visually hypointense to muscle on adc maps ( restricted diffusion ) in 73 regions ( 89% ) ( fig . small lymph nodes adjacent to the lungs and the heart may show falsely high adc values probably related to heart motion , and are not well visualized on dwibs images with high b values . although it is known that size criteria lack the desired accuracy for characterizing lymph nodes , our preliminary results show that for pretreatment staging purposes , the ability of dwi for detection of lymph node involvement based on size criteria alone ( i.e. , node larger than 1 cm on its longest transverse diameter ) was comparable with that of fdg - pet / ct . studies of whole - body mri using only t2-weighted images ( again with size - based analysis ) for pediatric lymphoma staging also corroborated this point . in our study , when visual adc analysis was combined with the size measurement , the specificity of dwi increased to 100% but sensitivity decreased to 81% ( fig . 3 ) . regarding extranodal organ involvement , whole - body dwi agreed with pet / ct in all 20 organs recorded ( 100% ) . all organ lesions showed restricted diffusion therefore combining visual adc analysis would not change the diagnostic performance of dwi for extranodal disease detection . dwi was not able to depict diffuse spleen involvement in one patient because normal spleen already showed restricted diffusion . dwi can be more sensitive than pet in depicting hepatic and renal involvement in some cases ( fig . there was agreement with ann arbor stages in 14 ( 93% ) of the 15 patients . figure 2diffusion - weighted images with b values of 50 and 800 s / mm ( b50 and b800 ) and their corresponding adc map ( upper row ) and integrated fdg - pet / ct images ( lower row ) in a 57-year - old patient with histologically proven concomitant diffuse large b - cell lymphoma and follicular lymphoma . the lymph node ( arrow in white / black ) on the sigmoid mesocolon is hyperintense on b50 diffusion - weighted images and remains hyperintense on b800 diffusion - weighted images ; the signal from the intestinal loops and background structures drops significantly . therefore , this lymph node ( mean adc 0.61210 mm / s ) was easily depicted on diffusion - weighted images along with bilateral iliac nodes ( orange arrows ) , which all show restricted diffusion with signal hypointense to muscle on the adc map . this sigmoid mesocolon node , however , probably a follicular component , shows relatively low glycolytic activity on pet ( maximum suv 2.9 ) . the left iliac bone lesion ( arrowheads ) shows more intense fdg uptake , as well as bone lesions at other slice levels ( images not shown ) . note that fdg uptake by right iliac bone lesions ( open arrows ) was lower than on the left side , because of their small size . figure 3diffusion - weighted images with b values of 50 and 800 s / mm ( b50 and b800 ) and their corresponding adc map in a 24-year - old patient with gastric involvement of diffuse large b - cell lymphoma . in addition to sub - diaphragmatic disease , dwi depicted an additional enlarged lymph node ( arrow ) on both b50 and b800 diffusion - weighted images over left lower neck ( no abnormal fdg uptake , pet image not shown ) . however , this lymph node shows no restricted diffusion ( isointense to muscle ) on the adc map . therefore , with combined adc analysis , this lymph node can be considered negative , and the patient would have been correctly staged . figure 4whole - body fdg - pet image in maximal intensity projection ( left ) , transverse integrated fdg - pet / ct images ( middle two columns ) and diffusion - weighted b800 images with adc map ( right ) in a 42-year - old patient with diffuse large b - cell lymphoma . dwi and pet / ct show focal lesions ( arrows ) involving both kidneys . however , the mass protruding into the left renal pelvis ( open arrow ) is obscured by the physiologic fdg excretion on pet ; it is clearly depicted on dwi because of excellent lesion - to - normal renal parenchyma contrast . note that another lesion on the left kidney ( arrowhead on b800 image ) and a lymph node ( arrowhead on pet image ) were both detected by the other imaging technique on adjacent slices ( images not shown ) . diffusion - weighted images with b values of 50 and 800 s / mm ( b50 and b800 ) and their corresponding adc map ( upper row ) and integrated fdg - pet / ct images ( lower row ) in a 57-year - old patient with histologically proven concomitant diffuse large b - cell lymphoma and follicular lymphoma . the lymph node ( arrow in white / black ) on the sigmoid mesocolon is hyperintense on b50 diffusion - weighted images and remains hyperintense on b800 diffusion - weighted images ; the signal from the intestinal loops and background structures drops significantly . therefore , this lymph node ( mean adc 0.61210 mm / s ) was easily depicted on diffusion - weighted images along with bilateral iliac nodes ( orange arrows ) , which all show restricted diffusion with signal hypointense to muscle on the adc map . this sigmoid mesocolon node , however , probably a follicular component , shows relatively low glycolytic activity on pet ( maximum suv 2.9 ) . the left iliac bone lesion ( arrowheads ) shows more intense fdg uptake , as well as bone lesions at other slice levels ( images not shown ) . note that fdg uptake by right iliac bone lesions ( open arrows ) was lower than on the left side , because of their small size . note also that water diffusion in normal bone marrow is restricted . diffusion - weighted images with b values of 50 and 800 s / mm ( b50 and b800 ) and their corresponding adc map in a 24-year - old patient with gastric involvement of diffuse large b - cell lymphoma . in addition to sub - diaphragmatic disease , dwi depicted an additional enlarged lymph node ( arrow ) on both b50 and b800 diffusion - weighted images over left lower neck ( no abnormal fdg uptake , pet image not shown ) . however , this lymph node shows no restricted diffusion ( isointense to muscle ) on the adc map . therefore , with combined adc analysis , this lymph node can be considered negative , and the patient would have been correctly staged . whole - body fdg - pet image in maximal intensity projection ( left ) , transverse integrated fdg - pet / ct images ( middle two columns ) and diffusion - weighted b800 images with adc map ( right ) in a 42-year - old patient with diffuse large b - cell lymphoma . however , the mass protruding into the left renal pelvis ( open arrow ) is obscured by the physiologic fdg excretion on pet ; it is clearly depicted on dwi because of excellent lesion - to - normal renal parenchyma contrast . note that another lesion on the left kidney ( arrowhead on b800 image ) and a lymph node ( arrowhead on pet image ) were both detected by the other imaging technique on adjacent slices ( images not shown ) . although size criteria alone may be sufficient for initial lymph node staging , functional information provided by dwi regarding the changes in cellularity , tissue composition and architecture after treatment may be helpful in response assessment . similar to contrast - enhanced ct , some residual lymph nodes or organ lesions on post - treatment dwi based on size and signal abnormality criteria may not represent viable disease . fdg - pet is more reliable than contrast - enhanced ct in differentiating fibrosis from residual disease and pet information has been incorporated into the revised iwg response criteria . a recent study of human dlbcl xenografts showed that dwi can reveal an increase in the mean adc after as little as 1 week of chemotherapy , preceding changes in the t2 relaxation time . previously ballon et al . pointed out the potential of dwi in assessing bone marrow signal changes in a patient with leukemia following therapy , indicating a good response . our preliminary results in patients with dlbcl also showed that post - treatment mean adc values of residual masses ( lymph node regions and organs ) on whole - body dwi increased significantly compared with baseline ( unpublished data ) . thus , combining adc analysis with size may potentially reduce false - positive findings based on size alone . with good anatomical information provided by b50 images and functional and quantitative information provided by the adc map , whole - body dwi might prove to be valuable for treatment response assessment in patients with lymphoma . there is still room for technical improvement including an epi sequence with shorter te and even a non - epi diffusion - weighted sequence , which still requires further evaluation for whole - body application . contrast - enhanced ct is still the most commonly used imaging modality for staging malignant lymphoma because of its widespread availability and relatively low cost . whole - body dwi does not require contrast medium administration and is superior to ct in depicting extranodal disease involvement . dwi , which reflects tissue structure and cellularity , may be complementary to fdg - pet , which indicates glucose metabolic activity and disease aggressiveness . future studies with larger patient cohorts and long - term follow - up are necessary to confirm the usefulness of whole - body dwi in the management of patients with lymphoma .

abstractthe current evidence regarding the usefulness of whole - body diffusion - weighted magnetic resonance imaging ( dwi ) in lymphoma is reviewed . dwi is capable of combining anatomical and functional information and is becoming a valuable tool in oncology , in particular for staging purposes . dwi may prove to be a useful biomarker in clinical decision making for patients with lymphoma . large - scaled prospective studies are needed to confirm these preliminary results .

You are an expert at summarizing long articles. Proceed to summarize the following text: dental implants have evolved dramatically over the last decade , and so have our expectations from them in terms of functional and esthetic criteria . at first dental implants but as dental implants evolved from the earlier blade types to the current root form types , the esthetic possibilities and demands from both clinicians and patients has changed . thus , the maintenance and augmentation of the soft tissue around dental implants has emerged as an area of much concern and focus . as more implants have been placed , clinicians have discovered the optimum treatments to get optimum esthetic results . since this has been through trial and error process , we have unfortunately also been witness to instances where the overall cosmetic appearance has been greatly disturbed [ figure 1 ] . improper implant placement and undeveloped soft tissue profile leads extremely unaesthetic results and so the question for all of us as periodontists is , where are we with regards to our ability to augment and maintain soft tissues around dental implants ? given that we have had about 40 years of implant dentistry to solve this problem ? this editorial examines the evolution of our thought regarding peri - implant soft tissue management and also looks at some new and emerging techniques available for augmenting peri - implant soft tissue . over the years , research has led us to a better understanding of the anatomical differences between the tooth - soft tissue and implant - soft tissue interface . the soft tissue profile and maintenance around implants is inherently more difficult than around teeth for a simple reason- the difference in vascular supply to support the soft tissues and the arrangement of fibers and fiber types around the implant . in the case of a natural tooth , the three main sources of blood supply are a ) the supraperiosteal vessels which supply the free and attached gingiva b ) blood vessels from the periodontal ligament and c ) blood vessels from alveolar bone . in the case of implants , also , there is a hypovascular- hypocellular connective tissue zone around the implant which is not seen around a natural tooth . the implanto - gingival junction of unloaded and loaded non - submerged titanium implants has been analyzed histometrically in the canine mandible . the biologic width around implants has been found to be quite similar to that around teeth . this is an important factor that we have come to understand and incorporate in our treatment plan . also , we have come to understand that the existing periodontal tissue biotype plays an equally important role when planning soft tissue augmentation . olsson and lindhe ( 1991 ) subdivide periodontal tissue into a)thin , scallopedb)thick , flat periodontium . the astute clinician takes the periodontal biotype into consideration when choosing a certain treatment modality , since the thick periodontal biotype is typically more forgiving of any surgical procedure compared to the thin biotype . the implant abutment - soft tissue interface has been the subject of research regarding its influence on the stability of the peri - implant tissues . more specifically , in the past 5 years , abutment materials such as zirconia have been postulated to function better than titanium abutments for helping to maintain the soft tissue profile . a recent systematic review attempted to evaluate the available evidence for a difference in the stability of peri - implant tissues between titanium abutments versus gold alloy , zirconium oxide , or aluminum oxide abutments . these studies revealed that titanium abutments did not maintain a higher bone level in comparison to gold alloy , aluminum oxide , or zirconium oxide abutments . the authors of the study also concluded that there was a lack of information about the clinical performance of zirconium oxide and gold alloy abutments as compared to titanium abutments . our collaborative group comprising the university of california at davis and the university of texas health science center , houston is currently looking at single cell cyto - detachment techniques in an attempt to quantify the adhesion characteristics of osteoblasts and fibroblasts to the implant surface . this might add value to the existing efforts with other research groups which are looking at ways to enhance the soft tissue attachment to the implant platform , paving the way for newer integrated implant - soft tissue constructs in the future . there has been a lot of debate over the past decade whether there is a need for attached soft tissues around implants . some researchers have demonstrated that attached soft tissues provide no statistical long term advantage over alveolar mucosa . others have correlated the presence of attached tissues with improved soft tissue health , prognosis and patient satisfaction . it is believed that the attached soft tissue resists disruption of the junctional epithelial seal , and thus adds to the long term prognosis . it has been postulated that the progression of plaque - induced alveolar bone loss of osseointegrated implants may be different from that of teeth . this authors opinion is that the presence of attached tissue is better than not having any , and since extremely few patients can maintain a zero plaque level , the presence of the attached tissue adds a layer of protection to resist the deteriorating effects of plaque accumulation , and to withstand the mechanical insult that the peri - implant soft tissue undergo each day [ figure 2a d ] . a recent study which assessed the association between keratinized mucosa width and mucosal thickness with clinical and immunological parameters around dental implants seems to corroborate this view . in that study , a thick mucosa ( 1 mm ) ( a ) mandibular site demonstrating inadequate keratinized mucosa , planned for implant restoration ; ( b ) implant placement followed by free gingival graft harvest from palate . fgg contoured to fit around implants and sutured in place using 5/0 vicryl sutures ; ( c ) post - op healing at 2 months , demonstrating good band of keratinized tissue around both implants ; ( d ) also note about 20% graft shrinkage at the distal implant , highlighting the need to over - augment augmenting keratinized mucosa around an implant , in my clinical experience , has been a fairly predictable procedure ; with good long term results ( from a follow - up of my patients over 3 years ) . the patients who had this procedure done were noted to have low plaque levels around the implants , and excellent tissue health after augmentation , in contrast to the baseline presentation . our thought process has evolved from simply augmenting tissue to a concept where preservation of tissue is given equal importance . we now understand that peri - implant soft tissue management starts at the time of tooth extraction , not following implant placement . we have thus moved away from the earlier concepts of socket compression following extraction . this fundamental change in our philosophy has been fueled by the appreciation of the fact that socket preservation ( with an appropriate grafting material when indicated ) and subsequent temporization ( with an ovate pontic ) done after tooth extraction plays an important role in preserving the existing soft tissue . use of incision designs such as the papilla preservation flap further helps to preserve any existing tissue . another advance in recent times has been the better understanding and use of suturing materials . it goes without saying that any suture which will be submerged beneath the flap needs to be resorbable , but this author 's personal preference is for resorbable sutures even for the flap closure . use of silk sutures is usually not recommended for soft tissue graft procedures , since silk sutures tend to have a plaque wicking effect , and often seem to show a mild inflammatory response during the initial healing process . the preferred suture type for soft tissue augmentation is a suture such as a 6/0 or a 5/0 vicryl ( ethicon inc . ) , although some clinicians prefer using 5/0 chromic gut suture or polypropylene sutures as well . a round body needle is often the preference for suturing the connective tissue graft , versus a reverse cutting needle , since the round body needle tends to maintain the soft tissue integrity better . in a surgery as technique - sensitive as peri - implant soft tissue grafting , the choice of suture materials , appropriate suturing techniques ( such as vertical mattress for maintaining coronal papilla level ) and the appropriate instruments adds the final but important component to a successful outcome . since vascularity and structural support is a limiting factor in cases of two adjacent implants , as explained in the earlier part of this article , there are two fundamental considerations to preserving and augmenting soft tissue in between two implants : a)position of two implants : as far as possible , it is advisable to not place two implants next to each other . we have learnt that the placement of the implants with a minimum distance of 3 mm between the platforms leads to a better chance of maintaining papilla between them . for instance , in the case of missing four maxillary incisors , some clinicians promote the placement of implants in the lateral incisor sites , and cantilevering the central incisors , or joining them as a four unit bridge , versus placement of implants in the central incisor regions . the rationale for this approach is that the existing pdl and bone support on the mesial aspects of the adjacent teeth will help support the papilla in between the implant and tooth , while it would be easier to build soft tissue support beneath the pontic with no interference from any implantsb)augmenting soft tissue between two implants : building the inter - implant papilla has proven to be a challenge , and various techniques such as insertion of a titanium papilla insert have also been proposed and attempted with some success . placement of a connective tissue graft is probably the most popular technique , however , the factors influencing the success of connective tissue augmentation are the distance between the two implants , distance from alveolar crest to contact point , periodontal tissue biotype , flap passivity prior to closure , suturing technique and post - operative maintenance . position of two implants : as far as possible , it is advisable to not place two implants next to each other . we have learnt that the placement of the implants with a minimum distance of 3 mm between the platforms leads to a better chance of maintaining papilla between them . for instance , in the case of missing four maxillary incisors , some clinicians promote the placement of implants in the lateral incisor sites , and cantilevering the central incisors , or joining them as a four unit bridge , versus placement of implants in the central incisor regions . the rationale for this approach is that the existing pdl and bone support on the mesial aspects of the adjacent teeth will help support the papilla in between the implant and tooth , while it would be easier to build soft tissue support beneath the pontic with no interference from any implants augmenting soft tissue between two implants : building the inter - implant papilla has proven to be a challenge , and various techniques such as insertion of a titanium papilla insert have also been proposed and attempted with some success . placement of a connective tissue graft is probably the most popular technique , however , the factors influencing the success of connective tissue augmentation are the distance between the two implants , distance from alveolar crest to contact point , periodontal tissue biotype , flap passivity prior to closure , suturing technique and post - operative maintenance . to study the effect of soft tissue augmentation around implants , 10 partially edentulous patients requiring at least one single implant in the premolar or molar areas of both sides of the mandible were randomized to have one side augmented at implant placement with a connective soft tissue graft harvested from the palate or no augmentation . after 3 months of submerged healing , abutments were placed and within 1 month definitive crowns were permanently cemented . outcome measures evaluated by the authors were implant success , any complications , peri - implant marginal bone level changes , patient satisfaction and preference , thickness of the soft tissues and aesthetics . soft tissues at augmented sites were 1.3 mm thicker ( p < 0.001 ) and had a significantly better pink aesthetic score ( p < 0.001 ) . patients were highly satisfied with both treatments , although they preferred the aesthetics of the augmented sites . the two clear choices that exist when placing a connective tissue graft are either a free connective tissue graft ( unpedicled ) or a pedicled connective tissue graft . the vascularized interpositional connective tissue graft ( vip - ct ) graft has been used successfully for augmenting buccal or vertical soft tissue deficiency . this is primarily a rotated pedicle connective tissue graft which adds soft tissue volume and minimizes graft shrinkage , since it has a patent vascular supply [ figure 3a g ] . over the past two years , i have used the vip - ct graft with increased success ; however , case selection remains a crucial factor . it is quite important to ensure that there is adequate thickness of palatal tissue with bone sounding , since a thin pedicle graft can often necrose and lead to compromised results . soft tissue augmentation using vascularized interpositional connective tissue graft ( vip - ct ) ( a ) baseline presentation with submerged implants ( b ) implant exposure with abutment placement ( c ) initial rotation of connective tissue graft pedicle from palatal site as shown in ( d ) , ( e ) temporary crown prior to placement ( f ) seated temporary crowns with connective tissue pedicle interposed in between the two to create papilla ( g ) palatal harvest site sutured . the connective tissue pedicle is tunneled below the sutured site to the buccal recipient site . compare augmented site ( f ) with baseline ( c ) ( soft tissue surgery : dr . neel bhatavadekar ) it is important to remember that since there is no augmentation in vertical interproximal bone height , the vip - ct graft leads to mere augmentation of soft tissue volume , and the anticipation of possible tissue shrinkage implies that the patient needs to be informed about the risk of an uncertain result long term . thus , building the inter - implant papilla continues to be a challenge , with the vip - ct graft being one of the possible treatment options . lastly , and most recently , the ability to tissue engineer soft tissue where needed has led dentistry into a new research direction which is exciting and promising . before long , we might be able to send a patient 's gingival cells to a lab , and get in return a petri - dish of tissue engineered soft tissue for surgical transplantation . at the academy of osseointegration ( ao ) summit meeting in chicago ( august 2010 ) , which i was invited to participate in , 75 clinicians and bioengineering experts discussed the translational applications of biological technologies such as micro - vibration , bone growth factors , and sustained release mechanisms to the enhancement of the implant - bone , and implant - soft tissue interface . the addition of bone growth factors to the implant surface is not a new concept , but the logistic and production challenges it poses , and the inability to maintain the growth factor on the surface after implantation , has been the main reason for the absence of such a product from the current implant market . newer implant testing protocols such as cyto - detachment have provided an option to test the individual cell attachments to implant surfaces , which has not been possible earlier . this , in turn , could lead to better ways to bioengineer dental implant surfaces . the possibility of bioengineering an integrated implant - soft tissue construct was also discussed , which , in turn could be directly implanted into the recipient site which was devoid of the necessary soft tissue . such an implant would theoretically have soft tissue bioengineered from the patient 's own tissue attached to the coronal platform , and a conventional root form implant which would osseointegrate . the ability to sustain the vascularity for this soft tissue does remain an area of active research interest , and we will probably see a lot of new clinically applicable ideas emerging from this concept in the near future . over the years , research has led us to a better understanding of the anatomical differences between the tooth - soft tissue and implant - soft tissue interface . the soft tissue profile and maintenance around implants is inherently more difficult than around teeth for a simple reason- the difference in vascular supply to support the soft tissues and the arrangement of fibers and fiber types around the implant . in the case of a natural tooth , the three main sources of blood supply are a ) the supraperiosteal vessels which supply the free and attached gingiva b ) blood vessels from the periodontal ligament and c ) blood vessels from alveolar bone . in the case of implants , also , there is a hypovascular- hypocellular connective tissue zone around the implant which is not seen around a natural tooth . the implanto - gingival junction of unloaded and loaded non - submerged titanium implants has been analyzed histometrically in the canine mandible . the biologic width around implants has been found to be quite similar to that around teeth . this is an important factor that we have come to understand and incorporate in our treatment plan . also , we have come to understand that the existing periodontal tissue biotype plays an equally important role when planning soft tissue augmentation . olsson and lindhe ( 1991 ) subdivide periodontal tissue into a)thin , scallopedb)thick , flat periodontium . the astute clinician takes the periodontal biotype into consideration when choosing a certain treatment modality , since the thick periodontal biotype is typically more forgiving of any surgical procedure compared to the thin biotype . the implant abutment - soft tissue interface has been the subject of research regarding its influence on the stability of the peri - implant tissues . more specifically , in the past 5 years , abutment materials such as zirconia have been postulated to function better than titanium abutments for helping to maintain the soft tissue profile . a recent systematic review attempted to evaluate the available evidence for a difference in the stability of peri - implant tissues between titanium abutments versus gold alloy , zirconium oxide , or aluminum oxide abutments . these studies revealed that titanium abutments did not maintain a higher bone level in comparison to gold alloy , aluminum oxide , or zirconium oxide abutments . the authors of the study also concluded that there was a lack of information about the clinical performance of zirconium oxide and gold alloy abutments as compared to titanium abutments . our collaborative group comprising the university of california at davis and the university of texas health science center , houston is currently looking at single cell cyto - detachment techniques in an attempt to quantify the adhesion characteristics of osteoblasts and fibroblasts to the implant surface . this might add value to the existing efforts with other research groups which are looking at ways to enhance the soft tissue attachment to the implant platform , paving the way for newer integrated implant - soft tissue constructs in the future . there has been a lot of debate over the past decade whether there is a need for attached soft tissues around implants . some researchers have demonstrated that attached soft tissues provide no statistical long term advantage over alveolar mucosa . others have correlated the presence of attached tissues with improved soft tissue health , prognosis and patient satisfaction . it is believed that the attached soft tissue resists disruption of the junctional epithelial seal , and thus adds to the long term prognosis . it has been postulated that the progression of plaque - induced alveolar bone loss of osseointegrated implants may be different from that of teeth . this authors opinion is that the presence of attached tissue is better than not having any , and since extremely few patients can maintain a zero plaque level , the presence of the attached tissue adds a layer of protection to resist the deteriorating effects of plaque accumulation , and to withstand the mechanical insult that the peri - implant soft tissue undergo each day [ figure 2a d ] . a recent study which assessed the association between keratinized mucosa width and mucosal thickness with clinical and immunological parameters around dental implants seems to corroborate this view . in that study , a thick mucosa ( 1 mm ) ( a ) mandibular site demonstrating inadequate keratinized mucosa , planned for implant restoration ; ( b ) implant placement followed by free gingival graft harvest from palate . fgg contoured to fit around implants and sutured in place using 5/0 vicryl sutures ; ( c ) post - op healing at 2 months , demonstrating good band of keratinized tissue around both implants ; ( d ) also note about 20% graft shrinkage at the distal implant , highlighting the need to over - augment augmenting keratinized mucosa around an implant , in my clinical experience , has been a fairly predictable procedure ; with good long term results ( from a follow - up of my patients over 3 years ) . the patients who had this procedure done were noted to have low plaque levels around the implants , and excellent tissue health after augmentation , in contrast to the baseline presentation . our thought process has evolved from simply augmenting tissue to a concept where preservation of tissue is given equal importance . we now understand that peri - implant soft tissue management starts at the time of tooth extraction , not following implant placement . this fundamental change in our philosophy has been fueled by the appreciation of the fact that socket preservation ( with an appropriate grafting material when indicated ) and subsequent temporization ( with an ovate pontic ) done after tooth extraction plays an important role in preserving the existing soft tissue . use of incision designs such as the papilla preservation flap further helps to preserve any existing tissue . another advance in recent times has been the better understanding and use of suturing materials . it goes without saying that any suture which will be submerged beneath the flap needs to be resorbable , but this author 's personal preference is for resorbable sutures even for the flap closure . use of silk sutures is usually not recommended for soft tissue graft procedures , since silk sutures tend to have a plaque wicking effect , and often seem to show a mild inflammatory response during the initial healing process . the preferred suture type for soft tissue augmentation is a suture such as a 6/0 or a 5/0 vicryl ( ethicon inc . ) , although some clinicians prefer using 5/0 chromic gut suture or polypropylene sutures as well . a round body needle is often the preference for suturing the connective tissue graft , versus a reverse cutting needle , since the round body needle tends to maintain the soft tissue integrity better . in a surgery as technique - sensitive as peri - implant soft tissue grafting , the choice of suture materials , appropriate suturing techniques ( such as vertical mattress for maintaining coronal papilla level ) and the appropriate instruments adds the final but important component to a successful outcome . since vascularity and structural support is a limiting factor in cases of two adjacent implants , as explained in the earlier part of this article , there are two fundamental considerations to preserving and augmenting soft tissue in between two implants : a)position of two implants : as far as possible , it is advisable to not place two implants next to each other . we have learnt that the placement of the implants with a minimum distance of 3 mm between the platforms leads to a better chance of maintaining papilla between them . for instance , in the case of missing four maxillary incisors , some clinicians promote the placement of implants in the lateral incisor sites , and cantilevering the central incisors , or joining them as a four unit bridge , versus placement of implants in the central incisor regions . the rationale for this approach is that the existing pdl and bone support on the mesial aspects of the adjacent teeth will help support the papilla in between the implant and tooth , while it would be easier to build soft tissue support beneath the pontic with no interference from any implantsb)augmenting soft tissue between two implants : building the inter - implant papilla has proven to be a challenge , and various techniques such as insertion of a titanium papilla insert have also been proposed and attempted with some success . placement of a connective tissue graft is probably the most popular technique , however , the factors influencing the success of connective tissue augmentation are the distance between the two implants , distance from alveolar crest to contact point , periodontal tissue biotype , flap passivity prior to closure , suturing technique and post - operative maintenance . position of two implants : as far as possible , it is advisable to not place two implants next to each other . we have learnt that the placement of the implants with a minimum distance of 3 mm between the platforms leads to a better chance of maintaining papilla between them . for instance , in the case of missing four maxillary incisors , some clinicians promote the placement of implants in the lateral incisor sites , and cantilevering the central incisors , or joining them as a four unit bridge , versus placement of implants in the central incisor regions . the rationale for this approach is that the existing pdl and bone support on the mesial aspects of the adjacent teeth will help support the papilla in between the implant and tooth , while it would be easier to build soft tissue support beneath the pontic with no interference from any implants augmenting soft tissue between two implants : building the inter - implant papilla has proven to be a challenge , and various techniques such as insertion of a titanium papilla insert have also been proposed and attempted with some success . placement of a connective tissue graft is probably the most popular technique , however , the factors influencing the success of connective tissue augmentation are the distance between the two implants , distance from alveolar crest to contact point , periodontal tissue biotype , flap passivity prior to closure , suturing technique and post - operative maintenance . to study the effect of soft tissue augmentation around implants , 10 partially edentulous patients requiring at least one single implant in the premolar or molar areas of both sides of the mandible were randomized to have one side augmented at implant placement with a connective soft tissue graft harvested from the palate or no augmentation . after 3 months of submerged healing , abutments were placed and within 1 month definitive crowns were permanently cemented . outcome measures evaluated by the authors were implant success , any complications , peri - implant marginal bone level changes , patient satisfaction and preference , thickness of the soft tissues and aesthetics . soft tissues at augmented sites were 1.3 mm thicker ( p < 0.001 ) and had a significantly better pink aesthetic score ( p < 0.001 ) . patients were highly satisfied with both treatments , although they preferred the aesthetics of the augmented sites . the two clear choices that exist when placing a connective tissue graft are either a free connective tissue graft ( unpedicled ) or a pedicled connective tissue graft . the vascularized interpositional connective tissue graft ( vip - ct ) graft has been used successfully for augmenting buccal or vertical soft tissue deficiency . this is primarily a rotated pedicle connective tissue graft which adds soft tissue volume and minimizes graft shrinkage , since it has a patent vascular supply [ figure 3a g ] . over the past two years , i have used the vip - ct graft with increased success ; however , case selection remains a crucial factor . it is quite important to ensure that there is adequate thickness of palatal tissue with bone sounding , since a thin pedicle graft can often necrose and lead to compromised results . soft tissue augmentation using vascularized interpositional connective tissue graft ( vip - ct ) ( a ) baseline presentation with submerged implants ( b ) implant exposure with abutment placement ( c ) initial rotation of connective tissue graft pedicle from palatal site as shown in ( d ) , ( e ) temporary crown prior to placement ( f ) seated temporary crowns with connective tissue pedicle interposed in between the two to create papilla ( g ) palatal harvest site sutured . the connective tissue pedicle is tunneled below the sutured site to the buccal recipient site . compare augmented site ( f ) with baseline ( c ) ( soft tissue surgery : dr . neel bhatavadekar ) it is important to remember that since there is no augmentation in vertical interproximal bone height , the vip - ct graft leads to mere augmentation of soft tissue volume , and the anticipation of possible tissue shrinkage implies that the patient needs to be informed about the risk of an uncertain result long term . thus , building the inter - implant papilla continues to be a challenge , with the vip - ct graft being one of the possible treatment options . lastly , and most recently , the ability to tissue engineer soft tissue where needed has led dentistry into a new research direction which is exciting and promising . before long , we might be able to send a patient 's gingival cells to a lab , and get in return a petri - dish of tissue engineered soft tissue for surgical transplantation . at the academy of osseointegration ( ao ) summit meeting in chicago ( august 2010 ) , which i was invited to participate in , 75 clinicians and bioengineering experts discussed the translational applications of biological technologies such as micro - vibration , bone growth factors , and sustained release mechanisms to the enhancement of the implant - bone , and implant - soft tissue interface . the addition of bone growth factors to the implant surface is not a new concept , but the logistic and production challenges it poses , and the inability to maintain the growth factor on the surface after implantation , has been the main reason for the absence of such a product from the current implant market . newer implant testing protocols such as cyto - detachment have provided an option to test the individual cell attachments to implant surfaces , which has not been possible earlier . this , in turn , could lead to better ways to bioengineer dental implant surfaces . the possibility of bioengineering an integrated implant - soft tissue construct was also discussed , which , in turn could be directly implanted into the recipient site which was devoid of the necessary soft tissue . such an implant would theoretically have soft tissue bioengineered from the patient 's own tissue attached to the coronal platform , and a conventional root form implant which would osseointegrate . the ability to sustain the vascularity for this soft tissue does remain an area of active research interest , and we will probably see a lot of new clinically applicable ideas emerging from this concept in the near future . our concepts about soft tissue management around implants have greatly evolved over the past two decades . we are in an exciting era where we have a better understanding of the conventional surgical techniques , and we also look to promising bioengineering approaches for the benefit of our patients . for instance , some procedures such as socket compression following extraction have become outdated , and newer concepts in socket preservation have emerged . the triad of anatomical peri - implant characteristics , soft tissue responses to the implant material , and clinical skill form the fundamental principles in augmenting soft tissue . although long term follow - up and more randomized controlled trials are necessary to demonstrate long term prognosis of some of the recent techniques , researchers have provided us sound data to enable an evidence - based approach to treatment decisions as regards peri - implant soft tissue enhancement .

dental implants have evolved dramatically over the last decade , and so have our expectations from them in terms of functional and esthetic criteria . the maintenance and augmentation of the soft tissue has emerged as an area of concern and focus . the triad of anatomical peri - implant characteristics , soft tissue response to the implant material , and clinical skill form the fundamental principles in augmenting soft tissue . however , as clinicians , where are we with regards to the ability to augment and maintain soft tissue around dental implants , about 40 years after the first implants were placed ? we now understand that peri - implant soft tissue management begins with extraction management . our treatment modalities have evolved from socket compression post - extraction , to socket preservation with an aim to enhance the eventual peri - implant soft tissue . this short communication will assess the evolution of our thought regarding peri - implant soft tissue management , augmentation of keratinized mucosa around implants , and also look at some recent techniques including the rotated pedicle connective tissue graft for enhancing inter - implant papilla architecture . with newer research modalities , such as cyto - detachment technology , and cutting - edge bioengineering solutions ( possibly a soft - tissue - implant construct ) which might be available in the near future for enhancing soft tissue , we are certainly in an exciting era in dentistry .

You are an expert at summarizing long articles. Proceed to summarize the following text: most cells are adherent and must attach and spread on a protein matrix in order to survive and carry out their functions . most commonly , the integrin family of receptors mediates adhesion by binding to peptides within the matrix . in this way , the adhesion of cells to a given substrate can be promoted by either modifying the latter with ligands for an endogenous receptor or engineering the cell to introduce receptors that recognize an epitope on the surface . both routes have been explored for promoting tissue integration with medical devices and for treating the blistering diseases caused by laminin and collagen mutations that disrupt normal adhesion of the epidermis and dermis.(5 ) an unexplored route to promote cell adhesion when complementary receptors and ligands are not present would use an adaptor protein that can simultaneously bind to the cell - surface receptor and an epitope present on the substrate . in this paper we demonstrate that this strategy can restore cell adhesion to substrates that do not present ligands for the endogenous receptors . like adhesion to a normal matrix , the adaptor protein - mediated adhesion is specific , and the polyvalent engagement of receptors is able to sustain the mechanical forces applied by the cell and support the assembly of a contractile cytoskeleton . we use self - assembled monolayers ( sams ) that present ligands against a background of tri(ethylene glycol ) groups as model substrates for cell adhesion . previous work has shown that monolayers that present the rgd peptide ligand support the integrin - mediated adhesion and spreading of cells.(6 ) the glycol groups are an important component of the monolayers , as they prevent the nonspecific attachment of cells and therefore ensure that adhesion is mediated only by the immobilized ligand.(2 ) in the present work , we characterized the adhesion of chinese hamster ovary ( cho ) cells on a monolayer presenting a benezenesulfonamide ligand ( figure 1a ) . the cho cells display 5 and v integrins on their surfaces , which interact with the canonical rgd tripeptide motif present in the matrix protein fibronectin ( figure 1b).(7 ) these cells are unable to attach to the benzenesulfonamide - terminated monolayer ( figure 1c ) . to restore adhesion to this monolayer , we designed and expressed a human carbonic anhydrase iv ( hcaiv ) protein that included at its carboxy - terminus a linker and the rgd motif ( ca - rgd ) ( figure 1d ) . because carbonic anhydrase binds to benzenesulfonamide ligand with micromolar affinity,(8 ) we reasoned that the inclusion of this protein in the cell culture medium would result in its binding to the monolayer and therefore recruitment of the rgd motif to the surface , where it could mediate adhesion of the cho cells . ternary complex formation has been shown to be an efficient method of targeting antibodies to virus - infected cells.(9 ) cho cell adhesion to model substrates . ( b ) cho cells adhere to rgd - presenting monolayers , but ( c ) fail to adhere to benzenesulfonamide surfaces . ( d ) cho cells adhere to benzenesulfonamide surfaces in the presence of ca - rgd . our results demonstrate that cell adhesion to unnatural ligands can be induced in the presence of the adaptor protein . the observed cell adhesion phenotype was similar to the one observed on covalently modified rgd surfaces , suggesting that cells can exert the same contractile forces on both substrates . this strategy is widely applicable and of special interest when surface modification or receptor introduction into a cell is impractical or impossible . ca - rgd was amplified from a previous hcaiv gene with adaptor primers including nhei and bamhi recognition sequences . the sequence of the forward primer , including an nhei recognition site followed by the first six codons of hcaiv , was 5-atatgctagcgccggtctagagtcacac-3. the reverse complementary sequence of the reverse primer , including a bamhi recognition site followed by the last five codons of hcaiv , followed by the codons of the ggsggggsggrgds sequence and a stop codon , was 5-attaggatccttagctgtcaccgcgaccaccgctaccaccaccaccgctaccaccggactttatcaccgt-3. the polymerase chain reaction ( pcr ) consisted of an initial 1 min denaturation at 95 c , followed by 30 cycles of 1 min 95 c denaturation , 1 min 55 c annealing , and 2.5 min of 73 c extension . after 30 cycles , a final extension at 73 c for 5 min followed by cooling at 4 c was performed . the pcr products were cleaved with nhei and bamhi , purified , and cloned in frame into the pet-11a vector ( novagen ) . insertion of the hcaiv gene with the c - terminal linker and rgds sequence was confirmed by dna sequencing . for ease of purification , a six his tag was introduced in the n - terminus using a quikchange site - directed mutagenesis kit ( stratagene ) . the forward primer had the sequence 5-gatatacatatggctagccaccaccaccaccaccacgccggtctagactcac-3. the reverse primer had the sequence 5-gtgactctagaccggcgtcgtcgtcgtcgtcgtggtggtggtggggtggctagccatatgtatatc-3. the construct was amplified with the cycling parameters suggested in the product , using 18 cycles . the construct was then transformed into escherichia coli ( strain origami b de3 ) cells for production of ca - rgd following standard procedures . for protein expression , single ampicillin - resistant colonies were grown in luriabertani medium supplemented with 100 mg / ml ampicillin at 37 c and 190 rpm overnight . a 1 ml aliquot of this culture was used to inoculate 1 l of luriabertani medium supplemented with 100 mg / ml ampicillin and grown to an od600 of 0.6 . after induction with 1 mm isopropyl--d - thiogalactopyranoside , the cells grew for 4 h at 37 c and 190 rpm . cultures were then centrifuged and pellets resuspended in 20 ml of phosphate - buffered saline ( pbs ) ( 10 mm phosphate , 150 mm nacl , ph 7.0 ) . cells were sonicated for 10 min , and the suspension was centrifuged to remove cellular debris . the supernatant was applied to a talon single step ( clontech ) and incubated in ice for 30 min . after initial elution , the column was incubated with 10 ml of buffer a ( 25 mm tris , 1.5 mm mgcl2 , 5 mm nacl , 1.25% triton x ) on ice for 30 min . after elution , the column was incubated with 5 ml of buffer b ( 25 mm tris , 1.5 mm mgcl2 , 5 mm nacl , 150 mm imidazole ) for 10 min on ice and eluted . this fraction was concentrated using 10 kda amicon filtration units ( millipore ) and extensively dialyzed against pbs ( 10 mm phosphate , 150 mm nacl , ph 7.0 ) in 10 kda dialysis cassettes . the purity of the protein was assessed with sodium dodecyl sulfidepolyacrylamide gel electrophoresis ; protein concentration was measured using nanodrop . ac - grgdsc , ac - ggrdgsc , ac - grgds , and ac - ggrdgs were synthesized manually following standard fmoc peptide synthesis protocols using fmoc - rink amide mbha resin . all peptides were purified by reverse - phase high - performance liquid chromatography using a c18 column ( waters ) and characterized with matrix - assisted laser desorption / ionization time - of - flight mass spectrometry ( maldi - tof ms ) . glass coverslips were sonicated for 30 min in deionized ultrafiltered ( diuf ) water and 30 min in ethanol and then dried under a stream of nitrogen . titanium ( 4 nm ) and then gold ( 29 nm ) were evaporated onto the coverslips using an electron beam evaporator ( boc edwards ) at a rate of 0.050.10 nm / s and at a pressure of 1 torr . the gold - coated coverslips were immersed in an ethanolic solution of either maleimide - terminated disulfide ( 2% ) and tri(ethylene glycol)-terminated disulfide ( 98% ) or amine - terminated disulfide ( 1% ) and tri(ethylene glycol)-terminated disulfide ( 99% ) and incubated overnight at room temperature . the total disulfide concentration was 1 mm . the substrates were washed with diuf water and ethanol and then dried under a stream of nitrogen . surface plasmon resonance ( spr ) measurements were performed using 1% benzenesulfonamide sams and ca - rgd following the methods described by mrksich et al.(8 ) cysteine - terminated peptides were immobilized onto 1% maleimide - presenting sams by immersing the biochip in 1 mm peptide solution ( tris buffer , ph 7.5 ) and incubating at 37 c for 1 h. benzenesulfonamide was immobilized by immersing a 1% amine - terminated sam in a 1 mm benzenesulfonamidenhs solution ( 1:1 dmso:100 mm triethanol amine , ph 7 ) and incubating at room temperature for 30 min . substrates were rinsed with diuf water and ethanol and dried under a stream of nitrogen . cho k1 cells were detached from culture plates with 1 mm ethylene glycol bis(2-aminoethyl ether)-n , n , n,n-tetraacetic acid ( egta)/2 mm ethylenediaminetetraacetic acid ( edta ) in pbs , rinsed with f-12k medium ( 10% fetal bovine serum ( fbs ) , 1x penicillin / streptomycin ) , centrifuged , and resuspended in the same medium at a density of 60 000/ml . cells were incubated at 37 c and 5% co2 for 4 h. upon completion of the incubation period , substrates were gently washed with warm pbs and imaged with a 20 objective of a zeiss axiovert 200 inverted microscope . substrates were washed gently with pbs , and permeabilized with 4% formaldehyde and 0.5% triton - x for 30 min . fixed and permeabilized cells were blocked in the presence of blocking buffer ( 1% bovine serum albumin , 5% goat serum , and 0.1% triton - x ) for 30 min . substrates were then incubated with 1:1000 dilution of monoclonal antivinculin immunoglobin ( igg ) ( sigma ) for 30 min , followed by incubation with 1:400 dilution of phalloidin - af488 and tr goat antimouse igg and 1:5000 4,6-diamidino-2-phenylindole ( dapi ) for 30 min . after washing extensively with blocking buffer , fluorescent images of cells on substrates were acquired with a 100 objective of a zeiss axiovert 200 inverted microscope . benzenesulfonamide was immobilized by immersing a 1% amine - terminated sam in a 1 mm benzenesulfonamidenhs solution ( 1:1 dmso:100 mm triethanol amine , ph 7 ) and incubating at room temperature for 30 min . substrates were rinsed with diuf water and ethanol and dried under a stream of nitrogen . cho k1 cells were detached from culture plates with 1 mm egta/2 mm edta in pbs , rinsed with f-12k medium ( 10% fbs , 1x penicillin / streptomycin ) , centrifuged , and resuspended in the same medium at a density of 60 000/ml . cells were added to substrates in 24-well culture plates with different concentrations of ca - rgd . cells were incubated with at 37 c and 5% co2 for 4 h , followed by a gentle pbs wash . adherent cells were immediately fixed and permeabilized with 4% formaldehyde and 0.5% triton - x for 30 min . fixed and permeabilized cells were stained with dapi ( 1:5000 ) for fluorescent images of cells nuclei on substrates were acquired with a 20 objective of a zeiss axiovert 200 inverted microscope . the number of adherent cells per field of view was counted using image j. cells were counted in at least five fields for each substrate , and each experiment was repeated three times . adhesion is reported as the average count of nuclei per field of view , using the standard error for error bars . suspensions of cho k1 cells ( 60 000/ml ) were incubated with soluble inhibitors ( ac - grgds , ac - ggrdgs , and benzenesulfonamide ) for 10 min prior to addition to benzenesulfonamide substrates ( in the presence of ca - rgd ) . after incubation , the substrates were washed gently with warm pbs , and adherent cells were immediately fixed and permeabilized with 4% formaldehyde and 0.5% triton - x for 30 min . fixed and permeabilized cells were stained with dapi ( 1:5000 ) for 30 min and mounted with aqua poly / fluorescent images of cells nuclei on substrates were acquired with a 20 objective of a zeiss axiovert 200 inverted microscope . the number of adherent cells per field of view was counted using image j. cells were counted in at least five fields for each substrate , and each experiment was repeated three times . the degree of inhibition is reported as a percentage of cells that adhere relative to control experiments in the absence of soluble inhibitor . the adaptor protein ca - rgd is composed of carbonic anhydrase iv ( caiv ) followed by a linker , ggsggggsgg . the c terminal of the linker is terminated with an rgds peptide that promotes cell adhesion . a his tag was introduced in the n terminal of the caiv segment for ease of purification ( figure 2a ) . spr experiments demonstrated that ca - rgd binds to 1% benzenesulfonamide sams and fails to bind to 100% ethylene glycol sams ( figure 2b ) . these experiments showed that the expressed protein is active and that it binds selectively to benzenesulfonamide substrates . his tag shown in bold , caiv shown underlined , linker shown in italics , rgd domain shown in red . ( b ) spr sensorgrams show that ca - rgd binds to 1% benzenesulfonamide sams but fails to bind to 100% tri(ethylene glycol ) sams . we next examined if ca - rgd was capable of mediating cho cell adhesion to benzenesulfonamide sams . as a control , we also seeded cho cells on 1% ac - grgdsc substrates , onto which the rgd peptide had been covalently immobilized . cho cells failed to adhere to 1% benzenesulfonamide substrates ( figure 3b ) . when the experiment was repeated using medium that was supplemented with ca - rgd ( 10 m ) , the cells attached to the monolayer and assumed a well - spread morphology ( figure 3c ) . the cells were indistinguishable from those that attached to a control monolayer that directly presented the rgd peptide ligand ( figure 3d ) . we fixed and stained the adherent cells with phalloidin to visualize the actin stress filaments and with an anti - vinculin antibody to visualize the focal adhesions . for both surfaces , cells had well - developed cytoskeletal structures ( figure 3e , f ) . for example , cho cells failed to adhere to monolayers presenting only tri(ethylene glycol ) groups or the scrambled peptide ac - ggrdgs ( data not shown ) . further , adhesion to the benzenesulfonamide - terminated monolayer in the presence of the adaptor protein could be inhibited by adding either bovine carbonic anhydrase or benzenesulfonamide ligand to the medium ( data not shown ) . cho cell adhesion and cytoskeletal structure mediated by ca - rgd on 1% benzenesulfonamide substrates ( c , e ) and 1% ac - grgdsc substrates ( d , f ) . the adaptor protein ca - rgd has a bivalent character , as it contains a domain that binds to cells and another that binds to the surface . hence , the adaptor protein has the capacity to form a ternary complex with cells and the surface , or to bind to each independently . this dual character allows ca - rgd to either mediate adhesion or inhibit the adhesion of the cells . because these roles should show a dependence on the concentration of protein , we compared the adhesion of cho cells to monolayers presenting the benzenesulfonamide ligand with concentrations of the adaptor protein ca - rgd ranging from 0.1 to 100 m ( figure 4 ) . we found that the number of cells that attached increased with the concentration of the adaptor protein , reached a maximum at 10 m , and then decreased with higher concentrations of protein . this trend is consistent with the bifunctional nature of the adaptor protein , since lower concentrations of protein should favor the equilibrium for binding of the protein to both the integrin and the benzenesulfonamide in a ternary complex , but higher protein concentration led to partitioning of the adaptor construct into binary complexes that would abrogate cell adhesion . as noted above , we found that both soluble rgd peptide and benzenesulfonamide ligand showed a dose - dependent inhibition of adaptor protein - mediated cell adhesion to the benezensulfonamide - terminated monolayer , with 50% inhibition occurring at inhibitor concentrations near 10 m . again , as evidence of the specificity of these interactions , the scrambled peptide ggrdgs had no effect on cell adhesion at any concentration tested ( figure 5a ) . we investigated the inhibition of adhesion by mixtures containing both the rgd peptide and the ca ligand , and we found that the mixture was more effective at blocking adhesion than was either ligand alone . indeed , using mixtures that had different ratios of the two ligands but always at a total concentration of 10 m we found that the strongest inhibition was observed when the ligands were present in a 1:1 ratio ( figure 5b ) . ( a ) inhibition of cell adhesion in model system using soluble inhibitors . ( b ) mixed inhibition of benzenesulfonamide and rgd peptide on ca - rgd - mediated cell adhesion . in this paper we report the use of an adaptor protein to restore cell adhesion to substrates that otherwise do not present ligands for the integrin receptors . we used a bifunctional protein that that can simultaneously bind to a benzenesulfonamide ligand immobilized to a monolayer substrate and to a cell - surface integrin receptor on cho cells . the bifunctional protein , ca - rgd , was effective in restoring cell adhesion to the monolayers and gave cell morphologies that were similar to those observed for cells adherent to an rgd - presenting monolayer . hence , cells that were tethered to the surface by way of a noncovalently immobilized rgd ligand could still display normal cell adhesion and contractile cytoskeletal structures . the ca - rgd adaptor protein mediated specific adhesion , as shown by the ability of a soluble benzenesulfonamide ligand or rgd peptide to block adhesion . the most significant result is the demonstration that reversibly immobilized adhesion ligands can support the adhesion of cells . the cabenzenesulfonamide complex undergoes dissociation with a rate constant on the order of 110 s. however , the adhesion of cells engages a large number of cabenzenesulfonamide complexes , and this polyvalent scaffold of interactions significantly increases the avidity of the complexes and consequently maintains a stable engagement of the cell with the surface . mechanistic studies of polyvalent complexes have revealed them to be extraordinarily stable , often mediating binding events comparable to irreversibly bound ligands . this stability derives from the improbability that each of the individual interactions is simultaneously in the dissociated state , which would be required for dissociation of the complex . thus , although the cabenzenesulfonamide interaction has a lifetime that is short relative to the time scale for cell adhesion , a threshold number of ligandreceptor bonds are maintained on average and able to support cell adhesion and spreading . again , it is significant that the observed adhesion was comparable to that observed for substrates having a covalently immobilized rgd . we note previous work that has used bimolecular complexes to immobilize adhesion ligands for promoting cell adhesion . for example , reichert and co - workers immobilized a biotin - labeled rgd peptide to tissue culture plastic that was coated with a layer of streptavidin . the resulting surfaces supported robust cell adhesion , but in this case the use of a streptavidinbiotin interaction provided for an essentially irreversible presentation of the rgd peptide and , in that sense , is more analogous to a covalent immobilization of ligands on a surface . by using a cabenzenesulfonamide interaction to immobilize the rgd , we use an interaction that is rapidly reversible over the time scale of an adhesion experiment . we believe that this report is the first that localizes cell adhesion ligands to a surface in a reversible manner . as discussed earlier , polyvalent systems combine two contradictory properties : they can associate to give an irreversible complex , but they can also be rapidly dissociated in the presence of a soluble ligand . we suggest that this property may enable a class of dynamic surfaces that can be used to change the identity of the immobilized ligand or remove the ligand completely and thereby release cells from the substrate . for example , by adding to the medium a fusion protein that binds the monolayer but that is modified with a second adhesion ligand , this protein is expected to exchange with the proteins that mediate adhesion and be driven by equilibrium to change the composition of adaptor protein at the cellsubstrate interface . similarly , a protein that can bind the substrate but that does not include an adhesion ligand may be useful for removing the rgd ligand and thereby releasing a cell culture without the need for enzyme treatment ( as is now common and which can lead to unwanted proteolysis of cellsurface receptors ) . finally , we recognize the possibility of using this strategy to induce cell adhesion where the covalent introduction of cell adhesion ligands is not straightforward , particularly in in vivo settings . many blistering diseases , for example , are associated with mutations that compromise the adhesion activity of extracellular matrix proteins.(14 ) adaptor proteins that are designed to include a domain that binds to the mutated protein and a domain that binds to cells might represent a therapeutic solution for rescuing cell adhesion and stabilizing the tissue interface that is compromised in these diseases . this strategy is distinct from those under investigation that are based on protein injection and gene therapy in that it involves an adaptor protein that would form a polyvalent scaffold at the site of injury and alleviate blistering symptoms , rather than the introduction of a native protein . this report also illustrates the applicability of sam substrates as mimics of the extracellular matrix.(2 ) the monolayers allow excellent control in orientations , densities , and compositions of immobilized ligands , whereas tri(ethylene glycol)-terminated monolayers are among the most effective at minimizing the nonspecific adsorption of protein . the combination of these benefits allows the molecular interactions between a cell and its substrate to be controlled . finally , the monolayers can be directly characterized with maldi - tof ms and therefore can be structurally checked . in this work , we used sams to present the benzenesulfonamide moiety against an inert background , facilitating the specific recruitment of ca - rgd to the surface and the subsequent specific cell adhesion . this work demonstrates the use of an exogenous protein to restore cell adhesion to a material that otherwise does not support adhesion . this engineering modality adds to the elegant strategies that have been demonstrated for biosynthetically modifying the cell surface or the surfaces of materials to introduce complementary interactions that mediate adhesion . the present strategy is significant in that it does not require either the introduction of receptors in the cell or the modification of substrate with cell adhesion ligands , and therefore it may be applicable for creating surfaces that can be dynamically remodeled with different adhesion motifs and for repairing the loss of cell adhesion to mutated proteins in vivo . in the analogous use of soluble ligands to inhibit the adhesion of cells , for example , the monomeric ligands are far less effective than are corresponding multivalent ligands.(18 ) in this sense , the present work demonstrates a strategy for the self - assembly of a polyvalent scaffold from monomeric building blocks and suggests that this strategy may find broader use in the design and application of polyvalent ligands .

this paper describes a molecular strategy to restore adhesion of cells to surfaces that otherwise do not present ligands that can mediate adhesion . the approach is based on a carbonic anhydrase fusion protein that binds benzenesulfonamides and that also includes the rgd peptide motif that can bind to cell - surface integrin adhesion receptors . in this way , the fusion protein can bind to a monolayer that presents the benzenesulfonamide ligand , thereby positioning the rgd peptide at the surface , where it can mediate the adhesion and spreading of cells . this strategy may provide a general method for promoting the adhesion of cells to non - natural surfaces or to defective biological matrices .

You are an expert at summarizing long articles. Proceed to summarize the following text: transcription factors present sequence - specific dna binding sites and are able to modulate the transcription rate of downstream target genes . wrky genes have primarily been located in plants , where they are one of the most important transcription factor families . wrky genes are defined by having a unique wrky domain of approximately 60 amino acid residues . the wrky domain contains a highly conserved amino acid sequence wrkygqk at the n - terminal and a metal chelating zinc finger motif ( c x4 - 5c x22 - 23h x h , ( c2h2 ) or c x58c x2528h x1 - 2c , ( c2hxc ) ) at the c - terminal end [ 25 ] . in some wrky genes , the wrky domain can be characterized as wrry , wsky , wkry , wvky , or wkky . wrky transcription factors interact with the w - box ( ttgac[t / c ] ) sequence in promoter regions to modulate gene expression [ 4 , 7 , 8 ] . in addition , wrky transcription factors bind sure , a novel cis - element in higher plants , to regulate sugar response . members of the wrky family can be classified into three groups according to the number of wrky domains and the pattern of the zinc finger motif . previous studies have demonstrated that the c - terminal wrky domain mediates sequence - specific binding to the target dna [ 8 , 10 , 11 ] . it has been proposed that the n - terminal wrky domain increases the affinity or specificity of these proteins to the target sites . group ii and iii wrky transcription factors contain one wrky domain with a c2h2 zinc finger motif and c2hxc zinc finger motif . based on a phylogenetic analysis of the wrky family , the members of group ii can be divided into five subgroups : iia , iib , iic , iid , and iie . since the cloning a wrky gene cdna from ipomoea batatas , a large number of wrky protein genes have been cloned from different plant species [ 3 , 4 , 1224 ] . so far , only two wrky homologues have been identified from nonplant species , giardia lamblia and dictyostelium discoideum . plant wrky genes regulate plant growth and development under normal and stressful conditions [ 26 , 27 ] . early studies found that wrky genes play an important role in gene expression responses to sucrose . studies in arabidopsis [ 17 , 28 , 29 ] , rice , tobacco [ 31 , 32 ] , and parsley have indicated that wrky proteins play key roles in plant responses to pathogens [ 27 , 34 ] . in addition , previous studies revealed the involvement of wrky proteins in abiotic stress responses , for example , to high temperatures , low temperatures , salt and drought , h2o2 , and uv radiation . wrky proteins have also been reported to upregulate in response to herbivory , nematode damage , and wounding . moreover , wrky genes may be involved in seed development [ 9 , 41 ] , dormancy and germination [ 4244 ] , plant senescence [ 45 , 46 ] and regulation of metabolic pathways , trichome morphogenesis , and plant growth . lotus japonicus , an important forage crop in the legume family , is planted in many parts of the world . it has been used extensively in plant research as a model legume , due to its short life cycle ( 2 - 3 months ) , self - fertility , and relatively simple diploid genome . since the release of the whole genome sequence of l. japonicus , it is now possible to compare transcription factors in this plant with other plants . in this study we conducted a phylogenetic analysis to evaluate gene duplications , chromosomal localization , motif analysis , gene structure , and selection pressure analysis of group iii wrky genes to provide information about wrky gene family evolution in l. japonicus . the l. japonicus genome sequence ( build 2.5 ) was downloaded from http://www.kazusa.or.jp / lotus/. the complete set of wrky gene sequences was identified using a deliberative process . first , a hidden markov model ( hmm ) profile of the wrky domain ( pf03106 ) was downloaded from the pfam database ( http://pfam.sanger.ac.uk/ ) . we employed the wrky domain as a query to identify all possible wrky gene sequences in the l. japonicus genome database using the blastp program ( p value = 0.001 ) . subsequently , a search on the pfam database was used to confirm and classify each putative wrky sequence . we located overlapping genes by aligning all of the candidate wrky gene sequences using clustal w . only the nonoverlapping wrky sequences were used for further analysis . to detect potential gene duplications , we aligned and calculated all of the relevant genes identified in l. japonicus genomes . we defined gene duplication between any two loci such that : ( 1 ) the alignable nucleotide sequence covered > 70% of the longer sequence ; ( 2 ) the amino acid identity between the sequences was > 70% identical . in order to determine the physical locations of wrky genes in chromosomes , we blasted each wrky gene as a query against the l. japonicus genome ( http://www.kazusa.or.jp/lotus/ ) to determine the initiation site of each gene . mapinspect software was used to draw the location images of the wrky genes ( http://www.plantbreeding.wur.nl/uk/software_mapinspect.html ) . to examine the domain organization of wrky proteins in detail , multiple sequence alignments of wrky domain sequences bootstrap analyses of 1,000 repetitions were obtained for each tree to analyze statistical support for nodes . the complete amino acid sequences of group iii wrky genes were analyzed for evidence of selection pressure . gene structure display server ( gsds ) software was used to illustrate exon - intron organization for individual wrky genes by comparing the cdna sequence with the corresponding genomic dna sequence . the program meme 4.9 was used to predict motifs in the wrky domain with the following parameters : ( 1 ) any number of repetitions , ( 2 ) an optimum motif width between 6 and 200 residues , ( 3 ) and a maximum of 20 motifs . the amino acid sequences of group iii medicago truncatula ( mtwrky ) and l. japonicus wrky ( ljwrky ) proteins were used to estimate phylogenetic trees and then the trees were used to detect evidence of selection . the pal2nal program was used for conversion of a protein sequence into the corresponding nucleotide sequence . we used paml 4.7 to analyze codon substitution patterns in a maximum likelihood framework , implementing a site - specific model . the program codeml was employed to calculate the dn / ds ratio ( or ) , the ratio of nonsynonymous / synonymous distances . generally , = 1 , > 1 , and < 1 indicate neutral , positive , and purifying selection , respectively . we detected variation in among sites by employing a likelihood ratio test ( lrt ) between m0 versus m3 and m7 versus m8 . the nodes were considered to have undergone positive selection , if they satisfied the following criteria : ( 1 ) an estimate of > 1 under m8 , ( 2 ) sites identified to be under positive selection by bayes empirical bayes ( beb ) analysis , ( 3 ) and a statistically significant lrt . in this study , a total of 71 wrky genes in the l. japonicus genome ( build 2.5 ) were identified ( table 1 ) . among these sequences , 10 wrky genes were excluded from this study due to the divergent structures of the putative proteins in these genes , a lack of specific domains or motifs , and the short length of the wrky domain , generally 2/3 of the normal wrky domain length . although the ljwrky51 protein , including two wrky domains , lacked a complete wrky domain at the c - terminal region , this protein was retained for subsequent analyses . among these 61 wrky genes , there were 12 group i wrky genes , 42 group ii wrky genes , and 7 group iii wrky genes , based on the number of wrky domains and the type of zinc finger motifs ( tables 1 and 2 ) . to obtain a better classification within group ii wrky proteins , we constructed a phylogenetic tree with 42 group ii ljwrky using the arabidopsis wrky sequence as a reference ( figure 1 ) . it was found that ljwrky genes in group ii could be divided into six subgroups , including 5 members in subgroup iia , 8 in subgroup iib , 13 in subgroup iic , 5 in subgroup iid , 9 in subgroup iie , and 2 in subgroup iix ( tables 1 and 2 and figure 1 ) . among them , ljwrly19 and ljwrky37 genes did not cluster with arabidopsis , and we temporarily named this group iix ( figure 1 ) . we found 9 potential pseudogenes among 61 wrky genes , with either a premature stop codon or a frame shift mutation . among these pseudogenes , 3 genes were found in group i , 2 in group iia , 2 in group iic , and 2 in groups iix and iie ( table 1 ) . gene duplication , including tandem and segmental duplication events , plays a crucial role in genomic expansions . two or more duplicated genes located in the same chromosome are defined as tandem duplication , while other types of gene duplication are defined as segmental duplication events . we detected only one tandem duplication ( ljwrky34 and ljwrky35 ) on chromosome 4 ( figure 2 ) , suggesting that wrky genes in l. japonicus are not recently generated by gene duplication . a total of 48 wrky genes could be mapped to chromosomes 16 , and the others could not be conclusively mapped to any chromosomes , because some wrky genes have no precise location information . fourteen wrky genes including two group i , 10 group ii , and two group iii genes were located on chromosome 1 . four genes were mapped to chromosome 3 ( one group i , two group ii , and one group iii genes ) and chromosome 6 ( two group i and two group ii genes ) , respectively . eight ( two group i , four group ii , and two group iii genes ) and five wrky genes ( five group ii genes ) were found on chromosome 2 and chromosome 5 , respectively ( figure 2 ) . a gene cluster is defined as a chromosome region with two or more genes located within 200 kb sequence . using this criterion chromosomes 2 and 4 each contain two gene clusters , while only one gene cluster was found on chromosomes 1 and 5 , respectively ( figure 2 ) . no clusters were found on chromosomes 3 and 6 . through chromosomal location and gene cluster analysis , we found that the number of genes on chromosomes is disproportionate to the number of gene clusters . for example , 14 wrky genes were found on chromosome 1 , which contains only one gene cluster . amino acid residues of wrkygqk are the distinguishing regions of the wrky transcription factor [ 2 , 27 ] . multiple alignment analysis of ljwrky domains found that mutations occurred at r , y , and q in the conserved wrkygqk sequence ( figure 3 ) . further study showed that the variation arose from amino acid substitutions of r to k or l or from k to c and from q to y , e , l , or k ( figure 3 ) . on the other hand , we identified a cx4cx22hxh zinc finger motif in subgroup in and iix genes , a cx4cx23hxh motif in subgroup ic and iie genes , and a cx5cx23hxh motif in subgroup iia , iic , iid , and iie genes ( figure 3 ) . we found that the wrky domain was replaced by wkky in subgroup in and iix genes , suggesting that subgroup iix genes originated from n - terminal wrky domain of group i genes . the subgroup iia and iie genes seem to have formed after the group i genes lost alternative wrky domains . the wrky domain phylogenetic tree can be subdivided into eight clades : in , ic , iia , iib , iic , iid , iie , and iii ( iix nested in in ; figure 4(a ) ) . the group i proteins contain two wrky domains located at the n - terminal domain ( in ) or the c - terminal domain ( ic ) . although in and ic belong to group i , members of in and ic were clustered in different clades , representing the sequence divergence of wrky domain in in and ic . clade ic contained 14 members in l. japonicus , including 12 members with wrky domains at the c - terminal region and two group ii members ( ljwrky20 and ljwrky63 ) ( figure 4(a ) ) . these two group ii members were clustered with ljwrky24c and ljwrky32c , respectively , indicating a common origin of their domains . moreover , two group ii members ( ljwrky19 and ljwrky37 ) were also found in the in clade . group ii can be divided into five clades with high bootstrap values ( figure 4(a ) ) . further analysis revealed that iia and iib form a single clade and iid and iie form a clade , while iic contained 11 ljwrky members form a clade ( figure 4(a ) ) . this suggests that the domains had a recent gene ancestor or formed under similar selective pressures . clade iii contained seven members which are more similar to clade iid and clade iie than any other members ( figure 4(a ) ) , suggesting that they may have shared an ancestor before divergence of group ii and group iii . during analysis of the cdna and dna sequences , we found that most of the ljwrky genes contained two types of introns in their wrky domains . the phase-2 intron is spliced exactly after the r position , similar to the splicing position observed in arabidopsis . a phase-0 intron is located before the v position , at the sixth amino acid after the second c residue in the c2h2 zinc finger motif . interestingly , in subgroups ic , iic , iid , iie , and iii , the r - type intron is located before the zinc finger motif region in the wrky domain of genes , while in subgroups iia and iib , the v - type intron is found within the zinc finger motif region in the wrky domain ( figure 4(b ) ) . furthermore , introns have been lost from ljwrky28 ( subgroup iie ) , ljwrky51c ( subgroup ic ) , and subgroups in and iix ( figure 4(b ) ) . intron loss can be considered as the result of intron turnover , the result of homologous recombination between an intron - containing allele and a mature mrna . with the exception of the conserved 60 amino acid residues , no functional or structural homologies were previously known from the remainder of the wrky protein sequences . analysis of the 20 motifs revealed that ljwrky motif lengths ranged from 11 to 113 and the distribution of 20 motifs in each amino acid sequence varied greatly ( table 3 and figure 5 ) . in addition , the function of the majority of ljwrky motifs could not be predicted . unexpectedly , we observed a herpes virus glycoprotein motif ( motif14 ) in ljwrky34 and ljwrky35 , which has not been reported in previous studies of wrky genes . it will be interesting to analyze the function of this motif in ljwrky genes in the future . compared with motifs of the wrky protein from arabidopsis , populus trichocarpa , and oryza sativa , we detected three conserved motifs in ljwrky genes , including leu zipper , harf , and nls motifs . subgroup iia ( ljwrky12 , ljwrky26 , ljwrky41 , and ljwrky51 ) , iib ( ljwrky5 , ljwrky10 , ljwrky22 , ljwrky23 , ljwrky36 , ljwrky70 , and ljwrky71 ) , and iie ( ljwrky28 ) genes contained a leu zipper motif ( motif7 ) . this motif is a hypothetical structure common to a new class of dna binding proteins . a harf motif ( motif16 ) was distributed in subgroup iid ( ljwrky33 , ljwrky38 , ljwrky43 , ljwrky44 , and ljwrky48 ) genes and an nls motif ( motif13 ) was observed in group i , subgroup iid , subgroup iie , and group iii ( ljwrky13 , ljwrky47 , ljwrky33 , ljwrky38 , ljwrky43 , ljwrky44 , ljwrky48 , ljwrky6 , ljwrky14 , ljwrky30 , ljwrky46 , ljwrky60 , ljwrky4 , ljwrky21 , ljwrky25 , ljwrky27 , and ljwrky53 ) genes , but their functions are not clear . previous studies have shown that wrky proteins contain a coactivator motif ( lxxll or lxlxlx . l , leucine ; x , any amino acid ) , suggesting the role of these motifs in plant immune responses [ 22 , 61 ] . in this study , we found a probable coactivator motif in group iii genes ( ljwrky4 , ljwrky16 , ljwrky25 , ljwrky27 , and ljwrky53 ) , suggesting the involvement of group iii genes in response to pathogens . in order to study the phylogenetic relationships of group iii genes , a phylogenetic tree was estimated using the wrky domain of seven species , including monocots and dicots . group iii ljwrky genes did not form a clade ; on the contrary , group iii ljwrky genes formed a clade with mtwrky genes ( figure 6 ) . this suggests that we did not find any paralogs of group iii ljwrky genes , but it suggests that group iii ljwrky genes are orthologous to mtwrky genes . paralogous relationships were observed among wrky genes in other species ( i.e. , mtwrky , atwrky , ptwrky , oswrky , and bdwrky ) . gene duplication events are considered as the most likely process to result in paralogous copies of genes . to detect whether selection pressure affected group iii ljwrky genes , ( dn / ds ) was calculated for phylogenetic nodes in paml ( table 4 and figure 7 ) . in l. japonicus and m. truncatula , the ml estimations of values for all nodes under the model m0 were < 1 ( table 4 ) , suggesting that group iii ljwrky and mtwrky genes have been under purifying selection during evolution . nevertheless , the log likelihood ratio differences between models m3 and m0 were statistically significant for all nodes tested , except nodes 1 and 2 in mtwrky ( table 4 ) . interestingly , we further analyzed the positive selection in group iii genes with models m8 and m7 . the values for all nodes were 1 under m8 . however , only one node identified one positive selection site in group iii mtwrky genes under model m8 ( table 4 ) . this result shows that group iii wrky genes in l. japonicus and m. truncatula have not undergone positive selection . wrky genes are commonly found in land plants and many wrky genes have been identified and classified in arabidopsis , oryza sativa [ 6 , 22 , 62 ] , hordeum vulgare , cucumis sativus , brachypodium distachyon , and populus trichocarpa . however , little information has been reported on wrky genes in leguminous forage crops . in 2008 , approximately 67% of the l. japonicus genome ( 472 mb ) sequences were available on public databases , representing 91.3% coverage of the gene space . in our current work , we conducted an analysis of 61 wrky genes in the l. japonicus genome . one hundred and four wrky genes were identified in p. trichocarpa , while only 55 wrky genes were discovered in c. sativus and vitis vinifera genomes , respectively ( table 2 ) . for example , the number of wrky genes was about 2x greater in p. trichocarpa ( 104 ) than in c. sativus ( 55 ) , while these two plants have an approximately equal genome size ( 458 mb and 487 mb ; table 2 ) . by analyzing the number of wrky gene groups or subgroups ( except for subgroup iix ) in each species where they have been characterized , we discovered an uneven distribution of the number of wrky genes in each group . in rice , the largest number of wrky genes ( 36 ) was found in group iii , but only four genes were found to belong to subgroup iia ( table 2 ) . in c. sativus , however , more wrky genes ( 16 ) are classified as subgroup iic and fewer wrky genes ( 4 ) are categorized in subgroup iia ( table 2 ) . although gene duplication events seem to have led to the expansion of wrky genes in the arabidopsis and oryza genomes , duplicated wrky genes were not detected in c. sativus . it is not yet clear whether gene duplication typically occurs during ljwrky gene evolution . among the 61 wrky genes , we found that , in l. japonicus , only 2 of them were involved in duplication events . in contrast , 11 gene duplication events were identified in the model plant m. truncatula . in addition , there were 42 ptwrky gene duplication events identified in the p. trichocarpa genome , with 29 out of 42 ptwrky genes arising from segmental duplication . this comparison suggests that the expansion of ljwrky genes is not necessarily dependent on gene duplication events . we found few duplicated ljwrky genes in the l. japonicus genome and there are at least three possible explanations : ( 1 ) most duplicated genes have been lost after segmental duplication events in ljwrky genes ; ( 2 ) ljwrky genes that are nonfunctional or duplicate the function of other copies are inclined to disappear to avoid fitness cost ; and ( 3 ) the draft sequenced genome in l. japonicus may not yet contain all wrky genes present in the genome . the wrky gene sequences contain two types of conserved introns ( r - type and v - type ) , and we found them in this study . in arabidopsis and c. sativus subgroup iia and iib wrky genes , r - type introns are inserted in domains located at the fourth amino acid ( k residue ) after the second c residue in the zinc finger region and there are no v - type introns . these results suggest that introns in subgroup iia and iib wrky genes may have different origins . the average length of the conserved introns ( 597 bp ) in l. japonicus wrky domains was longer than that in arabidopsis ( 241 bp ) but shorter than that in m. truncatula ( 705 bp ) . in nematodes and mammals , there is a dramatic decline in average intron size when there is increased gene expression . however , the correlation between expression of wrky genes in various plants and the intron length needs to be tested . we found an interesting phenomenon which may provide context to interpret group i , ii , and iii wrky gene origin and evolutionary relationships . two conserved motifs ( motif4 and/or motif9 ) were observed after motif1 ( contains the conserved sequence wrkygqk ) in the n - terminal region , while , in the c - terminal region , other conserved motifs ( motif5 or / and motif13 ) occur before motif1 ( figure 5 ) . in addition , analysis of group ii and iii ljwrky gene motifs revealed that most ljwrky genes contain motif1 , motif5 , and/or motif13 . however , motif1 , motif4 , and/or motif9 in the n - terminal region of group i genes are distributed in ljwrky19 , ljwrky37 , ( group ii ) and ljwrky25 and ljwrky27 ( group iii ) , respectively ( figure 5 ) . previous research showed that group ii and iii wrky genes evolved from group i through the loss of the n - terminal wrky domain [ 2 , 5 ] . however , our results indicate that some wrky genes in groups ii and iii may have originated from the n - terminal region of group i. from the phylogenetic relationship , we found that ljwrk19 and ljwrky37 ( group ii ) clustered with group in with well - supported bootstrap values , suggesting that they have a common origin or ancestry . moreover , we consider that some group iii wrky genes could have resulted from a mutation in the zinc finger motif in the n - terminal of group i genes . to confirm our inference , we analyzed the conserved motifs in mtwrky genes . the same phenomenon was detected in mtwrky genes based on analysis of location of motifs ( data not shown ) and 13 mtwrky genes might have evolved from n - terminal of group i genes . the natural selection pressure imposed by pathogens is expected to be diverse in different plants and wrky genes and nbs - lrr genes forming a fused gene may effectively resist a wide variety of pathogens . fusion genes contain the c - terminal wrky motif and a nbs - lrr ( nucleotide - binding site - leucine - rich repeat ) motif in the r gene was identified in atwrky [ 68 , 69 ] and oswrky genes . fusion gene , one gene included wrky and nbs - lrr domains and/or motifs , was not detected in l. japonicus . the majority of group iii atwrky genes under positive selection are expressed in response to various abiotic stresses . in contrast , the expression of group iii cswrky genes shows that these genes are under purifying selection and are specialized to respond as single type of stress . ling et al . showed that positive selection may have resulted in the functional divergence of duplicated genes during the expansion of group iii wrky genes in arabidopsis . similarly , our selection pressure study of group iii ljwrky and mtwrky genes found that expansion of these genes may be under purifying selection , although gene duplication events occurred within these genes . purifying selection may generate genes with conserved functions or pseudogenization in duplicated group iii mtwrky genes . therefore , we speculate that group iii ljwrky and mtwrky genes may be more conservative in their response to stress .

wrky transcription factor genes play critical roles in plant growth and development , as well as stress responses . wrky genes have been examined in various higher plants , but they have not been characterized in lotus japonicus . the recent release of the l. japonicus whole genome sequence provides an opportunity for a genome wide analysis of wrky genes in this species . in this study , we identified 61 wrky genes in the l. japonicus genome . based on the wrky protein structure , l. japonicus wrky ( ljwrky ) genes can be classified into three groups ( i iii ) . investigations of gene copy number and gene clusters indicate that only one gene duplication event occurred on chromosome 4 and no clustered genes were detected on chromosomes 3 or 6 . researchers previously believed that group ii and iii wrky domains were derived from the c - terminal wrky domain of group i. our results suggest that some wrky genes in group ii originated from the n - terminal domain of group i wrky genes . additional evidence to support this hypothesis was obtained by medicago truncatula wrky ( mtwrky ) protein motif analysis . we found that ljwrky and mtwrky group iii genes are under purifying selection , suggesting that wrky genes will become increasingly structured and functionally conserved .

You are an expert at summarizing long articles. Proceed to summarize the following text: epiploic appendagitis is an ischemic infarction of an epiploic appendage caused by torsion or spontaneous thrombosis of the central draining vein . epiploic appendagitis is self - limited without surgery , and it is imperative for clinicians to be familiar with this entity . a healthy 27-year - old man was admitted due to acute right lower quadrant abdominal pain . laboratory tests showed leukocytosis and an increased serum c - reactive protein level . computed tomography ( ct ) showed a fatty ovoid pericolonic mass measuring 12 mm in diameter , with a circumferential hyperdense ring that abutted on the ascending colon and was surrounded by ill - defined fat stranding with a hyperdense ring . the patient was given high - dose antibiotics due to the secondary inflammation involving the parietal peritoneum . epiploic appendagitis presents with an abrupt onset of focal abdominal pain and tenderness without significant guarding or rigidity ; it is an uncommon and difficult diagnosis . with awareness of this condition , however , evaluation by ct can provide an accurate diagnosis of epiploic appendagitis , distinguishing it from conditions with clinically overlapping manifestations . epiploic appendagitis is an ischemic infarction of an epiploic appendage caused by torsion or spontaneous thrombosis of the central draining vein [ 13 ] . epiploic appendagitis presents with an abrupt onset of focal abdominal pain and tenderness without significant guarding or rigidity , and it is difficult to diagnose because of the lack of pathognomonic clinical features . right - sided epiploic appendagitis is often confused with acute appendicitis or diverticulitis , whereas left - sided epiploic appendagitis can mimic sigmoid diverticulitis . in the past , diagnosis of epiploic appendagitis was often the result of an unexpected finding during an exploratory laparotomy . however , epiploic appendagitis is self - limited and needs only conservative management without excessive intervention . a healthy 27-year - old man was admitted to our hospital due to acute right lower quadrant abdominal pain . the blood pressure was 111/64 mmhg , the heart rate was 75 beats per minute and regular , the respiratory rate was 16 breaths per minute , and the temperature was 37.9c . laboratory tests showed a white blood cell count of 9000/mm ( 3900/mm to 8900/mm ) and a crp of 8.7 mg / dl ( < 0.17 mg / dl ) . the patient was treated with cefmetazole sodium ( 2 g / day ) for 2 days , but the symptoms became worse . the antimicrobial dose was increased to 4 g / day for the subsequent 3 days . an abdominal series and ultrasound of the upper abdomen were performed and interpreted as normal . on the coronal section of computed tomography ( ct ) , a fatty oval lesion measuring 12 mm in diameter with a circumferential hyperdense ring ( arrow , figure 1 ) was seen in the right lower abdomen . the transverse ct image showed that the ovoid , pericolonic mass abutted on the ascending colon and was surrounded by ill - defined fat stranding ( arrow , figure 2 ) . antibiotics were discontinued . oral loxoprofen sodium ( 60 mg ) was prescribed twice before his symptoms and signs resolved with normalization of the laboratory results . in the present case , ct images showed a fatty , ovoid , pericolonic mass with a circumferential hyperdense ring , surrounded by ill - defined fat stranding . the thin hyperdense rim is called the hyperattenuating ring sign , which represents the inflamed peritoneal covering of the epiploic appendages . the typical findings were diagnostic of primary epiploic appendagitis , which is caused by epiploic appendage torsion or spontaneous thrombosis of the draining vein resulting in vascular occlusion and focal inflammation . epiploic appendages are small , multiple , fat - filled , serosa - covered sacs , arranged in the tenia coli over the external surface . they number about 100 , and their average size is about 3 cm . their function is unknown but considered to be as follows : buffering the blood flow of the colon , a defense mechanism like the epiploon , absorption of body fluid , fat storage , and a protective cushion for the colon . their limited blood supply , together with their pedunculated shape , makes epiploic appendages prone to ischemic infarction [ 13 ] . epiploic appendagitis presents with an abrupt onset of focal abdominal pain and tenderness without significant guarding or rigidity , and it is considered an uncommon and difficult diagnosis . with increased awareness of this condition , however , evaluation by ct can provide an accurate diagnosis of epiploic appendagitis , distinguishing it from conditions with clinically overlapping manifestations such as diverticulitis , acute appendicitis , and acute cholecystitis . ultrasound coupled with awareness of this condition and/or performed by expertise can reveal epiploic appendagitis as an ovoid , non - compressible fatty mass with normal aspect of the adjacent colon which is adherent to the peritoneum during respiration . however , in this case the expertise was not available and ultrasound was performed without awareness of epiploic appendagitis , thus ultrasound could not give the diagnosis in our patient . acute appendicitis occurs due to bacterial infections inside the vermiform appendix and can lead to complications like sepsis and perforation . acute appendicitis causes fever , abdominal tenderness , and rebound tenderness , just like epiploic appendagitis [ 13,6 ] . some cases can be treated conservatively with drug therapy alone , but in an emergency , appendectomy is the standard treatment . acute cholecystitis is most often caused by gall stones , and the main symptoms are right upper abdominal tenderness , fever , nausea , vomiting , and jaundice . ct scan or ultrasonography shows gallbladder wall thickness , and murphy s sign is the typical clinical finding . it is said that diverticulitis is caused by stagnation of stool in the diverticulum , and it may rarely lead to abscess and fistula formation . when images are not typical , it is difficult to differentiate epiploic appendagitis from diverticulitis , and some cases of diverticulitis develop epiploic appendagitis when inflammation spreads to the epiploic appendages . less commonly , mesenteric panniculitis , primary tumors , and metastases to the peritoneum may be considered in the differential diagnosis . epiploic appendagitis is self - limited and needs only conservative management without excessive intervention [ 13 ] . epiploic appendagitis presents with an abrupt onset of focal abdominal pain and tenderness without significant guarding or rigidity , and it is considered an uncommon and difficult diagnosis . with awareness of this condition , however , evaluation by ct can provide an accurate diagnosis of epiploic appendagitis , distinguishing it from conditions with clinically overlapping manifestations .

summarybackgroundepiploic appendagitis is an ischemic infarction of an epiploic appendage caused by torsion or spontaneous thrombosis of the central draining vein . epiploic appendagitis is self - limited without surgery , and it is imperative for clinicians to be familiar with this entity.case reporta healthy 27-year - old man was admitted due to acute right lower quadrant abdominal pain . physical examination showed focal abdominal tenderness with slight rebound tenderness . laboratory tests showed leukocytosis and an increased serum c - reactive protein level . computed tomography ( ct ) showed a fatty ovoid pericolonic mass measuring 12 mm in diameter , with a circumferential hyperdense ring that abutted on the ascending colon and was surrounded by ill - defined fat stranding with a hyperdense ring . these findings were diagnostic of primary epiploic appendagitis . the patient was given high - dose antibiotics due to the secondary inflammation involving the parietal peritoneum.conclusionsepiploic appendagitis presents with an abrupt onset of focal abdominal pain and tenderness without significant guarding or rigidity ; it is an uncommon and difficult diagnosis . with awareness of this condition , however , evaluation by ct can provide an accurate diagnosis of epiploic appendagitis , distinguishing it from conditions with clinically overlapping manifestations .

You are an expert at summarizing long articles. Proceed to summarize the following text: we performed a prospective , nonrandomized , open - label phase 4 study in 35 centers ( australia [ 3 centers ] , austria [ 1 center ] , germany [ 9 centers ] , italy [ 6 centers ] , spain [ 1 center ] , south korea [ 4 centers ] , united kingdom [ 1 center ] , united states of america [ 7 centers ] , and thailand [ 3 centers ] ) . the enrollment period lasted from may 2009 to july 2013 ( clinicaltrials.gov identifier : nct00908596 ) . the primary objective was to assess the magnitude of potential risk of gadoxetate disodium liver imaging in patients with moderate to severe renal impairment for the development of nsf . this study was performed in compliance with international conference on harmonization good clinical practice guidelines after approval by applicable ethics committees / institutional review boards . the study population consisted of patients with moderate to severe renal impairment scheduled for gadoxetate disodium - enhanced liver mri within the approved indications and dose . participating study sites checked whether patients scheduled for a liver mri with gadoxetate disodium would potentially meet inclusion / exclusion criteria . after explaining the study details and obtaining informed consent the study was conducted in accordance with all guidelines set forth by the approving institutional review board . the cohort with severe renal impairment was defined as patients with egfr at less than 30 ml / min per 1.73 m or on dialysis before gadoxetate injection . the cohort with moderate renal impairment consisted of patients with egfr between 30 ml / min per 1.73 m and 59 ml / min per 1.73 m. however , egfr was assessed twice : once during screening / informed consent within 6 weeks before the contrast - enhanced mri ( at the local laboratory ) and a second time at baseline ( ie , 48 hours before gadoxetate disodium administration ) ( at a central laboratory ) . renal impairment cohort presenting an egfr of 59 ml / min per 1.73 m or less at screening , but greater than 59 and less than 65 ml / min/1.73 m at baseline . mild renal impairment was defined for patients with an initial egfr of 59 ml / min per 1.73 m or less at screening , but an egfr of greater than 65 ml / min per 1.73 m at baseline ( table 1 ) . classification of study cohorts all subjects received a single intravenous bolus injection of 0.025-mmol / kg ( 0.1 ml / kg ) body weight of gadoxetate disodium ( primovist / eovist / eob - primovist ; bayer healthcare ag , d-51368 leverkusen , germany ) , followed by a 20-ml saline flush in the framework of the clinically routine diagnostic workup . for patients receiving hemodialysis , investigators were asked to consider prompt hemodialysis after primovist / eovist administration to enhance the contrast agent s elimination . gadoxetate disodium is marketed in all participating countries and was purchased locally by the centers at hospital pharmacies . the primary target variable was the number of patients with moderate to severe renal impairment who developed nsf , which was based on diagnostically specific clinical and histopathological information according to girardi et al during the 2-year follow - up period . the secondary target variables included the following : ( 1 ) the number of patients in whom no biopsy was performed but who develop nsf - like symptoms based on diagnostically specific clinical information . again , the clinical findings suggestive of nsf were also summarized by the clinical score according to girardi et al ; and ( 2 ) the number and characteristics of adverse events reported in association with the administration of gadoxetate disodium . we designed the study in a way that a standardized diagnostic workup of potential nsf - related symptoms could be performed and comprehensive and reliable information could be collected under routine clinical conditions . a first blood sample to determine egfr was drawn during screening / informed consent , at maximum 6 weeks before mri and analyzed by the local laboratory . a second blood sample was drawn at baseline , that is , within 48 hours before gadoxetate disodium administration , and was analyzed by a central laboratory . after gadoxetate disodium liver imaging , the patients were followed up according to a defined standardized protocol : visits at 12 and 24 months for clinical examination as well as review of source documents and telephone contacts at 1 , 3 , 6 , and 18 months after injection . all patient contacts were performed by licensed health care professionals who had received study - specific training . all skin findings potentially suggestive of nsf were clinically and , if indicated , histopathologically assessed . this approach ensured a high likelihood of potential nsf - related clinical outcomes to be adequately captured . descriptive statistics including sample size , mean standard deviation , as well as minimum and maximum were calculated for quantitative variables . frequency counts and percentages by category were made for qualitative data . summaries are presented by renal status cohort ( mild , extended moderate , moderate , and severe renal impairment ) and overall study population . as stipulated by the fda ( letter on may 22 , 2007 for gd - dtpa and july 7 , 2008 for gadoxetate disodium ) , initially , 1000 male and female patients aged 18 years or older were planned to be enrolled . this sample size suggestion was based on 1 retrospective study of 370 patients with severe renal insufficiency who received gadodiamide . at least 400 patients with severe renal impairment ( egfr , < 30 ml / min per 1.73 m ) and 600 with moderate renal impairment ( egfr , 3059 ml / min per 1.73 m ) were targeted for enrollment . when the fda released the pharmaceutical companies manufacturing gbcas from completing their studies on june 2 , 2011 , we stopped enrollment on august 1 , 2011 but continued the 2-year follow - up for those patients already included according to the protocol . we performed a prospective , nonrandomized , open - label phase 4 study in 35 centers ( australia [ 3 centers ] , austria [ 1 center ] , germany [ 9 centers ] , italy [ 6 centers ] , spain [ 1 center ] , south korea [ 4 centers ] , united kingdom [ 1 center ] , united states of america [ 7 centers ] , and thailand [ 3 centers ] ) . the enrollment period lasted from may 2009 to july 2013 ( clinicaltrials.gov identifier : nct00908596 ) . the primary objective was to assess the magnitude of potential risk of gadoxetate disodium liver imaging in patients with moderate to severe renal impairment for the development of nsf . this study was performed in compliance with international conference on harmonization good clinical practice guidelines after approval by applicable ethics committees / institutional review boards . the study population consisted of patients with moderate to severe renal impairment scheduled for gadoxetate disodium - enhanced liver mri within the approved indications and dose . participating study sites checked whether patients scheduled for a liver mri with gadoxetate disodium would potentially meet inclusion / exclusion criteria . after explaining the study details and obtaining informed consent the study was conducted in accordance with all guidelines set forth by the approving institutional review board . the cohort with severe renal impairment was defined as patients with egfr at less than 30 ml / min per 1.73 m or on dialysis before gadoxetate injection . renal impairment consisted of patients with egfr between 30 ml / min per 1.73 m and 59 ml / min per 1.73 m. however , egfr was assessed twice : once during screening / informed consent within 6 weeks before the contrast - enhanced mri ( at the local laboratory ) and a second time at baseline ( ie , 48 hours before gadoxetate disodium administration ) ( at a central laboratory ) . renal impairment cohort presenting an egfr of 59 ml / min per 1.73 m or less at screening , but greater than 59 and less than 65 ml / min/1.73 m at baseline . mild renal impairment was defined for patients with an initial egfr of 59 ml / min per 1.73 m or less at screening , but an egfr of greater than 65 ml / min per 1.73 m at baseline ( table 1 ) . all subjects received a single intravenous bolus injection of 0.025-mmol / kg ( 0.1 ml / kg ) body weight of gadoxetate disodium ( primovist / eovist / eob - primovist ; bayer healthcare ag , d-51368 leverkusen , germany ) , followed by a 20-ml saline flush in the framework of the clinically routine diagnostic workup . for patients receiving hemodialysis , investigators were asked to consider prompt hemodialysis after primovist / eovist administration to enhance the contrast agent s elimination . gadoxetate disodium is marketed in all participating countries and was purchased locally by the centers at hospital pharmacies . the primary target variable was the number of patients with moderate to severe renal impairment who developed nsf , which was based on diagnostically specific clinical and histopathological information according to girardi et al during the 2-year follow - up period . the secondary target variables included the following : ( 1 ) the number of patients in whom no biopsy was performed but who develop nsf - like symptoms based on diagnostically specific clinical information . again , the clinical findings suggestive of nsf were also summarized by the clinical score according to girardi et al ; and ( 2 ) the number and characteristics of adverse events reported in association with the administration of gadoxetate disodium . we designed the study in a way that a standardized diagnostic workup of potential nsf - related symptoms could be performed and comprehensive and reliable information could be collected under routine clinical conditions . a first blood sample to determine egfr was drawn during screening / informed consent , at maximum 6 weeks before mri and analyzed by the local laboratory . a second blood sample was drawn at baseline , that is , within 48 hours before gadoxetate disodium administration , and was analyzed by a central laboratory . after gadoxetate disodium liver imaging , the patients were followed up according to a defined standardized protocol : visits at 12 and 24 months for clinical examination as well as review of source documents and telephone contacts at 1 , 3 , 6 , and 18 months after injection . all patient contacts were performed by licensed health care professionals who had received study - specific training . all skin findings potentially suggestive of nsf were clinically and , if indicated , histopathologically assessed . this approach ensured a high likelihood of potential nsf - related clinical outcomes to be adequately captured . descriptive statistics including sample size , mean standard deviation , as well as minimum and maximum were calculated for quantitative variables . frequency counts and percentages by category were made for qualitative data . summaries are presented by renal status cohort ( mild , extended moderate , moderate , and severe renal impairment ) and overall study population . as stipulated by the fda ( letter on may 22 , 2007 for gd - dtpa and july 7 , 2008 for gadoxetate disodium ) , initially , 1000 male and female patients aged 18 years or older were planned to be enrolled . this sample size suggestion was based on 1 retrospective study of 370 patients with severe renal insufficiency who received gadodiamide . at least 400 patients with severe renal impairment ( egfr , < 30 ml / min per 1.73 m ) and 600 with moderate renal impairment ( egfr , 3059 ml / min per 1.73 m ) were targeted for enrollment . when the fda released the pharmaceutical companies manufacturing gbcas from completing their studies on june 2 , 2011 , we stopped enrollment on august 1 , 2011 but continued the 2-year follow - up for those patients already included according to the protocol . three - hundred fifty - seven patients completed the mri examination and were included in the analysis set : 85 with severe , 193 with moderate , 32 with extended moderate , and 47 with mild renal impairment ( table 2 ) . demographic and baseline characteristics by degree of renal impairment ( full - analysis set ) the mean age ranged from 58 years in the severe dialysis - dependent renal impairment cohort to 65 to 66 years in the other cohorts ( overall range , 2492 years ) . the majority of patients were men , ranging from 57% in the mild renal impairment cohort to 78% in the extended moderate renal impairment cohort . the majority of patients in the moderately severe and severe dialysis dependent renal impairment cohorts were white ( 52% to 87% ) , whereas the majority of patients in the mild and extended moderate renal impairment cohorts were asian ( 57% and 50% , respectively ; table 2 ) . the time period since diagnosis of renal disease increased with severity of renal impairment , ranging from 0.54 years in the mild renal impairment cohort to 5.46 years in the severe renal impairment cohort ( overall range , < 0.129.5 years ) . hypertension and diabetes were the most frequently reported causes of renal disease , 49.4% and 38.8% , respectively . a total of 39 patients ( 10.9% ) were dependent on dialysis and were thus assigned to the severe renal impairment cohort . vascular injuries were reported by 35 patients ( 41% ) in the severe renal impairment cohort and by 50 patients ( 26% ) in the moderate cohort . a total of 30 patients ( 8.4% ) had a history of organ transplant surgery ( table 3 ) . history of renal disease by degree of renal impairment ( fas ) liver cirrhosis was recorded for 129 patients ( 36% ) . benign and malignant liver lesions were recorded for 77 ( 22% ) and 113 patients ( 32% ) , respectively ( table 4 ) . history of liver disease requiring mri by degree of renal impairment ( fas ) overall , 101 patients ( 28% ) underwent contrast - enhanced mri with another gbca within 12 months before the start of the study or in the follow - up . thirty - one patients ( 8.7% ) were exposed to a gbca before the start of the study and 82 patients ( 23.0% ) received additional gbcas during follow - up , that is , after gadoxetate disodium administration at baseline . the number of gbca administrations ranged from 1 for most patients ( 51 patients , 14% ) to more than 5 ( 10 patients , 3% ) . of the 10 patients with more than 5 injections , 9 had moderate renal impairment and 1 had severe renal impairment ( table 5 ) . patients with and number of gbca injections from 12 months before start of the study ( gadoxetate disodium administration ) and during follow - up ( fas ) three patients experienced drug - related adverse events ( aes ) immediately after gadoxetate disodium administration and before leaving the mri facility : generalized pruritus and respiratory distress were reported in 1 subject , and pruritus and vomiting were reported in 2 subjects . ae reporting was limited to skin - related findings and other findings suggestive of nsf . nineteen ( 9.8% ) and 7 ( 8.2% ) patients reported skin - related findings in the moderate ( n = 193 ) and severe ( n = 85 ) renal impairment cohort , respectively . of these patients , 3 had a clinical nsf score according to the study of girardi et al of higher than 0 . one subject in the severe renal impairment cohort was diagnosed with basal cell carcinoma , which was considered as not drug - related . the patients in the extended moderate cohort had no skin - related findings at all . there were 3 patients with a clinical score of higher than 0 owing to skin - related findings . one dialysis - dependent patient in the severe renal impairment cohort experienced a mild extremity contracture 5 days after the administration of gadoxetate disodium . this event fulfilled one of the major clinical criteria for nsf and was therefore given a clinical score of 3 ( ie , clinically consistent with nsf ) . because no skin findings suggestive of nsf ( eg , patterned plaques , cobblestoning , marked induration / peau dorange , superficial patches / plaques , dermal papules ) were detected , a skin biopsy was not indicated . one patient with severe renal impairment had had a skin rash 3 months after administration of gadoxetate disodium , and 1 patient with moderate renal impairment developed a macule on the right calf 6 months after administration of gadoxetate disodium . both of these patients were given a clinical score of 1 ( ie , inconsistent with nsf ) . the frequency of deaths during the follow - up period was related to the severity of renal impairment , with 15.6% , 29.5% , and 37.6% of patients in the cohorts with extended moderate , moderate , and severe renal impairment , respectively . after an fda request , dated july 2008 , we performed a prospective , nonrandomized multicenter study in 357 patients with various degrees of renal impairment . after 2 years of follow - up , no case of nsf was detected . to the best of our knowledge , this is the first time that such prospective data on gadoxetate disodium have been published . one study by amet et al investigated 268 patients on dialysis undergoing contrast - enhanced mri mainly with gadoteric acid . another study by smorodinsky et al retrospectively looked at 1167 patients with chronic liver disease ; thereof , 72% had also some degree of renal insufficiency . the gbcas applied were gadobenate dimeglumine , gadoversetamide , and gadopentetate dimeglumine . none of their patients developed nsf . we stopped this study prematurely after inclusion of roughly one third of our target following the fda s decision to release manufactures of gbcas from completing enrollment ( letter from june 2 , 2011 ) . at this time , the fda concluded that the nsf incidence estimate based on postmarketing surveillance reports was lower than the original literature - based estimate . as a consequence , the predefined sample size became inadequate to address the study s objective . in addition , the enrollment quota became unrealistic , owing to new labeling ( fda s black - box warning for application in patients with chronic , severe kidney disease ) and changes in clinical practice . therefore , enrollment was prematurely stopped in december 2011 , but follow - up was continued for 2 years as defined in the protocol . a total of 85 patients had severe and 193 had moderate renal impairment , which was the target population requested by the fda . in several patients , the 2 egfr determinations ( 1 at screening and 1 immediately before the mri / baseline ) resulted in different patient classifications on the basis of the cutoff values for mild , moderate , or severe renal impairment ; that is , patients who originally fulfilled the criterion for moderate renal impairment at the time of screening actually showed improved renal function at the time of contrast injection . to reflect a kind of worst - case scenario , we subsumed those patients still in the category moderate , which also allowed us to perform the 2-year follow - up ; however , to be fully transparent , we defined a subgroup of the so - called extended moderate ( screening , 59 ml / min ; baseline , > 59 and 65 ml / min ) . for the patients in the mild renal disease group , an elevated nsf risk has not been established , so follow - up was waived according to protocol . one important aspect is that many patients in our study population did not receive only gadoxetate disodium . a total of 101 patients ( 28% ) received other , additional gbca administrations before the study or during follow - up . although this does confound our primary study objective , we included all these patients in our analysis . taking the most conservative approach , we report the full - analysis data set that includes all patients who have got at least 1 dose of gadoxetate disodium and disregarded the per - protocol set , which would be cleaned for those protocol violators . thus , we are confident that our study population reflects the clinical reality of this particular patient group . in addition , because the number and dose of gbca administrations may impact the likelihood of nsf development , it might be reassuring that , even in these cases , no nsf has been detected . we think that our study provides sufficiently detailed data on medical history , showing that most patients had renal disease caused by hypertension or diabetes , which are both very common in the modern western world . the most frequent reasons for liver imaging were liver cirrhosis ( 36% ) and malignant liver tumors ( 32% ) , which are the 2 most relevant diagnoses for liver imaging . interestingly , a study by gschwend et al showed that , in humans with moderate renal impairment and mild - to - moderate hepatic impairment , no relevant changes were observed in pharmacokinetic parameters . this was considered a result of increased renal excretion to compensate in cases of hepatic impairment , or increased hepatic elimination in cases of renal impairment . gschwend et al concluded that there is no need for dose adjustment of gadoxetate disodium . today , gadoxetate disodium is used in more than 50 countries worldwide , including the extended european union , switzerland , australia , the united states , canada , japan , and china . since its introduction to the market in 2004 , until may 14 , 2014 , the cumulative patient exposure is estimated to be more than 2.2 million patients ( nsf annual surveillance report , data on file ) . no case of nsf has been reported to any regulatory authority in any country where gadoxetate disodium is marketed ( evidence level c , derived from registries ) . however , it is reasonable to assume that only a nonspecified minority of these patients was in the high - risk group for nsf , that is , in the group with moderate to severe renal impairment as our study cohort . neither drug - related aes nor clinically significant changes in any of the safety variables ( laboratory values , vital signs , electrocardiograms , cardiac rhythm , oxygen saturation , findings on physical examination ) were found during the study . mean serum creatinine values were stable throughout the study , except for dialysis - dependent changes . finally , it is important to note that the fda and the european medicines agency have defined risk categories for gbcas . in addition , the european society of urogenital radiology followed those categories in their recommendation . certain linear molecules have been identified as gbcas with the highest risk potential for nsf . in addition , european medicines agency and the european society of urogenital radiology defined a subclass , linear ionic agents . the gbcas of this intermediate risk group should be used with caution in patients with chronic kidney disease stages 4 and 5 ( gfr , < 30 ml / min per 1.73 m ) , and there should be at least 7 days between injections . use in pregnant women should only be considered in case essential information is expected . however , laboratory testing of renal function ( egfr ) is not mandatory . in the united states , however , the fda has mandated a new boxed warning on the product labelling of all gbcas . as previously mentioned already even with an nsf incidence of 0.1% to 1% for gd - dtpa in the at - risk population as mentioned by thomsen et al , a confirmative study might hardly be possible . another limitation may be related to the fact that some patients also received other gd - based contrast agents before the study or even during follow - up . however , none of these patients developed signs of nsf . in addition , all patients received the approved standard dose of 0.025-mmol / kg body weight . a number of institutions , however , routinely administer a dose of 10 ml in all patients instead of weight - based dosing . finally , it is unclear whether the medical background of the cohort with severe renal impairment matches the medical background of the group of gbca - induced nsf cases worldwide because this kind of analysis is , to our knowledge , not published yet . as triggered by the fda request , a number of similar studies with other gbcas have been initiated . we hope that , when all studies have been evaluated , a better assessment on the impact of gbca administration on nsf development might be possible . gadoxetate disodium in patients with moderate to severe renal impairment did not raise any clinically significant safety concern .

objectivethe objective of this study was to assess the risk of gadoxetate disodium in liver imaging for the development of nephrogenic systemic fibrosis ( nsf ) in patients with moderate to severe renal impairment.materials and methodswe performed a prospective , multicenter , nonrandomized , open - label phase 4 study in 35 centers from may 2009 to july 2013 . the study population consisted of patients with moderate to severe renal impairment scheduled for liver imaging with gadoxetate disodium . all patients received a single intravenous bolus injection of 0.025-mmol / kg body weight of liver - specific gadoxetate disodium . the primary target variable was the number of patients who develop nsf within a 2-year follow - up period.resultsa total of 357 patients were included , with 85 patients with severe and 193 patients with moderate renal impairment , which were the clinically most relevant groups . the mean time period from diagnosis of renal disease to liver magnetic resonance imaging ( mri ) was 1.53 and 5.46 years in the moderate and severe renal impairment cohort , respectively . overall , 101 patients ( 28% ) underwent additional contrast - enhanced mri with other gadolinium - based mri contrast agents within 12 months before the start of the study or in the follow - up . no patient developed symptoms conclusive of nsf within the 2-year follow-up.conclusionsgadoxetate disodium in patients with moderate to severe renal impairment did not raise any clinically significant safety concern . no nsf cases were observed .

You are an expert at summarizing long articles. Proceed to summarize the following text: body fluids are widely used in laboratory diagnosis . however , the process of obtaining them for research is accompanied by certain difficulties ( the introduction in the internal environment of the organism , tissue damage , compliance with special temporary algorithms which are not always physiological ) . in recent years , the first steps were taken in the study of manifestations of various diseases on the structural organization of biological fluids [ 37 ] . the structures of the investigated fluids are obtained via the phasic transfer from liquid to solid state through dehydration . the results of experimental studies demonstrated that the information contained in the liquid phase at the molecular level in the dehydrating process is transferred at macroscopic level having different structures that become visible to the researcher . the research of the self - organization processes of various physiological and pathological liquid media elucidated the primary importance of the organic components present in biological fluids even in a small amount ( from 0.01 microns to 100 the structures separation into organic and inorganic compounds is carried out by the dehydration method , by applying the biological liquid onto a transparent surface in the form of drops , and then dehydrated under specific conditions . the volume of the droplet is determined by the ratio of the specific gravity of the liquid and its surface tension forces . according to theoretical concepts in biological fluid dehydration , specific mechanisms interact , the term facies refers to what is left from a drop of saliva , after drying out . a graphical representation of the action of these mechanisms provides the scheme of the biological liquid droplet ( located on a horizontal plane ) in sagittal section , developed by tarasevici and aiupova ( 2003 ) ( fig . the authors noted that the evaporation of the liquid does not occur uniformly over the entire open area of the droplet . due to the fact that the hemisphere has a different thickness in the central area as opposed to the peripheral area , the evaporation of the analyzed water droplet , the concentration of the dissolved substance changes non - uniformly , thus particularly in the peripheral area ( which is of reduced thickness ) is increased more rapidly than in the central zone ( maximum thickness ) of the droplet . in such processes because the power of osmotic forces considerably exceeds the oncotic ones , the salts migrate to the centre of the droplet , to the low concentration of dissolved substances . in the central area , the proteins and other dissolved substances with high molecular weight yield water and are shifted to the periphery of the droplet . as a result , the marginal amorphous zone of the dehydrated droplet , is presented by structures of organic origin , while the central crystallized one by salts . thus , a shift of unstable structures is produced , rather dynamically at the molecular level in stable macrostructures of solid phase . according to the research of annarelli et al . ( 2001 ) , the central zone is called the crystallized structures zone , and the peripheral one - amorphous area . peripheral width area ratio of the diameter of the droplet is used for the determination of protein contents in biological fluids . therefore , taking into account the concept of classical crystallography , the early diagnosis of dental and systemic diseases , the method of crystallographic research of one of the most accessible biological liquid , i.e. oral liquid , was proposed . oral liquid is a very well organized specific biological environment , with unique , universal properties is a dynamic environment , reflecting any changes in the body , including pathological processes . over the past decades , the first steps in studying the manifestations of various diseases in the structural organization of the oral liquid have been made [ 1316 ] . the first investigations of crystalograms have revealed that after oral liquid droplets dehydration on the glass slide a sediment remains , its microcrystalline structure is dependent on the state of health of the oral cavity and the entire body . the results of the study of outlined microcrystalization types characterize the ability of the saliva remineralization . the optical properties of the crystals vary significantly depending on exo- and endogenous factors , this phenomenon being applied in the research , for diagnostic purposes . the morphological image blurring or changing oral liquid is an indicator of qualitative and quantitative disorders of salivary proteins , mucins , being one of the earliest markers of pathological processes that occur in the body and can be used to detect diseases at the premorbid stage and to apply efficiently the preventive measures and minimally invasive treatment . the structural features of microcrystalograms ( mcg ) are determined by the balance of organic mineral components and physicochemical properties of oral liquid . the use of oral liquid in the health study can be justified by many arguments : physicochemical properties of the oral liquid can be used as a marker for pathological changes not only in the salivary glands and oral cavity , but also in other organs and systems of human body [ 4,5,8,11,1721 ] . oral liquid composition reflects the psycho - emotional state , the intensity of metabolism , severity of inflammatory processes , structural and functional properties of enamel and its resistance to caries attack . a disorder in the contents of saliva and salivary secretion rate was noted in case of cardiovascular diseases . changing the shape of the crystals is a consequence of the modification of the physicochemical properties of saliva . changes in the composition of the saliva can be related not only to the presence of inflammatory processes and diseases ( acute and chronic ) , but also to the administration of drugs .structural peculiarities studies of oral liquid in the health study is promising due to the invasive method for obtaining biological material and simple application.the research method of oral fluid crytalogenesis by dehydration obtaining microcrystalograms ( mcg ) does not disturb the contents of the test sample and provides an overview of the state of the whole body . physicochemical properties of the oral liquid can be used as a marker for pathological changes not only in the salivary glands and oral cavity , but also in other organs and systems of human body [ 4,5,8,11,1721 ] . oral liquid composition reflects the psycho - emotional state , the intensity of metabolism , severity of inflammatory processes , structural and functional properties of enamel and its resistance to caries attack . a disorder in the contents of saliva and salivary secretion rate was noted in case of cardiovascular diseases . changing the shape of the crystals is a consequence of the modification of the physicochemical properties of saliva . changes in the composition of the saliva can be related not only to the presence of inflammatory processes and diseases ( acute and chronic ) , but also to the administration of drugs . structural peculiarities studies of oral liquid in the health study is promising due to the invasive method for obtaining biological material and simple application . the research method of oral fluid crytalogenesis by dehydration obtaining microcrystalograms ( mcg ) does not disturb the contents of the test sample and provides an overview of the state of the whole body . thus , the main advantages of oral fluid microcrystalograms oral liquid mcg are non - invasiveness , simplicity of implementation and availability of substrate sampling study providing new insights into clinical trials . therefore , the study of crytalogenesis oral fluid dynamics is up to date to produce precise quantitative assessment parameters of fractal structures and further standardization of analysis process of oral liquid mcg . the purpose of the paper consisted in the study of the oral liquid microcrystalization peculiarities in children with gerd . to achieve the objective 54 children were clinically examined : 27 ( 50% ) children with gerd were the research group and 27 ( 50% ) healthy children control group . selecting children s groups was randomly , the groups had the same age and sex . the two groups were matched regarding gender , age , residence environment and social - economic conditions . we performed the clinical examination of the patients , including the assessment of the dental caries prevalence by estimating the dmft index . the assessment of the erosive wear was performed on the palatine / lingual sides , on the vestibular and incisal / occlusal sides , noting down a single value for each sextant , corresponding to the dental side having the greatest erosion degree . the final score of the bewe index was obtained by adding up the values of all sextants based on which the erosive wear was calculated . in addition , we assessed the enamel resistance to acids , using the enamel resistance test following the method proposed by okushko , 2011 , the ph of saliva , salivary flow rate , the buffering capacity of saliva and the remineralization potential of saliva , assessed by estimating the remineralization speed of saliva using the method elaborated by leontiev et al . 2007 . in this study , we performed a comparative analysis of the crystallographic modifications of the of in children with and without decay according to the method developed by shatohina et al , 2006 . oral liquid was collected with a sterile pipette in the amount of 0.2 to 0.3 ml of the oral cavity floor . then , on a glass slide , pre - treated with alcohol and ether , three drops of oral liquid were applied . the dehydration of the of product drops was produced into the unit at t=37c , protected from dust . micropreparations were examined under scanning electron microscope vega ts 5130 mm tescan . using mcg and oral liquid research methods the central and peripheral areas of oral liquid facies were investigated . interpretation of crystaloscopic components was achieved by applying special tables with notification of characteristics of the studied structures . to quantify microcrystals , an algorithm was developed for the analysis of gcm , according to which the micropreparate is examined to highlight the facies layers and determine the base . for a description of the crystal the following parameters are estimated : length , width and degree of curvature of the main branch , main branch ratio of the width at the base and tip microcrystal report microcrystal surface perimeter and the frequency and angle of deviation degree dendrites , symmetrical ramifications of the dendrites degree from the mainline ( fig . 2 ) . further on , the integrity mainline trunk and connection area with the first degree dendrites , dendritic tip shape ( conical , oval or divided ) was investigated . the organic inclusions were also assessed : the proportion of surface organic inclusions and field of view ; the organic inclusions location ( on the periphery in the central area or the entire area of the field of view ) ; crystal report ( membership or isolation ) . the evaluation of mcg was performed after dried droplets examination by oral liquid , the results being expressed as the mean points depending on the types identified by the formation of crystals : 0.01.0 - at a very low extent , 1.12.0 - low , from 2.1 to 3.0 - satisfactory 3.14.0 - high , 4.1 to 5.0 - very high degree of microcrystallization . the risk of deviations of microcrystallization ( rdm ) was calculated according to the formula rdm = ( rr1)/rr 100 , rr relative risk . the study was approved by the local ethics committee and was conducted in accordance with ethical requirements , and with the written consent of the children s parents or their legal representatives . data analysis was performed using microsoft excel 2013 i ibm spss statistics 22.0 software using the functions and modules of these programs . the study was approved by the local ethics committee and was conducted in accordance with ethical requirements , and with the written consent of the children s parents or their legal representatives . data analysis was performed using microsoft excel 2013 i ibm spss statistics 22.0 software using the functions and modules of these programs . at the initial clinical examination , performed in 27 children with gerd , dental decay was detected in 77.78% of them , the incidence of the dmft index being 2.740.33 . dental erosion was detected in 59.26% of the total number of children , and the incidence of erosive wear was 3.960.7 . the average risk of erosive wear was detected in 6 ( 22.22% ) children , and the reduced risk , respectively - at 7 ( 25.93% ) children , depending on the duration of gerd . affection by dental decay and the presence of dental erosion were found in 37.04% of the children suffering from gerd . the frequency of the dental decay in healthy children represented 55.56% , the incidence of the dmft index is 1.260.14 . further on , in the study , we examined the central and peripheral areas of the facies obtained by dehydration of the of droplets . the outcome of the investigation specified the main types of oral liquid microcrystallization ( mc ) . mc type i was assessed by 5 points . fused random fractal structures are characteristic of type ii mc , gaining 4 points ( fig . in the central part star - shaped separated crystals were present , and remained at the periphery of larger fractal crystals ( 3 points ) ( fig . 5 ) . mc type iv was characterized by the presence of the separated crystals in the form of a branch or stem , placed relatively evenly over the whole surface of the dried droplet ( 2 points ) ( fig . a large amount of separated stellate crystals of an oval and irregular shape located isometrically was characteristic of type v mc ( 1 point ) ( fig . we found mc type i and ii in children with high resistance to caries , and in those with increased intensity of dental caries - types iv vi mc prevailed . for children with gerd and dental erosions , the types iv v mc were specific , while for children without any erosions and low risk of erosive wear we found types ii , we examined not only the fractal structures , separate crystals , but also the amorphous substance . the analysis of mcg established that in the peripheral area of the oral liquid droplet pyramidal cruciform structures predominated , in the central part linear structures were present , with a dendritic image in the form of fern , amorphous bodies were of a reduced size and crystals of large size accumulation on the surface . in the peripheral area of the oral liquid in healthy children crusade and prismatic structure prevailed . in patients with gerd affected by dental caries and those with low risk of erosive wear the crystals structure was disturbed considerably over the entire surface of the facia where crusader crystals of different sizes were present . in children suffering from gerd and carious lesions and those with low risk of erosive wear , the structure of the crystals was considerably disturbed , with different sizes of crusade crystals present on the entire surface of the facia . the peripheral area of the oral liquid facies was expanded and prominent , evidencing an abundance of elements that deteriorated the integrity of the structure ( fig . 8) , which might have been caused by the high concentration of mucin in the saliva . oral liquid mcg in children with complicated caries , as well as in children with dental erosions , are marked by the highlighted , expanded and cracked character of the peripheral zone ( fig . 9 ) as well as the presence of crystalline structures of fern located both in the peripheral and central zones . highlighted , expanded and cracked character of the peripheral area reflects increased protein contents and conduct oral fluid pathological processes caused by free radicals . it was found that in 96.29% of children from the control group and 7.41% of children with gerd the central area of the oral liquid mcg consisted mainly of dendritic crystals , but in the peripheral area additional inclusions were not found . in 3.7% of children in the control group and 92.59% of children in the study group a number of morphological features in the peripheral facies of oral fluid were established : pathological mineral compounds crystallization in the protein surroundings , manifested by the presence of crystalline inclusions , which were detected in the peripheral zone of the oral fluid facia;presence of the radial cracks network , which in clinical crystallography is considered a marker of tissue destruction processes ( fig . 10 ) , detected in children with untreated dental caries or tooth decay complications;presence of pigmentation portions ( marker of intoxication ) , which may be associated with the phenomenon of pathological crystallization of salts in the protein surroundings , were detected in children with carious activity , intensely untreated caries or tooth decay complications . pathological mineral compounds crystallization in the protein surroundings , manifested by the presence of crystalline inclusions , which were detected in the peripheral zone of the oral fluid facia ; presence of the radial cracks network , which in clinical crystallography is considered a marker of tissue destruction processes ( fig . 10 ) , detected in children with untreated dental caries or tooth decay complications ; presence of pigmentation portions ( marker of intoxication ) , which may be associated with the phenomenon of pathological crystallization of salts in the protein surroundings , were detected in children with carious activity , intensely untreated caries or tooth decay complications . next , we compared the specificities of mcg oral fluid in healthy children and those with gerd . thus , in the majority of children with gerd a pathological crystallization of mineral compounds in the protein surroundings was found . it was assumed that this marker characterizes the crystals ability to connect microorganisms and products of their activity in crystalline aggregates with organic inclusions . in children with carious intense activity , untreated caries lesions and / or dental caries complications , and in chronic persistent infection odontogenic outbreaks , the marker intoxication and / or tissue damage was found . it was found that the degree of mc of the oral liquid in children with gerd was considerably reduced , constituting 1.730.11 points , and was 1.86 times lower compared to the indicator considered in control children ( 3.220.16 points ) ( p<0.01 , rr=2 ) . among children in the study group there was a tendency to reduce the degree of mc damage correlated to the duration of gerd . thus , in children with gerd duration up to 1 year , the level of the mc of oral liquid was 0.9 times lower ( p<0.05 , rr = 1.9 ) , duration of illness in children between 1 to 2 years - 1.36 times ( p<0.01 , rr = 2.4 ) , and duration of illness in children between 23 years - 2.1 times lower as compared with the estimated values in children from the control group ( p<0.05 , rr = 3.8 ) . the analysis of the picture of dehydrated oral fluid droplet elucidated the relationship between the degree of the oral liquid and work mc caries process . children with carious activity had mc moderate degree of the oral liquid 1.9 times ( p<0.05 , rr=2.1 ) and in children with intense carious activity - 2.3 times lower compared with controls ( p<0.01 , rr=2.6 ) . the research results allow to conclude that the degree of oral liquid microcrystallization in children is directly related to the duration of impaired dental caries ( r=0.647 ) and degree of carious activity ( r=0.248 ) . it is well known that saliva is a supersaturated liquid with calcium and phosphate ions and possesses the ability of enamel mineralization . the saturated liquid state is provided by its structure , its entire volume being distributed among the micelles . under physiological conditions , saliva crystals have a branched form due to the presence in the oral liquid of micelles ca3(po4)2 , protected by the aggregation of mucin , which has a branched form . mucins are involved in the transport of transepithelial ions ( na+ , k+ , cl ) , and in the process of biocrystalization involving ions ca2 + , constituting the organic matrix which regulates the volume and configuration of the crystal structure and the formation of crystalline structures in dendritic drying oral liquid . the optical properties of the crystals vary significantly depending on exo- and endogenous factors , this phenomenon being applied in research , for diagnostic purposes . under unfavourable changes , in the oral cavity the structure of saliva modifies , thereby its mineralization function is disturbed followed by changes in the shape and properties of the crystal structure [ 2628 ] . thus , the morphological image changes of the oral liquid due to its microcrystallization properties is an index of qualitative or quantitative disorders of salivary proteins , in particular the mucins , and is one of the earliest markers of pathological processes occurring in the organism and may be used to detect diseases in the premorbid phase , to efficiently implement the preventive and minimally invasive treatment . therefore , the oral liquid microcrystallization disorder reflects the quantitative and qualitative disorders of mucins composition , which represents an increased risk of carious lesions . setting the hallmarks of crystallographic changes in saliva which are influenced by functional and metabolic changes increases accuracy of diagnosis and efficiency of caries risk prediction . dehydration method ( crystallization of bioliquids on the glass slide ) can provide an overview of the health of the entire body . changing the shape of the crystals is a consequence of changes of the physicochemical properties of saliva . the demineralization of dental enamel in carious process reflects the properties of the saliva , and is manifested by changing crystal structures of the oral liquid mcg . the microcrystallization degree of the oral liquid in children is directly correlated with the gerd duration and activity of carious process . thus , the study of morphological features of the oral liquid may serve as a predictive test that identifies impaired oral cavity protection mechanisms . the knowledge of the mechanisms of these changes is required for the cariopreventive measures targeted on individual risk factors , while the availability of the oral liquid research , the research methodology simplicity , and the minimum costs allow its application in the dental practice . the research method of oral liquid crystalogenesis may be applied not only in the diagnosis and prediction of diseases of the oral cavity , but it can also be used as a sensitive indicator of the operational status of the entire body . the development of a highly informative and noninvasive methodology of premorbid conditions diagnosis and the pre - research of methods for the appropriate diagnosis of the changes occurred in the health of the population represent the most important fields of research in medicine . the research of the oral liquid microcrystallization is a simple , non - invasive and informative method of investigation that can be applied to assess the functioning not only of the dental apparatus , but also as an indicator of the functioning of the whole organism . the degree of the oral liquid microcrystallization in children with gerd is 1.86 times lower than this indicator assessed in healthy children . a low level of oral liquid microcrystallization involvement correlates with the duration of gerd and carious activity process . the study of structural features of oral liquid dehydrated droplet in children with dental caries has elucidated a number of markers of the changes produced in the oral cavity , which can be later applied in screening studies in dental practice . the applied method of oral liquid microcrystallization offers the opportunity to study the most important pathogenic mechanisms involved in the initiation and development of dental caries and their complications , to perform dental caries prediction in order to elaborate cariopreventive measures and evaluation of their effectiveness .

background and aim.patients with disabilities have a higher prevalence of caries and dental erosions than general population . this particularity may be assessed by the study of microcrystallization of saliva . we investigated the oral liquid microcrystallization in children with gastroesophageal reflux disease ( gerd ) , a condition associated with dental erosions.material and methods.54 children have been clinically examined : 27 children suffering from gerd with ages between 13 and 15 , were included in the study group , and 27 healthy children - the control group . the study of crystallographic changes of the oral liquid was performed using the method developed by shatohina , razumov sn , shabalin vn ( 2006 ) with the scanning electron microscope vega tescan ts 5130 mm.resultsthe degree of microcrystalization of the oral liquid in children with gerd was considerably reduced , ( 1.730.11 points ) and was lower than in children in the control group ( 3.220.16 points ) ( p<0.01 , rr=2 ) . the degree of microcrystallization of oral liquid in children with gerd was 1.86 times lower than in healthy children . this was correlated with the duration of gastroesophageal reflux.conclusionthe study of structural particularities of dehydrated droplet of oral liquid in children with gerd has elucidated a number of markers of the changes produced in the oral cavity . these can be used in the screening research in prevention of caries and dental erosions .

You are an expert at summarizing long articles. Proceed to summarize the following text: classifying and managing dcis has always been a thorny issue , often dividing various groups of pathologists around the world . amongst dcis features , the architectural pattern , its prognostic value , and role in grading dcis the current literature on the subject accepts the existence of 3 major architectural patterns of dcis , namely , the solid , cribriform , and micropapillary patterns . it has been variably considered as an early micropapillary dcis or even a subvariant of the atypical ductal hyperplasia . other special types of dcis , such as the apocrine , the endocrine ( argyrophilic ) , and signet ring dcis , are all defined on histological criteria , rather than architectural pattern and they actually belong to the solid pattern of growth . with respect to grading , it is universally accepted that the nuclear grade is the essential feature , recurring in all classification systems previously proposed and currently in use . an association , albeit inconsistent , exists between the nuclear grade and the architectural growth pattern . it is generally accepted that most micropapillary and cribriform in situ carcinomas are of low nuclear grade and relatively indolent . however , in a recent publication by fisher and colleagues , micropapillary dcis was found to be associated with both ipsilateral and contralateral recurrence of malignancy in a statistically significant number of cases . as this result appears somewhat puzzling in the light of our present knowledge and understanding of dcis , we decided to have a new , fresh look at all cases of dcis reported during the past approximately 10 years at the department of pathology of the royal darwin hospital , nt , australia and report our findings . all cases of dcis reported at the royal darwin hospital , northern territory , australia between january 2001 and september 2010 , representing 60% of all breast cancers in the nt were retrospectively reviewed . in order to capture all the cases , including those that may have been incorrectly coded , we verified all breast tissue reports and then selected for active review all cases of dcis . the architectural and cytological aspects of dcis were assessed . the presence or absence of necrosis the 3 main types of dcis , according to the architectural growth pattern ( micropapillary , cribriform , and solid ) were assessed . 90% of the in situ tumour displayed one architectural pattern , and mixed when the dominant pattern constituted < 90% of the in situ carcinoma . nuclear grading is based on the size of malignant cells nuclei in comparison to normal ductal epithelial cells . grade 1 is applied when the nuclei of the malignant cell are between 1.5 and 2 times that of normal ductal epithelial cell . grade 2 is applied when the nuclei of the malignant cell are between 2 and 2.5 times that of normal ductal epithelial cell . grade 3 is applied when the nuclei of the malignant cell are greater than 2.5 times that of normal ductal epithelial cell . the term comedonecrosis , which is poorly defined in the literature , was applied when significant necrosis , creating an appearance similar the comedos , seen in cutaneous acne , was noted in ducts with dcis . a total of 289 breast carcinomas had been received at the royal darwin hospital during the period of the study . these consisted of 265 invasive and 24 pure in situ cancers . these cancers consisted of 231 infiltrating duct carcinomas of no special type , 24 infiltrating lobular carcinomas and 10 carcinomas of special type . of these special breast cancers , 5 were pure mucinous carcinomas , 2 were invasive papillary carcinomas , 2 were tubular carcinomas , and 1 was medullary carcinoma . the proportion of invasive ductal carcinomas containing dcis varied from year to year , ranging from 16/26 ( 62% ) in 2002 to 8/26 ( 31% ) in 2007 . table 1 also shows the frequency of pure dcis and dcis associated with invasive cancer . of the 157 cases of dcis ( pure dcis and invasive cancers with dcis ) , 91 ( 58% ) displayed a single growth pattern and 66 ( 42% ) showed a mixed growth pattern ( table 1 ) . of the 91 cases of dcis with a single growth pattern , 4 ( 5% ) were micropapillary , 23 ( 25% ) were cribriform , 61 ( 67% ) were solid , and 3 ( 3% ) were encysted papillary ( table 1 ) . of the 66 mixed type dcis cases , all 3 growth patterns ( micropapillary , cribriform , and solid ) were noted in 11 ( 17% ) of the cases . micropapillary and cribriform was present in 14 ( 21% ) , micropapillary and solid was seen in 11 ( 17% ) , and cribriform and solid was identified in 30 ( 45% ) of the cases ( table 1 ) . most of the pure in situ carcinomas were of the mixed type and there were no cases of single pattern micropapillary dcis ( table 2 ) . overall , a micropapillary pattern was seen in 40/157 ( 25% ) , a cribriform component in 78/157 ( 50% ) , a solid component in 113/157 ( 72% ) , and macropapillary ( encysted papillary carcinoma ) in 3 ( 1.9% ) of the dcis cases ( table 2 ) . comedonecrosis was present in 18/40 ( 45% ) of the micropapillary , 67/113 ( 59% ) of the solid , and 20/78 ( 26% ) of the cribriform cases of dcis . these findings show that comedonecrosis is more likely to be seen in micropapillary and solid types dcis than in the cribriform type . this association is statistically significant with p values of 0.033 and 0.00004 , respectively . at the same time , no statistically significant difference in comedonecrosis occurrence was noted between the micropapillary and solid dcis ( p = 0.117 ) . of the 157 cases of dcis high nuclear grade was recognised in 70 ( 45% ) , intermediate nuclear grade in 65 ( 41% ) , and low nuclear grade in 22 ( 14% ) of the cases ( table 3 ) . of the 40 cases of micropapillary dcis , 2 ( 5% ) were low grade , 18 ( 45% ) were intermediate grade , and 20 ( 50% ) were high grade ( table 3 ) . of the 78 cases of cribriform dcis , 17 ( 22% ) were low grade , 39 ( 50% ) were intermediate grade , and 22 ( 28% ) were high grade ( table 3 ) . of the 113 cases of solid dcis , 8 ( 7% ) were low grade , 47 ( 42% ) were intermediate grade , and 58 ( 51% ) were high grade ( table 3 ) . these results show a statistically significant difference between the presence of high nuclear grade ( grade 3 ) in the solid and micropapillary types of dcis compared to the cribriform type ( p = 0.0008 , and p = 0.019 resp . ) . on the other hand , no statistically significant nuclear grade differences were noted between the micropapillary and solid types ( p = 0.884 ) . all three cases of macropapillary ( encysted papillary carcinoma ) were low grade ( table 3 ) . overall , we identified 40 cases with a micropapillary dcis component ( table 2 ) . thirty - six of these were mixed with other growth patterns and 4 had only micropapillary growth pattern . in the cases of dcis with no invasive cancer , there was a micropapillary component in 9 cases ; all mixed with other growth patterns . of these , 4 had only a micropapillary growth and in 27 the micropapillary pattern was mixed with other growth patterns . of all the 91 cases of dcis with a single growth pattern , 4 ( 4% ) had only micropapillary growth ( table 1 ) . of the 24 cases of pure dcis , none was only micropapillary but 9 had a micropapillary component , mixed with other architectural patterns . of these , 6 cases were high grade , 2 cases were intermediate grade , and 1 case was low grade ( table 3 ) . the age of patients who had a micropapillary component ranged from 38 years to 88 years with a median of 50 years . the age range for the low grade was 52 years to 63 years , for the intermediate grade was 38 years to 88 years , and for the high grade was 40 years to 80 years . the invasive component of cases that included a micropapillary type dcis was grade 3 in 22.6% ( 7/31 ) , grade 2 in 38.7% ( 12/31 ) , and grade 1 in 38.7% ( 12/31 ) of the cases . of the 4 cases with micropapillary dcis not associated with any other type of dcis ( pure micropapillary type ) , 3 were intermediate grade and 1 was low grade . the micropapillary dcis represented only a minor component ( < 25% ) in 9/36 of the cases in which it appeared in combination with the other types of dcis . the cases had been reported by 6 pathologists , of which three were responsible for reporting 94% of cases . the overall concordance for all cases of dcis , in respect to nuclear grade , regardless of architectural pattern , was very good , with a kappa score of 0.87 . in cases with micropapillary component there was a good concordance between our evaluation and the initial report with a kappa score of 0.61 . the nonconcordant cases , which differed by 1 grade , were all between low to intermediate grade ; none involved a high grade . the concordance rate for cases not including a micropapillary pattern was also very good with a kappa score of 0.88 . it is beyond the scope of this study to chronologically recapitulate all aspects of this complex histopathological entity . regarding the micropapillary dcis , our results are surprising , but may explain partly the increased correlation with breast carcinoma recurrence identified by fisher et al . . fisher and colleagues reviewing dcis from 1456 patients enrolled in the national surgical adjuvant breast and bowel project ( nsabp ) protocol b-24 to determine predictors for ipsilateral breast tumour recurrences and contralateral breast cancers , after a median follow - up time of 10.5 years , found ductal comedonecrosis , micropapillary histological tumour type to be independent high risk factors for ipsilateral breast tumour recurrence and for contralateral breast cancers . in a recent article , castellano et al . have shown the nuclear grade to be crucial in determining the biology of micropapillary dcis . they also showed that high nuclear grade micropapillary dcis more frequently overexpressed her2 , showed a higher proliferation index , and displayed necrosis and microinvasion . logistic regression analysis confirmed high nuclear grade ( odds ratio , 6.86 ; confidence interval , 1.4033.57 ) as the only parameter associated with elevated risk of local recurrence after breast - conserving surgery . however , the recurrence rate of 19 micropapillary dcis , which were part of a cohort of 338 consecutive dcis , was significantly higher ( log - rank test , p = 0.019 ) than that of nonmicropapillary , independent of nuclear grade . the authors concluded that although nuclear grade may significantly influence the biological behaviour of micropapillary ductal carcinoma in situ , micropapillary growth pattern represents a risk factor for local recurrence after breast - conserving surgery . while the number of cases in which the micropapillary growth pattern constitutes the only pattern was very small in our study , it may not be a coincidence that none of these cases was high nuclear grade and none was associated with necrosis . this finding would be consistent with the dogma defining micropapillary dcis as a predominantly low grade dcis . the frequent association between micropapillary dcis and necrosis may explain why authors , considering comedonecrosis a separate pattern of dcis , have been discarding all those cases also displaying comedonecrosis from the micropapillary group . another notion on which all publications seem to agree is the fact that the solid variant tends to be associated with high grade dcis , whereas the micropapillary and cribriform variants most often form a low grade dcis . we believe comedocarcinoma is not a separate type of dcis and should not be used as such . in other words , each dcis should be given an architectural pattern label and the presence or absence of necrosis should be described separately . in all the cases of dcis with a pure micropapillary growth pattern , the nuclear grade was low or intermediate . this may mean that those cases of low grade dcis that may have a certain genetic makeup will maintain an indolent course , whereas the more aggressive ones will undergo the changes described above and assume a mixed growth pattern with comedonecrosis . because of this supposed evolution , the micropapillary component may represent a minor proportion of the entire dcis at the time the tissue is removed for histological evaluation . if comedocarcinoma is considered a separate type of dcis in which the architectural pattern is neglected and not reported , then our results , with only 4 cases of micropapillary dcis , are all in keeping with the old dogma that micropapillary dcis is a low or intermediate grade with no necrosis . we agree with fisher and colleagues in considering comedocarcinoma a separate feature , rather than a histological type . pinder and o'malley hit the nail on the head and explain that comedonecrosis may be seen in association with any dcis architectural type , and that it is not a type itself , as it is neither a grade nor an architectur . so they clearly recommend that the term comedo - type dcis should not be used as a characterisation of growth pattern . also in keeping with our view is the fact that the rare , special type dcis , namely , the signet ring , endocrine , and other types , also have a growth pattern that is , the solid one , even if the cells show specific our results show that over 40% ( 66/157 ) of the dcis cases are not of pure architectural type , but in fact they are mixed . approximately half of the solid ( 51% ) and micropapillary ( 50% ) cases in our series are high grade . these values are statistically significant when compared to the occurrence of high grade cribriform dcis , of which only 28% are high grade . just under half ( 45% ) of the micropapillary and nearly two - thirds ( 67% ) of the solid cases of dcis are associated with comedonecrosis , while only a quarter ( 26% ) of the cribriform cases of dcis are associated with comedonecrosis . the micropapillary type is the rarest one , occurring seldom as a pure form with less than 3% of all cases of dcis and less than 5% of dcis cases with a single pattern being pure micropapillary ones . slightly more than half ( 54% ) of the solid and almost a third ( 30% ) of the cribriform cases occur on their own , whereas in only 10% of the cases low grade micropapillary and solid dcis were very rare in our series ( 5% and 7% , resp . ) . our results can be translated into the newly accepted din system by replacing the nuclear grade value with the equivalent din . after carefully observing and analysing our data , we draw the conclusion that in many cases the pattern of growth may be a continuum , starting as micropapillary , with papillae then either joining one another to form arches resembling the cribriform pattern or even continuing to proliferate until a solid sheet of cells fills the entire lumen . as necrosis occurs toward the tips or on the sides of the micropapillary structures , the lesion becomes intermediate grade . with progression , nuclear pleomorphism and a comedo - type necrosis appear , and the lesion then qualifies as a high grade dcis . we therefore believe the study of the determinants of growth pattern in dcis would be the key to unravelling the diverse , often nonconcordant evidence one encounters in the literature .

mammary ductal carcinoma in - situ ( dcis ) , a malignant appearing lesion on cytological and histological grounds , is in fact a non - obligate precancer . dcis is difficult to manage and is sometimes treated more aggressively than invasive carcinoma . although most dcis classifications take into account the architectural growth pattern , when it comes to architecture , the literature is full of contradictory information . we examined 289 breast cancers and found dcis in 265 of the cases . the majority of the dcis cases were seen in the setting of invasive cancer and only 9% of the cases represented pure dcis with no invasive cancer . the dcis commonly displayed a mixed pattern with micropapillary , cribriform and solid components with the micropapillary type being the rarest , occurring seldom on its own . a continuum of growth with a micropapillary pattern evolving into a cribriform type could be seen in some of the cases . this may explain some of the conflicting information , in the literature , regarding the different architectural types of dcis . the comedo - pattern of necrosis could be seen in all types of dcis . we therefore conclude that the study of the determinants of growth pattern in dcis would be the key to unravelling the diverse , often non - concordant evidence one encounters in the literature .

You are an expert at summarizing long articles. Proceed to summarize the following text: kidney stones afflict 10% of the population during their lifetime and over the past two decades this statistic has risen , thought to be caused by diet , climate changes , and a concurrent rise in comorbidities like diabetes and obesity.15 this increase in stone events has been quite dramatic for women and incidence is now close to equal between sexes , while previously it was far more common in men.3,6 while this rise has not necessarily been observed in pregnant females , this population is still affected by kidney stones , which occur in 1 in 2001,500 pregnancies.713 the top cause for nonobstetric hospital admission during pregnancy is acute urolithiasis.14,15 anatomical and pathophysiological changes occur in the pregnant female to alter the urinary environment ( table 1 ) . elevated progesterone and mechanical compression cause urinary stasis . increased glomerular filtration rate , calcium supplementation , and increased circulating vitamin d levels lead to elevated urinary ph and hypercalciuria.1627 uric acid , sodium , and oxalate , all lithogenic factors , also all have increased urinary excretion during pregnancy.8,19,20 these changes promote calcium phosphate stone formation . up to 75% of pregnant patients with kidney stones have calcium phosphate stones in contradistinction to the general population where calcium oxalate is the most common stone type.11,14,2833 renal colic has been associated with multiple potential risks to mother and fetus including preterm labor , preterm delivery , preterm premature rupture of membranes , recurrent pregnancy losses , and mild preeclampsia , but data are somewhat mixed.10,12,3338 these potential complications make accurate diagnosis crucial . renal ultrasound is considered first - line because the gold standard for diagnosis in the non - pregnant state , computed tomography ( ct ) , involves radiation use , which is avoided during pregnancy because of teratogenic risks and risk of childhood malignancy . ultrasound has a poor sensitivity and one group only identified stones 60% of the time during pregnancy.3941 transvaginal ultrasound can be helpful to evaluate distal ureter and distinguish obstruction from physiological hydronephrosis of pregnancy which can occur in up to 90% of patients.2325,42 when results are equivocal , half fourier single shot turbo spin echo ( haste ) magnetic resonance urography ( mru ) without contrast is safe , effective , comparable to ct accuracy , and now considered second - line during pregnancy when available.4346 it visualizes the stone as a filling defect , evaluates secondary findings of obstruction , and also gives information about non - urologic organ systems . low dose ct ( fetal radiation dose 4 mgy versus 25 mgy ) is highly sensitive and specific , increasing in popularity , but still is last - line given its use of radiation.4749 plain radiography , intravenous urogram , nuclear medicine scans , and magnetic resonance imaging with contrast can be done but all have limitations and risks associated with them during pregnancy.33,5056 the need and importance for more accurate diagnosis is elucidated by white et al where they report a negative ureteroscopy rate of 14%.57 this means that 1 in 7 patients who went to the operating room for assumed nephrolithiasis did not have a stone . once the diagnosis of a stone is made during pregnancy , multi - disciplinary decision - making is required given the potential complications that can occur as discussed above ( figure 1 ) . urology and obstetrics should be in active communication with the patient outlining a plan with close follow - up and monitoring . first choice , similar to the general population , is always conservative management and trial of passage with hydration and analgesia . nonsteroidal anti - inflammatory drugs ( nsaids ) are usually avoided during pregnancy and narcotics are generally required . requirements for this pathway are a solitary stone less than 1 cm , absence of infection , adequate oral pain control , and ability to tolerate food and liquid . this will be successful 70%80% of time and 50% of those without spontaneous passage during pregnancy will pass their stones after delivery.12,33,36,38,5860 while some have found spontaneous passage rate to be higher during pregnancy , thought to be due to physiological ureteral dilation , others believe the rate to be biased because of higher subject numbers for trial of passage , given surgeon reluctance to operate.11 additionally , the rate may be overestimated because of misdiagnosis and poor follow - up ; a mayo clinic series had 23% of patients misdiagnosed and only 48% passage rate.61 the patient should be followed closely with physical exam , blood work , and ultrasound . alpha blockers are category b drugs ; they have not been studied in humans but have been shown to be safe in animal studies and are often used during pregnancy . gestational hypertension and preterm labor are often treated with calcium channel blockers and these are also thought to be safe.62 similar to the general population , some patients are not candidates for trial of passage and some fail conservative management . renal insufficiency and anatomical considerations such as solitary kidney or bilateral obstruction also require intervention . more minor indications for further management are refractory pain , intractable nausea and vomiting , stone greater than 1 cm , or non - diagnostic imaging.63 if a procedure is needed , experienced anesthesiologists , neonatologists , radiologists , urologists , and obstetricians should be involved . cardiopulmonary changes during pregnancy make a pregnant woman s management more complex.17 temporary drainage versus definitive treatment of the stone is the next decision point in the management algorithm . only over the last decade has definitive management become an accepted option.17,64 risks of surgery were previously thought to be too high and treatment too complex . however , over the last two decades endourology has expanded , and may be one of the most progressive fields within urology . ureteroscopy is far more sophisticated with miniaturization , advanced visualization , improved deflection , and an immense armamentarium of instruments , baskets , and lasers available . obstetrics care has also advanced and has improved monitoring technology . shock wave lithotripsy and percutaneous nephrolithotomy are still contraindicated during pregnancy for a multitude of reasons.6567 multiple factors are considered when electing temporary drainage versus ureteroscopy . infection is an absolute contraindication for ureteroscopy and urgent temporary drainage is required when fever is present . experienced medical teams ( surgeon , anesthesiologist , obstetrician , neonatologist ) , are required if stone treatment is elected . adequate resources must be available as well ( ie , laser , obstetric monitoring , etc).64 other reasons to potentially choose temporary drainage include large stone burden , complex anatomy , bilateral stone disease , obstetric complications , presentation in the first trimester , or presentation near full term.64 patient and surgeon preference are also important . while once the preferred and only acceptable method of management , there are many disadvantages to temporary drainage . first and foremost , it is temporary and requires definitive management at a later date post - partum , often during a time that is hectic and focused on a new child . additionally , multiple procedures may be required during pregnancy , as the physiological variations induce rapid encrustation and exchanges are required every 46 weeks.6870 this is expensive and each exchange incurs a risk on the pregnancy . tubes and stents dislodge , migrate , are uncomfortable , and become colonized with bacteria increasing risk for urinary infection ; patients are often miserable . the advantages of temporary drainage are that it can be done very quickly , with minimal anesthesia and no radiation exposure . stent versus nephrostomy tube is always the subject of a debate . with regards to infection , study has shown them to be equivalent in outcome.71 in general though , stent is preferred because it does not require an external tube which can be quite burdensome to the patient . stents do cause lower urinary tract symptoms , whereas nephrostomy tubes do not . if a large stone burden is present , nephrostomy tubes can assist with future access for definitive treatment.17,72 because of the above - mentioned disadvantages of temporary drainage , definitive treatment with ureteroscopy is often considered and is now accepted as a reasonable and sometimes ideal option ( table 2).17,64 patient selection is critical and guided by the contraindications mentioned above . radiation is not required and good outcomes can be achieved using ultrasound alone.73 an experienced radiologist and/or technician can be involved in the operating room . in 2009 semins et al performed a systematic review and meta - analysis of 14 reports of ureteroscopy during pregnancy in over 100 patients.74 complication rates between the general female population and pregnancy were similar and ureteroscopy was deemed to be safe and effective in the properly selected patient . it is important to remember that these reports are by experienced endourologists with excellent available resources . over the past 5 years , more groups have published case series reporting acceptable safety profiles and good efficacy for ureteroscopy during pregnancy.28,7580 johnson et al also stresses that a multi - disciplinary approach is critical as they did have 2 patients go into pre - term labor , 1 of which delivered early.79 experience , patient selection , and available resources are vital to a good outcome . in conclusion , urolithiasis during pregnancy is more complex than when it occurs in the general population and diagnosis can sometimes be quite challenging . expectant management is first - line , but if not an option or if it fails , then both temporary drainage and definitive treatment are acceptable secondary management alternatives . patient and surgeon preference , along with clinical variables and available resources , guide decision - making .

kidney stones are very common and unfortunately do not spare the pregnant population . anatomical and pathophysiological changes occur in the pregnant female that alter the risk for development of nephrolithiasis . acute renal colic during pregnancy is associated with significant potential risks to both mother and fetus . diagnosis is often challenging because good imaging options without radiation use are limited . management of diagnosed nephrolithiasis is unique in the pregnant population and requires multi - disciplinary care . herein , we review the metabolic alterations during pregnancy that may promote kidney stone formation , the complications associated with acute renal colic in the pregnant state , and our proposed diagnostic and management algorithms when dealing with this clinical scenario .

You are an expert at summarizing long articles. Proceed to summarize the following text: morinda citrifolia , commonly known as noni , is a small tree that has been used as a traditional source of food and medicine throughout the tropics [ 1 , 2 ] . a variety of potential health benefits these include immunomodulation [ 4 , 5 ] and antioxidant activities in vitro and in vivo [ 68 ] . the antioxidant activity of noni juice was found to be associated with increased endurance in athletes . in a human clinical trial involving heavy cigarette smokers , consumption of noni juice resulted in lowered plasma concentrations of superoxide anion radicals ( sar ) and lipid hydroperoxides . further , consumption of noni juice also decreased the level of lipid peroxidation - derived dna adducts in the lymphocytes of heavy smokers . in vivo research has demonstrated that noni juice increases superoxide dismutase ( sod ) and glutathione peroxidase ( gpx ) enzyme activities . the superoxide anion radical ( sar ) is a major cellular reactive oxygen species and may be generated via enzymatic and nonenzymatic process or may come from exogenous sources , including cigarette smoke . gpx also reduces lipid hydroperoxides , as well as prevents free radical attack on polyunsaturated fatty acids in cellular membranes . as such , the effect of noni juice on these two enzymes may be at least two of the major antioxidant mechanisms of action through which it protects lymphocyte dna and lowers plasma concentration of tobacco smoke - induced free radicals and peroxides . chemical studies of noni fruit have revealed that iridoids are the main phytochemical constituents , with deacetylasperulosidic acid ( daa ) comprising the majority of the iridoid content . daa has anticlastogenic activity , suppressing the induction of chromosome aberrations in chinese hamster ovary cells and in mice . daa is reported to inhibit the release of tumor necrosis factor - alpha from cultured mouse peritoneal macrophages and inhibits low - density lipoprotein oxidation [ 19 , 20 ] . 4nqo exposure leads to the formation of superoxide , hydrogen peroxide , and hydroxyl radicals , resulting in the production of a substantial amount of 8-hydroxydeoxyguanosine , a product of dna oxidation in mammalian and bacterial cells [ 22 , 23 ] . treatment with daa reduced 4nqo genotoxicity by 98.96% , suggesting that iridoids are responsible for the dna protective effects of noni juice in cigarette smokers . with demonstrated antioxidant activity of noni juice and the potential bioactivities of its major phytochemical constituent , the current study was conducted to investigate the role of daa on sod and gpx activities in vivo . the purity of daa was 98% , and the identity was confirmed by high performance liquid chromatography . daa was dissolved in meoh - h2o ( 1 : 1 ) at a concentration of 0.2 mg / ml . separation of the standard was performed with a hc - c18 column ( 25 cm 4.6 mm ; 5 m , agilent technologies , santa clara , ca , usa ) in a waters 2690 separations module ( waters corporation , milford , ma , usa ) and detected with a waters 2489 uv / vis detector at 235 nm . daa was eluted at a flow rate of 0.8 ml / min with two mobile phases : ( a ) mecn and ( b ) 0.1% formic acid in h2o ( v / v ) . the elution gradient was 5 min with 100% b , 35 min with 30% a and 70% b , 12 min 95% a and 5% b , and then 8 minutes with 100% b. the retention time and absorbance spectrum were compared against those of a daa standard . for this study , 40 wistar rats ( male and female , 180200 g ) were obtained from the experimental animal center , academy of military medical sciences ( beijing ) , approval no . the care of animals and experimental procedures were compliant with ethical and institutional animal welfare guidelines of tianjin medical university . following acclimation , rats were randomly divided into 4 groups of 10 each ( 5 male and 5 female ) . daa was dissolved in saline and each animal was gavaged for 7 days with 1 ml/200 g body weight ( bw ) of one of four treatments , depending on group assignment . the treatments were normal saline ( control ) , 15 mg daa / kg bw ( low dose ) , 30 mg daa / kg bw ( mid dose ) , and 60 mg daa / kg bw ( high dose ) . individual animal weight and feed intake were recorded on days 1 , 4 , and 7 . on the 8th day , the rats were anesthetized and 0.5 ml blood was removed from the orbital sinus . whole blood was centrifuged at 3,000 rpm for 10 min in a low speed centrifuge ( model bfx5 - 320 , baiyang centrifuge factory , liulizhuang , hebei , china ) . the resulting serum was retained for assays . using a commercial bioassay kit ( jiancheng bioengineering institute , nanjing , china ) , the superoxide dismutase activity assay utilized the production of a water soluble dye ( wst-1 formazan ) from a tetrazolium salt ( wst-1 ) in the presence of sar . in a phosphate - buffered reaction mixture , xanthine and xanthine oxidase are incubated at 37c in the presence of samples , blanks , sod standards , and wst-1 . during the reaction , sod catalyzes the dismutation of sar , thereby reducing the amount available to oxidize wst-1 to wst-1 formazan . sample results were compared against an sod standard reference curve after the absorbance was read at 450 nm with a microplate reader ( epoch microplate spectrophotometer , biotek , winooski , vt , usa ) . the sod activity is determined by calculating the wst-1 formazan inhibition rate and is expressed in u / ml . gpx activities in serum samples were also determined with a commercially available bioassay kit ( jiancheng bioengineering institute , nanjing , china ) . absorbance of sample , blanks , and standards were read at 412 nm with a microplate reader ( epoch microplate spectrophotometer , biotek , winooski , vt , usa ) . malondialdehyde ( mda ) concentrations were assayed with a commercial bioassay kit ( jiancheng bioengineering institute , nanjing , china ) . mda was detected according to the common colorimetric method involving the reaction of samples and 1,3,3,3 tetra - ethoxypropane standards with thiobarbituric acid in a 95c water bath for 40 min . the absorbance of each of the samples and standards was measured at 532 nm ( epoch microplate spectrophotometer , biotek , winooski , vt , usa ) . intergroup differences were measured with student 's t - test , following bartlett 's test for homogeneity of variance . weights and feed intake rates among the different groups are compared in tables 1 and 2 . all groups experienced appropriate weight gain during the seven - day period , with no differences between any groups . the low and mid dose groups had slightly lower feed intakes on day 7 than the control group , but these were within the expected amounts for healthy wistar rats . there was no significant difference in feed intake between the control and high dose groups . the effects of daa intake on mda concentration and antioxidant enzyme activities are summarized in table 3 . while mean serum mda content in the low dose group is lower than that of the control group , the difference is not statistically significant . however , there is a trend of reduced serum mda concentrations with increased daa dose . serum mda of the mid and high dose groups was significantly lower than those observed in the controls . the approximate percent reductions in mean serum mda in the mid and high dose groups were , respectively , 19.7 and 22.6% when compared to the control group . while sod activity in low dose group was almost 10% greater than that in the controls , the difference was only marginally significant ( p = 0.098 ) . on the other hand , sod activities observed in the mid and high dose groups were significantly greater than that of the control group . mid and high dose animals experienced , respectively , an average increase of 11.3 ( p < 0.05 ) and 13.0% ( p < 0.01 ) in serum sod activity . unlike sod , gpx activities were not influenced by daa intake at any of the doses evaluated . the effect of daa on sod activity helps to explain at least one mechanism whereby noni juice lowered plasma sar in heavy smokers . sar contributes to the eventual formation of mda by means of reactive hydroxyl radicals formed either through the reduction of transition metal ions by sar or from the degradation of peroxynitrite that is produced in reactions between sar and nitric oxide . therefore , the increased dismutation of sar to h2o2 and oxygen will lower the amount available for the formation of mda . this suggests that one way in which daa decreases lipid peroxidation , as measured by lower mda levels , is by increasing sod activity . this is further evidenced by the observed dna protective effect of noni juice in heavy smokers , as mda reacts readily with dna bases to form lipid peroxidation - derived dna adducts [ 11 , 29 ] . one very interesting observation of this study is the inability of daa to increase gpx activity . increased sod activity results in a decrease in sar concentrations . but a consequence of sod activity is the increased h2o2 . h2o2 , in turn , can cause oxidative damage , if not further metabolized into less reactive compounds . catalase is another antioxidant enzyme which promotes the degradation of h2o2 into water and oxygen . this possibility is further supported by the fact that morinda citrifolia leaves contain daa and that catalase activity was increased in lymphoma - bearing mice which had been fed crude m. citrifolia leaf extract . additionally , an aqueous extract of m. citrifolia leaves increased catalase activity in hyperlipidemic rats . other iridoids have also been reported to increase catalase activity , so this is a bioactivity associated with this class of compounds . the results of this experiment demonstrate that daa exerts an antioxidant effect by increasing sod activity . this effect may be responsible , at least in part , for the antioxidant properties of noni juice as demonstrated in human trials and in vivo . the in vitro antioxidant activity of daa against 4nqo may also be mediated through sod activation , as the microorganism involved expresses this enzyme . however , daa does not appear to increase gpx activity by itself , at least under the conditions of this study . as discussed previously , noni juice increases gpx activity in vivo . even though daa is a major constituent of noni juice , the fruit also contains several other iridoids in minor concentrations [ 17 , 36 , 37 ] . loganin , an iridoid similar in structure to epi - dihydrocornin found in noni fruit , increased gpx expression in rat mesangial cells that had been exposed to advanced glycation end products . so , it is likely that another iridoid compound in noni , aside from daa , is responsible for the increased gpx activity . it is also possible that interaction between several phytochemical constituents results in increased serum gpx . the in vivo antioxidant activity of daa has been demonstrated via oral administration to wistar rats for 7 days . a dose - dependent trend was evident , with significant reduction in serum mda and an accompanying increase in sod activity at 30 and 60 mg / kg bw . since serum mda declined with increased dose , it is possible that daa induces catalase activity . however , additional research is required to confirm this . animal weights and feed intake , along with previous toxicity tests of daa , the results of the current study suggest that daa is responsible , at least in part , for the antioxidant activities observed in human trials . while it is possible that daa 's influence on sod activity could explain the effect of noni juice on heavy smokers , the results also demonstrate that the effect of noni juice on gpx activity in vivo is not associated with daa alone . induction of gpx is likely due to another iridoid or a combination of phytochemical constituents .

deacetylasperulosidic acid ( daa ) is a major phytochemical constituent of morinda citrifolia ( noni ) fruit . noni juice has demonstrated antioxidant activity in vivo and in human trials . to evaluate the role of daa in this antioxidant activity , wistar rats were fed 0 ( control group ) , 15 , 30 , or 60 mg / kg body weight per day for 7 days . afterwards , serum malondialdehyde concentration and superoxide dismutase and glutathione peroxidase activities were measured and compared among groups . a dose - dependent reduction in malondialdehyde was evident as well as a dose - dependent increase in superoxide dismutase activity . daa ingestion did not influence serum glutathione peroxidase activity . these results suggest that daa contributes to the antioxidant activity of noni juice by increasing superoxide dismutase activity . the fact that malondialdehyde concentrations declined with increased daa dose , despite the lack of glutathione peroxidase - inducing activity , suggests that daa may also increase catalase activity . it has been previously reported that noni juice increases catalase activity in vivo but additional research is required to confirm the effect of daa on catalase . even so , the current findings do explain a possible mechanism of action for the antioxidant properties of noni juice that have been observed in human clinical trials .

You are an expert at summarizing long articles. Proceed to summarize the following text: direct carotid cavernous fistula ( dccf ) results from head and facial injuries or cavernous internal carotid artery ( ica ) aneurysm rupture . the direct communication between the ica and the cavernous sinus produces a series of symptoms including exophthalmos , conjunctival injection , bruit , and cranial nerve impairment . the treatment options include : detachable balloons , coils , other embolic material , and stents through a transarterial or transvenous approach7,8,13,14 ) . in recent years , covered stents have been applied for the treatment of dccf with encouraging short - to - midterm clinical results , thus , showing that a covered stent is an effective alternative after failure of conventional endovascular therapy5,6 ) . however , there are few reports regarding the application of covered stents in dccf treatment as the first choice . the purpose of this study was to evaluate whether covered stent placement could be a preferred first - line method for dccf patients . we present 10 cases of dccf treated with covered stents ; in five , a covered stent was the first choice . from january 2009 through july 2013 , a total of 13 cases of dccf were treated by the endovascular approach at our institution . therapeutic alternatives were discussed with both neurosurgical and neurointerventional teams in a multidisciplinary decision - making process . a jostent coronary stent graft ( abbott vascular , rangendingen , germany ) was applied in 10 patients with dccf ( six females and four males ; mean age , 45.816.1 years ) . head trauma was the cause of dccf in seven patients ; however , two patients did not have a history of a head injury before the onset of the fistula . the fistula developed after a le fort ii procedure for open - bite malocclusion in the remaining patient . nine patients presented with symptoms , such as tinnitus , diplopia , conjunctival injection , and proptosis with alert mentality . the other patient was in a vegetative state due to severe brain injury , and the ccf was found in a follow - up brain ct scan . a covered stent placement was performed in five patients primarily as the first choice and in the other five as an alternative option after incomplete occlusion with coils . three of the latter patients were transferred from another facility after treatment failure ; they underwent covered stent placement as the first treatment option at our institution . this study was conducted with the approval of the institutional review board of our hospital . the angio - architectures were evaluated by using the integris v ( philips medical system , best , the netherlands ) biplane system , including three - dimensional ( 3d ) rotational angiography . angiographic evaluation included ipsilateral and contralateral carotid and vertebral angiographies with neck ( carotid ) compression . angiographic segments of the cavernous ica to demonstrate the fistula point were classified as follows : vertical , genu , and horizontal portion . prior to the interventional procedures , most of the patients were given dual antiplatelet medication . heparin ( 3000 iu ) was administered as a bolus after femoral arterial sheath placement and intermittently thereafter 1000 iu bolus per hour with monitoring of activated clotting time to maintain 250 - 300 seconds . after arterial access , a double coaxial guide system was used . a 7-f shuttle ( cook , bloomington , in , usa ) was advanced to the level of the common carotid artery , and then a 7-f softip guide catheter ( boston scientific , natick , ma , usa ) was advanced coaxially into the cervical ica near the carotid canal . after selection of the middle cerebral artery with the aid of a microcatheter through the true lumen of the cavernous ica , the covered stent was placed at the fistula point of the cavernous ica along an exchange microguidewire . , the stent was deployed by low - pressure balloon inflation until the balloon - waist disappeared . then , the balloon inflation was repeated with gradually - increasing pressure to ensure good apposition of the stent to the vessel wall ; the balloon was gently moved into the proximal position to avoid arterial dissection . if endoleak with large amount persisted despite balloon inflation up to the bursting pressure , a larger balloon was found to be helpful for reduction of the endoleak . dual antiplatelet medication was maintained for at least three month after the procedure , and a single agent was maintained for at least one year . the degree of dccf occlusion was assessed by completion angiography with a 3-point scale : total occlusion ( no residual shunt ) , near - total occlusion ( minimal residual shunt ) , and subtotal occlusion ( high flow residual shunt ) . in patients with total occlusion of the fistula , clinical follow - up was recommended at one and three months after the procedure . only if the patient showed aggravation of the clinical symptoms , imaging follow - up , such as dsa or mra , was recommended . in patients with near - total or subtotal occlusion after the procedure , a follow - up dsa was recommended one month post procedure to confirm the progressive occlusion , or to decide if further treatment was necessary . from january 2009 through july 2013 , a total of 13 cases of dccf were treated by the endovascular approach at our institution . therapeutic alternatives were discussed with both neurosurgical and neurointerventional teams in a multidisciplinary decision - making process . a jostent coronary stent graft ( abbott vascular , rangendingen , germany ) was applied in 10 patients with dccf ( six females and four males ; mean age , 45.816.1 years ) . head trauma was the cause of dccf in seven patients ; however , two patients did not have a history of a head injury before the onset of the fistula . the fistula developed after a le fort ii procedure for open - bite malocclusion in the remaining patient . nine patients presented with symptoms , such as tinnitus , diplopia , conjunctival injection , and proptosis with alert mentality . the other patient was in a vegetative state due to severe brain injury , and the ccf was found in a follow - up brain ct scan . a covered stent placement was performed in five patients primarily as the first choice and in the other five as an alternative option after incomplete occlusion with coils . three of the latter patients were transferred from another facility after treatment failure ; they underwent covered stent placement as the first treatment option at our institution . this study was conducted with the approval of the institutional review board of our hospital . the angio - architectures were evaluated by using the integris v ( philips medical system , best , the netherlands ) biplane system , including three - dimensional ( 3d ) rotational angiography . angiographic evaluation included ipsilateral and contralateral carotid and vertebral angiographies with neck ( carotid ) compression . angiographic segments of the cavernous ica to demonstrate the fistula point were classified as follows : vertical , genu , and horizontal portion . prior to the interventional procedures , most of the patients were given dual antiplatelet medication . heparin ( 3000 iu ) was administered as a bolus after femoral arterial sheath placement and intermittently thereafter 1000 iu bolus per hour with monitoring of activated clotting time to maintain 250 - 300 seconds . after arterial access , a double coaxial guide system was used . a 7-f shuttle ( cook , bloomington , in , usa ) was advanced to the level of the common carotid artery , and then a 7-f softip guide catheter ( boston scientific , natick , ma , usa ) was advanced coaxially into the cervical ica near the carotid canal . after selection of the middle cerebral artery with the aid of a microcatheter through the true lumen of the cavernous ica , the covered stent was placed at the fistula point of the cavernous ica along an exchange microguidewire . , the stent was deployed by low - pressure balloon inflation until the balloon - waist disappeared . then , the balloon inflation was repeated with gradually - increasing pressure to ensure good apposition of the stent to the vessel wall ; the balloon was gently moved into the proximal position to avoid arterial dissection . if endoleak with large amount persisted despite balloon inflation up to the bursting pressure , a larger balloon was found to be helpful for reduction of the endoleak . dual antiplatelet medication was maintained for at least three month after the procedure , and a single agent was maintained for at least one year . the degree of dccf occlusion was assessed by completion angiography with a 3-point scale : total occlusion ( no residual shunt ) , near - total occlusion ( minimal residual shunt ) , and subtotal occlusion ( high flow residual shunt ) . in patients with total occlusion of the fistula , clinical follow - up was recommended at one and three months after the procedure . only if the patient showed aggravation of the clinical symptoms , imaging follow - up , such as dsa or mra , was recommended . in patients with near - total or subtotal occlusion after the procedure , a follow - up dsa was recommended one month post procedure to confirm the progressive occlusion , or to decide if further treatment was necessary . covered stents were implanted in five patients ( 50% ) as the first choice and in the other five patients ( 50% ) after failure of transarterial embolization ( n=4 ) or transvenous coil embolization ( n=1 ) . total occlusion at the conclusion of the procedure was obtained for five patients ( 50% ) , near - total occlusion was for three , and subtotal occlusion was for the other two . most patients receiving covered stents as the alternative option had total occlusion immediately after procedure , whereas four patients treated with covered stents as the first choice had a remnant fistula due to endoleak . all four patients with endoleak underwent one month control angiography , and complete occlusion was demonstrated in three . the remaining patient experienced increased shunt flow ; additional coil embolization via transvenous approach was performed . the other patients were improved without evidence of fistula recurrence for clinical and radiologic follow - up period ( range , 1 - 21 months ; mean 5.3 months ) . minimal stenosis at the proximal end of stent was detected in three cases ( fig . balloon inflation - related arterial dissection occurred in two patients ; it was noted to have healed at the follow - up angiography . one case of asymptomatic internal carotid artery occlusion was identified at seven month follow - up ct angiography . a 30-year - old man with abducens nerve palsy and pulsatile tinnitus was admitted for treatment of dccf , which developed after open reduction of a medial orbital wall fracture caused by blunt trauma . the fistula was located at the genu portion of the cavernous ica . with a 7-f shuttle flexor and 7-f guiding catheter co - axial system , then , a covered stent ( 5.019 mm ) was advanced to the fistula location and repeated balloon - dilatation was performed with gradually increasing pressure . balloon inflation - induced arterial dissection developed at the distal portion of the stented segment . after confirmation of ica patency and absence of thrombus , the procedure was completed . at one - month control angiography , minimal stenosis at the proximal end of stent was detected ; however , patency of the stented ica was maintained . on conventional angiography , the fistula was located at the vertical segment of cavernous ica . after placement of a covered stent ( 4.519 mm ) at the fistula location , the balloon was gradually inflated until its waist disappeared . then , repeated inflation of the balloon with higher pressure was carried out . although the flow of the shunt was notably decreased , endoleak remained . additional balloon inflation was performed with a larger caliber balloon ( 5.012 mm ) , and the fistula was completely occluded . a 30-year - old man with abducens nerve palsy and pulsatile tinnitus was admitted for treatment of dccf , which developed after open reduction of a medial orbital wall fracture caused by blunt trauma . the fistula was located at the genu portion of the cavernous ica . with a 7-f shuttle flexor and 7-f guiding catheter co - axial system , then , a covered stent ( 5.019 mm ) was advanced to the fistula location and repeated balloon - dilatation was performed with gradually increasing pressure . balloon inflation - induced arterial dissection developed at the distal portion of the stented segment . after confirmation of ica patency and absence of thrombus , the procedure was completed . at one - month control angiography , minimal stenosis at the proximal end of stent was detected ; however , patency of the stented ica was maintained . after placement of a covered stent ( 4.519 mm ) at the fistula location , the balloon was gradually inflated until its waist disappeared . then , repeated inflation of the balloon with higher pressure was carried out . although the flow of the shunt was notably decreased , endoleak remained . additional balloon inflation was performed with a larger caliber balloon ( 5.012 mm ) , and the fistula was completely occluded . a 30-year - old man with abducens nerve palsy and pulsatile tinnitus was admitted for treatment of dccf , which developed after open reduction of a medial orbital wall fracture caused by blunt trauma . the fistula was located at the genu portion of the cavernous ica . with a 7-f shuttle flexor and 7-f guiding catheter co - axial system , then , a covered stent ( 5.019 mm ) was advanced to the fistula location and repeated balloon - dilatation was performed with gradually increasing pressure . balloon inflation - induced arterial dissection developed at the distal portion of the stented segment . after confirmation of ica patency and absence of thrombus , the procedure was completed . at one - month control angiography , minimal stenosis at the proximal end of stent was detected ; however , patency of the stented ica was maintained . after placement of a covered stent ( 4.519 mm ) at the fistula location , the balloon was gradually inflated until its waist disappeared . then , repeated inflation of the balloon with higher pressure was carried out . additional balloon inflation was performed with a larger caliber balloon ( 5.012 mm ) , and the fistula was completely occluded . dccf is frequently associated with poor neurological outcomes , necessitating surgical or endovascular repair . due to its technical difficulty and associated morbidity , direct surgical closure following its introduction in the 1970s , occlusion with a detachable balloon quickly became the method of choice to treat dccf . currently , the detachable balloon is still considered as the optimal therapeutic tool for dccf4,13 ) . however , balloons do have some limitations : the fistula and cavernous sinus must be of appropriate size , premature deflation can result in fistula recurrence , and mass effect might occur7 ) . an additional shortcoming is their limited availability . detachable or pushable coils have disadvantages similar to those of balloons : mass effect , fistula recurrence due to coil compaction , and higher cost10 ) . during the past decade , the endovascular stent graft has been widely used for placement in the aorta , peripheral arteries and coronary arteries2,3 ) . recently , covered stents have been utilized in the treatment of intracranial aneurysms and dccf as well6,15 ) . a series of reports have been published regarding the feasibility , safety , and outcome of covered stents in the treatment of dccf1,11,16,17 ) ; thus , showing that a covered stent can be an effective and reliable alternative method . in our series of 10 cases treated with covered stents , the technical success rate was 100% . complete fistula occlusion was obtained in nine cases ( 90% ) . according to the literatures , the technical success rate and complete occlusion rate at the conclusion of the procedure with a covered stent for dccf ranges 90 - 100% and 75 - 100% , respectively1,11,16,17 ) . one of the main advantages of graft stents may be that they do not exert any mass effect on the cranial nerves thus may enhance cranial nerve symptom recovery . given the limited availability of detachable balloons , we believe that covered stent placement could be a first - line method , as shown in five cases in our series . a covered stent immediately obliterates dccf in a single step by placing an impermeable barrier at the site of abnormal communication . in addition , it decreases the risk of ischemic stroke by preserving the ica patency , as compared to carotid trapping , which is the last resort in the treatment of dccf . treating dccf with covered stents appears to be more reasonable because it does not require deployment of any embolization materials in the cavernous sinus that may complicate the procedure and enhance its associated risk . to the best of our knowledge , only gomez et al.6 ) has reported two cases of a covered stent as the first choice , with complete fistula occlusion and good ica patency at 7-month follow - up . in our stent - as - the - first - choice group , the total occlusion rate was 80% ( 4/5 ) , including a patient with total occlusion immediately following the procedure and three patients with progressive occlusion noted at one month follow - up . results of gomez et al.6 ) and our experience show that a covered stent has the potential to be used as the first choice in dccf treatment . endoleak , defined as persistent perfusion of the space between the stent graft and the parent vessel wall , is the most common procedural failure of endovascular repair . hoit et al.9 ) reported their experience with a covered stent for dccf and a traumatic pseudoaneurysm . according to the report , transient endoleak occurred in 83% ( 5/6 ) ; the endoleaks were related to poor stent vessel apposition or size mismatch . in two patients , they were able to completely appose the stent to the vessel wall with an additional angioplasty ; however , three patients required deployment of an additional graft stent . saatci et al.15 ) found that 32% ( 8/25 ) had an endoleak immediately after intracranial covered stent deployment for aneurysm treatment . however , 75% ( 6/8 ) of the endoleaks disappeared by balloon re - inflation at the proximal and distal ends of the stent grafts . in our series , transient endoleaks were observed in 67% ( 6/9 ) immediately after stent deployment . to decrease the flow of the endoleak , we applied two methods in consecutive order : 1 ) repeated - dilation with gradually - increasing pressure ( initially ) , and 2 ) use of a balloon with a larger caliber ( if endoleak persisted ) . the former method induced successful occlusion in three cases , and subtotal occlusion with remarkably decreased shunt flow with remnant in one case . both methods were effective to decrease or halt shunt flow , improving the approximation of the stent to the fistula point . although four out of five cases with endoleak immediately after the procedure were found to have progressive occlusion at follow - up , the endoleak acted as a structural limitation to the covered stent . all of the endoleak , which persisted after completion of the procedure , were located at the posterior genu portion of cavernous ica . the curvature of the posterior genu , combined with the limited flexibility of covered stent , may lead to poor apposition of the stent to the vessel wall , especially at the lesser curve of covered stent . in addition , this sectional shape mismatch might cause stent migration and incomplete coverage of the fistula during inflation ; thus , enhancing the risk of endoleak , for which the staged ballooning technique mentioned above , offers a feasible solution . of course , the endoleak may also be caused by a size mismatch between the covered stent and the parent vessel due to situation such as high flow - induced parent artery remodeling , transient vasospasm , and rupture of the covered membrane1,9 ) . in a large series of intracranial stent grafting , zhu et al.19 ) noted that the number , diameter and angulation of stents are possible predictors of an endoleak . recovery methods for endoleak elimination consist of re - dilation , a second covered or bare stent9,15 ) , trans - venous coil embolization , and observation , which offer an opportunity for spontaneous occlusion of endoleaks with minimal slow residual filling16 ) . other important points regarding jostent stent graft are long - term patency of the stented ica and difficulty of stent delivery in a tortuous intracranial artery . the covered stent is composed of a tubular expanded polytetrafluoro - ethylene ( eptfe ) layer sandwiched between two stainless steel stents . due to this composition and construction , rigidity is the main shortcoming of this stent . it is difficult to adapt a rigid stent designed for coronary use to the curves of the neurovascular anatomy ; this situation is associated with the poor navigation of the stent graft in the cerebral arteries . possible problems that may result from this rigidity are dissection and vasospasm of the cerebral arteries , or even endoleaks due to sectional shape mismatch between the stent and parent artery . however , technical success can be achieved with no harm to the patient , if necessary precautions are taken both in case selection and during the procedure by using necessary interventional adjunctive tools and techniques such as a coaxial guiding system and use of the buddy wire to enhance the guidance support . in regards to the patency of the stented ica , encouraging results for intracranial covered stent have been reported in the literature , ranging 83.3% to 100%1,6,15,16,17 ) . minimal stenosis at proximal end of stent was noted in three cases in our series . a similar finding was reported by lukito et al.12 ) ; they attributed it to the incomplete coverage of the proximal and distal parts of the stent by the ptfe . in addition , the rigidity of the covered stent may cause vessel trauma at the edge during implantation and intimal hyperplasia as a response . , the stented ica was found to be occluded in one patient on seven month follow - up , despite the fact that it was a subclinical event . the group using the covered stent as an alternative option were found to have better results than the ' the first choice group ' in terms of immediate morphological outcome . the better outcome in the former group may be related to a decrease in shunt flow following initial treatment . however , we believe that the covered stent can be used as the first - line therapeutic tool in selected dccf patients because the residual endoleak with markedly decreased shunt flow will heal spontaneously or become manageable if it persists . the decision to treat dccf with covered stents as the first line therapy is based on several factors : the non - availability of detachable balloon ; the high cost and risk associated with coil embolization ; and the presence of a favorable carotid siphon anatomy with a less tortuous course . recently , a new kind of covered stent specifically designed for intracranial use has reduced on the problem . the stent is reported to be more flexible and to achieve good preliminary results in dccf treatment18 ) . further progress can be anticipated as technology of the covered stents and their delivery systems continue to evolve . stent - based artery reconstruction could soon become the first - line therapy for dccf as experience with this device increases , materials continue to improve , and more data are accumulated . our experience shows that a covered stent graft can serve as an effective and safe micro - invasive technique in dccf treatment . it has the potential to be used as first - line therapy in selected cases because it may offer a more definitive reconstructive treatment than the conventional endovascular approach . however , in regard to for the limited number of case series , large - scale randomized studies are warranted to further develop the specifications and indications of this device .

objectivecovered stent has been recently reported as an effective alternative treatment for direct carotid cavernous fistulas ( dccfs ) . the purpose of this study is to describe our experiences with the treatment of dccf with covered stents and to evaluate whether a covered stent has a potential to be used as the first choice in selected cases.methodsfrom february 2009 through july 2013 , 10 patients underwent covered stent placement for a dccf occlusion . clinical and angiographic data were retrospectively reviewed.resultscovered stent placement was performed for five patients primarily as the first choice and in the other five as an alternative option . access and deployment of a covered stent was successful in all patients ( 100% ) and total occlusion of the fistula was achieved in nine ( 90% ) . complete occlusion immediately after the procedure was obtained in five patients ( 50% ) . endoleak persisted in five patients and the fistulae were found to be completely occluded by one month control angiography in four . the other patient underwent additional coil embolization by a transvenous approach . balloon inflation - related arterial dissection during the procedure was noted in two cases ; healing was noted at follow - up angiography . one patient suffered an asymptomatic internal carotid artery occlusion noted seven months post-treatment.conclusionalthough endoleak is currently a common roadblock , our experience demonstrates that a covered stent has the potential to be used as the first choice in dccf ; this potential is likely to increase as experience with this device accumulates and the materials continue to improve .

You are an expert at summarizing long articles. Proceed to summarize the following text: primary endodontic infections are polymicrobial in nature and are dominated by gram - negative anaerobic rods while secondary endodontic infections are composed of few bacterial species.[25 ] facultative bacteria like enterococcus faecalis is the most commonly isolated species from the root canals of the teeth with failed endodontic treatment and its prevalence in such infections ranges from 24% to 77% . e. faecalis is gram - positive cocci that occur singly , in pairs or short chains , can survive harsh environments like extreme alkaline ph ( 9.6 ) and a temperature of 60c for 30 min . it possesses certain virulence factors such as lytic enzymes , cytolysin , pheromones , and lipotechoic acid , suppresses the action of lymphocytes , potentially contributing to endodontic failure . it is very small to invade and live within dentinal tubules and can endure prolonged periods of starvation . when nutritional supply becomes available it can utilize serum as a nutritional source that originates from alveolar bone and periodontal ligament . it has been shown to synthesize a variety of stress proteins when exposed to adverse environmental conditions . since , its introduction in 1920 by hermann , calcium hydroxide has been widely used as intracanal medication for the treatment of apical periodontitis . certain studies have indicated that killing of microbes in the canal can be achieved with calcium hydroxide . in a study of microbiology of root canals in retreatment cases , where calcium hydroxide - tolerant microbes were frequently isolated , it was suggested that alternative medicaments may be sometimes needed to resolve the infection to gain healing . it is bacteriostatic while at higher concentration it is bactericidal as it brings about coagulation and precipitation of cytoplasm . chx gluconate gel has been extensively used in dentistry mainly as an intracanal medicament . in this modern era of dentistry use of plant parts as folklore medicine has been trailed by traditional healers since time immemorial . who has reported that 80% of world 's population relies mainly on traditional therapies . there are many advantages of using herbs as antimicrobials : ( a ) they have fewer side effects ; ( b ) less expensive ; ( c ) better patient tolerance ; and ( d ) renewable in nature . throughout asia , traditional medicine has long used turmeric as an anti - inflammatory , anti - oxidant , anti - microbial agent to deal with a wide range of conditions . ajwain , the bishop 's weed containing thymol , the major phenolic compound renders it good germicidal and anti - fungal properties . the purpose of this in vitro study was to evaluate the anti - microbial efficacy of curcuma longa ( turmeric t1 - 10% , t2 - 20% ) ; tachyspermum ammi ( ajwain a1 - 10% , a2 - 20% ) ; chx gluconate gel ( hexigel chx-1% ) and calcium hydroxide ( 10% ) as intracanal medicaments against e. faecalis . six agar plates were prepared by using brain - heart infusion ( bhi ) agar ( titan biotech ltd . agar was mixed according to manufacturer 's directions , and enough agar was poured to cover the surface of a 125 mm petridish . the bhi agar dishes were then stored at room temperature for 2 days before use to verify that they had remained sterile . bhi broth ( titan media ) was also prepared and stored in 5 ml vials for 2 days . e. faecalis ( mtcc 2729 ) was maintained on bhi broth and cultures of e. faecalis were grown overnight at 37c in bhi broth for 24 h and bacterial growth was checked by presence of turbidity . the bhi broth was inoculated with e. faecalis from a freshly grown culture on an agar plate . the broth culture was incubated at 37c for 24 h. medicaments like c. longa ( turmeric ) were prepared in two concentrations of 10% ( t1 ) and 20% ( t2 ) by taking raw turmeric and grinding it into a coarse powder and then by adding sterile distilled water according to the required concentrations in two different test tubes . similarly , t. ammi ( ajwain ) was prepared in two different concentrations in two different test tubes by adding sterile distilled water to ajwain crystals , thus , obtaining it in concentrations of 10% ( a1 ) and 20% ( a2 ) . other medicaments that were used were calcium hydroxide ( nice chemicals , kochi , india batch 711330 ) , which was obtained in a powdered form and then made to 10% by adding sterile distilled water in a test tube . gujarat , india , batch 0201920712 ) was also used as one of the medicaments . . wells of 7 mm diameter and 4 mm depth were punched in agar plates and filled with 10 l of medicaments to be tested . all manipulations of the specimens were performed under a laminar flow ( toshiba ) to avoid contamination . it was observed that c. longa ( t2 - 20% ) showed significantly ( p < 0.05 ) more zone of microbial inhibition than c. longa ( t1 - 10% ) , t. ammi ( a1 - 10% and a2 - 20% ) and calcium hydroxide ( 10% ) . hexigel ( chx-1% ) and c. longa ( t1 - 10% ) showed significantly larger zones of microbial inhibition than t. ammi ( a1 - 10% and a2 - 20% ) and calcium hydroxide ( 10% ) . the size of zone of inhibition between c. longa ( t2 - 20% ) and hexigel ( chx-1% ) was not significant ( p > 0.05 ) . t. ammi ( a1 - 10% and a2 - 20% ) and control group showed no microbial inhibition [ table 1 and figure 1 ] . antimicrobial effect of intracanal dressing on enterococcus faecalis antibacterial activity of curcuma longa ( t1 - 10% , t2 - 20% ) , tachyspermum ammi ( a1 - 10% , a2 - 20% ) , chlorhexidine gluconate gel ( chx-1% ) and calcium hydroxide ( 10% ) complete elimination of microorganisms from the root canal is not possible despite antimicrobial properties of chemomechanical preparation and intracanal medicaments . it could be because of anatomical complexities or may be due to varying vulnerabilities of involved species . the most commonly isolated species from root canals of teeth with failed endodontic treatment is e. faecalis . it can gain entry into the root canal system during treatment , between appointments or after root canal completion . virulence factor of e. faecalis in failed endodontically treated teeth may be related to the ability of e. faecalis to invade dentinal tubules and adhere to collagen in presence of human serum . in this in vitro study , anti - microbial activity of various intracanal medicaments was compared to eliminate endodontic pathogen responsible for root canal failure . e. faecalis in dentinal tubules has been shown to resist intracanal dressings of calcium hydroxide for over 10 days as it is shown to withstand a high ph . at ph 11.5 or greater e. faecalis does not survive , yet it can survive at a ph below 11.5 . in radicular dentin , alkalinity may only reach ph 10.3 after dressing the canal with calcium hydroxide . it forms a biofilm that helps it resist destruction by enabling the bacteria to become more resistant to phagocytosis and antimicrobials . even though calcium hydroxide does have some antibacterial action , but under the experimental conditions it was not able to kill and eliminate sufficient cells of e. faecalis at any time . this is in accordance with findings of other reports by haapasalo et al . in the present study , chx in gel formulation at 1% is a powerful anti - microbial agent , showing large inhibition zones , which ranged from 19 mm to 21 mm . although chx showed better anti - microbial activity but its main drawback is that it does not act as a physical barrier , thus , staying in canal for a shorter period of time . this is in accordance with the study by gomes et al . , which suggested that chx gel has a greater antibacterial activity against e. faecalis than calcium hydroxide but loses its property for longer periods . various authors have shown the anti - microbial activity of c. longa against an array of pathogens . in the present study , it was found that c. longa turmeric ( t2 - 20% ) with a wide range of therapeutic action being anti - inflammatory , antibacterial , and antifungal showed highest zones of microbial inhibition ranging from 21 mm to 23 mm . the mechanism behind this has been explained by many authors on the basis of hypothesis , which states that it is due to bacterial cell wall perturbation . although t. ammi ( ajwain ) in both 10% ( a1 ) and 20% ( a2 ) concentrations did not show any antimicrobial effect against e. faecalis . with time plant extracts have been understood to encompass the attributes accounted not only for their fragrance and flavor , but also for their antimicrobial nature . in our study , c. longa ( t2 - 20% ) showed promising results in elimination of e. faecalis one of the common organism responsible for root canal failure and is a good cost effective alternative to all the historical intracanal medicaments with fewer side effects and least resistance developed by the species . however , further studies should be carried out to determine the use of turmeric as an intracanal medicament in endodontics .

aim and objectives : this in vitro study was designed to comparatively evaluate the antimicrobial efficacy of curcuma longa ( turmeric t1 - 10% , t2 - 20% ) ; tachyspermum ammi ( ajwain a1 - 10% , a2 - 20% ) ; chlorhexidine ( chx ) gluconate gel ( hexigel 1% ) ; and calcium hydroxide ( 10% ) as intracanal medicaments against enterococcus faecalis.materials and methods : agar plates were prepared using brain - heart infusion ( bhi ) agar . cultures of e. faecalis were grown in bhi broth at 37c . well diffusion method was used to derive results . plates were inoculated for 72 h at 37c and microbial zones of inhibition were recorded . statistical analysis was performed with repeated measures analysis of variance.results:c . longa ( t2 - 20% ) and chx gluconate gel ( hexigel chx-1% ) showed larger zones of microbial inhibition than c. longa ( t1 - 10% ) that were statistically significant ( p < 0.05 ) and were highly significant when compared to t. ammi ( ajwain a1 and a2 ) and calcium hydroxide.conclusion:c . longa can be used as intracanal medicament in endodontic failure cases .

You are an expert at summarizing long articles. Proceed to summarize the following text: mortality rates have diminished worldwide2 due , in part , to improvements in surgical techniques and in the postoperative care of these patients . radical exenterative surgery has mainly been used for the treatment of advanced gynecological cancer . the experience with the first series that described this procedure for colorectal cancer was carried out by butcher and spjut in 1959.3 the authors pointed out the benefits of exenterative surgery for cancer of the lower colon and realized that not every case was suitable for this procedure . earlier recognition of recurrent malignancies , in addition to radiotherapy and multidisciplinary care , have led to improved pelvic cancer treatment , thus avoiding the need for complete pe.4 there are a group of patients who would benefit from exenterative surgery ; these individuals include those with locally advanced pelvic tumors without distant metastases , which can cause severe local problems such as pain , voiding and defecation problems , and may result in decreased quality of life . extensive surgery is often the only possibility for complete resection in an attempt to provide local control and palliation . in the case of involvement of the base or trigone of the bladder or prostate , total pelvic exenteration ( tpe ) with resection of the rectum together with the bladder , lower ureters , and internal genital organs could potentially save the patient.5 pe has been well described in mexico for the management of gynecological cancer.6 in the present study , all patients who underwent pe were reviewed . morbidity and mortality , local disease recurrence , disease - free survival ( dfs ) , and overall survival ( os ) rates were studied ; furthermore , prognostic factors for local control or survival were also analyzed . between 1994 and 2010 , 59 of 728 patients ( 8.1% ) with a diagnosis of either colorectal or anal cancer underwent pe at the instituto nacional de cancerologa in mexico city . a review of the clinical charts of patients with this diagnosis was performed . demographic data such as age at diagnosis , gender , and clinical status were analyzed . the tumor data gathered were size , histological type , and disease stage at the time of diagnosis , and all patients were classified according to the modified dukes staging system . treatment variables analyzed included preoperative treatment , exenteration type , complete resection versus gross or microscopic positive margins , adjuvant therapy , complications , disease recurrence , and survival . ( disease - free margins achieved ) if the entire gross tumor was removed . the incomplete category included patients who had microscopic or gross residual disease after surgery . retrospective analysis of the 59 patients was performed , and follow - up data are presented as available . a total of 59 patients with a diagnosis of colorectal and/or anal cancer underwent pe ; 53 of these patients were female ( 90% ) and six were male ( 10% ) . mean age at the time of diagnosis was 50 years ( range , 2177 years ) . in total , all of the patients underwent exenterative surgery ; 51 patients underwent posterior pelvic exenteration ( ppe ) ( 86% ) , 10 patients underwent supralevator surgery , and eight patients were submitted to tpe ( 14% ) ( table 1 ) . overall , 54 patients presented with rectal bleeding ( 92% ) , 46 patients complained of diarrhea and/or constipation ( 78% ) , 26 patients suffered from pain ( 44% ) , and 23 reported weight loss ( 39% ) . symptom duration ranged from 137 months , with an average of 10 months . in total , 31 patients ( 53% ) received symptomatic treatment for their pain , obstruction or bleeding ; 14 of these patients ( 24% ) had undergone a nonradical surgical procedure at their local institution ( table 2 ) . one patient received preoperative radiotherapy , and an additional five patients received both neoadjuvant chemo- and radiotherapy at our hospital . patients were analyzed preoperatively and were selected using computerized tomography and/or magnetic resonance imaging scanning . screening for distant metastases was performed using thoracic and abdominal computerized tomography scans in all patients . disease - free margins were obtained in 50 patients ( 85% ) ; gross macroscopic tumor was left behind in five patients ( 9% ) , and microscopic tumor was observed by the pathologist in four patients ( 7% ) . in terms of mortality rates , two patients died after the procedure as a result of abdominal sepsis and pulmonary thromboembolism ( 3% ) , and 29 patients developed complications during the postoperative period ( 49% ) ; the postoperative complications are described in table 3 . the most common intraoperative complication was major bleeding , which was observed in four patients ( 7% ) . other complications included wound dehiscence ( 15% ) , abscess or wound infection ( 12% ) , and complications associated with colostomy ( 10% ) . pelvic floor reconstruction was performed in 10 patients ( 17% ) . in eight patients , an omental flap was employed , and in the remaining two , a peritoneal flap was constructed . mean hospital stay was 9 days ( median , 10.29 days ; range , 127 days ) . seventeen patients ( 29% ) were taken to the intensive care unit ( icu ) for immediate postoperative care . mean icu stay was 2 days ( median , 3 days ; range , 19 days ) . of the 59 patients analyzed here , 30 patients received adjuvant therapy , 16 received neoadjuvant therapy , and 13 patients were submitted to surgery alone ( table 4 ) . overall , 38 patients were submitted to radiation either alone or together with another chemotherapy treatment . according to the pathology charts , the three most common types of adenocarcinomas noted among patients were the moderately differentiated type , the well - differentiated type , and the poorly differentiated type . the moderately differentiated type was most frequently present , as it was noted among 37 patients ( 63% ) , followed by the well - differentiated type found in 13 patients ( 22% ) , and the poorly differentiated type occurred among seven patients ( 12% ) . an intermediate - degree leiomyosarcoma and a moderately differentiated squamous cell carcinoma were also diagnosed ( table 1 ) . we found only one patient was classified at dukes a stage ( 1.75% ) , 18 patients at dukes b stage ( 32% ) , 28 patients at dukes c stage ( 49% ) , and 10 patients at dukes d stage ( 18% ) ; two ( 3% ) patients were not classified . the only patient at the dukes a stage never experienced tumor recurrence ; conversely , three patients at dukes b experienced recurrence ( 17% ) , seven patients at dukes c stage recurred ( 25% ) , and one patient at dukes d stage experienced recurrence ( 10% ) ( table 5 ) . overall , 37 patients died with malignancy ( 63% ) ; 11 patients ( 19% ) had local failure with a mean dfs time of 10.2 months . after a mean follow up period of 28.3 months , nine patients were alive without evidence of disease ( 15% ) , two patients were still alive with tumor ( 3% ) , and 11 patients ( 19% ) were lost to follow - up , and data on their disease were not collected at the last follow - up ( figure 1 ) . a total of 46 patients received some type of oncologic treatment in addition to surgery ( figure 2 ) . pelvic exenteration plays an important role in the care of patients with advanced pelvic malignancies . throughout 50 years of constant evolution , it has been labeled as the gold standard treatment for highly developed and not disseminated pelvic lesions . the procedure was first described by alexander brunschwig,1 but similar techniques were already being performed independently at hospital centers in north america . in the early 1940s , even prior to the actual technique being described and published worldwide , eugene bricker who developed the earliest method of bladder substitution7 believed that exenterative surgery would provide a better outcome when used for the treatment of rectal neoplasms instead of cervical cancer , due to fact that disease - free margins were obtained with greater ease . in mexico , the procedure is employed for the treatment of advanced pelvic malignancies , especially gynecologic tumors , which are a significant health issue in many latin american countries . colorectal and anal canal cancer occupies 30% of large bowel tumors8 and represents 2% of all malignancy - associated deaths in mexico.9,10 this disease occurs in adult males beyond the sixth decade of life and presents with symptoms such as rectal bleeding and abdominal pain or discomfort . in mexico , pe for colorectal and anal cancer is seldom used as a means to treat a patient s targeted lesion . this is due to the fact that these lesions should fulfill certain criteria : the neoplasm should be locally advanced , and it should present without distant metastases at the time of diagnosis . boey11 stated : an invasive tumor , penetrating contiguous pelvic viscera but without disseminated disease , confronts the surgeon in about 6% of large bowel cancers . throughout history , ppe has been performed mainly to target anorectal malignancies . there is sufficient evidence to suggest that this exenteration type is usually used based on the specific organ of origin . a total of 51 patients were submitted to ppe ( 86.4% ) , while 10 underwent supralevator surgery , and 8 patients were submitted to tpe ( 14% ) . it is important to note that 53 patients were female ( 90% ) ; this is not to suggest that colorectal and anal cancer occurs more frequently in women than men , but it clarifies the idea that this tumor type involves the female uterus , vagina , and rectum , therefore creating the ideal scenario for the use of the ppe procedure . the primary goal of exenterative surgery is to remove the central tumor mass , despite its size . neither cure nor palliation occurs if the tumor is left behind.12 in this series , disease - free margins were achieved in 50 patients ( 85% ) , and a remnant of the lesion was left in nine patients ( 15% ) . futile attempts to save an adjacent organ can result in tumor transection , and incomplete resection is generally followed by prompt recurrence and death.13 colon and rectal surgery is prone to complications , which reflect the physiologic and anatomical nature of the systems of the particular organ involved . for years , exenterative surgery has been known to account for an important number of postoperative complications . moreover , although significant improvements in surgical techniques and in postoperative management of the patient have occurred , potential complications after pe are numerous . reported morbidity rates vary widely in the literature , ranging from 13%-77%.1417 on the other hand , while early studies reported operative mortality rates near 15% , more recent reviews report rates closer to 3%;18 this is where current improved care standards affect patient outcomes . an individual who undergoes radical pelvic surgery is at risk of early ( up to 30 days after surgery ) and late ( later than 30 days after the surgery ) complications . our findings in this study are in line with these rates , as we obtained an overall morbidity of 49% and an overall mortality rate of 3% . our most important complications were related with stoma and wound care ; this is because ppe was the procedure performed in about 81.35% of patients in the study . ppe does not require urinary diversion ; as a result , the most common complications noted among patients were wound dehiscence ( 15% ) , abscess or wound infection ( 12% ) , and stroma complications ( 10% ) . some researchers have indicated that radiation therapy either preoperatively or post - procedurally is associated with higher morbidity rates , especially after the surgical event.16 sixteen patients received radiation before the procedure , and eight of these patients submitted to radiation prior to the development of complications following radical pelvic surgery ( 50% ) . of the 43 patients who received no radiation therapy at all , 21 patients developed complications ( 49% ) . there was no significant difference in the outcome of patients who underwent radiation therapy and those who did not receive such a treatment in this series ; however , the effects of radiation on tissues and wound healing have been well known for years.18,20 local tumor recurrence has been recorded in 20% to > 50% of cases in many studies.1820 in our experience , local recurrence occurred in 19% of patients , and distant recurrence occurred in 47% of patients . positive nodes as well as tumor size were described as the most important determinants for local recurrence of colorectal cancers that have been submitted to exenterative surgery . risk of local recurrence has been associated with regional lymph nodes in about 20%25% of cases.21 only one patient recurred out of the twelve patients , with palpable lymph nodes noted upon clinical examination . local recurrence remains an issue with which surgeons are required to deal in order to achieve better survival rates . size , as stated previously , was defined as a determinant for local recurrence of tumors , but it has been demonstrated in recent years that size does not affect recurrence or survival unless residual tumor remains after surgery.14 at our institution , many patients arrive with huge masses and highly advanced disease . mean tumor size of patients studied here was 6.56 cm ( range , 214 cm ) , and although the literature has overlooked the value of tumor size as a determinant for survival , a large mass implies rectal penetration by tumor , nodal spread , or direct invasion of other tissues and organs , thereby directly affecting a patient s survival rate ; this is a common issue among the majority of our patients . size , involvement of adjacent organs , previous surgery , and prior irradiation are all factors that may lead to substantial recurrence and to subsequent morbidity and mortality rates . today , the main purpose of pe is to provide a cure ; therefore , recurrence represents the most important failure of the procedure . many authors have noted the absence of symptomatic pelvic recurrence even with visceral spread or carcinomatosis , such is the case in this series.2,18,22 the key item here is the gap in dfs . the dukes classification correlates well with the latency period and os . in this series , patients who recurred at dukes b had a latency period of 34.6 months , those who recurred at dukes c had a latency period of 8.21 months , and those who recurred at dukes d had a latency period of 7.02 months ( table 5 ) . careful patient selection is imperative in order to improve outcomes.2224 as was the case with recurrence rates , survival is also closely related to the disease stage , but patients with nodal disease and/or systemic spread will have a poor prognosis , and exenterative surgery is palliative , not curative . a total of 46 patients received some type of cancer treatment in addition to surgery . while we do not have significant data pertaining to this subject , we noted that the only patients that presented with a positive os were those who submitted to radiation after the procedure ( a total of eight patients survived of the 15 who received the therapy ) , as opposed to patients who underwent the remaining treatments . because the percentage of local and distant recurrence remains high , we think that this factor must be included in further discussions of pe as a standard treatment for advanced pelvic malignancies . pelvic sarcomas are rare tumors that originate from the stroma of pelvic viscera or from the retroperitoneum . complete resection and tumor grade are the main prognostic factors associated with increased survival rates . in the present study , only one patient with sarcoma had undergone complete tumor resection and did not experience disease recurrence in the pelvis.25,26 the figures for 5-year os after exenterative surgery for colorectal cancer have not changed in recent years . the pelvis , either alone or in combination with other sites , is the earliest and most predominant site of the first tumor recurrence after adequate resection . pe is accompanied by considerable morbidity ( 49% ) and mortality ( 3% ) , but local control is good , which justifies pe in patients with primary or locally recurrent advanced rectal cancer .

backgroundpelvic exenteration ( pe ) continues to be the only curative option in selected patients with advanced or recurrent pelvic neoplasms . a current debate exists concerning the appropriate selection of patients for pe , with the most important factor being the absence of extrapelvic disease.aimto evaluate the outcome of patients submitted to exenterative surgery.patients and methodsa review of the clinical charts of patients with colorectal cancer who underwent pe between january 1994 and june 2010 at the institute national of cancerologa in mexico city was performed.resultswe selected 59 patients , 53 of whom were females ( 90% ) , and six of whom were males ( 10% ) . mean age at the time of diagnosis was 50 years ( range , 2177 years ) . a total of 51 patients underwent posterior pe ( 86% ) , and eight patients underwent total pe ( 14% ) . operative mortality occurred in two cases ( 3% ) , and 29 patients developed complications ( 49% ) . overall , 11 patients ( 19% ) experienced local failure with mean disease - free survival time of 10.2 months . after a mean follow - up of 28.3 months , nine patients are still alive without evidence of the disease ( 15%).conclusionspe should be considered in advanced colorectal cancer without extrapelvic metastatic disease . pe is accompanied by considerable morbidity ( 49% ) and mortality ( 3% ) , but local control is desirable . overall survival justifies the use of this procedure in patients with primary or recurrent locally advanced rectal cancer .

You are an expert at summarizing long articles. Proceed to summarize the following text: alzheimer 's disease ( ad ) , the most common form of dementia , is the term that describes the loss of mental abilities in a variety of areas of cognition , such as memory , speech , executive functions , and visuospatial skills . this loss is so severe that it leads to the impairment of everyday , professional , and social activities of the individual [ 1 , 2 ] . approximately 26.6 million people worldwide are living with ad . this number is expected to quadruple to more than 100 million by 2050 [ 35 ] . in 2010 the worldwide cost of dementia was 604 billion dollars . in europe alone , overall expenditures related to dementia exceeded 170 billion by 2006 . caregiving is by definition a very stressful task , especially when the patient faces a chronic , degenerative disease that presents several challenges such as ad . although the loss of recent memory is one of the early symptoms of the disease , the gradual loss of decision - making , orientation , and finally communication requires increased levels of supervision and personal care . at the final stages of the disease , patients may be completely dependent on their caregivers , even for basic daily activities such as eating and bathing . one option for the provision of this level of care on a consistent basis is to provide it in an organized facility like a nursing home through formal caregivers , such as nurses and doctors . more often , however , care is provided by relatives ( usually spouses and adult children ) , in an informal vis vis unpaid fashion . these caregivers , without formal training , may end up both emotionally and physically exhausted [ 8 , 9 ] due to the round - the - clock involvement with the patient . this is why they have often been called the hidden victims of ad [ 10 , 11 ] . the caregiver 's burden is a term coined to describe the accumulation of problems ranging from the stress involved in caretaking for ad patients to social isolation and financial problems that eventually could damage a caretaker 's own professional and social life , physical and mental health , and financial prosperity [ 7 , 9 , 1214 ] . in greece , according to the european alzheimer organization ( 2012 ) , there are approximately 202.000 dementia patients . it is estimated that ninety percent of these patients live at home and are cared for by a family member . by utilizing cost indicators from other developed countries , however , the annual cost of dementia in greece may be as high as 3 billion euros . the role of caregivers in greece , especially in relation to ad patients , has rarely been studied . the aim of this study is to estimate the physical heath and psychological well - being of relatives who care for ad patients , measuring the effects on the health - related quality of life ( hrqol ) and the existence of depressive symptoms induced from the care . this is an observational study that was designed in order to evaluate descriptive characteristics as well as associations between sociodemographic and emotional parameters with time devoted in care for ad patients ' . between november 2013 and march 2014 , 180 relatives - caregivers of ad patients ( 58,1 13,4 years old ) from the greater athens metropolitan area of the 180 caregivers approached , 25 declined to participate ; 5 did not consent ; 8 cared for patients suffering from other forms of dementia ; and 8 did not find time to carry out the interview . the selected sample of 155 participants is considered adequate to evaluate multiple adjusted effect size measures equal to 0.14 at 5% significance level of two - sided hypotheses , achieving statistical power equal to 95% ( sample size calculations were performed in g - power v 3.0.10 , kiel , germany ) . the different caregivers occurred through the assistance of the more established ad and dementia associations in athens greater area , such as nestor psychogeriatric association , athens association of ad and other dementia , karelleio standard alzheimer center , iasis amke day center , dementia special clinic in laiko university general hospital , and memory disorder clinic in gennimatas general hospital . the inclusion criteria for caregivers were as follows : ( a ) age 18 years ; ( b ) ability to communicate in greek ; and ( c ) providing written informed consent . all participants were informed about the aims of the study and gave their consent to participate in the face - to - face interviews . the guided interviews were carried out at the associations ' and public hospital facilities . in special circumstances concerning the patient 's clinical condition , a structured , close type questionnaire was used to retrieve sociodemographic and household information from the participants . the questionnaire included questions about age , sex , education , family status , self - reported medical history of hypertension , dyslipidemia , diabetes , coronary artery disease , heart failure , copd , and arthritis , as well as questions about the relationship with the patient ( spouse , child , brother , or others ) and their living conditions . in particular , they were asked whether they live with the patient and asked about the number of other housemates and the size of the house as well as the housing ownership . the educational level of the participants was classified into three groups - levels ( primary education , secondary education : up to high school or technical colleges , and higher education : university , masters , and doctorate degree ) . moreover , participants were also asked to evaluate their financial status ( report it as good , moderate , or bad ) and report potential participation in patient 's medical expenses . finally , the stage of the disease as well as the overall time that the caregiver has been caring for their relative ( in years , days a week , and hours per day ) , as well as potential attendance to caregivers ' support programs , was also recorded . depressive symptomatology was assessed using a translated and validated version of the zung depression rating scale ( zdrs ) [ 16 , 17 ] . worldwide the zdrs is one of the most popular items used for self - rating measurement of depression . this self - reporting instrument was originally developed to estimate depression symptoms unbiased by administrators influence in the results . the patient determines the frequency with which the symptom is experienced ( i.e. , a little = 1 , some = 2 , a good part of the time = 3 , or most of the time = 4 ) . the zdrs scores fall into four ranges : normal range and mild , moderate , and severe depression . a subject with a zdrs score of 70 or above is regarded as suggestive for severe depression , scores of 6069 indicate moderate depression , while subject with a score of 5059 is considered as mildly depressed and that with scores below 50 is considered normal [ 1618 ] . previous studies render zdrs to be a valid and sensitive measure ideal as a research instrument for clinical severity in depressed patients and support its continued use . moreover , besides the sensitivity of the zdrs , the adequacy of the scale [ 17 , 19 ] was able to sufficiently differentiate four severity groups classified on the basis of the global rating . health - related quality of life evaluates the impact of physical and mental disorders on the general well - being of a person . among the different questionnaires for assessing hrqol , the short form 36 health survey ( sf-36 ) , developed by the medical outcome study ( mos ) for use in clinical practice and research , health policy evaluations , and general population surveys , is the most used one worldwide . the sf-36 questionnaire , translated and validated in greek , describes eight dimensions with scale score ranges from 0 to 100 ( percent of maximum sum score , worst to best health state ) ; it covers four physical health perceptions ( physical functioning pf , role limitations because of physical health problems rp , bodily pain bp , and general health gh ) and four mental health concepts ( vitality vt , social functioning sf , role limitations because of personal or emotional problems re , and mental health perceptions twenty - eight items are in ordinal type following the likert format ( i.e. , pf items : yes limited a lot recoded 1 ; yes limited a little recoded 2 ; no not limited at all recoded 3 ) seven items are in binary format ( yes - no recoded 1 - 2 ) , and one item , investigating the health changes over the past year , is not used for hrqol evaluation . successively these eight scales can be derived into two global measures , referred to as physical component summary ( pcs ) and as mental component summary ( mcs ) [ 15 , 22 , 23 ] . the mcs and pcs scores , which were designed to be independent and uncorrelated with each other , have been shown to have sufficient reliability and validity in indicating health - related quality of life . continuous variables are presented as mean standard deviation and median ( due to nonconvergence of the distributions with the normal distribution ) . correlations between categorical variables were tested by calculation of pearson 's chi - squared test . comparisons between continuous variables following normal distribution or with general population 's sf-36 scores were performed by measuring the control student 's t - test . in the case of continuous variables not normally distributed control cases were evaluated using the nonparametric u test criterion which was proposed by mann and whitney . the normality of variables was tested using pp charts . for further investigation of the physical and mental health along with depressive symptomatology of caregivers of ad patients , versus various sociodemographic factors , chronic diseases , stage of disease progression , lineage relationship , cohabitation with the patient , and weekly care , the associations between , age , gender , level of education , chronic diseases ( hypertension , dyslipidemia , diabetes , coronary artery disease , heart failure , copd , and arthritis ) , degree of kinship , stage of illness , cohabitation , days a week of care , financial status ( dependent variables ) , and zdrs score , physical component summary score ( pcs ) , and mental component summary ( mcs ) score ( independent variables ) were tested through the multiple linear regression analysis . the results from the regression models are presented as b - coefficients and standard error of the coefficient . all statistical analyses were performed using the spss version 18.0 ( spss predicta hellas ) . the majority of caregivers were adult children of the patient ( 48,4% ) , 74,8% were married , and 48,4% had secondary education . the patients ' medical expenses were covered by their own or the spouse 's retirement pension in 72,3% , while for the 23,9% of the patients the caregivers also covered part or all of the medical expenses , although 67,1% stated that their economic status is moderate . self - reported health status of the participants , living conditions , time engaged in the care , and stage of illness of the patients are outlined in table 2 . the reported history of hypertension in a rate of 32,9% and dyslipidemia ( 18,1% of the sample ) were the most important comorbidities among the chronic diseases surveyed . moreover , the majority of the patients ( 85 out of the 155 , percentage of 54,8% ) were clinically diagnosed at the second stage of ad disease . the caregivers provided assistance for 4,6 3,7 years , with an average of 7,1 5,2 days of weekly care and 10,1 7,4 hours of daily care . while 69,7% of the caregivers resided with the demented patient , only 27,7% of the whole group had ever received any formal education in caregiving , such as informational seminars , psychoeducational , skills - training , and therapeutic counselling interventions to help offset their burden . due to the small percentage of caregivers receiving help there was no statistically significant association between the participation in such courses and depressive symptomatology and quality of life of the participants . the distribution of the sf-36 and zdrs scores of caregivers of the study is presented in table 3 . higher scores are found in physical functioning ( pf 80 22,5 ) , while the lowest ones are in the emotional role because of the caregivers ' emotional problems ( re 44,7 44 ) . an inverse linear association was observed between depressive symptomatology and the eight dimensions , the four physical health perceptions , and the four mental health concepts of the quality of life of the participants . as a consequence both the two component summary scales the associations from the multiple linear regression analysis performed between the zdrs , pcs , and mcs scores ( independent variables ) and gender , age , years of school , financial level , chronic diseases , living conditions , progression of illness , weekly care , and family relationship ( dependent values ) are shown in table 4 . it seems that gender ( women versus men ) was highly associated with the physical and mental quality of life along with depressive symptomatology of the women caregivers . in addition the presence of hypertension , increased frequency of care ( more hours per week ) , cohabitation with the demented relative , and poor financial state of the caregivers as well as the progression of ad disease aggravated the caregivers ' hrqol and their depressive symptoms . comparisons of sf-36 dimensions between the sample of the study 's caregivers and an age - sex matched sample from the dataset of the greek general population retrieved from pappa et al . it seems that the family caregivers of ad patients have a lower hrqol in all dimensions compared to the greek urban general population , except the scores in physical functioning in which the caregivers have higher scores . the statistically significant association results in general health and the mental health concepts : social functioning and emotional role limitations ( role limitations because of personal or emotional problems ) and mental health perceptions . comparing the sf-36 scores of the population of the present study to those of the greek urban general population as they were presented at another survey that was also conducted in athens , family caregivers of ad patients have a lower hrqol in almost all dimensions with exception of the subjective assessment of the level of physical functioning . also , in comparison to the general population , a much higher burden , for the caregivers , appeared to result from their social role and be due to their mental health status . moreover , our results appear to follow results of studies in other countries [ 2 , 8 , 12 , 14 , 2534 ] . female caregivers , who were also the majority of caregivers , appear to face a greater adverse impact in both quality of life and depression measurements than their male counterparts [ 8 , 9 , 12 , 14 , 3136 ] . analysis of cohabitation relationship also remains consistent with literature , as caregivers who lived with the care recipient seemed to experience more severe symptoms of depression and had poorer mental dimension of quality of life , compared to caregivers living separately [ 8 , 30 , 37 ] . furthermore , according to the survey results , the self - reported economic status was found to affect both quality of life and levels of depression [ 9 , 14 , 31 ] . the multiple linear regression highlighted the inverse relationship of the transition from best to worst economic situation and the concurrent reduction of physical health and increased depression . the involvement of caregivers in the patients ' medical costs was not correlated , however , as was expected , despite the large financial cost involved in the treatment of the demented and the challenging fiscal conditions in greece . we also found a strong relation between hrqol and the stage of disease progression : as if it is deteriorating , the mental health and psychology of the caregiver are affected negatively [ 6 , 8 , 9 , 14 ] . in addition , the more the time a caregiver spends caring for patients the lower the caregivers ' qol score [ 2 , 8 , 14 , 30 ] . other studies have linked caregiving induced stress to cardiovascular complications especially hypertension [ 12 , 27 ] . in our study , it is evident that caregivers with hypertension have worse physical quality of life and experience stronger symptoms of depression , compared to those without hypertension . the lack of readily available demographics for the greek population of ad caregivers does not , however , allow us to make broader statements based on our findings . the link between ad caregiving and higher rates of physical and mental disorders that can cause deterioration of quality of life has been well established in the literature [ 22 , 31 , 33 ] . social services need to aim at developing more targeted interventions to support caregivers since the latter run the risk of higher depression rates and physical vulnerability , especially if they receive neither formal nor informal support [ 5 , 12 , 14 , 35 ] . support can range from functional support ( helping with the demanding daily living needs and housework ) to emotional support and/or informational support , which includes sharing knowledge from health professionals and individuals that have experienced similar situations [ 29 , 3739 ] . the positive relationship between receiving formal or informal support and a caregiver 's psychological well - being and overall qol may lead to better quality of care and reduction of the possibility of institutionalization of the ad patient . exposing the caregiver to multicomponent interventions [ 5 , 13 , 40 ] can increase knowledge ( i.e. , attending an information session or a skills building program ) and reduce depression levels [ 5 , 36 ] . psychosocial interventions such as behaviour management therapy , psychological ad hoc counselling ( both family and individual ) , participating in a specialized support group , and stress management techniques can improve outcomes for caregivers [ 5 , 12 , 29 , 3739 ] and in so doing also improve the quality of life for patients . the small number of participants in our study who had received support of some fashion ( only 43 of the 155 participants ) was , however , a limitation and possibly explains the lack of statistical significance in the association between the participation in such courses , the depressive symptomatology , and quality of life of the caregivers , despite all the previous findings in the literature . as our findings indicate , women were more adversely affected compared to men in terms of both qol and depression . this can mainly be explained by the fact that women take up more exhausting activities such as patient 's personal hygiene and managing household chores [ 8 , 30 , 32 ] while balancing other life responsibilities , including child rearing , career , and relationships . moreover , our data indicate that the mental quality of life and the depressive consequences of the informal caregivers are both closely correlated with the severity of ad . an ad patient who is in the later stage needs more assistance even for daily mundane routines in comparison to patients in earlier stages . this in turn may increase the burden on the caregiver and increase his / her levels of physical and psychological exhaustion [ 2 , 6 , 8 , 9 , 28 ] . moreover , as other studies have shown , ad patients ' caregivers often relate their emotional problems to physical illness such as cardiovascular diseases , reduced wound healing capacity , and reduced overall body immunity . we also found in this study strong correlations between hypertension , depression , and physical quality of life . the basic limitation is that it can not draw any definitive conclusions about cause and effect results and , therefore , only informed assumptions can be made for the underlying relationships that affect ad patients ' caregivers ' physical and mental health . comparisons were made only to data from epidemiological reference population , since there is no registered representative sample for the population of our study in greece . however , comparison to a control group is required to fully assess the magnitude of the consequences brought upon the ad caregiver . in addition , the survey was conducted in only one region of the country , which , as representative as it might be since half the greek population resides in the capital , does not fully cover the entire societal spectrum . moreover , the fact that participants did not enter the caring role at identical intervals , as well as the fact that they did not face similar care challenges at the same time , may also have affected the scores recorded . the interview of the same caregivers at different times as part of an overall cohort study could give a clearer picture of the quality of life and depressive symptoms experienced . however this work also has some merits ; the study is of the few of its kind in the greek setting and could therefore serve as the basis for further funding and research as well as public health policies in relation to ad caregiving . important and necessary functional , emotional , and financial support could be provided to assist relatives who serve as informal caregivers cope with the burden of caring and in this way increase their quality of life and overall economic well - being . in conclusion , this study has shown that taking care of a family member with ad negatively affects hrqol and depressive symptomatology . the presented findings provide strong support for exploiting the possibility of offering functional , emotional , and financial support to the caregiver . local dementia associations could provide information , emotional support , practical advice , support groups , and training programs , assuming that greater financial support for that cause becomes available either through the state or through other fund raising processes . under the prism of the current financial crisis that greece faces , a national action plan could present a roadmap of tackling the medical , social , and financial impact of dementia in our country , assist in the overall coordination of both health and social services among a number of currently fragmented structures , and initiate a national research policy . finally , the development and implementation of such a national action plan on ad disease are of the utmost importance not only in terms of supporting patients and their caregivers but also in terms of achieving long - term rationalization of state resources available for the disease .

background . alzheimer 's disease ( ad ) dementia is a chronic neurodegenerative disorder that results in total cognitive impairment and functional decline . family members are the most usual caregivers worldwide , resulting in a subsequent degradation of their quality of life . methods . during november 2013march 2014 in athens , greece , 155 ad patients ' family caregivers ' health - related quality of life and existence of depressive symptomatology were assessed . results . a strong negative correlation between the dimensions of hrqol and the scores of the depression scale was revealed . ad patients ' caregivers have a lower hrqol almost in all dimensions compared to the greek urban general population . the caregivers ' social role , the existence of emotional problems , and their mental health status led to this result . furthermore significantly important differences in caregivers ' total hrqol and depressive symptomatology were indicated in relation to their gender , hypertension existence , patient care frequency , cohabitation with the patient , disease aggravation , and economic status . conclusions . caring for relatives with ad strongly correlates with negative caregivers ' hrqol scores and adversely affects their depressive symptomatology . this negative correlation is enhanced in the later stages of the disease , in greater frequency of care , through living with a patient , in poor financial status , and with the existence of a chronic illness .

You are an expert at summarizing long articles. Proceed to summarize the following text: our ancestors knew that human beings , like plants , seeds , and other living things in the universe , were immersed in an evolutionary cycle . thus , since the beginning of civilization , our ancestors have turned their gaze to the sky for answers and found that certain astronomical cycles overlap each other , just like the seasons , day and night , migratory movements of animals , etc . , so they used these celestial cycles as the background for deciding , among other things , the times that were more conducive to hunting , planting , and harvesting . the term climate in traditional chinese medicine ( tcm ) , from the point of view of chinese medicine , refers to agents that cause disease ; tcm believes that man is a reflection upon the universe , like the existence of a microcosm within the macrocosm . each of these climate forces has a specific action on the body , depending upon their characteristics . hence humans must follow the laws of the universe to accomplish harmony and total health . tcm uses a unique terminology to diagnose and treat a wide range of health problems . patients or modern practitioners who are not familiar with chinese medicine have a look of concern or smile in a humoring manner when an acupuncturist or herbalist tells them they are suffering from a devil wind strike , stagnation of liver qi , or blood deficiency ; they often erroneously assume that something is physically wrong with their liver or blood . the theory of chinese medicine uses the names of the organs to help illustrate related patterns of physical and psychological problems . when a traditional chinese doctor diagnoses a patient with a problem , from a historic chinese medicine perspective , the doctor is usually talking about a problem with the hepatic system . this system involves the physical liver , acupuncture meridian liver - related disharmonies ( or patterns ) , and liver diseases ( western medicine ) such as hepatitis and cirrhosis . wind is one of the most difficult terms for modern doctors to understand , particularly when they approach alternative medicine . it considers the human body as a whole and attributes disease to an imbalance between the different elements it considers . not only is what happens within the body important , but what happens throughout the body and how that is manifested in response to external and environmental stimuli are also important . thus , tcm treatments , rather than being aimed at healing a particular symptom , focus on restoring the body s balance , emphasizing the need to have a healthy , nutritious lifestyle , with plenty of relaxation and breathing exercises . wind is one of five climates that characterize the five seasons according to a chinese philosophical principle . heat occurs in summer , humidity in late summer , drought in autumn , and cold wind in winter and spring . while wind is present in all seasons , its manifestation will be stronger in the season that matches it . wind in the body resembles the wind in nature ; thus , it generates both movement and movement in what would otherwise remain motionless . it produces change and acceleration in what otherwise would be steady and slow and causes things to appear and disappear quickly . it affects the body in the same way as moving branches and leaves on a tree affect the tree ; consequently , wind is a yang phenomenon . when feng xie , or wind nefarious , attacks the body by penetrating the skin and the pores , an important result in tcm is the emergence of imbalances of external origin caused by climatic aggression pathogenic factors . wind is associated with spring , but a disharmony characterized by wind can occur in any season . feng xie is a corrupting influence that rarely appears alone , usually being accompanied by some other external pernicious influence , such as cold and damp weather . wind that is directed toward the upper body has a pernicious influence on yang . because wind is light and airy , the huangdi neijing says , the damage inflicted by wind affects primarily the top . wind is thought to be initially manifested in the highest parts of , and more outside , the body , especially the face , skin and sweat glands , and lungs . when the body is invaded from outside , its defensive capabilities are weakened , causing a mismatch in the opening and the closing of the pores in the entire body , leading to the invasion of other pathogenic factors causing diseases with symptoms such as a headaches , nasal obstruction , painful and itching throat , facial edema , abnormal aversion to wind , and perspiration . cold wind is an aversion to wind and chill and is accompanied by fever , headaches and generalized aches , a runny nose , and a cough . hot wind is accompanied by fever , sweating , headaches , red eyes , sore throat , photosensitivity , thirst , a cough with yellow and dense sputum , respiratory problems , constipation , and epistaxis . damp wind has effects similar to those of the common cold , with sore limbs , listlessness , nausea , anorexia , and diarrhea and can cause diseases like arthritis . an endogenous wind attacks the liver and causes dizziness , spasms , convulsions and even coma . as wind is associated with movement , its attack is varied and fast and is often recognized by signs like pain that moves from one place to another , itching or rashes that change location , spasms , tremors , tics , and lightheartedness . feng xie is often associated with cold , humidity , dryness and heat , forming complex pathogenic factors such as wind - cold , wind - humidity , wind - dryness and wind - heat . a characteristic of winds as harmful exterior influences is the speed with which that characteristic appears , as is the case with all other external pernicious influences . winds often include a fever , which is a sign of conflict between an exterior influence and normal qi , sweating , sudden headaches , nasal obstruction , itching , and throat irritation . as wind is typically accompanied by another harmful influence , it contains the signs of the other baneful influence . the inner feng xie generally accompanies chronic disharmonies , and often these disharmonies involve the liver , which is responsible for regular movement within the body and , therefore , are sensitive to irregular movement . signs of unpromising wind include dizziness , ringing in the ears , heaviness or numbness of the limbs , tremors , and seizures . heavenly stems and earthly branches are collectively known as stem - branch or gan - zhi . the 10 heavenly stems are jia , yi , bing , ding , wu , ji , geng , xin , ren and gui . the 12 earthly branches are zi , chou , yin , mao , chen , si , wu , wei , shen , you , xu and hai . each heavenly stem is paired with an earthly branch to form the gan - zhi sexagenary cycle that starts with jia - zi . six excesses ( wind , cold , heat , dryness , moisture , and heat of summer ) originated thousands of years ago and may sound primitive and unscientific , but are precisely associated with many diseases and disorders and with how they behave in the body ( table 1 ) for example , in nature , wind often breaks out quickly without warning , coming and going . similarly , the symptoms of winds in the body are often characterized by coming and going , sometimes suddenly . have you ever had a sudden headache that is passed as mysterious as to why it appeared ? that was a wind attack . if during the headache , you were red - faced , sweating , and hot , those symptoms indicate that the condition was caused by a wind - heat . wind is one of the six external factors of disease ( six qi or six yin / six excesses ) . these climates can attack the body , enter the meridians , and cause external diseases ; e.g. , cold wind can cause a cold . wind is a climatic condition that is observed everywhere , but is given a heightened importance in tcm . a healthy body is the result of a balance between yin and yang and is supported by a network of activities and complementary forces that generate and put limits on one another . thus , qi moves the blood , but at the same time keeps it in place ; heart stores the shen ( spirit ) and moves the blood ; gallbladder regulates the ascension ; stomach regulates the descent ; liver controls distribution and kidneys regulate storage ; lungs regulate the flow of qi descent ; kidney qi governs fixation . an energy imbalance occurs as a result of breakage of the relationship between real power and pathogenic power ( zheng qi - xie qi ) . when the balance is disturbed , the yin and the yang no longer fit , and the body becomes vulnerable to the damaging effects of a pernicious influence . for tcm , the root of most diseases is a serious imbalance of the various energy systems of the body organs and the lack of overall functional harmony of the entire structure , which occur unfailingly when an organic imbalance exists . the human body has the capacity to resist different pathogenic factors and to maintain a relative balance inside the body and between it and the outside world . this ability to resist zheng qi ( true power ) is the ability of the body to resist pathogens . it is a term of tcm that is preserved in the kidneys , is inspired by nature , and comes from consumed water and rice . it is the quintessence of action and the ability to maintain the physiological functions of the tissues and the organs throughout the body . keep in mind that zheng qi , real power , is the sum of energy inherited and acquired . in pathogenesis , tcm pays attention to physical functions , believing that if a person is full of positive force , a malicious energy will not attack . xie qi or malicious energy is another term used in tcm and refers broadly to all pathogenic factors . the appearance of disease results from a struggle between these two factors , zhengqi - xie qi . zheng qi - xie qi has no resistance , so the natural balance between yin and yang in the body is lost . the factors that tend to break this relative equilibrium are called xie qi or pernicious influences . if the zheng qi is strong because the person has inherited a proper zheng qi , good contributions provided later by nutrition and breathing are maintained , and no emotional disturbances and no environmental and traumatic assault occur . a xie- qi single attack or unbalance occurs in extreme circumstances and is an extreme response . the body will always be positive even with acute symptoms such as fever , headache , and erratic pain . when the xie - qi factor reaches the interior , overcoming the various levels of defense , it affects the viscera and the bowels , causing an imbalanced yin- yang , and can attack the normal functions of rising and falling qi , organic liquids , and blood . if zheng qi is weak , xie qi will always be present , causing a person to be sickly , with a latent and prolonged aspect , the signs of which may appear as weakness , asthenia , chills , and clinical chronic conditions that are exacerbated by any factor affecting the body , whether dietary , emotional or climatologic . a malicious power vacuum leads to infiltration , and the sky and the earth remain closed and dark . mists and clouds can not rise , and rain will not fall . the above and below the conflict between zheng qi and xie qi can be outlined as follows : normality when zheng qi is stronger than xie qi , fullness when zheng qi is durable and is equal to or slightly less than xie zheng , empty when zheng qi is weak but less weak than xie qi , chronicity when xi -qi is weak but less than zheng qi , gravity when zheng qi is real and much lower than xie qi . when the body is weakened by an imbalance of yin and yang , a weather phenomenon can invade and become a destructive influence . a harmful influence is a natural event that becomes destructive only when the body has an inappropriate relationship with that influence in this state ; the body is subjected to a conflict between the injurious influence and normal qi . if the qi protector is durable , the destructive influence is expelled , and the person recovers . however , if the qi is weak or the pernicious influence is very strong , an imbalance develops and penetrates deeper , engaging the internal organs more . the imbalances generated by some of the pernicious influences that invade the body are produced suddenly and are characterized by an aversion to the specific influence that generated those imbalances , for example , fear of cold , aversion to wind , fever , chills , body aches and malaise . these symptoms are the result of an attempt to shed the influence that is affecting normal qi and the qi protector . when a hurtful influence invades the body in this way from the outside , it is called an external pernicious influence . in ancient china , people were very concerned with wind . at that time , people believed that the world was full of benevolent spirits and evil spirits , both of which affected human events . if a person became ill , especially with a sudden onset , that illness may have been attributed to an evil spirit that had entered the person s body . for example , if someone had a stroke or heart attack , an unexpected or severe pain , or loss of consciousness or motor abilities or had died , an evil spirit was thought to have possessed the person s body . in africa and the middle east , zr is used as a term for malevolent spirits or demons that are thought to possess individuals , mostly women , and cause discomfort or illness . the superstitious belief that demons travelled with the wind led to the use of words like evil wind stroke , and this explanation for the causes of disease has continued to the present . diseases caused by erratic wind , which are predominant in the spring , exist throughout the year . leprosy is the best example for illustrating the ambiguity of the epistemological status of contagion in the middle ages . at that time , leprosy was considered to be a disease of the soul , the consequence of sin and divine punishment . when classifying different types of infection diseases , avicenna in the canon says , pass from one to another and mentions that leprosy , scabies , smallpox , pestilential fevers and some eye diseases are transmitted by wind . leprosy is a chronic infectious disease that mainly affects the skin and peripheral nerves ; severe cases can involve deep tissue and visceral organs . although leprosy rarely causes death , it can lead to physical disability and deformity , so that patients are lost to the labor force . leprosy can occur at any age , and both men and women may be affected . in explanation of leprosy , tcm uses many terms such as apathetic wind ( ma feng ) and releasing the wind ( fang feng ) , scabies gale , wind scabies , wind in blood , also known as harsh wind , and pandora wind / pandora s ulcers . all above terms are associated with the release of all the evils of humanity into the world , just like pandora opened her box . pandora wind is a toxic pathogenic wind that causes apathetic feeling of chronic skin diseases . releasing the wind is followed by sickness , fatigue , madness , leprosy and plague , sorrow , poverty , and crime ; all the world s ills are spreading through the land . when we mean that any of the acts we perform in life will bring us new evils and unknown misfortunes . from antiquity to the renaissance , physicians explained the mechanisms for the spread of disease on the basis of direct contact with poison or mediation of the foul air between a sick agent and a healthy patient . as the medical ideas moved away from devil - caused diseases to nature - caused diseases , the concept soon developed into the six qi and six yin , and wind became specifically associated with the spring season , even though spring is definitely not the season in which there is more wind , as we imagine wind today . the exposure of a person to the wind after perspiring or sleeping in a place with drafts promotes the development of wind syndromes . wind generates humidity , dryness and sometimes heat , which invade the body as a result of wind . by its nature its direction is upward ; thus , it affects the upper body ( face and head ) and the body s surface , causing a mismatch between the openings and the closings of the pores of the skin . clinical manifestations of wind include fever , aversion to cold , headache , sore throat , sweating , feeling of hyperthermia , cough , rhinal obstruction , rhinorrhea , nasal pruritus , a tongue with a thin white coating , and a floating or moderate pulse . wind invades the body from the outside , and defensive qi loses its ability to protect the body against foreign pathogens . in this initial struggle , manifestations of the openings of the pores of the skin and attempted expulsions of external pathogens are observed . thus , the patient is seen to be sweating , with the temperature of the body beginning to rise , and to have both an aversion to cold and a headache . that is to say , the location of wind changes , thus , for example , causing pain in various joints . likewise , wind causes movement disorders , such as dizziness , tremors , muscle spasms , convulsions , a stiff neck , and facial paralysis . as wind s attack is fast , diseases can change abruptly , with symptoms sometimes appearing and disappearing rapidly . for example , conditions such as hives or itching can suddenly appear and then suddenly disappear , and rheumatism can migrate from one joint to another . other morbific factors mostly attach themselves to wind to invade the human body , as in wind - cold syndrome , wind - heat syndrome , and wind - dampness syndrome . . an evil - excess will attack the body only when the defense system is weak , and the protective qi is deficient somewhere along the surface of the body . one of the aims of preventive medicine is to keep the body invulnerable to such attacks from outside the body . diseases of the six evils are most likely to appear under abnormal weather conditions when the body is prepared for the powers of the present season but is suddenly faced with an opposite force . sudden cold emerges in the mid - summer and , for example , often causes epidemics of grippe . correspondingly , people who go from a cool , dry place to a warm , damp place are more likely to be exposed to an invasion by local meteorological excesses than natives of the region . because , plague was a major problem during ancient times , practitioners of tcm learned about it long ago and blamed it on pestilential evils . attacks of pestilential evils are usually related to bizarre climates , such as droughts , floods , and extreme heat , as well as environmental conditions such pollution . epidemics occur abruptly , with the victims having severe symptoms and the disease being highly contagious . for example , wind diseases occur in spring , summer - heat diseases in summer , clammy diseases in late summer and early autumn , dry diseases in autumn , and cold diseases in winter . in addition , people who live for a long time in a humid environment tend to be easily attacked by the humid evil , and those who work extensively in a high - temperature environment are freely attacked by the dry - heat evil or fire evil . evils can work alone or in groups of two or more in attacking the body ; syndromes such as the common cold ( wind - cold type ) , damp - heat diarrhea , and wind - cold - damp blockage are examples of medical problems caused by a unification of evils . during the early stages of a disease , any one of the six evils can influence the others and can transform into another kind of evil under particular conditions . for example , the cold evil that enters the body can be transformed into the heat evil , and the prolonged summer - heat with dampness evil can be transformed into the dryness evil . the six climatic evils penetrate the body and cause disease , mostly through the spaces located between the skin and the muscles or through openings such as the nose and the mouth . wind is one of five climates that represent the five seasons [ 15 , 16 ] ( table 2 ) . external wind comes from outside , enters the body through the acupuncture meridians , and causes what are known as colds , flu , and virus . wind is said to be the spearhead as it promotes the opening of the pores and the penetration of other evil summer will be more conducive to heat - wind penetration , causing sunstroke or heatstroke . winter will be more conducive to cold wind penetration ( colds , flu ) , and spring is typically associated with allergic rhinitis . the harmful action of wind penetrates into the muscle layers in the meridians of the triple burner and the small intestine , which blocks the normal flow of qi , causing muscle stiffness . cases of occasionally or permanently weakened defensive energy or immunity are associated with insomnia or overeating , leading to an attack of an external pathological wind in unregulated seasons . in other words , our bodies follow the rhythm of the energies of the seasons and do not have the ability to adapt to changes . the following is a summary of some key points : allopathic practitioners who begin to study tcm are surprised to hear about wind , heat , humidity , dryness , and cold . tcm believes that man is a reflection of the universe , a microcosm within the macrocosm . each of these climate forcers has a specific action in the body , depending on their characteristics . a person is clear and calm , the flesh and the interstice structures are firmly closed up and resist . even though there is a strong wind which is a violent poison , it will be unable to harm that person . diseases involving excess movement of the body are epilepsy ( rare convulsions ) and parkinson s disease , diseases involving symptoms appearing in various parts of the body at different times are early stage rheumatism involving differing joints or skin rashes that appear in multiple places . diseases involving loss of movement are stroke , paralysis , tetany , and coma . various kinds of pain and numbness , as well as spastic syndromes , are sometimes referred to as bi syndromes and include a headache , a toothache , limb numbness , tendon spasms , arthritis , and deep bone pain . diseases that are acute are the common cold , influenza , a sinus infection , a skin eruption , a sore throat , a cough , and eye disorders . diseases that affect the surface of the body ( skin or flesh , rather than viscera ) are chronic eczema , leprosy , scrofula , and hair loss . in western medicine , acute cerebrovascular disease refers to a non - traumatic serious cerebral blood supply disorder caused by focal neurological damage . in tcm , zhong feng terms is refers to human body targeted ( struck ) by an external pathogenic wind and internal wind . zhong refers to a sudden onset of this condition because the character zhong conveys the idea of an arrow hitting its target . a wind strike in chinese medicine corresponds to all of the following medical conditions in western medicine : brain hemorrhage , cerebral thrombosis and vessel spasm . clinical characteristics of cerebrovascular disease are a sudden onset and rapid progress . in tcm , this is a type of bi - syndrome . a vicious wind , chill , wet or heat invasion of the body leads to a blockage of the meridians . working or living in a chilled and damp environment , walking in the rain , working long - term underwater , or drastic changes in climate are other reasons that wind - cold - dampness evil invades the body and causes disease . it is a common problem of old age because deficiencies of yin naturally develop with aging , giving rise to liver yang agitation , which can produce interior wind . facial paralysis after a stroke is due to internal wind while bell s palsy is attributable to external wind . wind strike can be summarized in four words : wind - phlegm - fire - stasis . all of these may or may not be present , but at least three of them must be present to produce blowing wind . they can also be present to different degrees of intensity , which can give rise to many various kinds of wind strikes . wind causes the sudden loss of self - awareness of an acute attack , i.e. , wind strike and its subsequent hemiplegia . when holes are clogged , phlegm causes aphasia or slurred speech . when fire damages the yin , subsequent yin fails to nourish the tendons and meridians , which occurring meridians malnutrition and hemiplegia . blood stasis affects the meridians and joints , causing stiffness and pain in the extremities ; this is an observed consequence of wind strike . naturally , it is a pathogenic factor listed in the wind blowing . in addition , some deficiencies of qi , blood or yin , especially yin kidney and/or yin liver , are observed . overwork : working long hours under stressful conditions without adequate rest lead to kidney yin deficiency . powerful stress : a combination of overwork and stress factors is the most common cause of kidney yin deficiency in industrialized societies . liver yang , especially in the elderly , often results in liver wind , and liver wind is a causative agent of stroke , coma , mental clouding , and paralysis . internal wind and external wind 3 . eating irregularly or ingesting amounts of fat , dairy products , fatty foods , fried foods , and/or sugars weakens the spleen and leads to phlegm , which predisposes the body to obesity . phlegm causes numbness in the extremities , mental clouding , slurred speech or aphasia , and a swollen tongue with a sticky coating . extreme physical work , including excessive exercise and sports , also weakens the spleen and can lead to spleen deficiency , which , in turn , causes phlegm . marrow fails to nourish the blood , and eventually this can lead to blood stasis . extravagant physical activity and inadequate rest , such as lifting heavy objects or taking part in too many sports or excessive exercise , weakens the spleen , muscles , and meridians . spleen deficiency lead to a failure to produce sufficient blood , so blood deficiency develops in the meridians . in qi and blood deficiency on the other hand , exposure to external wind interacts with internal wind meridians , leading to paralysis of the limbs . gout is one of the most painful forms of arthritis and is due to hyperuricemia caused by the accumulation of monosodium- urate crystals . drop is derived from gutta ; drop in latin , as in the middle ages , was believed to be due to a drop of evil humor that someone had deposited in the joints . gout is also called rich man s disease because it occurs most often in the upper classes . in tcm , white tiger joint disease is the ancient name for gout or disease of the toes . gout , the so - called white tiger disease , produces pain like that of a tiger gnawing on one s toes . white tiger joint disease , which is a bi - syndrome , is a disorder resulting from obstruction of the meridians and sluggishness of qi and blood flow after an attack of pathogenic wind , cold , dampness or heat . it is characterized by pain ; insensibility and heaviness of muscles , tendons and joints or edema ; hotness with limitations on joint movement . in tcm , gout is believed to be caused by excessive intake of fatty and sweet food , alcohol abuse , overstrain , tension , or contraction of wind , cold , dampness and heat , resulting in obstruction of the meridian qi due to stagnation of qi and blood , as well as retention of phlegm and blood in the joints . the pathological changes are as follows : pathogenic wind - heat coupled with dampness creates a predisposition for the disease . in addition , predominance of yang , hyperactivity of the liver , and excessive intake of alcohol and food can all lead to retention of pathogenic wind , dampness and heat , or pathogenic wind , phlegm and heat in the meridians and joints , obstructing the flow of qi and blood and bringing about a bi - syndrome due to wind , dampness and heat . furthermore , pathogenic wind - cold combined with dampness can invade the meridians and obstruct the flows of qi and blood , bringing about a bi - syndrome due to wind , dampness and cold . if the bi - syndrome persists , the flows of qi and blood will become even more sluggish , giving rise to an obstinate adhesion of turbid phlegm and blood stasis in the joints and meridians , which is marked by pricking pain , nodules , and even deformities of the joints . the prolonged lingering of pathogens will inevitably impair the healthy qi , so a deficiency of spleen yang and kidney yang and fatigue or weakness often occur in the late stages of the disease due to unchecked discharge of essence . cancer metastasis is the spread of cancer cells to tissues and organs beyond where the tumor originated , resulting in the formation of new tumors . the formation of metastases is a major problem in clinical oncology because it is one of the main causes of death in most cancer patients . classical chinese medicine has no specific concept of cancer ; however , experts in tcm are studying the causes and treatments of metastasis . tcm doctors believe the causes of cancer are multiple , including toxins and other environmental factors , called external causes , as well as internal causes such as blood and qi stagnation , emotional stress , bad eating habits , wastes accumulated from food , and damaged organs . they also believe that internal wind of hepatic origin is not only one of the causes of malignant tumors but also the main cause for the formation of metastases . an analysis of the causes of internal wind in patients with malignant tumors suggests that removing wind is the fundamental method of tcm for the treatment of patients with malignant tumors and metastases ; thus , drugs that eliminate wind are important prescriptions for treating patients with such tumors . three main patterns appear in patients with cancer , which are phlegm ( tan ) , toxic heat - fire ( re - huo ) and wind - cold causing qi stagnation and to which are attributed , from the western viewpoint , the concepts of hyperplasia , neoplasia , and metastasis , respectively . the pathogenesis of metastasis caused by pathogenic wind is as follows : tcm holds that pathogen wind is ranked as external wind and internal wind , the first being the most important of the six climatic factors and the second being a pathological manifestation of a disturbance in yang qi . the inner wind that is due to a yin and yang imbalance is called internal wind that rises in the liver and is characterized by change and movement . it is not as strong as external wind and attacks internal organs only when they are weak , resulting in symptoms of internal involvement . pathological changes in the liver can propagate along the meridians and collaterals and attack other internal organs , which is the reason the liver is considered in tcm to be the source of all diseases . in tcm , tumors are believed to be the result of zheng qi failure , internal organ dysfunction , and pathogen accumulation in the meridians , collaterals , and internal organs , which can cause an imbalance between yin and yang , qi stasis , and blood stasis , the production of tan , the accumulation of toxins and , eventually , the formation of a tumor . tumor formation is accompanied by internal wind , which , in turn , helps liver wind , leading to blood stasis , phlegm , and internal organ toxins , resulting in the formation of metastases in the lungs , liver , brain , lymphatic system , bone , or skin . diseases caused by wind are also characterized by a rapid onset and change , which explains why cancer patients are already in middle or an advanced stage of the disease when they receive the diagnosis . a small portion of patients with cancer in an early phase can quickly move to end - stage cancer with the formation of metastases in a short time . the imbalance of qi , blood , yin , and yang is the leading cause of metastasis . stasis qi , blood stasis , phlegm generation , and retention of toxins are the basic factors of metastasis while the movement of the liver inner wind is the condition under which metastases are formed . drugs that eliminate wind have an anti - cancer effect . in short , in the treatment of cancer , the practitioner needs to pay attention both to the pathogenesis of liver internal wind and to the origin of metastases produced by the liver wind . drugs that disperse wind are an important part of treatments for cancer . according to studies in allopathic medicine for that reason , research both in the field of modern medicine and tcm is focused on finding effective methods for preventing and treating cancer and metastases , on providing new methods for preventing and treating metastases , and on establishing a theoretical basis for the application of drugs that eliminate wind to treat cancer . chinese medicine is useful in all stages of the disease to augment the benefits of conventional treatments , to prevent recurrence and metastasis in early stages of breast cancer , and to promote health , improve the quality of life and prolong life in advanced stages [ 26 - 38 ] . a study on human melanoma cells reported that treatment with essential oils induced deoxyribonucleic acid ( dna ) damage in cancer cells , which is an indicator of apoptosis . modern pharmacological studies have shown that the following drugs eliminate wind and have an anticancer effect [ 40 - 42 ] : dang gui ( radix angelicae sinensis ) , angelica pubescens ( du huo ) , bupleurum chinese ( chai hu ) , pueraria lobata ( ge gen ) , vitex rotundifolia ( ma jing zi ) , arcticum lappa ( niu bang zi ) , stephania tetandra ( fang ji ) , aristolochia mollissima ( xun gu feng ) , pinus tabuleaformis ( song jie ) , viscum coloratum ( sang ji sheng ) , acanthopanax gracilistylus ( wu jia pi ) , lagenaria chaenomeles ( mu gua ) , erodium stephanianum ( lao guan cao ) , chloranthus glaber ( zhong jie feng ) , agkistrodon acutus ( bai hua she ) , scorpio ( quan xie ) , scolopendra ( wu gong ) , gekko japonicus ( bi hu ) , agkistrodon halys ( fu she ) , smilax glabra ( tu fu ling ) , solanum lyratis ( bai ying ) , arisaema consanguineum ( tian nan xing ) , acorus grass ( shi chang pu ) , sophora flavescens ( ku shen ) , dictamnus dasycarpus ( bai xian pi ) , polygonum multiflorum ( he shou wu ) , ligusticum chuanxiong ( chuan xiong ) , zanthoxylum nitidum ( lian mian zhen ) , campsis grandiflora ( ling xiao hua ) , dwarf musk deer ( she xiang ) , taurus domesticus ( niu huang ) , tribulus terrestris ( bai ji li ) , pheretima aspergilum ( di long ) , paris polyphylla ( chong lou ) , amyda sinensis ( bie jia ) and bombyx mori ( bai jian can ) . among compounds derived from plants , essential oils from aromatic plants have been reported to possess anticancer properties . all tcm practitioners should be very familiar with the herbs and acupuncture points related to treating patients with the conditions caused by wind . table 3 gives a partial listing of well - known herbs that are reputed to dispel wind . the actions and the indication of the herbs are from the practical dictionary of chinese medicine with only those aspects that are directly or indirectly related to the concept of wind included . the uses of wind - dispelling herbs are various , but mainly include the treatment of patients with pain , stroke and paralysis , spasms , skin disorders , and a variety of acute diseases involving infection or inflammation affecting the upper part of the body . table 4 gives a partial listing of acupuncture points well - known to be wind - dispelling points . the concepts of wind in traditional medicine books have gone beyond the old established manuscript boundaries and are widely incomprehensible . this study intended to provide information , context , and guidance for a collection of all important subjects and simplification concepts for wind . this new vision for understanding earlier chinese medicine is applicable for public health specialists , traditional and complementary medicine practitioners , and those who are interested in historical medicine and provides a theoretical basis for herbal drugs or acupuncture administration to eliminate wind in order to treat various diseases .

the use of folk medicine has been widely embraced in many developed countries under the name of traditional , complementary and alternative medicine ( tcam ) and is now becoming the mainstream in the uk and the rest of europe , as well as in north america and australia . diversity , easy accessibility , broad continuity , relatively low cost , base levels of technological inputs , fewer side effects , and growing economic importance are some of the positive features of folk medicine . in this framework , a critical need exists to introduce the practice of folk medicine into public healthcare if the goal of reformed access to healthcare facilities is to be achieved . the amount of information available to public health practitioners about traditional medicine concepts and the utilization of that information are inadequate and pose many problems for the delivery of primary healthcare globally . different societies have evolved various forms of indigenous perceptions that are captured under the broad concept of folk medicine , e.g. , persian , chinese , grecian , and african folk medicines , which explain the lack of universally accepted definitions of terms . thus , the exchange of information on the diverse forms of folk medicine needs to be facilitated . various concepts of wind are found in books on traditional medicine , and many of those go beyond the boundaries established in old manuscripts and are not easily understood . this study intends to provide information , context , and guidance for the collection of all important information on the different concepts of wind and for their simplification . this new vision for understanding earlier chinese medicine will benefit public health specialists , traditional and complementary medicine practitioners , and those who are interested in historical medicine by providing a theoretical basis for the traditional medicines and the acupuncture that is used to eliminate wind in order to treat various diseases .